WorldWideScience

Sample records for synthase gene expression

  1. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  2. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  3. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  4. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  5. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  6. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2017-08-09

    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  7. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  8. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate ... Journal of Genetics, DOI 10.1007/s12041-016-0680-8, Vol. 95, No. ... leaf of C. forskohlii. Quantitative real time RT-PCR was used ..... SGG acknowledges the financial support for this work from CSIR. 12th FYP project ...

  9. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  10. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  11. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  12. Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Lin-Hui Gao

    2018-01-01

    Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

  13. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  14. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  15. Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

    Science.gov (United States)

    Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

    2007-10-01

    Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

  16. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  17. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  18. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  19. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  20. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  1. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  2. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  3. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  4. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  5. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  6. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  7. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  8. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  9. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  10. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    Science.gov (United States)

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  11. [Expression of enterotoxigenic Bacteroides fragilis and polyketide synthase gene-expressing Escherichia coli in colorectal adenoma patients].

    Science.gov (United States)

    Xie, L L; Wu, N; Zhu, Y M; Qiu, X Y; Chen, G D; Zhang, L M; Liu, Y L

    2016-03-29

    To investigate the distribution of various bacteria in adenoma tissue of colorectal adenoma (T/CRA), normal colonic mucosa tissue adjacent to the adenoma (N/CRA), and healthy colonic mucosa tissue (N/H) by comparing the number of total bacteria, Bacteroides fragilis (BF), enterotoxigenic Bacteroides fragilis (ETBF), polyketide synthase (pks) gene-expressing Escherichia coli(E.coli)(pks(+) E. coli)among the above 3 types of tissues. A total of 36 patients diagnosed with colorectal adenoma by colonoscopy and pathology in Department of Gastroenterology, Peking University People's Hospital from September 2011 to September 2013 were selected into this study. T/CRA and N/CRA tissues from the 36 patients and N/H tissues from 18 healthy controls were collected for DNA extraction. The number of total bacteria, BF, ETBF, pks(+) E. coli was detected by quantitative real time PCR, and their correlation with colorectal adenoma was analyzed. (1) The number of total bacteria decreased gradually from N/H, N/CRA, to T/CRA, with the median values being 3.18×10(8,) 1.57×10(8,) and 7.91×10(7) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the median values being 6.03×10(5,) 4.28×10(4,) and 5.48×10(3) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the relative expression being 1.73±0.30, 6.15±1.52, and 8.54±1.80, respectively. Significant difference was found between the T/CRA and N/H tissue (P=0.003), but not between any other two groups. (4) The expression of clbB in pks(+) E.coli was highest in T/CRA colonic tissue (2.96±0.28), followed by the N/CRA (2.79±0.19) and N/H tissue (1.06±0.08). Significant difference was found between T/CRA and N/H tissues, as well as between N/CRA and N/H tissues (both PCRA and N/CRA tissues. The number of total bacteria is markedly reduced in the colonic mucosa of CRA patients

  12. Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

    Science.gov (United States)

    Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

    2016-12-01

    To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

  13. Phenotype commitment in vascular smooth muscle cells derived from coronary atherosclerotic plaques: differential gene expression of endothelial Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    ML Rossi

    2009-06-01

    Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.

  14. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  15. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....

  16. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  17. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  18. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  19. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

    Science.gov (United States)

    Xiang, Lin; Zhao, Kaige; Chen, Longqing

    2010-01-01

    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  20. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  1. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1) in Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.)

    OpenAIRE

    Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek

    2014-01-01

    Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...

  2. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  3. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  4. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    International Nuclear Information System (INIS)

    Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-01-01

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni"2"+-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  5. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    Science.gov (United States)

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  6. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  7. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

    Directory of Open Access Journals (Sweden)

    Linjie Wang

    Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

  8. Down regulation by a low-zinc diet in gene expression of rat prostatic thymidylate synthase and thymidine kinase

    Directory of Open Access Journals (Sweden)

    Sassa Shuji

    2008-05-01

    Full Text Available Abstract Background Zinc has a wide spectrum of biological activities and its deficiency is related to various abnormalities of cell metabolism. Methods Wistar male rats, at age of 4 weeks, were fed a low-zinc diet for six weeks. The levels of bromodeoxyuridine incorporated into the prostatic DNA and the mRNA expression levels of prostate thymidylate synthase and thymidine kinase were examined. Result The low-zinc diet caused a marked reduction in the body growth and organ weights, resulted in a low hematopoiesis, hypo-albuminemia and hypocholesterolemia. Although there were few differences in plasma biochemical markers, plasma levels of luteinizing hormone and testosterone were reduced by the low-zinc diet. Bromodeoxyuridine-immunoreactive (S-phase cells and mRNA expression levels of thymidylate synthase and thymidine kinase in the prostate cells were markedly affected by the low-zinc diet. Conclusion A low-zinc diet appears to reduce the body growth and organ weights including prostate, causing low plasma levels of luteinizing hormone and testosterone and reduction in prostate DNA replication in growing-rats.

  9. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  10. Expression of phytoene synthase1 and carotene desaturase crtI genes result in an increase in the total carotenoids content in transgenic elite wheat (Triticum aestivum L.).

    Science.gov (United States)

    Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan

    2009-09-23

    Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.

  11. Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

    2017-01-01

    RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  12. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  13. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  14. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  15. Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

    Science.gov (United States)

    Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

    2014-01-01

    Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

  16. Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

    International Nuclear Information System (INIS)

    Christie, J.M.; Jenkins, G.I.

    1996-01-01

    UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

  17. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  18. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  19. Genome-wide analysis of the Solanum tuberosum (potato) trehalose-6-phosphate synthase (TPS) gene family: evolution and differential expression during development and stress.

    Science.gov (United States)

    Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang

    2017-12-01

    Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.

  20. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  1. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress.

    Science.gov (United States)

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-11-01

    Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Methylation effect on chalcone synthase gene expression determines anthocyanin pigmentation in floral tissues of two Oncidium orchid cultivars.

    Science.gov (United States)

    Liu, Xiao-Jing; Chuang, Yao-Nung; Chiou, Chung-Yi; Chin, Dan-Chu; Shen, Fu-Quan; Yeh, Kai-Wun

    2012-08-01

    The anthocyanin-biosynthetic pathway was studied in flowers of Oncidium Gower Ramsey with yellow floral color and mosaic red anthocyanin in lip crests, sepals and petals, and compared with the anthocyanin biosynthesis in flowers of Oncidium Honey Dollp, a natural somatoclone derived from tissue culture of Gower Ramsey, with a yellow perianth without red anthocyanins in floral tissues. HPLC analysis revealed that the red anthocyanin in lip crests of the Gower Ramsey cultivar comprised peonidin-3-O-glucoside, delphinidin-3-O-glucoside and cyanidin-3-O-glucoside, whereas Honey Dollp was devoid of anthocyanin compounds. Among the five anthocyanin-biosynthetic genes, OgCHS was actively expressed in lip crests of Gower Ramsey flowers, but no transcripts of OgCHS were detected in Honey Dollp floral tissues. Transient expression of OgCHS by bombardment confirmed that recovery of the OgCHS gene expression completed the anthocyanin pathway and produced anthocyanin compounds in lip crests of Honey Dollp flowers. Transcription factor genes regulating anthocyanin biosynthesis showed no distinctive differences in the expression level of OgMYB1, OgbHLH and OgWD40 between the two cultivars. A methylation assay revealed that the promoter of OgCHS was not methylated in Gower Ramsey, while a positive methylation effect was present in the upstream promoter region of OgCHS in Honey Dollp. Overall, our results suggest that the failure of anthocyanin accumulation in Honey Dollp floral tissues may be attributed to inactivation of the OgCHS gene resulting from the epigenetic methylation of 5'-upstream promoter region.

  3. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin.

    Science.gov (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge

    2008-08-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.

  4. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  5. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    Science.gov (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  6. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  7. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  8. Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

    Science.gov (United States)

    Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

    2012-11-01

    5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

  9. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  10. cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

    Directory of Open Access Journals (Sweden)

    Krittaya Supathaweewat

    2013-10-01

    Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

  11. Expression of mismatch repair gene PMS2 in nasopharyngeal carcinoma and regulation by glycogen synthase kinase-3β in vivo and in vitro.

    Science.gov (United States)

    Fang, Jugao; Lei, Wenbin; Huang, Xiaoming; Li, Pingdong; Chen, Xiaohong; Zhu, Xiaolin; Wen, Weiping; Li, Huabin

    2012-02-01

    To evaluate the expression of mismatch repair gene PMS2 in human nasopharyngeal carcinoma (NPC) tissues and evaluate the effect of glycogen synthase kinase (GSK)-3β on PMS2 production in vivo and in vitro. The expression of PMS2 and inactivated phosphorylated GSK-3β(s9) was examined by immunohistochemical staining in 25 NPC tissues and the relation was determined by correlation analysis. The effect of GSK-3β transfection in CNE-2 cells on PMS2 production as well as cell apoptosis and chemosensitization were evaluated using small interference RNA (siRNA), immunoblotting and flow cytometric analysis in vitro. The expression of inactivated phosphorylated GSK-3β(s9) was found to negative correlated with PMS2 in vivo. And transfected GSK-3β was found to be able to enhance PMS2 production, and increase cell apoptosis in CNE-2 cells in combination with cisplatin administration in vitro. Inactivation of GSK-3β might be important for NPC tumorgenesis through negatively regulating PMS2 production, and enhanced PMS2 production by GSK-3β is beneficial for understanding the NPC tumorgenesis and developing potential strategy for future therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  12. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  13. Flavonoids from artichoke (Cynara scolymus L.) up-regulate endothelial-type nitric-oxide synthase gene expression in human endothelial cells.

    Science.gov (United States)

    Li, Huige; Xia, Ning; Brausch, Isolde; Yao, Ying; Förstermann, Ulrich

    2004-09-01

    Nitric oxide (NO) produced by endothelial nitric-oxide synthase (eNOS) represents an antithrombotic and anti-atherosclerotic principle in the vasculature. Hence, an enhanced expression of eNOS in response to pharmacological interventions could provide protection against cardiovascular diseases. In EA.hy 926 cells, a cell line derived from human umbilical vein endothelial cells (HUVECs), an artichoke leaf extract (ALE) increased the activity of the human eNOS promoter (determined by luciferase reporter gene assay). An organic subfraction from ALE was more potent in this respect than the crude extract, whereas an aqueous subfraction of ALE was without effect. ALE and the organic subfraction thereof also increased eNOS mRNA expression (measured by an RNase protection assay) and eNOS protein expression (determined by Western blot) both in EA.hy 926 cells and in native HUVECs. NO production (measured by NO-ozone chemiluminescence) was increased by both extracts. In organ chamber experiments, ex vivo incubation (18 h) of rat aortic rings with the organic subfraction of ALE enhanced the NO-mediated vasodilator response to acetylcholine, indicating that the up-regulated eNOS remained functional. Caffeoylquinic acids and flavonoids are two major groups of constituents of ALE. Interestingly, the flavonoids luteolin and cynaroside increased eNOS promoter activity and eNOS mRNA expression, whereas the caffeoylquinic acids cynarin and chlorogenic acid were without effect. Thus, in addition to the lipid-lowering and antioxidant properties of artichoke, an increase in eNOS gene transcription may also contribute to its beneficial cardiovascular profile. Artichoke flavonoids are likely to represent the active ingredients mediating eNOS up-regulation.

  14. Pycnogenol® effects on skin elasticity and hydration coincide with increased gene expressions of collagen type I and hyaluronic acid synthase in women.

    Science.gov (United States)

    Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J

    2012-01-01

    In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.

  15. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  16. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection

    Directory of Open Access Journals (Sweden)

    Benjamin A. Diner

    2016-11-01

    Full Text Available The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS. Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1 and human cytomegalovirus (HCMV infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses.

  17. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  18. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection.

    Science.gov (United States)

    Diner, Benjamin A; Lum, Krystal K; Toettcher, Jared E; Cristea, Ileana M

    2016-11-15

    The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. How mammalian cells detect and respond to DNA viruses that replicate in the nucleus is poorly understood. Here, we decipher the distinct functions of two viral DNA sensors, IFI16 and cGAS, during active immune signaling upon infection with two herpesviruses, herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV). We show that IFI16

  19. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  20. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  1. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  2. The anthocyanidin synthase gene from sweetpotato [Ipomoea ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... The tissue expression profiles of IbANS indicated that it could be expressed in all tissues but at different ... al., 1997). Likewise, transcripts of the apple ANS gene are detected ... electrophoresis (EC250-90, E-C Apparatus Corporation) and ... Instruments Inc.) analyses and the RNA samples were stored in a.

  3. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    DEFF Research Database (Denmark)

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  4. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  5. Analysis of genomic DNA of DcACS1, a 1-aminocyclopropane-1-carboxylate synthase gene, expressed in senescing petals of carnation (Dianthus caryophyllus) and its orthologous genes in D. superbus var. longicalycinus.

    Science.gov (United States)

    Harada, Taro; Murakoshi, Yuino; Torii, Yuka; Tanase, Koji; Onozaki, Takashi; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

    2011-04-01

    Carnation (Dianthus caryophyllus) flowers exhibit climacteric ethylene production followed by petal wilting, a senescence symptom. DcACS1, which encodes 1-aminocyclopropane-1-carboxylate synthase (ACS), is a gene involved in this phenomenon. We determined the genomic DNA structure of DcACS1 by genomic PCR. In the genome of 'Light Pink Barbara', we found two distinct nucleotide sequences: one corresponding to the gene previously shown as DcACS1, designated here as DcACS1a, and the other novel one designated as DcACS1b. It was revealed that both DcACS1a and DcACS1b have five exons and four introns. These two genes had almost identical nucleotide sequences in exons, but not in some introns and 3'-UTR. Analysis of transcript accumulation revealed that DcACS1b is expressed in senescing petals as well as DcACS1a. Genomic PCR analysis of 32 carnation cultivars showed that most cultivars have only DcACS1a and some have both DcACS1a and DcACS1b. Moreover, we found two DcACS1 orthologous genes with different nucleotide sequences from D. superbus var. longicalycinus, and designated them as DsuACS1a and DsuACS1b. Petals of D. superbus var. longicalycinus produced ethylene in response to exogenous ethylene, accompanying accumulation of DsuACS1 transcripts. These data suggest that climacteric ethylene production in flowers was genetically established before the cultivation of carnation.

  6. Tandemly arranged chalcone synthase A genes contribute to the spatially regulated expression of siRNA and the natural bicolor floral phenotype in Petunia hybrida.

    Science.gov (United States)

    Morita, Yasumasa; Saito, Ryoko; Ban, Yusuke; Tanikawa, Natsu; Kuchitsu, Kazuyuki; Ando, Toshio; Yoshikawa, Manabu; Habu, Yoshiki; Ozeki, Yoshihiro; Nakayama, Masayoshi

    2012-06-01

    The natural bicolor floral traits of the horticultural petunia (Petunia hybrida) cultivars Picotee and Star are caused by the spatial repression of the chalcone synthase A (CHS-A) gene, which encodes an anthocyanin biosynthetic enzyme. Here we show that Picotee and Star petunias carry the same short interfering RNA (siRNA)-producing locus, consisting of two intact CHS-A copies, PhCHS-A1 and PhCHS-A2, in a tandem head-to-tail orientation. The precursor CHS mRNAs are transcribed from the two CHS-A copies throughout the bicolored petals, but the mature CHS mRNAs are not found in the white tissues. An analysis of small RNAs revealed the accumulation of siRNAs of 21 nucleotides that originated from the exon 2 region of both CHS-A copies. This accumulation is closely correlated with the disappearance of the CHS mRNAs, indicating that the bicolor floral phenotype is caused by the spatially regulated post-transcriptional silencing of both CHS-A genes. Linkage between the tandemly arranged CHS-A allele and the bicolor floral trait indicates that the CHS-A allele is a necessary factor to confer the trait. We suppose that the spatially regulated production of siRNAs in Picotee and Star flowers is triggered by another putative regulatory locus, and that the silencing mechanism in this case may be different from other known mechanisms of post-transcriptional gene silencing in plants. A sequence analysis of wild Petunia species indicated that these tandem CHS-A genes originated from Petunia integrifolia and/or Petunia inflata, the parental species of P. hybrida, as a result of a chromosomal rearrangement rather than a gene duplication event. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  7. The role of hexokinases from grape berries (Vitis vinifera L.) in regulating the expression of cell wall invertase and sucrose synthase genes.

    Science.gov (United States)

    Wang, X Q; Li, L M; Yang, P P; Gong, C L

    2014-02-01

    In plants, hexokinase (HXK, EC 2.7.1.1) involved in hexose phosphorylation, plays an important role in sugar sensing and signaling. In this study, we found that at Phase I of grape berry development, lower hexose (glucose or fructose) levels were concomitant with higher HXK activities and protein levels. After the onset of ripening, we demonstrated a drastic reduction in HXK activity and protein levels accompanied by a rising hexose level. Therefore, our results revealed that HXK activity and protein levels had an inverse relationship with the endogenous glucose or fructose levels during grape berry development. A 51 kDa HXK protein band was detected throughout grape berry development. In addition, HXK located in the vacuoles, cytoplasm, nucleus, proplastid, chloroplast, and mitochondrion of the berry flesh cells. During grape berry development, HXK transcriptional level changed slightly, while cell wall invertase (CWINV) and sucrose synthase (SuSy) expression was enhanced after véraison stage. Intriguingly, when sliced grape berries were incubated in different glucose solutions, CWINV and SuSy expression was repressed by glucose, and the intensity of repression depended on glucose concentration and incubation time. After sliced, grape berries were treated with different glucose analogs, CWINV and SuSy expression analyses revealed that phosphorylation of hexoses by hexokinase was an essential component in the glucose-dependent CWINV and SuSy expression. In the meantime, mannoheptulose, a specific inhibitor of hexokinase, blocked the repression induced by glucose on CWINV and SuSy expression. It suggested that HXK played a major role in regulating CWINV and SuSy expression during grape berry development.

  8. Gene structure, phylogeny and expression profile of the sucrose ...

    Indian Academy of Sciences (India)

    Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.

  9. Expression analysis of a heat-inducible, Myo-inositol-1-phosphate synthase (MIPS) gene from wheat and the alternatively spliced variants of rice and Arabidopsis.

    Science.gov (United States)

    Khurana, Neetika; Chauhan, Harsh; Khurana, Paramjit

    2012-01-01

    Molecular dissection and a deeper analysis of the heat stress response mechanism in wheat have been poorly understood so far. This study delves into the molecular basis of action of TaMIPS, a heat stress-inducible enzyme that was identified through PCR-select subtraction technology, which is named here as TaMIPS2. MIPS (L-Myo-inositol-phosphate synthase) is important for the normal growth and development in plants. Expression profiling showed that TaMIPS2 is expressed during different developing seed stages upon heat stress. Also, the transcript levels increase in unfertilized ovaries and significant amounts are present during the recovery period providing evidence that MIPS is crucial for its role in heat stress recovery and flower development. Alternatively spliced forms from rice and Arabidopsis were also identified and their expression analysis revealed that apart from heat stress, some of the spliced variants were also inducible by drought, NaCl, Cold, ABA, BR, SA and mannitol. In silico promoter analysis revealed various cis-elements that could contribute for the differential regulation of MIPS in different plant systems. Phylogenetic analysis indicated that MIPS are highly conserved among monocots and dicots and TaMIPS2 grouped specifically with monocots. Comparative analyses was undertaken by different experimental approaches, i.e., semi-quantitative RT-PCR, quantitative RT-PCR, Genevestigator as a reference expression tool and motif analysis to predict the possible function of TaMIPS2 in regulating the different aspects of plant development under abiotic stress in wheat.

  10. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  11. Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis.

    Science.gov (United States)

    Gao, Yuan; Li, Jun; Pan, Xukun; Liu, Dingrong; Napier, Richard; Dong, Liyao

    2018-04-01

    We previously reported that the mechanism of quinclorac resistance in Echinochloa crus-galli var. zelayensis may be closely related to ethylene biosynthesis and the detoxification of cyanide. Differences in EcCAS gene sequences and expression levels may result in higher capacity to detoxify cyanide in resistant biotypes, which may avoid cyanide accumulation and avoid more ethylene and cyanide production and then avoid damage. In the present study, we focused on the mechanism of resistance related to ethylene biosynthesis in E. crus-galli var. zelayensis. The fresh weight of susceptible and moderately resistant biotypes were significantly reduced after treatment with quinclorac. However, AOA, an ethylene biosynthesis inhibitor, reduced the impact of quinclorac. On pretreatment with AOA, ethylene production was significantly reduced in the three biotypes. The highly resistant biotype produced less ethylene compared to the other two biotypes. Three ACS and seven ACO genes, which are the key genes in ethylene biosynthesis, were obtained. The expression levels of EcACS-like, EcACS7, and EcACO1 varied in the three biotypes upon treatment with quinclorac, which could be manipulated by AOA. In summary, it is inferred that the expression of EcACS-like, EcACS7, and EcACO1 can be stimulated to varying extent after quinclorac treatment in three E. crus-galli var. zelayensis biotypes, which consequently results in varying levels of ethylene production. Lower expression of these three genes results in more resistance to quinclorac, which may also be related to quinclorac resistance in E. crus-galli var. zelayensis. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Science.gov (United States)

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Optimization of expression and properties of the recombinant acetohydroxyacid synthase of Thermotoga maritima

    Directory of Open Access Journals (Sweden)

    Mohammad S. Eram

    2015-12-01

    Full Text Available The data provide additional support of the characterization of the biophysical and biochemical properties of the enzyme acetohydroxyacid synthase from the hyperthermophilic bacterium Thermotoga maritima (Eram et al., 2015 [1]. The genes encoding the enzyme subunits have been cloned and expressed in the mesophilic host Escherichia coli. Detailed data include information about the optimization of the expression conditions, biophysical properties of the enzyme and reconstitution of the holoenzyme from individually expressed and purified subunits.

  14. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  15. Thymidylate synthase, dihydropyrimidine dehydrogenase, ERCC1, and thymidine phosphorylase gene expression in primary and metastatic gastrointestinal adenocarcinoma tissue in patients treated on a phase I trial of oxaliplatin and capecitabine

    International Nuclear Information System (INIS)

    Uchida, Kazumi; Danenberg, Peter V; Danenberg, Kathleen D; Grem, Jean L

    2008-01-01

    Over-expression of thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) in tumor tissue is associated with insensitivity to 5-fluorouracil (5-FU). Over-expression of ERCC1 correlates with insensitivity to oxaliplatin (OX) therapy, while high thymidine phosphorylase (TP) levels predict for increased sensitivity to capecitabine (Xel). Biopsies of metastatic tumor were taken before OX (130 mg/m 2 day 1) given with Xel (1200–3000 mg/m 2 in two divided doses days 1–5 and 8–12) every 3-weeks. Micro-dissected metastatic and primary tumors were analyzed for relative gene expression by real-time quantitative polymerase chain reaction. The clinical protocol prospectively identified the molecular targets of interest that would be tested. Endpoints for the molecular analyses were correlation of median, first and third quartiles for relative gene expression of each target with response, time to treatment failure (TTF), and survival. Among 91 patients participating in this trial; 97% had colorectal cancer. The median number of prior chemotherapy regimens was 2, and most had prior 5-FU and irinotecan. In paired samples, median mRNA levels were significantly higher in metastatic versus primary tumor (-fold): TS (1.9), DPD (3.8), ERCC1 (2.1) and TP (1.6). A strong positive correlation was noted between DPD and TP mRNA levels in both primary (r = 0.693, p < 0.0005) and metastatic tissue (r = 0.697, p < 0.00001). There was an association between TS gene expression and responsive and stable disease: patients whose intratumoral TS mRNA levels were above the median value had significantly greater risk of early disease progression (43% vs 17%), but this did not translate into a significant difference in TTF. ERCC1 gene expression above the third quartile was associated with a shorter TTF (median 85 vs 162 days, p = 0.046). Patients whose TS mRNA levels in metastatic tumor tissue were below the median had a longer overall survival (median 417 vs 294 days, p = 0

  16. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  17. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  18. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  19. 2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

    Science.gov (United States)

    Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

    2015-01-01

    Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

  20. Studies of gene expression and activity of hexokinase, phosphofructokinase and glycogen synthase in human skeletal muscle in states of altered insulin-stimulated glucose metabolism

    DEFF Research Database (Denmark)

    Vestergaard, H

    1999-01-01

    been reported to increase the basal concentration of muscle GS mRNA in NIDDM patients to a level similar to that seen in control subjects although insulin-stimulated glucose disposal rates remain reduced in NIDDM patients. In the insulin resistant states examined so far, basal and insulin-stimulated......When whole body insulin-stimulated glucose disposal rate is measured in man applying the euglycaemic, hyperinsulinaemic clamp technique it has been shown that approximately 75% of glucose is taken up by skeletal muscle. After the initial transport step, glucose is rapidly phosphorylated to glucose...... critical roles in glucose oxidation/glycolysis and glucose storage, respectively. Glucose transporters and glycogen synthase activities are directly and acutely stimulated by insulin whereas the activities of hexokinases and phosphofructokinase may primarily be allosterically regulated. The aim...

