WorldWideScience

Sample records for synthase gene expression

  1. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  2. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  3. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  4. Cloning and expression analysis of an anthocyanidin synthase gene ...

    Indian Academy of Sciences (India)

    Expression of ANS in leaves, embryo and seed coat was analysed, which provided a ... taneously amplify the 666-bp fragment of actin gene. The. ANS gene expression in leaves, 15 days after pollination ... ANS expression with shading treatment was evaluated by semiquantitive RT-PCR using B. carinata variety 3H008-6.

  5. Heterologous expression of dammarenediol synthase gene in an engineered Saccharomyces cerevisiae.

    Science.gov (United States)

    Liang, Y-L; Zhao, S-J; Xu, L-X; Zhang, X-Y

    2012-11-01

    Dammarenediol production by an engineered yeast Saccharomyces cerevisiae was investigated. A dammarenediol-producing engineered yeast was constructed by heterologous expression of the dammarenediol synthase gene from Panax ginseng hairy roots through RT-PCR. Fermentation was carried out in a 5-L GRJY-bioreactor with an inoculum size of 1% v/v at 30°C. Dammarenediol detection was performed with silica gel chromatography and HPLC. Determination of dammarenediol synthase activity subcellular distribution was carried out by surveying the enzyme activity in microsomes, lipid particles and total yeast homogenate. When cultured under aerobic conditions, the engineered yeast could produce dammarenediol up to 250μgl(-1). However, when an anaerobic shift strategy was employed, dammarenediol accumulated at a level as twice as that under aerobic condition. The dammarenediol synthase and dammarenediol were mainly localized in lipid particles. Dammarenediol could be heterologously produced in engineered yeast. The heterologously expressed dammarenediol synthase is mainly localized in lipid particles. Anaerobic shift strategy could enhance the dammarenediol level in the engineered yeast. This study showed that the high-value plant product dammarenediol could be produced by heterologous expression of the according gene in yeast. Furthermore, the anaerobic shift strategy could be potentially applied in oxidosqualene-derived compounds production in yeast. Here, the information about subcellular distribution of heterologously expressed dammarenediol synthase in the engineered yeast was also provided. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  6. Cloning and expression pattern of chitin synthase (CHS) gene in ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... This study provided an important information for further research on development of RNA interference. (RNAi) technology to control E. ... transcriptional gene silencing; RNAi, RNA interference; RACE, rapid amplification of cDNA .... Alignment showed that the alternately spliced. cDNA sequence of CHS-A in ...

  7. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  8. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    For instance, downregulating the strawberry CHS resulted in enhanced production of phenylpropene aroma compounds like eugenol (Hoffmann et al. 2011). As a result, we carried out an in silico search to find the miRNAs that may target CfCHS, thereby downregulating its expression. MiRNAs are small noncoding RNAs ...

  9. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  10. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber.

    Science.gov (United States)

    Graham, IA; Leaver, CJ; Smith, SM

    1992-01-01

    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  11. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun

    2012-06-01

    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  12. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    Science.gov (United States)

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  14. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  15. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  16. Expression of monoamine transporters, nitric oxide synthase 3 and neurotrophin genes in antidepressant-stimulated astrocytes

    Directory of Open Access Journals (Sweden)

    Sarah eKittel-Schneider

    2012-04-01

    Full Text Available Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the mRNA expression of brain derived neurotrophic factor (Bdnf, serotonin transporter (5Htt, dopamine transporter (Dat and endothelial nitric oxide synthase (Nos3 was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, lead to a significant increase of the Bdnf mRNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 mRNA expression was detected in cultured astrocytes. Conclusions: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants.

  17. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  18. Carotenoid content and expression of phytoene synthase and phytoene desaturase genes in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Park, Nam Il; Lee, Sook Young; Park, Sang Un

    2011-06-15

    Momordica charantia, a tropical plant, produces a fruit that has a β-carotene concentration five times higher than that of carrot. To elucidate the molecular basis of β-carotene accumulation in M. charantia, the gene expression levels of phytoene synthase (McPSY) and phytoene desaturase (McPDS) were determined. These levels were particularly high in the flowers of M. charantia. During fruit maturation, the expression levels of McPSY and McPDS decreased during the mid-stages but increased in the fully mature fruit. In addition, carotenoids accumulated as the peel changed from green to orange. Thus, McPSY and McPDS expression correlated with carotenoid accumulation during fruit maturation. Principal component analysis (PCA) also was used to evaluate the differences among the profiles of seven carotenoids identified in the fruit at several maturation stages. Riper fruits had higher carotenoid concentrations than less ripe fruits. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  19. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...

  20. [Cloning and prokaryotic expression of Rhodoblastus acidophilus 5-aminolevlinate synthase gene].

    Science.gov (United States)

    Zhang, De-yong; Cheng, Fei-xue; Cheng, Ju-e; Zhang, Zhan-hong; Liu, Yong

    2007-08-01

    5-aminolevulinic acid (ALA) is formed by the enzyme ALA synthase (ALAS). However, the fidelity of ALAS gene among species is low. The ALAS gene of photosynthetic bacteria Rhodoblastus acidophilus was cloned from its genomic DNA by conventional PCR and Veterette PCR and further sequenced. The identity of ALAS gene among photosynthetic bacteria species is from 64.0% to 95.1% according to phylogenic analysis. Furthermore, the ALAS gene was subcloned into an expression vector pQE30. For the overproduction of ALA, the recombinant ALAS was overexpressed in Escherichia coli strains JM109, M15 and BL21 (DE3), respectively. The expected 44kD protein was detected by SDS-PAGE in three E. coli strains after IPTG induction and further purified by affinity purification on Ni-NTA. The conditions including strain, medium, substrate of ALA synthesize (glycine and succinic acid), and ALA dehydratase inhibitor (levulinic acid) were optimized for attainning the maximum yield of ALA in E. coli. The ALA production was established on E. coli M15, medium 1 supplied with 100mmol/L glycine and 50mmol/L succinic acid, and 40mmol/L levulinic acid. The activity of ALAS was up to 333U/min x mg of protein. Meanwhile, the output of ALA was reached to 5.379g/L, which is the highest yield of ALA up to date by biofermentation. ALA has a variety of agricultural applications not only as an herbicide, insecticide, and growth promoting factor, but also based on its ability to confer salt and cold temperature tolerance in plants. Our recombinant bacteria are of great potential in the production of ALA. Our results offer an easy and simple ALA mass production method and may stimulate the application of ALA in agriculture.

  1. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  2. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  3. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    Science.gov (United States)

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  4. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  5. Molecular characterization of a transient expression gene encoding for 1-aminocyclopropane-1-carboxylate synthase in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Wang, Xia; Zhang, Ying; Zhang, Jiedao; Cheng, Cheng; Guo, Xingqi

    2007-09-30

    Ethylene performs an important function in plant growth and development. 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), the key enzyme involved in ethylene biosynthesis, has been the focus of most ethylene studies. Here, a cotton ACS gene referred to as Gossypium hirsutum ACS1 (GhACS1), was isolated. The full-length cDNA of GhACS1 encodes for a 476-amino acid protein which harbors seven conserved regions, 11 invariant amino acid residues, and the PLP binding active site, all of which characterize ACC synthases. Alignment analysis showed that GhACS1 shared a high degree of identity with other known ACC synthases from different species. Two introns were detected in the genomic DNA sequence, and the results of Southern blot analysis suggested that there might be a multi-gene family encoding for ACC synthase in cotton. From the phylogenetic tree constructed with 24 different kinds of ACC synthases, we determined that GhACS1 falls into group II, and was closely associated with the wound-inducible ACS of citrus. The analysis of the 5' flanking region of GhACS1 revealed a group of putative cis-acting elements. The results of expression analysis showed that GhACS1 displayed its transient expression nature after wounding, abscisic acid (ABA), and CuCl(2) treatments. These results indicate that GhACS1, which was transiently expressed in response to certain stimuli, may be involved in the production of ethylene for the transmission of stress signals.

  6. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  7. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  8. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  9. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  10. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Science.gov (United States)

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  11. Evolution of floral scent in Clarkia: novel patterns of S-linalool synthase gene expression in the C. breweri flower.

    Science.gov (United States)

    Dudareva, N; Cseke, L; Blanc, V M; Pichersky, E

    1996-01-01

    Flowers of Clarkia breweri, an annual plant from the coastal range of California, emit a strong sweet scent of which S-linalool, an acyclic monoterpene, is a major component. Chromosomal, chemical, and morphological data, and the species' geographic distribution, suggest that C. breweri evolved from an extant nonscented species, C. concinna. A cDNA of Lis, the gene encoding S-linalool synthase, was isolated from C. breweri. We show that in C. breweri, Lis is highly expressed in cells of the transmitting tract of the stigma and style and in the epidermal cells of petals, as well as in stamens, whereas in the nonscented C. concinna, Lis is expressed only in the stigma and at a relatively low level. In both species, changes in protein levels parallel changes in mRNA levels, and changes in enzyme activity levels parallel changes in protein levels. The results indicate that in C. breweri, the expression of Lis has been upregulated and its range enlarged to include cells not expressing this gene in C. concinna. These results show how scent can evolve in a relatively simple way without the evolution of highly specialized "scent glands" and other specialized structures. Lis encodes a protein that is structurally related to the family of proteins termed terpene synthases. The protein encoded by Lis is the first member of this family found to catalyze the formation of an acyclic monoterpene. PMID:8768373

  12. Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization

    Science.gov (United States)

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  13. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Directory of Open Access Journals (Sweden)

    Takashi Kadono

    2015-08-01

    Full Text Available Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  14. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Science.gov (United States)

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  15. Malate synthase gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Williams).

    Science.gov (United States)

    Pua, Eng-Chong; Chandramouli, Sumana; Han, Ping; Liu, Pei

    2003-01-01

    Malate synthase (MS) is a key enzyme responsible for malic acid synthesis in the glyoxylate cycle, which functions to convert stored lipids to carbohydrates, by catalysing the glyoxylate condensation reaction with acetyl-CoA in the peroxisome. In this study, the cloning of an MS cDNA, designated MaMS-1, from the banana fruit is reported. MaMS-1 was 1801 bp in length encoding a single polypeptide of 556 amino acid residues. Sequence analysis revealed that MaMS-1 possessed the conserved catalytic domain and a putative peroxisomal targeting signal SK(I/L) at the carboxyl terminal. MaMS-1 also shared an extensive sequence homology (79-81.3%) with other plant MS homologues. Southern analysis indicated that MS might be present as multiple members in the banana genome. In Northern analysis, MaMS-1 was expressed specifically in ripening fruit tissue and transcripts were not detected in other organs such as roots, pseudostem, leaves, ovary, male flower, and in fruit at different stages of development. However, the transcript abundance in fruit was affected by stage of ripening, during which transcript was barely detectable at the early stage of ripening (FG and TY), but the level increased markedly in MG and in other fruits at advanced ripening stages. Furthermore, MaMS-1 expression in FG fruit could be stimulated by treatment with 1 microl l(-1) exogenous ethylene, but the stimulatory effect was abolished by the application of an ethylene inhibitor, norbornadiene. Results of this study clearly show that MS expression in banana fruit is temporally regulated during ripening and is ethylene-inducible.

  16. Enhanced cadmium resistance and accumulation in Pseudomonas putida KT2440 expressing the phytochelatin synthase gene of Schizosaccharomyces pombe.

    Science.gov (United States)

    Yong, X; Chen, Y; Liu, W; Xu, L; Zhou, J; Wang, S; Chen, P; Ouyang, P; Zheng, T

    2014-03-01

    Phytochelatins (PCs) are cysteine-rich peptides with high binding affinity for toxic metals. Expressing the PC synthase gene (PCS) in plant growth-promoting bacteria may enhance its metal resistance and accumulation, consequently increasing phytoremediation efficiency in heavy metal pollution. In this study, PCS from Schizosaccharomyces pombe was cloned and expressed in Pseudomonas putida KT2440, which was confirmed by real-time RT-PCR through an increase in SpPCS mRNA expression level when induced by 20 μmol of CdCl2 in the transformed Ps. putida cells. The recombined strain KT2440-SpPCS exhibited enhanced Cd, Ag and Hg resistance. Compared with the original strain, KT2440-SpPCS also displayed a threefold to fivefold increase in Cd accumulation (14·32 μmol g(-1) to 17·38 μmol g(-1) ; dry weight) when grown in 30 and 50 μmol CdCl2 , along with an increase in nonprotein thiols. Further experiments showed significantly enhanced germination rates and growth of wheat seeds in 0·1 mmol to 1·0 mmol Cd when inoculated with KT2440-SpPCS. This study shows potential use of Ps. putida KT2440-SpPCS in plants to construct a symbiotic system for an enhanced phytoremediation of heavy metal-contaminated environments. The symbiotic system of using plant growth-promoting bacteria Pseudomonas putida to express phytochelatin synthase gene of Schizosaccharomyces pombe together in plants resulted in high heavy metal resistance and high accumulation capacity, suggesting potential enhancement in phytoremediation of heavy metal-contaminated environments. © 2013 The Society for Applied Microbiology.

  17. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils.

    Science.gov (United States)

    Irmisch, Sandra; Krause, Sandra T; Kunert, Grit; Gershenzon, Jonathan; Degenhardt, Jörg; Köllner, Tobias G

    2012-06-08

    The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (-)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (-)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (-)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  18. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  19. Negative feedback regulation of lipopolysaccharide-induced inducible nitric oxide synthase gene expression by heme oxygenase-1 induction in macrophages.

    Science.gov (United States)

    Ashino, Takashi; Yamanaka, Rieko; Yamamoto, Masayuki; Shimokawa, Hiroaki; Sekikawa, Kenji; Iwakura, Yoichiro; Shioda, Seiji; Numazawa, Satoshi; Yoshida, Takemi

    2008-04-01

    Heme oxygenase-1 (HO-1) is induced under infectious diseases in macrophages. We performed experiments using various gene deficient mouse-derived macrophages to determine a detailed induction mechanism of HO-1 by lipopolysaccharide (LPS) and the functional role of HO-1 induction in macrophages. LPS (1 microg/mL) maximally induced inducible nitric oxide synthase (iNOS) and HO-1 mRNAs in wild-type (WT) macrophages at 6h and 12h after treatment, respectively, and liberated tumor necrosis factor alpha (TNFalpha) from WT macrophages. LPS also induced iNOS and HO-1 in TNFalpha(-/-) macrophages, but not in iNOS(-/-) macrophages. Interestingly, although LPS strongly induced iNOS, it failed to induce HO-1 almost completely in nuclear-factor erythroid 2-related factor 2 (Nrf2)(-/-) macrophages. The LPS-induced iNOS gene expression was suppressed by pretreatment with HO-1 inducers, hemin and Co-protoporphyrin (CoPP), but not with HO-1 inhibitor, Sn-protoporphyrin in WT macrophages. In the Nrf2(-/-) macrophages, the ability of CoPP to induce HO-1 and its inhibitory effect on the LPS-induced iNOS gene expression were lower than seen in WT macrophages. The present findings suggest that HO-1 is induced via NO-induced nuclear translocation of Nrf2, and the enzymatic function of HO-1 inhibits the overproduction of NO in macrophages.

  20. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase.

    Science.gov (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke

    2016-05-15

    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  1. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    Science.gov (United States)

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  2. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  3. Expression Profiles of the Trehalose-6-Phosphate Synthase Gene Associated With Thermal Stress in Ostrinia furnacalis (Lepidoptera: Crambidae)

    Science.gov (United States)

    Jin, Tingting; Gao, Yulin; He, Kanglai

    2018-01-01

    Abstract Trehalose is the major blood sugar in insects. Physiological significance of this compound has been extensively reported. Trehalose-6-phosphate synthase (TPS) is an important enzyme in the trehalose biosynthesis pathway. Full-length cDNAs of TPS (Of tps) and its alternative splicing isoform (Of tps_isoformI) were cloned from the Asian corn borer (ACB), Ostrinia furnacalis (Guenée; Lepidoptera: Crambidae) larvae. The Of tps and Of tps_isoformI transcripts were 2913 and 1689 bp long, contained 2529 and 1293 bp open reading frames encoding proteins of 842 and 430 amino acids with a molecular mass of 94.4 and 48.6 kDa, respectively. Transcriptional profiling and response to thermal stress of Of tps gene were determined by quantitative real-time PCR showing that the Of tps was predominantly expressed in the larval fat body, significantly enhanced during molting and transformation; and thermal stress also induced Of tps expression. Gene structure analysis is indicating that one TPS domain and one trehalose-6-phosphate phosphatase (TPP) domain were located at the N- and C-termini of Of        TPS, respectively, while only the TPS domain was detected in OfTPS_isoformI. Three-dimensional modeling and heterologous expression were developed to predict the putative functions of OfTPS and Of   TPS_isoformI. We infer that the expression of Of tps gene is thermally induced and might be crucial for larvae survival.

  4. Molecular cloning and expression profiling of a chalcone synthase gene from hairy root cultures of Scutellaria viscidula Bunge

    Directory of Open Access Journals (Sweden)

    Wei Lei

    2010-01-01

    Full Text Available A cDNA encoding chalcone synthase (CHS, the key enzyme in flavonoid biosynthesis, was isolated from hairy root cultures of Scutellaria viscidula Bunge by rapid amplification of cDNA ends (RACE. The full-length cDNA of S. viscidula CHS, designated as Svchs (GenBank accession no. EU386767, was 1649 bp with a 1170 bp open reading frame (ORF that corresponded to a deduced protein of 390 amino acid residues, a calculated molecular mass of 42.56 kDa and a theoretical isoelectric point (pI of 5.79. Multiple sequence alignments showed that SvCHS shared high homology with CHS from other plants. Functional analysis in silico indicated that SvCHS was a hydrophilic protein most likely associated with intermediate metabolism. The active sites of the malonyl-CoA binding motif, coumaroyl pocket and cyclization pocket in CHS of Medicago sativa were also found in SvCHS. Molecular modeling indicated that the secondary structure of SvCHS contained mainly α-helixes and random coils. Phylogenetic analysis showed that SvCHS was most closely related to CHS from Scutellaria baicalensis. In agreement with its function as an elicitor-responsive gene, the expression of Svchs was induced and coordinated by methyl jasmonate. To our knowledge, this is the first report to describe the isolation and expression of a gene from S. viscidula.

  5. VaCPK20 gene overexpression significantly increased resveratrol content and expression of stilbene synthase genes in cell cultures of Vitis amurensis Rupr.

    Science.gov (United States)

    Aleynova-Shumakova, O A; Dubrovina, A S; Manyakhin, A Y; Karetin, Y A; Kiselev, K V

    2014-06-01

    Resveratrol, a naturally occurring plant phenol, has been reported to exhibit a wide range of valuable biological and pharmacological properties. In the present investigation, we show that transformation of a Vitis amurensis Rupr. cell suspension with the gene VaCPK20 for a calcium-dependent protein kinase (CDPK) under the control of double CaMV 35S promoter increased resveratrol production in five independently transformed cell lines in 9-68 times compared with control cells. The VaCPK20-transformed calli were capable of producing 0.04-0.42 % dry wt. of resveratrol, while the control calli produced up to 0.008 % dry wt. of resveratrol Also, we characterized expression of stilbene synthase (STS) genes in the five VaCPK20-transgenic cell lines of V. amurensis. In all VaCPK20-transgenic cell lines, expression of VaSTS7 increased; while expression of VaSTS1 decreased. We suggest that transformation of V. amurensis calli with the VaCPK20 gene induced resveratrol accumulation via enhancement of expression of the VaSTS7 gene involved in resveratrol biosynthesis. The obtained data first demonstrate that overexpression of a CDPK gene resulted in increased accumulation of a stilbenoid phytoalexine in transgenic plant cells. We propose that the VaCPK20 gene could play an important role in the regulation of resveratrol biosynthesis in grape cells.

  6. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A

    1997-01-03

    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  7. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  8. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR

    NARCIS (Netherlands)

    Olawole, O.; Jacobsen, E.; Vincken, J.P.; Visser, R.G.F.

    2009-01-01

    Two transgenic potato lines, csr2–1 and csr4–8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the

  9. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides...... in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western...

  10. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips.

    Science.gov (United States)

    Yang, Ting; Stoopen, Geert; Thoen, Manus; Wiegers, Gerrie; Jongsma, Maarten A

    2013-09-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western flower thrips (WFT, Frankliniella occidentalis) showed, initially during the first 15 min of WFT release, that FaNES1 plants were significantly preferred. This gradually reversed into significant preference for the control, however, at 20-28 h after WFT release. The initial preference was shown to be based on the linalool odour of FaNES1 plants by olfactory dual-choice assays using paper discs emitting pure linalool at similar rates as leaf discs. The reversal of preference into deterrence could be explained by the initial nonvolatile composition of the FaNES1 plants, as methanolic extracts were less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Divinyl ether synthase gene and protein, and uses thereof

    Science.gov (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  12. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  13. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  15. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    Science.gov (United States)

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  16. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    Science.gov (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  17. Studies of gene expression and activity of hexokinase, phosphofructokinase and glycogen synthase in human skeletal muscle in states of altered insulin-stimulated glucose metabolism

    DEFF Research Database (Denmark)

    Vestergaard, H

    1999-01-01

    of the review is to discuss our present knowledge of the activities and gene expression of hexokinase II (HKII), phosphofructokinase (PFK) and glycogen synthase (GS) in human skeletal muscle in states of altered insulin-stimulated glucose metabolism. My own experimental studies have comprised patients...... been reported to increase the basal concentration of muscle GS mRNA in NIDDM patients to a level similar to that seen in control subjects although insulin-stimulated glucose disposal rates remain reduced in NIDDM patients. In the insulin resistant states examined so far, basal and insulin...

  18. Structure and expression profile of the sucrose synthase gene family in the rubber tree: indicative of roles in stress response and sucrose utilization in the laticifers.

    Science.gov (United States)

    Xiao, Xiaohu; Tang, Chaorong; Fang, Yongjun; Yang, Meng; Zhou, Binhui; Qi, Jiyan; Zhang, Yi

    2014-01-01

    Sucrose synthase (Sus, EC 2.4.1.13) is widely recognized as a key enzyme in sucrose metabolism in plants. However, nothing is known about this gene family in Hevea brasiliensis (para rubber tree). Here, we identified six Sus genes in H. brasiliensis that comprise the entire Sus family in this species. Analysis of the gene structure and phylogeny of the Sus genes demonstrates evolutionary conservation in the Sus families across Hevea and other plant species. The expression of Sus genes was investigated via Solexa sequencing and quantitative PCR in various tissues, at various phases of leaf development, and under abiotic stresses and ethylene treatment. The Sus genes exhibited distinct but partially redundant expression profiles. Each tissue has one abundant Sus isoform, with HbSus3, 4 and 5 being the predominant isoforms in latex (cytoplasm of rubber-producing laticifers), bark and root, respectively. HbSus1 and 6 were barely expressed in any tissue examined. In mature leaves (source), all HbSus genes were expressed at low levels, but HbSus3 and 4 were abundantly expressed in immature leaves (sink). Low temperature and drought treatments conspicuously induced HbSus5 expression in root and leaf, suggesting a role in stress responses. HbSus2 and 3 transcripts were decreased by ethylene treatment, consistent with the reduced sucrose-synthesizing activity of Sus enzymes in the latex in response to ethylene stimulation. Our results are beneficial to further determination of functions for the Sus genes in Hevea trees, especially roles in regulating latex regeneration. © 2013 FEBS.

  19. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    OpenAIRE

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focuse...

  20. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  1. Alteration of flower color in Iris germanica L. 'Fire Bride' through ectopic expression of phytoene synthase gene (crtB) from Pantoea agglomerans.

    Science.gov (United States)

    Jeknić, Zoran; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H H

    2014-08-01

    Genetic modulation of the carotenogenesis in I. germanica 'Fire Bride' by ectopic expression of a crtB gene causes several flower parts to develop novel orange and pink colors. Flower color in tall bearded irises (Iris germanica L.) is determined by two distinct biochemical pathways; the carotenoid pathway, which imparts yellow, orange and pink hues and the anthocyanin pathway, which produces blue, violet and maroon flowers. Red-flowered I. germanica do not exist in nature and conventional breeding methods have thus far failed to produce them. With a goal of developing iris cultivars with red flowers, we transformed a pink iris I. germanica, 'Fire Bride', with a bacterial phytoene synthase gene (crtB) from Pantoea agglomerans under the control of the promoter region of a gene for capsanthin-capsorubin synthase from Lilium lancifolium (Llccs). This approach aimed to increase the flux of metabolites into the carotenoid biosynthetic pathway and lead to elevated levels of lycopene and darker pink or red flowers. Iris callus tissue ectopically expressing the crtB gene exhibited a color change from yellow to pink-orange and red, due to accumulation of lycopene. Transgenic iris plants, regenerated from the crtB-transgenic calli, showed prominent color changes in the ovaries (green to orange), flower stalk (green to orange), and anthers (white to pink), while the standards and falls showed no significant differences in color when compared to control plants. HPLC and UHPLC analysis confirmed that the color changes were primarily due to the accumulation of lycopene. In this study, we showed that ectopic expression of a crtB can be used to successfully alter the color of certain flower parts in I. germanica 'Fire Bride' and produce new flower traits.

  2. Chitinase-like (CTL and cellulose synthase (CESA gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L. bast fibers.

    Directory of Open Access Journals (Sweden)

    Natalia Mokshina

    Full Text Available Plant chitinases (EC 3.2.1.14 and chitinase-like (CTL proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs, belonging to glycoside hydrolase family 19 (GH19. Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21 that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8 was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2 that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type cellulosic walls.

  3. Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

    International Nuclear Information System (INIS)

    Christie, J.M.; Jenkins, G.I.

    1996-01-01

    UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

  4. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  5. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  6. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  7. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress.

    Science.gov (United States)

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-11-01

    Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin.

    Science.gov (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge

    2008-08-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.

  9. Ambient pH controls glycogen levels by regulating glycogen synthase gene expression in Neurospora crassa. New insights into the pH signaling pathway.

    Science.gov (United States)

    Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; de Paula, Renato Magalhães; Bertolini, Maria Célia

    2012-01-01

    Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn) in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacC(KO) strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8). These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa.

  10. Ambient pH controls glycogen levels by regulating glycogen synthase gene expression in Neurospora crassa. New insights into the pH signaling pathway.

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa Cupertino

    Full Text Available Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacC(KO strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8. These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa.

  11. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    Science.gov (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  12. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  13. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  14. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The

  15. Chrysanthemum expressing a linalool synthase gene ‘smells good’, but ‘tastes bad’to western flower thrips

    NARCIS (Netherlands)

    Ting Yang, Ting; Stoopen, G.M.; Thoen, H.P.M.; Wiegers, G.L.; Jongsma, M.A.

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the

  16. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    obtained for csmA indicated that it had high similarity to class V chitin synthases. chsB and csmA disruption strains and a strain in which chsB transcription was controlled were constructed using the nitrite reductase (niiA) promoter. The strains were examined during hyphal growth by Northern analysis...

  17. Production of dammarane-type sapogenins in rice by expressing the dammarenediol-II synthase gene from Panax ginseng C.A. Mey.

    Science.gov (United States)

    Huang, Zhiwei; Lin, Juncheng; Cheng, Zuxin; Xu, Ming; Huang, Xinying; Yang, Zhijian; Zheng, Jingui

    2015-10-01

    Ginsenosides are the main active ingredients in Chinese medicinal ginseng; 2,3-oxidosqualene is a precursor metabolite to ginsenosides that is present in rice. Because rice lacks a key rate-limiting enzyme (dammarenediol-II synthase, DS), rice cannot synthesize dammarane-type ginsenosides. In this study, the ginseng (Panax ginseng CA Mey.) DS gene (GenBank: AB265170.1) was transformed into rice using agrobacterium, and 64 rice transgenic plants were produced. The Transfer-DNA (T-DNA) insertion sites in homozygous lines of the T2 generation were determined by using high-efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR) and differed in all tested lines. One to two copies of the T-DNA were present in each transformant, and real-time PCR and Western blotting showed that the transformed DS gene could be transcribed and highly expressed. High performance liquid chromatography (HPLC) analysis showed that the dammarane-type sapogenin 20(S)-protopanaxadiol (PPD) content was 0.35-0.59 mg/g dw and the dammarane-type sapogenin 20(S)-protopanaxatriol (PPT) content was 0.23-0.43 mg/g dw in the transgenic rice. LC/MS analysis confirmed production of PPD and PPT. These results indicate that a new "ginseng rice" germplasm containing dammarane-type sapogenins has been successfully developed by transforming the ginseng DS gene into rice. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Elevated gene expression in chalcone synthase enzyme suggests an increased production of flavonoids in skin and synchronized red cell cultures of North American native grape berries.

    Science.gov (United States)

    Davis, Gina; Ananga, Anthony; Krastanova, Stoyanka; Sutton, Safira; Ochieng, Joel W; Leong, Stephen; Tsolova, Violetka

    2012-06-01

    Anthocyanins are antioxidants and are among the natural products synthesized via the flavonoid biosynthesis pathway. Anthocyanins have been recommended for dietary intake in the prevention of cardiovascular diseases, cancer, and age-related conditions such as Alzheimer's disease or dementia. With an increasingly aging population in many parts of the world, strategies for the commercial production of in vitro synchronized red cell cultures as natural antioxidants will be a significant contribution to human medicine. Red pigmented fruits such as grapes (Vitis sp.) are a major source of bioavailable anthocyanins and other polyphenols. Since the level of antioxidants varies among cultivars, this study is the first one that phytochemically and genetically characterizes native grape cultivars of North America to determine the optimal cultivar and berry cells for the production of anthocyanins as antioxidants. Using real-time PCR and bioinformatics approaches, we tested for the transcript expression of the chalcone synthase (CHS) gene, an enzyme involved in the flavonoid and anthocyanin biosynthesis pathway, in different parts of physiologically mature grape berries and in vitro synchronized red cells. A low level of expression was recorded in berry flesh, compared with an elevated expression in berry skins and in vitro synchronized red cells, suggesting increased production of flavonoids in skin and cell cultures. This preliminary study demonstrates the potential of functional genomics in natural products research as well as in systematic studies of North American native grapes, specifically in muscadine (Vitis rotundifolia).

  19. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  20. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  1. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  2. Expression of the aldehyde oxidase 3, ent-copalyl diphosphate synthase, and VIVIPAROUS 1 genes in wheat cultivars differing in their susceptibility to pre-harvest sprouting

    Directory of Open Access Journals (Sweden)

    Magdalena Simlat

    2017-04-01

    Full Text Available The quality of wheat grains is often negatively affected by pre-harvest sprouting (PHS, a complex trait with a poorly understood genetic background. In this study two wheat cultivars differing in their susceptibility to PHS were used to investigate expression of three genes: AAO3, CPS3 and VP1. AAO3 is coding for aldehyde oxidase 3, an enzyme involved in the synthesis of abscisic acid. CPS3 codes for ent-copalyl diphosphate synthase which belongs to the pathway of gibberellic acid synthesis. The product of VP1 (VIVIPAROUS 1 is a transcription factor which controls expression of the former two genes. The study was carried out using both developing and sprouting-induced grains. In Piko, a wheat cultivar susceptible to PHS, accumulation of the AAO3 transcript was significantly decreased, during the last stages of grain development, in comparison to Sława, a cultivar tolerant to PHS. In case of the CPS3 and VP1 transcripts, the differences between cultivars were especially evident from 17th to 31st day after pollination. In turn, after induction of sprouting within spikes, accumulation of the AAO3 and VP1 mRNA in the Sława grains was lower in comparison to that observed in the Piko grains. Moreover, accumulation of the CPS3 transcript was significantly higher for Piko than for Sława, both in sprouting and non-sprouting grains. According to our knowledge this report provides the first description of the AAO3 and CPS3 expression in the context of PHS, and in the future it would be valuable to correlate this information with the data on the accumulation of ABA and GA3.

  3. Forest tent caterpillars (Malacosoma disstria) induce local and systemic diurnal emissions of terpenoid volatiles in hybrid poplar (Populus trichocarpa x deltoides): cDNA cloning, functional characterization, and patterns of gene expression of (-)-germacrene D synthase, PtdTPS1.

    Science.gov (United States)

    Arimura, Gen-Ichiro; Huber, Dezene P W; Bohlmann, Jörg

    2004-02-01

    Feeding forest tent caterpillars (FTCs) induced local and systemic diurnal emissions of (-)-germacrene D, along with (E)-beta-ocimene, linalool, (E)-4,8-dimethyl-1,3,7-nonatriene (DMNT), benzene cyanide, and (E,E)-alpha-farnesene, from leaves of hybrid poplar. FTC feeding induced substantially higher levels of volatiles in local and systemic leaves than did mechanical wounding. A full-length poplar sesquiterpene synthase cDNA (PtdTPS1) was isolated and functionally identified as (-)-germacrene D synthase. Expression of PtdTPS1, expression of genes of early, intermediate and late steps in terpenoid biosynthesis, and expression of a lipoxygenase gene (PtdLOX1) were analyzed in local FTC-infested and systemic leaves. Transcript levels of PtdTPS1 and PtdLOX1 were strongly increased in response to herbivory. PtdTPS1 was also induced by mechanical wounding or by methyl jasmonate (MeJA) treatment. FTC feeding did not affect transcript levels of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (DXR), and isoprene synthase (IPS). Two other TPS genes, PtdTPS2 and PtTPS3, and farnesyl diphosphate synthase were only very transiently induced. These results illustrate differential expression of terpenoid pathway genes in response to insect feeding and a key function of (-)-germacrene D synthase PtdTPS1 for herbivore-induced local and systemic volatile emissions in hybrid poplar. FTC-induced transcripts of PtdTPS1 followed diurnal rhythm. Spatial patterns of FTC-induced PtdTPS1 transcript accumulation revealed acropetal but not basipetal direction of the systemic response. Implications for tritrophic poplar-FTC-predator/parasitoid interactions are discussed.

  4. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    Science.gov (United States)

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  5. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    OpenAIRE

    Shuiyuan Cheng; Xiaohui Wang; Feng Xu; Qiangwen Chen; Tingting Tao; Jing Lei; Weiwei Zhang; Yongling Liao; Jie Chang; Xingxiang Li

    2016-01-01

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was c...

  6. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  7. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  8. Analysis of cellulose synthase genes from domesticated apple identifies collinear genes WDR53 and CesA8A: partial co-expression, bicistronic mRNA, and alternative splicing of CESA8A.

    Science.gov (United States)

    Guerriero, Gea; Spadiut, Oliver; Kerschbamer, Christine; Giorno, Filomena; Baric, Sanja; Ezcurra, Inés

    2012-10-01

    Cellulose synthase (CesA) genes constitute a complex multigene family with six major phylogenetic clades in angiosperms. The recently sequenced genome of domestic apple, Malus×domestica, was mined for CesA genes, by blasting full-length cellulose synthase protein (CESA) sequences annotated in the apple genome against protein databases from the plant models Arabidopsis thaliana and Populus trichocarpa. Thirteen genes belonging to the six angiosperm CesA clades and coding for proteins with conserved residues typical of processive glycosyltransferases from family 2 were detected. Based on their phylogenetic relationship to Arabidopsis CESAs, as well as expression patterns, a nomenclature is proposed to facilitate further studies. Examination of their genomic organization revealed that MdCesA8-A is closely linked and co-oriented with WDR53, a gene coding for a WD40 repeat protein. The WDR53 and CesA8 genes display conserved collinearity in dicots and are partially co-expressed in the apple xylem. Interestingly, the presence of a bicistronic WDR53-CesA8A transcript was detected in phytoplasma-infected phloem tissues of apple. The bicistronic transcript contains a spliced intergenic sequence that is predicted to fold into hairpin structures typical of internal ribosome entry sites, suggesting its potential cap-independent translation. Surprisingly, the CesA8A cistron is alternatively spliced and lacks the zinc-binding domain. The possible roles of WDR53 and the alternatively spliced CESA8 variant during cellulose biosynthesis in M.×domestica are discussed.

  9. Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory.

    Science.gov (United States)

    Gomaa, Lamis; Loscar, Michael E; Zein, Haggag S; Abdel-Ghaffar, Nahed; Abdelhadi, Abdelhadi A; Abdelaal, Ali S; Abdallah, Naglaa A

    2017-08-08

    Isoprene represents a key building block for the production of valuable materials such as latex, synthetic rubber or pharmaceutical precursors and serves as basis for advanced biofuel production. To enhance the production of the volatile natural hydrocarbon isoprene, released by plants, animals and bacteria, the Kudzu isoprene synthase (kIspS) gene has been heterologously expressed in Bacillus subtilis DSM 402 and Bacillus licheniformis DSM 13 using the pHT01 vector. As control, the heterologous expression of KIspS in E. coli BL21 (DE3) with the pET28b vector was used. Isoprene production was analyzed using Gas Chromatography Flame Ionization Detector. The highest isoprene production was observed by recombinant B. subtilis harboring the pHT01-kIspS plasmid which produced 1434.3 μg/L (1275 µg/L/OD) isoprene. This is threefold higher than the wild type which produced 388 μg/L (370 μg/L/OD) isoprene, when both incubated at 30 °C for 48 h and induced with 0.1 mM IPTG. Additionally, recombinant B. subtilis produced fivefold higher than the recombinant B. licheniformis, which produced 437.2 μg/L (249 μg/L/OD) isoprene when incubated at 37 °C for 48 h induced with 0.1 mM IPTG. This is the first report of optimized isoprene production in B. licheniformis. However, recombinant B. licheniformis showed less isoprene production. Therefore, recombinant B. subtilis is considered as a versatile host for heterologous production of isoprene.

  10. Heterologous expression of pentalenene synthase (PSS) from Streptomyces UC5319 in Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Melillo, Elena; Muntendam, Remco; Quax, Wim J.; Kayser, Oliver

    2012-01-01

    For the first time, the pentalenene synthase (PSS) gene from Streptomyces UC5319 was expressed in Xanthophyllomyces dendrorhous, a native producer of astaxanthin. For the expression of the gene and the concurrent knock out of the native crtE or crtYB genes, two new vectors were engineered and used

  11. The Effect of Artemisia fragrans Willd: Essential Oil on Inducible Nitric Oxide Synthase Gene Expression and Nitric Oxide Production in Lipopolysaccharide-stimulated Murine Macrophage Cell Line.

    Science.gov (United States)

    Farghadan, Maryam; Ghafoori, Hosein; Vakhshiteh, Faezeh; Shahzadeh Fazeli, Seyed Abolhassan; Farzaneh, Parvaneh; Kokhaei, Parviz

    2016-12-01

    The genus Artemisia is estimated to comprise over 800 species with anti-cancer, anti-fungal, anti-oxidant and anti-inflammatory properties. Artemisia fragrans (A. fragrans), a species that belongs to genus Artemisia, is rich in monoterpenes and sesquiterpenes derivatives. Due to anti-inflammatory properties of monoterpenes and sesquiterpenes, we aimed to investigate the effect of A. fragrans essential oil on mRNA expression of inducible nitric oxide synthase (iNOS) gene and nitric oxide (NO) production in Lipopolysaccharide (LPS) -stimulated RAW264.7 cell line. NO, which is synthesized by iNOS, is the main macrophage-derived inflammatory mediator. The oil obtained from the A. fragrans was prepared from aerial parts of the plant. Chemical composition of essential oil was analyzed by gas chromatography-mass spectrometry (GC/MS).The cytotoxicity of various concentrations of essential oil was evaluated by mitochondrial reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) test assay. The effect of different doses (1.75-7 mg/mL) of A. fragrans oil on mRNA expression of iNOS gene and NO production in LPS-stimulated RAW 264.7 cells was assessed by real-time PCR method and Griess reagent, respectively. In GC/MS analyses of A. fragrans oil, 32 compounds were identified. The main components of the oil were camphor and 1, 8-cineole. The results demonstrated that the essential oil of A. fragrans (1.75- 7 mg/mL), in a dose-dependent manner, inhibits mRNA expression of iNOS induced by LPS in the RAW264.7 cells without cytotoxic effect even at higher doses. The results of iNOS were consistent with the results of NO production. Our preliminary results suggest the possible anti-inflammatory effect of A. fragrans. Further studies are needed to determine the full pharmacokinetics of A. fragrans activity in vivo.

  12. Nodule-enhanced expression of a sucrose phosphate synthase gene member (MsSPSA) has a role in carbon and nitrogen metabolism in the nodules of alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Aleman, Lorenzo; Ortega, Jose Luis; Martinez-Grimes, Martha; Seger, Mark; Holguin, Francisco Omar; Uribe, Diana J; Garcia-Ibilcieta, David; Sengupta-Gopalan, Champa

    2010-01-01

    Sucrose phosphate synthase (SPS) catalyzes the first step in the synthesis of sucrose in photosynthetic tissues. We characterized the expression of three different isoforms of SPS belonging to two different SPS gene families in alfalfa (Medicago sativa L.), a previously identified SPS (MsSPSA) and two novel isoforms belonging to class B (MsSPSB and MsSPSB3). While MsSPSA showed nodule-enhanced expression, both MsSPSB genes exhibited leaf-enhanced expression. Alfalfa leaf and nodule SPS enzymes showed differences in chromatographic and electrophoretic migration and differences in V (max) and allosteric regulation. The root nodules in legume plants are a strong sink for photosynthates with its need for ATP, reducing power and carbon skeletons for dinitrogen fixation and ammonia assimilation. The expression of genes encoding SPS and other key enzymes in sucrose metabolism, sucrose phosphate phosphatase and sucrose synthase, was analyzed in the leaves and nodules of plants inoculated with Sinorhizobium meliloti. Based on the expression pattern of these genes, the properties of the SPS isoforms and the concentration of starch and soluble sugars in nodules induced by a wild type and a nitrogen fixation deficient strain, we propose that SPS has an important role in the control of carbon flux into different metabolic pathways in the symbiotic nodules.

  13. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  14. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  15. Effects of an Antimutagenic 1,4-Dihydropyridine AV-153 on Expression of Nitric Oxide Synthases and DNA Repair-related Enzymes and Genes in Kidneys of Rats with a Streptozotocin Model of Diabetes Mellitus.

    Science.gov (United States)

    Ošiņa, Kristīne; Rostoka, Evita; Isajevs, Sergejs; Sokolovska, Jelizaveta; Sjakste, Tatjana; Sjakste, Nikolajs

    2016-11-01

    Development of complications of diabetes mellitus (DM), including diabetic nephropathy, is a complex multi-stage process, dependent on many factors including the modification of nitric oxide (NO) production and an impaired DNA repair. The goal of this work was to study in vivo effects of 1,4-dihydropyridine AV-153, known as antimutagen and DNA binder, on the expression of several genes and proteins involved in NO metabolism and DNA repair in the kidneys of rats with a streptozotocin (STZ)-induced model of DM. Transcription intensity was monitored by means of real-time RT-PCR and the expression of proteins by immunohistochemistry. Development of DM significantly induced PARP1 protein expression, while AV-153 (0.5 mg/kg) administration decreased it. AV-153 increased the expression of Parp1 gene in the kidneys of both intact and diabetic animals. Expression of H2afx mRNA and γH2AX histone protein, a marker of DNA breakage, was not changed in diabetic animals, but AV-153 up-regulated the expression of the gene without any impact on the protein expression. Development of DM was followed by a significant increase in iNOS enzyme expression, while AV-153 down-regulated the enzyme expression up to normal levels. iNos gene expression was also found to be increased in diabetic animals, but unlike the protein, the expression of mRNA was found to be enhanced by AV-153 administration. Expression of both eNOS protein and eNos gene in the kidneys was down-regulated, and the administration of AV-153 normalized the expression level. The effects of the compound in the kidneys of diabetic animals appear to be beneficial, as a trend for the normalization of expression of NO synthases is observed. © 2016 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  16. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases.

    Science.gov (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E

    1990-09-11

    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  17. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    DEFF Research Database (Denmark)

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  18. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  19. DHEA and non-alcoholic fat liver disease: increased gene expression of peroxisome proliferation-activated receptor γ (PPARγ and fatty acid synthase (FAS

    Directory of Open Access Journals (Sweden)

    Felipe Natali Almeida

    2014-05-01

    Full Text Available Dehydroespiandrosterone (DHEA is associated with improvements in chronic degenerative diseases, including obesity, insulin resistance, and cardiovascular diseases. Nevertheless, it is observed an increase in its concentration in individuals with liver lipid infiltration, but it is not precise if this condition emerges as a cause or a consequence. In this way, we aimed to identify gene expression alterations in lipid and glucose liver metabolism markers, as well as oxidative stress markers. For this purpose, male Wistar rats, 12-14 months old were treated with subcutaneous injections of DHEA (only dose of 10 mg kg-1; and after 7 days, hepatic gene expression by PCR real time were performed for the following genes:  G6Pase, PEPCK, FAS, PPARγ, malic enzyme, ChREBP, LXR, catalase, GPx, iNOS, NADPH oxidase subunits and PCNA. We observed a tendency of reduction in G6Pase gene expression in treated group (p = 0.08. In addition, it was identified an increase in liver PPARγ and FAS gene expressions, two markers of increased activity of lipogenic pathway. We also observed an increase in iNOS gene expression, a known inductor of systemic and hepatic insulin resistance. In conclusion, our data indicates that the treatment with DHEA can be associated with the development of liver lipid infiltration and hepatic insulin resistance.

  20. The role of hexokinases from grape berries (Vitis vinifera L.) in regulating the expression of cell wall invertase and sucrose synthase genes.

    Science.gov (United States)

    Wang, X Q; Li, L M; Yang, P P; Gong, C L

    2014-02-01

    In plants, hexokinase (HXK, EC 2.7.1.1) involved in hexose phosphorylation, plays an important role in sugar sensing and signaling. In this study, we found that at Phase I of grape berry development, lower hexose (glucose or fructose) levels were concomitant with higher HXK activities and protein levels. After the onset of ripening, we demonstrated a drastic reduction in HXK activity and protein levels accompanied by a rising hexose level. Therefore, our results revealed that HXK activity and protein levels had an inverse relationship with the endogenous glucose or fructose levels during grape berry development. A 51 kDa HXK protein band was detected throughout grape berry development. In addition, HXK located in the vacuoles, cytoplasm, nucleus, proplastid, chloroplast, and mitochondrion of the berry flesh cells. During grape berry development, HXK transcriptional level changed slightly, while cell wall invertase (CWINV) and sucrose synthase (SuSy) expression was enhanced after véraison stage. Intriguingly, when sliced grape berries were incubated in different glucose solutions, CWINV and SuSy expression was repressed by glucose, and the intensity of repression depended on glucose concentration and incubation time. After sliced, grape berries were treated with different glucose analogs, CWINV and SuSy expression analyses revealed that phosphorylation of hexoses by hexokinase was an essential component in the glucose-dependent CWINV and SuSy expression. In the meantime, mannoheptulose, a specific inhibitor of hexokinase, blocked the repression induced by glucose on CWINV and SuSy expression. It suggested that HXK played a major role in regulating CWINV and SuSy expression during grape berry development.

  1. Nitric Oxide Synthase in the Central Nervous System and Peripheral Organs of Stramonita haemastoma: Protein Distribution and Gene Expression in Response to Thermal Stress

    Science.gov (United States)

    Toni, Mattia; De Angelis, Federica; Bonaccorsi di Patti, Maria Carmela; Cioni, Carla

    2015-01-01

    Nitric oxide (NO) is generated via the oxidation of l-arginine by the enzyme NO synthase (NOS) both in vertebrates and invertebrates. Three NOS isoforms, nNOS, iNOS and eNOS, are known in vertebrates, whereas a single NOS isoform is usually expressed in invertebrates, sharing structural and functional characteristics with nNOS or iNOS depending on the species. The present paper is focused on the constitutive Ca2+/calmodulin-dependent nNOS recently sequenced by our group in the neogastropod Stramonita haemastoma (ShNOS). In this paper we provide new data on cellular distribution of ShNOS in the CNS (pedal ganglion) and peripheral organs (osphradium, tentacle, eye and foot) obtained by WB, IF, CM and NADPHd. Results demonstrated that NOS-like proteins are widely expressed in sensory receptor elements, neurons and epithelial cells. The detailed study of NOS distribution in peripheral and central neurons suggested that NOS is both intracellular and presynaptically located. Present findings confirm that NO may have a key role in the central neuronal circuits of gastropods and in sensory perception. The physiological relevance of NOS enzymes in the same organs was suggested by thermal stress experiments demonstrating that the constitutive expression of ShNOS is modulated in a time- and organ-dependent manner in response to environmental stressors. PMID:26528988

  2. Nitric Oxide Synthase in the Central Nervous System and Peripheral Organs of Stramonita haemastoma: Protein Distribution and Gene Expression in Response to Thermal Stress

    Directory of Open Access Journals (Sweden)

    Mattia Toni

    2015-10-01

    Full Text Available Nitric oxide (NO is generated via the oxidation of l-arginine by the enzyme NO synthase (NOS both in vertebrates and invertebrates. Three NOS isoforms, nNOS, iNOS and eNOS, are known in vertebrates, whereas a single NOS isoform is usually expressed in invertebrates, sharing structural and functional characteristics with nNOS or iNOS depending on the species. The present paper is focused on the constitutive Ca2+/calmodulin-dependent nNOS recently sequenced by our group in the neogastropod Stramonita haemastoma (ShNOS. In this paper we provide new data on cellular distribution of ShNOS in the CNS (pedal ganglion and peripheral organs (osphradium, tentacle, eye and foot obtained by WB, IF, CM and NADPHd. Results demonstrated that NOS-like proteins are widely expressed in sensory receptor elements, neurons and epithelial cells. The detailed study of NOS distribution in peripheral and central neurons suggested that NOS is both intracellular and presynaptically located. Present findings confirm that NO may have a key role in the central neuronal circuits of gastropods and in sensory perception. The physiological relevance of NOS enzymes in the same organs was suggested by thermal stress experiments demonstrating that the constitutive expression of ShNOS is modulated in a time- and organ-dependent manner in response to environmental stressors.

  3. gene structure, gene expression

    Indian Academy of Sciences (India)

    and seedling leaves were sampled at 6 h after the treatment. For cold stress, the seedlings were transferred to 4◦C growth chamber for 30 min. Control seedlings were exposed to none of these treatments. To examine the expression patterns of these predicted genes in Poplar and to further confirm their stress responsive-.

  4. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  5. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.).

    Science.gov (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D

    2008-04-30

    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  6. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  7. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana.

    Science.gov (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  8. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Science.gov (United States)

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis.

    Science.gov (United States)

    Gao, Yuan; Li, Jun; Pan, Xukun; Liu, Dingrong; Napier, Richard; Dong, Liyao

    2018-04-01

    We previously reported that the mechanism of quinclorac resistance in Echinochloa crus-galli var. zelayensis may be closely related to ethylene biosynthesis and the detoxification of cyanide. Differences in EcCAS gene sequences and expression levels may result in higher capacity to detoxify cyanide in resistant biotypes, which may avoid cyanide accumulation and avoid more ethylene and cyanide production and then avoid damage. In the present study, we focused on the mechanism of resistance related to ethylene biosynthesis in E. crus-galli var. zelayensis. The fresh weight of susceptible and moderately resistant biotypes were significantly reduced after treatment with quinclorac. However, AOA, an ethylene biosynthesis inhibitor, reduced the impact of quinclorac. On pretreatment with AOA, ethylene production was significantly reduced in the three biotypes. The highly resistant biotype produced less ethylene compared to the other two biotypes. Three ACS and seven ACO genes, which are the key genes in ethylene biosynthesis, were obtained. The expression levels of EcACS-like, EcACS7, and EcACO1 varied in the three biotypes upon treatment with quinclorac, which could be manipulated by AOA. In summary, it is inferred that the expression of EcACS-like, EcACS7, and EcACO1 can be stimulated to varying extent after quinclorac treatment in three E. crus-galli var. zelayensis biotypes, which consequently results in varying levels of ethylene production. Lower expression of these three genes results in more resistance to quinclorac, which may also be related to quinclorac resistance in E. crus-galli var. zelayensis. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  11. Optimization of expression and properties of the recombinant acetohydroxyacid synthase of Thermotoga maritima

    Directory of Open Access Journals (Sweden)

    Mohammad S. Eram

    2015-12-01

    Full Text Available The data provide additional support of the characterization of the biophysical and biochemical properties of the enzyme acetohydroxyacid synthase from the hyperthermophilic bacterium Thermotoga maritima (Eram et al., 2015 [1]. The genes encoding the enzyme subunits have been cloned and expressed in the mesophilic host Escherichia coli. Detailed data include information about the optimization of the expression conditions, biophysical properties of the enzyme and reconstitution of the holoenzyme from individually expressed and purified subunits.

  12. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance.

    Science.gov (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg

    2014-08-22

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.

    2001-01-01

    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  14. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  15. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S. (Univ. of Texas Medical School, Houston (United States))

    1991-03-15

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-({sup 35}S)methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate.

  16. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  17. Engineering Isoprene Synthase Expression and Activity in Cyanobacteria.

    Science.gov (United States)

    Chaves, Julie E; Rueda-Romero, Paloma; Kirst, Henning; Melis, Anastasios

    2017-12-15

    Efforts to heterologously produce quantities of isoprene hydrocarbons (C 5 H 8 ) renewably from CO 2 and H 2 O through the photosynthesis of cyanobacteria face barriers, including low levels of recombinant enzyme accumulation compounded by their slow innate catalytic activity. The present work sought to alleviate the "expression level" barrier upon placing the isoprene synthase (IspS) enzyme in different fusion configurations with the cpcB protein, the highly expressed β-subunit of phycocyanin. Different cpcB*IspS fusion constructs were made, distinguished by the absence or presence of linker amino acids between the two proteins. Composition of linker amino acids was variable with lengths of 7, 10, 16, and 65 amino acids designed to test for optimal activity of the IspS through spatial positioning between the cpcB and IspS. Results showed that fusion constructs with the highly expressed cpcB gene, as the leader sequence, improved transgene expression in the range of 61 to 275-fold over what was measured with the unfused IspS control. However, the specific activity of the IspS enzyme was attenuated in all fusion transformants, possibly because of allosteric effects exerted by the leader cpcB fusion protein. This inhibition varied depending on the nature of the linker amino acids between the cpcB and IspS proteins. In terms of isoprene production, the results further showed a trade-off between specific activity and transgenic enzyme accumulation. For example, the cpcB*L7*IspS strain showed only about 10% the isoprene synthase specific-activity of the unfused cpcB-IspS control, but it accumulated 254-fold more IspS enzyme. The latter more than countered the slower specific activity and made the cpcB*L7*IspS transformant the best isoprene producing strain in this work. Isoprene to biomass yield ratios improved from 0.2 mg g -1 in the unfused cpcB-IspS control to 5.4 mg g -1 in the cpcB*L7*IspS strain, a 27-fold improvement.

  18. Expression of Inducible Nitric Oxide Synthase in the Epithelial ...

    African Journals Online (AJOL)

    Conclusion: iNOS was over expressed in OKCs when compared with DC and RC suggesting that iNOS may contribute to the aggressive behavior of OKC. This is yet another evidence to support that OKC is the neoplasm. Keywords: Dentigerous cyst, Immunohistochemistry, Inducible nitric oxide synthase, Odontogenic ...

  19. Cloning and expression analysis of 1-deoxy-D-xylulose-5-phosphate synthase gene from the medicinal plant Conyza blinii H.Lév.

    OpenAIRE

    SUN, Rong; LIU, Shan; GAO, Jing-Lei; TANG, Zi-Zhong; CHEN, Hui; LI, Cheng-Lei; WU, Qi

    2015-01-01

    Conyza blinii H.Lév. is a traditional Chinese medicinal plant that is distributed mainly in southwestern Sichuan and northern Yunnan. Its characteristic product is blinin, which has, among other properties, antigastric ulcer activity, and can serve as a quality-control standard for such medicine. The problem is that C. blinii only produces low yields of blinin. As a diterpene, blinin is likely formed by the methylerythritol phosphate pathway. While 1-deoxy-D-xylulose-5-phosphate synthase (DXS...

  20. Heterologous expression of an active chitin synthase from Rhizopus oryzae.

    Science.gov (United States)

    Salgado-Lugo, Holjes; Sánchez-Arreguín, Alejandro; Ruiz-Herrera, José

    2016-12-01

    Chitin synthases are highly important enzymes in nature, where they synthesize structural components in species belonging to different eukaryotic kingdoms, including kingdom Fungi. Unfortunately, their structure and the molecular mechanism of synthesis of their microfibrilar product remain largely unknown, probably because no fungal active chitin synthases have been isolated, possibly due to their extreme hydrophobicity. In this study we have turned to the heterologous expression of the transcript from a small chitin synthase of Rhizopus oryzae (RO3G_00942, Chs1) in Escherichia coli. The enzyme was active, but accumulated mostly in inclusion bodies. High concentrations of arginine or urea solubilized the enzyme, but their dilution led to its denaturation and precipitation. Nevertheless, use of urea permitted the purification of small amounts of the enzyme. The properties of Chs1 (Km, optimum temperature and pH, effect of GlcNAc) were abnormal, probably because it lacks the hydrophobic transmembrane regions characteristic of chitin synthases. The product of the enzyme showed that, contrasting with chitin made by membrane-bound Chs's and chitosomes, was only partially in the form of short microfibrils of low crystallinity. This approach may lead to future developments to obtain active chitin synthases that permit understanding their molecular mechanism of activity, and microfibril assembly. Copyright © 2016. Published by Elsevier Inc.

  1. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  2. Association of a Soybean Raffinose Synthase Gene with Low Raffinose and Stachyose Seed Phenotype

    Directory of Open Access Journals (Sweden)

    Emily C. Dierking

    2008-11-01

    Full Text Available Oligosaccharides are an important component of soybean [ (L. Merr.] meal in terms of metabolizable energy for monogastric animals. Sucrose, raffinose, and stachyose are the three main oligosaccharides present in soybean meal. Of the three, only sucrose is nutritionally useful. When raffinose and stachyose are fermented by microbes present in the gut, the results are flatulence and discomfort, which ultimately lead to poor weight gain. The long term objective of this research is ultimately to increase the nutritional value of soybean meal by elevating the metabolizable energy at the expense of raffinose and stachyose through the manipulation of soybean raffinose synthase, the key enzyme for raffinose and stachyose biosynthesis. The objectives of this work were to develop molecular genetic information about soybean raffinose synthases and to evaluate the candidate raffinose synthase genes in a soybean germplasm accession (PI 200508 that contains low levels of raffinose and stachyose. Our results indicate the soybean genome contains at least two expressed genes similar to other characterized raffinose synthases. A novel allele of one of these putative soybean raffinose synthase genes was discovered from the PI 200508 that completely associates with the low raffinose and stachyose phenotype. Molecular marker assays specific for the PI 200508 allele were developed to allow direct selection for the low raffinose and low stachyose phenotype.

  3. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  4. Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis.

    Science.gov (United States)

    Kato, Shota; Takaichi, Shinichi; Ishikawa, Takahiro; Asahina, Masashi; Takahashi, Senji; Shinomura, Tomoko

    2016-01-05

    Euglena gracilis, a unicellular phytoflagellate within Euglenida, has attracted much attention as a potential feedstock for renewable energy production. In outdoor open-pond cultivation for biofuel production, excess direct sunlight can inhibit photosynthesis in this alga and decrease its productivity. Carotenoids play important roles in light harvesting during photosynthesis and offer photoprotection for certain non-photosynthetic and photosynthetic organisms including cyanobacteria, algae, and higher plants. Although, Euglenida contains β-carotene and xanthophylls (such as zeaxanthin, diatoxanthin, diadinoxanthin and 9'-cis neoxanthin), the pathway of carotenoid biosynthesis has not been elucidated. To clarify the carotenoid biosynthetic pathway in E. gracilis, we searched for the putative E. gracilis geranylgeranyl pyrophosphate (GGPP) synthase gene (crtE) and phytoene synthase gene (crtB) by tblastn searches from RNA-seq data and obtained their cDNAs. Complementation experiments in Escherichia coli with carotenoid biosynthetic genes of Pantoea ananatis showed that E. gracilis crtE (EgcrtE) and EgcrtB cDNAs encode GGPP synthase and phytoene synthase, respectively. Phylogenetic analyses indicated that the predicted proteins of EgcrtE and EgcrtB belong to a clade distinct from a group of GGPP synthase and phytoene synthase proteins, respectively, of algae and higher plants. In addition, we investigated the effects of light stress on the expression of crtE and crtB in E. gracilis. Continuous illumination at 460 or 920 μmol m(-2) s(-1) at 25 °C decreased the E. gracilis cell concentration by 28-40 % and 13-91 %, respectively, relative to the control light intensity (55 μmol m(-2) s(-1)). When grown under continuous light at 920 μmol m(-2) s(-1), the algal cells turned reddish-orange and showed a 1.3-fold increase in the crtB expression. In contrast, EgcrtE expression was not significantly affected by the light-stress treatments examined. We identified genes

  5. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  6. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal...... and sex showed no such changes. Our data support the hypothesis that NO is a pathogenic factor in MS, and that NOS IR is strongly expressed in brain regions appearing normal by MRI...

  7. Construction of the co-expression plasmids of fostriecin polyketide synthases and heterologous expression in Streptomyces.

    Science.gov (United States)

    Su, Chun; Zhao, Xinqing; Qiu, Rongguo; Tang, Li

    2015-02-01

    Polyketides are bioactive natural products with diverse bioactivities, and heterologous production of polyketides in easily engineered microbial hosts is preferred for the production of structurally diverse and the therapeutically active polyketides. In this study, heterologous expression of the biosynthetic genes encoding type I polyketide synthases (PKS) involved in biosynthesis of fostriecin, a unique phosphate monoester polyketide antibiotic, was attempted. Fostriecin PKS (Fos-PKS) biosynthetic gene cluster in a total of 48.4 kb were cloned downstream of the act I promoter in two compatible Streptomyces vectors using Red/ET recombination. The co-expression plasmids were sequentially transferred into Streptomyces lividans and Streptomyces coelicolor. Active transcription of the polyketide genes was confirmed by reverse transcription PCR (RT-PCR) analysis, and the metabolites were detected using high-performance liquid chromatography (HPLC). The recombinant strains S. lividans TK24/p6-fosAB-p4-fosCDEF and S. coelicolor M512/p6-fosAB-p4-fosCDEF were obtained for heterologous expression in Streptomyces. Pigmentation was observed in the recombinant strains, whereas the control strain with empty vector displayed no change in pigment production. Active transcription of the polyketide genes was confirmed by RT-PCR analysis and subsequent sequencing. The present study is the first attempt to overexpress Fos-PKS biosynthetic gene cluster in Streptomyces. More studies on heterologous expression of the fostriecin biosynthetic gene cluster would be beneficial for further understanding the mechanisms of its structural as well as the potential pharmaceutically effect.

  8. cDNA isolation, functional expression, and characterization of (+)-alpha-pinene synthase and (-)-alpha-pinene synthase from loblolly pine (Pinus taeda): stereocontrol in pinene biosynthesis.