  1. Enhanced Toxic Metal Accumulation in Engineered Bacterial Cells Expressing Arabidopsis thaliana Phytochelatin Synthase

    Science.gov (United States)

    Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles

    2003-01-01

    Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032

  2. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal......NOS expressing cells in active lesions. NOS IR expressing cells were widely distributed in plaques, in white and gray matter that appeared normal macroscopically, and on MR. Endothelial NOS (eNOS) was highly expressed in intraparenchymal vascular endothelial cells of MS patients. A control group matched for age...

  3. Hemorrhagic Shock-Induced Vascular Hyporeactivity in the Rat: Relationship to Gene Expression of Nitric Oxide Synthase, Endothelin-1, and Select Cytokines in Corresponding Organs

    Science.gov (United States)

    2005-01-01

    the Selected Genes Sense Antisense Product length (bp) G3PDH 5=-TCCTGCACCACCAACTGCTTAG-3= 5=-TGCTTCACCACCTTCTTGATGTC-3= 341 iNOS 5...GAPDH, as a housekeeping gene, was not affected significantly by the hemorrhage protocol. The results showed that mRNA levels of all enzymes and

  4. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... Ginkgo biloba is one of the oldest living plant species and often referred to as “a .... GbGGDPS were analyzed and the sequence comparison was conducted ... function of plant GGDPS genes (Zhu et al., 1997) and human and.

  5. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  6. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  7. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  8. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  9. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  10. Expression, crystallization and preliminary crystallographic study of octaprenyl pyrophosphate synthase from Helicobacter pylori

    International Nuclear Information System (INIS)

    Zhang, Jinyong; Zhang, Xiaoli; Mao, Xuhu; Zou, Quanming; Li, Defeng

    2011-01-01

    Octaprenyl pyrophosphate synthase from H. pylori has been expressed, purified and crystallized, and a diffraction data set was collected to 2.00 Å resolution. Octaprenyl pyrophosphate synthase (OPPs) is involved in the synthesis of the side chains of ubiquinone and menaquinone and catalyzes consecutive condensation reactions of farnesyl pyrophosphate with isopentenyl pyrophosphate to generate polyprenyl pyrophosphate and pyrophosphate. In order to investigate the roles played by OPPs in the metabolism of ubiquinone and menaquinone and the enzymatic mechanisms of these enzymes, analysis of the structure–function relationship of OPPs from Helicobacter pylori was initiated. The gene for OPPs was cloned, the protein was expressed, purified and crystallized and a diffraction data set was collected to 2.00 Å resolution. The crystals belonged to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 109.33, c = 103.41 Å

  11. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    Science.gov (United States)

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future.

  12. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

    Science.gov (United States)

    Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

    2017-02-01

    Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  14. Expression of chalcone synthase genes in coleoptiles and primary leaves of Secale cereale L. after induction by UV radiation: evidence for a UV-protective role of the coleoptile

    International Nuclear Information System (INIS)

    Haussühl, K.; Rohde, W.; Weissenböck, G.

    1996-01-01

    Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation

  15. Expression of inflammatory cytokine and inducible nitric oxide synthase genes in the small intestine and mesenteric lymph node tissues of pauci- and multibacillary sheep naturally infected with Mycobacterium avium ssp. paratuberculosis.

    Science.gov (United States)

    Sonawane, Ganesh G; Tripathi, Bhupendra Nath

    2016-12-01

    Paratuberculosis (Johne's disease) is a chronic infectious granulomatous enteritis, primarily affecting ruminants, and caused by Mycobacterium avium ssp. paratuberculosis (MAP). The disease is widely prevalent throughout the world with significant economic losses. MAP has also been implicated with human Crohn's disease. There exists a strong correlation between the immune response and development of various types of pathologies in ruminants. The polarization of the immune response, which is critical to clinical outcome of the paratuberculosis infection, is controlled by the differential expression of certain cytokines and inducible nitric oxide synthase (iNOS) in Johne's disease. In previous studies, the role of different cytokines (Th1 and Th2) has been occasionally studied in sheep paratuberculosis. In the present study, we studied differential expression of interferon (IFN)-γ, interleukin (IL)-1α, IL-10, transforming growth factor (TGF)-β, iNOS, and TRAF1 genes in MAP-infected sheep and established relationship with distinct pathologies. Tissue sections (small intestine, ileocecal junction, and mesenteric lymph nodes) were collected from sheep suspected for Johne's disease and appropriately preserved for RNA extraction, polymerase chain reaction (PCR) analysis, and histopathology. Pathologic grading was done on the basis of nature and extent of cellular infiltration, granuloma formation and abundance of acid-fast bacilli. Six sheep each with pauci (PB)- and multibacillary (MB) lesions and six healthy control sheep were selected for cytokine studies. MAP in tissue extracted genomic DNA of sheep was quantified by a quantitative PCR assay. Tissue extracted RNA was reversed transcribed to prepare c-DNA from which quantitative reverse transcription PCR (qRT-PCR) was performed to amplify IFN-γ, IL-1β, IL-10, TGF-β, β-actin, TRAF1, and iNOS with Quantitect SYBR Green Master Mix. qRT-PCR data were analyzed using 2 -ΔΔCT method using β-actin gene as a control

  16. Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

    Science.gov (United States)

    Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

    2010-07-01

    Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

  17. Oxide Synthase Expression by p38 MAP Kinase

    Directory of Open Access Journals (Sweden)

    Tuija Turpeinen

    2011-01-01

    Full Text Available The role of dual specificity phosphatase 1 (DUSP1 in inducible nitric oxide synthase (iNOS expression in A549 human pulmonary epithelial cells, J774 mouse macrophages and primary mouse bone marrow-derived macrophages (BMMs was investigated. iNOS expression was induced by a cytokine mixture (TNF, IFNγ and IL-1β in A549 cells and by LPS in J774 cells, and it was inhibited by p38 MAPK inhibitors SB202190 and BIRB 796. Stimulation with cytokine mixture or LPS enhanced also DUSP1 expression. Down-regulation of DUSP1 by siRNA increased p38 MAPK phosphorylation and iNOS expression in A549 and J774 cells. In addition, LPS-induced iNOS expression was enhanced in BMMs from DUSP1(−/− mice as compared to that in BMMs from wild-type mice. The results indicate that DUSP1 suppresses iNOS expression by limiting p38 MAPK activity in human and mouse cells. Compounds that enhance DUSP1 expression or modulate its function may be beneficial in diseases complicated with increased iNOS-mediated NO production.

  18. Controlling Citrate Synthase Expression by CRISPR/Cas9 Genome Editing for n-Butanol Production in Escherichia coli

    DEFF Research Database (Denmark)

    Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong

    2017-01-01

    Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...

  19. Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

    Directory of Open Access Journals (Sweden)

    Wen-Qin Bai

    Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

  20. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  1. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  2. Bifunctional effects of fucoidan on the expression of inducible nitric oxide synthase

    International Nuclear Information System (INIS)

    Yang, Jin Won; Yoon, Se Young; Oh, Soo Jin; Kim, Sang Kyum; Kang, Keon Wook

    2006-01-01

    Algal fucoidan is a marine sulfated polysaccharide with a wide variety of biological activities including anti-thrombotic and anti-inflammatory effects. This study evaluated the effect of fucoidan on the expression of inducible nitric oxide synthase (iNOS) in a macrophage cell line, RAW264.7. Low concentration range of fucoidan (10 μg/ml) increased the basal expression level of iNOS in quiescent macrophages. However, we found for the first time that fucoidan inhibited the release of nitric oxide (NO) in RAW264.7 cells stimulated with lipopolysaccharide (LPS). Western blot analysis revealed that fucoidan suppressed the LPS-induced expression of the inducible nitric oxide synthase (iNOS) gene. Moreover, the activation of both nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) are key steps in the transcriptional activation of the iNOS gene. Here, it was revealed that fucoidan selectively suppressed AP-1 activation, and that the activation of AP-1 appears to be essential for the induction of iNOS in activated macrophages. This inhibitory effect on AP-1 activation by fucoidan might be associated with its NO blocking and anti-inflammatory effects

  3. Gene Expression Omnibus (GEO)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  4. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  5. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  6. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  7. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  8. Zinc affects differently growth, photosynthesis, antioxidant enzyme activities and phytochelatin synthase expression of four marine diatoms.

    Science.gov (United States)

    Nguyen-Deroche, Thi Le Nhung; Caruso, Aurore; Le, Thi Trung; Bui, Trang Viet; Schoefs, Benoît; Tremblin, Gérard; Morant-Manceau, Annick

    2012-01-01

    Zinc-supplementation (20 μM) effects on growth, photosynthesis, antioxidant enzyme activities (superoxide dismutase, ascorbate peroxidase, catalase), and the expression of phytochelatin synthase gene were investigated in four marine diatoms (Amphora acutiuscula, Nitzschia palea, Amphora coffeaeformis and Entomoneis paludosa). Zn-supplementation reduced the maximum cell density. A linear relationship was found between the evolution of gross photosynthesis and total chlorophyll content. The Zn treatment decreased the electron transport rate except in A. coffeaeformis and in E. paludosa at high irradiance. A linear relationship was found between the efficiency of light to evolve oxygen and the size of the light-harvesting antenna. The external carbonic anhydrase activity was stimulated in Zn-supplemented E. paludosa but was not correlated with an increase of photosynthesis. The total activity of the antioxidant enzymes did not display any clear increase except in ascorbate peroxidase activity in N. palea. The phytochelatin synthase gene was identified in the four diatoms, but its expression was only revealed in N. palea, without a clear difference between control and Zn-supplemented cells. Among the four species, A. paludosa was the most sensitive and A. coffeaeformis, the most tolerant. A. acutiuscula seemed to be under metal starvation, whereas, to survive, only N. palea developed several stress responses.

  9. Zinc Affects Differently Growth, Photosynthesis, Antioxidant Enzyme Activities and Phytochelatin Synthase Expression of Four Marine Diatoms

    Directory of Open Access Journals (Sweden)

    Thi Le Nhung Nguyen-Deroche

    2012-01-01

    Full Text Available Zinc-supplementation (20 μM effects on growth, photosynthesis, antioxidant enzyme activities (superoxide dismutase, ascorbate peroxidase, catalase, and the expression of phytochelatin synthase gene were investigated in four marine diatoms (Amphora acutiuscula, Nitzschia palea, Amphora coffeaeformis and Entomoneis paludosa. Zn-supplementation reduced the maximum cell density. A linear relationship was found between the evolution of gross photosynthesis and total chlorophyll content. The Zn treatment decreased the electron transport rate except in A. coffeaeformis and in E. paludosa at high irradiance. A linear relationship was found between the efficiency of light to evolve oxygen and the size of the light-harvesting antenna. The external carbonic anhydrase activity was stimulated in Zn-supplemented E. paludosa but was not correlated with an increase of photosynthesis. The total activity of the antioxidant enzymes did not display any clear increase except in ascorbate peroxidase activity in N. palea. The phytochelatin synthase gene was identified in the four diatoms, but its expression was only revealed in N. palea, without a clear difference between control and Zn-supplemented cells. Among the four species, A. paludosa was the most sensitive and A. coffeaeformis, the most tolerant. A. acutiuscula seemed to be under metal starvation, whereas, to survive, only N. palea developed several stress responses.

  10. Starch granules size distribution in superior and inferior grains of wheat is related to enzyme activities and their gene expressions during grain filling

    DEFF Research Database (Denmark)

    Zhang, Chuanhui; Jiang, Dong; Liu, Fulai

    2010-01-01

    with the temporally change patterns of starch synthase activities and relative gene expression levels. For instance, activities of soluble and granule-bound starch synthases (designated SSS and GBSS) peaked at 20 and 24 DAF. Genes encoding isoforms of starch synthases expressed at different grain filling periods...

  11. Quick and sensitive determination of gene expression of fatty acid ...

    African Journals Online (AJOL)

    User

    2011-05-16

    May 16, 2011 ... from fatty acid synthase (FAS) with a different glucose level in ... By using the following formula, this study was able to quantify the mRNA expression of ... hypertension, heart disease and diabetes. ... regulation of gene expression has emerged in recent ... stages of adipocyte meta-bolism are relatively well.

  12. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  13. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  14. Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

    Science.gov (United States)

    Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

    2002-01-01

    Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

  15. Optimization of the expression of phaC2 encoding poly (3-hydroxyalkanoate synthase from Pseudomonas aeruginosa PTCC1310 in Fad B deleted Escherichia coli

    Directory of Open Access Journals (Sweden)

    Daryoush Abedi

    2016-01-01

    Conclusion: We obtained functional expression of the phaC2 gene and investigated various conditions that could influence the expression of protein to optimize production of PHA synthase enzymes. This would allow us to study PHA production in large quantities.

  16. Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.

    LENUS (Irish Health Repository)

    Cathcart, Mary-Clare

    2012-02-01

    BACKGROUND: Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. METHODS: PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. RESULTS: PGIS expression was reduced\\/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. CONCLUSIONS: PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC.

  17. Gene expression in periodontal tissues following treatment

    Directory of Open Access Journals (Sweden)

    Eisenacher Martin

    2008-07-01

    Full Text Available Abstract Background In periodontitis, treatment aimed at controlling the periodontal biofilm infection results in a resolution of the clinical and histological signs of inflammation. Although the cell types found in periodontal tissues following treatment have been well described, information on gene expression is limited to few candidate genes. Therefore, the aim of the study was to determine the expression profiles of immune and inflammatory genes in periodontal tissues from sites with severe chronic periodontitis following periodontal therapy in order to identify genes involved in tissue homeostasis. Gingival biopsies from 12 patients with severe chronic periodontitis were taken six to eight weeks following non-surgical periodontal therapy, and from 11 healthy controls. As internal standard, RNA of an immortalized human keratinocyte line (HaCaT was used. Total RNA was subjected to gene expression profiling using a commercially available microarray system focusing on inflammation-related genes. Post-hoc confirmation of selected genes was done by Realtime-PCR. Results Out of the 136 genes analyzed, the 5% most strongly expressed genes compared to healthy controls were Interleukin-12A (IL-12A, Versican (CSPG-2, Matrixmetalloproteinase-1 (MMP-1, Down syndrome critical region protein-1 (DSCR-1, Macrophage inflammatory protein-2β (Cxcl-3, Inhibitor of apoptosis protein-1 (BIRC-1, Cluster of differentiation antigen 38 (CD38, Regulator of G-protein signalling-1 (RGS-1, and Finkel-Biskis-Jinkins murine osteosarcoma virus oncogene (C-FOS; the 5% least strongly expressed genes were Receptor-interacting Serine/Threonine Kinase-2 (RIP-2, Complement component 3 (C3, Prostaglandin-endoperoxide synthase-2 (COX-2, Interleukin-8 (IL-8, Endothelin-1 (EDN-1, Plasminogen activator inhibitor type-2 (PAI-2, Matrix-metalloproteinase-14 (MMP-14, and Interferon regulating factor-7 (IRF-7. Conclusion Gene expression profiles found in periodontal tissues following

  18. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  19. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  20. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  1. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  2. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  3. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Neuronal expression of glucosylceramide synthase in central nervous system regulates body weight and energy homeostasis.

    Science.gov (United States)

    Nordström, Viola; Willershäuser, Monja; Herzer, Silke; Rozman, Jan; von Bohlen Und Halbach, Oliver; Meldner, Sascha; Rothermel, Ulrike; Kaden, Sylvia; Roth, Fabian C; Waldeck, Clemens; Gretz, Norbert; de Angelis, Martin Hrabě; Draguhn, Andreas; Klingenspor, Martin; Gröne, Hermann-Josef; Jennemann, Richard

    2013-01-01

    Hypothalamic neurons are main regulators of energy homeostasis. Neuronal function essentially depends on plasma membrane-located gangliosides. The present work demonstrates that hypothalamic integration of metabolic signals requires neuronal expression of glucosylceramide synthase (GCS; UDP-glucose:ceramide glucosyltransferase). As a major mechanism of central nervous system (CNS) metabolic control, we demonstrate that GCS-derived gangliosides interacting with leptin receptors (ObR) in the neuronal membrane modulate leptin-stimulated formation of signaling metabolites in hypothalamic neurons. Furthermore, ganglioside-depleted hypothalamic neurons fail to adapt their activity (c-Fos) in response to alterations in peripheral energy signals. Consequently, mice with inducible forebrain neuron-specific deletion of the UDP-glucose:ceramide glucosyltransferase gene (Ugcg) display obesity, hypothermia, and lower sympathetic activity. Recombinant adeno-associated virus (rAAV)-mediated Ugcg delivery to the arcuate nucleus (Arc) significantly ameliorated obesity, specifying gangliosides as seminal components for hypothalamic regulation of body energy homeostasis.

  5. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  6. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  7. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  8. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  9. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  10. Expression Patterns, Activities and Carbohydrate-Metabolizing Regulation of Sucrose Phosphate Synthase, Sucrose Synthase and Neutral Invertase in Pineapple Fruit during Development and Ripening

    Science.gov (United States)

    Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming

    2012-01-01

    Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808

  11. Cyclooxygenase 2 and neuronal nitric oxide synthase expression in the renal cortex are not interdependent in states of salt deficiency

    DEFF Research Database (Denmark)

    Castrop, H; Kammerl, M; Mann, Birgitte

    2000-01-01

    Neuronal nitric oxide synthase (nNOS) and cyclooxygenase-2 (COX-2) expression in the kidney are localized to the cortical thick ascending limb of the loop of Henle (cTALH), including the macula region, and increase after salt restriction. Because of the similar localization and regulation of n...... excretion. These findings suggest that under these conditions the control of nNOS and COX-2 gene expression in the macula densa regions of the kidney cortex are not dependent on each other....

  12. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  14. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  15. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  16. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  17. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  18. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  19. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    Science.gov (United States)

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  20. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  1. Heterologous Gene Expression of N-Terminally Truncated Variants of LipPks1 Suggests a Functionally Critical Structural Motif in the N-terminus of Modular Polyketide Synthase

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Bailey, Constance B.; Fujii, Tatsu A.

    2017-01-01

    Streptomyces-derived, Well-characterized modular, polyketide synthase (PKS). Using this enzyme as a model, we experimentally investigated the effects of alternative TSSs using a heterologous host, Streptomyces venezuelae. One of the TSSs employed boosted the protein level by 59-fold and the product yield by 23...

  2. The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

    Science.gov (United States)

    Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

    2018-05-11

    Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

  3. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  4. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  5. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  6. An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

    Science.gov (United States)

    Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

    2014-01-01

    Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

  7. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang

    2018-01-01

    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  8. Expression of prostaglandin synthases (pgds and pges) during zebrafish gonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Nielsen, Betina Frydenlund

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E2 synthase (pges) and especially the lipocalin-type prostaglandin D2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found....... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph. The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...

  9. Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found...... In this study, a sexually dimorphic expression of pgds was found in gonads of adult zebrafish with expression in testis but not in ovaries. To determine whether the sex-specific expression pattern of pgds was present in gonads of juvenile zebrafish and therefore could be an early marker of sex in zebrafish, we...... microdissected gonads from four randomly selected individual zebrafish for every second day in the period 2-20 days post hatch (dph) and 0-1 dph The temporal expression of pgds and pges was investigated in the microdissected gonads, however, no differential expression that could indicate sex-specific difference...

  10. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  11. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  12. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    Ge Shimei; Xie Baoen; Chen Sanfeng

    2006-01-01

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

  13. Artichoke, Cynarin and Cyanidin Downregulate the Expression of Inducible Nitric Oxide Synthase in Human Coronary Smooth Muscle Cells

    OpenAIRE

    Ning Xia; Andrea Pautz; Ursula Wollscheid; Gisela Reifenberg; Ulrich Förstermann; Huige Li

    2014-01-01

    Artichoke (Cynara scolymus L.) is one of the world’s oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS) in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects ...

  14. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  15. Identification of a novel CoA synthase isoform, which is primarily expressed in Brain

    International Nuclear Information System (INIS)

    Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.

    2006-01-01

    CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation

  16. Differential Gene Expression and Aging

    Directory of Open Access Journals (Sweden)

    Laurent Seroude

    2002-01-01

    Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.

  17. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis.

    Science.gov (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E; Chen, Ming; Zhou, Yongming; Yu, Bin; Cahoon, Edgar B

    2015-08-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. © 2015 American Society of

  18. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  19. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  20. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  1. Effects of acetoacetyl-CoA synthase expression on production of farnesene in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Tippmann, Stefan; Ferreira, Raphael; Siewers, Verena

    2017-01-01

    to overcome the thermodynamic constraint imposed on the first reaction, in which acetoacetyl-CoA is produced from two moles of acetyl-CoA by acetoacetyl-CoA thiolase. Recently, a novel acetoacetyl-CoA synthase (nphT7) has been identified from Streptomyces sp. strain CL190, which catalyzes the irreversible...... functionality of the bypass was limited by the efficiency of acetoacetyl-CoA synthase (nphT7). Besides modulation of the expression level, which could be used as a means to partially restore the phenotype, nphT7 from Streptomyces glaucescens showed clearly higher efficiency compared to Streptomyces sp. strain...

  2. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  3. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  4. Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

    Science.gov (United States)

    Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

    2017-07-01

    Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

  5. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  6. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  7. The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

    Directory of Open Access Journals (Sweden)

    Leila Shabani

    2015-03-01

    Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

  8. Expression of Cyclic GMP-AMP Synthase in Patients With Systemic Lupus Erythematosus.

    Science.gov (United States)

    An, Jie; Durcan, Laura; Karr, Reynold M; Briggs, Tracy A; Rice, Gillian I; Teal, Thomas H; Woodward, Joshua J; Elkon, Keith B

    2017-04-01

    Type I interferon (IFN) is implicated in the pathogenesis of systemic lupus erythematosus (SLE) and interferonopathies such as Aicardi-Goutières syndrome. A recently discovered DNA-activated type I IFN pathway, cyclic GMP-AMP synthase (cGAS), has been linked to Aicardi-Goutières syndrome and mouse models of lupus. The aim of this study was to determine whether the cGAS pathway contributes to type I IFN production in patients with SLE. SLE disease activity was measured by the Safety of Estrogens in Lupus Erythematosus National Assessment version of the Systemic Lupus Erythematosus Disease Activity Index. Expression of messenger RNA for cGAS and IFN-stimulated genes (ISGs) was determined by quantitative polymerase chain reaction analysis. Cyclic GMP-AMP (cGAMP) levels were examined by multiple reaction monitoring with ultra-performance liquid chromatography tandem mass spectrometry. Expression of cGAS in peripheral blood mononuclear cells (PBMCs) was significantly higher in SLE patients than in normal controls (n = 51 and n = 20 respectively; P < 0.01). There was a positive correlation between cGAS expression and the IFN score (P < 0.001). The expression of cGAS in PBMCs showed a dose response to type I IFN stimulation in vitro, consistent with it being an ISG. Targeted measurement of cGAMP by tandem mass spectrometry detected cGAMP in 15% of the SLE patients (7 of 48) but none of the normal (0 of 19) or rheumatoid arthritis (0 of 22) controls. Disease activity was higher in SLE patients with cGAMP versus those without cGAMP. Increased cGAS expression and cGAMP in a proportion of SLE patients indicates that the cGAS pathway should be considered as a contributor to type I IFN production. Whereas higher cGAS expression may be a consequence of exposure to type I IFN, detection of cGAMP in patients with increased disease activity indicates potential involvement of this pathway in disease expression. © 2016, American College of Rheumatology.

  9. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  10. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  11. Disequilibrium of flavonol synthase and dihydroflavonol-4-reductase expression associated tightly to white versus red color flower formation in plants

    Directory of Open Access Journals (Sweden)

    Ping eLuo

    2016-01-01

    Full Text Available Flower colour is the main character throughout the plant kingdom. Though substantial information exists regarding the structural and regulatory genes involved in anthocyanin and flavonol biosynthesis, little is known that what make a diverse white versus red color flower in natural species. Here, the contents of pigments in seven species from varied phylogenetic location in plants with red and white flowers.were determined. Flavonols could be detected in red and white flowers, but anthocyanins were almost undetectable in the white cultivar. Comparisons of expression patterns of gene related to the flavonoid biosynthesis indicated that disequilibrium expression of flavonol synthase (FLS and dihydroflavonol-4-reductase (DFR genes determined the accumulation of flavonols and anothcyanins in both red and white flowers of seven species. To further investigate the role of such common regulatory patterns in determining flower color, FLS genes were isolated from Rosa rugosa (RrFLS1, Prunus persica (PpFLS and Petunia hybrida (PhFLS, and DFR genes were isolated from Rosa rugosa (RrDFR1 and Petunia hybrida (PhDFR. Heterologous expression of the FLS genes within tobacco host plants demonstrated conservation of function, with the transgenes promoting flavonol biosynthesis and inhibiting anthocyanin accumulation, so resulting in white flowers. Conversely, overexpression of DFR genes in tobacco displayed down-regulation of the endogenous NtFLS gene, and the promotion of anthocyanin synthesis. On this basis, we propose a model in which FLS and DFR gene-products compete for common substrates in order to direct the biosynthesis of flavonols and anthocyanins, respectively, thereby determining white versus red coloration of flowers.

  12. Soybean seeds expressing feedback-insensitive cystathionine γ-synthase exhibit a higher content of methionine.

    Science.gov (United States)

    Song, Shikui; Hou, Wensheng; Godo, Itamar; Wu, Cunxiang; Yu, Yang; Matityahu, Ifat; Hacham, Yael; Sun, Shi; Han, Tianfu; Amir, Rachel

    2013-04-01

    Soybean seeds provide an excellent source of protein for human and livestock nutrition. However, their nutritional quality is hampered by a low concentration of the essential sulfur amino acid, methionine (Met). In order to study factors that regulate Met synthesis in soybean seeds, this study used the Met-insensitive form of Arabidopsis cystathionine γ-synthase (AtD-CGS), which is the first committed enzyme of Met biosynthesis. This gene was expressed under the control of a seed-specific promoter, legumin B4, and used to transform the soybean cultivar Zigongdongdou (ZD). In three transgenic lines that exhibited the highest expression level of AtD-CGS, the level of soluble Met increased significantly in developing green seeds (3.8-7-fold). These seeds also showed high levels of other amino acids. This phenomenon was more prominent in two transgenic lines, ZD24 and ZD91. The total Met content, which including Met incorporated into proteins, significantly increased in the mature dry seeds of these two transgenic lines by 1.8- and 2.3-fold, respectively. This elevation was accompanied by a higher content of other protein-incorporated amino acids, which led to significantly higher total protein content in the seeds of these two lines. However, in a third transgenic line, ZD01, the level of total Met and the level of other amino acids did not increase significantly in the mature dry seeds. This line also showed no significant change in protein levels. This suggests a positive connection between high Met content and the synthesis of other amino acids that enable the synthesis of more seed proteins.

  13. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

    2008-01-01

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  14. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.

    1988-01-01

    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  15. Ceramide synthases expression and role of ceramide synthase-2 in the lung: insight from human lung cells and mouse models.

    Directory of Open Access Journals (Sweden)

    Irina Petrache

    Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.

  16. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  17. Sterol regulatory element-binding protein-1 participates in the regulation of fatty acid synthase expression in colorectal neoplasia.

    Science.gov (United States)

    Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S

    2000-11-25

    Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.

  18. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the boraginales.

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-07-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.

  19. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  20. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  1. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  2. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    DEFF Research Database (Denmark)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens

    2009-01-01

    unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. METHODS: MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS....... Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard...

  3. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  4. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated ... specific human leukocyte antigen alleles that seem to be ... prevents the contractions of the uterine myometrium directly or by an ... an anatomical factor, to avoid this possible bias all candidates.

  5. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  6. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.

  7. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

  8. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  9. Immunohistochemical expression of nitric oxide synthases in gastric adenocarcinomas

    OpenAIRE

    Begnami, Maria Dirlei F. S.; Cunha, Isabela Werneck da; Montagnini, André; Nonogaki, Sueli; Soares, Fernando

    2004-01-01

    INTRODUÇÃO: O óxido nítrico (NO) é uma molécula mediadora de diversas funções, tais como vasodilatação, neurotransmissão e metabolismo do ferro. Os efeitos do NO na biologia tumoral são ambíguos e complexos. A atividade das sintases do óxido nítrico (NOS) tem sido demonstrada em diversos tumores humanos. OBJETIVO: Pesquisar a expressão das isoformas das NOS em carcinomas gástricos e correlacionar estes achados com características demográficas e histopatológicas destes tumores. MATERIAL E MÉTO...

  10. Stable expression of lipocalin-type prostaglandin D synthase in cultured preadipocytes impairs adipogenesis program independently of endogenous prostanoids

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Mohammad Salim; Chowdhury, Abu Asad; Rahman, Mohammad Sharifur [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Nishimura, Kohji [Department of Molecular and Functional Genomics, Center for Integrated Research in Science, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Jisaka, Mitsuo; Nagaya, Tsutomu [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Shono, Fumiaki [Department of Clinical Pharmacy, Faculty of Pharmaceutical Sciences, Tokushima Bunri University, 180 Yamashiro-cho, Tokushima-shi, Tokushima 770-8514 (Japan); Yokota, Kazushige, E-mail: yokotaka@life.shimane-u.ac.jp [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan)

    2012-02-15

    Lipocalin-type prostaglandin D synthase (L-PGDS) expressed preferentially in adipocytes is responsible for the synthesis of PGD{sub 2} and its non-enzymatic dehydration products, PGJ{sub 2} series, serving as pro-adipogenic factors. However, the role of L-PGDS in the regulation of adipogenesis is complex because of the occurrence of several derivatives from PGD{sub 2} and their distinct receptor subtypes as well as other functions such as a transporter of lipophilic molecules. To manipulate the expression levels of L-PGDS in cultured adipocytes, cultured preadipogenic 3T3-L1 cells were transfected stably with a mammalian expression vector having cDNA encoding murine L-PGDS oriented in the sense direction. The isolated cloned stable transfectants with L-PGDS expressed higher levels of the transcript and protein levels of L-PGDS, and synthesized PGD{sub 2} from exogenous arachidonic acid at significantly higher levels. By contrast, the synthesis of PGE{sub 2} remained unchanged, indicating no influence on the reactions of cyclooxygenase (COX) and PGE synthase. Furthermore, the ability of those transfectants to synthesize {Delta}{sup 12}-PGJ{sub 2} increased more greatly during the maturation phase. The sustained expression of L-PGDS in cultured stable transfectants hampered the storage of fats during the maturation phase of adipocytes, which was accompanied by the reduced gene expression of adipocyte-specific markers reflecting the down-regulation of the adipogenesis program. The suppressed adipogenesis was not rescued by either exogenous aspirin or peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists including troglitazone and {Delta}{sup 12}-PGJ{sub 2}. Taken together, the results indicate the negative regulation of the adipogenesis program by the enhanced expression of L-PGDS through a cellular mechanism involving the interference of the PPAR{gamma} signaling pathway without the contribution of endogenous pro-adipogenic prostanoids

  11. Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A Randomized Controlled Trial. Addendum

    Science.gov (United States)

    2011-07-01

    controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the

  12. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...

  13. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin

    2014-01-01

    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...

  14. A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

    Directory of Open Access Journals (Sweden)

    Hiroaki Iwasaka

    2018-04-01

    Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

  15. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

    2017-11-03

    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  16. Geranylgeranyl diphosphate synthases from Scoparia dulcis and Croton sublyratus. cDNA cloning, functional expression, and conversion to a farnesyl diphosphate synthase.

    Science.gov (United States)

    Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U

    2000-07-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.

  17. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  18. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Gene expression analysis in watermelon (Citrullus lanatus fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC, β-actin (ClACT, and alpha tubulin 5 (ClTUA5 as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1, a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  19. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Science.gov (United States)

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong

    2015-01-01

    Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  20. Regulation of galactan synthase expression to modify galactan content in plants

    Science.gov (United States)

    None

    2017-08-22

    The disclosure provides methods of engineering plants to modulate galactan content. Specifically, the disclosure provides methods for engineering a plant to increase the galactan content in a plant tissue by inducing expression of beta-1,4-galactan synthase (GALS), modulated by a heterologous promoter. Further disclosed are the methods of modulating expression level of GALS under the regulation of a transcription factor, as well as overexpression of UDP-galactose epimerse in the same plant tissue. Tissue specific promoters and transcription factors can be used in the methods are also provided.

  1. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

    2014-01-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  2. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  3. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  4. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  5. Impact of drought stress on specialised metabolism: Biosynthesis and the expression of monoterpene synthases in sage (Salvia officinalis).

    Science.gov (United States)

    Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk

    2017-09-01

    In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  7. Human papillomavirus gene expression

    International Nuclear Information System (INIS)

    Chow, L.T.; Hirochika, H.; Nasseri, M.; Stoler, M.H.; Wolinsky, S.M.; Chin, M.T.; Hirochika, R.; Arvan, D.S.; Broker, T.R.

    1987-01-01

    To determine the role of tissue differentiation on expression of each of the papillomavirus mRNA species identified by electron microscopy, the authors prepared exon-specific RNA probes that could distinguish the alternatively spliced mRNA species. Radioactively labeled single-stranded RNA probes were generated from a dual promoter vector system and individually hybridized to adjacent serial sections of formalin-fixed, paraffin-embedded biopsies of condylomata. Autoradiography showed that each of the message species had a characteristic tissue distribution and relative abundance. The authors have characterized a portion of the regulatory network of the HPVs by showing that the E2 ORF encodes a trans-acting enhancer-stimulating protein, as it does in BPV-1 (Spalholz et al. 1985). The HPV-11 enhancer was mapped to a 150-bp tract near the 3' end of the URR. Portions of this region are duplicated in some aggressive strains of HPV-6 (Boshart and zur Hausen 1986; Rando et al. 1986). To test the possible biological relevance of these duplications, they cloned tandem arrays of the enhancer and demonstrated, using a chloramphenicol acetyltransferase (CAT) assay, that they led to dramatically increased transcription proportional to copy number. Using the CAT assays, the authors found that the E2 proteins of several papillomavirus types can cross-stimulate the enhancers of most other types. This suggests that prior infection of a tissue with one papillomavirus type may provide a helper effect for superinfection and might account fo the HPV-6/HPV-16 coinfections in condylomata that they have observed

  8. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  9. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  10. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

    Science.gov (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2017-07-01

    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  13. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  14. The Balance of Expression of Dihydroflavonol 4-reductase and Flavonol Synthase Regulates Flavonoid Biosynthesis and Red Foliage Coloration in Crabapples.

    Science.gov (United States)

    Tian, Ji; Han, Zhen-yun; Zhang, Jie; Hu, YuJing; Song, Tingting; Yao, Yuncong

    2015-07-20

    Red leaf color is an attractive trait of Malus families, including crabapple (Malus spp.); however, little is known about the molecular mechanisms that regulate the coloration. Dihydroflavonols are intermediates in the production of both colored anthocyanins and colorless flavonols, and this current study focused on the gene expression balance involved in the relative accumulation of these compounds in crabapple leaves. Levels of anthocyanins and the transcript abundances of the anthocyanin biosynthetic gene, dihydroflavonol 4-reductase (McDFR) and the flavonol biosynthetic gene, flavonol synthase (McFLS), were assessed during the leaf development in two crabapple cultivars, 'Royalty' and 'Flame'. The concentrations of anthocyanins and flavonols correlated with leaf color and we propose that the expression of McDFR and McFLS influences their accumulation. Further studies showed that overexpression of McDFR, or silencing of McFLS, increased anthocyanin production, resulting in red-leaf and red fruit peel phenotypes. Conversely, elevated flavonol production and green phenotypes in crabapple leaves and apple peel were observed when McFLS was overexpressed or McDFR was silenced. These results suggest that the relative activities of McDFR and McFLS are important determinants of the red color of crabapple leaves, via the regulation of the metabolic fate of substrates that these enzymes have in common.

  15. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  16. Artichoke, Cynarin and Cyanidin Downregulate the Expression of Inducible Nitric Oxide Synthase in Human Coronary Smooth Muscle Cells

    Directory of Open Access Journals (Sweden)

    Ning Xia

    2014-03-01

    Full Text Available Artichoke (Cynara scolymus L. is one of the world’s oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects of artichoke on iNOS expression in human coronary artery smooth muscle cells (HCASMC. Incubation of HCASMC with a cytokine mixture led to an induction of iNOS mRNA expression. This iNOS induction was concentration- and time-dependently inhibited by an artichoke leaf extract (1–100 µg/mL, 6 h or 24 h. Consistently, the artichoke leaf extract also reduced cytokine-induced iNOS promoter activation and iNOS protein expression. In addition, treatment of HCASMC with four well-known artichoke compounds (cynarin > cyanidin > luteolin ≈ cynaroside led to a downregulation iNOS mRNA and protein expression, with cynarin being the most potent one. In conclusion, artichoke contains both eNOS-upregulating and iNOS-downregulating compounds. Such compounds may contribute to the beneficial effects of artichoke and may per se have therapeutic potentials.

  17. Artichoke, cynarin and cyanidin downregulate the expression of inducible nitric oxide synthase in human coronary smooth muscle cells.

    Science.gov (United States)

    Xia, Ning; Pautz, Andrea; Wollscheid, Ursula; Reifenberg, Gisela; Förstermann, Ulrich; Li, Huige

    2014-03-24

    Artichoke (Cynara scolymus L.) is one of the world's oldest medicinal plants with multiple health benefits. We have previously shown that artichoke leaf extracts and artichoke flavonoids upregulate the gene expression of endothelial-type nitric oxide synthase (eNOS) in human endothelial cells. Whereas NO produced by the eNOS is a vasoprotective molecule, NO derived from the inducible iNOS plays a pro-inflammatory role in the vasculature. The present study was aimed to investigate the effects of artichoke on iNOS expression in human coronary artery smooth muscle cells (HCASMC). Incubation of HCASMC with a cytokine mixture led to an induction of iNOS mRNA expression. This iNOS induction was concentration- and time-dependently inhibited by an artichoke leaf extract (1-100 µg/mL, 6 h or 24 h). Consistently, the artichoke leaf extract also reduced cytokine-induced iNOS promoter activation and iNOS protein expression. In addition, treatment of HCASMC with four well-known artichoke compounds (cynarin > cyanidin > luteolin ≈ cynaroside) led to a downregulation iNOS mRNA and protein expression, with cynarin being the most potent one. In conclusion, artichoke contains both eNOS-upregulating and iNOS-downregulating compounds. Such compounds may contribute to the beneficial effects of artichoke and may per se have therapeutic potentials.

  18. Regulation of Banana Phytoene Synthase (MaPSY) Expression, Characterization and Their Modulation under Various Abiotic Stress Conditions

    Science.gov (United States)

    Kaur, Navneet; Pandey, Ashutosh; Shivani; Kumar, Prateek; Pandey, Pankaj; Kesarwani, Atul K.; Mantri, Shrikant S.; Awasthi, Praveen; Tiwari, Siddharth

    2017-01-01

    Phytoene synthase (PSY) is a key regulatory enzyme of carotenoid biosynthesis pathway in plants. The present study examines the role of PSY in carotenogenesis and stress management in banana. Germplasm screening of 10 Indian cultivars showed that Nendran (3011.94 μg/100 g dry weight) and Rasthali (105.35 μg/100 g dry weight) contained the highest and lowest amounts of β-carotene, respectively in ripe fruit-pulp. Nendran ripe pulp also showed significantly higher antioxidant activity as compared to Rasthali. Meta-analysis of three banana PSY genes (MaPSY1, MaPSY2, and MaPSY3) was performed to identify their structural features, subcellular, and chromosomal localization in banana genome. The distinct expression patterns of MaPSY1, MaPSY2, and MaPSY3 genes were observed in various tissues, and fruit developmental stages of these two contrasting cultivars, suggesting differential regulation of the banana PSY genes. A positive correlation was observed between the expression of MaPSY1 and β-carotene accumulation in the ripe fruit-peel and pulp of Nendran. The presence of stress responsive cis-regulatory motifs in promoter region of MaPSY genes were correlated with the expression pattern during various stress (abscisic acid, methyl jasmonate, salicylic acid and dark) treatments. The positive modulation of MaPSY1 noticed under abiotic stresses suggested its role in plant physiological functions and defense response. The amino acid sequence analysis of the PSY proteins in contrasting cultivars revealed that all PSY comprises conserved domains related to enzyme activity. Bacterial complementation assay has validated the functional activity of six PSY proteins and among them PSY1 of Nendran (Nen-PSY1) gave the highest activity. These data provide new insights into the regulation of PSY expression in banana by developmental and stress related signals that can be explored in the banana improvement programs. PMID:28421096

  19. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

    2018-04-01

    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  20. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas

    2011-01-01

    (ectoderm) specification with co-opted functions in notochord formation in chordates and left/right determination in ambulacrarians and vertebrates. The caudal ortholog, TtrCdx, is first expressed in the ectoderm of the gastrulating embryo in the posterior region of the blastopore. Its expression stays......The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa...... completion of larval development, which is marked by a three-lobed body with larval setae. Expression starts at gastrulation in two areas lateral to the blastopore and subsequently extends over the animal pole of the gastrula. With elongation of the gastrula, expression at the animal pole narrows to a small...

  1. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro

    2013-07-01

    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  2. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  3. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  4. The chalcone synthase multigene family of Petunia hybrida (V30): differential, light-regulated expression during flower development and UV light induction

    International Nuclear Information System (INIS)

    Koes, R.E.; Spelt, C.E.; Mol, J.N.M.

    1989-01-01

    We have analysed the expression of the 8-10 members of the gene family encoding the flavonoid biosynthetic enzyme chalcone synthase (CHS) from Petunia hybrida. During normal plant development only two members of the gene family (CHS-A and CHS-J) are expressed. Their expression is restricted to floral tissues mainly. About 90% of the total CHS mRNA pool is transcribed from CHS-A, wheares CHS-J delivers about 10% in flower corolla, tube and anthers. Expression of CHS-A and CHS-J during flower development is coordinated and (red) light-dependent. In young seedlings and cell suspension cultures expression of CHS-A and CHS-J can be induced with UV light. In addition to CHS-A and CHS-J, expression of another two CHS genes (CHS-B and CHS-G) is induced in young seedlings by UV light, albeit at a low level. In contrast to CHS genes from Leguminoseae, Petunia CHS genes are not inducible by phytopathogen-derived elicitors. Expression of CHS-A and CHS-J is reduced to a similar extent in a regulatory CHS mutant, Petunia hybrida Red Star, suggesting that both genes are regulated by the same trans-acting factors. Comparison of the promoter sequences of CHS-A and CHS-J reveals some striking homologies, which might represent cis-acting regulatory sequences. (author)

  5. Neighboring Genes Show Correlated Evolution in Gene Expression

    Science.gov (United States)

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  6. Gene expression profile of pulpitis.

    Science.gov (United States)

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology.

  7. Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

    DEFF Research Database (Denmark)

    Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

    2005-01-01

    RNA and protein could be detected. The data suggest that iNOS expression may be a molecular mechanism mediating the adaptive response of trigeminal ganglia cells to the serum free stressful stimulus the culture environment provides. It may act as a cellular signalling molecule that is expressed after cell......Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular......, reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. In trigeminal ganglia cells not subjected to culture, endothelial (e) and neuronal (n) but not inducible (i) NOS mRNA and protein were detected. Culture of rat neurones resulted in a rapid axonal outgrowth of NOS positive...

  8. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  9. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Science.gov (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  10. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

    Science.gov (United States)

    Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.

    2006-01-01

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870

  11. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from Agrobacterium tumefaciens

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Dobson, Renwick C. J.; Perugini, Matthew A.

    2012-01-01

    Dihydrodipicolinate synthase from the plant pathogen A. tumefaciens has been cloned, expressed, purified and crystallized in its unliganded form, in the presence of its substrate pyruvate and in the presence of pyruvate and the allosteric inhibitor lysine. Diffraction data for the crystals were collected to a maximum resolution of 1.40 Å. Dihydrodipicolinate synthase (DHDPS) catalyzes the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS (NP-354047.1) from the plant pathogen Agrobacterium tumefaciens (AgT-DHDPS). Enzyme-kinetics studies demonstrate that AgT-DHDPS possesses DHDPS activity in vitro. Crystals of AgT-DHDPS were grown in the unliganded form and in forms with substrate bound and with substrate plus allosteric inhibitor (lysine) bound. X-ray diffraction data sets were subsequently collected to a maximum resolution of 1.40 Å. Determination of the structure with and without substrate and inhibitor will offer insight into the design of novel pesticide agents

  12. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the psychrophile Shewanella benthica

    International Nuclear Information System (INIS)

    Wubben, Jacinta M.; Dogovski, Con; Dobson, Renwick C. J.; Codd, Rachel; Gerrard, Juliet A.; Parker, Michael W.; Perugini, Matthew A.

    2010-01-01

    Dihydrodipicolinate synthase (DHDPS) is an essential oligomeric enzyme of interest to antibiotic discovery research and studies probing the importance of quaternary structure to protein function, stability and dynamics. The cloning, expression, purification and crystallization of DHDPS from the psychrophilic (cold-dwelling) bacterium Shewanella benthica are described. Dihydrodipicolinate synthase (DHDPS) is an oligomeric enzyme that catalyzes the first committed step of the lysine-biosynthesis pathway in plants and bacteria, which yields essential building blocks for cell-wall and protein synthesis. DHDPS is therefore of interest to drug-discovery research as well as to studies that probe the importance of quaternary structure to protein function, stability and dynamics. Accordingly, DHDPS from the psychrophilic (cold-dwelling) organism Shewanella benthica (Sb-DHDPS) was cloned, expressed, purified and crystallized. The best crystals of Sb-DHDPS were grown in 200 mM ammonium sulfate, 100 mM bis-tris pH 5.0–6.0, 23–26%(w/v) PEG 3350, 0.02%(w/v) sodium azide and diffracted to beyond 2.5 Å resolution. Processing of diffraction data to 2.5 Å resolution resulted in a unit cell with space group P2 1 2 1 2 1 and dimensions a = 73.1, b = 84.0, c = 143.7 Å. These studies of the first DHDPS enzyme to be characterized from a bacterial psychrophile will provide insight into the molecular evolution of enzyme structure and dynamics

  13. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the grapevine Vitis vinifera

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Newman, Janet; Dobson, Renwick C. J.; Perugini, Matthew A.

    2011-01-01

    Dihydrodipicolinate synthase from the common grapevine V. vinifera has been cloned, expressed, purified and crystallized in the presence of the substrate pyruvate by in-drop hexahistidine-tag cleavage. A diffraction data set has been collected to a resolution of 2.2 Å. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS from the grapevine Vitis vinifera (Vv-DHDPS). Following in-drop cleavage of the hexahistidine tag, cocrystals of Vv-DHDPS with the substrate pyruvate were grown in 0.1 M Bis-Tris propane pH 8.2, 0.2 M sodium bromide, 20%(w/v) PEG 3350. X-ray diffraction data in space group P1 at a resolution of 2.2 Å are presented. Preliminary diffraction data analysis indicated the presence of eight molecules per asymmetric unit (V M = 2.55 Å 3 Da −1 , 52% solvent content). The pending crystal structure of Vv-DHDPS will provide insight into the molecular evolution in quaternary structure of DHDPS enzymes

  14. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    International Nuclear Information System (INIS)

    Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano; Macone, Alberto; Boffi, Alberto; Ilari, Andrea

    2008-01-01

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to the trigonal space group P3 1 21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction

  15. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    International Nuclear Information System (INIS)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens; Sørensen, Jens B

    2009-01-01

    Microsatellite instability (MSI) refers to mutations in short motifs of tandemly repeated nucleotides resulting from replication errors and deficient mismatch repair (MMR). Colorectal cancer with MSI has characteristic biology and chemosensitivity, however the molecular basis remains unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression were assessed in paraffin embedded tumor specimens, and associated with outcome in 340 consecutive patients completely resected for colorectal cancer stages II-IV and subsequently receiving adjuvant 5-fluorouracil therapy. MSI was found in 43 (13.8%) tumors. Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard ratio (HR) = 0.3; 95% CI: 0.2–0.7; P = 0.0007) and death (HR = 0.4; 95% CI: 0.2–0.9; P = 0.02) independently of the TS and DPD expressions. A direct relationship between MSI and TS intensity (P = 0.001) was found, while there was no significant association with DPD intensity (P = 0.1). The favourable outcome of MSI colorectal carcinomas is ascribed mainly to the tumor biology and to a lesser extent to antitumor response to 5-fluorouracil therapy. There is no evidence that differential TS or DPD expression may account for these outcome characteristics

  16. Expression of phytoene synthase ( psy ) gene and its relation with ...

    African Journals Online (AJOL)

    Carotenoids are important determinant of tea quality as many of the quality related flavour volatiles are produced through the degradation of carotenoids during tea processing. Variation in levels of carotenoids including neoxanthin, violoxanthin, xanthophylls and -carotene in early and late period of spring, summer and ...

  17. Cloning and expression analysis of an anthocyanidin synthase gene ...

    Indian Academy of Sciences (India)

    Structure of AtANS and BcANS1 signal pep- tides was analysed using neural networks (NN) model in http://www.cbs.dtu.dk/services/SignalP/. Based on BcANS1 sequences, primers ANS1D (sense primer: 5 - AAAGGCGGCTATGGATTGGG-3 , antisense primer: 5 - GGCTGAGGGCATTTCGGGTA-3 ) were desig- ned and the ...