    Science.gov (United States)

    Phillips, Michael A; Wildung, Mark R; Williams, David C; Hyatt, David C; Croteau, Rodney

    2003-03-15

    The complex mixture of monoterpenes, sesquiterpenes, and diterpenes that comprises oleoresin provides the primary defense of conifers against bark beetles and their associated fungal pathogens. Monoterpene synthases produce the turpentine fraction of oleoresin, which allows mobilization of the diterpene resin acid component (rosin) and is also toxic toward invading insects; this is particularly the case for alpha-pinene, a prominent bicyclic monoterpene of pine turpentine. The stereochemistry of alpha-pinene is a critical determinant of host defense capability and has implications for host selection, insect pheromone biosynthesis, and tritrophic-level interactions. Pines produce both enantiomers of alpha-pinene, which appear to arise through antipodal reaction mechanisms by distinct enzymes. Using a cDNA library constructed with mRNA from flushing needles of loblolly pine (Pinus taeda), we employed a homology-based cloning strategy to isolate, and confirm by functional expression, the genes encoding (+)-(3R:5R)-alpha-pinene synthase, (-)-(3S:5S)-alpha-pinene synthase, and several other terpene synthases. The pinene synthases, which produce mirror-image products, share only 66% amino acid identity (72% similarity) but are similar in general properties to other monoterpene synthases of gymnosperms. The stereochemical control of monoterpene cyclization reactions, the evolution of "antipodal" enzymes, and the implications of turpentine composition in ecological interactions are discussed.

  9. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained from the ... (Serrano et al., 2004),. Behcet's disease (Karasneh et al., 2005), diabetes (Monti ... EDTA-treated peripheral venous blood using the salting-out method. (Miller et al., 1988).

  10. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... necessary to map the ginkgolide pathway at the level of molecular biology. Ginkgolides belong to plant diterpenoids just like the famous anti-tumor ..... A new isopentenyl diphosphate isomerase gene from sweet cloning, characterization and color complementation. Biologia. 63(2): 221-. 226. Liao ZH, Chen ...

  11. Studies on the expression of sesquiterpene synthases using promoter-β-glucuronidase fusions in transgenic Artemisia annua L.

    Directory of Open Access Journals (Sweden)

    Hongzhen Wang

    Full Text Available In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS, epi-cedrol (ECS and β-farnesene (FS synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS, a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production.

  12. Studies on the expression of sesquiterpene synthases using promoter-β-glucuronidase fusions in transgenic Artemisia annua L.

    Science.gov (United States)

    Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E

    2013-01-01

    In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS), a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS) transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production.

  13. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  14. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  15. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  16. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    Science.gov (United States)

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future.

  17. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Genome and transcriptome-wide analyses of cellulose synthase gene superfamily in soybean.

    Science.gov (United States)

    Nawaz, Muhammad Amjad; Rehman, Hafiz Mamoon; Baloch, Faheem Shehzad; Ijaz, Babar; Ali, Muhammad Amjad; Khan, Iqrar Ahmad; Lee, Jeong Dong; Chung, Gyuhwa; Yang, Seung Hwan

    2017-08-01

    The plant cellulose synthase gene superfamily belongs to the category of type-2 glycosyltransferases, and is involved in cellulose and hemicellulose biosynthesis. These enzymes are vital for maintaining cell-wall structural integrity throughout plant life. Here, we identified 78 putative cellulose synthases (CS) in the soybean genome. Phylogenetic analysis against 40 reference Arabidopsis CS genes clustered soybean CSs into seven major groups (CESA, CSL A, B, C, D, E and G), located on 19 chromosomes (except chromosome 18). Soybean CS expansion occurred in 66 duplication events. Additionally, we identified 95 simple sequence repeat makers related to 44 CSs. We next performed digital expression analysis using publically available datasets to understand potential CS functions in soybean. We found that CSs were highly expressed during soybean seed development, a pattern confirmed with an Affymatrix soybean IVT array and validated with RNA-seq profiles. Within CS groups, CESAs had higher relative expression than CSLs. Soybean CS models were designed based on maximum average RPKM values. Gene co-expression networks were developed to explore which CSs could work together in soybean. Finally, RT-PCR analysis confirmed the expression of 15 selected CSs during all four seed developmental stages. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Recombinant gene expression protocols

    National Research Council Canada - National Science Library

    Tuan, Rocky S

    1997-01-01

    .... A fundamental requirement for successful recombinant gene expression is the design of the cloning vector and the choice of the host organism for expression. Recombinant Gene Expression Protocols grows out of the need for a laboratory manual that provides the reader the background and rationale, as well as the practical protocols for the preparation of...

  20. Expression of chalcone synthase genes in coleoptiles and primary leaves of Secale cereale L. after induction by UV radiation: evidence for a UV-protective role of the coleoptile

    International Nuclear Information System (INIS)

    Haussühl, K.; Rohde, W.; Weissenböck, G.

    1996-01-01

    Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation

  1. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    KTUZ

    2012-08-21

    Aug 21, 2012 ... Bacterial cells were cultivated aerobically on a rotary shaker (Forma Orbital, Thermo. Fisher Scientific Inc, Marietta, OH, US) at 45°C (pH 7.2) in a modified medium ... for 10 min. The pJET (resistant to ampicillin) (Fermentas UAB, ... CaCl2 were transformed by the ligation mixture for 1 h at 8°C and after heat ...

  2. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    Science.gov (United States)

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  3. Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

    Directory of Open Access Journals (Sweden)

    Wen-Qin Bai

    Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

  4. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    ... our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways ...

  5. Vitis vinifera terpenoid cyclases: functional identification of two sesquiterpene synthase cDNAs encoding (+)-valencene synthase and (-)-germacrene D synthase and expression of mono- and sesquiterpene synthases in grapevine flowers and berries.

    Science.gov (United States)

    Lücker, Joost; Bowen, Pat; Bohlmann, Jörg

    2004-10-01

    Valencene is a volatile sesquiterpene emitted from flowers of grapevine, Vitis vinifera L. A full-length cDNA from the cultivar Gewürztraminer was functionally expressed in Escherichia coli and found to encode valencene synthase (VvVal). The two major products formed by recombinant VvVal enzyme activity with farnesyl diphosphate (FPP) as substrate are (+)-valencene and (-)-7-epi-alpha-selinene. Grapevine valencene synthase is closely related to a second sesquiterpene synthase from this species, (-)-germacrene D synthase (VvGerD). VvVal and VvGerD cDNA probes revealed strong signals in Northern hybridizations with RNA isolated from grapevine flower buds. Transcript levels were lower in open pre-anthesis flowers, flowers after anthesis, or at early onset of fruit development. Similar results were obtained using a third probe, (-)-alpha-terpineol synthase, a monoterpenol synthase. Sesquiterpene synthase and monoterpene synthase transcripts were not detected in the mesocarp and exocarp during early stages of fruit development, but transcripts hybridizing with VvVal appeared during late ripening of the berries. Sesquiterpene synthase transcripts were also detected in young seeds.

  6. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  7. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  8. Identification of a novel hedycaryol synthase gene isolated from Camellia brevistyla flowers and floral scent of Camellia cultivars.

    Science.gov (United States)

    Hattan, Jun-ichiro; Shindo, Kazutoshi; Ito, Tomoko; Shibuya, Yurica; Watanabe, Arisa; Tagaki, Chie; Ohno, Fumina; Sasaki, Tetsuya; Ishii, Jun; Kondo, Akihiko; Misawa, Norihiko

    2016-04-01

    A novel terpene synthase (Tps) gene isolated from Camellia brevistyla was identified as hedycaryol synthase, which was shown to be expressed specifically in flowers. Camellia plants are very popular because they bloom in winter when other plants seldom flower. Many ornamental cultivars of Camellia have been bred mainly in Japan, although the fragrance of their flowers has not been studied extensively. We analyzed floral scents of several Camellia cultivars by gas chromatography-mass spectrometry (GC-MS) and found that Camellia brevistyla produced various sesquiterpenes in addition to monoterpenes, whereas Camellia japonica and its cross-lines produced only monoterpenes, including linalool as the main product. From a flower of C. brevistyla, we isolated one cDNA encoding a terpene synthase (TPS) comprised of 554 amino acids, which was phylogenetically positioned to a sole gene clade. The cDNA, designated CbTps1, was expressed in mevalonate-pathway-engineered Escherichia coli, which carried the Streptomyces mevalonate-pathway gene cluster in addition to the acetoacetate-CoA ligase gene. A terpene product was purified from recombinant E. coli cultured with lithium acetoacetate, and analyzed by (1)H-nulcear magnetic resonance spectroscopy ((1)H-NMR) and GC-MS. It was shown that a sesquiterpene hedycaryol was produced, because (1)H-NMR signals of the purified product were very broad, and elemol, a thermal rearrangement product from hedycaryol, was identified by GC-MS analysis. Spectroscopic data of elemol were also determined. These results indicated that the CbTps1 gene encodes hedycaryol synthase. Expression analysis of CbTps1 showed that it was expressed specifically in flowers, and hedycaryol is likely to be one of the terpenes that attract insects for pollination of C. brevistyla. A linalool synthase gene, which was isolated from a flower of Camellia saluenensis, is also described.

  9. Characterization of Squalene synthase gene from Chlorophytum borivilianum (Sant. and Fernand.).

    Science.gov (United States)

    Kalra, Shikha; Kumar, Sunil; Lakhanpal, Neha; Kaur, Jagdeep; Singh, Kashmir

    2013-07-01

    Saponins are important group of secondary metabolites known for their pharmacological properties. Chlorophytum borivilianum contains high amount of saponins and is thus, recognized as an important medicinal plant with aphrodisiac properties. Though the plant is well known for its pharmaceutical properties, there is meager information available about the genes and enzymes responsible for biosynthesis of saponins from this plant. Squalene synthase (SqS) is the key enzyme of saponin biosynthesis pathway and here, we report cloning and characterization of SqS gene from C. borivilianum. A full-length CbSqS cDNA consisting of 1,760 bp was cloned which contained an open reading frame (ORF) of 1,233 bp, encoding a protein of 411 amino acids. Analysis of deduced amino acid sequence of CbSqS predicted the presence of conserved isoprenoid family domain and catalytic sites. Phylogenetic analysis revealed that CbSqS is closer to Glycine max and monocotyledonous plants. 3D structure prediction using various programs showed CbSqS structure to be similar to SqS from other species. C-terminus truncated recombinant squalene synthase (TruncCbSqS) was expressed in E. coli M15 cells with optimum expression induced with 1 mM IPTG at 37 °C. The gene expression level was analyzed through semi-quantitative RT-PCR and was found to be higher in leaves as compared to the roots.

  10. Memory consolidation and inducible nitric oxide synthase expression during different sleep stages in Parkinson disease.

    Science.gov (United States)

    Wu, Dean; Tseng, Ing-Jy; Yuan, Rey-Yue; Hsieh, Chia-Yu; Hu, Chaur-Jong

    2014-01-01

    Parkinson disease (PD) is a neurodegenerative disease characterized by motor and nonmotor dysfunctions, which include sleep disturbances. Rapid eye movement (REM) sleep is associated with numerous physiologic changes such as memory consolidation. Compelling evidence suggests that nitric oxide (NO) is crucial to both sleep regulation and memory consolidation. In our study, we explored changes in biologic molecules during various sleep stages and the effects of sleep on memory consolidation in PD. Ten PD patients and 14 volunteers without PD participated in our study. The gene expression of inducible NO synthase (iNOS) in all sleep stages was measured using realtime polymerase chain reaction (PCR) based on polysomnography (PSG)-guided peripheral blood sampling. In addition, the efficiency of memory consolidation during the sleep of the participants was measured using the Wechsler Memory Scale, third edition (WMS-III). The iNOS expression increased in all sleep stages among the PD patients compared to the control participants, in whom iNOS expression decreased during REM sleep. Regarding memory consolidation, the performance of the controls in logic memory and the patients in visual reproduction tasks improved after sleep. The iNOS synthase expression was different from control participants among PD patients, and the expression was dissimilar in various sleep stages. Sleep might enhance memory consolidation and there are different memory consolidation profiles between PD and control participants demonstrating distinct memory consolidation profiles. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Tetrahydrobiopterin, but not L-arginine, decreases NO synthase uncoupling in cells expressing high levels of endothelial NO synthase

    NARCIS (Netherlands)

    Bevers, LM; Braam, B; Post, JA; van Zonneveld, AJ; Rabelink, TJ; Koomans, HA; Verhaar, MC; Joles, JA

    Endothelial NO synthase (eNOS) produces superoxide when depleted of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) and L-arginine by uncoupling the electron flow from NO production. High expression of eNOS has been reported to have beneficial effects in atherosclerotic arteries after relatively short

  12. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  13. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    Science.gov (United States)

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  14. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  15. Transformation of trehalose synthase gene (TPS Gene) into corn ...

    African Journals Online (AJOL)

    ARL

    2011-11-02

    Nov 2, 2011 ... heredity; as such, no improvement can be seen in this way. Therefore, using transgenic technology to .... inherited and expressed stably in transferred plants. This can be verified from the result of drought .... Is verification involved in depression of the phase transition temperature in dry phospholipids.

  16. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  17. Gene Expression Omnibus (GEO)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  18. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    and endothelial nitric oxide synthase (NOS)], and enzymatic NO synthase activity. MRI guided biopsies documented more active plaques than macroscopic examination, and histological examination revealed further lesions. Inducible NOS (iNOS) was the dominant IR isoform, while reactive astrocytes were the dominant i...

  19. Molecular cloning and expression pattern of oriental river prawn (Macrobrachium nipponense) nitric oxide synthase.

    Science.gov (United States)

    Rahman, N M A; Fu, H T; Sun, S M; Qiao, H; Jin, S; Bai, H K; Zhang, W Y; Liang, G X; Gong, Y S; Xiong, Y W; Wu, Y

    2016-08-29

    Nitric oxide synthase (NOS) produces nitric oxide (NO) by catalyzing the conversion of l-arginine to l-citrulline, with the concomitant oxidation of nicotinamide adenine dinucleotide phosphate. Recently, various studies have verified the importance of NOS invertebrates and invertebrates. However, the NOS gene family in the oriental river prawn Macrobrachium nipponense is poorly understood. In this study, we cloned the full-length NOS complementary DNA from M. nipponense (MnNOS) and characterized its expression pattern in different tissues and at different developmental stages. Real-time quantitative polymerase chain reaction (RT-qPCR) showed the MnNOS gene to be expressed in all investigated tissues, with the highest levels observed in the androgenic gland (P < 0.05). Our results revealed that the MnNOS gene may play a key role in M. nipponense male sexual differentiation. Moreover, RT-qPCR revealed that MnNOS mRNA expression was significantly increased in post-larvae 10 days after metamorphosis (P < 0.05). The expression of this gene in various tissues indicates that it may perform versatile biological functions in M. nipponense.

  20. Functional expression and characterization of sesquiterpene synthases from Artemisia annua L. using transient expression system in Nicotiana benthamiana.

    Science.gov (United States)

    Kanagarajan, Selvaraju; Muthusamy, Saraladevi; Gliszczyńska, Anna; Lundgren, Anneli; Brodelius, Peter E

    2012-07-01

    Artemisia annua L. produces a number of sesquiterpene synthases, which catalyze the conversion of farnesyl diphosphate to various sesquiterpenes. The cDNAs encoding amorpha-4,11-diene synthase (ADS), a key enzyme in the artemisinin biosynthesis, and epi-cedrol synthase (ECS), a complex sesquiterpene cyclization synthase, were cloned into Cowpea mosaic virus-based viral vector (pEAQ-HT) with Kozak consensus motif and C-terminal histidine tag. The plasmids were transformed into Agrobacterium LBA4404 and, agroinfiltrated into Nicotiana benthamiana leaves along with vector (pJL3:p19) containing Tomato bushy stunt virus post-transcriptional gene silencing suppressor. Quantitative PCR was carried out to measure the transcript levels at 0, 3, 6, 9, 12 and 15 days post-infiltration (dpi). The highest relative expression was observed at 9 dpi for both genes. Transiently expressed recombinant proteins of ADS and ECS were confirmed by SDS-PAGE and western blot. Recombinant proteins were extracted from 9 dpi leaves and purified by immobilized metal ion affinity chromatography using histidine tag, which produced yields of 90 and 96 mg kg⁻¹ fresh weight of leaves for ADS and ECS, respectively. Activities of the purified enzymes were assayed using gas chromatography-mass spectrometry for product identification and quantification using valencene as internal standard. The recombinant ADS and ECS converted farnesyl diphosphate into amorpha-4,11-diene (97 %) and epi-cedrol (96 %) as the major products, respectively. The purified enzymes exhibited the specific activity of 0.002 and 0.01 μmol min⁻¹ mg⁻¹ protein for ADS and ECS, respectively. The apparent k(cat) values were 2.1 × 10⁻³ s⁻¹ and 11 × 10⁻³ s⁻¹ for ADS and ECS, respectively. Agroinfiltration of leaves of Nicotiana bentamiana can be used to produce recombinant biosynthetic enzymes as exemplified by two sesquiterpene synthases from Artemisia annua in relatively high yields.

  1. Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found ...

  2. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  3. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  4. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  5. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  6. Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

    Science.gov (United States)

    Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

    2002-01-01

    Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

  7. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  8. Optimization of the expression of phaC2 encoding poly (3-hydroxyalkanoate synthase from Pseudomonas aeruginosa PTCC1310 in Fad B deleted Escherichia coli

    Directory of Open Access Journals (Sweden)

    Daryoush Abedi

    2016-01-01

    Conclusion: We obtained functional expression of the phaC2 gene and investigated various conditions that could influence the expression of protein to optimize production of PHA synthase enzymes. This would allow us to study PHA production in large quantities.

  9. Prostacyclin synthase expression and epigenetic regulation in nonsmall cell lung cancer.

    LENUS (Irish Health Repository)

    Cathcart, Mary-Clare

    2012-02-01

    BACKGROUND: Prostacyclin synthase (PGIS) metabolizes prostaglandin H(2), into prostacyclin. This study aimed to determine the expression profile of PGIS in nonsmall cell lung cancer (NSCLC) and examine potential mechanisms involved in PGIS regulation. METHODS: PGIS expression was examined in human NSCLC and matched controls by reverse transcriptase polymerase chain reaction (RT-PCR), Western analysis, and immunohistochemistry. A 204-patient NSCLC tissue microarray was stained for PGIS and cyclooxygenase 2 (COX2) expression. Staining intensity was correlated with clinical parameters. Epigenetic mechanisms underpinning PGIS promoter expression were examined using RT-PCR, methylation-specific PCR, and chromatin immunoprecipitation analysis. RESULTS: PGIS expression was reduced\\/absent in human NSCLC protein samples (P < .0001), but not mRNA relative to matched controls. PGIS tissue expression was higher in squamous cell carcinoma (P = .004) and in male patients (P < .05). No significant correlation of PGIS or COX2 expression with overall patient survival was observed, although COX2 was prognostic for short-term (2-year) survival (P < .001). PGIS mRNA expression was regulated by DNA CpG methylation and histone acetylation in NSCLC cell lines, with chromatin remodeling taking place directly at the PGIS gene. PGIS mRNA expression was increased by both demethylation agents and histone deacetylase inhibitors. Protein levels were unaffected by demethylation agents, whereas PGIS protein stability was negatively affected by histone deacetylase inhibitors. CONCLUSIONS: PGIS protein expression is reduced in NSCLC, and does not correlate with overall patient survival. PGIS expression is regulated through epigenetic mechanisms. Differences in expression patterns between mRNA and protein levels suggest that PGIS expression and protein stability are regulated post-translationally. PGIS protein stability may have an important therapeutic role in NSCLC.

  10. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Jimai 22 were used as an experimental model to analyse the expression patterns of wheat TPS genes .... the Bioanalyzer 2100 algorithm (Agilent Technologies, Palo. Alto, USA); high quality (RNA integrity ... software (Premier Biosoft International, Palo Alto, USA). Sequences and other information of the ...

  11. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  12. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan

    2001-01-01

    of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  13. Molecular cloning and spatiotemporal expression of prostaglandin F synthase and microsomal prostaglandin E synthase-1 in porcine endometrium.

    Science.gov (United States)

    Waclawik, Agnieszka; Rivero-Muller, Adolfo; Blitek, Agnieszka; Kaczmarek, Monika M; Brokken, Leon J S; Watanabe, Kikuko; Rahman, Nafis A; Ziecik, Adam J

    2006-01-01

    Endometrial prostaglandins (PGs) and the PGE2/PGF2alpha ratio play an important role in regulating the estrous cycle and establishment of pregnancy. The enzymes downstream of cyclooxygenase-2 may determine the PGE2/PGF2alpha ratio in the porcine uterus. Thus, we have cloned porcine PGF synthase (PGFS) and microsomal PGE synthase-1 (mPGES-1) and characterized their expression in porcine endometrium during the estrous cycle and early pregnancy. PGFS and mPGES-1 amino acid sequences possessed a high degree (>67% and >77%, respectively) of identity with the other mammalian homologs. There was little modulation of mPGES-1 throughout the estrous cycle; however, PGFS expression was highly up-regulated in endometrium around the time of luteolysis. During early pregnancy, PGFS at the protein level showed a time-dependent increase (low on d 10-13, intermediate on d 14-23, and high on d 24-25). In pregnancy, expression of mPGES-1 was intermediate on d 10-11 and low on d 14-17 and then increased after d 22, reaching the maximum on d 24-25. Immunohistochemistry showed localization of PGFS and mPGES-1 proteins mainly in luminal and glandular epithelium. Concluding, the spatiotemporal expression of PGFS throughout the estrous cycle indicates an involvement of PGFS in regulating luteolysis in the pig. The comparison of endometrial PGFS and mPGES-1 expression on d 10-13 of the estrous cycle and pregnancy suggest a supportive role of these enzymes in determining the increase of uterine PGE2/PGF2alpha ratio during maternal recognition of pregnancy. Moreover, high expression of both PG synthases after initiation of implantation may indicate their significant role in placentation.

  14. Stable expression of a bifunctional diterpene synthase in the chloroplast of Chlamydomonas reinhardtii

    DEFF Research Database (Denmark)

    Zedler, Julie Annemarie Zita; Gangl, Doris; Hamberger, Björn Robert

    2015-01-01

    the generation of transgenic lines without the use of antibiotic-resistance genes. Here, we have expressed a bifunctional diterpene synthase in C. reinhardtii chloroplasts. Homoplasmic transformants were obtained with the expressed enzyme accounting for 3.7 % of total soluble protein. The enzyme was purified...... to homogeneity and expression was shown to have a small but reproducible effect on growth rate at the end of log phase growth. These results demonstrate that large recombinant enzymes can be synthesised in the algal chloroplast, and serve to underline its potential as a platform for the biosynthesis of novel...

  15. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    Science.gov (United States)

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  16. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  17. Expression, crystallization and structure elucidation of γ-terpinene synthase from Thymus vulgaris.

    Science.gov (United States)

    Rudolph, Kristin; Parthier, Christoph; Egerer-Sieber, Claudia; Geiger, Daniel; Muller, Yves A; Kreis, Wolfgang; Müller-Uri, Frieder

    2016-01-01

    The biosynthesis of γ-terpinene, a precursor of the phenolic isomers thymol and carvacrol found in the essential oil from Thymus sp., is attributed to the activitiy of γ-terpinene synthase (TPS). Purified γ-terpinene synthase from T. vulgaris (TvTPS), the Thymus species that is the most widely spread and of the greatest economical importance, is able to catalyze the enzymatic conversion of geranyl diphosphate (GPP) to γ-terpinene. The crystal structure of recombinantly expressed and purified TvTPS is reported at 1.65 Å resolution, confirming the dimeric structure of the enzyme. The putative active site of TvTPS is deduced from its pronounced structural similarity to enzymes from other species of the Lamiaceae family involved in terpenoid biosynthesis: to (+)-bornyl diphosphate synthase and 1,8-cineole synthase from Salvia sp. and to (4S)-limonene synthase from Mentha spicata.

  18. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  19. Gene therapy of transplant arteriopathy by liposome-mediated transfection of endothelial nitric oxide synthase.

    Science.gov (United States)

    Iwata, A; Sai, S; Moore, M; Nyhuis, J; de Fries-Hallstrand, R; Quetingco, G C; Allen, M D

    2000-11-01

    Transplant arteriopathy is the major factor limiting long-term survival after cardiac transplantation. We have previously demonstrated that liposome-mediated gene delivery of endothelial nitric oxide synthase (eNOS) to donor hearts reduces ischemia-reperfusion injury by blocking NFkappaB activation, adhesion molecule expression, and leukocyte infiltration. In this study, we used gene transfer of eNOS in a rabbit carotid transplant model to see whether these same effects would similarly ameliorate transplant arteriopathy. Liposomes complexed to the gene encoding eNOS were injected into donor carotid arterial segments that were transplanted orthotopically into recipient carotid arteries (n = 10). Controls included transplanted carotids transfected with liposomes complexed to empty plasmids (no functional gene) (n = 4) and transplanted carotids treated with saline (n = 6). Transplanted arteries were harvested for processing at 21 days. Intima/media (I/M) area ratios were calculated by computerized image analysis. Infiltrating T-lymphocytes and macrophages, and expression of VCAM-1 and ICAM-1 were quantified on immunocytochemistry. The I/M ratio was significantly reduced in eNOS-transfected arteries compared with arteries transfected with empty plasmids and saline-treated controls. Compared to transplanted control arteries, eNOS-transfected arteries demonstrated significantly reduced T-cell infiltration into the intima and significantly reduced macrophage infiltration into the media. Cell surface expression of VCAM-1 and ICAM-1 were both reduced in eNOS-transfected arteries. ENOS gene delivery can suppress neointimal lesion formation and T-lymphocyte and macrophage infiltration in transplanted arteries, associated with a reduction in relevant adhesion molecule expression. Thus, gene therapy with eNOS may not only reduce ischemia-reperfusion injury but may also ameliorate transplant arteriopathy in transplanted hearts.

  20. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. Copyright © 2014. Published by Elsevier Inc.

  1. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  2. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  3. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  4. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  5. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  6. Cyclooxygenase 2 and neuronal nitric oxide synthase expression in the renal cortex are not interdependent in states of salt deficiency

    DEFF Research Database (Denmark)

    Castrop, H; Kammerl, M; Mann, Birgitte

    2000-01-01

    Neuronal nitric oxide synthase (nNOS) and cyclooxygenase-2 (COX-2) expression in the kidney are localized to the cortical thick ascending limb of the loop of Henle (cTALH), including the macula region, and increase after salt restriction. Because of the similar localization and regulation of n...... excretion. These findings suggest that under these conditions the control of nNOS and COX-2 gene expression in the macula densa regions of the kidney cortex are not dependent on each other....

  7. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  8. Cloning, expression and purification of squalene synthase from Candida tropicalis in Pichia pastoris.

    Science.gov (United States)

    Lee, Pey Yee; Yong, Voon Chen; Rosli, Rozita; Gam, Lay Harn; Chong, Pei Pei

    2014-02-01

    Squalene synthase (SS) is the key precursor and first committed enzyme of the sterol biosynthesis pathway. In a previous work, SS has been identified as one of the immunogenic proteins that could be a potential diagnostic candidate for the pathogenic fungus Candida tropicalis. In this study, SS from C. tropicalis was cloned and expressed as recombinant protein in Pichia pastoris to investigate its reactivity with serum antibodies. ERG9 gene that encodes for SS was amplified by PCR and cloned in-frame into pPICZB expression vector. The recombinant construct was then transformed into P. pastoris GS115 host strain. Expression of the recombinant protein was confirmed by SDS-PAGE and Western blot analysis using anti-His tag probe. Optimal protein production was achieved by cultivating the culture with 1.0% methanol for 72h. The recombinant protein was purified to approximately 97% pure in a single step immobilized metal affinity chromatography with a yield of 70.3%. Besides, the purified protein exhibited specific reactivity with immune sera on Western blot. This is the first report on heterologous expression of antigenic SS from C. tropicalis in P. pastoris which can be exploited for large-scale production and further research. The results also suggested that the protein might be of great value as antigen candidate for serodiagnosis of Candida infection. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Regulation of expression, activity and localization of fungal chitin synthases

    Science.gov (United States)

    Rogg, Luise E.; Fortwendel, Jarrod R.; Juvvadi, Praveen R.; Steinbach, William J.

    2013-01-01

    The fungal cell wall represents an attractive target for pharmacologic inhibition, as many of the components are fungal-specific. Though targeted inhibition of β-glucan synthesis is effective treatment for certain fungal infections, the ability of the cell wall to dynamically compensate via the cell wall integrity pathway may limit overall efficacy. To date, chitin synthesis inhibitors have not been successfully deployed in the clinical setting. Fungal chitin synthesis is a complex and highly regulated process. Regulation of chitin synthesis occurs on multiple levels, thus targeting of these regulatory pathways may represent an exciting alternative approach. A variety of signaling pathways have been implicated in chitin synthase regulation, at both transcriptional and post-transcriptional levels. Recent research suggests that localization of chitin synthases likely represents a major regulatory mechanism. However, much of the regulatory machinery is not necessarily shared among different chitin synthases. Thus, an in depth understanding of the precise roles of each protein in cell wall maintenance and repair will be essential to identifying the most likely therapeutic targets. PMID:21526913

  10. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  11. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  12. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    Science.gov (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  13. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  14. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  15. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  16. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  17. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  18. Gene Expression in Bone

    Science.gov (United States)

    D'Ambrogio, A.

    Skeletal system has two main functions, to provide mechanical integrity for both locomotion and protection and to play an important role in mineral homeostasis. There is extensive evidence showing loss of bone mass during long-term Space-Flights. The loss is due to a break in the equilibrium between the activity of osteoblasts (the cells that forms bone) and the activity of osteoclasts (the cells that resorbs bone). Surprisingly, there is scanty information about the possible altered gene expression occurring in cells that form bone in microgravity.(Just 69 articles result from a "gene expression in microgravity" MedLine query.) Gene-chip or microarray technology allows to screen thousands of genes at the same time: the use of this technology on samples coming from cells exposed to microgravity could provide us with many important informations. For example, the identification of the molecules or structures which are the first sensors of the mechanical stress derived from lack of gravity, could help in understanding which is the first event leading to bone loss due to long-term exposure to microgravity. Consequently, this structure could become a target for a custom-designed drug. It is evident that bone mass loss, observed during long-time stay in Space, represents an accelerated model of what happens in aging osteoporosis. Therefore, the discovery and design of drugs able to interfere with the bone-loss process, could help also in preventing negative physiological processes normally observed on Earth. Considering the aims stated above, my research is designed to:

  19. The Control and Importance of Hyaluronan Synthase Expression in Palatogenesis

    Directory of Open Access Journals (Sweden)

    Jennifer eGalloway

    2013-02-01

    Full Text Available Development of the lip and palate involves a complex series of events that requires the close co-ordination of cell migration, growth, differentiation and apoptosis. Palatal shelf elevation is considered to be driven by regional accumulation and hydration of glycosoaminoglycans, principally hyaluronan (HA, which provides an intrinsic shelf force, directed by components of the extracellular matrix (ECM. During embryogenesis, the extracellular and pericellular matrix surrounding migrating and proliferating cells is rich in HA. This would suggest that HA may be important in both shelf growth and fusion. TGFβ3 plays an important role in palatogenesis and the corresponding homozygous null (TGFβ3 -/- mouse, exhibits a defect in the fusion of the palatal shelves resulting in clefting of the secondary palate. TGFβ3 is expressed at the future medial edge epithelium (MEE and at the actual edge epithelium during E14.5, suggesting a role for TGFβ3 in fusion. This is substantiated by experiments showing that addition of exogenous TGFβ3 can ‘rescue’ the cleft palate phenotype in the null mouse. In addition, TGFβ1 and TGFβ2 can rescue the null mouse palate (in vitro to near normal fusion. In vivo a TGFβ1 knock-in mouse, where the coding region of the TGFβ3 gene was replaced with the full-length TGFβ1 cDNA, displayed complete fusion at the mid portion of the secondary palate, whereas the anterior and posterior regions failed to fuse appropriately. We present experimental data indicating that the three Has enzymes are differentially expressed during palatogenesis. Using immunohistochemistry and embryo sections from the TGFβ3 null mouse at days E13.5 and E14.5, it was established that there was a decrease in expression of Has2 in the mesenchyme and an increase in expression of Has3 in comparison to the wild type mouse. In vitro data indicate that HA synthesis is affected by addition of exogenous TGFβ3. Preliminary data suggests that this increase

  20. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutat...