  18. Intermittent pneumatic compression regulates expression of nitric oxide synthases in skeletal muscles.

    Science.gov (United States)

    Tan, Xiangling; Qi, Wen-Ning; Gu, Xiaosong; Urbaniak, James R; Chen, Long-En

    2006-01-01

    This study investigated the effects of intermittent pneumatic compression (IPC) on expression of nitric oxide synthase (NOS) isoforms in compressed (anterior tibialis, AT) and uncompressed (cremaster muscles, CM) skeletal muscles. Following IPC application of 0.5, 1, and 5h on both legs of rats, the endothelial NOS (eNOS) mRNA expression was significantly up-regulated to 1.2-, 1.8, and 2.7-fold from normal, respectively, in both AT and CM, and protein expression increased more than 1.5-fold of normal at each time point. Similarly, neuronal NOS expression was up-regulated, but to a lesser degree. In contrast, inducible NOS expression was significantly and time-dependently down-regulated in both muscles. After IPC cessation, eNOS levels returned to normal in both AT and CM. The results confirm our hypothesis that IPC-induced vasodilation is mediated by regulating expression of NOS isoforms, in particular eNOS, in both compressed and uncompressed skeletal muscles. The results also suggest the importance of precisely characterizing expression of each NOS isoform in tissue pathophysiology.

  19. Recombinant expression of a functional myo-inositol-1-phosphate synthase (MIPS) in Mycobacterium smegmatis.

    Science.gov (United States)

    Huang, Xinyi; Hernick, Marcy

    2015-10-01

    Myo-inositol-1-phosphate synthase (MIPS, E.C. 5.5.1.4) catalyzes the first step in inositol production-the conversion of glucose-6-phosphate (Glc-6P) to myo-inositol-1-phosphate. While the three dimensional structure of MIPS from Mycobacterium tuberculosis has been solved, biochemical studies examining the in vitro activity have not been reported to date. Herein we report the in vitro activity of mycobacterial MIPS expressed in E. coli and Mycobacterium smegmatis. Recombinant expression in E. coli yields a soluble protein capable of binding the NAD(+) cofactor; however, it has no significant activity with the Glc-6P substrate. In contrast, recombinant expression in M. smegmatis mc(2)4517 yields a functionally active protein. Examination of structural data suggests that MtMIPS expressed in E. coli adopts a fold that is missing a key helix containing two critical (conserved) Lys side chains, which likely explains the inability of the E. coli expressed protein to bind and turnover the Glc-6P substrate. Recombinant expression in M. smegmatis may yield a protein that adopts a fold in which this key helix is formed enabling proper positioning of important side chains, thereby allowing for Glc-6P substrate binding and turnover. Detailed mechanistic studies may be feasible following optimization of the recombinant MIPS expression protocol in M. smegmatis.

  20. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  1. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  2. Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Directory of Open Access Journals (Sweden)

    Khalil Zaynali

    2010-06-01

    Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

  3. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Ethylene biosynthesis genes are differentially expressed during carnation (Dianthus caryophyllus L.) flower senescence.

    NARCIS (Netherlands)

    Have, ten A.; Woltering, E.J.

    1997-01-01

    Ethylene production and expression patterns of an 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase (CARAO1) and of two ACC synthase (EC 4.4.1.14) genes (CARACC3 and CARAS1) were studied in floral organs of cut carnation flowers (Dianthus caryophyllus L.) cv. White Sim. During the vase life and

  5. Using gene expression noise to understand gene regulation

    NARCIS (Netherlands)

    Munsky, B.; Neuert, G.; van Oudenaarden, A.

    2012-01-01

    Phenotypic variation is ubiquitous in biology and is often traceable to underlying genetic and environmental variation. However, even genetically identical cells in identical environments display variable phenotypes. Stochastic gene expression, or gene expression "noise," has been suggested as a

  6. GNC and CGA1 Modulate Chlorophyll Biosynthesis and Glutamate Synthase (GLU1/Fd-GOGAT) Expression in Arabidopsis

    Science.gov (United States)

    Hudson, Darryl; Guevara, David; Yaish, Mahmoud W.; Hannam, Carol; Long, Nykoll; Clarke, Joseph D.; Bi, Yong-Mei; Rothstein, Steven J.

    2011-01-01

    Chloroplast development is an important determinant of plant productivity and is controlled by environmental factors including amounts of light and nitrogen as well as internal phytohormones including cytokinins and gibberellins (GA). The paralog GATA transcription factors GNC and CGA1/GNL up-regulated by light, nitrogen and cytokinin while also being repressed by GA signaling. Modifying the expression of these genes has previously been shown to influence chlorophyll content in Arabidopsis while also altering aspects of germination, elongation growth and flowering time. In this work, we also use transgenic lines to demonstrate that GNC and CGA1 exhibit a partially redundant control over chlorophyll biosynthesis. We provide novel evidence that GNC and CGA1 influence both chloroplast number and leaf starch in proportion to their transcript level. GNC and CGA1 were found to modify the expression of chloroplast localized GLUTAMATE SYNTHASE (GLU1/Fd-GOGAT), which is the primary factor controlling nitrogen assimilation in green tissue. Altering GNC and CGA1 expression was also found to modulate the expression of important chlorophyll biosynthesis genes (GUN4, HEMA1, PORB, and PORC). As previously demonstrated, the CGA1 transgenic plants demonstrated significantly altered timing to a number of developmental events including germination, leaf production, flowering time and senescence. In contrast, the GNC transgenic lines we analyzed maintain relatively normal growth phenotypes outside of differences in chloroplast development. Despite some evidence for partial divergence, results indicate that regulation of both GNC and CGA1 by light, nitrogen, cytokinin, and GA acts to modulate nitrogen assimilation, chloroplast development and starch production. Understanding the mechanisms controlling these processes is important for agricultural biotechnology. PMID:22102866

  7. A constructive approach to gene expression dynamics

    International Nuclear Information System (INIS)

    Ochiai, T.; Nacher, J.C.; Akutsu, T.

    2004-01-01

    Recently, experiments on mRNA abundance (gene expression) have revealed that gene expression shows a stationary organization described by a scale-free distribution. Here we propose a constructive approach to gene expression dynamics which restores the scale-free exponent and describes the intermediate state dynamics. This approach requires only one assumption: Markov property

  8. [Effect of adaptation to hypoxia on expression of NO synthase isoforms in rat myocardium].

    Science.gov (United States)

    Goryacheva, A V; Terekhina, O L; Abramochkin, D V; Budanova, O P; Belkina, L M; Smirin, B V; Downey, H F; Malyshev, I Yu; Manukhina, E B

    2015-01-01

    Previously we have shown that adaptation to hypoxia (AH) is cardio- and vasoprotective in myocardial ischemic and reperfusion injury and this protection is associated with restriction of nitrosative stress. The present study was focused on further elucidation of NO-dependent mechanisms of AH by identifying specific NO synthases (NOS) that could play the major role in AH protection. AH was performed in a normobaric hypoxic chamber by breathing hypoxic gas mixture (9.5-10% O2) for 5-10 min with intervening 4 min normoxia (5-8 cycles daily for 21 days). Expression of neuronal (nNOS), inducible (iNOS), and endothelial (eNOS) protein was measured in the left ventricular myocardium using Western blot analysis with respective antibodies. AH educed iNOS protein expression by 71% (p < 0.05) whereas eNOS protein expression tended to be reduced by 41% compared to control (p < 0.05). nNOS protein expression remained unchanged after AH. Selective iNOS inhibition can mimic the AH-induced protection. Therefore protective effects of AH could be at least partially due to restriction of iNOS and, probably, eNOS expression.

  9. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  10. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  11. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    Science.gov (United States)

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  13. Effects of Intracerebroventricularly (ICV) Injected Ghrelin on Cardiac Inducible Nitric Oxide Synthase Activity/Expression in Obese Rats.

    Science.gov (United States)

    Sudar Milovanovic, E; Jovanovic, A; Misirkic-Marjanovic, M; Vucicevic, Lj; Janjetovic, K; Isenovic, E R

    2015-11-01

    The aim of this study was to examine the effects of ghrelin on regulation of cardiac inducible nitric oxide synthase (iNOS) activity/expression in high fat (HF), obese rats.For this study, male Wistar rats fed with HF diet (30% fat) for 4 weeks were injected every 24 h for 5 days intracerebroventricularly (ICV) with ghrelin (0.3 nmol/5 µl) or with an equal volume of phosphate buffered saline (PBS). Control rats were ICV injected with an equal volume of PBS. Glucose, insulin and nitric oxide (NO) concentrations were measured in serum, while arginase activity and citrulline concentrations were measured in heart lysate. Protein iNOS and regulatory subunit of nuclear factor-κB (NFκB-p65), phosphorylation of enzymes protein kinase B (Akt) at Ser(473), and extracellular signal-regulated kinases 1/2 (ERK1/2) at Tyr(202)/Tyr(204) were determined in heart lysate by Western blot. For gene expression of iNOS qRT-PCR was used.Results show significantly (parginase activity (pactivity of cardiac iNOS via Akt phosphorylation followed by NFκB activation in HF rats. © Georg Thieme Verlag KG Stuttgart · New York.

  14. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal

    2002-01-01

    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... that the method can be applied to modulating the expression of native genes on the chromosome. We constructed a series of strains in which the expression of the las operon, containing the genes pfk, pyk, and ldh, was modulated by integrating a truncated copy of the pfk gene. Importantly, the modulation affected...

  15. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  17. cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yamamura, Saburo; Koiwa, Hiroyuki; Nishihara, Masashiro; Sandmann, Gerhard

    2002-02-01

    All cDNAs involved in carotenoid biosynthesis leading to lycopene in yellow petals of Gentiana lutea have been cloned from a cDNA library. They encode a geranylgeranyl pyrophosphate synthase, a phytoene synthase, a phytoene desaturase and a zeta-carotene desaturase. The indicated function of all cDNAs was established by heterologous complementation in Escherichia coli. The amino acid sequences deduced from the cDNAs were between 47.5% and 78.9% identical to those reported for the corresponding enzymes from other higher plants. Southern analysis suggested that the genes for each enzyme probably represent a small multi-gene family. Tissue-specific expression of the genes and expression during flower development was investigated. The expression of the phytoene synthase gene, psy, was enhanced in flowers but transcripts were not detected in stems and leaves by northern blotting. Transcripts of the genes for geranylgeranyl pyrophosphate (ggpps), phytoene desaturase (pds) and zeta-carotene desaturase (zds) were detected in flowers and leaves but not in stems. Analysis of the expression of psy and zds in petals revealed that levels of the transcripts were lowest in young buds and highest in fully open flowers, in parallel with the formation of carotenoids. Obviously, the transcription of these genes control the accumulation of carotenoids during flower development in G. lutea. For pds only a very slight increase of mRNA was found whereas the transcripts of ggpps decreased during flower development.

  18. Upregulation of cyclooxygenase-2 expression in porcine macula densa with chronic nitric oxide synthase inhibition.

    Science.gov (United States)

    Kommareddy, M; McAllister, R M; Ganjam, V K; Turk, J R; Laughlin, M Harold

    2011-11-01

    The objective of this study was to investigate the effects of chronic inhibition of nitric oxide synthase (NOS) on cyclooxygenase-2 (COX-2) expression in the macula densa (MD) of swine, as well as the effects on expression of related proteins. Adult female Yucatan swine were given either tap water (control, n = 6) or water with N (G)-nitro-L-arginine methyl ester (L-NAME, 100 mg/liter, n = 5) for a minimum of 30 days. Duplicate samples of kidney were fixed or snap frozen. There was a significant (P = .0082) upregulation of COX-2 mRNA expression in the MD of L-NAME, as well as an apparent increase in COX-2 protein. Plasma renin activity also increased with L-NAME treatment (control, 0.34 ± 0.08 ng/ml; L-NAME, 1.26 ± 0.03 ng/ml; P = .00000003). There were no differences between groups in expression of either inducible NOS or renin protein or in serum electrolyte concentrations. In conclusion, with chronic inhibition of NOS, COX-2 in MD is upregulated, perhaps to compensate for loss of nitric oxide. Increases in COX-2 products may counteract renal arteriolar constriction and sustain renin release.

  19. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  20. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  2. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  3. Influence of thymidylate synthase expression on survival in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Kinjal K Gajjar

    2017-01-01

    Full Text Available Background: Thymidylate synthase (TS plays a critical role in nucleotide metabolism and is an important target for 5-fluorouracil (5-FU, the standard chemotherapeutic drug for treatment of colorectal cancer (CRC. Aims and Methods: The present study aimed to evaluate TS variable number tandem repeat sequences (VNTR polymorphism by polymerase chain reaction and TS protein expression by immunohistochemistry and its association with clinicopathological parameters in untreated CRC patients (n = 100. Further, the prognostic and predictive role of TS has been evaluated. Results: For TS VNTR polymorphism, the observed frequencies of 2R/2R, 2R/3R, and 3R/3R genotypes were 22%, 51%, and 27%, respectively. When immunohistochemical localization was studied, cytoplasmic staining for TS was observed in 70% of patients. A significant inverse correlation was noted between TS protein expression and tumor, node, metastasis staging (P = 0.027, Dukes' staging (P = 0.039, and lymph node status (P = 0.012 of CRC patients. However, there was no significant correlation between TS VNTR polymorphism and TS protein expression. On survival analysis, a significantly shorter overall survival (OS was seen in CRC patients with negative protein expression (P = 0.031. Moreover, the subgroup of CRC patients treated only with surgery also showed a trend of poor OS in patients with negative TS protein expression (P = 0.058. However, neither TS polymorphism nor its protein expression was able to predict relapse-free survival. Conclusion: Negative TS protein expression may be related to unfavorable clinical outcome in CRC patients. However, further studies in a larger set of patients are necessary to better assess TS as a prognostic and predictive marker for 5-FU response in CRC patients.

  4. Alteration in expression of defence genes in Pisum sativum after exposure to supplementary ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Strid, A.

    1993-01-01

    Alterations in the amounts of mRNA for different types of defence genes after exposure of peas to supplementary ultraviolet-B radiation are demonstrated. The expression of the genes which encode the chalcone synthase of the flavonoid biosynthetic pathway and glutathione reductase was induced, while a decrease was found for the chloroplastic radical-scavenging enzyme, superoxide dismutase. (author)

  5. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

    OpenAIRE

    Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris

    2016-01-01

    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...

  6. The evolution of gene expression in primates

    OpenAIRE

    Tashakkori Ghanbarian, Avazeh

    2015-01-01

    The evolution of a gene’s expression profile is commonly assumed to be independent of its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between expression of neighboring genes in extant taxa. Indeed, in all eukaryotic genomes, genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their e...

  7. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  8. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    Science.gov (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Thymidylate synthase protein expression levels remain stable during paclitaxel and carboplatin treatment in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn

    2014-01-01

    BACKGROUND: Thymidylate synthase (TS) is a potential predictive marker for efficacy of treatment with pemetrexed. The current study aimed at investigating whether TS expression changes during non-pemetrexed chemotherapy of non-small cell lung cancer (NSCLC), thus making rebiopsy necessary for dec...

  10. Chlorophyll Synthase under Epigenetic Surveillance Is Critical for Vitamin E Synthesis, and Altered Expression Affects Tocopherol Levels in Arabidopsis1[OPEN

    Science.gov (United States)

    Zhang, Chunyu; Zhang, Wei; Ren, Guodong; Li, Delin; Cahoon, Rebecca E.; Chen, Ming; Zhou, Yongming; Yu, Bin

    2015-01-01

    Chlorophyll synthase catalyzes the final step in chlorophyll biosynthesis: the esterification of chlorophyllide with either geranylgeranyl diphosphate or phytyl diphosphate (PDP). Recent studies have pointed to the involvement of chlorophyll-linked reduction of geranylgeranyl by geranylgeranyl reductase as a major pathway for the synthesis of the PDP precursor of tocopherols. This indirect pathway of PDP synthesis suggests a key role of chlorophyll synthase in tocopherol production to generate the geranylgeranyl-chlorophyll substrate for geranylgeranyl reductase. In this study, contributions of chlorophyll synthase to tocopherol formation in Arabidopsis (Arabidopsis thaliana) were explored by disrupting and altering expression of the corresponding gene CHLOROPHYLL SYNTHASE (CHLSYN; At3g51820). Leaves from the homozygous chlysyn1-1 null mutant were nearly devoid of tocopherols, whereas seeds contained only approximately 25% of wild-type tocopherol levels. Leaves of RNA interference lines with partial suppression of CHLSYN displayed marked reductions in chlorophyll but up to a 2-fold increase in tocopherol concentrations. Cauliflower mosaic virus35S-mediated overexpression of CHLSYN unexpectedly caused a cosuppression phenotype at high frequencies accompanied by strongly reduced chlorophyll content and increased tocopherol levels. This phenotype and the associated detection of CHLSYN-derived small interfering RNAs were reversed with CHLSYN overexpression in rna-directed rna polymerase6 (rdr6), which is defective in RNA-dependent RNA polymerase6, a key enzyme in sense transgene-induced small interfering RNA production. CHLSYN overexpression in rdr6 had little effect on chlorophyll content but resulted in up to a 30% reduction in tocopherol levels in leaves. These findings show that altered CHLSYN expression impacts tocopherol levels and also, show a strong epigenetic surveillance of CHLSYN to control chlorophyll and tocopherol synthesis. PMID:26048882

  11. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    OpenAIRE

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-01-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...

  12. A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria).

    Science.gov (United States)

    Formighieri, Cinzia; Melis, Anastasios

    2015-11-01

    Cyanobacteria can be exploited as photosynthetic platforms for heterologous generation of terpene hydrocarbons with industrial applications. Transformation of Synechocystis and heterologous expression of the β-phellandrene synthase (PHLS) gene alone is necessary and sufficient to confer to Synechocystis the ability to divert intermediate terpenoid metabolites and to generate the monoterpene β-phellandrene during photosynthesis. However, terpene synthases, including the PHLS, have a slow Kcat (low Vmax) necessitating high levels of enzyme concentration to enable meaningful rates and yield of product formation. Here, a novel approach was applied to increase the PHLS protein expression alleviating limitations in the rate and yield of β-phellandrene product generation. Different PHLS fusion constructs were generated with the Synechocystis endogenous cpcB sequence, encoding for the abundant in cyanobacteria phycocyanin β-subunit, expressed under the native cpc operon promoter. In one of these constructs, the CpcB·PHLS fusion protein accumulated to levels approaching 20% of the total cellular protein, i.e., substantially higher than expressing the PHLS protein alone under the same endogenous cpc promoter. The CpcB·PHLS fusion protein retained the activity of the PHLS enzyme and catalyzed β-phellandrene synthesis, yielding an average of 3.2 mg product g(-1) dry cell weight (dcw) versus the 0.03 mg g(-1)dcw measured with low-expressing constructs, i.e., a 100-fold yield improvement. In conclusion, the terpene synthase fusion-protein approach is promising, as, in this case, it substantially increased the amount of the PHLS in cyanobacteria, and commensurately improved rates and yield of β-phellandrene hydrocarbons production in these photosynthetic microorganisms. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  13. A Dual Repeat Cis-Element Determines Expression of GERANYL DIPHOSPHATE SYNTHASE for Monoterpene Production in Phalaenopsis Orchids

    Directory of Open Access Journals (Sweden)

    Yu-Chen Chuang

    2018-06-01

    Full Text Available Phalaenopsis bellina is a scented orchid emitting large amount of monoterpenes. GERANYL DIPHOSPHATE SYNTHASE (PbGDPS is the key enzyme for monoterpene biosynthesis, and shows concomitant expression with the emission of monoterpenes during flower development in P. bellina. Here, we identified a dual repeat cis-element in the GDPS promoter that is critical for monoterpene biosynthesis in Phalaenopsis orchids. A strong correlation between the dual repeat and the monoterpene production was revealed by examination of the GDPS promoter fragments over 12 Phalaenopsis species. Serial-deletion of the 2-kb GDPS promoter fragments demonstrated that the integrity of the dual repeat was crucial for its promoter activities. By screening the Arabidopsis transcription factors (TFs cDNA library using yeast one-hybrid assay, AtbZIP18, a member of group I of bZIP TFs, was identified to be able to bind the dual repeat. We then identified PbbZIP4 in the transcriptome of P. bellina, showing 83% identity in the DNA binding region with that of AtbZIP18, and the expression level of PbbZIP4 was higher in the scented orchids. In addition, PbbZIP4 transactivated the GDPS promoter fragment containing the dual repeat in dual luciferase assay. Furthermore, transient ectopic expression of PbbZIP4 induced a 10-fold production of monoterpenoids in the scentless orchid. In conclusion, these results indicate that the dual repeat is a real TF-bound cis-element significant for GDPS gene expression, and thus subsequent monoterpene biosynthesis in the scented Phalaenopsis orchids.

  14. Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

    DEFF Research Database (Denmark)

    Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

    2005-01-01

    The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

  15. The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Nitric oxide synthase 2 (NOS2) expression in histologically normal margins of oral squamous cell carcinoma.

    Science.gov (United States)

    Morelatto, Rosana; Itoiz, María-Elina; Guiñazú, Natalia; Piccini, Daniel; Gea, Susana; López-de Blanc, Silvia

    2014-05-01

    The activity of Nitric Oxide Synthase 2 (NOS2) was found in oral squamous cell carcinomas (OSCC) but not in normal mucosa. Molecular changes associated to early carcinogenesis have been found in mucosa near carcinomas, which is considered a model to study field cancerization. The aim of the present study is to analyze NOS2 expression at the histologically normal margins of OSCC. Eleven biopsy specimens of OSCC containing histologically normal margins (HNM) were analyzed. Ten biopsies of normal oral mucosa were used as controls. The activity of NOS2 was determined by immunohistochemistry. Salivary nitrate and nitrite as well as tobacco and alcohol consumption were also analyzed. The Chi-squared test was applied. Six out of the eleven HNM from carcinoma samples showed positive NOS2 activity whereas all the control group samples yielded negative (p=0.005). No statistically significant association between enzyme expression and tobacco and/or alcohol consumption and salivary nitrate and nitrite was found. NOS2 expression would be an additional evidence of alterations that may occur in a state of field cancerization before the appearance of potentially malignant morphological changes.

  17. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

    Science.gov (United States)

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-03-09

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  18. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

    Science.gov (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

    2015-07-28

    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  19. Effects of cavernous nerve reconstruction on expression of nitric oxide synthase isoforms in rats.

    Science.gov (United States)

    Schlenker, Boris; Matiasek, Kaspar; Saur, Dieter; Gratzke, Christian; Bauer, Ricarda M; Herouy, Yared; Arndt, Christian; Blesch, Armin; Hartung, Rudolf; Stief, Christian G; Weidner, Norbert; May, Florian

    2010-12-01

    To evaluate the expression of nitric oxide synthase (NOS) isoforms after various reconstruction techniques in rats, to improve the understanding of neuronal repair mechanisms after radical prostatectomy, as Schwann cell-seeded guidance tubes have been shown to promote cavernous nerve regeneration, and glial cell-line-derived neurotrophic factor (GDNF)-overexpressing Schwann cells enhance nerve regenerative capacity. Segments (5 mm) of the cavernous nerve were excised bilaterally, followed by immediate bilateral microsurgical reconstruction. In four rats per group, the eight nerves were reconstructed by autologous nerve grafting (A), interposition of Schwann cell-seeded silicon tubes (B), or silicon tubes seeded with GDNF-hypersecreting Schwann cells (C). Further rats were either sham-operated (D) or had nerve excision without repair (E). Erectile function was evaluated after 6 weeks by re-laparotomy, electrical nerve stimulation and morphological evaluation of reconstructed nerves. NOS isoform mRNA expression was analysed by reverse transcription-polymerase chain reaction in tissue specimens taken from the corpora cavernosa. GDNF-transduced Schwann cell grafts restored erectile function better than untransduced Schwann cell and autologous nerve grafts (88% vs 75% vs 38%; not significant). Tissue specimens in group C had the highest expression of neuronal NOS mRNA in relation to the neuronal marker PGP9.5 among all treatment groups (not significant). Compared to nerve grafts (A) and negative controls (E) nNOS/PGP9.5 expression was significantly higher (P Schwann cell grafts (P < 0.05). Restoration of erectile function is paralleled by an increase of neuronal NOS expression in rats. Further experiments will determine the physiological role of neuronal NOS in erectile nerve repair processes. © 2010 THE AUTHORS. JOURNAL COMPILATION © 2010 BJU INTERNATIONAL.

  20. The Regulation of Nitric Oxide Synthase Isoform Expression in Mouse and Human Fallopian Tubes: Potential Insights for Ectopic Pregnancy

    Directory of Open Access Journals (Sweden)

    Junting Hu

    2014-12-01

    Full Text Available Nitric oxide (NO is highly unstable and has a half-life of seconds in buffer solutions. It is synthesized by NO-synthase (NOS, which has been found to exist in the following three isoforms: neuro nitric oxide synthase (nNOS, inducible nitric oxide synthase (iNOS, and endothelial nitric oxide synthase (eNOS. NOS activity is localized in the reproductive tracts of many species, although direct evidence for NOS isoforms in the Fallopian tubes of mice is still lacking. In the present study, we investigated the expression and regulation of NOS isoforms in the mouse and human Fallopian tubes during the estrous and menstrual cycles, respectively. We also measured isoform expression in humans with ectopic pregnancy and in mice treated with lipopolysaccharide (LPS. Our results confirmed the presence of different NOS isoforms in the mouse and human Fallopian tubes during different stages of the estrous and menstrual cycles and showed that iNOS expression increased in the Fallopian tubes of women with ectopic pregnancy and in LPS-treated mice. Elevated iNOS activity might influence ovulation, cilia beats, contractility, and embryo transportation in such a manner as to increase the risk of ectopic pregnancy. This study has provided morphological and molecular evidence that NOS isoforms are present and active in the human and mouse Fallopian tubes and suggests that iNOS might play an important role in both the reproductive cycle and infection-induced ectopic pregnancies.

  1. Analysis of meniscal degeneration and meniscal gene expression

    Directory of Open Access Journals (Sweden)

    Norton James H

    2010-01-01

    Full Text Available Abstract Background Menisci play a vital role in load transmission, shock absorption and joint stability. There is increasing evidence suggesting that OA menisci may not merely be bystanders in the disease process of OA. This study sought: 1 to determine the prevalence of meniscal degeneration in OA patients, and 2 to examine gene expression in OA meniscal cells compared to normal meniscal cells. Methods Studies were approved by our human subjects Institutional Review Board. Menisci and articular cartilage were collected during joint replacement surgery for OA patients and lower limb amputation surgery for osteosarcoma patients (normal control specimens, and graded. Meniscal cells were prepared from these meniscal tissues and expanded in monolayer culture. Differential gene expression in OA meniscal cells and normal meniscal cells was examined using Affymetrix microarray and real time RT-PCR. Results The grades of meniscal degeneration correlated with the grades of articular cartilage degeneration (r = 0.672; P HLA-DPA1, integrin, beta 2 (ITGB2, ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1, ankylosis, progressive homolog (ANKH and fibroblast growth factor 7 (FGF7, were expressed at significantly higher levels in OA meniscal cells compared to normal meniscal cells. Importantly, many of the genes that have been shown to be differentially expressed in other OA cell types/tissues, including ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS5 and prostaglandin E synthase (PTGES, were found to be expressed at significantly higher levels in OA meniscal cells. This consistency suggests that many of the genes detected in our study are disease-specific. Conclusion Our findings suggest that OA is a whole joint disease. Meniscal cells may play an active role in the development of OA. Investigation of the gene expression profiles of OA meniscal cells may reveal new therapeutic targets for OA therapy and also may uncover novel

  2. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

    Science.gov (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

    2008-08-01

    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  3. Expression of the Inducible Nitric Oxide Synthase Isoform in Chorionic Villi in the Early Spontaneous Abortion

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    To investigate the relationship between inducible nitric oxide synthase (iNOS) and the early spontaneous abortion. , in situ hybridization and immunohistochemistry were used to detect the expression of iNOS in trophoblasts in the early pregnancy with and without spontaneous abortion (group Ⅰ and group Ⅱ ). By light microscopy and computer color magic image analysis system (CMIAS), light density (D) and the positive cell number per statistic square (N/S) in situ hybridization were used to analyze the positive cell index, while total positive cells (N) and the positive unit (Pu) were used in immunohistochemistry. By in situ hybridization, D and N/S in trophoblasts were 0. 35±0. 028, 0. 07±0. 011 respectively in group Ⅰ and 0. 18±0. 016,0. 015±0. 003 in group Ⅱ . In terms of immunohistochemical staining, N and Pu were 0. 058±±0. 007, 11. 94±2. 01 in group Ⅰ and 0. 013±0. 009, 1. 08±0. 35 in group Ⅱ in trophoblasts. Significant differences existed between two groups. It is concluded that the higher nitric oxide produced by the higher expression of iNOS in trophoblasts might play an important role in the early spontaneous abortion.

  4. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  5. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  6. Thymidilate synthase and p53 primary tumour expression as predictive factors for advanced colorectal cancer patients.

    Science.gov (United States)

    Paradiso, A; Simone, G; Petroni, S; Leone, B; Vallejo, C; Lacava, J; Romero, A; Machiavelli, M; De Lena, M; Allegra, C J; Johnston, P G

    2000-02-01

    The purpose of this work was to analyse the ability of p53 and thymidilate synthase (TS) primary tumour expression to retrospectively predict clinical response to chemotherapy and long-term prognosis in patients with advanced colorectal cancers homogeneously treated by methotrexate (MTX)-modulated-5-fluorouracil (5-FU-FA). A total of 108 advanced colorectal cancer patients entered the present retrospective study. Immunohistochemical p53 (pAb 1801 mAb) and TS (TS106 mAb) expression on formalin-fixed paraffin-embedded primary tumour specimens was related to probability of clinical response to chemotherapy, time to progression and overall survival. p53 was expressed in 53/108 (49%) tumours, while 54/108 (50%) showed TS immunostaining. No relationship was demonstrated between p53 positivity and clinical response to chemotherapy (objective response (OR): 20% vs 23%, in p53+ and p53- cases respectively) or overall survival. Percent of OR was significantly higher in TS-negative with respect to TS-positive tumours (30% vs 15% respectively; P < 0.04); simultaneous analysis of TS and p53 indicated 7% OR for p53-positive/TS-positive tumours vs 46% for p53-positive/TS-negative tumours (P < 0.03). Logistic regression analysis confirmed a significant association between TS tumour status and clinical response to chemotherapy (hazard ratio (HR): 2.91; 95% confidence interval (CI) 8.34-1.01; two-sided P < 0.05). A multivariate analysis of overall survival showed that only a small number of metastatic sites was statistically relevant (HR 1.89; 95% CI 2.85-1.26; two-sided P < 0.03). Our study suggests that immunohistochemical expression of p53 and TS could assist the clinician in predicting response of colorectal cancer patients to modulated MTX-5-FU therapy.

  7. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  8. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  9. Gene expression inference with deep learning.

    Science.gov (United States)

    Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui

    2016-06-15

    Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. D-GEX is available at https://github.com/uci-cbcl/D-GEX CONTACT: xhx@ics.uci.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  11. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  12. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  13. Pu-erh Tea Reduces Nitric Oxide Levels in Rats by Inhibiting Inducible Nitric Oxide Synthase Expression through Toll-Like Receptor 4

    Science.gov (United States)

    Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei

    2012-01-01

    Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686

  14. Ocean acidification modulates expression of genes and physiological performance of a marine diatom

    Science.gov (United States)

    Li, Y.; Zhuang, S.; Wu, Y.; Ren, H.; Cheng, F.; Lin, X.; Wang, K.; Beardall, J.; Gao, K.

    2015-09-01

    Ocean Acidification (OA) is known to affect various aspects of the physiological performance of diatoms, but there is little information on the underlining molecular mechanisms involved. Here, we show that in the model diatom Phaeodactylum tricornutum expression of the genes related to light harvesting, carbon acquisition and carboxylation, nitrite assimilation and ATP synthesis are modulated by OA. Growth and photosynthetic carbon fixation were enhanced by elevated CO2 (1000 μatm) under both constant indoor and fluctuating outdoor light regimes. The genetic expression of nitrite reductase (NiR) was up-regulated by OA regardless of light levels and/or regimes. The transcriptional expression of fucoxanthin chlorophyll a/c protein (lhcf type (FCP)) and mitochondrial ATP synthase (mtATP synthase) genes were also enhanced by OA, but only under high light intensity. OA treatment decreased the expression of β-carbonic anhydrase (β-CA) along with down-regulation of CO2 concentrating mechanisms (CCMs). Additionally, the genes for these proteins (NiR, FCP, mtATP synthase, β-CA) showed diel expressions either under constant indoor light or fluctuating sunlight. Thus, OA enhanced photosynthetic and growth rates by stimulating nitrogen assimilation and indirectly by down-regulating the energy-costly inorganic carbon acquisition process.

  15. Determinants of human adipose tissue gene expression

    DEFF Research Database (Denmark)

    Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José

    2012-01-01

    weight maintenance diets. For 175 genes, opposite regulation was observed during calorie restriction and weight maintenance phases, independently of variations in body weight. Metabolism and immunity genes showed inverse profiles. During the dietary intervention, network-based analyses revealed strong...... interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index...... on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently...

  16. Deriving Trading Rules Using Gene Expression Programming

    Directory of Open Access Journals (Sweden)

    Adrian VISOIU

    2011-01-01

    Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.

  17. Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don.

    Science.gov (United States)

    Xiao, Zheng; Sun, Xiaobo; Liu, Xiaoqing; Li, Chang; He, Lisi; Chen, Shangping; Su, Jiale

    2016-01-01

    The quantitative real-time polymerase chain reaction (qRT-PCR) approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder, and BestKeeper. The results showed that EF1- α (elongation factor 1-alpha), 18S (18s ribosomal RNA), and RPL3 (ribosomal protein L3) were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin ( TUB ) was the least stable. ACT5 (actin), RPL3 , 18S , and EF1- α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle . Furthermore, the expression profiles of RmPSY (phytoene synthase) and RmPDS (phytoene dehydrogenase) were assessed using EF1- α, 18S , ACT5 , RPL3 , and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle .

  18. Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don

    Directory of Open Access Journals (Sweden)

    Zheng Xiao

    2016-10-01

    Full Text Available The quantitative real-time polymerase chain reaction (qRT-PCR approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder and BestKeeper. The results showed that EF1-α (elongation factor 1-alpha, 18S (18s ribosomal RNA and RPL3 (ribosomal protein L3 were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin (TUB was the least stable. ACT5 (actin, RPL3, 18S and EF1-α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle. Furthermore, the expression profiles of RmPSY (phytoene synthase and RmPDS (phytoene dehydrogenase were assessed using EF1-α, 18S, ACT5, and RPL3 and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle.

  19. Polycistronic gene expression in Aspergillus niger.

    Science.gov (United States)

    Schuetze, Tabea; Meyer, Vera

    2017-09-25

    Genome mining approaches predict dozens of biosynthetic gene clusters in each of the filamentous fungal genomes sequenced so far. However, the majority of these gene clusters still remain cryptic because they are not expressed in their natural host. Simultaneous expression of all genes belonging to a biosynthetic pathway in a heterologous host is one approach to activate biosynthetic gene clusters and to screen the metabolites produced for bioactivities. Polycistronic expression of all pathway genes under control of a single and tunable promoter would be the method of choice, as this does not only simplify cloning procedures, but also offers control on timing and strength of expression. However, polycistronic gene expression is a feature not commonly found in eukaryotic host systems, such as Aspergillus niger. In this study, we tested the suitability of the viral P2A peptide for co-expression of three genes in A. niger. Two genes descend from Fusarium oxysporum and are essential to produce the secondary metabolite enniatin (esyn1, ekivR). The third gene (luc) encodes the reporter luciferase which was included to study position effects. Expression of the polycistronic gene cassette was put under control of the Tet-On system to ensure tunable gene expression in A. niger. In total, three polycistronic expression cassettes which differed in the position of luc were constructed and targeted to the pyrG locus in A. niger. This allowed direct comparison of the luciferase activity based on the position of the luciferase gene. Doxycycline-mediated induction of the Tet-On expression cassettes resulted in the production of one long polycistronic mRNA as proven by Northern analyses, and ensured comparable production of enniatin in all three strains. Notably, gene position within the polycistronic expression cassette matters, as, luciferase activity was lowest at position one and had a comparable activity at positions two and three. The P2A peptide can be used to express at

  20. Profiling Gene Expression in Germinating Brassica Roots.

    Science.gov (United States)

    Park, Myoung Ryoul; Wang, Yi-Hong; Hasenstein, Karl H

    2014-01-01

    Based on previously developed solid-phase gene extraction (SPGE) we examined the mRNA profile in primary roots of Brassica rapa seedlings for highly expressed genes like ACT7 (actin7), TUB (tubulin1), UBQ (ubiquitin), and low expressed GLK (glucokinase) during the first day post-germination. The assessment was based on the mRNA load of the SPGE probe of about 2.1 ng. The number of copies of the investigated genes changed spatially along the length of primary roots. The expression level of all genes differed significantly at each sample position. Among the examined genes ACT7 expression was most even along the root. UBQ was highest at the tip and root-shoot junction (RS). TUB and GLK showed a basipetal gradient. The temporal expression of UBQ was highest in the MZ 9 h after primary root emergence and higher than at any other sample position. Expressions of GLK in EZ and RS increased gradually over time. SPGE extraction is the result of oligo-dT and oligo-dA hybridization and the results illustrate that SPGE can be used for gene expression profiling at high spatial and temporal resolution. SPGE needles can be used within two weeks when stored at 4 °C. Our data indicate that gene expression studies that are based on the entire root miss important differences in gene expression that SPGE is able to resolve for example growth adjustments during gravitropism.

  1. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

    Science.gov (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

    2015-05-01

    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  3. Cloning and functional expression of the small subunit of acetolactate synthase from Nicotiana plumbaginifolia.

    Science.gov (United States)

    Hershey, H P; Schwartz, L J; Gale, J P; Abell, L M

    1999-07-01

    Acetolactate synthase (ALS) is the first committed step of branched-chain amino acid biosynthesis in plants and bacteria. The bacterial holoenzyme has been well characterized and is a tetramer of two identical large subunits (LSUs) of 60 kDa and two identical small subunits (SSUs) ranging in molecular mass from 9 to 17 kDa depending on the isozyme. The enzyme from plants is much less well characterized. Attempts to purify the protein have yielded an enzyme which appears to be an oligomer of LSUs, with the potential existence of a SSU for the plant enzyme remaining a matter of considerable speculation. We report here the discovery of a cDNA clone that encodes a SSU of plant ALS based upon the homology of the encoded peptide with various bacterial ALS SSUs. The plant ALS SSU is more than twice as large as any of its prokaryotic homologues and contains two domains that each encode a full-length copy of the prokaryotic SSU polypeptide. The cDNA clone was used to express Nicotiana plumbaginifolia SSU in Escherichia coli. Mixing a partially purified preparation of this SSU with the LSU of ALS from either N. plumbaginifolia or Arabidopsis thaliana results in both increased specific activity and increased stability of the enzymic activity. These results are consistent with those observed for the bacterial enzyme in similar experiments and represent the first functional demonstration of the existence of a SSU for plant ALS.

  4. Chromatin loops, gene positioning, and gene expression

    NARCIS (Netherlands)

    Holwerda, S.; de Laat, W.

    2012-01-01

    Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

  5. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  6. Serial analysis of gene expression (SAGE)

    NARCIS (Netherlands)

    van Ruissen, Fred; Baas, Frank

    2007-01-01

    In 1995, serial analysis of gene expression (SAGE) was developed as a versatile tool for gene expression studies. SAGE technology does not require pre-existing knowledge of the genome that is being examined and therefore SAGE can be applied to many different model systems. In this chapter, the SAGE

  7. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  8. POLYMORPHISMS OF ENDOTHELIAL NITRIC OXIDE SYNTHASE GENE AS PREDICTORS OF WOLFF-PARKINSON-WHITE SYNDROME

    Directory of Open Access Journals (Sweden)

    G. V. Matyushin

    2017-01-01

    Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

  9. Distinct Cell-Specific Expression of Homospermidine Synthase Involved in Pyrrolizidine Alkaloid Biosynthesis in Three Species of the Boraginales1[C][W][OA

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-01-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant’s chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature. PMID:22566491

  10. Expression of Sox genes in tooth development.

    Science.gov (United States)

    Kawasaki, Katsushige; Kawasaki, Maiko; Watanabe, Momoko; Idrus, Erik; Nagai, Takahiro; Oommen, Shelly; Maeda, Takeyasu; Hagiwara, Nobuko; Que, Jianwen; Sharpe, Paul T; Ohazama, Atsushi

    2015-01-01

    Members of the Sox gene family play roles in many biological processes including organogenesis. We carried out comparative in situ hybridization analysis of seventeen sox genes (Sox1-14, 17, 18, 21) during murine odontogenesis from the epithelial thickening to the cytodifferentiation stages. Localized expression of five Sox genes (Sox6, 9, 13, 14 and 21) was observed in tooth bud epithelium. Sox13 showed restricted expression in the primary enamel knots. At the early bell stage, three Sox genes (Sox8, 11, 17 and 21) were expressed in pre-ameloblasts, whereas two others (Sox5 and 18) showed expression in odontoblasts. Sox genes thus showed a dynamic spatio-temporal expression during tooth development.

  11. Positron emission tomography imaging of gene expression

    International Nuclear Information System (INIS)

    Tang Ganghua

    2001-01-01

    The merging of molecular biology and nuclear medicine is developed into molecular nuclear medicine. Positron emission tomography (PET) of gene expression in molecular nuclear medicine has become an attractive area. Positron emission tomography imaging gene expression includes the antisense PET imaging and the reporter gene PET imaging. It is likely that the antisense PET imaging will lag behind the reporter gene PET imaging because of the numerous issues that have not yet to be resolved with this approach. The reporter gene PET imaging has wide application into animal experimental research and human applications of this approach will likely be reported soon

  12. Lipoplex gene transfer of inducible nitric oxide synthase inhibits the reactive intimal hyperplasia after expanded polytetrafluoroethylene bypass grafting.

    Science.gov (United States)

    Pfeiffer, Tomas; Wallich, Martina; Sandmann, Wilhelm; Schrader, Jürgen; Gödecke, Axel

    2006-05-01

    Intimal hyperplasia (IH) is most commonly the cause of graft occlusion in infrainguinal bypass grafting for arterial occlusive disease. We investigated the influence of nitric oxide on the IH of the arterial vessel wall at the region of prosthetic bypass anastomoses. Experiments were performed in 10 Foxhound dogs. We used a technique of inducible nitric oxide synthase (iNOS) overexpression by a non-virus-mediated, liposome-based iNOS gene transfer. The plasmid pSCMV-iNOS, which drives the expression of iNOS under control of the cytomegalovirus promoter, was complexed with cationic liposomes (lipoplexes). Segments of both carotid arteries were pretreated by intramural injection of a lipoplex solution by using an infiltrator balloon catheter (Infiltrator Drug Delivery Balloon System). In each dog, iNOS was administered at one side, and a control vector (pSCMV2) was administered at the contralateral side. Carotid arteries were ligated, and bypass grafts (expanded polytetrafluoroethylene, 6-mm, ring enforced) were implanted on both sides. The proximal and distal anastomoses (end-to-side fashion; running nonabsorbable sutures) were placed in the pretreated regions. After 6 months, the prostheses were excised, and the intimal thicknesses of 50 cross sections (orcein staining) of each anastomosis were measured planimetrically. The average reduction of the neointima thickness of the iNOS side in proximal anastomoses at the prosthetic wall, suture region, and arterial wall was 43%, 52%, and 81%, respectively. In distal anastomoses, the average reduction was 40%, 47%, and 52%, respectively. All differences of neointima thickness between the iNOS and control sides were statistically significant (Wilcoxon test; P < or = .05). Inducible NOS expression is an efficient approach for inhibition of IH. In contrast to earlier studies, which investigated the efficacy of gene therapeutic NOS expression at 3 to 4 weeks after intervention, the novelty of our findings is that a single

  13. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    . This may reflect that many PKs are either produced in small amounts, under special conditions or in developmental stages that are rarely observed under laboratory conditions. In order to trigger expression of “silent” genes we are currently pursuing several approaches; i) stimulation of A. nidulans wild...

  14. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  15. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  16. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    Science.gov (United States)

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  18. Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

    Science.gov (United States)

    Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

    2016-11-01

    Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  19. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  20. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  1. The clinical significance of thymidylate synthase expression in human papillomavirus-related oropharyngeal squamous carcinoma

    International Nuclear Information System (INIS)

    Kato, Hisayuki; Yui, Takehiro; Okada, Tatsuyoshi; Urano, Makoto; Sakurai, Kazuo; Naito, Kensei; Yamamoto, Naoki

    2012-01-01

    The focus of human papilloma virus (HPV), particulary HPV 16 is on the role of carcinogenic and prognostic factors on oropharyngeal squamous carcinoma (OSCC). However, it remains unclear why patients with HPV-positive tumors have better outcomes than those with HPV-negative tumors. Thymidylate synthase (TS) is one of the initial key enzymes in the 5-fluouracil (5-FU) metabolic pathway. Clinical studies showed that intratumoural TS level was related to the response to 5-FU-based chemotherapy in patients with several types of cancer such as gastroenterological and head and neck cancers. We investigated the prevalence of HPV infection and TS expression in the patients with OSCC and evaluated the prognostic implications according to the HPV status and TS expression. We evaluated for high-risk HPV types (HPV 16, 18, 31, 33, 51, 52, 58) using a real-time polymerase chain reaction (RT-PCR) assay on archival biopsies from 54 patients with OSCC. Immunohistochemical assessments for TS were also performed. HPV was positive in 22 (40.7%) of 54 samples. Of these positive cases, 21 (95%) carried HPV 16 and only 1 (5%) HPV58 sequences. TS was overexpressed in 25 (46.3%) of 54 samples. Of these, 19 (76.0%) had an HPV-negative status and 21 (84.0%) were heavy smokers. TS overexpression was associated with the patients with HPV-negative tumors (P=0.02) and heavy smokers (p=0.012). Univariate analysis revealed that HPV positive status (77.3% vs. 29.0%; p=0.006) significantly improved overall survival. Conversely, no remarkable prognostic difference was observed on immunohistochemical analysis of TS expression. A multivariate analysis using Cox's proportional hazard model showed that early T stage (T1-2), early N stage (N0-1), and positive HPV status were significantly independent predictors for superior overall survival. Our studies suggested that positive HPV status was most strongly associated with a favorable prognosis in the patients with OSCC. TS expression has an unusual aspect

  2. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

  3. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  4. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  5. rpb2 is a reliable reference gene for quantitative gene expression analysis in the dermatophyte Trichophyton rubrum.

    Science.gov (United States)

    Jacob, Tiago R; Peres, Nalu T A; Persinoti, Gabriela F; Silva, Larissa G; Mazucato, Mendelson; Rossi, Antonio; Martinez-Rossi, Nilce M

    2012-05-01

    The selection of reference genes used for data normalization to quantify gene expression by real-time PCR amplifications (qRT-PCR) is crucial for the accuracy of this technique. In spite of this, little information regarding such genes for qRT-PCR is available for gene expression analyses in pathogenic fungi. Thus, we investigated the suitability of eight candidate reference genes in isolates of the human dermatophyte Trichophyton rubrum subjected to several environmental challenges, such as drug exposure, interaction with human nail and skin, and heat stress. The stability of these genes was determined by geNorm, NormFinder and Best-Keeper programs. The gene with the most stable expression in the majority of the conditions tested was rpb2 (DNA-dependent RNA polymerase II), which was validated in three T. rubrum strains. Moreover, the combination of rpb2 and chs1 (chitin synthase) genes provided for the most reliable qRT-PCR data normalization in T. rubrum under a broad range of biological conditions. To the best of our knowledge this is the first report on the selection of reference genes for qRT-PCR data normalization in dermatophytes and the results of these studies should permit further analysis of gene expression under several experimental conditions, with improved accuracy and reliability.

  6. The functional landscape of mouse gene expression

    Directory of Open Access Journals (Sweden)

    Zhang Wen

    2004-12-01

    Full Text Available Abstract Background Large-scale quantitative analysis of transcriptional co-expression has been used to dissect regulatory networks and to predict the functions of new genes discovered by genome sequencing in model organisms such as yeast. Although the idea that tissue-specific expression is indicative of gene function in mammals is widely accepted, it has not been objectively tested nor compared with the related but distinct strategy of correlating gene co-expression as a means to predict gene function. Results We generated microarray expression data for nearly 40,000 known and predicted mRNAs in 55 mouse tissues, using custom-built oligonucleotide arrays. We show that quantitative transcriptional co-expression is a powerful predictor of gene function. Hundreds of functional categories, as defined by Gene Ontology 'Biological Processes', are associated with characteristic expression patterns across all tissues, including categories that bear no overt relationship to the tissue of origin. In contrast, simple tissue-specific restriction of expression is a poor predictor of which genes are in which functional categories. As an example, the highly conserved mouse gene PWP1 is widely expressed across different tissues but is co-expressed with many RNA-processing genes; we show that the uncharacterized yeast homolog of PWP1 is required for rRNA biogenesis. Conclusions We conclude that 'functional genomics' strategies based on quantitative transcriptional co-expression will be as fruitful in mammals as they have been in simpler organisms, and that transcriptional control of mammalian physiology is more modular than is generally appreciated. Our data and analyses provide a public resource for mammalian functional genomics.