  1. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis of 3-methyl...

  2. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  3. Heterologous Gene Expression of N-Terminally Truncated Variants of LipPks1 Suggests a Functionally Critical Structural Motif in the N-terminus of Modular Polyketide Synthase

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Bailey, Constance B.; Fujii, Tatsu A.

    2017-01-01

    Streptomyces-derived, Well-characterized modular, polyketide synthase (PKS). Using this enzyme as a model, we experimentally investigated the effects of alternative TSSs using a heterologous host, Streptomyces venezuelae. One of the TSSs employed boosted the protein level by 59-fold and the product yield by 23...

  4. Expression pattern and biochemical properties of zebrafish N-acetylglutamate synthase.

    Directory of Open Access Journals (Sweden)

    Ljubica Caldovic

    Full Text Available The urea cycle converts ammonia, a waste product of protein catabolism, into urea. Because fish dispose ammonia directly into water, the role of the urea cycle in fish remains unknown. Six enzymes, N-acetylglutamate synthase (NAGS, carbamylphosphate synthetase III, ornithine transcarbamylase, argininosuccinate synthase, argininosuccinate lyase and arginase 1, and two membrane transporters, ornithine transporter and aralar, comprise the urea cycle. The genes for all six enzymes and both transporters are present in the zebrafish genome. NAGS (EC 2.3.1.1 catalyzes the formation of N-acetylglutamate from glutamate and acetyl coenzyme A and in zebrafish is partially inhibited by L-arginine. NAGS and other urea cycle genes are highly expressed during the first four days of zebrafish development. Sequence alignment of NAGS proteins from six fish species revealed three regions of sequence conservation: the mitochondrial targeting signal (MTS at the N-terminus, followed by the variable and conserved segments. Removal of the MTS yields mature zebrafish NAGS (zfNAGS-M while removal of the variable segment from zfNAGS-M results in conserved NAGS (zfNAGS-C. Both zfNAGS-M and zfNAGS-C are tetramers in the absence of L-arginine; addition of L-arginine decreased partition coefficients of both proteins. The zfNAGS-C unfolds over a broader temperature range and has higher specific activity than zfNAGS-M. In the presence of L-arginine the apparent Vmax of zfNAGS-M and zfNAGS-C decreased, their Km(app for acetyl coenzyme A increased while the Km(app for glutamate remained unchanged. The expression pattern of NAGS and other urea cycle genes in developing zebrafish suggests that they may have a role in citrulline and/or arginine biosynthesis during the first day of development and in ammonia detoxification thereafter. Biophysical and biochemical properties of zebrafish NAGS suggest that the variable segment may stabilize a tetrameric state of zfNAGS-M and that under

  5. Studies on the Expression of Sesquiterpene Synthases Using Promoter-?-Glucuronidase Fusions in Transgenic Artemisia annua L

    OpenAIRE

    Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.

    2013-01-01

    In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expressio...

  6. The polyketide synthase gene pks4 of Trichoderma reesei provides pigmentation and stress resistance.

    Science.gov (United States)

    Atanasova, Lea; Knox, Benjamin P; Kubicek, Christian P; Druzhinina, Irina S; Baker, Scott E

    2013-11-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi.

  7. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  8. Transgenic peas (Pisum sativum) expressing polygalacturonase inhibiting protein from raspberry (Rubus idaeus) and stilbene synthase from grape (Vitis vinifera).

    Science.gov (United States)

    Richter, A; Jacobsen, H-J; de Kathen, A; de Lorenzo, G; Briviba, K; Hain, R; Ramsay, G; Kiesecker, H

    2006-11-01

    The pea (Pisum sativum L.) varieties Baroness (United Kingdome) and Baccara (France) were transformed via Agrobacterium tumefaciens-mediated gene transfer with pGPTV binary vectors containing the bar gene in combination with two different antifungal genes coding for polygalacturonase-inhibiting protein (PGIP) from raspberry (Rubus idaeus L.) driven by a double 35S promoter, or the stilbene synthase (Vst1) from grape (Vitis vinifera L.) driven by its own elicitor-inducible promoter. Transgenic lines were established and transgenes combined via conventional crossing. Resveratrol, produced by Vst1 transgenic plants, was detected using HPLC and the PGIP expression was determined in functional inhibition assays against fungal polygalacturonases. Stable inheritance of the antifungal genes in the transgenic plants was demonstrated.

  9. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

    Science.gov (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

    2004-08-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  10. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang

    2018-01-01

    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  11. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Science.gov (United States)

    Tang, Bin; Wang, Su; Wang, Shi-Gui; Wang, Hui-Juan; Zhang, Jia-Yong; Cui, Shuai-Ying

    2018-01-01

    The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects. PMID:29445344

  12. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  13. Frequent epigenetic silencing of the folate-metabolising gene cystathionine-beta-synthase in gastrointestinal cancer.

    Directory of Open Access Journals (Sweden)

    Hong Zhao

    Full Text Available Both gastric and colorectal cancers (CRC are the most frequently occurring malignancies worldwide with the overall survival of these patients remains unsatisfied. Identification of tumor suppressor genes (TSG silenced by promoter CpG methylation uncovers mechanisms of tumorigenesis and identifies new epigenetic biomarkers for early cancer detection and prognosis assessment. Cystathionine-beta-synthase (CBS functions in the folate metabolism pathway, which is intricately linked to methylation of genomic DNA. Dysregulation of DNA methylation contributes substantially to cancer development.To identify potential TSGs silenced by aberrant promoter methylation in CRC, we analyzed tumor and adjacent tissues from CRC cases using the Illumina Human Methylation45 BeadChip. We identified hypermethylation of the CBS gene in CRC samples, compared to adjacent tissues. Methylation and decreased mRNA expression of CBS were detected in most CRC cell lines by methylation-specific PCR and semiquantitative RT-PCR, as well as in gastric cancer. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin A reversed methylation and restored CBS mRNA expression indicating a direct effect. Aberrant methylation was further detected in 31% of primary CRCs (29 of 96 and 55% of gastric tumors (11 of 20. In contrast, methylation was seldom found in normal tissues adjacent to the tumor. CBS methylation was associated with KRAS mutations in primary CRCs (P = 0.04, by χ(2-test. However, no association was found between CBS methylation or KRAS mutations with cancer relapse/metastasis in Stage II CRC patients.A novel finding from this study is that the folate metabolism enzyme CBS mRNA levels are frequently downregulated through CpG methylation of the CBS gene in gastric cancer and CRC, suggesting that CBS functions as a tumor suppressor gene. These findings warrant further study of CBS as an epigenetic biomarker for molecular diagnosis of gastrointestinal cancers.

  14. Prognostic significance of numeric aberrations of genes for thymidylate synthase, thymidine phosphorylase and dihydrofolate reductase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Søren Astrup; Vainer, B.; Witton, C.J.

    2008-01-01

    ) in colorectal cancer, and to evaluate its prognostic significance following adjuvant chemotherapy, since these enzymes are closely related to efficacy of 5-fluorouracil (5FU). PATIENTS AND METHODS: Consecutive patients (n = 314), who were completely resected for colorectal cancer stages II-IV and adjuvantly......BACKGROUND: Most human cancer cells have structural aberrations of chromosomal regions leading to loss or gain of gene specific alleles. This study aimed to assess the range of gene copies per nucleus of thymidylate synthase (TYMS), thymidine phosphorylase (TP) and dihydrofolate reductase (DHFR...... the median were compared. Also TYMS expression, assessed by immunohistochemistry, was associated with TYMS copies per nucleus. RESULTS: The number of gene copies per nucleus were 1.7 (0.7-2.8), 1.8 (0.9-3.1) and 1.8 (1.1-2.7) median (range) for TYMS, TP and DHFR, respectively. TYMS expression was directly...

  15. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  16. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  17. Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

    DEFF Research Database (Denmark)

    Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

    2005-01-01

    Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular...

  18. Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

    DEFF Research Database (Denmark)

    Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

    2005-01-01

    Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascul...

  19. Constitutive expression of inducible nitric oxide synthase in the normal human colonic epithelium

    DEFF Research Database (Denmark)

    Perner, A; Andresen, Lars; Normark, M

    2002-01-01

    Inducible nitric oxide synthase (iNOS) in the human colon is considered expressed only in inflammatory states such as ulcerative or collagenous colitis. As subtle iNOS labelling was previously observed in some colonic mucosal biopsies from a heterogeneous group of controls with non-inflamed bowel...

  20. Linalool and linalool nerolidol synthases in roses, several genes for little scent.

    Science.gov (United States)

    Magnard, Jean-Louis; Bony, Aurélie Rius; Bettini, Fabienne; Campanaro, Ausilia; Blerot, Bernard; Baudino, Sylvie; Jullien, Frédéric

    2018-03-11

    Roses are widely appreciated for the appearance of their flowers and for their fragrance. This latter character results from the combination of different odorant molecules among which monoterpenes are often prevalent constituents. In this study, we report the cloning and characterization of three rose monoterpene synthases. In vitro functional characterization of these enzymes showed that one is a (-)-(3R)-linalool synthase whereas the others have a dual (+)-(3S)-linalool nerolidol synthase activity. However, given that the characterized rose cultivars were only able to produce the (-)-(3R)-linalool stereoisomer, the linalool nerolidol synthases are probably not active in planta. Furthermore, these three enzymes were also characterized by a weak expression level as assessed by RT-qPCR and by the low abundance of the corresponding sequences in an EST library. This characteristic is likely to explain why linalool is generally a minor constituent in rose flowers' scents. On this basis, we propose that in roses the monoterpene biosynthesis effort is focused on the production of acyclic monoterpenes derived from geraniol through the recently characterized Nudix biosynthesis pathway, at the expense of conventional monoterpene biosynthesis via terpene synthases such as linalool or linalool nerolidol synthases. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  1. Evolution of gene expression after gene amplification.

    Science.gov (United States)

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim

    2015-04-24

    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat-maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that γ-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a γ-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. How complex an intron may be? The example of the first intron of the CTP synthase gene of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Roberto Piergentili

    2013-02-01

    Full Text Available In eukaryotes, maturation of primary transcripts into mature messenger RNAs involves the elimination of parts of the gene called ‘introns’. The biological significance of introns is not yet completely understood. It has been demonstrated that introns may contain other genes, or regulatory sequences that may be involved in transcriptional control, or also being involved in alternative splicing mechanisms. However, these functions explain the role of only a small number of them, and it is very difficult to formulate any generalization. The CTP synthase gene of Drosophila melanogaster is characterized by the presence of a long first intron (approximately 7.2 kilobases whose role is currently unknown. In the present report we analyzed in silico the content of this intron, and found that it contains at least three interesting sub-sequences. Two of them are homologous to the CTP synthase itself and to a putative nucleotide pyrophosphatase, respectively. The third is a short stretch of DNA able to fold into a thermodynamically stable hairpin and showing homology with other 19 sequences from 21 genes inside the D. melanogaster genome. These findings suggest a complex yet very accurate way of controlling gene expression inside the fruit fly.

  3. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  4. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  5. Development of a human mitochondrial oligonucleotide microarray (h-MitoArray) and gene expression analysis of fibroblast cell lines from 13 patients with isolated F1Fo ATP synthase deficiency

    Czech Academy of Sciences Publication Activity Database

    Čížková, Alena; Stránecký, V.; Ivánek, Robert; Hartmannová, H.; Nosková, L.; Piherová, L.; Tesařová, M.; Hansíková, H.; Honzík, T.; Zeman, J.; Divina, Petr; Potocká, A.; Paul, J.; Sperl, W.; Mayr, J. A.; Seneca, S.; Houštěk, J.; Kmoch, S.

    2008-01-01

    Roč. 9, - (2008), s. 38-38 ISSN 1471-2164 R&D Projects: GA ČR(CZ) GD303/03/H065; GA ČR(CZ) GA303/07/0781 Grant - others:GA MZd(CZ) NR8069 Institutional research plan: CEZ:AV0Z50110509; CEZ:AV0Z50520514 Keywords : microarray * mitochondria * F1Fo ATP synthase deficiency Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.926, year: 2008

  6. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  7. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  8. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  9. Differential Gene Expression and Aging

    Directory of Open Access Journals (Sweden)

    Laurent Seroude

    2002-01-01

    Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.

  10. Homologous and heterologous expression of grapevine E-(β)-caryophyllene synthase (VvGwECar2).

    Science.gov (United States)

    Salvagnin, Umberto; Carlin, Silvia; Angeli, Sergio; Vrhovsek, Urska; Anfora, Gianfranco; Malnoy, Mickael; Martens, Stefan

    2016-11-01

    E-(β)-caryophyllene is a sesquiterpene volatile emitted by plants and involved in many ecological interactions within and among trophic levels and it has a kairomonal activity for many insect species. In grapevine it is a key compound for host-plant recognition by the European grapevine moth, Lobesia botrana, together with other two sesquiterpenes. In grapevine E-(β)-caryophyllene synthase is coded by the VvGwECar2 gene, although complete characterization of the corresponding protein has not yet been achieved. Here we performed the characterization of the enzyme after heterologous expression in E. coli, which resulted to produce in vitro also minor amounts of the isomer α-humulene and of germacrene D. The pH optimum was estimated to be 7.8, and the K m and K cat values for farnesyl pyrophosphate were 31.4 μM and 0.19 s -1 respectively. Then, we overexpressed the gene in the cytoplasm of two plant species, Arabidopsis thaliana and the native host Vitis vinifera. In Arabidopsis the enzyme changed the plant head space release, showing a higher selectivity for E-(β)-caryophyllene, but also the production of thujopsene instead of germacrene D. Overall plants increased the E-(β)-caryophyllene emission in the headspace collection by 8-fold compared to Col-0 control plants. In grapevine VvGwECar2 overexpression resulted in higher E-(β)-caryophyllene emissions, although there was no clear correlation between gene activity and sesquiterpene quantity, suggesting a key role by the plant regulation machinery. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Enhanced (S)-linalool production by fusion expression of farnesyl diphosphate synthase and linalool synthase in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deng, Yu; Sun, Mingxue; Xu, Sha; Zhou, Jingwen

    2016-07-01

    In order to improve the availability of geranyl diphosphate (GPP) in the mevalonate pathway for enhancing (S)-linalool production in Saccharomyces cerevisiae. A (S)-linalool synthase (LIS): AaLS1 from Actinidia arguta was coexpressed with FPPS with different peptide linkers to redirect the flux from geranyl diphosphate (GPP) to (S)-linalool production in S. cerevisiae. The strain with the best peptide linker ((GGGGS)3 ), produced 101·55 ± 2·97 μg l(-1) (S)-linalool, a 69·7% increase compared to those with two independent LIS and FPPS expressed. In a 3-l fermenter, the (S)-linalool titre was further improved to 240·64 ± 5·31 μg l(-1) . The results demonstrate that the fusion proteins catalysing consecutive steps in a metabolic pathway significantly improved the (S)-linalool production with GPP as precursor. The fusion protein strategy co-expressing AaLS1 and FPPS, assembled with a long peptide linker made S. cerevisiae produced the highest reported (S)-Linalool titre to date. © 2016 The Society for Applied Microbiology.

  12. Molecular cloning and expression profiling of a chalcone synthase ...

    Indian Academy of Sciences (India)

    Chem. 38, 5031–5037. Liu J. M. 2006. Genetic diversity and lipophilic composition in. Lamiophlomis rotata, an endemic species of Qinghai-Tibetan plateau. Fudan University, Doctor dissertation. Lu X., Zhou W. and Gao F. 2009 Cloning, characterization and localization of CHS gene from blood orange, Citrus sinensis (L.).

  13. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi.

    Science.gov (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J

    1996-01-01

    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  14. The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

    Directory of Open Access Journals (Sweden)

    Leila Shabani

    2015-03-01

    Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

  15. Regulation of Expression of Citrate Synthase by the Retinoic Acid Receptor-Related Orphan Receptor α (RORα)

    Science.gov (United States)

    Crumbley, Christine; Wang, Yongjun; Banerjee, Subhashis; Burris, Thomas P.

    2012-01-01

    The retinoic acid receptor-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily of transcription factors that plays an important role in regulation of the circadian rhythm and metabolism. Mice lacking a functional RORα display a range of metabolic abnormalities including decreased serum cholesterol and plasma triglycerides. Citrate synthase (CS) is a key enzyme of the citric acid cycle that provides energy for cellular function. Additionally, CS plays a critical role in providing citrate derived acetyl-CoA for lipogenesis and cholesterologenesis. Here, we identified a functional RORα response element (RORE) in the promoter of the CS gene. ChIP analysis demonstrates RORα occupancy of the CS promoter and a putative RORE binds to RORα effectively in an electrophoretic mobility shift assay and confers RORα responsiveness to a reporter gene in a cotransfection assay. We also observed a decrease in CS gene expression and CS enzymatic activity in the staggerer mouse, which has a mutation of in the Rora gene resulting in nonfunctional RORα protein. Furthermore, we found that SR1001 a RORα inverse agonist eliminated the circadian pattern of expression of CS mRNA in mice. These data suggest that CS is a direct RORα target gene and one mechanism by which RORα regulates lipid metabolism is via regulation of CS expression. PMID:22485150

  16. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    International Nuclear Information System (INIS)

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-01-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd 2+ and Cu 2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd 2+ and Cu 2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu 2+ ) in A. germinans leaves

  17. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    Science.gov (United States)

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves.

  18. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  19. Cloning and characterization of cellulose synthase-like gene, PtrCSLD2 from developing xylem of aspen trees.

    Science.gov (United States)

    Samuga, Anita; Joshi, Chandrashekhar P.

    2004-04-01

    Genetic improvement of cell wall polymer synthesis in forest trees is one of the major goals of forest biotechnology that could possibly impact their end product utilization. Identification of genes involved in cell wall polymer biogenesis is essential for achieving this goal. Among various candidate cell wall-related genes, cellulose synthase-like D (CSLD) genes are intriguing due to their hitherto unknown functions in cell wall polymer synthesis but strong structural similarity with cellulose synthases (CesAs) involved in cellulose deposition. Little is known about CSLD genes from trees. In the present article PtrCSLD2, a first CSLD gene from an economically important tree, aspen (Populus tremuloides) is reported. PtrCSLD2 cDNA was isolated from an aspen xylem cDNA library and encodes a protein that shares 90% similarity with Arabidopsis AtCSLD3 protein involved in root hair tip growth. It is possible that xylem fibers that also grow by intrusive tip growth may need expression of PtrCSLD2 for controlling the length of xylem fibers, a wood quality trait of great economical importance. PtrCSLD2 protein has a N-terminal cysteine-rich putative zinc-binding domain; eight transmembrane domains; alternating conserved and hypervariable domains; and a processive glycosyltransferases signature, D, D, D, QXXRW; all similar to aspen CesA proteins. However, PtrCSLD2 shares only 43-48% overall identity with the known aspen CesAs suggesting its distinct functional role in cell wall polymer synthesis perhaps other than cellulose biosynthesis. Based on Southern analysis, the aspen CSLD gene family consists of at least three genes and this gene copy estimate is supported by phylogenetic analysis of available CSLDs from plants. Moreover, gene expression studies using RT-PCR and in situ mRNA hybridization showed that PtrCSLD2 is expressed at a low level in all aspen tissues examined with a slightly higher expression level in secondary cell wall-enriched aspen xylem as compared to

  20. Identification and characterization of genetic variation in the folylpolyglutamate synthase gene.

    Science.gov (United States)

    Leil, Tarek A; Endo, Chiaki; Adjei, Araba A; Dy, Grace K; Salavaggione, Oreste E; Reid, Joel R; Ames, Matthew M; Adjei, Alex A

    2007-09-15

    Folylpolyglutamate synthase (FPGS) catalyzes the polyglutamation of folic acid, methotrexate, and pemetrexed to produce highly active metabolites. To characterize genetic variation in the FPGS gene, FPGS, have resequenced the gene in four different ethnic populations. Thirty-four single nucleotide polymorphisms were identified including five nonsynonymous coding single nucleotide polymorphisms that altered the FPGS protein sequence: F13L and V22I polymorphisms in the mitochondrial isoform of FPGS, and R466/424C, A489/447V, and S499/457F polymorphisms, which exist in both the mitochondrial and cytosolic isoforms. When expressed in AuxB1 cells, the A447V cytosolic variant was functionally similar to the wild-type cytosolic (WT Cyt) allozyme, whereas the R424C and S457F cytosolic variants were reduced by approximately 2-fold in protein expression compared with WT Cyt (P glutamate was reduced by 12.3-fold (R424C, P < 0.01) and 6.2-fold (S457F, P < 0.01), whereas the intrinsic clearance of methotrexate was reduced by 4.2-fold (R424C, P < 0.05) and 5.4-fold (S457F, P < 0.05) in these two cytosolic variants when compared with the WT Cyt isoform. Additionally, the in vitro enzyme velocity at saturating pemetrexed concentrations was reduced by 1.6-fold (R424C, P < 0.05) and 2.6-fold (S457F, P < 0.01) compared with WT Cyt. AuxB1 cells harboring these same cytosolic variant allozymes displayed significant increases in the EC(50) for folic acid and in the IC(50) values for both methotrexate and pemetrexed relative to the WT Cyt form of FPGS. These observations suggest that genetic variations in FPGS may alter the efficacy of antifolate therapy in cancer patients.

  1. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene

    Directory of Open Access Journals (Sweden)

    Mijeong Cha1, Sang Hee Shim1, Sung Hong Kim2, Ok Tae Kim3, Se-Weon Lee4, Suk-Yoon Kwon5 & Kwang-Hyun Baek1,*

    2012-10-01

    Full Text Available Paclitaxel is produced by various species of yew trees and hasbeen extensively used to treat tumors. In our research, ataxadiene synthase (TS gene from Taxus brevifolia was used totransform the roots of cultured ginseng (Panax ginseng C.A.Meyer to produce taxadiene, the unique skeletal precursor totaxol. The TS gene was successfully introduced into theginseng genome, and the de novo formation of taxadiene wasidentified by mass spectroscopy profiling. Without any changein phenotypes or growth difference in a TS-transgenic ginsengline, the transgenic TSS3-2 line accumulated 9.1 μg taxadieneper gram of dry weight. In response to the treatment of methyljasmonate for 3 or 6 days, the accumulation was 14.6 and15.9 μg per g of dry weight, respectively. This is the first reportof the production of taxadiene by engineering ginseng rootswith a taxadiene synthase gene.

  2. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... but it was relatively lower in other three tissues. In addition, the atpA gene was successfully expressed in Escherichia coli. Key words: Sweet potato, atpA gene, gene expression, digital gene expression profiling, quantitative analysis. INTRODUCTION. Sweet potato (Ipomoea batatas L. Lam) is the seventh.

  3. Disequilibrium of flavonol synthase and dihydroflavonol-4-reductase expression associated tightly to white versus red color flower formation in plants

    Directory of Open Access Journals (Sweden)

    Ping eLuo

    2016-01-01

    Full Text Available Flower colour is the main character throughout the plant kingdom. Though substantial information exists regarding the structural and regulatory genes involved in anthocyanin and flavonol biosynthesis, little is known that what make a diverse white versus red color flower in natural species. Here, the contents of pigments in seven species from varied phylogenetic location in plants with red and white flowers.were determined. Flavonols could be detected in red and white flowers, but anthocyanins were almost undetectable in the white cultivar. Comparisons of expression patterns of gene related to the flavonoid biosynthesis indicated that disequilibrium expression of flavonol synthase (FLS and dihydroflavonol-4-reductase (DFR genes determined the accumulation of flavonols and anothcyanins in both red and white flowers of seven species. To further investigate the role of such common regulatory patterns in determining flower color, FLS genes were isolated from Rosa rugosa (RrFLS1, Prunus persica (PpFLS and Petunia hybrida (PhFLS, and DFR genes were isolated from Rosa rugosa (RrDFR1 and Petunia hybrida (PhDFR. Heterologous expression of the FLS genes within tobacco host plants demonstrated conservation of function, with the transgenes promoting flavonol biosynthesis and inhibiting anthocyanin accumulation, so resulting in white flowers. Conversely, overexpression of DFR genes in tobacco displayed down-regulation of the endogenous NtFLS gene, and the promotion of anthocyanin synthesis. On this basis, we propose a model in which FLS and DFR gene-products compete for common substrates in order to direct the biosynthesis of flavonols and anthocyanins, respectively, thereby determining white versus red coloration of flowers.

  4. Controlling Citrate Synthase Expression by CRISPR/Cas9 Genome Editing for n-Butanol Production in Escherichia coli

    DEFF Research Database (Denmark)

    Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong

    2017-01-01

    Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolical...... that redistributing carbon flux using genome editing is an efficient engineering tool for metabolite overproduction.......Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... engineered E. coli, resulting in 0.82 g/L butanol production. To increase butanol production, carbon flux from acetyl-CoA to citric acid cycle should be redirected to acetoacetyl-CoA. For this purpose, the 5′-untranslated region sequence of gltA encoding citrate synthase was designed using an expression...

  5. [Double-antisense ACC oxidase and ACC synthase fusion gene introduced into tomato by Agrobacterium-mediated transformation and analysis the ethylene production of transgenic plants].

    Science.gov (United States)

    Xiong, Ai Sheng; Yao, Quan Hong; Li, Xian; Fan, Hui Qin; Peng, Ri He

    2003-12-01

    The tomato fruit-specific promoter 2A11 was amplified from tomato genomic DNA using PCR techniques. Total RNA was isolated from ripen fruit of tomato, then ACC oxidase gene and ACC synthase gene were obtained using reverse-transcription polymerase chain reaction. The fusion encoding ACC oxidase and ACC synthase gene was obtained through ACC oxidase gene and ACC synthase gene ligation. The fusion gene was then inserted into a plant binary vector pYPX145 in an inverted orientation. Finally, the binary plant expression vector pOSACC was constructed in which the double-antisense fusion gene was controlled by fruit-specific 2A11 promoter. By using hypocotyls and cotyledon petioles as explants, the unit of double-antisense fusion gene was successfully introduced into tomato (Lycopersicon esculentum Mill) cultivar "Hezuo 903" by Agrobacterium tumefaciens-mediated transformation. 105 transgenic plants were obtained through 200 mg/L kanamycin selection and GUS assay. Two lines of DR-1 and DR-2 were obtained through selecting the characteristics of prolonged shelf life and agriculture. The transgenic plants showed the characteristics of prolonged shelf life over 50 d. The amount of ethylene released from DR-1 and DR-2 fruits were reduced significantly to about 9.5% of that released by non-transformed controls.

  6. AtCSLD3, a cellulose synthase-like gene important for root hair growth in arabidopsis.

    Science.gov (United States)

    Wang, X; Cnops, G; Vanderhaeghen, R; De Block, S; Van Montagu, M; Van Lijsebettens, M

    2001-06-01

    A member of the cellulose synthase-like (subfamily D) gene family of Arabidopsis, AtCSLD3, has been identified by T-DNA tagging. The analysis of the corresponding mutant, csld3-1, showed that the AtCSLD3 gene plays a role in root hair growth in plants. Root hairs grow in phases: First a bulge is formed and then the root hair elongates by polarized growth, the so-called "tip growth." In the mutant, root hairs were initiated at the correct position and grew into a bulge, but their elongation was severely reduced. The tips of the csld3-1 root hairs easily leaked cytoplasm, indicating that the tensile strength of the cell wall had changed at the site of the tip. Based on the mutant phenotype and the functional conservation between CSLD3 and the genuine cellulose synthase proteins, we hypothesized that the CSLD3 protein is essential for the synthesis of polymers for the fast-growing primary cell wall at the root hair tip. The distinct mutant phenotype and the ubiquitous expression pattern indicate that the CSLD3 gene product is only limiting at the zone of the root hair tip, suggesting particular physical properties of the cell wall at this specific site of the root hair cell.

  7. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    DEFF Research Database (Denmark)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens

    2009-01-01

    BACKGROUND: Microsatellite instability (MSI) refers to mutations in short motifs of tandemly repeated nucleotides resulting from replication errors and deficient mismatch repair (MMR). Colorectal cancer with MSI has characteristic biology and chemosensitivity, however the molecular basis remains...... unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. METHODS: MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS......) and dihydropyrimidine dehydrogenase (DPD) expression were assessed in paraffin embedded tumor specimens, and associated with outcome in 340 consecutive patients completely resected for colorectal cancer stages II-IV and subsequently receiving adjuvant 5-fluorouracil therapy. RESULTS: MSI was found in 43 (13.8%) tumors...

  8. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  9. Stable expression of lipocalin-type prostaglandin D synthase in cultured preadipocytes impairs adipogenesis program independently of endogenous prostanoids

    Energy Technology Data Exchange (ETDEWEB)

    Hossain, Mohammad Salim; Chowdhury, Abu Asad; Rahman, Mohammad Sharifur [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Nishimura, Kohji [Department of Molecular and Functional Genomics, Center for Integrated Research in Science, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Jisaka, Mitsuo; Nagaya, Tsutomu [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan); Shono, Fumiaki [Department of Clinical Pharmacy, Faculty of Pharmaceutical Sciences, Tokushima Bunri University, 180 Yamashiro-cho, Tokushima-shi, Tokushima 770-8514 (Japan); Yokota, Kazushige, E-mail: yokotaka@life.shimane-u.ac.jp [Department of Life Science and Biotechnology, Shimane University, 1060 Nishikawatsu-cho, Matsue, Shimane 690-8504 (Japan)

    2012-02-15

    Lipocalin-type prostaglandin D synthase (L-PGDS) expressed preferentially in adipocytes is responsible for the synthesis of PGD{sub 2} and its non-enzymatic dehydration products, PGJ{sub 2} series, serving as pro-adipogenic factors. However, the role of L-PGDS in the regulation of adipogenesis is complex because of the occurrence of several derivatives from PGD{sub 2} and their distinct receptor subtypes as well as other functions such as a transporter of lipophilic molecules. To manipulate the expression levels of L-PGDS in cultured adipocytes, cultured preadipogenic 3T3-L1 cells were transfected stably with a mammalian expression vector having cDNA encoding murine L-PGDS oriented in the sense direction. The isolated cloned stable transfectants with L-PGDS expressed higher levels of the transcript and protein levels of L-PGDS, and synthesized PGD{sub 2} from exogenous arachidonic acid at significantly higher levels. By contrast, the synthesis of PGE{sub 2} remained unchanged, indicating no influence on the reactions of cyclooxygenase (COX) and PGE synthase. Furthermore, the ability of those transfectants to synthesize {Delta}{sup 12}-PGJ{sub 2} increased more greatly during the maturation phase. The sustained expression of L-PGDS in cultured stable transfectants hampered the storage of fats during the maturation phase of adipocytes, which was accompanied by the reduced gene expression of adipocyte-specific markers reflecting the down-regulation of the adipogenesis program. The suppressed adipogenesis was not rescued by either exogenous aspirin or peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists including troglitazone and {Delta}{sup 12}-PGJ{sub 2}. Taken together, the results indicate the negative regulation of the adipogenesis program by the enhanced expression of L-PGDS through a cellular mechanism involving the interference of the PPAR{gamma} signaling pathway without the contribution of endogenous pro-adipogenic prostanoids

  10. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  11. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each......' C, and clustered Dukes' D separately. Real-time PCR of 10 known genes and 5 ESTs demonstrated excellent reproducibility of the array-based findings. The most frequently altered genes belonged to functional categories of metabolism (22%), transcription and translation (11%), and cellular processes (9...

  12. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  13. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  14. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp ...

  15. The geranylgeranyl pyrophosphate synthase gene from Ginkgo biloba

    African Journals Online (AJOL)

    polypeptide. Comparative analysis showed that GbGGDPS had a high similarity to other plant GGDPSs. Bioinformatic analysis showed that GbGGDPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the polyprenyltransferases.

  16. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  17. Human Lacrimal Gland Gene Expression.

    Directory of Open Access Journals (Sweden)

    Vinay Kumar Aakalu

    Full Text Available The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development.We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium.The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described.Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas.

  18. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  19. Cloning, expression, and characterization of soluble starch synthase I cDNA from taro (Colocasia esculenta Var. esculenta).

    Science.gov (United States)

    Lin, Da-Gin; Jeang, Chii-Ling

    2005-10-05

    Soluble starch synthase I (SSSI) cDNA was isolated from taro (Colocasia esculenta var. esculenta) by RT-PCR and rapid amplification of cDNA ends reaction. The transcript of this single-copy gene is 2340 bp and encodes 642 amino acids protein containing a putative transit peptide of 54 residues. Recombinant SSSI protein displayed both primer-dependent and primer-independent activities of starch synthase. More SSSI transcript was expressed in taro leaves than in tubers, with no evident expression in petioles; and more transcript and protein were found in tubers of 597 +/- 37 g of fresh weight than in smaller or larger ones. Two forms of SSSI, i.e., 72 and 66 kDa, exist in leaves, and only the 66 kDa form was found in tubers. The taro SSSI, proposed as a novel member, was located only in the soluble fraction of tuber extract, while SSSI from other sources exist in both soluble and granule-bound forms.

  20. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    ). SmCHS1/SmCHS3 expression in mid-flowering stage (relative to the transcript level of SmCHS2 in stem 2 of the same stage). Columns followed by the same letter are not significantly different at 5% level by LSD test. Journal of Genetics, Vol.

  1. Identification of Sporothrix schenckii based on sequences of the chitin synthase 1 gene.

    Science.gov (United States)

    Kano, R; Nakamura, Y; Watanabe, S; Tsujimoto, H; Hasegawa, A

    2001-01-01

    Sporothrix schenckii is pathogenic to human and animals. To detect S. schenckii in the tissue, we designed specific oligonucleotide primers based on the chitin synthase gene. Amplification products were selectively obtained from S. schenckii DNA. Polymerase chain reaction analysis with the primer pair S2-R2 was able to detect 10 pg genomic DNA of S. schenckii with ethidium bromide staining. This detection system will be useful as a microbiological tool for the diagnosis of human and animal sporotrichosis.

  2. Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora.

    Science.gov (United States)

    Chen, Longfei; Li, Yingying; Zhang, Qian; Wang, Dan; Akhberdi, Oren; Wei, Dongsheng; Pan, Jiao; Zhu, Xudong

    2017-02-01

    Pestalotiollide B, an analog of dibenzodioxocinones which are inhibitors of cholesterol ester transfer proteins, is produced by Pestalotiopsis microspora NK17. To increase the production of pestalotiollide B, we attempted to eliminate competing polyketide products by deleting the genes responsible for their biosynthesis. We successfully deleted 41 out of 48 putative polyketide synthases (PKSs) in the genome of NK17. Nine of the 41 PKS deleted strains had significant increased production of pestalotiollide B (P polyketides.

  3. Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens').

    Science.gov (United States)

    Jeknić, Zoran; Morré, Jeffrey T; Jeknić, Stevan; Jevremović, Sladana; Subotić, Angelina; Chen, Tony H H

    2012-11-01

    The orange color of tiger lily (Lolium lancifolium 'Splendens') flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription-PCR (RT-PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species.

  4. Isolation and characterization of drought-related trehalose 6-phosphate-synthase gene from cultivated cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Kosmas, Sotirios A; Argyrokastritis, Alexandros; Loukas, Michael G; Eliopoulos, Elias; Tsakas, Spyros; Kaltsikes, Pantouses J

    2006-01-01

    Due to the important role of cotton drought-tolerant varieties and the reported involvement in this trait of trehalose-6-phosphate-synthase, the respective gene (TPS) was isolated and characterized from cultivated cotton, Gossypium hirsutum (ZETA 2 cultivar), using a chromosome-walking technique. TPS has three exons comprising the coding region. Southern blot analysis indicated that the Gossypium genomes (A and D) contain a single copy of TPS per genome. In addition, the expression of this gene was studied in different plant tissues. Plants of the Australian cotton variety Siokra L23, known for its drought tolerance, were subjected to drought stress (using PEG 6,000 solution, for 4 h during the dark period of the day and for four consecutive days); leaves, stems and roots were collected after the end of the stress period. Total extracted RNA was examined for the presence of transcripts, in the above-mentioned tissues of stressed and well-watered plants, by reverse transcription-polymerase chain reaction (RT-PCR). The expression levels, determined semi-quantitatively, indicated that the gene was expressed in all plant tissues under both water availability conditions. However, increased expression levels of TPS were observed mainly in stressed leaves and roots compared to those of the well-watered control. This finding is in agreement with the fact that TPS participates in trehalose biosynthesis, known for its participation in stress signal transduction in higher plants.

  5. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

    2017-11-03

    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  6. Regulation of galactan synthase expression to modify galactan content in plants

    Science.gov (United States)

    None

    2017-08-22

    The disclosure provides methods of engineering plants to modulate galactan content. Specifically, the disclosure provides methods for engineering a plant to increase the galactan content in a plant tissue by inducing expression of beta-1,4-galactan synthase (GALS), modulated by a heterologous promoter. Further disclosed are the methods of modulating expression level of GALS under the regulation of a transcription factor, as well as overexpression of UDP-galactose epimerse in the same plant tissue. Tissue specific promoters and transcription factors can be used in the methods are also provided.

  7. Characterization and expression of glucosamine-6-phosphate synthase from Saccharomyces cerevisiae in Pichia pastoris.

    Science.gov (United States)

    Wang, Sheng; Li, Piwu; Su, Jing; Wu, Xiangkun; Liang, Rongrong

    2014-10-01

    Glucosamine-6-phosphate (GlcN-6-P) synthase from Saccharomyces cerevisiae was expressed in Pichia pastoris SMD1168 GIVING maximum activity of 96 U ml(-1) for the enzyme in the culture medium. By SDS-PAGE, the enzyme, a glycosylated protein, had an apparent molecular mass of 90 kDa. The enzyme was purified by gel exclusion chromatography to near homogeneity, with a 90 % yield and its properties were characterized. Optimal activities were at pH 5.5 and 55 °C, respectively, at which the highest specific activity was 6.8 U mg protein (-1). The enzyme was stable from pH 4.5 to 5.5 and from 45 to 60 °C. The Km and Vmax of the GlcN-6-P synthase towards D-fructose 6-phosphate were 2.8 mM and 6.9 μmol min(-1) mg(-1), respectively.

  8. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...

  9. Impact of drought stress on specialised metabolism: Biosynthesis and the expression of monoterpene synthases in sage (Salvia officinalis).

    Science.gov (United States)

    Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk

    2017-09-01

    In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Remote control of gene expression.

    Science.gov (United States)

    Long, Xiaochun; Miano, Joseph M

    2007-06-01

    The elucidation of a growing number of species' genomes heralds an unprecedented opportunity to ascertain functional attributes of non-coding sequences. In particular, cis regulatory modules (CRMs) controlling gene expression constitute a rich treasure trove of data to be defined and experimentally validated. Such information will provide insight into cell lineage determination and differentiation and the genetic basis of heritable diseases as well as the development of novel tools for restricting the inactivation of genes to specific cell types or conditions. Historically, the study of CRMs and their individual transcription factor binding sites has been limited to proximal regions around gene loci. Two important by-products of the genomics revolution, artificial chromosome vectors and comparative genomics, have fueled efforts to define an increasing number of CRMs acting remotely to control gene expression. Such regulation from a distance has challenged our perspectives of gene expression control and perhaps the very definition of a gene. This review summarizes current approaches to characterize remote control of gene expression in transgenic mice and inherent limitations for accurately interpreting the essential nature of CRM activity.

  11. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  12. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  13. Studies on the expression of linalool synthase using a promoter-β-glucuronidase fusion in transgenic Artemisia annua.

    Science.gov (United States)

    Wang, Hongzhen; Kanagarajan, Selvaraju; Han, Junli; Hao, Mengshu; Yang, Yiyi; Lundgren, Anneli; Brodelius, Peter E

    2014-01-15

    Artemisinin, an antimalarial endoperoxide sesquiterpene, is synthesized in glandular trichomes of Artemisia annua L. A number of other enzymes of terpene metabolism utilize intermediates of artemisinin biosynthesis, such as isopentenyl and farnesyl diphosphate, and may thereby influence the yield of artemisinin. In order to study the expression of such enzymes, we have cloned the promoter regions of some enzymes and fused them to β-glucuronidase (GUS). In this study, we have investigated the expression of the monoterpene synthase linalool synthase (LIS) using transgenic A. annua carrying the GUS gene under the control of the LIS promoter. The 652bp promoter region was cloned by the genome walker method. A number of putative cis-acting elements were predicted indicating that the LIS is driven by a complex regulation mechanism. Transgenic plants carrying the promoter-GUS fusion showed specific expression of GUS in T-shaped trichomes (TSTs) but not in glandular secretory trichomes, which is the site for artemisinin biosynthesis. GUS expression was observed at late stage of flower development in styles of florets and in TSTs and guard cells of basal bracts. GUS expression after wounding showed that LIS is involved in plant responsiveness to wounding. Furthermore, the LIS promoter responded to methyl jasmonate (MeJA). These results indicate that the promoter carries a number of cis-acting regulatory elements involved in the tissue-specific expression of LIS and in the response of the plant to wounding and MeJA treatment. Southern blot analysis indicated that the GUS gene was integrated in the A. annua genome as single or multi copies in different transgenic lines. Promoter activity analysis by qPCR showed that both the wild-type and the recombinant promoter are active in the aerial parts of the plant while only the recombinant promoter was active in roots. Due to the expression in TSTs but not in glandular trichomes, it may be concluded that LIS expression will most

  14. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  15. Modulation of cerebral RAGE expression following nitric oxide synthase inhibition in rats subjected to focal cerebral ischemia.

    Science.gov (United States)

    Greco, Rosaria; Demartini, Chiara; Zanaboni, Anna Maria; Blandini, Fabio; Amantea, Diana; Tassorelli, Cristina

    2017-04-05

    The receptor for advanced glycation endproducts (RAGE) is a key mediator of neuroinflammation following cerebral ischemia. Nitric oxide (NO) plays a dualistic role in cerebral ischemia, depending on whether it originates from neuronal, inducible or endothelial synthase. Although a dynamic interplay between RAGE and NO pathways exists, its relevance in ischemic stroke has not been investigated. The aim of this study is to evaluate the effect of the NO synthase (NOS) inhibition on RAGE expression in rats subjected to transient middle cerebral artery occlusion (tMCAo). Full-length (fl-RAGE) gene expression was elevated in the striatum and, to a lesser extent, in the cortex of rats undergone tMCAo. The exacerbation of cortical damage caused by systemic administration of L-N-(1-iminoethyl)ornithine (L-NIO), a relatively selective inhibitor of endothelial NOS (eNOS), was associated with elevated mRNA levels of interleukin (IL)-6, tumor necrosis factor (TNF)-α and fl-RAGE in both the cortex and the striatum. Conversely, NG-nitro-l-arginine methyl ester (L-NAME), a non-selective NOS inhibitor, decreased cortical damage, did not affect cerebral cytokine mRNA levels, while it increased fl-RAGE mRNA expression only in the striatum. Fl-RAGE striatal protein levels varied accordingly with observed mRNA changes in the striatum, while in the cortex, RAGE protein levels were reduced by tMCAo and further decreased following L-NIO treatment. Modulation of RAGE expression by different inhibitors of NOS may have opposite effects on transient cortical ischemia: the non selective inhibition of NOS activity is protective, while the selective inhibition of eNOS is harmful, probably via the activation of inflammatory pathways. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  17. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    Science.gov (United States)

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  18. The Rice Terpene Synthase Gene OsTPS19 Functions as an (S)-Limonene Synthase in planta and its Overexpression Leads to Enhanced Resistance to the Blast Fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defense mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defense gene. Here, we report the functional characterization of OsTPS19, which is upregulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defense against M. oryzae, at least partly, by inhibiting spore germination. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  19. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  20. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  1. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Gene expression analysis in watermelon (Citrullus lanatus fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC, β-actin (ClACT, and alpha tubulin 5 (ClTUA5 as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1, a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  2. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Science.gov (United States)

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong

    2015-01-01

    Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  3. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

    Science.gov (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2017-07-01

    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Carbon Catabolite Repression Regulates Glyoxylate Cycle Gene Expression in Cucumber.

    Science.gov (United States)

    Graham, I. A.; Denby, K. J.; Leaver, C. J.

    1994-01-01

    We have previously proposed that metabolic status is important in the regulation of cucumber malate synthase (MS) and isocitrate lyase (ICL) gene expression during plant development. In this article, we used a cell culture system to demonstrate that intracellular metabolic status does influence expression of both of these genes. Starvation of cucumber cell cultures resulted in the coordinate induction of the expression of MS and ICL genes, and this effect was reversed when sucrose was returned to the culture media. The induction of gene expression was closely correlated with a drop in intracellular sucrose, glucose, and fructose below threshold concentrations, but it was not correlated with a decrease in respiration rate. Glucose, fructose, or raffinose in the culture media also resulted in repression of MS and ICL. Both 2-deoxyglucose and mannose, which are phosphorylated by hexokinase but not further metabolized, specifically repressed MS and ICL gene expression relative to a third glyoxylate cycle gene, malate dehydrogenase. However, the addition of 3-methylglucose, an analog of glucose that is not phosphorylated, did not result in repression of either MS or ICL. It is proposed that the signal giving rise to a change in gene expression originates from the intracellular concentration of hexose sugars or the flux of hexose sugars into glycolysis. PMID:12244257

  5. Specificity of Ocimum basilicum geraniol synthase modified by its expression in different heterologous systems.

    Science.gov (United States)

    Fischer, Marc J C; Meyer, Sophie; Claudel, Patricia; Perrin, Mireille; Ginglinger, Jean François; Gertz, Claude; Masson, Jean E; Werck-Reinhardt, Danièle; Hugueney, Philippe; Karst, Francis

    2013-01-10

    Numerous aromatic plant species produce high levels of monoterpenols, using geranyl diphosphate (GPP) as a precursor. Sweet basil (Ocimum basilicum) geraniol synthase (GES) was used to evaluate the monoterpenol profiles arising from heterologous expressions in various plant models. Grapevine (Vitis vinifera) calli were transformed using Agrobacterium tumefasciens and the plants were regenerated. Thale cress (Arabidopsis thaliana) was transformed using the floral dip method. Tobacco (Nicotiana benthamiana) leaves were agro-infiltrated for transient expression. Although, as expected, geraniol was the main product detected in the leaves, different minor products were observed in these plants (V. vinifera: citronellol and nerol; N. benthamiana: linalool and nerol; A. thaliana: none). O. basilicum GES expression was also carried out with microbial system yeasts (Saccharomyces cerevisiae) and Escherichia coli. These results suggest that the functional properties of a monoterpenol synthase depend not only on the enzyme's amino-acidic sequence, but also on the cellular background. They also suggest that some plant species or microbial expression systems could induce the simultaneous formation of several carbocations, and could thus have a natural tendency to produce a wider spectrum of monoterpenols. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Conservation and divergence of Starch Synthase III genes of monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Bhavya Priyadarshini Mishra

    Full Text Available Starch Synthase (SS plays an important role in extending the α-1,4 glucan chains during starch biosynthesis by catalyzing the transfer of the glucosyl moiety from ADP-glucose to the non-reducing end of a pre-existing glucan chain. SS has five distinct isoforms of which SSIII is involved in the formation of longer glucan chain length. Here we report identification and detailed characterization of 'true' orthologs of the well-characterized maize SSIII (ZmSSIII, among six monocots and two dicot species. ZmSSIII orthologs have nucleotide sequence similarity ranging from 56-81%. Variation in gene size among various orthologs ranged from 5.49 kb in Arabidopsis to 11.62 kb in Brachypodium and the variation was mainly due to intron size and indels present in the exons 1 and 3. Number of exons and introns were highly conserved among all orthologs however. While the intron number was conserved, intron phase showed variation at group, genera and species level except for intron 1 and 5. Several species, genera, and class specific cis-acting regulatory elements were identified in the promoter region. The predicted protein size of the SSIII orthologs ranged from 1094 amino acid (aa in Arabidopsis to 1688 aa in Brachypodium with sequence identity ranging from 60%-89%. The N-terminal region of the protein was highly variable whereas the C-terminal region containing the Glycosyltransferase domain was conserved with >80% sequence similarity among the orthologs. In addition to confirming the known motifs, eleven novel motifs possibly providing species, genera and group specific functions, were identified in the three carbohydrate binding domains. Despite of significant sequence variation among orthologs, most of the motifs and their relative distances are highly conserved among the orthologs. The 3-D structure of catalytic region of SSIII orthologs superimposed with higher confidence confirming the presence of similar binding sites with five unidentified

  7. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  8. The Balance of Expression of Dihydroflavonol 4-reductase and Flavonol Synthase Regulates Flavonoid Biosynthesis and Red Foliage Coloration in Crabapples.

    Science.gov (United States)

    Tian, Ji; Han, Zhen-yun; Zhang, Jie; Hu, YuJing; Song, Tingting; Yao, Yuncong

    2015-07-20

    Red leaf color is an attractive trait of Malus families, including crabapple (Malus spp.); however, little is known about the molecular mechanisms that regulate the coloration. Dihydroflavonols are intermediates in the production of both colored anthocyanins and colorless flavonols, and this current study focused on the gene expression balance involved in the relative accumulation of these compounds in crabapple leaves. Levels of anthocyanins and the transcript abundances of the anthocyanin biosynthetic gene, dihydroflavonol 4-reductase (McDFR) and the flavonol biosynthetic gene, flavonol synthase (McFLS), were assessed during the leaf development in two crabapple cultivars, 'Royalty' and 'Flame'. The concentrations of anthocyanins and flavonols correlated with leaf color and we propose that the expression of McDFR and McFLS influences their accumulation. Further studies showed that overexpression of McDFR, or silencing of McFLS, increased anthocyanin production, resulting in red-leaf and red fruit peel phenotypes. Conversely, elevated flavonol production and green phenotypes in crabapple leaves and apple peel were observed when McFLS was overexpressed or McDFR was silenced. These results suggest that the relative activities of McDFR and McFLS are important determinants of the red color of crabapple leaves, via the regulation of the metabolic fate of substrates that these enzymes have in common.

  9. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  10. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  11. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  12. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  13. Human papillomavirus gene expression

    International Nuclear Information System (INIS)

    Chow, L.T.; Hirochika, H.; Nasseri, M.; Stoler, M.H.; Wolinsky, S.M.; Chin, M.T.; Hirochika, R.; Arvan, D.S.; Broker, T.R.

    1987-01-01

    To determine the role of tissue differentiation on expression of each of the papillomavirus mRNA species identified by electron microscopy, the authors prepared exon-specific RNA probes that could distinguish the alternatively spliced mRNA species. Radioactively labeled single-stranded RNA probes were generated from a dual promoter vector system and individually hybridized to adjacent serial sections of formalin-fixed, paraffin-embedded biopsies of condylomata. Autoradiography showed that each of the message species had a characteristic tissue distribution and relative abundance. The authors have characterized a portion of the regulatory network of the HPVs by showing that the E2 ORF encodes a trans-acting enhancer-stimulating protein, as it does in BPV-1 (Spalholz et al. 1985). The HPV-11 enhancer was mapped to a 150-bp tract near the 3' end of the URR. Portions of this region are duplicated in some aggressive strains of HPV-6 (Boshart and zur Hausen 1986; Rando et al. 1986). To test the possible biological relevance of these duplications, they cloned tandem arrays of the enhancer and demonstrated, using a chloramphenicol acetyltransferase (CAT) assay, that they led to dramatically increased transcription proportional to copy number. Using the CAT assays, the authors found that the E2 proteins of several papillomavirus types can cross-stimulate the enhancers of most other types. This suggests that prior infection of a tissue with one papillomavirus type may provide a helper effect for superinfection and might account fo the HPV-6/HPV-16 coinfections in condylomata that they have observed

  14. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  15. Functional identification and differential expression of 1-deoxy-D-xylulose 5-phosphate synthase in induced terpenoid resin formation of Norway spruce (Picea abies).

    Science.gov (United States)

    Phillips, Michael A; Walter, Michael H; Ralph, Steven G; Dabrowska, Paulina; Luck, Katrin; Urós, Eva Maria; Boland, Wilhelm; Strack, Dieter; Rodríguez-Concepción, Manuel; Bohlmann, Jörg; Gershenzon, Jonathan

    2007-10-01

    Conifers produce terpenoid-based oleoresins as constitutive and inducible defenses against herbivores and pathogens. Much information is available about the genes and enzymes of the late steps of oleoresin terpenoid biosynthesis in conifers, but almost nothing is known about the early steps which proceed via the methylerythritol phosphate (MEP) pathway. Here we report the cDNA cloning and functional identification of three Norway spruce (Picea abies) genes encoding 1-deoxy-D-xylulose 5-phosphate synthase (DXS), which catalyzes the first step of the MEP pathway, and their differential expression in the stems of young saplings. Among them are representatives of both types of plant DXS genes. A single type I DXS gene is constitutively expressed in bark tissue and not affected by wounding or fungal application. In contrast, two distinct type II DXS genes, PaDXS2A and PaDXS2B, showed increased transcript abundance after these treatments as did two other genes of the MEP pathway tested, 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) and 4-hydroxyl 3-methylbutenyl diphosphate reductase (HDR). We also measured gene expression in a Norway spruce cell suspension culture system that, like intact trees, accumulates monoterpenes after treatment with methyl jasmonate. These cell cultures were characterized by an up-regulation of monoterpene synthase gene transcripts and enzyme activity after elicitor treatment, as well as induced formation of octadecanoids, including jasmonic acid and 12-oxophytodienoic acid. Among the Type II DXS genes in cell cultures, PaDXS2A was induced by treatment with chitosan, methyl salicylate, and Ceratocystis polonica (a bark beetle-associated, blue-staining fungal pathogen of Norway spruce). However, PaDXS2B was induced by treatment with methyl jasmonate and chitosan, but was not affected by methyl salicylate or C. polonica. Our results suggest distinct functions of the three DXS genes in primary and defensive terpenoid metabolism in Norway

  16. The Peptidylarginine Deiminase Inhibitor Cl-Amidine Suppresses Inducible Nitric Oxide Synthase Expression in Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Byungki Jang

    2017-10-01

    Full Text Available The conversion of peptidylarginine into peptidylcitrulline by calcium-dependent peptidylarginine deiminases (PADs has been implicated in the pathogenesis of a number of diseases, identifying PADs as therapeutic targets for various diseases. The PAD inhibitor Cl-amidine ameliorates the disease course, severity, and clinical manifestation in multiple disease models, and it also modulates dendritic cell (DC functions such as cytokine production, antigen presentation, and T cell proliferation. The beneficial effects of Cl-amidine make it an attractive compound for PAD-targeting therapeutic strategies in inflammatory diseases. Here, we found that Cl-amidine inhibited nitric oxide (NO generation in a time- and dose-dependent manner in maturing DCs activated by lipopolysaccharide (LPS. This suppression of NO generation was independent of changes in NO synthase (NOS enzyme activity levels but was instead dependent on changes in inducible NO synthase (iNOS transcription and expression levels. Several upstream signaling pathways for iNOS expression, including the mitogen-activated protein kinase, nuclear factor-κB p65 (NF-κB p65, and hypoxia-inducible factor 1 pathways, were not affected by Cl-amidine. By contrast, the LPS-induced signal transducer and the activator of transcription (STAT phosphorylation and activator protein-1 (AP-1 transcriptional activities (c-Fos, JunD, and phosphorylated c-Jun were decreased in Cl-amidine-treated DCs. Inhibition of Janus kinase/STAT signaling dramatically suppressed iNOS expression and NO production, whereas AP-1 inhibition had no effect. These results indicate that Cl-amidine-inhibited STAT activation may suppress iNOS expression. Additionally, we found mildly reduced cyclooxygenase-2 expression and prostaglandin E2 production in Cl-amidine-treated DCs. Our findings indicate that Cl-amidine acts as a novel suppressor of iNOS expression, suggesting that Cl-amidine has the potential to ameliorate the effects of

  17. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas

    2011-01-01

    The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa. Not...

  18. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin

    2014-01-01

    an analytical approach to examine the suitability of correction methods by considering the inter-treatment bias as well as the inter-replicate variance, which allows use of the best correction method with minimum residual bias. Analyses of RNA sequencing and microarray data showed that the efficiencies......This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...

  19. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette

    2012-01-01

    for future polyketide synthases (PKSs) and nonribosomal peptides synthetases (NRPSs) nomenclature assignment and classification. Sequence similarities of the adenylation and ketosynthase domain sequences were used to group the identified NRPS and PKS genes. We present the current state of knowledge of PKS......Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...

  20. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  1. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    Science.gov (United States)

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed actinomycetes to produce bioactive molecules.

  2. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro

    2013-07-01

    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  3. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from Agrobacterium tumefaciens

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Dobson, Renwick C. J.; Perugini, Matthew A.

    2012-01-01

    Dihydrodipicolinate synthase from the plant pathogen A. tumefaciens has been cloned, expressed, purified and crystallized in its unliganded form, in the presence of its substrate pyruvate and in the presence of pyruvate and the allosteric inhibitor lysine. Diffraction data for the crystals were collected to a maximum resolution of 1.40 Å. Dihydrodipicolinate synthase (DHDPS) catalyzes the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS (NP-354047.1) from the plant pathogen Agrobacterium tumefaciens (AgT-DHDPS). Enzyme-kinetics studies demonstrate that AgT-DHDPS possesses DHDPS activity in vitro. Crystals of AgT-DHDPS were grown in the unliganded form and in forms with substrate bound and with substrate plus allosteric inhibitor (lysine) bound. X-ray diffraction data sets were subsequently collected to a maximum resolution of 1.40 Å. Determination of the structure with and without substrate and inhibitor will offer insight into the design of novel pesticide agents

  4. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    Energy Technology Data Exchange (ETDEWEB)

    Pasquo, Alessandra [ENEA Casaccia Research Centre, Dipartimento BIOTEC, Sezione Genetica e Genomica Vegetale, PO Box 2400, I-00100 Rome (Italy); Bonamore, Alessandra; Franceschini, Stefano; Macone, Alberto; Boffi, Alberto; Ilari, Andrea, E-mail: andrea.ilari@uniroma1.it [Istituto di Biologia e Patologia Molecolari, CNR (IBPM) and Department Of Biochemical Sciences, University of Roma ‘La Sapienza’, Piazza Aldo Moro 5, 00179 Roma (Italy); ENEA Casaccia Research Centre, Dipartimento BIOTEC, Sezione Genetica e Genomica Vegetale, PO Box 2400, I-00100 Rome (Italy)

    2008-04-01

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.

  5. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    International Nuclear Information System (INIS)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens; Sørensen, Jens B

    2009-01-01

    Microsatellite instability (MSI) refers to mutations in short motifs of tandemly repeated nucleotides resulting from replication errors and deficient mismatch repair (MMR). Colorectal cancer with MSI has characteristic biology and chemosensitivity, however the molecular basis remains unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression were assessed in paraffin embedded tumor specimens, and associated with outcome in 340 consecutive patients completely resected for colorectal cancer stages II-IV and subsequently receiving adjuvant 5-fluorouracil therapy. MSI was found in 43 (13.8%) tumors. Absence of repair protein expression was assessed in 52 (17.0%) tumors, which had primarily lost hMLH1 in 39 (12.7%), hMSH2 in 5 (1.6%), and hMSH6 in 8 (2.6%) tumors. In multivariate analysis MSI (instable) compared to MSS (stable) tumors were significantly associated with lower risk of recurrence (hazard ratio (HR) = 0.3; 95% CI: 0.2–0.7; P = 0.0007) and death (HR = 0.4; 95% CI: 0.2–0.9; P = 0.02) independently of the TS and DPD expressions. A direct relationship between MSI and TS intensity (P = 0.001) was found, while there was no significant association with DPD intensity (P = 0.1). The favourable outcome of MSI colorectal carcinomas is ascribed mainly to the tumor biology and to a lesser extent to antitumor response to 5-fluorouracil therapy. There is no evidence that differential TS or DPD expression may account for these outcome characteristics

  6. Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI

    DEFF Research Database (Denmark)

    Wang, Weijing; Jiang, Wenjie; Hou, Lin

    2017-01-01

    and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. RESULTS: In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs......) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database...... and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0...

  7. Intermittent pneumatic compression regulates expression of nitric oxide synthases in skeletal muscles.

    Science.gov (United States)

    Tan, Xiangling; Qi, Wen-Ning; Gu, Xiaosong; Urbaniak, James R; Chen, Long-En

    2006-01-01

    This study investigated the effects of intermittent pneumatic compression (IPC) on expression of nitric oxide synthase (NOS) isoforms in compressed (anterior tibialis, AT) and uncompressed (cremaster muscles, CM) skeletal muscles. Following IPC application of 0.5, 1, and 5h on both legs of rats, the endothelial NOS (eNOS) mRNA expression was significantly up-regulated to 1.2-, 1.8, and 2.7-fold from normal, respectively, in both AT and CM, and protein expression increased more than 1.5-fold of normal at each time point. Similarly, neuronal NOS expression was up-regulated, but to a lesser degree. In contrast, inducible NOS expression was significantly and time-dependently down-regulated in both muscles. After IPC cessation, eNOS levels returned to normal in both AT and CM. The results confirm our hypothesis that IPC-induced vasodilation is mediated by regulating expression of NOS isoforms, in particular eNOS, in both compressed and uncompressed skeletal muscles. The results also suggest the importance of precisely characterizing expression of each NOS isoform in tissue pathophysiology.

  8. Neighboring Genes Show Correlated Evolution in Gene Expression

    Science.gov (United States)

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  9. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  10. Gene expression profile of pulpitis

    Science.gov (United States)

    Galicia, Johnah C.; Henson, Brett R.; Parker, Joel S.; Khan, Asma A.

    2016-01-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the Significance Analysis of Microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (≥30mm on VAS) compared to those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology. PMID:27052691

  11. Gene expression profile of pulpitis.

    Science.gov (United States)

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology.

  12. Gene Expression in Trypanosomatid Parasites

    Directory of Open Access Journals (Sweden)

    Santiago Martínez-Calvillo

    2010-01-01

    Full Text Available The parasites Leishmania spp., Trypanosoma brucei, and Trypanosoma cruzi are the trypanosomatid protozoa that cause the deadly human diseases leishmaniasis, African sleeping sickness, and Chagas disease, respectively. These organisms possess unique mechanisms for gene expression such as constitutive polycistronic transcription of protein-coding genes and trans-splicing. Little is known about either the DNA sequences or the proteins that are involved in the initiation and termination of transcription in trypanosomatids. In silico analyses of the genome databases of these parasites led to the identification of a small number of proteins involved in gene expression. However, functional studies have revealed that trypanosomatids have more general transcription factors than originally estimated. Many posttranslational histone modifications, histone variants, and chromatin modifying enzymes have been identified in trypanosomatids, and recent genome-wide studies showed that epigenetic regulation might play a very important role in gene expression in this group of parasites. Here, we review and comment on the most recent findings related to transcription initiation and termination in trypanosomatid protozoa.

  13. Cloning and expression analysis of an anthocyanidin synthase gene ...

    Indian Academy of Sciences (India)

    Proanthocyanidins and anthocyanidins have an effect on the colour of flowers and seeds (Grotewold 2006; Lepiniec et al. 2006). Studying the biosynthetic mechanism of proantho- cyanidins in Brassica is of great significance for elucidating the colour formation mechanism of seed coat and guiding the breeding work of ...