  7. Ethylene-Related Gene Expression Networks in Wood Formation

    Directory of Open Access Journals (Sweden)

    Carolin Seyfferth

    2018-03-01

    Full Text Available Thickening of tree stems is the result of secondary growth, accomplished by the meristematic activity of the vascular cambium. Secondary growth of the stem entails developmental cascades resulting in the formation of secondary phloem outwards and secondary xylem (i.e., wood inwards of the stem. Signaling and transcriptional reprogramming by the phytohormone ethylene modifies cambial growth and cell differentiation, but the molecular link between ethylene and secondary growth remains unknown. We addressed this shortcoming by analyzing expression profiles and co-expression networks of ethylene pathway genes using the AspWood transcriptome database which covers all stages of secondary growth in aspen (Populus tremula stems. ACC synthase expression suggests that the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC is synthesized during xylem expansion and xylem cell maturation. Ethylene-mediated transcriptional reprogramming occurs during all stages of secondary growth, as deduced from AspWood expression profiles of ethylene-responsive genes. A network centrality analysis of the AspWood dataset identified EIN3D and 11 ERFs as hubs. No overlap was found between the co-expressed genes of the EIN3 and ERF hubs, suggesting target diversification and hence independent roles for these transcription factor families during normal wood formation. The EIN3D hub was part of a large co-expression gene module, which contained 16 transcription factors, among them several new candidates that have not been earlier connected to wood formation and a VND-INTERACTING 2 (VNI2 homolog. We experimentally demonstrated Populus EIN3D function in ethylene signaling in Arabidopsis thaliana. The ERF hubs ERF118 and ERF119 were connected on the basis of their expression pattern and gene co-expression module composition to xylem cell expansion and secondary cell wall formation, respectively. We hereby establish data resources for ethylene-responsive genes and

  8. Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

    Science.gov (United States)

    Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

    2017-07-01

    The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  10. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  11. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  12. Early pregnancy peripheral blood gene expression and risk of preterm delivery: a nested case control study

    Directory of Open Access Journals (Sweden)

    Muhie Seid Y

    2009-12-01

    Full Text Available Abstract Background Preterm delivery (PTD is a significant public health problem associated with greater risk of mortality and morbidity in infants and mothers. Pathophysiologic processes that may lead to PTD start early in pregnancy. We investigated early pregnancy peripheral blood global gene expression and PTD risk. Methods As part of a prospective study, ribonucleic acid was extracted from blood samples (collected at 16 weeks gestational age from 14 women who had PTD (cases and 16 women who delivered at term (controls. Gene expressions were measured using the GeneChip® Human Genome U133 Plus 2.0 Array. Student's T-test and fold change analysis were used to identify differentially expressed genes. We used hierarchical clustering and principle components analysis to characterize signature gene expression patterns among cases and controls. Pathway and promoter sequence analyses were used to investigate functions and functional relationships as well as regulatory regions of differentially expressed genes. Results A total of 209 genes, including potential candidate genes (e.g. PTGDS, prostaglandin D2 synthase 21 kDa, were differentially expressed. A set of these genes achieved accurate pre-diagnostic separation of cases and controls. These genes participate in functions related to immune system and inflammation, organ development, metabolism (lipid, carbohydrate and amino acid and cell signaling. Binding sites of putative transcription factors such as EGR1 (early growth response 1, TFAP2A (transcription factor AP2A, Sp1 (specificity protein 1 and Sp3 (specificity protein 3 were over represented in promoter regions of differentially expressed genes. Real-time PCR confirmed microarray expression measurements of selected genes. Conclusions PTD is associated with maternal early pregnancy peripheral blood gene expression changes. Maternal early pregnancy peripheral blood gene expression patterns may be useful for better understanding of PTD

  13. A comparative gene expression database for invertebrates

    Directory of Open Access Journals (Sweden)

    Ormestad Mattias

    2011-08-01

    Full Text Available Abstract Background As whole genome and transcriptome sequencing gets cheaper and faster, a great number of 'exotic' animal models are emerging, rapidly adding valuable data to the ever-expanding Evo-Devo field. All these new organisms serve as a fantastic resource for the research community, but the sheer amount of data, some published, some not, makes detailed comparison of gene expression patterns very difficult to summarize - a problem sometimes even noticeable within a single lab. The need to merge existing data with new information in an organized manner that is publicly available to the research community is now more necessary than ever. Description In order to offer a homogenous way of storing and handling gene expression patterns from a variety of organisms, we have developed the first web-based comparative gene expression database for invertebrates that allows species-specific as well as cross-species gene expression comparisons. The database can be queried by gene name, developmental stage and/or expression domains. Conclusions This database provides a unique tool for the Evo-Devo research community that allows the retrieval, analysis and comparison of gene expression patterns within or among species. In addition, this database enables a quick identification of putative syn-expression groups that can be used to initiate, among other things, gene regulatory network (GRN projects.

  14. Adaptive Evolution of Gene Expression in Drosophila.

    Science.gov (United States)

    Nourmohammad, Armita; Rambeau, Joachim; Held, Torsten; Kovacova, Viera; Berg, Johannes; Lässig, Michael

    2017-08-08

    Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Identification of GIG1, a GlcNAc-induced gene in Candida albicans needed for normal sensitivity to the chitin synthase inhibitor nikkomycin Z.

    Science.gov (United States)

    Gunasekera, Angelo; Alvarez, Francisco J; Douglas, Lois M; Wang, Hong X; Rosebrock, Adam P; Konopka, James B

    2010-10-01

    The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism.

  16. Identification of GIG1, a GlcNAc-Induced Gene in Candida albicans Needed for Normal Sensitivity to the Chitin Synthase Inhibitor Nikkomycin Z▿§

    Science.gov (United States)

    Gunasekera, Angelo; Alvarez, Francisco J.; Douglas, Lois M.; Wang, Hong X.; Rosebrock, Adam P.; Konopka, James B.

    2010-01-01

    The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism. PMID:20675577

  17. Differential gene expression during Trypanosoma cruzi metacyclogenesis

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Krieger

    1999-09-01

    Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

  18. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR

    DEFF Research Database (Denmark)

    Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Cirera, Susanna

    2007-01-01

    -microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase I (HPRT I), ribosomal protein L4 (RPL4), succinate dehydrogenase complex subunit A (SDHA), TATA box binding protein (TPB) and tyrosine 3-monooxygenase/tryptophan 5......-monooxygenase activation protein zeta polypeptide (YWHAZ). The stability of these reference genes in different pig tissues was investigated using the geNorm application. The range of expression stability in the genes analysed was (from the most stable to the least stable): ACTB/RPL4, TBP, HPRT, HMBS, YWHAZ...

  19. Stochastic gene expression in Arabidopsis thaliana.

    Science.gov (United States)

    Araújo, Ilka Schultheiß; Pietsch, Jessica Magdalena; Keizer, Emma Mathilde; Greese, Bettina; Balkunde, Rachappa; Fleck, Christian; Hülskamp, Martin

    2017-12-14

    Although plant development is highly reproducible, some stochasticity exists. This developmental stochasticity may be caused by noisy gene expression. Here we analyze the fluctuation of protein expression in Arabidopsis thaliana. Using the photoconvertible KikGR marker, we show that the protein expressions of individual cells fluctuate over time. A dual reporter system was used to study extrinsic and intrinsic noise of marker gene expression. We report that extrinsic noise is higher than intrinsic noise and that extrinsic noise in stomata is clearly lower in comparison to several other tissues/cell types. Finally, we show that cells are coupled with respect to stochastic protein expression in young leaves, hypocotyls and roots but not in mature leaves. Our data indicate that stochasticity of gene expression can vary between tissues/cell types and that it can be coupled in a non-cell-autonomous manner.

  20. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  1. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

    Directory of Open Access Journals (Sweden)

    Ravid Rivka

    2008-05-01

    Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.

  2. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  3. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  4. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

    Science.gov (United States)

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-09-06

    Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

  5. Different patterns of gene expression in rice varieties undergoing a ...

    African Journals Online (AJOL)

    Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

  6. Cloning, expression, and characterization of recombinant nitric oxide synthase-like protein from Bacillus anthracis

    International Nuclear Information System (INIS)

    Midha, Shuchi; Mishra, Rajeev; Aziz, M.A.; Sharma, Meenakshi; Mishra, Ashish; Khandelwal, Puneet; Bhatnagar, Rakesh

    2005-01-01

    Nitric oxide synthase (NOS) is amongst a family of evolutionarily conserved enzymes, involved in a multi-turnover process that results in NO as a product. The significant role of NO in various pathological and physiological processes has created an interest in this enzyme from several perspectives. This study describes for the first time, cloning and expression of a NOS-like protein, baNOS, from Bacillus anthracis, a pathogenic bacterium responsible for causing anthrax. baNOS was expressed in Escherichia coli as a soluble and catalytically active enzyme. Homology models generated for baNOS indicated that the key structural features that are involved in the substrate and active site interaction have been highly conserved. Further, the behavior of baNOS in terms of heme-substrate interactions and heme-transitions was studied in detail. The optical perturbation spectra of the heme domain demonstrated that the ligands perturb the heme site in a ligand specific manner. baNOS forms a five-coordinate, high-spin complex with L-arginine analogs and a six-coordinate low-spin complex with inhibitor imidazole. Studies indicated that the binding of L-arginine, N ω -hydroxy-L-arginine, and imidazole produces various spectroscopic species that closely correspond to the equivalent complexes of mammalian NOS. The values of spectral binding constants further corroborated these results. The overall conservation of the key structural features and the correlation of heme-substrate interactions in baNOS and mammalian NOS, thus, point towards an interesting phenomenon of convergent evolution. Importantly, the NO generated by NOS of mammalian macrophages plays a potent role in antimicrobicidal activity. Because of the existence of high structural and behavioral similarity between mammalian NOS and baNOS, we propose that NO produced by B. anthracis may also have a pivotal pathophysiological role in anthrax infection. Therefore, this first report of characterization of a NOS-like protein

  7. Widespread ectopic expression of olfactory receptor genes

    Directory of Open Access Journals (Sweden)

    Yanai Itai

    2006-05-01

    Full Text Available Abstract Background Olfactory receptors (ORs are the largest gene family in the human genome. Although they are expected to be expressed specifically in olfactory tissues, some ectopic expression has been reported, with special emphasis on sperm and testis. The present study systematically explores the expression patterns of OR genes in a large number of tissues and assesses the potential functional implication of such ectopic expression. Results We analyzed the expression of hundreds of human and mouse OR transcripts, via EST and microarray data, in several dozens of human and mouse tissues. Different tissues had specific, relatively small OR gene subsets which had particularly high expression levels. In testis, average expression was not particularly high, and very few highly expressed genes were found, none corresponding to ORs previously implicated in sperm chemotaxis. Higher expression levels were more common for genes with a non-OR genomic neighbor. Importantly, no correlation in expression levels was detected for human-mouse orthologous pairs. Also, no significant difference in expression levels was seen between intact and pseudogenized ORs, except for the pseudogenes of subfamily 7E which has undergone a human-specific expansion. Conclusion The OR superfamily as a whole, show widespread, locus-dependent and heterogeneous expression, in agreement with a neutral or near neutral evolutionary model for transcription control. These results cannot reject the possibility that small OR subsets might play functional roles in different tissues, however considerable care should be exerted when offering a functional interpretation for ectopic OR expression based only on transcription information.

  8. Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

    International Nuclear Information System (INIS)

    Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

    2004-01-01

    The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure

  9. Regulation of Gene Expression in Protozoa Parasites

    Directory of Open Access Journals (Sweden)

    Consuelo Gomez

    2010-01-01

    Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  10. Regulation of gene expression in protozoa parasites.

    Science.gov (United States)

    Gomez, Consuelo; Esther Ramirez, M; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  11. Inferring gene networks from discrete expression data

    KAUST Repository

    Zhang, L.; Mallick, B. K.

    2013-01-01

    graphical models applied to continuous data, which give a closedformmarginal likelihood. In this paper,we extend network modeling to discrete data, specifically data from serial analysis of gene expression, and RNA-sequencing experiments, both of which

  12. Gene Expression and Microarray Investigation of Dendrobium ...

    African Journals Online (AJOL)

    blood glucose > 16.7 mmol/L were used as the model group and treated with Dendrobium mixture. (DEN ... Keywords: Diabetes, Gene expression, Dendrobium mixture, Microarray testing ..... homeostasis in airway smooth muscle. Am J.

  13. Identification of genes showing differential expression profile ...

    Indian Academy of Sciences (India)

    3Department of Natural Sciences, International Christian University, Mitaka, Tokyo 181-8585, Japan ... the changes of expression predicted from gene function suggested association ... ate School of Science and Technology, Niigata University.

  14. Drosophila melanogaster gene expression changes after spaceflight.

    Data.gov (United States)

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  15. Exertional Heat Illness and Human Gene Expression

    National Research Council Canada - National Science Library

    Sonna, L.A; Sawka, M. N; Lilly, C. M

    2007-01-01

    Microarray analysis of gene expression at the level of RNA has generated new insights into the relationship between cellular responses to acute heat shock in vitro, exercise, and exertional heat illness...

  16. Expression Profiling of Tyrosine Kinase Genes

    National Research Council Canada - National Science Library

    Weier, Heinz

    2000-01-01

    ... of these genes parallels the progression of tumors to a more malignant phenotype. We developed a DNA micro-array based screening system to monitor the level of expression of tyrosine kinase (tk...

  17. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  18. Identification of genes preferentially expressed during

    African Journals Online (AJOL)

    雨林木风

    2012-08-16

    Aug 16, 2012 ... The suppression subtractive hybridization (SSH) method conducted to generate ... which showed the lack of genomic information currently available for lily. ..... characterization of genes expressed during somatic embryo.

  19. Mining gene expression data of multiple sclerosis.

    Directory of Open Access Journals (Sweden)

    Pi Guo

    Full Text Available Microarray produces a large amount of gene expression data, containing various biological implications. The challenge is to detect a panel of discriminative genes associated with disease. This study proposed a robust classification model for gene selection using gene expression data, and performed an analysis to identify disease-related genes using multiple sclerosis as an example.Gene expression profiles based on the transcriptome of peripheral blood mononuclear cells from a total of 44 samples from 26 multiple sclerosis patients and 18 individuals with other neurological diseases (control were analyzed. Feature selection algorithms including Support Vector Machine based on Recursive Feature Elimination, Receiver Operating Characteristic Curve, and Boruta algorithms were jointly performed to select candidate genes associating with multiple sclerosis. Multiple classification models categorized samples into two different groups based on the identified genes. Models' performance was evaluated using cross-validation methods, and an optimal classifier for gene selection was determined.An overlapping feature set was identified consisting of 8 genes that were differentially expressed between the two phenotype groups. The genes were significantly associated with the pathways of apoptosis and cytokine-cytokine receptor interaction. TNFSF10 was significantly associated with multiple sclerosis. A Support Vector Machine model was established based on the featured genes and gave a practical accuracy of ∼86%. This binary classification model also outperformed the other models in terms of Sensitivity, Specificity and F1 score.The combined analytical framework integrating feature ranking algorithms and Support Vector Machine model could be used for selecting genes for other diseases.

  20. Expression analysis of NOS family and HSP genes during thermal stress in goat ( Capra hircus)

    Science.gov (United States)

    Yadav, Vijay Pratap; Dangi, Satyaveer Singh; Chouhan, Vikrant Singh; Gupta, Mahesh; Dangi, Saroj K.; Singh, Gyanendra; Maurya, Vijay Prakash; Kumar, Puneet; Sarkar, Mihir

    2016-03-01

    Approximately 50 genes other than heat shock protein (HSP) expression changes during thermal stress. These genes like nitric oxide synthase (NOS) need proper attention and investigation to find out their possible role in the adaptation to thermal stress in animals. So, the present study was undertaken to demonstrate the expressions of inducible form type II NOS (iNOS), endothelial type III NOS (eNOS), constitutively expressed enzyme NOS (cNOS), HSP70, and HSP90 in peripheral blood mononuclear cells (PBMCs) during different seasons in Barbari goats. Real-time polymerase chain reaction, western blot, and immunocytochemistry were applied to investigate messenger RNA (mRNA) expression, protein expression, and immunolocalization of examined factors. The mRNA and protein expressions of iNOS, eNOS, cNOS, HSP70, and HSP90 were significantly higher ( P goats.

  1. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  2. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  3. Evaluation of suitable reference genes for gene expression studies ...

    Indian Academy of Sciences (India)

    2011-12-14

    Dec 14, 2011 ... MADS family of TFs control floral organ identity within each whorl of the flower by activating downstream genes. Measuring gene expression in different tissue types and developmental stages is of fundamental importance in TFs functional research. In last few years, quantitative real-time. PCR (qRT-PCR) ...

  4. PRAME gene expression profile in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Tânia Maria Vulcani-Freitas

    2011-02-01

    Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

  5. Comparative gene expression between two yeast species

    Directory of Open Access Journals (Sweden)

    Guan Yuanfang

    2013-01-01

    Full Text Available Abstract Background Comparative genomics brings insight into sequence evolution, but even more may be learned by coupling sequence analyses with experimental tests of gene function and regulation. However, the reliability of such comparisons is often limited by biased sampling of expression conditions and incomplete knowledge of gene functions across species. To address these challenges, we previously systematically generated expression profiles in Saccharomyces bayanus to maximize functional coverage as compared to an existing Saccharomyces cerevisiae data repository. Results In this paper, we take advantage of these two data repositories to compare patterns of ortholog expression in a wide variety of conditions. First, we developed a scalable metric for expression divergence that enabled us to detect a significant correlation between sequence and expression conservation on the global level, which previous smaller-scale expression studies failed to detect. Despite this global conservation trend, between-species gene expression neighborhoods were less well-conserved than within-species comparisons across different environmental perturbations, and approximately 4% of orthologs exhibited a significant change in co-expression partners. Furthermore, our analysis of matched perturbations collected in both species (such as diauxic shift and cell cycle synchrony demonstrated that approximately a quarter of orthologs exhibit condition-specific expression pattern differences. Conclusions Taken together, these analyses provide a global view of gene expression patterns between two species, both in terms of the conditions and timing of a gene's expression as well as co-expression partners. Our results provide testable hypotheses that will direct future experiments to determine how these changes may be specified in the genome.

  6. Expression of glycogen synthase and phosphofructokinase in muscle from type 1 (insulin-dependent) diabetic patients before and after intensive insulin treatment

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...

  7. Inferring gene networks from discrete expression data

    KAUST Repository

    Zhang, L.

    2013-07-18

    The modeling of gene networks from transcriptional expression data is an important tool in biomedical research to reveal signaling pathways and to identify treatment targets. Current gene network modeling is primarily based on the use of Gaussian graphical models applied to continuous data, which give a closedformmarginal likelihood. In this paper,we extend network modeling to discrete data, specifically data from serial analysis of gene expression, and RNA-sequencing experiments, both of which generate counts of mRNAtranscripts in cell samples.We propose a generalized linear model to fit the discrete gene expression data and assume that the log ratios of the mean expression levels follow a Gaussian distribution.We restrict the gene network structures to decomposable graphs and derive the graphs by selecting the covariance matrix of the Gaussian distribution with the hyper-inverse Wishart priors. Furthermore, we incorporate prior network models based on gene ontology information, which avails existing biological information on the genes of interest. We conduct simulation studies to examine the performance of our discrete graphical model and apply the method to two real datasets for gene network inference. © The Author 2013. Published by Oxford University Press. All rights reserved.

  8. Gene expression profiling in autoimmune diseases

    DEFF Research Database (Denmark)

    Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo

    2007-01-01

    A central issue in autoimmune disease is whether the underlying inflammation is a repeated stereotypical process or whether disease specific gene expression is involved. To shed light on this, we analysed whether genes previously found to be differentially regulated in rheumatoid arthritis (RA...

  9. Bayesian assignment of gene ontology terms to gene expression experiments.

    Science.gov (United States)

    Sykacek, P

    2012-09-15

    Gene expression assays allow for genome scale analyses of molecular biological mechanisms. State-of-the-art data analysis provides lists of involved genes, either by calculating significance levels of mRNA abundance or by Bayesian assessments of gene activity. A common problem of such approaches is the difficulty of interpreting the biological implication of the resulting gene lists. This lead to an increased interest in methods for inferring high-level biological information. A common approach for representing high level information is by inferring gene ontology (GO) terms which may be attributed to the expression data experiment. This article proposes a probabilistic model for GO term inference. Modelling assumes that gene annotations to GO terms are available and gene involvement in an experiment is represented by a posterior probabilities over gene-specific indicator variables. Such probability measures result from many Bayesian approaches for expression data analysis. The proposed model combines these indicator probabilities in a probabilistic fashion and provides a probabilistic GO term assignment as a result. Experiments on synthetic and microarray data suggest that advantages of the proposed probabilistic GO term inference over statistical test-based approaches are in particular evident for sparsely annotated GO terms and in situations of large uncertainty about gene activity. Provided that appropriate annotations exist, the proposed approach is easily applied to inferring other high level assignments like pathways. Source code under GPL license is available from the author. peter.sykacek@boku.ac.at.

  10. Bayesian assignment of gene ontology terms to gene expression experiments

    Science.gov (United States)

    Sykacek, P.

    2012-01-01

    Motivation: Gene expression assays allow for genome scale analyses of molecular biological mechanisms. State-of-the-art data analysis provides lists of involved genes, either by calculating significance levels of mRNA abundance or by Bayesian assessments of gene activity. A common problem of such approaches is the difficulty of interpreting the biological implication of the resulting gene lists. This lead to an increased interest in methods for inferring high-level biological information. A common approach for representing high level information is by inferring gene ontology (GO) terms which may be attributed to the expression data experiment. Results: This article proposes a probabilistic model for GO term inference. Modelling assumes that gene annotations to GO terms are available and gene involvement in an experiment is represented by a posterior probabilities over gene-specific indicator variables. Such probability measures result from many Bayesian approaches for expression data analysis. The proposed model combines these indicator probabilities in a probabilistic fashion and provides a probabilistic GO term assignment as a result. Experiments on synthetic and microarray data suggest that advantages of the proposed probabilistic GO term inference over statistical test-based approaches are in particular evident for sparsely annotated GO terms and in situations of large uncertainty about gene activity. Provided that appropriate annotations exist, the proposed approach is easily applied to inferring other high level assignments like pathways. Availability: Source code under GPL license is available from the author. Contact: peter.sykacek@boku.ac.at PMID:22962488

  11. Selection of relatively exact reference genes for gene expression studies in goosegrass (Eleusine indica) under herbicide stress.

    Science.gov (United States)

    Chen, Jingchao; Huang, Zhaofeng; Huang, Hongjuan; Wei, Shouhui; Liu, Yan; Jiang, Cuilan; Zhang, Jie; Zhang, Chaoxian

    2017-04-21

    Goosegrass (Eleusine indica) is one of the most serious annual grassy weeds worldwide, and its evolved herbicide-resistant populations are more difficult to control. Quantitative real-time PCR (qPCR) is a common technique for investigating the resistance mechanism; however, there is as yet no report on the systematic selection of stable reference genes for goosegrass. This study proposed to test the expression stability of 9 candidate reference genes in goosegrass in different tissues and developmental stages and under stress from three types of herbicide. The results show that for different developmental stages and organs (control), eukaryotic initiation factor 4 A (eIF-4) is the most stable reference gene. Chloroplast acetolactate synthase (ALS) is the most stable reference gene under glyphosate stress. Under glufosinate stress, eIF-4 is the best reference gene. Ubiquitin-conjugating enzyme (UCE) is the most stable reference gene under quizalofop-p-ethyl stress. The gene eIF-4 is the recommended reference gene for goosegrass under the stress of all three herbicides. Moreover, pairwise analysis showed that seven reference genes were sufficient to normalize the gene expression data under three herbicides treatment. This study provides a list of reliable reference genes for transcript normalization in goosegrass, which will facilitate resistance mechanism studies in this weed species.

  12. Comparative transcriptomic analyses of differentially expressed genes in transgenic melatonin biosynthesis ovine HIOMT gene in switchgrass

    Directory of Open Access Journals (Sweden)

    Shan Yuan

    2016-11-01

    Full Text Available Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405 and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. The significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3 genes were consistent with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Early flowering in overexpression of oHIOMT switchgrass involved in the regulation of flowering-time genes (APETALA2. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc. were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc. were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants.

  13. Nitric oxide synthase expression and apoptotic cell death in brains of AIDS and AIDS dementia patients

    NARCIS (Netherlands)

    Vincent, V. A.; de Groot, C. J.; Lucassen, P. J.; Portegies, P.; Troost, D.; Tilders, F. J.; van Dam, A. M.

    1999-01-01

    To determine the occurrence and cellular localization of inducible nitric oxide synthase (iNOS), NOS activity and its association with cell death in brains of AIDS and AIDS dementia complex (ADC) patients. Post-mortem cerebral cortex tissue of eight AIDS patients, eight ADC patients and eight

  14. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  15. Down-regulation of a chitin synthase a gene by RNA interference enhances pathogenicity of Beauveria bassiana ANU1 against Spodoptera exigua (HÜBNER).