  14. Expression of phytoene synthase ( psy ) gene and its relation with ...

    African Journals Online (AJOL)

    Carotenoids are important determinant of tea quality as many of the quality related flavour volatiles are produced through the degradation of carotenoids during tea processing. Variation in levels of carotenoids including neoxanthin, violoxanthin, xanthophylls and -carotene in early and late period of spring, summer and ...

  15. Expression of Inducible Nitric Oxide Synthase in Skin Lesions of Patients with American Cutaneous Leishmaniasis

    Science.gov (United States)

    Qadoumi, Muna; Becker, Inge; Donhauser, Norbert; Röllinghoff, Martin; Bogdan, Christian

    2002-01-01

    Cytokine-inducible (or type 2) nitric oxide synthase (iNOS) is indispensable for the resolution of Leishmania major or Leishmania donovani infections in mice. In contrast, little is known about the expression and function of iNOS in human leishmaniasis. Here, we show by immunohistological analysis of skin biopsies from Mexican patients with local (LCL) or diffuse (DCL) cutaneous leishmaniasis that the expression of iNOS was most prominent in LCL lesions with small numbers of parasites whereas lesions with a high parasite burden (LCL or DCL) contained considerably fewer iNOS-positive cells. This is the first study to suggest an antileishmanial function of iNOS in human Leishmania infections in vivo. PMID:12117977

  16. Clinical aspects of endothelial NO-synthase gene polymorphism in professional sportsmen (literature review

    Directory of Open Access Journals (Sweden)

    S. N. Malakhova

    2016-08-01

    Full Text Available The article deals the questions of properties and biological role of nitric oxide molecule, which is characterized with vasodilating, stress limiting and neurotransmitter properties, and participates in reactions of oxidative stress, glutamate and calcium cascade and inflammation. Researches of the relationship of endothelial NO-synthase and the risk of cardiovascular, ischemic and respiratory diseases in population of untrained persons and athletes continue. The aim of this study was to establish, according to the literature, the present state of the influence of endothelial NO-synthase gene polymorphism on the formation of the physical qualities of strength, endurance and speed in professional athletes, its changes and influence on functional state of athlete. At the present stage of development of medical genetics it is proved, that the implementation of the action of each individual isoform of the enzyme NO-synthase is caused by the presence of polymorphism. The most studied are the T-786С polymorphism of the eNOS gene promoter, G894T (Glu298Asp polymorphism of the 7th exon, 4a/b–4th intron of eNOS, but their influence is not definitively proven, and is caused by the presence of homo- or heterozygotes. Genetic researches among professional athletes prove the significant role of nitric oxide system in enhancing of physical working capacity, but do not allow evaluating the characteristics of this effect, taking into account multi-directional training process and the level of sports qualification, as well as predicting future professional success and the preservation of the proper functioning of the cardiovascular, respiratory and other body systems. Conclusions. Thus, contemporary researches allow stating that oxide synthesis has a leading role in the functioning of the organism, and in particular athletes, but do not allow assessing its effects on the body of athletes of different sports qualification. It is proved that polymorphism of the

  17. Chamomile: an anti-inflammatory agent inhibits inducible nitric oxide synthase expression by blocking RelA/p65 activity.

    Science.gov (United States)

    Bhaskaran, Natarajan; Shukla, Sanjeev; Srivastava, Janmejai K; Gupta, Sanjay

    2010-12-01

    Chamomile has long been used in traditional medicine for the treatment of inflammation-related disorders. In this study we investigated the inhibitory effects of chamomile on nitric oxide (NO) production and inducible nitric oxide synthase (iNOS) expression, and explored its potential anti-inflammatory mechanisms using RAW 264.7 macrophages. Chamomile treatment inhibited LPS-induced NO production and significantly blocked IL-1β, IL-6 and TNFα-induced NO levels in RAW 264.7 macrophages. Chamomile caused reduction in LPS-induced iNOS mRNA and protein expression. In RAW 264.7 macrophages, LPS-induced DNA binding activity of RelA/p65 was significantly inhibited by chamomile, an effect that was mediated through the inhibition of IKKβ, the upstream kinase regulating NF-κB/Rel activity, and degradation of inhibitory factor-κB. These results demonstrate that chamomile inhibits NO production and iNOS gene expression by inhibiting RelA/p65 activation and supports the utilization of chamomile as an effective anti-inflammatory agent.

  18. Chamomile, an anti-inflammatory agent inhibits inducible nitric oxide synthase expression by blocking RelA/p65 activity

    Science.gov (United States)

    Bhaskaran, Natarajan; Shukla, Sanjeev; Srivastava, Janmejai K; Gupta, Sanjay

    2010-01-01

    Chamomile has long been used in traditional medicine for the treatment of inflammation-related disorders. In this study we aimed to investigate the inhibitory effects of chamomile on nitric oxide (NO) production and inducible nitric oxide synthase (iNOS) expression, and to explore its potential anti-inflammatory mechanisms using RAW 264.7 macrophages. Chamomile treatment inhibited LPS-induced NO production and significantly blocked IL-1β , IL-6 and TNFα-induced NO levels in RAW 264.7 macrophages. Chamomile caused reduction in LPS-induced iNOS mRNA and protein expression. In RAW 264.7 macrophages, LPS-induced DNA binding activity of RelA/p65 was significantly inhibited by chamomile, an effect that was mediated through the inhibition of IKKβ , the upstream kinase regulating NF-κ B/Rel activity, and degradation of inhibitory factor-κ B. These results demonstrate that chamomile inhibits NO production and iNOS gene expression by inhibiting RelA/p65 activation and supports the utilization of chamomile as an effective anti-inflammatory agent. PMID:21042790

  19. Expression, purification, and characterization of recombinant amorpha-4,11-diene synthase from Artemisia annua L.

    Science.gov (United States)

    Picaud, Sarah; Olofsson, Linda; Brodelius, Maria; Brodelius, Peter E

    2005-04-15

    A cDNA clone encoding amorpha-4,11-diene synthase from Artemisia annua was subcloned into a bacterial expression vector in frame with a His6-tag. Recombinant amorpha-4,11-diene synthase was produced in Escherichia coli and purified to apparent homogeneity. The enzyme showed pH optimum at pH 6.5, and a minimum at pH 7.5. Substantial activity was observed in the presence of Mg2+, Mn2+ or Co2+ as cofactor. The enzyme exhibits a low activity in the presence of Ni2+ and essentially no activity with Cu2+ or Zn2+. The sesquiterpenoids produced from farnesyl diphosphate in the presence of Mg2+ were analyzed by GC-MS. In addition to amorpha-4,11-diene, 15 sesquiterpenoids were produced. Only small quantitative differences in product pattern were observed at pH 6.5, 7.5, or 9.5. Amorpha-4,11-diene synthase showed significant increased product selectivity in the presence of Mn2+ or Co2+. Km for farnesyl diphosphate was 3.3, 8.0, and 0.7 microM in the presence of Mg2+, Mn2+ or Co2+, respectively. The corresponding kcat-values were 6.8, 15.0, and 1.3 x 10(-3) s(-1), respectively. Km and kcat for geranyl diphosphate were 16.9 microM and 7.0 x 10(-4) s(-1), respectively, at pH 6.5, in the presence of Mn2+.

  20. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Science.gov (United States)

    Wang, Guoliang; Zhao, Ge; Feng, Yanbin; Xuan, Jinsong; Sun, Jianwei; Guo, Baotai; Jiang, Guoyong; Weng, Manli; Yao, Jianting; Wang, Bin; Duan, Delin; Liu, Tao

    2010-01-01

    The full-length cDNA sequence (3219 base pairs) of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS) was isolated by RACE-PCR and deposited in GenBank (NCBI) with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5), whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB). Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI). All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94%) and in amino acid composition (>96%). Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes. PMID:20714424

  1. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  2. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Soluble Starch Synthase III-1 in Amylopectin Metabolism of Banana Fruit: Characterization, Expression, Enzyme Activity, and Functional Analyses

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Qing; Jia, Caihong; Liu, Juhua; Hu, Wei; Jin, Zhiqiang; Xu, Biyu

    2017-01-01

    Soluble starch synthase (SS) is one of the key enzymes involved in amylopectin biosynthesis in plants. However, no information is currently available about this gene family in the important fruit crop banana. Herein, we characterized the function of MaSSIII-1 in amylopectin metabolism of banana fruit and described the putative role of the other MaSS family members. Firstly, starch granules, starch and amylopectin content were found to increase during banana fruit development, but decline during storage. The SS activity started to increase later than amylopectin and starch content. Secondly, four putative SS genes were cloned and characterized from banana fruit. Among them, MaSSIII-1 showed the highest expression in banana pulp during fruit development at transcriptional levels. Further Western blot analysis suggested that the protein was gradually increased during banana fruit development, but drastically reduced during storage. This expression pattern was highly consistent with changes in starch granules, amylopectin content, and SS activity at the late phase of banana fruit development. Lastly, overexpression of MaSSIII-1 in tomato plants distinctly changed the morphology of starch granules and significantly increased the total starch accumulation, amylopectin content, and SS activity at mature-green stage in comparison to wild-type. The findings demonstrated that MaSSIII-1 is a key gene expressed in banana fruit and responsible for the active amylopectin biosynthesis, this is the first report in a fresh fruit species. Such a finding may enable the development of molecular markers for banana breeding and genetic improvement of nutritional value and functional properties of banana fruit. PMID:28424724

  4. Soluble Starch Synthase III-1 in Amylopectin Metabolism of Banana Fruit: Characterization, Expression, Enzyme Activity, and Functional Analyses.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Qing; Jia, Caihong; Liu, Juhua; Hu, Wei; Jin, Zhiqiang; Xu, Biyu

    2017-01-01

    Soluble starch synthase (SS) is one of the key enzymes involved in amylopectin biosynthesis in plants. However, no information is currently available about this gene family in the important fruit crop banana. Herein, we characterized the function of MaSSIII-1 in amylopectin metabolism of banana fruit and described the putative role of the other MaSS family members. Firstly, starch granules, starch and amylopectin content were found to increase during banana fruit development, but decline during storage. The SS activity started to increase later than amylopectin and starch content. Secondly, four putative SS genes were cloned and characterized from banana fruit. Among them, MaSSIII-1 showed the highest expression in banana pulp during fruit development at transcriptional levels. Further Western blot analysis suggested that the protein was gradually increased during banana fruit development, but drastically reduced during storage. This expression pattern was highly consistent with changes in starch granules, amylopectin content, and SS activity at the late phase of banana fruit development. Lastly, overexpression of MaSSIII-1 in tomato plants distinctly changed the morphology of starch granules and significantly increased the total starch accumulation, amylopectin content, and SS activity at mature-green stage in comparison to wild-type. The findings demonstrated that MaSSIII-1 is a key gene expressed in banana fruit and responsible for the active amylopectin biosynthesis, this is the first report in a fresh fruit species. Such a finding may enable the development of molecular markers for banana breeding and genetic improvement of nutritional value and functional properties of banana fruit.

  5. Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Directory of Open Access Journals (Sweden)

    Khalil Zaynali

    2010-06-01

    Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

  6. Differentially expressed galactinol synthase(s) in chickpea are implicated in seed vigor and longevity by limiting the age induced ROS accumulation

    Science.gov (United States)

    Salvi, Prafull; Saxena, Saurabh Chandra; Petla, Bhanu Prakash; Kamble, Nitin Uttam; Kaur, Harmeet; Verma, Pooja; Rao, Venkateswara; Ghosh, Shraboni; Majee, Manoj

    2016-01-01

    Galactinol synthase (GolS) catalyzes the first and rate limiting step of Raffinose Family Oligosaccharide (RFO) biosynthetic pathway, which is a highly specialized metabolic event in plants. Increased accumulation of galactinol and RFOs in seeds have been reported in few plant species, however their precise role in seed vigor and longevity remain elusive. In present study, we have shown that galactinol synthase activity as well as galactinol and raffinose content progressively increase as seed development proceeds and become highly abundant in pod and mature dry seeds, which gradually decline as seed germination progresses in chickpea (Cicer arietinum). Furthermore, artificial aging also stimulates galactinol synthase activity and consequent galactinol and raffinose accumulation in seed. Molecular analysis revealed that GolS in chickpea are encoded by two divergent genes (CaGolS1 and CaGolS2) which potentially encode five CaGolS isoforms through alternative splicing. Biochemical analysis showed that only two isoforms (CaGolS1 and CaGolS2) are biochemically active with similar yet distinct biochemical properties. CaGolS1 and CaGolS2 are differentially regulated in different organs, during seed development and germination however exhibit similar subcellular localization. Furthermore, seed-specific overexpression of CaGolS1 and CaGolS2 in Arabidopsis results improved seed vigor and longevity through limiting the age induced excess ROS and consequent lipid peroxidation. PMID:27725707

  7. Coordinated gene expression for pheromone biosynthesis in the pine engraver beetle, Ips pini (Coleoptera: Scolytidae)

    Science.gov (United States)

    Keeling, Christopher I.; Blomquist, Gary J.; Tittiger, Claus

    In several pine bark beetle species, phloem feeding induces aggregation pheromone production to coordinate a mass attack on the host tree. Male pine engraver beetles, Ips pini (Say) (Coleoptera: Scolytidae), produce the monoterpenoid pheromone component ipsdienol de novo via the mevalonate pathway in the anterior midgut upon feeding. To understand how pheromone production is regulated in this tissue, we used quantitative real-time PCR to examine feeding-induced changes in gene expression of seven mevalonate pathway genes: acetoacetyl-coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, mevalonate 5-diphosphate decarboxylase, isopentenyl-diphosphate isomerase, geranyl-diphosphate synthase (GPPS), and farnesyl-diphosphate synthase (FPPS). In males, expression of all these genes significantly increased upon feeding. In females, the expression of the early mevalonate pathway genes (up to and including the isomerase) increased significantly, but the expression of the later genes (GPPS and FPPS) was unaffected or decreased upon feeding. Thus, feeding coordinately regulates expression of the mevalonate pathway genes necessary for pheromone biosynthesis in male, but not female, midguts. Furthermore, basal mRNA levels were 5- to 41-fold more abundant in male midguts compared to female midguts. This is the first report of coordinated regulation of mevalonate pathway genes in an invertebrate model consistent with their sex-specific role in de novo pheromone biosynthesis.

  8. Expression of Inducible Nitric Oxide Synthase (iNOS) in Microglia of the Developing Quail Retina

    Science.gov (United States)

    Sierra, Ana; Navascués, Julio; Cuadros, Miguel A.; Calvente, Ruth; Martín-Oliva, David; Ferrer-Martín, Rosa M.; Martín-Estebané, María; Carrasco, María-Carmen; Marín-Teva, José L.

    2014-01-01

    Inducible nitric oxide synthase (iNOS), which produce large amounts of nitric oxide (NO), is induced in macrophages and microglia in response to inflammatory mediators such as LPS and cytokines. Although iNOS is mainly expressed by microglia that become activated in different pathological and experimental situations, it was recently reported that undifferentiated amoeboid microglia can also express iNOS during normal development. The aim of this study was to investigate the pattern of iNOS expression in microglial cells during normal development and after their activation with LPS by using the quail retina as model. iNOS expression was analyzed by iNOS immunolabeling, western-blot, and RT-PCR. NO production was determined by using DAR-4M AM, a reliable fluorescent indicator of subcellular NO production by iNOS. Embryonic, postnatal, and adult in situ quail retinas were used to analyze the pattern of iNOS expression in microglial cells during normal development. iNOS expression and NO production in LPS-treated microglial cells were investigated by an in vitro approach based on organotypic cultures of E8 retinas, in which microglial cell behavior is similar to that of the in situ retina, as previously demonstrated in our laboratory. We show here that amoeboid microglia in the quail retina express iNOS during normal development. This expression is stronger in microglial cells migrating tangentially in the vitreal part of the retina and is downregulated, albeit maintained, when microglia differentiate and become ramified. LPS treatment of retina explants also induces changes in the morphology of amoeboid microglia compatible with their activation, increasing their lysosomal compartment and upregulating iNOS expression with a concomitant production of NO. Taken together, our findings demonstrate that immature microglial cells express iNOS during normal development, suggesting a certain degree of activation. Furthermore, LPS treatment induces overactivation of amoeboid

  9. Relative expression of genes of terpene metabolism in different tissues of Artemisia annua L.

    Science.gov (United States)

    Olofsson, Linda; Engström, Alexander; Lundgren, Anneli; Brodelius, Peter E

    2011-03-09

    Recently, Artemisia annua L. (annual or sweet wormwood) has received increasing attention due to the fact that the plant produces the sesquiterpenoid endoperoxide artemisinin, which today is widely used for treatment of malaria. The plant produces relatively small amounts of artemisinin and a worldwide shortage of the drug has led to intense research in order to increase the yield of artemisinin. In order to improve our understanding of terpene metabolism in the plant and to evaluate the competition for precursors, which may influence the yield of artemisinin, we have used qPCR to estimate the expression of 14 genes of terpene metabolism in different tissues. The four genes of the artemisinin biosynthetic pathway (amorpha-4,11-diene synthase, amorphadiene-12-hydroxylase, artemisinic aldehyde ∆11(13) reductase and aldehyde dehydrogenase 1) showed remarkably higher expression (between ~40- to ~500-fold) in flower buds and young leaves compared to other tissues (old leaves, stems, roots, hairy root cultures). Further, dihydroartemisinic aldehyde reductase showed a very high expression only in hairy root cultures. Germacrene A and caryophyllene synthase were mostly expressed in young leaves and flower buds while epi-cedrol synthase was highly expressed in old leaves. 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase exhibited lower expression in old leaves compared to other tissues. Farnesyldiphosphate synthase, squalene synthase, and 1-deoxy-D-xylulose-5-phosphate reductoisomerase showed only modest variation in expression in the different tissues, while expression of 1-deoxy-D-xylulose-5-phosphate synthase was 7-8-fold higher in flower buds and young leaves compared to old leaves. Four genes of artemisinin biosynthesis were highly expressed in flower buds and young leaves (tissues showing a high density of glandular trichomes). The expression of dihydroartemisinic aldehyde reductase has been suggested to have a negative effect on artemisinin production through

  10. Relative expression of genes of terpene metabolism in different tissues of Artemisia annua L

    Science.gov (United States)

    2011-01-01

    Background Recently, Artemisia annua L. (annual or sweet wormwood) has received increasing attention due to the fact that the plant produces the sesquiterpenoid endoperoxide artemisinin, which today is widely used for treatment of malaria. The plant produces relatively small amounts of artemisinin and a worldwide shortage of the drug has led to intense research in order to increase the yield of artemisinin. In order to improve our understanding of terpene metabolism in the plant and to evaluate the competition for precursors, which may influence the yield of artemisinin, we have used qPCR to estimate the expression of 14 genes of terpene metabolism in different tissues. Results The four genes of the artemisinin biosynthetic pathway (amorpha-4,11-diene synthase, amorphadiene-12-hydroxylase, artemisinic aldehyde ∆11(13) reductase and aldehyde dehydrogenase 1) showed remarkably higher expression (between ~40- to ~500-fold) in flower buds and young leaves compared to other tissues (old leaves, stems, roots, hairy root cultures). Further, dihydroartemisinic aldehyde reductase showed a very high expression only in hairy root cultures. Germacrene A and caryophyllene synthase were mostly expressed in young leaves and flower buds while epi-cedrol synthase was highly expressed in old leaves. 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase exhibited lower expression in old leaves compared to other tissues. Farnesyldiphosphate synthase, squalene synthase, and 1-deoxy-D-xylulose-5-phosphate reductoisomerase showed only modest variation in expression in the different tissues, while expression of 1-deoxy-D-xylulose-5-phosphate synthase was 7-8-fold higher in flower buds and young leaves compared to old leaves. Conclusions Four genes of artemisinin biosynthesis were highly expressed in flower buds and young leaves (tissues showing a high density of glandular trichomes). The expression of dihydroartemisinic aldehyde reductase has been suggested to have a negative effect on

  11. Relative expression of genes of terpene metabolism in different tissues of Artemisia annua L

    Directory of Open Access Journals (Sweden)

    Lundgren Anneli

    2011-03-01

    Full Text Available Abstract Background Recently, Artemisia annua L. (annual or sweet wormwood has received increasing attention due to the fact that the plant produces the sesquiterpenoid endoperoxide artemisinin, which today is widely used for treatment of malaria. The plant produces relatively small amounts of artemisinin and a worldwide shortage of the drug has led to intense research in order to increase the yield of artemisinin. In order to improve our understanding of terpene metabolism in the plant and to evaluate the competition for precursors, which may influence the yield of artemisinin, we have used qPCR to estimate the expression of 14 genes of terpene metabolism in different tissues. Results The four genes of the artemisinin biosynthetic pathway (amorpha-4,11-diene synthase, amorphadiene-12-hydroxylase, artemisinic aldehyde ∆11(13 reductase and aldehyde dehydrogenase 1 showed remarkably higher expression (between ~40- to ~500-fold in flower buds and young leaves compared to other tissues (old leaves, stems, roots, hairy root cultures. Further, dihydroartemisinic aldehyde reductase showed a very high expression only in hairy root cultures. Germacrene A and caryophyllene synthase were mostly expressed in young leaves and flower buds while epi-cedrol synthase was highly expressed in old leaves. 3-Hydroxy-3-methyl-glutaryl coenzyme A reductase exhibited lower expression in old leaves compared to other tissues. Farnesyldiphosphate synthase, squalene synthase, and 1-deoxy-D-xylulose-5-phosphate reductoisomerase showed only modest variation in expression in the different tissues, while expression of 1-deoxy-D-xylulose-5-phosphate synthase was 7-8-fold higher in flower buds and young leaves compared to old leaves. Conclusions Four genes of artemisinin biosynthesis were highly expressed in flower buds and young leaves (tissues showing a high density of glandular trichomes. The expression of dihydroartemisinic aldehyde reductase has been suggested to have a

  12. TCP transcription factors are critical for the coordinated regulation of isochorismate synthase 1 expression in Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Xiaoyan; Gao, Jiong; Zhu, Zheng; Dong, Xianxin; Wang, Xiaolei; Ren, Guodong; Zhou, Xin; Kuai, Benke

    2015-04-01

    Salicylic acid (SA) plays an important role in various aspects of plant development and responses to stresses. To elucidate the sophisticated regulatory mechanism of SA synthesis and signaling, we used a yeast one-hybrid system to screen for regulators of isochorismate synthase 1 (ICS1), a gene encoding the key enzyme in SA biosynthesis in Arabidopsis thaliana. A TCP family transcription factor AtTCP8 was initially identified as a candidate regulator of ICS1. The regulation of ICS1 by TCP proteins is supported by the presence of a typical TCP binding site in the ICS1 promoter. The binding of TCP8 to this site was confirmed by in vitro and in vivo assays. Expression patterns of TCP8 and its corresponding gene TCP9 largely overlapped with ICS1 under pathogen attack. A significant reduction in the expression of ICS1 during immune responses was observed in the tcp8 tcp9 double mutant. We also detected strong interactions between TCP8 and SAR deficient 1 (SARD1), WRKY family transcription factor 28 (WRKY28), NAC (NAM/ATAF1,ATAF2/CUC2) family transcription factor 019 (NAC019), as well as among TCP8, TCP9 and TCP20, suggesting a complex coordinated regulatory mechanism underlying ICS1 expression. Our results collectively demonstrate that TCP proteins are involved in the orchestrated regulation of ICS1 expression, with TCP8 and TCP9 being verified as major representatives. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  13. Cloning, expression, and characterization of epi-cedrol synthase, a sesquiterpene cyclase from Artemisia annua L.

    Science.gov (United States)

    Mercke, P; Crock, J; Croteau, R; Brodelius, P E

    1999-09-15

    Sesquiterpene cyclases (synthases) catalyze the conversion of the isoprenoid intermediate farnesyl diphosphate to various sesquiterpene structural types. In plants, many sesquiterpenes are produced as defensive chemicals (phytoalexins) or mediators of chemical communication (i.e., pollinator attractants). A number of sesquiterpene synthases are present in Artemisia annua L. (annual wormwood). We have isolated a cDNA clone encoding one of these, epi-cedrol synthase. This clone contains a 1641-bp open reading frame coding for 547 amino acids (63.5 kDa), a 38-bp 5'-untranslated end, and a 272-bp 3'-untranslated sequence. The deduced amino acid sequence was 32 to 43% identical with the sequences of other known sesquiterpene cyclases from angiosperms. When expressed in Escherichia coli, the recombinant enzyme catalyzed the formation of both olefinic (3%) and oxygenated (97%) sesquiterpenes from farnesyl diphosphate. GC-MS analysis identified the olefins as alpha-cedrene (57% of the olefins), beta-cedrene (13%), (E)-beta-farnesene (5%), alpha-acoradiene (1%), (E)-alpha-bisabolene (8%), and three unknown olefins (16%) and the oxygenated sesquiterpenes (97% of total sesquiterpene generated, exclusive of farnesol and nerolidol) as cedrol (4%) and epi-cedrol (96%). epi-Cedrol synthase was not active with geranylgeranyl diphosphate as substrate, whereas geranyl diphosphate was converted to monoterpenes by the recombinant enzyme at a rate of about 15% of that observed with farnesyl diphosphate as substrate. The monoterpene olefin products are limonene (45%), terpinolene (42%), gamma-terpinene (8%), myrcene (5%), and alpha-terpinene (2%); a small amount of the monoterpene alcohol terpinen-4-ol is also produced. The pH optimum for the recombinant enzyme is 8.5-9.0 (with farnesyl diphosphate as substrate) and the K(m) values for farnesyl diphosphate are 0.4 and 1.3 microM at pH 7. 0 and 9.0, respectively. The K(m) for Mg(2+) is 80 microM at pH 7.0 and 9.0.

  14. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    regions and regions of importance for translation, as well as coding sequences of the two genes, were studied using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The genetic analyses were performed in subgroups of 52 Caucasian NIDDM patients and 25 age-matched healthy......To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  15. Cloning and characterization of homeologous cellulose synthase catalytic subunit 2 genes from allotetraploid cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Kim, Hee Jin; Triplett, Barbara A; Zhang, Hong-Bin; Lee, Mi-Kyung; Hinchliffe, Doug J; Li, Ping; Fang, David D

    2012-02-25

    Cellulose synthase catalytic subunits (CesAs) are the catalytic sites within a multisubunit complex for cellulose biosynthesis in plants. CesAs have been extensively studied in diploid plants, but are not well characterized in polyploid plants. Gossypium hirsutum is an allotetraploid cotton species producing over 90% of the world's cotton fibers. Although G. hirsutum CesAs (GhCesAs) are responsible for cellulose production in cotton fiber, very limited numbers of GhCesA genes have been identified. Here, we report isolating and characterizing a pair of homeologous CesA2 genes and their full-length cDNAs from allotetraploid cotton. The GhCesA2-A(T) gene from the A-subgenome and GhCesA2-D(T) gene from the D-subgenome were screened from a G. hirsutum BAC library. These genes shared 92% sequence similarity throughout the entire sequence. The coding sequences were nearly identical, and the deduced amino acid sequences from GhCesA2-A(T) (1,039 amino acids) and GhCesA2-D(T) (1,040 amino acids) were identical except four amino acids, whereas the noncoding sequences showed divergence. Sequence analyses showed that all exons of GhCesA2-A(T) contained consensus splice donor dinucleotides, but one exon in GhCesA2-D(T) contained nonconsensus splice donor dinucleotides. Although the nonconsensus splice donor dinucleotides were previously suggested to be involved in alternative splice or pseudogenization, our results showed that a majority of GhCesA2-A(T) and GhCesA2-D(T) transcripts consisted of functional and full-length transcripts with little evidence for alternative mRNA isoforms in developing cotton fibers. Expression analyses showed that GhCesA2-A(T) and GhCesA2-D(T) shared common temporal and spatial expression patterns, and they were highly and preferentially expressed during the cellulose biosynthesis stage in developing cotton fibers. The observations of higher expression levels of both GhCesA2-A(T) and GhCesA2-D(T) in developing fibers of one near-isogenic line (NIL

  16. [Effect of adaptation to hypoxia on expression of NO synthase isoforms in rat myocardium].

    Science.gov (United States)

    Goryacheva, A V; Terekhina, O L; Abramochkin, D V; Budanova, O P; Belkina, L M; Smirin, B V; Downey, H F; Malyshev, I Yu; Manukhina, E B

    2015-01-01

    Previously we have shown that adaptation to hypoxia (AH) is cardio- and vasoprotective in myocardial ischemic and reperfusion injury and this protection is associated with restriction of nitrosative stress. The present study was focused on further elucidation of NO-dependent mechanisms of AH by identifying specific NO synthases (NOS) that could play the major role in AH protection. AH was performed in a normobaric hypoxic chamber by breathing hypoxic gas mixture (9.5-10% O2) for 5-10 min with intervening 4 min normoxia (5-8 cycles daily for 21 days). Expression of neuronal (nNOS), inducible (iNOS), and endothelial (eNOS) protein was measured in the left ventricular myocardium using Western blot analysis with respective antibodies. AH educed iNOS protein expression by 71% (p < 0.05) whereas eNOS protein expression tended to be reduced by 41% compared to control (p < 0.05). nNOS protein expression remained unchanged after AH. Selective iNOS inhibition can mimic the AH-induced protection. Therefore protective effects of AH could be at least partially due to restriction of iNOS and, probably, eNOS expression.

  17. Reactivation of methionine synthase from Thermotoga maritima (TM0268) requires the downstream gene product TM0269.

    Science.gov (United States)

    Huang, Sha; Romanchuk, Gail; Pattridge, Katherine; Lesley, Scott A; Wilson, Ian A; Matthews, Rowena G; Ludwig, Martha

    2007-08-01

    The crystal structure of the Thermotoga maritima gene product TM0269, determined as part of genome-wide structural coverage of T. maritima by the Joint Center for Structural Genomics, revealed structural homology with the fourth module of the cobalamin-dependent methionine synthase (MetH) from Escherichia coli, despite the lack of significant sequence homology. The gene specifying TM0269 lies in close proximity to another gene, TM0268, which shows sequence homology with the first three modules of E. coli MetH. The fourth module of E. coli MetH is required for reductive remethylation of the cob(II)alamin form of the cofactor and binds the methyl donor for this reactivation, S-adenosylmethionine (AdoMet). Measurements of the rates of methionine formation in the presence and absence of TM0269 and AdoMet demonstrate that both TM0269 and AdoMet are required for reactivation of the inactive cob(II)alamin form of TM0268. These activity measurements confirm the structure-based assignment of the function of the TM0269 gene product. In the presence of TM0269, AdoMet, and reductants, the measured activity of T. maritima MetH is maximal near 80 degrees C, where the specific activity of the purified protein is approximately 15% of that of E. coli methionine synthase (MetH) at 37 degrees C. Comparisons of the structures and sequences of TM0269 and the reactivation domain of E. coli MetH suggest that AdoMet may be bound somewhat differently by the homologous proteins. However, the conformation of a hairpin that is critical for cobalamin binding in E. coli MetH, which constitutes an essential structural element, is retained in the T. maritima reactivation protein despite striking divergence of the sequences.

  18. Functional Characterization of Nine Norway Spruce TPS Genes and Evolution of Gymnosperm Terpene Synthases of the TPS-d Subfamily1[w

    Science.gov (United States)

    Martin, Diane M.; Fäldt, Jenny; Bohlmann, Jörg

    2004-01-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (−)-limonene synthase, (−)-α/β-pinene synthase, and (−)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-α-farnesene synthase, and E-α-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed. PMID:15310829

  19. Enhanced tolerance and accumulation of heavy metal ions by engineered Escherichia coli expressing Pyrus calleryana phytochelatin synthase.