    Science.gov (United States)

    Lee, Jung-Bok; Kim, Hyun Soo; Park, Youngjin

    2017-02-01

    Chitin synthase (CHS) is an important enzymatic component, which is required for chitin formation in the cuticles and cuticular linings of other tissues in insects. CHSs have been divided into two classes, classes A and B, based on their amino acid sequence similarities and functions. Class A CHS (CHS-A) is specifically expressed in the epidermis and related ectodermal cells such as tracheal cells, while class B CHS (CHS-B) is expressed in gut epithelial cells that produce peritrophic matrices. In this study, we cloned the CHS-A gene from the beet armyworm, Spodoptera exigua (SeCHS-A). The SeCHS-A contains an open reading frame of 4,698 nucleotides, encoding a protein of 1,565 amino acids with a predicted molecular mass of approximately 177.8 kDa. The SeCHS-A mRNA was expressed in all developmental stages and specifically in the epidermis and tracheae tissue by quantitative real-time-PCR analysis. Expression of SeCHS-A gene was suppressed by feeding double-stranded RNA (dsCHS-A, 400 ng/larva) in the third instar larvae of S. exigua. Suppression of the SeCHS-A gene expression significantly increased 35% of mortality on pupation of S. exigua. Also, the third instar larvae fed with dsCHS-A significantly increased susceptibility to entomopathogenic fungi, Beauveria bassiana ANU1 at 3 days after treatment. These results suggest that the SeCHS-A gene plays an important role in development of S. exigua and RNA interference may apply to effective pest control with B. bassiana. © 2017 Wiley Periodicals, Inc.

  16. Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO.

    Science.gov (United States)

    Hou, Shasha; Tan, Jian; Yang, Bing; He, Lu; Zhu, Yu

    2018-05-01

    Thyroid cancer is a common primary tumor in China. Therefore, it is important to investigate the underlying molecular mechanism of thyroid cancer in order to achieve effective individualized treatments. In our previous study, a positive correlation between the expression of alkylglycerone phosphate synthase (AGPS) and the malignant phenotype of thyroid cancer cell lines was identified. The inactivation of AGPS was able to decrease the malignancy of cancer, and inhibit tumor growth and invasion. However, the function of AGPS on thyroid cancer was unclear. In the present study, it was revealed that AGPS was able to regulate the expression of circular RNAs (circRNAs), which may be the mechanism of its anticancer activity. Therefore, the effects of AGPS silencing and knockout on circRNA expression in the thyroid cancer cell line FRO were investigated using circRNAs microarray, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed in order to investigate the underlying molecular mechanism of AGPS for the regulation of thyroid cancer through circRNAs.

  17. Reference Gene Screening for Analyzing Gene Expression Across Goat Tissue

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2013-12-01

    Full Text Available Real-time quantitative PCR (qRT-PCR is one of the important methods for investigating the changes in mRNA expression levels in cells and tissues. Selection of the proper reference genes is very important when calibrating the results of real-time quantitative PCR. Studies on the selection of reference genes in goat tissues are limited, despite the economic importance of their meat and dairy products. We used real-time quantitative PCR to detect the expression levels of eight reference gene candidates (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH and EEF1A2 in ten tissues types sourced from Boer goats. The optimal reference gene combination was selected according to the results determined by geNorm, NormFinder and Bestkeeper software packages. The analyses showed that tissue is an important variability factor in genes expression stability. When all tissues were considered, 18S, TBP and HMBS is the optimal reference combination for calibrating quantitative PCR analysis of gene expression from goat tissues. Dividing data set by tissues, ACTB was the most stable in stomach, small intestine and ovary, 18S in heart and spleen, HMBS in uterus and lung, TBP in liver, HPRT1 in kidney and GAPDH in muscle. Overall, this study provided valuable information about the goat reference genes that can be used in order to perform a proper normalisation when relative quantification by qRT-PCR studies is undertaken.

  18. Influence of environmental ammonia on the production of nitric oxide and expression of inducible nitric oxide synthase in the freshwater air-breathing catfish (Heteropneustes fossilis)

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Mahua G. [Biochemical Adaptation Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022 (India); Saha, Nirmalendu, E-mail: nsaha@nehu.ac.in [Biochemical Adaptation Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022 (India)

    2012-07-15

    Highlights: Black-Right-Pointing-Pointer High environmental ammonia caused more production and accumulation of NO in air-breathing catfish (Heteropneustes fossilis). Black-Right-Pointing-Pointer Hyper-ammonia stress caused induction and zonal specific expression of iNOS enzyme protein, mRNA expression in different tissues. Black-Right-Pointing-Pointer Activation of NF{kappa}B that resulted under hyper-ammonia stress was believed to be the cause of induction of iNOS gene. - Abstract: Nitric oxide (NO) is a highly versatile and unique ubiquitous signaling molecule, and is known to play diverse physiological functions in mammals including those of adaptation to various stresses. The present study reports on the influence of exposure to high external ammonia (HEA) on the production of nitric oxide (NO) and the expression of inducible nitric oxide synthase (iNOS), that produces NO from L-arginine in the freshwater air-breathing catfish (Heteropneustes fossilis), which is reported to tolerate a very HEA. Some levels of NO were found to be present in all the tissues and also in plasma of control fish, which further enhanced significantly in fishes treated with high concentrations of environmental ammonia (25 and 50 mM ammonium chloride) for 7 days, accompanied by more efflux of NO from the perfused liver. This was accomplished by the induction of iNOS activity in different tissues of fish exposed to HEA, which otherwise was not detectable in control fish. Exposure to 25 mM ammonium chloride also led to a significant expression of iNOS protein in different tissues, followed by further increase at 50 mM ammonium chloride. Further, there was an increase in the expression of iNOS mRNA in ammonia-treated fish, thus suggesting that the expression of iNOS gene under hyper-ammonia stress was probably regulated at the transcriptional level. Immunocytochemical analysis indicated that the expression of iNOS in different tissues was zonal specific and not expressed uniformly

  19. Influence of environmental ammonia on the production of nitric oxide and expression of inducible nitric oxide synthase in the freshwater air-breathing catfish (Heteropneustes fossilis)

    International Nuclear Information System (INIS)

    Choudhury, Mahua G.; Saha, Nirmalendu

    2012-01-01

    Highlights: ► High environmental ammonia caused more production and accumulation of NO in air-breathing catfish (Heteropneustes fossilis). ► Hyper-ammonia stress caused induction and zonal specific expression of iNOS enzyme protein, mRNA expression in different tissues. ► Activation of NFκB that resulted under hyper-ammonia stress was believed to be the cause of induction of iNOS gene. - Abstract: Nitric oxide (NO) is a highly versatile and unique ubiquitous signaling molecule, and is known to play diverse physiological functions in mammals including those of adaptation to various stresses. The present study reports on the influence of exposure to high external ammonia (HEA) on the production of nitric oxide (NO) and the expression of inducible nitric oxide synthase (iNOS), that produces NO from L-arginine in the freshwater air-breathing catfish (Heteropneustes fossilis), which is reported to tolerate a very HEA. Some levels of NO were found to be present in all the tissues and also in plasma of control fish, which further enhanced significantly in fishes treated with high concentrations of environmental ammonia (25 and 50 mM ammonium chloride) for 7 days, accompanied by more efflux of NO from the perfused liver. This was accomplished by the induction of iNOS activity in different tissues of fish exposed to HEA, which otherwise was not detectable in control fish. Exposure to 25 mM ammonium chloride also led to a significant expression of iNOS protein in different tissues, followed by further increase at 50 mM ammonium chloride. Further, there was an increase in the expression of iNOS mRNA in ammonia-treated fish, thus suggesting that the expression of iNOS gene under hyper-ammonia stress was probably regulated at the transcriptional level. Immunocytochemical analysis indicated that the expression of iNOS in different tissues was zonal specific and not expressed uniformly throughout the organ. Hyper-ammonia stress also led to activation and nuclear

  20. Noise minimization in eukaryotic gene expression.

    Directory of Open Access Journals (Sweden)

    Hunter B Fraser

    2004-06-01

    Full Text Available All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or "noise." Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.

  1. Noise minimization in eukaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, Hunter B.; Hirsh, Aaron E.; Giaever, Guri; Kumm, Jochen; Eisen, Michael B.

    2004-01-15

    All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or noise. Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection.

  2. Noise minimization in eukaryotic gene expression

    International Nuclear Information System (INIS)

    Fraser, Hunter B.; Hirsh, Aaron E.; Giaever, Guri; Kumm, Jochen; Eisen, Michael B.

    2004-01-01

    All organisms have elaborate mechanisms to control rates of protein production. However, protein production is also subject to stochastic fluctuations, or noise. Several recent studies in Saccharomyces cerevisiae and Escherichia coli have investigated the relationship between transcription and translation rates and stochastic fluctuations in protein levels, or more generally, how such randomness is a function of intrinsic and extrinsic factors. However, the fundamental question of whether stochasticity in protein expression is generally biologically relevant has not been addressed, and it remains unknown whether random noise in the protein production rate of most genes significantly affects the fitness of any organism. We propose that organisms should be particularly sensitive to variation in the protein levels of two classes of genes: genes whose deletion is lethal to the organism and genes that encode subunits of multiprotein complexes. Using an experimentally verified model of stochastic gene expression in S. cerevisiae, we estimate the noise in protein production for nearly every yeast gene, and confirm our prediction that the production of essential and complex-forming proteins involves lower levels of noise than does the production of most other genes. Our results support the hypothesis that noise in gene expression is a biologically important variable, is generally detrimental to organismal fitness, and is subject to natural selection

  3. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  4. Plasmodium falciparum avoids change in erythrocytic surface expression of phagocytosis markers during inhibition of nitric oxide synthase activity

    DEFF Research Database (Denmark)

    Hempel, Casper; Kohnke, Hannes; Maretty, Lasse

    2014-01-01

    Nitric oxide (NO) accumulates in Plasmodium falciparum-infected erythrocytes. It may be produced by a parasite NO synthase (NOS) or by nitrate reduction. The parasite's benefit of NO accumulation is not understood. We investigated if inhibiting the P. falciparum NOS with specific and unspecific NOS...... increased the fraction of phosphatidyl serine exposing cells significantly. The infection did not change the level of expression of neither total CD47 nor its oxidized form. Unrelated to NOS inhibition, incubation with caveolin-1 scaffolding domain peptide lead to a decrease in oxidized CD47. In conclusion...

  5. Effect of quercetin on metallothionein, nitric oxide synthases and cyclooxygenase-2 expression on experimental chronic cadmium nephrotoxicity in rats

    International Nuclear Information System (INIS)

    Morales, Ana I.; Vicente-Sanchez, Cesar; Jerkic, Mirjana; Santiago, Jose M.; Sanchez-Gonzalez, Penelope D.; Perez-Barriocanal, Fernando; Lopez-Novoa, Jose M.

    2006-01-01

    Inflammation can play a key role in Cd-induced dysfunctions. Quercetin is a potent oxygen free radical scavenger and a metal chelator. Our aim was to study the effect of quercetin on Cd-induced kidney damage and metallothionein expression. The study was performed in Wistar rats that were administered during 9 weeks with either cadmium (1.2 mg Cd/kg/day, s.c.), quercetin (50 mg/kg/day, i.p.) or cadmium + quercetin. Renal toxicity was evaluated by measuring blood urea nitrogen concentration and urinary excretion of enzymes marker of tubular damage. Endothelial nitric oxide synthase (eNOS), inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) renal expression were assessed by Western blot. Renal expression of metallothionein 1 and 2 (MT-1, MT-2) and eNOS mRNA was assessed by Northern blot. Our data demonstrated that Cd-induced renal toxicity was markedly reduced in rats that also received quercetin. MT-1 and MT-2 mRNA levels in kidney were substantially increased during treatment with Cd, being even higher when the animals received Cd and quercetin. Renal eNOS expression was significantly higher in rats receiving Cd and quercetin than in animals receiving Cd alone or in control rats. In the group that received Cd, COX-2 and iNOS expression was markedly higher than in control rats. In the group Cd + quercetin, no changes in COX-2 and iNOS expression were observed compared with the control group. Our results demonstrate that quercetin treatment prevents Cd-induced overexpression of iNOS and COX-2, and increases MT expression. These effects can explain the protection by quercetin of Cd-induced nephrotoxicity

  6. Canine placental prostaglandin E2 synthase: expression, localization, and biological functions in providing substrates for prepartum PGF2alpha synthesis.

    Science.gov (United States)

    Gram, Aykut; Fox, Barbara; Büchler, Urs; Boos, Alois; Hoffmann, Bernd; Kowalewski, Mariusz P

    2014-12-01

    The prepartum output of PGF2alpha in the bitch is associated with increased placental PGE2-synthase (PTGES) mRNA levels. Contrasting with this is a decreased expression of PGF2alpha-synthase (PGFS/AKR1C3) in uteroplacental compartments during prepartum luteolysis, suggesting an involvement of alternative synthetic pathways in PGF2alpha synthesis, for example, conversion of PGE2 to PGF2alpha. However, because the expression and possible functions of the respective PTGES proteins remained unknown, no further conclusion could be drawn. Therefore, a canine-specific PTGES antibody was generated and used to investigate the expression, cellular localization, and biochemical activities of canine uteroplacental PTGES throughout pregnancy and at prepartum luteolysis. Additionally, the biochemical activities of these tissues involved in the conversion of PGE2 to PGF2alpha were investigated. The endometrial PTGES was localized in the uterine surface epithelium at preimplantation and in superficial and deep uterine glands, endothelial cells, and myometrium throughout pregnancy and at parturition. Placental signals were mostly in the trophoblast. The biochemical properties of recombinant PTGES protein were confirmed. Additionally, expression of two PGE2-receptors, PTGER2/EP2 and PTGER4/EP4, revealed their decreasing expression during luteolysis. In contrast, the uteroplacental expression of prostaglandin transporter (PGT) was strongly elevated prior to parturition. These localization patterns resembled that of PTGES. The increased expression of PTGES and PGT at parturition, together with the accompanying decreased levels of PGE2-receptors and the capability of canine uterine and placental homogenates to take part in the conversion of PGE2 to PGF2alpha, as found in this study, suggest that PGE2 could be used locally as a substrate for prepartum PGF2alpha synthesis in the dog. © 2014 by the Society for the Study of Reproduction, Inc.

  7. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  8. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  9. Different stress-related gene expression in depression and suicide.

    Science.gov (United States)

    Zhao, J; Qi, X-R; Gao, S-F; Lu, J; van Wamelen, D J; Kamphuis, W; Bao, A-M; Swaab, D F

    2015-09-01

    Suicide occurs in some, but not all depressed patients. So far, it remains unknown whether the studied stress-related candidate genes change in depression, suicide or both. The prefrontal cortex (PFC) is involved in, among other things, impulse control and inhibitory behavior and plays an important role in both suicide and depression. We have employed qPCR to study 124 anterior cingulate cortex (ACC) and dorsolateral PFC (DLPFC) brain samples, obtained from two brain banks, from: i) young depressed patients (average age 43 years) who committed suicide (MDD-S) and depressed patients who died from causes other than suicide (MDD-NS) and from ii) elderly depressed patients (average age 75 years) who did not commit suicide (DEP). Both cohorts were individually matched with non-psychiatric non-suicide control subjects. We determined the transcript levels of hypothalamic-pituitary-adrenal axis-regulating molecules (corticotropin-releasing hormone (CRH), CRH receptors, CRH binding protein, mineralocorticoid receptor/glucocorticoid receptor), transcription factors that regulate CRH expression, CRH-stimulating cytokines, chaperone proteins, retinoid signaling, brain-derived neurotrophic factor and tropomyosin-related kinase B, cytochrome proteins, nitric oxide synthase (NOS) and monoamines. In the MDD-S group, expression levels of CRH and neuronal NOS-interacting DHHC domain-containing protein with dendritic mRNA (NIDD) were increased. Other changes were only present in the DEP group, i.e. decreased NIDD, and increased and 5-hydroxytryptamine receptor 1A (5-HT1A) expression levels. Changes were found to be more pronounced in the anterior cingulate cortex than in the dorsolateral PFC. Depressed patients who committed suicide have different gene expression patterns than depressed patients who died of causes other than suicide. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Differential gene expression at different stages of mesocarp development in high- and low-yielding oil palm.

    Science.gov (United States)

    Wong, Yick Ching; Teh, Huey Fang; Mebus, Katharina; Ooi, Tony Eng Keong; Kwong, Qi Bin; Koo, Ka Loo; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R; Kulaveerasingam, Harikrishna

    2017-06-21

    The oil yield trait of oil palm is expected to involve multiple genes, environmental influences and interactions. Many of the underlying mechanisms that contribute to oil yield are still poorly understood. In this study, we used a microarray approach to study the gene expression profiles of mesocarp tissue at different developmental stages, comparing genetically related high- and low- oil yielding palms to identify genes that contributed to the higher oil-yielding palm and might contribute to the wider genetic improvement of oil palm breeding populations. A total of 3412 (2001 annotated) gene candidates were found to be significantly differentially expressed between high- and low-yielding palms at at least one of the different stages of mesocarp development evaluated. Gene Ontologies (GO) enrichment analysis identified 28 significantly enriched GO terms, including regulation of transcription, fatty acid biosynthesis and metabolic processes. These differentially expressed genes comprise several transcription factors, such as, bHLH, Dof zinc finger proteins and MADS box proteins. Several genes involved in glycolysis, TCA, and fatty acid biosynthesis pathways were also found up-regulated in high-yielding oil palm, among them; pyruvate dehydrogenase E1 component Subunit Beta (PDH), ATP-citrate lyase, β- ketoacyl-ACP synthases I (KAS I), β- ketoacyl-ACP synthases III (KAS III) and ketoacyl-ACP reductase (KAR). Sucrose metabolism-related genes such as Invertase, Sucrose Synthase 2 and Sucrose Phosphatase 2 were found to be down-regulated in high-yielding oil palms, compared to the lower yield palms. Our findings indicate that a higher carbon flux (channeled through down-regulation of the Sucrose Synthase 2 pathway) was being utilized by up-regulated genes involved in glycolysis, TCA and fatty acid biosynthesis leading to enhanced oil production in the high-yielding oil palm. These findings are an important stepping stone to understand the processes that lead to

  11. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  12. Pathological Lesions and Inducible Nitric Oxide Synthase Expressions in the Liver of Mice Experimentally Infected with Clonorchis sinensis.

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Xue, Yan; Cheng, Xiao-Bing; Jiang, Zhi-Hua; Yang, Yi-Chao; Chen, Ying-Dan; Zhou, Xiao-Nong

    2015-12-01

    The nitric oxide (NO) formation and intrinsic nitrosation may be involved in the possible mechanisms of liver fluke-associated carcinogenesis. We still do not know much about the responses of inducible NO synthase (iNOS) induced by Clonorchis sinensis infection. This study was conducted to explore the pathological lesions and iNOS expressions in the liver of mice with different infection intensity levels of C. sinensis. Extensive periductal inflammatory cell infiltration, bile duct hyperplasia, and fibrosis were commonly observed during the infection. The different pathological responses in liver tissues strongly correlated with the infection intensity of C. sinensis. Massive acute spotty necrosis occurred in the liver parenchyma after a severe infection. The iNOS activity in liver tissues increased, and iNOS-expressing cells with morphological differences were observed after a moderate or severe infection. The iNOS-expressing cells in liver tissues had multiple origins.

  13. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  14. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  15. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  16. Inhibition by sodium nitroprusside of the expression of inducible nitric oxide synthase in rat neutrophils.

    OpenAIRE

    Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G

    1995-01-01

    A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils.

  17. Inhibition by sodium nitroprusside of the expression of inducible nitric oxide synthase in rat neutrophils.

    Science.gov (United States)

    Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G

    1995-01-01

    A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils. PMID:7542530

  18. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Science.gov (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  1. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)

    uwerhiavwe

    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  2. Factors influencing gene silencing of granule-bound starch synthase in potato

    NARCIS (Netherlands)

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

  3. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  4. Hepatocyte specific expression of human cloned genes

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, R

    1986-01-01

    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  5. Gene expression profiles in skeletal muscle after gene electrotransfer

    DEFF Research Database (Denmark)

    Hojman, Pernille; Zibert, John R; Gissel, Hanne

    2007-01-01

    BACKGROUND: Gene transfer by electroporation (DNA electrotransfer) to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have...... caused down-regulation of structural proteins e.g. sarcospan and catalytic enzymes. Injection of DNA induced down-regulation of intracellular transport proteins e.g. sentrin. The effects on muscle fibres were transient as the expression profiles 3 weeks after treatment were closely related......) followed by a long low voltage pulse (LV, 100 V/cm, 400 ms); a pulse combination optimised for efficient and safe gene transfer. Muscles were transfected with green fluorescent protein (GFP) and excised at 4 hours, 48 hours or 3 weeks after treatment. RESULTS: Differentially expressed genes were...

  6. Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI

    DEFF Research Database (Denmark)

    Wang, Weijing; Jiang, Wenjie; Hou, Lin

    2017-01-01

    BACKGROUND: The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis......) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database...

  7. Gene expression analysis of flax seed development

    Science.gov (United States)

    2011-01-01

    Background Flax, Linum usitatissimum L., is an important crop whose seed oil and stem fiber have multiple industrial applications. Flax seeds are also well-known for their nutritional attributes, viz., omega-3 fatty acids in the oil and lignans and mucilage from the seed coat. In spite of the importance of this crop, there are few molecular resources that can be utilized toward improving seed traits. Here, we describe flax embryo and seed development and generation of comprehensive genomic resources for the flax seed. Results We describe a large-scale generation and analysis of expressed sequences in various tissues. Collectively, the 13 libraries we have used provide a broad representation of genes active in developing embryos (globular, heart, torpedo, cotyledon and mature stages) seed coats (globular and torpedo stages) and endosperm (pooled globular to torpedo stages) and genes expressed in flowers, etiolated seedlings, leaves, and stem tissue. A total of 261,272 expressed sequence tags (EST) (GenBank accessions LIBEST_026995 to LIBEST_027011) were generated. These EST libraries included transcription factor genes that are typically expressed at low levels, indicating that the depth is adequate for in silico expression analysis. Assembly of the ESTs resulted in 30,640 unigenes and 82% of these could be identified on the basis of homology to known and hypothetical genes from other plants. When compared with fully sequenced plant genomes, the flax unigenes resembled poplar and castor bean more than grape, sorghum, rice or Arabidopsis. Nearly one-fifth of these (5,152) had no homologs in sequences reported for any organism, suggesting that this category represents genes that are likely unique to flax. Digital analyses revealed gene expression dynamics for the biosynthesis of a number of important seed constituents during seed development. Conclusions We have developed a foundational database of expressed sequences and collection of plasmid clones that comprise

  8. Gene expression analysis of flax seed development

    Directory of Open Access Journals (Sweden)

    Sharpe Andrew

    2011-04-01

    Full Text Available Abstract Background Flax, Linum usitatissimum L., is an important crop whose seed oil and stem fiber have multiple industrial applications. Flax seeds are also well-known for their nutritional attributes, viz., omega-3 fatty acids in the oil and lignans and mucilage from the seed coat. In spite of the importance of this crop, there are few molecular resources that can be utilized toward improving seed traits. Here, we describe flax embryo and seed development and generation of comprehensive genomic resources for the flax seed. Results We describe a large-scale generation and analysis of expressed sequences in various tissues. Collectively, the 13 libraries we have used provide a broad representation of genes active in developing embryos (globular, heart, torpedo, cotyledon and mature stages seed coats (globular and torpedo stages and endosperm (pooled globular to torpedo stages and genes expressed in flowers, etiolated seedlings, leaves, and stem tissue. A total of 261,272 expressed sequence tags (EST (GenBank accessions LIBEST_026995 to LIBEST_027011 were generated. These EST libraries included transcription factor genes that are typically expressed at low levels, indicating that the depth is adequate for in silico expression analysis. Assembly of the ESTs resulted in 30,640 unigenes and 82% of these could be identified on the basis of homology to known and hypothetical genes from other plants. When compared with fully sequenced plant genomes, the flax unigenes resembled poplar and castor bean more than grape, sorghum, rice or Arabidopsis. Nearly one-fifth of these (5,152 had no homologs in sequences reported for any organism, suggesting that this category represents genes that are likely unique to flax. Digital analyses revealed gene expression dynamics for the biosynthesis of a number of important seed constituents during seed development. Conclusions We have developed a foundational database of expressed sequences and collection of plasmid

  9. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  10. Lithium ions induce prestalk-associated gene expression and inhibit prespore gene expression in Dictyostelium discoideum

    NARCIS (Netherlands)

    Peters, Dorien J.M.; Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van; Spek, Wouter; Schaap, Pauline

    1989-01-01

    We investigated the effect of Li+ on two types of cyclic AMP-regulated gene expression and on basal and cyclic AMP-stimulated inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) levels. Li+ effectively inhibits cyclic AMP-induced prespore gene expression, half-maximal inhibition occurring at about 2mM-LiCl.

  11. Scaling of gene expression data allowing the comparison of different gene expression platforms

    NARCIS (Netherlands)

    van Ruissen, Fred; Schaaf, Gerben J.; Kool, Marcel; Baas, Frank; Ruijter, Jan M.