    Science.gov (United States)

    Li, Hui; Cong, Yu; Lin, Jing; Chang, Youhong

    2015-03-01

    Contamination by heavy metals is a major environmental problem worldwide and microbial bioremediation is an efficient method for removing this type of pollution. The plant enzymephytochelatin synthase (PCS, also known as glutathione g-glutamylcysteinyltransferase, EC2.3.2.15) involved in the synthesis of phytochelatins (PCs), which are metal-binding cysteine-rich peptides, has a major role in the detoxification of heavy metals in plants. Expression of the PcPCS1 gene from the bean pear (Pyrus calleryana Dcne.) was induced after cadmium and copper treatments. However, functional analysis of this gene in vivo has not been reported. And it is or not suitable for bioremediation also needs to be assessed. In this study, we found Escherichia coli with over-expressed PcPCS1 had enhanced tolerance to cadmium, copper, sodium, and mercury. E. colicells transformed with pPcPCS1 was found to survive in solid M9 medium containing 2.0 mM Cd(2+), 4.0 mM Cu(2+). 4.5% (w/v) Na+, or 200 μ MHg(2+). Moreover, the growth curve showed 1.5 mM Cd(2+), 2.5 mM Cu(2+), 3.5% (w/v) Naþ, and 100 μ MHg(2+) had no effect on the growth of the E. coli cells transformed with pPcPCS1. Also, we found the contents of PCs and the accumulation of cadmium,copper, sodium, and mercury ions were enhanced in the recombinant E. coli strain Rosetta(TM) (DE3).These results suggested the PcPCS1 gene might be a candidate for heavy metal bioremediation via recombinant bacteria.

  20. Effects of Intracerebroventricularly (ICV) Injected Ghrelin on Cardiac Inducible Nitric Oxide Synthase Activity/Expression in Obese Rats.

    Science.gov (United States)

    Sudar Milovanovic, E; Jovanovic, A; Misirkic-Marjanovic, M; Vucicevic, Lj; Janjetovic, K; Isenovic, E R

    2015-11-01

    The aim of this study was to examine the effects of ghrelin on regulation of cardiac inducible nitric oxide synthase (iNOS) activity/expression in high fat (HF), obese rats.For this study, male Wistar rats fed with HF diet (30% fat) for 4 weeks were injected every 24 h for 5 days intracerebroventricularly (ICV) with ghrelin (0.3 nmol/5 µl) or with an equal volume of phosphate buffered saline (PBS). Control rats were ICV injected with an equal volume of PBS. Glucose, insulin and nitric oxide (NO) concentrations were measured in serum, while arginase activity and citrulline concentrations were measured in heart lysate. Protein iNOS and regulatory subunit of nuclear factor-κB (NFκB-p65), phosphorylation of enzymes protein kinase B (Akt) at Ser(473), and extracellular signal-regulated kinases 1/2 (ERK1/2) at Tyr(202)/Tyr(204) were determined in heart lysate by Western blot. For gene expression of iNOS qRT-PCR was used.Results show significantly (parginase activity (pactivity of cardiac iNOS via Akt phosphorylation followed by NFκB activation in HF rats. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.

    Science.gov (United States)

    Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk

    2016-05-01

    Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Effects of acetoacetyl-CoA synthase expression on production of farnesene in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Tippmann, Stefan; Ferreira, Raphael; Siewers, Verena

    2017-01-01

    Efficient production of sesquiterpenes in Saccharomyces cerevisiae requires a high flux through the mevalonate pathway. To achieve this, the supply of acetyl-CoA plays a crucial role, partially because nine moles of acetyl-CoA are necessary to produce one mole of farnesyl diphosphate, but also...... condensation of malonyl-CoA and acetyl-CoA to acetoacetyl-CoA and, therefore, represents a potential target to increase the flux through the mevalonate pathway. This study investigates the effect of acetoacetyl-CoA synthase on growth as well as the production of farnesene and compares different homologs...... regarding their efficiency. While plasmid-based expression of nphT7 did not improve final farnesene titers, the construction of an alternative pathway, which exclusively relies on the malonyl-CoA bypass, was detrimental for growth and farnesene production. The presented results indicate that the overall...

  3. Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42.

    Science.gov (United States)

    Chen, Xiao-Hua; Vater, Joachim; Piel, Jörn; Franke, Peter; Scholz, Romy; Schneider, Kathrin; Koumoutsi, Alexandra; Hitzeroth, Gabriele; Grammel, Nicolas; Strittmatter, Axel W; Gottschalk, Gerhard; Süssmuth, Roderich D; Borriss, Rainer

    2006-06-01

    Although bacterial polyketides are of considerable biomedical interest, the molecular biology of polyketide biosynthesis in Bacillus spp., one of the richest bacterial sources of bioactive natural products, remains largely unexplored. Here we assign for the first time complete polyketide synthase (PKS) gene clusters to Bacillus antibiotics. Three giant modular PKS systems of the trans-acyltransferase type were identified in Bacillus amyloliquefaciens FZB 42. One of them, pks1, is an ortholog of the pksX operon with a previously unknown function in the sequenced model strain Bacillus subtilis 168, while the pks2 and pks3 clusters are novel gene clusters. Cassette mutagenesis combined with advanced mass spectrometric techniques such as matrix-assisted laser desorption ionization-time of flight mass spectrometry and liquid chromatography-electrospray ionization mass spectrometry revealed that the pks1 (bae) and pks3 (dif) gene clusters encode the biosynthesis of the polyene antibiotics bacillaene and difficidin or oxydifficidin, respectively. In addition, B. subtilis OKB105 (pheA sfp(0)), a transformant of the B. subtilis 168 derivative JH642, was shown to produce bacillaene, demonstrating that the pksX gene cluster directs the synthesis of that polyketide. The GenBank accession numbers for gene clusters pks1(bae), pks2, and pks3(dif) are AJ 634060.2, AJ 6340601.2, and AJ 6340602.2, respectively.

  4. Positive selection and functional divergence of farnesyl pyrophosphate synthase genes in plants.

    Science.gov (United States)

    Qian, Jieying; Liu, Yong; Chao, Naixia; Ma, Chengtong; Chen, Qicong; Sun, Jian; Wu, Yaosheng

    2017-02-04

    Farnesyl pyrophosphate synthase (FPS) belongs to the short-chain prenyltransferase family, and it performs a conserved and essential role in the terpenoid biosynthesis pathway. However, its classification, evolutionary history, and the forces driving the evolution of FPS genes in plants remain poorly understood. Phylogeny and positive selection analysis was used to identify the evolutionary forces that led to the functional divergence of FPS in plants, and recombinant detection was undertaken using the Genetic Algorithm for Recombination Detection (GARD) method. The dataset included 68 FPS variation pattern sequences (2 gymnosperms, 10 monocotyledons, 54 dicotyledons, and 2 outgroups). This study revealed that the FPS gene was under positive selection in plants. No recombinant within the FPS gene was found. Therefore, it was inferred that the positive selection of FPS had not been influenced by a recombinant episode. The positively selected sites were mainly located in the catalytic center and functional areas, which indicated that the 98S and 234D were important positively selected sites for plant FPS in the terpenoid biosynthesis pathway. They were located in the FPS conserved domain of the catalytic site. We inferred that the diversification of FPS genes was associated with functional divergence and could be driven by positive selection. It was clear that protein sequence evolution via positive selection was able to drive adaptive diversification in plant FPS proteins. This study provides information on the classification and positive selection of plant FPS genes, and the results could be useful for further research on the regulation of triterpenoid biosynthesis.

  5. Expression of endothelial nitric oxide synthase in acute radiation-induced cerebral edema

    International Nuclear Information System (INIS)

    Liu Baoguo; Zhang Baomin; Chen Xiaohua; Gao Yabing; Wang Dewen

    2000-01-01

    Objective: To study the relation between changes in expression of endothelial nitric oxide synthase (eNOS) in brain vascular endothelial cells and acute radiation-induced cerebral edema after 60 Co gamma knife irradiation with a high dose. Methods: The right caudate nucleus of rats were irradiated with 200 Gy 60 Co gamma knife. the rats were sacrificed within 14 days after irradiation. By a light microscopy, electron microscopy, immunohistochemistry and in situ hybridization, the authors studied the formation and development of acute radiation-induced cerebral edema as well as the expression of eNOS in brain vascular endothelial cells. Results: Acute radiation-induced cerebral edema was observed morphologically 2 hours after irradiation and peaked on day 3 after irradiation. The expression of eNOS in brain vascular endothelial cells markedly increased 2 hours after irradiation, which could be consistently visualized during the acute developmental phase of radiation-induced cerebral edema. Conclusion: The increased expression of eNOS may be related to the formation and development of acute radiation-induced cerebral edema after 60 Co gamma knife irradiation with a high dose

  6. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  7. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Influence of thymidylate synthase expression on survival in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Kinjal K Gajjar

    2017-01-01

    Full Text Available Background: Thymidylate synthase (TS plays a critical role in nucleotide metabolism and is an important target for 5-fluorouracil (5-FU, the standard chemotherapeutic drug for treatment of colorectal cancer (CRC. Aims and Methods: The present study aimed to evaluate TS variable number tandem repeat sequences (VNTR polymorphism by polymerase chain reaction and TS protein expression by immunohistochemistry and its association with clinicopathological parameters in untreated CRC patients (n = 100. Further, the prognostic and predictive role of TS has been evaluated. Results: For TS VNTR polymorphism, the observed frequencies of 2R/2R, 2R/3R, and 3R/3R genotypes were 22%, 51%, and 27%, respectively. When immunohistochemical localization was studied, cytoplasmic staining for TS was observed in 70% of patients. A significant inverse correlation was noted between TS protein expression and tumor, node, metastasis staging (P = 0.027, Dukes' staging (P = 0.039, and lymph node status (P = 0.012 of CRC patients. However, there was no significant correlation between TS VNTR polymorphism and TS protein expression. On survival analysis, a significantly shorter overall survival (OS was seen in CRC patients with negative protein expression (P = 0.031. Moreover, the subgroup of CRC patients treated only with surgery also showed a trend of poor OS in patients with negative TS protein expression (P = 0.058. However, neither TS polymorphism nor its protein expression was able to predict relapse-free survival. Conclusion: Negative TS protein expression may be related to unfavorable clinical outcome in CRC patients. However, further studies in a larger set of patients are necessary to better assess TS as a prognostic and predictive marker for 5-FU response in CRC patients.

  9. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  10. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Expression of three galactinol synthase isoforms in Coffea arabica L. and accumulation of raffinose and stachyose in response to abiotic stresses.

    Science.gov (United States)

    dos Santos, Tiago B; Budzinski, Ilara G F; Marur, Celso J; Petkowicz, Carmen L O; Pereira, Luiz F P; Vieira, Luiz G E

    2011-04-01

    Galactinol synthase (EC 2.4.1.123; GolS) catalyzes the first step in the synthesis of raffinose family oligosaccharides (RFOs). Their accumulation in response to abiotic stresses implies a role for RFOs in stress adaptation. In this study, the expression patterns of three isoforms of galactinol synthase (CaGolS1-2-3) from Coffea arabica were evaluated in response to water deficit, salinity and heat stress. All CaGolS isoforms were highly expressed in leaves while little to no expression were detected in flower buds, flowers, plagiotropic shoots, roots, endosperm and pericarp of mature fruits. Transcriptional analysis indicated that the genes were differentially regulated under water deficit, high salt and heat stress. CaGolS1 isoform is constitutively expressed in plants under normal growth conditions and was the most responsive during all stress treatments. CaGolS2 is unique among the three isoforms in that it was detected only under severe water deficit and salt stresses. CaGolS3 was primarily expressed under moderate and severe drought. This isoform was induced only at the third day of heat and under high salt stress. The increase in GolS transcription was not reflected into the amount of galactinol in coffee leaves, as specific glycosyltransferases most likely used galactinol to transfer galactose units to higher homologous oligosaccharides, as suggested by the increase of raffinose and stachyose during the stresses. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  12. Harnessing gene expression networks to prioritize candidate epileptic encephalopathy genes.

    Science.gov (United States)

    Oliver, Karen L; Lukic, Vesna; Thorne, Natalie P; Berkovic, Samuel F; Scheffer, Ingrid E; Bahlo, Melanie

    2014-01-01

    We apply a novel gene expression network analysis to a cohort of 182 recently reported candidate Epileptic Encephalopathy genes to identify those most likely to be true Epileptic Encephalopathy genes. These candidate genes were identified as having single variants of likely pathogenic significance discovered in a large-scale massively parallel sequencing study. Candidate Epileptic Encephalopathy genes were prioritized according to their co-expression with 29 known Epileptic Encephalopathy genes. We utilized developing brain and adult brain gene expression data from the Allen Human Brain Atlas (AHBA) and compared this to data from Celsius: a large, heterogeneous gene expression data warehouse. We show replicable prioritization results using these three independent gene expression resources, two of which are brain-specific, with small sample size, and the third derived from a heterogeneous collection of tissues with large sample size. Of the nineteen genes that we predicted with the highest likelihood to be true Epileptic Encephalopathy genes, two (GNAO1 and GRIN2B) have recently been independently reported and confirmed. We compare our results to those produced by an established in silico prioritization approach called Endeavour, and finally present gene expression networks for the known and candidate Epileptic Encephalopathy genes. This highlights sub-networks of gene expression, particularly in the network derived from the adult AHBA gene expression dataset. These networks give clues to the likely biological interactions between Epileptic Encephalopathy genes, potentially highlighting underlying mechanisms and avenues for therapeutic targets.

  13. Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Crock, John E. (Moscow, ID)

    1999-01-01

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  14. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce; Crock, John E.

    2005-01-25

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  15. In silico prediction of gene expression patterns in Citrus flavedo

    Directory of Open Access Journals (Sweden)

    Irving J. Berger

    2007-01-01

    Full Text Available Out of the 18,942 flavedo expressed sequences (clusters plus singletons in Citrus sinensis from the Citrus EST Project (CitEST, 25 were statistically supported to be differentially expressed in this tissue after a double in silico hybridization strategy against leaf-, flower-, and bark-derived ESTs. Five of them, two terpene synthases and three O-methyltransferases, are absent in the other citrus tissues with concomitant 2x2 statistics, supporting the hypothesis that they are putative flavedo-specific expressed sequences. The pattern of these differentially expressed sequences during fruit development suggests that most of them are developmentally regulated. Some expressed gene products, including a putative germin-like protein highly expressed in flavedo, are shown to be promising candidates for further characterization. In addition to promoter seeking, this kind of analysis can lead to gene discovery, tissue-specific and tissue-enriched expression pattern predictions (as shown herein and can also be adopted as an in silico first, and probably reliable approach, for detecting expression profiles from EST sequencing efforts before experimental validation is available or for heuristically guiding that validation.

  16. Enhanced thermotolerance for ethanol fermentation of Saccharomyces cerevisiae strain by overexpression of the gene coding for trehalose-6-phosphate synthase.

    Science.gov (United States)

    An, Ming-Zhe; Tang, Yue-Qin; Mitsumasu, Kanako; Liu, Ze-Shen; Shigeru, Morimura; Kenji, Kida

    2011-07-01

    The effect of overexpression of the trehalose-6-phosphate (T6P) synthase gene (TPS1) on ethanol fermentation of Saccharomyces cerevisiae has been studied at 30 and 38°C. The activity of T6P synthase and the accumulation of trehalose during ethanol fermentation were significantly improved by overexpression of TPS1, and especially at 38°C. Ethanol produced by transformants with and without TPS1 gene overexpression at 38°C was approx. 60 and 37 g/l, respectively. The fermentation efficiency of transformants with TPS1 gene overexpression at 38°C was similar to that at 30°C. The critical growth temperature was increased from 36 to 42°C by TPS1 gene overexpression. These results indicated that overexpression of the TPS1 gene had a beneficial effect on the fermentation capacity of the title yeast strain at high temperatures.

  17. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase.

    Directory of Open Access Journals (Sweden)

    Carole H Sellem

    2016-07-01

    Full Text Available Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO of the ATP synthase drive the rotation of a ring of 8-15 c-subunits, which induces conformational changes in the catalytic part (F1 of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary cells while Atp9-5 is expressed in the cells at the extremity (apex of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before.

  18. A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria).

    Science.gov (United States)

    Formighieri, Cinzia; Melis, Anastasios

    2015-11-01

    Cyanobacteria can be exploited as photosynthetic platforms for heterologous generation of terpene hydrocarbons with industrial applications. Transformation of Synechocystis and heterologous expression of the β-phellandrene synthase (PHLS) gene alone is necessary and sufficient to confer to Synechocystis the ability to divert intermediate terpenoid metabolites and to generate the monoterpene β-phellandrene during photosynthesis. However, terpene synthases, including the PHLS, have a slow Kcat (low Vmax) necessitating high levels of enzyme concentration to enable meaningful rates and yield of product formation. Here, a novel approach was applied to increase the PHLS protein expression alleviating limitations in the rate and yield of β-phellandrene product generation. Different PHLS fusion constructs were generated with the Synechocystis endogenous cpcB sequence, encoding for the abundant in cyanobacteria phycocyanin β-subunit, expressed under the native cpc operon promoter. In one of these constructs, the CpcB·PHLS fusion protein accumulated to levels approaching 20% of the total cellular protein, i.e., substantially higher than expressing the PHLS protein alone under the same endogenous cpc promoter. The CpcB·PHLS fusion protein retained the activity of the PHLS enzyme and catalyzed β-phellandrene synthesis, yielding an average of 3.2 mg product g(-1) dry cell weight (dcw) versus the 0.03 mg g(-1)dcw measured with low-expressing constructs, i.e., a 100-fold yield improvement. In conclusion, the terpene synthase fusion-protein approach is promising, as, in this case, it substantially increased the amount of the PHLS in cyanobacteria, and commensurately improved rates and yield of β-phellandrene hydrocarbons production in these photosynthetic microorganisms. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  19. Nitric oxide synthase 2 (NOS2) expression in histologically normal margins of oral squamous cell carcinoma.

    Science.gov (United States)

    Morelatto, Rosana; Itoiz, María-Elina; Guiñazú, Natalia; Piccini, Daniel; Gea, Susana; López-de Blanc, Silvia

    2014-05-01

    The activity of Nitric Oxide Synthase 2 (NOS2) was found in oral squamous cell carcinomas (OSCC) but not in normal mucosa. Molecular changes associated to early carcinogenesis have been found in mucosa near carcinomas, which is considered a model to study field cancerization. The aim of the present study is to analyze NOS2 expression at the histologically normal margins of OSCC. Eleven biopsy specimens of OSCC containing histologically normal margins (HNM) were analyzed. Ten biopsies of normal oral mucosa were used as controls. The activity of NOS2 was determined by immunohistochemistry. Salivary nitrate and nitrite as well as tobacco and alcohol consumption were also analyzed. The Chi-squared test was applied. Six out of the eleven HNM from carcinoma samples showed positive NOS2 activity whereas all the control group samples yielded negative (p=0.005). No statistically significant association between enzyme expression and tobacco and/or alcohol consumption and salivary nitrate and nitrite was found. NOS2 expression would be an additional evidence of alterations that may occur in a state of field cancerization before the appearance of potentially malignant morphological changes.

  20. Manganese influences the expression of fatty acid synthase and malic enzyme in cultured primary chicken hepatocytes.

    Science.gov (United States)

    Lu, Lin; Wang, Meiling; Liao, Xiudong; Zhang, Liyang; Luo, Xugang

    2017-12-01

    Two experiments were designed to investigate the effects of Mn source and concentration on the mRNA expression and enzymatic activities of fatty acid synthase (FAS) and malic enzyme (ME) in cultured primary broiler hepatocytes. In Expt 1, primary broiler hepatocytes were treated with 0 (control), 0·25, 0·50 or 0·75 mmol/l of Mn as inorganic manganese chloride (MnCl2.4H2O) for 24 and 48 h. In Expt 2, primary broiler hepatocytes were incubated with 0 (control), 0·25 or 0·50 mmol/l of Mn as either manganese chloride or Mn-amino acid chelate for 48 h. The mRNA levels and activities of FAS and ME in the hepatocytes were measured in Expts 1 and 2. The results in Expt 1 showed that only at 48 h mRNA expression levels of FAS and ME in the hepatocytes decreased linearly (P0·33) on any of the measured cellular parameters. The results suggested that Mn might reduce cell damage and regulate FAS and ME expression at a transcriptional level in primary cultured broiler hepatocytes.

  1. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  2. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  3. Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

    DEFF Research Database (Denmark)

    Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

    2005-01-01

    The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

  4. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal

    2002-01-01

    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... that the method can be applied to modulating the expression of native genes on the chromosome. We constructed a series of strains in which the expression of the las operon, containing the genes pfk, pyk, and ldh, was modulated by integrating a truncated copy of the pfk gene. Importantly, the modulation affected...

  5. Cerebrovascular gene expression in spontaneously hypertensive rats

    DEFF Research Database (Denmark)

    Grell, Anne-Sofie; Frederiksen, Simona Denise; Edvinsson, Lars

    2017-01-01

    in the middle cerebral arteries from hypertensive compared to normotensive rats. The gene expression of 72 genes was decreased and the gene expression of 97 genes was increased. The following genes with a fold difference ≥1.40 were verified by quantitative PCR; Postn, Olr1, Fas, Vldlr, Mmp2, Timp1, Serpine1......, Mmp11, Cd34, Ptgs1 and Ptgs2. The gene expression of Postn, Olr1, Fas, Vldlr, Mmp2, Timp1 and Serpine1 and the protein expression of LOX1 (also known as OLR1) were significantly increased in the middle cerebral arteries from spontaneously hypertensive rats compared to Wistar-Kyoto rats. In conclusion...

  6. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  7. Vascular endothelial growth factor and nitric oxide synthase expression in human tooth germ development.

    Science.gov (United States)

    Mastrangelo, F; Sberna, M T; Tettamanti, L; Cantatore, G; Tagliabue, A; Gherlone, E

    2016-01-01

    Vascular Endothelia Growth Factor (VEGF) and Nitric Oxide Synthase (NOS) expression, were evaluated in human tooth germs at two different stages of embryogenesis, to clarify the role of angiogenesis during tooth tissue differentiation and growth. Seventy-two third molar germ specimens were selected during oral surgery. Thirty-six were in the early stage and 36 in the later stage of tooth development. The samples were evaluated with Semi-quantitative Reverse Transcription-Polymerase chain Reaction analyses (RT-PcR), Western blot analysis (WB) and immunohistochemical analysis. Western blot and immunohistochemical analysis showed a VEGF and NOS 1-2-3 positive reaction in all samples analysed. VEGF high positive decrease reaction was observed in stellate reticulum cells, ameloblast and odontoblast clusters in early stage compared to later stage of tooth germ development. Comparable VEGF expression was observed in endothelial cells of early and advanced stage growth. NOS1 and NOS3 expressions showed a high increased value in stellate reticulum cells, and ameloblast and odontoblast clusters in advanced stage compared to early stage of development. The absence or only moderate positive reaction of NOS2 was detected in all the different tissues. Positive NOS2 expression showed in advanced stage of tissue development compared to early stage. The action of VEGF and NOS molecules are important mediators of angiogenesis during dental tissue development. VEGF high positive expression in stellate reticulum cells in the early stage of tooth development compared to the later stage and the other cell types, suggests a critical role of the stellate reticulum during dental embryo-morphogenesis.

  8. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae).

    Science.gov (United States)

    Zhou, Bo; Wang, Yu; Zhan, Yaguang; Li, Yuhua; Kawabata, Saneyuki

    2013-12-01

    The epidermis of Brassica rapa (turnip) cv. Tsuda contains light-induced anthocyanins, visible signs of activity of chalcone synthase (CHS), a key anthocyanin biosynthetic enzyme, which is encoded by the CHS gene family. To elucidate the regulation of this light-induced pigmentation, we isolated Brassica rapa CHS1-CHS6 (BrCHS1-CHS6) and characterized their cis-elements and expression patterns. Epidermises of light-exposed swollen hypocotyls (ESHS) were harvested to analyze transcription levels of BrCHS genes by real-time PCR. Different promoters for the genes were inserted into tobacco to examine pCHS-GUS activity by histochemistry. Yeast-one-hybridization was used to detect binding activity of BrCHS motifs to transcription factors. Transcript levels of BrCHS1, -4, and -5 and anthocyanin-biosynthesis-related genes F3H, DFR, and ANS were high, while those of BrCHS2, -3, and -6 were almost undetectable in pigmented ESHS. However, in leaves, CHS5, F3H, and ANS expression was higher than in nonpigmented ESHS, but transcription of DFR was not detected. In the analysis of BrCHS1 and BrCHS3 promoter activity, GUS activity was strong in pigmented flowers of BrPCHS1-GUS-transformed tobacco plants, but nearly absent in BrPCHS3-GUS-transformed plants. Transcript levels of regulators, BrMYB75 and BrTT8, were strongly associated with the anthocyanin content and were light-induced. Coregulated cis-elements were found in promoters of BrCHS1,-4, and -5, and BrMYB75 and BrTT8 had high binding activities to the BrCHS Unit 1 motif. The chalcone synthase gene family encodes a redundant set of light-responsive, tissue-specific genes that are expressed at different levels and are involved in flavonoid biosynthesis in Tsuda turnip.

  9. The Regulation of Nitric Oxide Synthase Isoform Expression in Mouse and Human Fallopian Tubes: Potential Insights for Ectopic Pregnancy

    Directory of Open Access Journals (Sweden)

    Junting Hu

    2014-12-01

    Full Text Available Nitric oxide (NO is highly unstable and has a half-life of seconds in buffer solutions. It is synthesized by NO-synthase (NOS, which has been found to exist in the following three isoforms: neuro nitric oxide synthase (nNOS, inducible nitric oxide synthase (iNOS, and endothelial nitric oxide synthase (eNOS. NOS activity is localized in the reproductive tracts of many species, although direct evidence for NOS isoforms in the Fallopian tubes of mice is still lacking. In the present study, we investigated the expression and regulation of NOS isoforms in the mouse and human Fallopian tubes during the estrous and menstrual cycles, respectively. We also measured isoform expression in humans with ectopic pregnancy and in mice treated with lipopolysaccharide (LPS. Our results confirmed the presence of different NOS isoforms in the mouse and human Fallopian tubes during different stages of the estrous and menstrual cycles and showed that iNOS expression increased in the Fallopian tubes of women with ectopic pregnancy and in LPS-treated mice. Elevated iNOS activity might influence ovulation, cilia beats, contractility, and embryo transportation in such a manner as to increase the risk of ectopic pregnancy. This study has provided morphological and molecular evidence that NOS isoforms are present and active in the human and mouse Fallopian tubes and suggests that iNOS might play an important role in both the reproductive cycle and infection-induced ectopic pregnancies.

  10. Yeast dihydroxybutanone phosphate synthase, an enzyme of the riboflavin biosynthetic pathway, has a second unrelated function in expression of mitochondrial respiration.

    Science.gov (United States)

    Jin, Can; Barrientos, Antoni; Tzagoloff, Alexander

    2003-04-25

    aE280/U1 is a pet mutant of Saccharomyces cerevisiae partially deficient in cytochromes a, a3, and cytochrome b. The ability of this mutant to respire is restored by RIB3, a gene previously shown to code for 3,4-dihydroxy-2-butanone-4-phosphate synthase (DHBP synthase), an enzyme of the riboflavin biosynthetic pathway. The sequences of RIB3 from wild type and aE280/U1 indicated a single base change resulting in an A137T substitution. The alanine 137 is a conserved residue located in a cavity on the surface of the protein distant from the active site and from the subunit interaction domain involved in homodimer formation. The respiratory defect elicited by this mutation cannot be explained by a flavin insufficiency based on the following evidence: 1) growth of the aE280/U1 on respiratory substrates is not rescued by exogenous riboflavin; 2) the levels of flavin nucleotides are not significantly different in the mutant and wild type. We proposed that in addition to its known function in riboflavin synthesis, RIB3 also functions in expression of mitochondrial respiration. Restoration by riboflavin of growth of a rib3 deletion mutant on glucose but not glycerol/ethanol also supported this conclusion. An antibody against the N-terminal half of DHBP synthase was used to study its subcellular distribution. Most of the protein was localized in the cytosolic fraction, but a small fraction was detected in the mitochondrial intermembrane space.

  11. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    Science.gov (United States)

    Yang, G H; Liu, J P

    2014-10-20

    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  12. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

    Science.gov (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

    2015-07-28

    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  13. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase ( Ans ) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans +5 . The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans / ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans +5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  14. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  15. Nonlinear dimensionality reduction of gene expression data

    OpenAIRE

    Nilsson, Jens

    2006-01-01

    Using microarray measurements techniques, it is possible to measure the activity of genes simultaneously across the whole genome. Since genes influence each others activity levels through complex regulatory networks, such gene expression measurements are state samples of a dynamical system. Gene expression data has proven useful for diagnosis and definition of disease subgroups, for inference of the functional role of a given gene or for the deciphering of complex disease mechanisms. However,...

  16. Starch granules size distribution in superior and inferior grains of wheat is related to enzyme activities and their gene expressions during grain filling

    DEFF Research Database (Denmark)

    Zhang, Chuanhui; Jiang, Dong; Liu, Fulai

    2010-01-01

    studied in superior and inferior grains during grain filling. Compared with inferior grains, superior grains showed higher grain weight, contents of starch, amylose and amylopectin. The formation of A-, B-, C-type starch granules initiated at 4, 8, 20 DAF, respectively, and was well consistent...... with the temporally change patterns of starch synthase activities and relative gene expression levels. For instance, activities of soluble and granule-bound starch synthases (designated SSS and GBSS) peaked at 20 and 24 DAF. Genes encoding isoforms of starch synthases expressed at different grain filling periods...

  17. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes.

    Science.gov (United States)

    Wendisch, V F; Spies, M; Reinscheid, D J; Schnicke, S; Sahm, H; Eikmanns, B J

    1997-10-01

    In the amino-acid-producing microorganism Corynebacterium glutamicum, the specific activities of the acetate-activating enzymes acetate kinase and phosphotransacetylase and those of the glyoxylate cycle enzymes isocitrate lyase and malate synthase were found to be high when the cells were grown on acetate (0.8, 2.9, 2.1, and 1.8 U/mg protein, respectively). When the cells were grown on glucose or on other carbon sources such as lactate, succinate, or glutamate, the specific activities were two- to fourfold (acetate kinase and phosphotransacetylase) and 45- to 100-fold (isocitrate lyase and malate synthase) lower, indicating that the synthesis of the four enzymes is regulated by acetate in the growth medium. A comparative Northern (RNA) analysis of the C. glutamicum isocitrate lyase and malate synthase genes (aceA and aceB) and transcriptional cat fusion experiments revealed that aceA and aceB are transcribed as 1.6- and 2.7-kb monocistronic messages, respectively, and that the regulation of isocitrate lyase and malate synthase synthesis is exerted at the level of transcription from the respective promoters. Surprisingly, C. glutamicum mutants defective in either acetate kinase or phosphotransacetylase showed low specific activities of the other three enzymes (phosphotransacetylase, isocitrate lyase, and malate synthase or acetate kinase, isocitrate lyase, and malate synthase, respectively) irrespective of the presence or absence of acetate in the medium. This result and a correlation of a high intracellular acetyl coenzyme A concentration with high specific activities of isocitrate lyase, malate synthase, acetate kinase, and phosphotransacetylase suggest that acetyl coenzyme A or a derivative thereof may be a physiological trigger for the genetic regulation of enzymes involved in acetate metabolism of C. glutamicum.