    2008-01-01

    Serial analysis of gene expression (SAGE) and microarrays have found a widespread application, but much ambiguity exists regarding the amalgamation of the data resulting from these technologies. Cross-platform utilization of gene expression data from the SAGE and microarray technology could reduce

  12. Direct capture and heterologous expression of Salinispora natural product genes for the biosynthesis of enterocin.

    Science.gov (United States)

    Bonet, Bailey; Teufel, Robin; Crüsemann, Max; Ziemert, Nadine; Moore, Bradley S

    2015-03-27

    Heterologous expression of secondary metabolic pathways is a promising approach for the discovery and characterization of bioactive natural products. Herein we report the first heterologous expression of a natural product from the model marine actinomycete genus Salinispora. Using the recently developed method of yeast-mediated transformation-associated recombination for natural product gene clusters, we captured a type II polyketide synthase pathway from Salinispora pacifica with high homology to the enterocin pathway from Streptomyces maritimus and successfully produced enterocin in two different Streptomyces host strains. This result paves the way for the systematic interrogation of Salinispora's promising secondary metabolome.

  13. Renal Gene Expression Database (RGED): a relational database of gene expression profiles in kidney disease.

    Science.gov (United States)

    Zhang, Qingzhou; Yang, Bo; Chen, Xujiao; Xu, Jing; Mei, Changlin; Mao, Zhiguo

    2014-01-01

    We present a bioinformatics database named Renal Gene Expression Database (RGED), which contains comprehensive gene expression data sets from renal disease research. The web-based interface of RGED allows users to query the gene expression profiles in various kidney-related samples, including renal cell lines, human kidney tissues and murine model kidneys. Researchers can explore certain gene profiles, the relationships between genes of interests and identify biomarkers or even drug targets in kidney diseases. The aim of this work is to provide a user-friendly utility for the renal disease research community to query expression profiles of genes of their own interest without the requirement of advanced computational skills. Website is implemented in PHP, R, MySQL and Nginx and freely available from http://rged.wall-eva.net. http://rged.wall-eva.net. © The Author(s) 2014. Published by Oxford University Press.

  14. Renal Gene Expression Database (RGED): a relational database of gene expression profiles in kidney disease

    Science.gov (United States)

    Zhang, Qingzhou; Yang, Bo; Chen, Xujiao; Xu, Jing; Mei, Changlin; Mao, Zhiguo

    2014-01-01

    We present a bioinformatics database named Renal Gene Expression Database (RGED), which contains comprehensive gene expression data sets from renal disease research. The web-based interface of RGED allows users to query the gene expression profiles in various kidney-related samples, including renal cell lines, human kidney tissues and murine model kidneys. Researchers can explore certain gene profiles, the relationships between genes of interests and identify biomarkers or even drug targets in kidney diseases. The aim of this work is to provide a user-friendly utility for the renal disease research community to query expression profiles of genes of their own interest without the requirement of advanced computational skills. Availability and implementation: Website is implemented in PHP, R, MySQL and Nginx and freely available from http://rged.wall-eva.net. Database URL: http://rged.wall-eva.net PMID:25252782

  15. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

    Science.gov (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  16. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

    2000-01-01

    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  17. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  18. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid

    2010-10-01

    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  19. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3beta is implicated in the treatment of cervical carcinoma.

    Science.gov (United States)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3beta (GSK-3beta) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3beta(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3beta after transfection with GSK-3beta by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3beta (s9). Furthermore, we demonstrated GSK-3beta transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3beta was important to improve chemosensitization, indicating the significance of GSK-3beta-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  20. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Directory of Open Access Journals (Sweden)

    Wang Ze

    2010-02-01

    Full Text Available Abstract Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9 expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA, co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9. Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  1. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yuan [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shu, Yi Min [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Wang, Shu Fang [Department of Pathology, Baylor College of Medicine, Houston, TX 77030 (United States); Da, Bang Hong; Wang, Ze Hua [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Li, Hua Bin [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Department of Medicine, Feinberg Medical School, Northwestern University, Chicago, IL 60611 (United States)

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  2. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Science.gov (United States)

    2010-01-01

    Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy. PMID:20178594

  3. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    International Nuclear Information System (INIS)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-01-01

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy

  4. [Effects of cytosolic bacteria on cyclic GMP-AMP synthase expression in human gingival tissues and periodontal ligament cells].

    Science.gov (United States)

    Xiaojun, Yang; Yongmei, Tan; Zhihui, Tian; Ting, Zhou; Wanghong, Zhao; Jin, Hou

    2017-04-01

    This work aims to determine the effect of cytosolic bacteria on the expression of cyclic GMP-AMP synthase (cGAS) in human periodontal ligament cells (hPDLCs) and gingival tissues. The ability of Porphyromonas gingivalis (P. gingivalis) to invade hPDLCs was detected using laser scanning confocal microscope assay at a multiplicity of infection of 10. P. gingivalis-infected cells were sorted by fluorescence-activated cell sorting (FACS). Then, quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and Western blot were used to detect cGAS expression in infected cells. Finally, the location and expression of cGAS in inflammatory and normal gingival tissues were investigated by immunohistochemistry. P. gingivalis actively invaded hPDLCs. Moreover, cGAS expression significantly increased in P. gingivalis-infected cells. Although cGAS was expressed in the epithelial and subepithelial cells of both inflamed and normal gingival tissues, cGAS expression significantly increased in inflamed gingival tissues. Cytosolic bacteria can upregulate cGAS expression in infected cells. These data suggest that cGAS may act as pattern-recognition receptors and participate in recognizing cytosolic nucleic acid pathogen-associated molecular patterns.
.

  5. Morphological alterations and NO-synthase expression in the heart after continuous light exposure of rats

    Czech Academy of Sciences Publication Activity Database

    Paulis, L.; Važan, R.; Šimko, F.; Pecháňová, Olga; Styk, J.; Babál, P.; Janega, P.

    2007-01-01

    Roč. 56, Suppl.2 (2007), S71-S76 ISSN 0862-8408 Grant - others:VEGA(SK) 1/3429/06; VEGA(SK) 2/6148/26; VEGA(SK) 2/5110/25; -(SK) 29/2007; -(SK) 30/2007; -(SK) SP51/0280900/0280901; -(SK) APVT-51-027404; -(SK) APVT51-018004 Institutional research plan: CEZ:AV0Z50110509 Keywords : myocardium * collagen I/III * nitric oxide synthase Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 1.505, year: 2007

  6. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata

    2015-01-01

    Many cancer-associated somatic copy number alterations (SCNAs) are known. Currently, one of the challenges is to identify the molecular downstream effects of these variants. Although several SCNAs are known to change gene expression levels, it is not clear whether each individual SCNA affects gen...

  7. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

    Science.gov (United States)

    Tucker, Mark L; Xue, Ping; Yang, Ronghui

    2010-01-01

    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  8. Metallothionein gene expression in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Deeksha Pal

    2014-01-01

    Full Text Available Introduction: Metallothioneins (MTs are a group of low-molecular weight, cysteine-rich proteins. In general, MT is known to modulate three fundamental processes: (1 the release of gaseous mediators such as hydroxyl radical or nitric oxide, (2 apoptosis and (3 the binding and exchange of heavy metals such as zinc, cadmium or copper. Previous studies have shown a positive correlation between the expression of MT with invasion, metastasis and poor prognosis in various cancers. Most of the previous studies primarily used immunohistochemistry to analyze localization of MT in renal cell carcinoma (RCC. No information is available on the gene expression of MT2A isoform in different types and grades of RCC. Materials and Methods: In the present study, total RNA was isolated from 38 histopathologically confirmed cases of RCC of different types and grades. Corresponding adjacent normal renal parenchyma was taken as control. Real-time polymerase chain reaction (RT PCR analysis was done for the MT2A gene expression using b-actin as an internal control. All statistical calculations were performed using SPSS software. Results: The MT2A gene expression was found to be significantly increased (P < 0.01 in clear cell RCC in comparison with the adjacent normal renal parenchyma. The expression of MT2A was two to three-fold higher in sarcomatoid RCC, whereas there was no change in papillary and collecting duct RCC. MT2A gene expression was significantly higher in lower grade (grades I and II, P < 0.05, while no change was observed in high-grade tumor (grade III and IV in comparison to adjacent normal renal tissue. Conclusion: The first report of the expression of MT2A in different types and grades of RCC and also these data further support the role of MT2A in tumorigenesis.

  9. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  10. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  11. Transcriptional activation of a geranylgeranyl diphosphate synthase gene, GGPPS2, isolated from Scoparia dulcis by treatment with methyl jasmonate and yeast extract.

    Science.gov (United States)

    Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F

    2014-10-01

    A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.

  12. Analysis of baseline gene expression levels from ...

    Science.gov (United States)

    The use of gene expression profiling to predict chemical mode of action would be enhanced by better characterization of variance due to individual, environmental, and technical factors. Meta-analysis of microarray data from untreated or vehicle-treated animals within the control arm of toxicogenomics studies has yielded useful information on baseline fluctuations in gene expression. A dataset of control animal microarray expression data was assembled by a working group of the Health and Environmental Sciences Institute's Technical Committee on the Application of Genomics in Mechanism Based Risk Assessment in order to provide a public resource for assessments of variability in baseline gene expression. Data from over 500 Affymetrix microarrays from control rat liver and kidney were collected from 16 different institutions. Thirty-five biological and technical factors were obtained for each animal, describing a wide range of study characteristics, and a subset were evaluated in detail for their contribution to total variability using multivariate statistical and graphical techniques. The study factors that emerged as key sources of variability included gender, organ section, strain, and fasting state. These and other study factors were identified as key descriptors that should be included in the minimal information about a toxicogenomics study needed for interpretation of results by an independent source. Genes that are the most and least variable, gender-selectiv

  13. Gene expression of the endolymphatic sac

    DEFF Research Database (Denmark)

    Friis, Morten; Martin-Bertelsen, Tomas; Friis-Hansen, Lennart

    2011-01-01

    that the endolymphatic sac has multiple and diverse functions in the inner ear. Objectives:The objective of this study was to provide a comprehensive review of the genes expressed in the endolymphatic sac in the rat and perform a functional characterization based on measured mRNA abundance. Methods:Microarray technology...

  14. Gene expression in early stage cervical cancer

    NARCIS (Netherlands)

    Biewenga, Petra; Buist, Marrije R.; Moerland, Perry D.; van Thernaat, Emiel Ver Loren; van Kampen, Antoine H. C.; ten Kate, Fiebo J. W.; Baas, Frank

    2008-01-01

    Objective. Pelvic lymph node metastases are the main prognostic factor for survival in early stage cervical cancer, yet accurate detection methods before surgery are lacking. In this study, we examined whether gene expression profiling can predict the presence of lymph node metastasis in early stage

  15. Shrinkage Approach for Gene Expression Data Analysis

    Czech Academy of Sciences Publication Activity Database

    Haman, Jiří; Valenta, Zdeněk; Kalina, Jan

    2013-01-01

    Roč. 1, č. 1 (2013), s. 65-65 ISSN 1805-8698. [EFMI 2013 Special Topic Conference. 17.04.2013-19.04.2013, Prague] Institutional support: RVO:67985807 Keywords : shrinkage estimation * covariance matrix * high dimensional data * gene expression Subject RIV: IN - Informatics, Computer Science

  16. Minocycline attenuates experimental colitis in mice by blocking expression of inducible nitric oxide synthase and matrix metalloproteinases

    International Nuclear Information System (INIS)

    Huang, T.-Y.; Chu, H.-C.; Lin, Y.-L.; Lin, C.-K.; Hsieh, T.-Y.; Chang, W.-K.; Chao, Y.-C.; Liao, C.-L.

    2009-01-01

    In addition to its antimicrobial activity, minocycline exerts anti-inflammatory effects in several disease models. However, whether minocycline affects the pathogenesis of inflammatory bowel disease has not been determined. We investigated the effects of minocycline on experimental colitis and its underlying mechanisms. Acute and chronic colitis were induced in mice by treatment with dextran sulfate sodium (DSS) or trinitrobenzene sulfonic acid (TNBS), and the effect of minocycline on colonic injury was assessed clinically and histologically. Prophylactic and therapeutic treatment of mice with minocycline significantly diminished mortality rate and attenuated the severity of DSS-induced acute colitis. Mechanistically, minocycline administration suppressed inducible nitric oxide synthase (iNOS) expression and nitrotyrosine production, inhibited proinflammatory cytokine expression, repressed the elevated mRNA expression of matrix metalloproteinases (MMPs) 2, 3, 9, and 13, diminished the apoptotic index in colonic tissues, and inhibited nitric oxide production in the serum of mice with DSS-induced acute colitis. In DSS-induced chronic colitis, minocycline treatment also reduced body weight loss, improved colonic histology, and blocked expression of iNOS, proinflammatory cytokines, and MMPs from colonic tissues. Similarly, minocycline could ameliorate the severity of TNBS-induced acute colitis in mice by decreasing mortality rate and inhibiting proinflammatory cytokine expression in colonic tissues. These results demonstrate that minocycline protects mice against DSS- and TNBS-induced colitis, probably via inhibition of iNOS and MMP expression in intestinal tissues. Therefore, minocycline is a potential remedy for human inflammatory bowel diseases.

  17. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  18. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Science.gov (United States)

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

  19. Fluid Mechanics, Arterial Disease, and Gene Expression.

    Science.gov (United States)

    Tarbell, John M; Shi, Zhong-Dong; Dunn, Jessilyn; Jo, Hanjoong

    2014-01-01

    This review places modern research developments in vascular mechanobiology in the context of hemodynamic phenomena in the cardiovascular system and the discrete localization of vascular disease. The modern origins of this field are traced, beginning in the 1960s when associations between flow characteristics, particularly blood flow-induced wall shear stress, and the localization of atherosclerotic plaques were uncovered, and continuing to fluid shear stress effects on the vascular lining endothelial) cells (ECs), including their effects on EC morphology, biochemical production, and gene expression. The earliest single-gene studies and genome-wide analyses are considered. The final section moves from the ECs lining the vessel wall to the smooth muscle cells and fibroblasts within the wall that are fluid me chanically activated by interstitial flow that imposes shear stresses on their surfaces comparable with those of flowing blood on EC surfaces. Interstitial flow stimulates biochemical production and gene expression, much like blood flow on ECs.

  20. Accumulation of Kaempferitrin and Expression of Phenyl-Propanoid Biosynthetic Genes in Kenaf (Hibiscus cannabinus

    Directory of Open Access Journals (Sweden)

    Shicheng Zhao

    2014-10-01

    Full Text Available Kenaf (Hibiscus cannabinus is cultivated worldwide for its fiber; however, the medicinal properties of this plant are currently attracting increasing attention. In this study, we investigated the expression levels of genes involved in the biosynthesis of kaempferitrin, a compound with many biological functions, in different kenaf organs. We found that phenylalanine ammonia lyase (HcPAL was more highly expressed in stems than in other organs. Expression levels of cinnamate 4-hydroxylase (HcC4H and 4-coumarate-CoA ligase (Hc4CL were highest in mature leaves, followed by stems and young leaves, and lowest in roots and mature flowers. The expression of chalcone synthase (HcCHS, chalcone isomerase (HcCHI, and flavone 3-hydroxylase (HcF3H was highest in young flowers, whereas that of flavone synthase (HcFLS was highest in leaves. An analysis of kaempferitrin accumulation in the different organs of kenaf revealed that the accumulation of this compound was considerably higher (>10-fold in leaves than in other organs. On the basis of a comparison of kaempferitrin contents with the expression levels of different genes in different organs, we speculate that HcFLS plays an important regulatory role in the kaempferitrin biosynthetic pathway in kenaf.

  1. Accumulation of kaempferitrin and expression of phenyl-propanoid biosynthetic genes in kenaf (Hibiscus cannabinus).

    Science.gov (United States)

    Zhao, Shicheng; Li, Xiaohua; Cho, Dong Ha; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah; Park, Sang Un

    2014-10-23

    Kenaf (Hibiscus cannabinus) is cultivated worldwide for its fiber; however, the medicinal properties of this plant are currently attracting increasing attention. In this study, we investigated the expression levels of genes involved in the biosynthesis of kaempferitrin, a compound with many biological functions, in different kenaf organs. We found that phenylalanine ammonia lyase (HcPAL) was more highly expressed in stems than in other organs. Expression levels of cinnamate 4-hydroxylase (HcC4H) and 4-coumarate-CoA ligase (Hc4CL) were highest in mature leaves, followed by stems and young leaves, and lowest in roots and mature flowers. The expression of chalcone synthase (HcCHS), chalcone isomerase (HcCHI), and flavone 3-hydroxylase (HcF3H) was highest in young flowers, whereas that of flavone synthase (HcFLS) was highest in leaves. An analysis of kaempferitrin accumulation in the different organs of kenaf revealed that the accumulation of this compound was considerably higher (>10-fold) in leaves than in other organs. On the basis of a comparison of kaempferitrin contents with the expression levels of different genes in different organs, we speculate that HcFLS plays an important regulatory role in the kaempferitrin biosynthetic pathway in kenaf.

  2. Gene Expression Commons: an open platform for absolute gene expression profiling.

    Directory of Open Access Journals (Sweden)

    Jun Seita

    Full Text Available Gene expression profiling using microarrays has been limited to comparisons of gene expression between small numbers of samples within individual experiments. However, the unknown and variable sensitivities of each probeset have rendered the absolute expression of any given gene nearly impossible to estimate. We have overcome this limitation by using a very large number (>10,000 of varied microarray data as a common reference, so that statistical attributes of each probeset, such as the dynamic range and threshold between low and high expression, can be reliably discovered through meta-analysis. This strategy is implemented in a web-based platform named "Gene Expression Commons" (https://gexc.stanford.edu/ which contains data of 39 distinct highly purified mouse hematopoietic stem/progenitor/differentiated cell populations covering almost the entire hematopoietic system. Since the Gene Expression Commons is designed as an open platform, investigators can explore the expression level of any gene, search by expression patterns of interest, submit their own microarray data, and design their own working models representing biological relationship among samples.

  3. Comparative gene expression of intestinal metabolizing enzymes.

    Science.gov (United States)

    Shin, Ho-Chul; Kim, Hye-Ryoung; Cho, Hee-Jung; Yi, Hee; Cho, Soo-Min; Lee, Dong-Goo; Abd El-Aty, A M; Kim, Jin-Suk; Sun, Duxin; Amidon, Gordon L

    2009-11-01

    The purpose of this study was to compare the expression profiles of drug-metabolizing enzymes in the intestine of mouse, rat and human. Total RNA was isolated from the duodenum and the mRNA expression was measured using Affymetrix GeneChip oligonucleotide arrays. Detected genes from the intestine of mouse, rat and human were ca. 60% of 22690 sequences, 40% of 8739 and 47% of 12559, respectively. Total genes of metabolizing enzymes subjected in this study were 95, 33 and 68 genes in mouse, rat and human, respectively. Of phase I enzymes, the mouse exhibited abundant gene expressions for Cyp3a25, Cyp4v3, Cyp2d26, followed by Cyp2b20, Cyp2c65 and Cyp4f14, whereas, the rat showed higher expression profiles of Cyp3a9, Cyp2b19, Cyp4f1, Cyp17a1, Cyp2d18, Cyp27a1 and Cyp4f6. However, the highly expressed P450 enzymes were CYP3A4, CYP3A5, CYP4F3, CYP2C18, CYP2C9, CYP2D6, CYP3A7, CYP11B1 and CYP2B6 in the human. For phase II enzymes, glucuronosyltransferase Ugt1a6, glutathione S-transferases Gstp1, Gstm3 and Gsta2, sulfotransferase Sult1b1 and acyltransferase Dgat1 were highly expressed in the mouse. The rat revealed predominant expression of glucuronosyltransferases Ugt1a1 and Ugt1a7, sulfotransferase Sult1b1, acetyltransferase Dlat and acyltransferase Dgat1. On the other hand, in human, glucuronosyltransferases UGT2B15 and UGT2B17, glutathione S-transferases MGST3, GSTP1, GSTA2 and GSTM4, sulfotransferases ST1A3 and SULT1A2, acetyltransferases SAT1 and CRAT, and acyltransferase AGPAT2 were dominantly detected. Therefore, current data indicated substantial interspecies differences in the pattern of intestinal gene expression both for P450 enzymes and phase II drug-metabolizing enzymes. This genomic database is expected to improve our understanding of interspecies variations in estimating intestinal prehepatic clearance of oral drugs.

  4. Cloning and Characterization of a Flavonol Synthase Gene From Litchi chinensis and Its Variation Among Litchi Cultivars With Different Fruit Maturation Periods

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2018-04-01

    Full Text Available Litchi (Litchi chinensis is an important subtropical fruit tree with high commercial value. However, the short and centralized fruit maturation period of litchi cultivars represents a bottleneck for litchi production. Therefore, the development of novel cultivars with extremely early fruit maturation period is critical. Previously, we showed that the genotypes of extremely early-maturing (EEM, early-maturing (EM, and middle-to-late-maturing (MLM cultivars at a specific locus SNP51 (substitution type C/T were consistent with their respective genetic background at the whole-genome level; a homozygous C/C genotype at SNP51 systematically differentiated EEM cultivars from others. The litchi gene on which SNP51 was located was annotated as flavonol synthase (FLS, which catalyzes the formation of flavonols. Here, we further elucidate the variation of the FLS gene from L. chinensis (LcFLS among EEM, EM, and MLM cultivars. EEM cultivars with a homozygous C/C genotype at SNP51 all contained the same 2,199-bp sequence of the LcFLS gene. For MLM cultivars with a homozygous T/T genotype at SNP51, the sequence lengths of the LcFLS gene were 2,202–2,222 bp. EM cultivars with heterozygous C/T genotypes at SNP51 contained two different alleles of the LcFLS gene: a 2,199-bp sequence identical to that in EEM cultivars and a 2,205-bp sequence identical to that in MLM cultivar ‘Heiye.’ Moreover, the coding regions of LcFLS genes of other MLM cultivars were almost identical to that of ‘Heiye.’ Therefore, the LcFLS gene coding region may be used as a source of diagnostic SNP markers to discriminate or identify genotypes with the EEM trait. The expression pattern of the LcFLS gene and accumulation pattern of flavonol from EEM, EM, and MLM cultivars were analyzed and compared using quantitative real-time PCR (qRT-PCR and high-performance liquid chromatography (HPLC for mature leaves, flower buds, and fruits, 15, 30, 45, and 60 days after anthesis. Flavonol

  5. Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI.

    Science.gov (United States)

    Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng

    2017-11-13

    The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly

  6. Structure and expression of thyroglobulin gene

    Energy Technology Data Exchange (ETDEWEB)

    Vassart, G; Brocas, H; Christophe, D; de Martynoff, G; Leriche, A; Mercken, L; Pohl, V; van Heuverswyn, B [Institut de Recherche Interdisciplinaire en Biologie Humaine et Nucleaire (IRIBHN), Faculte de Medecine, Universite libre de Bruxelles, Campus Hopital Erasme, Brussels (Belgium)

    1982-01-01

    Thyroglobulin is composed of two 300000 dalton polypeptide chains, translated from an 8000 base mRNA. Preparation of a full length cDNA and its cloning in E. coli have lead to the demonstration that the polypeptides of thyroglobulin protomers were identical. Used as molecular probes, the cloned cDNA allowed the isolation of a fragment of thyroglobulin gene. Electron microscopic studies have demonstrated that this gene contains more than 90 % intronic material separating small size exons (<200 bp). Sequencing of bovine thyroglobulin structural gene is in progress. Preliminary results show evidence for the existence of repetitive segments. Availability of cloned DNA complementary to bovine and human thyroglobulin mRNA allows the study of genetic defects of thyroglobulin gene expression in the human and in various animal models.

  7. Cerebrovascular gene expression in spontaneously hypertensive rats

    DEFF Research Database (Denmark)

    Grell, Anne-Sofie; Frederiksen, Simona Denise; Edvinsson, Lars

    2017-01-01

    Hypertension is a hemodynamic disorder and one of the most important and well-established risk factors for vascular diseases such as stroke. Blood vessels exposed to chronic shear stress develop structural changes and remodeling of the vascular wall through many complex mechanisms. However......, the molecular mechanisms involved are not fully understood. Hypertension-susceptible genes may provide a novel insight into potential molecular mechanisms of hypertension and secondary complications associated with hypertension. The aim of this exploratory study was to identify gene expression differences......, the identified genes in the middle cerebral arteries from spontaneously hypertensive rats could be possible mediators of the vascular changes and secondary complications associated with hypertension. This study supports the selection of key genes to investigate in the future research of hypertension-induced end...

  8. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of molybdopterin synthase from Thermus thermophilus HB8

    International Nuclear Information System (INIS)

    Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Ohmori, Miwa; Agari, Kazuko; Kitamura, Yoshiaki; Baba, Seiki; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki

    2007-01-01

    The molybdopterin synthase from T. thermophilus HB8 was cloned, expressed, purified and crystallized. The crystals belong to space group P2 1 and diffracted to a resolution of 1.64 Å. Thermus thermop