  18. Characterisation and vascular expression of nitric oxide synthase 3 in amphibians.

    Science.gov (United States)

    Cameron, Melissa S; Trajanovska, Sofie; Forgan, Leonard G; Donald, John A

    2016-12-01

    In mammals, nitric oxide (NO) produced by nitric oxide synthase 3 (NOS3) localised in vascular endothelial cells is an important vasodilator but the presence of NOS3 in the endothelium of amphibians has been concluded to be absent, based on physiological studies. In this study, a nos3 cDNA was sequenced from the toad, Rhinella marina. The open reading frame of R. marina nos3 encoded an 1170 amino acid protein that showed 81 % sequence identity to the recently cloned Xenopus tropicalis nos3. Rhinella marina nos3 mRNA was expressed in a range of tissues and in the dorsal aorta and pulmonary, mesenteric, iliac and gastrocnemius arteries. Furthermore, nos3 mRNA was expressed in the aorta of Xenopus laevis and X. tropicalis. Quantitative real-time PCR showed that removal of the endothelium of the lateral aorta of R. marina significantly reduced the expression of nos3 mRNA compared to control aorta with the endothelium intact. However, in situ hybridisation was not able to detect any nos3 mRNA in the dorsal aorta of R. marina. Immunohistochemistry using a homologous R. marina NOS3 antibody showed immunoreactivity (IR) within the basal region of many endothelial cells of the dorsal aorta and iliac artery. NOS3-IR was also observed in the proximal tubules and collecting ducts of the kidney but not within the capillaries of the glomeruli. This is the first study to demonstrate that vascular endothelial cells of an amphibian express NOS3.

  19. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  20. Quantitative Gene Expression of ERG9 in Model Saccharomyces cerevisiae: Chamomile Extract For Human Cancer Treatment.

    Science.gov (United States)

    Hosseinpour, Maryam; Mobini-Dehkordi, Mohsen; Teimori, Hossein

    2016-07-01

    Over expression of squalene synthase gene causes induction of growth tumour and reduction of apoptosis. This gene which is conserved between Saccharomyces cerevisiae yeast and humans, is named (ERG9). In this work, we studied the effect of Matricaria recutita extract on ERG9 gene (squalene synthase) expression in S.cerevisiae which was used as organism model in cancer therapy. S. cerevisiae was cultured in YPD medium plus 0,250, 1000 and 3000 μg/ml of Matricaria recutita extract and we evaluated the (ERG9) gene expression by Real-time RT-PCR method after 24 hours. At least 3 independent experiments were done. Data were analyzed using One-way ANOVA and Dunnett's test. A p-value of less than 0.01 was considered as significant. We found that 250, 1000 and 3000 μg/ml of Matricaria recutita extract could reduce expression of ERG9 gene significantly (p<0.01). Interestingly, the expression of this gene was completely inhibited in 1000 and 3000 μg/ml concentrations. This study predicted that Matricaria recutita extract produced anti-cancer effects in humans, because it could inhibit the expression of an analogue key gene in this malignant disease. Further investigations should be made, to study its molecular mechanism of action at the mammal cell level.

  1. Simultaneous post-transcriptional gene silencing of two different chalcone synthase genes resulting in pure white flowers in the octoploid dahlia.

    Science.gov (United States)

    Ohno, Sho; Hosokawa, Munetaka; Kojima, Misa; Kitamura, Yoshikuni; Hoshino, Atsushi; Tatsuzawa, Fumi; Doi, Motoaki; Yazawa, Susumu

    2011-11-01

    Garden dahlias (Dahlia variabilis) are autoallooctoploids with redundant genes producing wide color variations in flowers. There are no pure white dahlia cultivars, despite its long breeding history. However, the white areas of bicolor flower petals appear to be pure white. The objective of this experiment was to elucidate the mechanism by which the pure white color is expressed in the petals of some bicolor cultivars. A pigment analysis showed that no flavonoid derivatives were detected in the white areas of petals in a star-type cultivar 'Yuino' and the two seedling cultivars 'OriW1' and 'OriW2' borne from a red-white bicolor cultivar, 'Orihime', indicating that their white areas are pure white. Semi-quantitative RT-PCR showed that in the pure white areas, transcripts of two chalcone synthases (CHS), DvCHS1 and DvCHS2 which share 69% nucleotide similarity with each other, were barely detected. Premature mRNA of DvCHS1 and DvCHS2 were detected, indicating that these two CHS genes are silenced post-transcriptionally. RNA gel blot analysis revealed that small interfering RNAs (siRNAs) derived from CHSs were produced in these pure white areas. By high-throughput sequence analysis of small RNAs in the pure white areas with no mismatch acceptance, small RNAs were mapped to two alleles of DvCHS1 and two alleles of DvCHS2 expressed in 'Yuino' petals. Therefore, we concluded that simultaneous siRNA-mediated post-transcriptional gene silencing of redundant CHS genes results in the appearance of pure white color in dahlias.

  2. Expression of the inducible isoform of nitric oxide synthase in pigment cell lesions of the skin.

    Science.gov (United States)

    Ahmed, B; Van Den Oord, J J

    2000-03-01

    Nitric oxide (NO) is a small molecule produced during the conversion of L-arginine to L-citrulline by NO synthase (NOS). Several isoforms of NOS exist, of which the Ca2+-independent, inducible NOS (iNOS or NOS2) is most prominently expressed by macrophages. iNOS activity and increased levels of iNOS have been found in various tumours and tumour cell lines but not in normal tissues; however, the precise role of NO in tumour progression has yet to be elucidated. We studied the expression of iNOS in paraffin sections of 41 benign naevi and 52 primary malignant melanomas (MM) of the skin, as well as in 13 metastatic MM. In addition, nitrotyrosine, indicative of NO production and formation of peroxynitrite, was studied in frozen sections of 13 naevi and 30 MM. Virtually all naevi expressed iNOS, but very few expressed nitrotyrosine, indicating either that iNOS in naevi is functionally inactive, or that naevus cells lack reactive oxygen radicals and thus do not form peroxynitrite. Normal melanocytes in adjacent uninvolved skin were unreactive for both markers. In MM, iNOS was most frequently expressed in the 'pure' and 'invasive' radial growth phase (RGP), whereas expression in the vertical growth phase (VGP) and metastatic phase occurred only in 76% of cases; moreover, in these latest phases of tumour progression, iNOS staining was weak and focal. We conclude that iNOS is expressed de novo in most benign pigment cell lesions. In MM (iNOS-generated) NO appears to play an important part in the early steps of invasion (i.e. the 'invasive' RGP), where it may stimulate neo-angiogenesis and may be a prerequisite for further tumour progression; this view is also supported by the finding of iNOS in the associated blood vessels in the papillary dermis. Finally, our data suggest that (iNOS-generated) NO plays a less significant part in the VGP and in metastatic melanoma.

  3. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    Science.gov (United States)

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Pu-erh Tea Reduces Nitric Oxide Levels in Rats by Inhibiting Inducible Nitric Oxide Synthase Expression through Toll-Like Receptor 4

    Science.gov (United States)

    Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei

    2012-01-01

    Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686

  5. Analysis of meniscal degeneration and meniscal gene expression

    Directory of Open Access Journals (Sweden)

    Norton James H

    2010-01-01

    Full Text Available Abstract Background Menisci play a vital role in load transmission, shock absorption and joint stability. There is increasing evidence suggesting that OA menisci may not merely be bystanders in the disease process of OA. This study sought: 1 to determine the prevalence of meniscal degeneration in OA patients, and 2 to examine gene expression in OA meniscal cells compared to normal meniscal cells. Methods Studies were approved by our human subjects Institutional Review Board. Menisci and articular cartilage were collected during joint replacement surgery for OA patients and lower limb amputation surgery for osteosarcoma patients (normal control specimens, and graded. Meniscal cells were prepared from these meniscal tissues and expanded in monolayer culture. Differential gene expression in OA meniscal cells and normal meniscal cells was examined using Affymetrix microarray and real time RT-PCR. Results The grades of meniscal degeneration correlated with the grades of articular cartilage degeneration (r = 0.672; P HLA-DPA1, integrin, beta 2 (ITGB2, ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1, ankylosis, progressive homolog (ANKH and fibroblast growth factor 7 (FGF7, were expressed at significantly higher levels in OA meniscal cells compared to normal meniscal cells. Importantly, many of the genes that have been shown to be differentially expressed in other OA cell types/tissues, including ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS5 and prostaglandin E synthase (PTGES, were found to be expressed at significantly higher levels in OA meniscal cells. This consistency suggests that many of the genes detected in our study are disease-specific. Conclusion Our findings suggest that OA is a whole joint disease. Meniscal cells may play an active role in the development of OA. Investigation of the gene expression profiles of OA meniscal cells may reveal new therapeutic targets for OA therapy and also may uncover novel

  6. Decreased expression of hyaluronan synthase 1 and 2 associates with poor prognosis in cutaneous melanoma.

    Science.gov (United States)

    Poukka, Mari; Bykachev, Andrey; Siiskonen, Hanna; Tyynelä-Korhonen, Kristiina; Auvinen, Päivi; Pasonen-Seppänen, Sanna; Sironen, Reijo

    2016-05-16

    Hyaluronan is a large extracellular matrix molecule involved in several biological processes such as proliferation, migration and invasion. In many cancers, hyaluronan synthesis is altered, which implicates disease progression and metastatic potential. We have previously shown that synthesis of hyaluronan and expression of its synthases 1-2 (HAS1-2) decrease in cutaneous melanoma, compared to benign melanocytic lesions. In the present study, we compared immunohistological staining results of HAS1 and HAS2 with clinical and histopathological parameters to investigate whether HAS1 or HAS2 has prognostic value in cutaneous melanoma. The specimens consisted of 129 tissue samples including superficial (Breslow ≤ 1 mm) and deep (Breslow > 4 mm) melanomas and lymph node metastases. The differences in immunostainings were analysed with non-parametric Mann-Whitney U test. Associations between immunohistological staining results and clinical parameters were determined with the χ(2) test. Survival between patient groups was compared by the Kaplan-Meier method using log rank test and Cox's regression model was used for multivariate analyses. The expression of HAS1 and HAS2 was decreased in deep melanomas and metastases compared to superficial melanomas. Decreased immunostaining of HAS2 in melanoma cells was significantly associated with several known unfavourable histopathologic prognostic markers like increased mitotic count, absence of tumor infiltrating lymphocytes and the nodular subtype. Furthermore, reduced HAS1 and HAS2 immunostaining in the melanoma cells was associated with increased recurrence of melanoma (p = 0.041 and p = 0.006, respectively) and shortened disease- specific survival (p = 0.013 and p = 0.001, respectively). This study indicates that reduced expression of HAS1 and HAS2 is associated with melanoma progression and suggests that HAS1 and HAS2 have a prognostic significance in cutaneous melanoma.

  7. [Antibacterial activity of Porphyra spp. epiphytic bacteria and polyketide synthase I gene screening].

    Science.gov (United States)

    Fang, Wenya; Yang, Rui; Zhu, Peng; Shan, Yuanyuan; Yan, Xiaojun

    2009-02-01

    Based on the antibacterial analysis, we screened Polyketide synthase (PKS I) gene from the epiphytic bacteria of Porphyra spp., in order to obtain the PKS I positive strains and detect the potential connection between the PKS pathway and the antibacterial mechanisms. A total of 31 bacteria with broad-spectrum antibacterial activity were screened by agar-screening methods. The 16S rDNA and the Ketosynthase gene were amplified from the genome DNA of these bacteria, which were cloned into pMD19-T vector for sequencing analysis. Porphyra spp. epiphytic bacteria showed broad-spectrum antibacterial activity. Three PKS I positive epiphytic bacteria were obtained from Wenzhou rotten Porphyra spp. samples which had high antibacterial activity. The BLAST results indicated that the Ketosynthase fragments of PKS I from the strains of WPhG3, WPySwl and WPySw2 shared highest similarity (98%, 99%, 98%) to the strains of Bacillus subtilis subsp. Subtilis str. 168 (NP_389602), Bacillus subtilis (ABR19776) and Aspergillus carbonarius (AAZ99721), respectively. Furthermore, the phylogenetic analysis based on 16S rDNA sequences indicated that they belonged to the genus of Bacillus. The flora of Porphyra spp. epiphytic bacteria was complex, which regulated the phycosphere in many ways. The PKS I pathway might be a performance of antibacterial function of Bacillus from Wenzhou rotten samples.

  8. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  9. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba.

    Science.gov (United States)

    Kim, Sang-Min; Kim, Soo-Un

    2010-02-01

    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  10. Diversifying selection on flavanone 3-hydroxylase and isoflavone synthase genes in cultivated soybean and its wild progenitors.

    Directory of Open Access Journals (Sweden)

    Hao Cheng

    Full Text Available Soybean isoflavone synthase (IFS and flavanone 3-hydroxylase (F3H are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2 and Flavanone 3-hydroxylase (F3H2 genes from 33 soybean accessions, including 17 cultivars (Glycine max and 16 their wild progenitors (Glycine soja. Our data showed that the target genes shared the levels of nucleotide polymorphism with three reference genes involved in plant-microbe interactions, but possessed a much higher nucleotide polymorphism than other reference genes. Moreover, no significant genetic differentiation was found between cultivated soybean and its wild relatives in three target genes, despite of considering bottleneck and founder effect during domestication. These results indicate that IFS and F3H genes could have experienced gene introgressions or diversifying selection events during domestication process. Especially, F3H2 gene appears to evolve under positive selection and enjoy a faster evolutionary rate than IFS1 and IFS2 genes.

  11. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  12. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  13. Soluble Starch Synthase III-1 in Amylopectin Metabolism of Banana Fruit: Characterization, Expression, Enzyme Activity, and Functional Analyses

    OpenAIRE

    Miao, Hongxia; Sun, Peiguang; Liu, Qing; Jia, Caihong; Liu, Juhua; Hu, Wei; Jin, Zhiqiang; Xu, Biyu

    2017-01-01

    Soluble starch synthase (SS) is one of the key enzymes involved in amylopectin biosynthesis in plants. However, no information is currently available about this gene family in the important fruit crop banana. Herein, we characterized the function of MaSSIII-1 in amylopectin metabolism of banana fruit and described the putative role of the other MaSS family members. Firstly, starch granules, starch and amylopectin content were found to increase during banana fruit development, but decline duri...

  14. Expression of microsomal prostaglandin E synthase in bovine endometrium: coexpression with cyclooxygenase type 2 and regulation by interferon-tau.

    Science.gov (United States)

    Parent, Julie; Chapdelaine, Pierre; Sirois, Jean; Fortier, Michel A

    2002-08-01

    Prostaglandins (PGs) are important regulators of reproductive functions. In ruminants, interferon (IFN)-tau is the embryonic signal responsible for recognition of pregnancy. This is effected by a reduction of the production of PGF(2alpha) relative to PGE(2.) This may be accomplished by a decrease in PGF(2alpha) production, but a stimulation of PGE(2) via the PGE synthase might also be involved. The purpose of the present study was to confirm the presence of PGE synthase (PGES) in the bovine endometrium, identify the factors affecting its expression, and compare it with that of cyclooxygenase-2 (COX-2). This was done by Northern blot analysis using primary cultures of bovine epithelial and stromal cells of the endometrium and bovine endometrial cell line. PGES mRNA expression was increased in the presence of lipopolysaccharides, TNF-alpha, and IFN-tau in stromal cells and IFN-tau in epithelial cells. In stromal cells, IFN-tau induced a rapid increase of PGES and COX-2 mRNA expression. In bovine endometrial cells, phorbol 12-myristate 13-actetate increased PGES mRNA, COX-2 mRNA and PGE(2) production. These results suggest that in endometrial cells, the expression of PGE synthase is correlated with that of COX-2 and is an important enzyme for the production of PGE(2). Increasing this production will modulate the PGE(2)/PGF(2alpha) ratio and contribute to establishment of pregnancy.

  15. Functional Expression of an Orchid Fragrance Gene in Lactococcus lactis

    Science.gov (United States)

    Song, Adelene Ai Lian; Abdullah, Janna O.; Abdullah, Mohd Puad; Shafee, Norazizah; Rahim, Raha A.

    2012-01-01

    Vanda Mimi Palmer (VMP), an orchid hybrid of Vanda tesselata and Vanda Tan Chay Yan is a highly scented tropical orchid which blooms all year round. Previous studies revealed that VMP produces a variety of isoprenoid volatiles during daylight. Isoprenoids are well known to contribute significantly to the scent of most fragrant plants. They are a large group of secondary metabolites which may possess valuable characteristics such as flavor, fragrance and toxicity and are produced via two pathways, the mevalonate (MVA) pathway or/and the 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway. In this study, a sesquiterpene synthase gene denoted VMPSTS, previously isolated from a floral cDNA library of VMP was cloned and expressed in Lactococcus lactis to characterize the functionality of the protein. L. lactis, a food grade bacterium which utilizes the mevalonate pathway for isoprenoid production was found to be a suitable host for the characterization of plant terpene synthases. Through recombinant expression of VMPSTS, it was revealed that VMPSTS produced multiple sesquiterpenes and germacrene D dominates its profile. PMID:22408409

  16. Prediction of the gene expression in normal lung tissue by the gene expression in blood.

    Science.gov (United States)

    Halloran, Justin W; Zhu, Dakai; Qian, David C; Byun, Jinyoung; Gorlova, Olga Y; Amos, Christopher I; Gorlov, Ivan P

    2015-11-17

    Comparative analysis of gene expression in human tissues is important for understanding the molecular mechanisms underlying tissue-specific control of gene expression. It can also open an avenue for using gene expression in blood (which is the most easily accessible human tissue) to predict gene expression in other (less accessible) tissues, which would facilitate the development of novel gene expression based models for assessing disease risk and progression. Until recently, direct comparative analysis across different tissues was not possible due to the scarcity of paired tissue samples from the same individuals. In this study we used paired whole blood/lung gene expression data from the Genotype-Tissue Expression (GTEx) project. We built a generalized linear regression model for each gene using gene expression in lung as the outcome and gene expression in blood, age and gender as predictors. For ~18 % of the genes, gene expression in blood was a significant predictor of gene expression in lung. We found that the number of single nucleotide polymorphisms (SNPs) influencing expression of a given gene in either blood or lung, also known as the number of quantitative trait loci (eQTLs), was positively associated with efficacy of blood-based prediction of that gene's expression in lung. This association was strongest for shared eQTLs: those influencing gene expression in both blood and lung. In conclusion, for a considerable number of human genes, their expression levels in lung can be predicted using observable gene expression in blood. An abundance of shared eQTLs may explain the strong blood/lung correlations in the gene expression.

  17. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

    Science.gov (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

    2015-05-01

    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...... be met by using promoter libraries. This approach generally consists of inserting a library of promoters in front of the gene to be studied, whereby the individual promoters might deviate either in their spacer sequences or bear slight deviations from the consensus sequence of a vegetative promoter. Here......, we describe the two different methods for obtaining promoter libraries and compare their applicability....

  19. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  20. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  1. Distinct Cell-Specific Expression of Homospermidine Synthase Involved in Pyrrolizidine Alkaloid Biosynthesis in Three Species of the Boraginales1[C][W][OA

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-01-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant’s chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature. PMID:22566491

  2. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    Science.gov (United States)

    Ishida, Hiroshi; Ray, Radharaman; Amnuaysirikul, Jack; Ishida, Keiko; Ray, Prabhati

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of NO on wound healing inhibited by SM in NHEKs. The effect of the iNOS gene transfer on iNOS protein expression and NO generation were monitored by Western blot and flow cytometry, respectively. Wound healing with or without the iNOS gene transfer after SM exposure was assessed by light and confocal microscopy. The iNOS gene transfer via adenovirus resulted in overexpression of the iNOS and an increase in NO production regardless of SM exposure in the NHEK model. The gene transfer was also effective in overcoming the inhibition of wound healing due to SM exposure leading to the promotion of wound closure. The findings in this study suggest that the iNOS gene transfer is a promising therapeutic strategy for SM-induced skin injury. PMID:23762631

  3. Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays.

    Science.gov (United States)

    Martin, Diane M; Aubourg, Sébastien; Schouwey, Marina B; Daviet, Laurent; Schalk, Michel; Toub, Omid; Lund, Steven T; Bohlmann, Jörg

    2010-10-21

    Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS) were predicted by in silico analysis of the grapevine (Vitis vinifera) genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information about gene structure and phylogeny for the entire currently

  4. Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don

    Directory of Open Access Journals (Sweden)

    Zheng Xiao

    2016-10-01

    Full Text Available The quantitative real-time polymerase chain reaction (qRT-PCR approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder and BestKeeper. The results showed that EF1-α (elongation factor 1-alpha, 18S (18s ribosomal RNA and RPL3 (ribosomal protein L3 were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin (TUB was the least stable. ACT5 (actin, RPL3, 18S and EF1-α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle. Furthermore, the expression profiles of RmPSY (phytoene synthase and RmPDS (phytoene dehydrogenase were assessed using EF1-α, 18S, ACT5, and RPL3 and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle.

  5. Profiling Gene Expression in Germinating Brassica Roots.

    Science.gov (United States)

    Park, Myoung Ryoul; Wang, Yi-Hong; Hasenstein, Karl H

    2014-01-01

    Based on previously developed solid-phase gene extraction (SPGE) we examined the mRNA profile in primary roots of Brassica rapa seedlings for highly expressed genes like ACT7 (actin7), TUB (tubulin1), UBQ (ubiquitin), and low expressed GLK (glucokinase) during the first day post-germination. The assessment was based on the mRNA load of the SPGE probe of about 2.1 ng. The number of copies of the investigated genes changed spatially along the length of primary roots. The expression level of all genes differed significantly at each sample position. Among the examined genes ACT7 expression was most even along the root. UBQ was highest at the tip and root-shoot junction (RS). TUB and GLK showed a basipetal gradient. The temporal expression of UBQ was highest in the MZ 9 h after primary root emergence and higher than at any other sample position. Expressions of GLK in EZ and RS increased gradually over time. SPGE extraction is the result of oligo-dT and oligo-dA hybridization and the results illustrate that SPGE can be used for gene expression profiling at high spatial and temporal resolution. SPGE needles can be used within two weeks when stored at 4 °C. Our data indicate that gene expression studies that are based on the entire root miss important differences in gene expression that SPGE is able to resolve for example growth adjustments during gravitropism.

  6. Polycistronic gene expression in Aspergillus niger.

    Science.gov (United States)

    Schuetze, Tabea; Meyer, Vera

    2017-09-25

    Genome mining approaches predict dozens of biosynthetic gene clusters in each of the filamentous fungal genomes sequenced so far. However, the majority of these gene clusters still remain cryptic because they are not expressed in their natural host. Simultaneous expression of all genes belonging to a biosynthetic pathway in a heterologous host is one approach to activate biosynthetic gene clusters and to screen the metabolites produced for bioactivities. Polycistronic expression of all pathway genes under control of a single and tunable promoter would be the method of choice, as this does not only simplify cloning procedures, but also offers control on timing and strength of expression. However, polycistronic gene expression is a feature not commonly found in eukaryotic host systems, such as Aspergillus niger. In this study, we tested the suitability of the viral P2A peptide for co-expression of three genes in A. niger. Two genes descend from Fusarium oxysporum and are essential to produce the secondary metabolite enniatin (esyn1, ekivR). The third gene (luc) encodes the reporter luciferase which was included to study position effects. Expression of the polycistronic gene cassette was put under control of the Tet-On system to ensure tunable gene expression in A. niger. In total, three polycistronic expression cassettes which differed in the position of luc were constructed and targeted to the pyrG locus in A. niger. This allowed direct comparison of the luciferase activity based on the position of the luciferase gene. Doxycycline-mediated induction of the Tet-On expression cassettes resulted in the production of one long polycistronic mRNA as proven by Northern analyses, and ensured comparable production of enniatin in all three strains. Notably, gene position within the polycistronic expression cassette matters, as, luciferase activity was lowest at position one and had a comparable activity at positions two and three. The P2A peptide can be used to express at

  7. The clinical significance of thymidylate synthase expression in human papillomavirus-related oropharyngeal squamous carcinoma

    International Nuclear Information System (INIS)

    Kato, Hisayuki; Yui, Takehiro; Okada, Tatsuyoshi; Urano, Makoto; Sakurai, Kazuo; Naito, Kensei; Yamamoto, Naoki

    2012-01-01

    The focus of human papilloma virus (HPV), particulary HPV 16 is on the role of carcinogenic and prognostic factors on oropharyngeal squamous carcinoma (OSCC). However, it remains unclear why patients with HPV-positive tumors have better outcomes than those with HPV-negative tumors. Thymidylate synthase (TS) is one of the initial key enzymes in the 5-fluouracil (5-FU) metabolic pathway. Clinical studies showed that intratumoural TS level was related to the response to 5-FU-based chemotherapy in patients with several types of cancer such as gastroenterological and head and neck cancers. We investigated the prevalence of HPV infection and TS expression in the patients with OSCC and evaluated the prognostic implications according to the HPV status and TS expression. We evaluated for high-risk HPV types (HPV 16, 18, 31, 33, 51, 52, 58) using a real-time polymerase chain reaction (RT-PCR) assay on archival biopsies from 54 patients with OSCC. Immunohistochemical assessments for TS were also performed. HPV was positive in 22 (40.7%) of 54 samples. Of these positive cases, 21 (95%) carried HPV 16 and only 1 (5%) HPV58 sequences. TS was overexpressed in 25 (46.3%) of 54 samples. Of these, 19 (76.0%) had an HPV-negative status and 21 (84.0%) were heavy smokers. TS overexpression was associated with the patients with HPV-negative tumors (P=0.02) and heavy smokers (p=0.012). Univariate analysis revealed that HPV positive status (77.3% vs. 29.0%; p=0.006) significantly improved overall survival. Conversely, no remarkable prognostic difference was observed on immunohistochemical analysis of TS expression. A multivariate analysis using Cox's proportional hazard model showed that early T stage (T1-2), early N stage (N0-1), and positive HPV status were significantly independent predictors for superior overall survival. Our studies suggested that positive HPV status was most strongly associated with a favorable prognosis in the patients with OSCC. TS expression has an unusual aspect

  8. Lipoplex gene transfer of inducible nitric oxide synthase inhibits the reactive intimal hyperplasia after expanded polytetrafluoroethylene bypass grafting.

    Science.gov (United States)

    Pfeiffer, Tomas; Wallich, Martina; Sandmann, Wilhelm; Schrader, Jürgen; Gödecke, Axel

    2006-05-01

    Intimal hyperplasia (IH) is most commonly the cause of graft occlusion in infrainguinal bypass grafting for arterial occlusive disease. We investigated the influence of nitric oxide on the IH of the arterial vessel wall at the region of prosthetic bypass anastomoses. Experiments were performed in 10 Foxhound dogs. We used a technique of inducible nitric oxide synthase (iNOS) overexpression by a non-virus-mediated, liposome-based iNOS gene transfer. The plasmid pSCMV-iNOS, which drives the expression of iNOS under control of the cytomegalovirus promoter, was complexed with cationic liposomes (lipoplexes). Segments of both carotid arteries were pretreated by intramural injection of a lipoplex solution by using an infiltrator balloon catheter (Infiltrator Drug Delivery Balloon System). In each dog, iNOS was administered at one side, and a control vector (pSCMV2) was administered at the contralateral side. Carotid arteries were ligated, and bypass grafts (expanded polytetrafluoroethylene, 6-mm, ring enforced) were implanted on both sides. The proximal and distal anastomoses (end-to-side fashion; running nonabsorbable sutures) were placed in the pretreated regions. After 6 months, the prostheses were excised, and the intimal thicknesses of 50 cross sections (orcein staining) of each anastomosis were measured planimetrically. The average reduction of the neointima thickness of the iNOS side in proximal anastomoses at the prosthetic wall, suture region, and arterial wall was 43%, 52%, and 81%, respectively. In distal anastomoses, the average reduction was 40%, 47%, and 52%, respectively. All differences of neointima thickness between the iNOS and control sides were statistically significant (Wilcoxon test; P < or = .05). Inducible NOS expression is an efficient approach for inhibition of IH. In contrast to earlier studies, which investigated the efficacy of gene therapeutic NOS expression at 3 to 4 weeks after intervention, the novelty of our findings is that a single

  9. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  10. Metagenomic Survey of Potential Symbiotic Bacteria and Polyketide Synthase Genes in an Indonesian Marine Sponge

    Directory of Open Access Journals (Sweden)

    Nia M. Kurnia

    2017-01-01

    Full Text Available There has been emerging evidence that the bacteria associated with marine sponges are the key producers of many complex bioactive compounds. The as-yet uncultured candidate bacterial genus “Candidatus Entotheonella” of the marine sponge Theonella swinhoei from Japan have recently been recognized as the source of numerous pharmacologically relevant polyketides and modified peptides, as previously reported by the Piel group (Wilson et al. 2014. This work reported the presence of “Candidatus Entotheonella sp.” in the highly complex microbiome of an Indonesian marine sponge from Kapoposang Island, South Sulawesi. We further identified the Kapoposang sponge specimen used in this work as Rhabdastrella sp. based on the integrated morphological, histological, and cytochrome oxidase subunit I (COI gene analyses. To detect the polyketide biosynthetic machinery called type I polyketide synthase (PKS in this Indonesian Rhabdastrella sp., we amplified and cloned the ketosynthase-encoding DNA regions of approximately 700 bp from the uncultured sponge's microbiome. Further sequencing and analysis of several randomly chosen clones indicated that all of them are mostly likely involved in the biosynthesis of methyl-branched fatty acids. However, employing a PKS-targeting primer designed in this work led to the isolation of four positive clones. BlastX search and subsequent phylogenetic analysis showed that one of the positive clones, designed as RGK32, displayed high homology with ketosynthase domains of many type I PKS systems and may belong to the subclass cis-AT PKS group.

  11. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    Directory of Open Access Journals (Sweden)

    Ling Jiang

    Full Text Available A novel trehalose synthase (TreS gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+ and Hg(2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%, making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  12. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  13. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  14. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  15. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Czech Academy of Sciences Publication Activity Database

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef

    2010-01-01

    Roč. 19, č. 17 (2010), s. 3430-3439 ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant - others:Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 8.058, year: 2010

  16. Glucosylceramide synthase upregulates MDR1 expression in the regulation of cancer drug resistance through cSrc and β-catenin signaling

    Directory of Open Access Journals (Sweden)

    Cabot Myles C

    2010-06-01

    Full Text Available Abstract Background Drug resistance is the outcome of multiple-gene interactions in cancer cells under stress of anticancer agents. MDR1 overexpression is most commonly detected in drug-resistant cancers and accompanied with other gene alterations including enhanced glucosylceramide synthase (GCS. MDR1 encodes for P-glycoprotein that extrudes anticancer drugs. Polymorphisms of MDR1 disrupt the effects of P-glycoprotein antagonists and limit the success of drug resistance reversal in clinical trials. GCS converts ceramide to glucosylceramide, reducing the impact of ceramide-induced apoptosis and increasing glycosphingolipid (GSL synthesis. Understanding the molecular mechanisms underlying MDR1 overexpression and how it interacts with GCS may find effective approaches to reverse drug resistance. Results MDR1 and GCS were coincidently overexpressed in drug-resistant breast, ovary, cervical and colon cancer cells; silencing GCS using a novel mixed-backbone oligonucleotide (MBO-asGCS sensitized these four drug-resistant cell lines to doxorubicin. This sensitization was correlated with the decreased MDR1 expression and the increased doxorubicin accumulation. Doxorubicin treatment induced GCS and MDR1 expression in tumors, but MBO-asGCS treatment eliminated "in-vivo" growth of drug-resistant tumor (NCI/ADR-RES. MBO-asGCS suppressed the expression of MDR1 with GCS and sensitized NCI/ADR-RES tumor to doxorubicin. The expression of P-glycoprotein and the function of its drug efflux of tumors were decreased by 4 and 8 times after MBO-asGCS treatment, even though this treatment did not have a significant effect on P-glycoprotein in normal small intestine. GCS transient transfection induced MDR1 overexpression and increased P-glycoprotein efflux in dose-dependent fashion in OVCAR-8 cancer cells. GSL profiling, silencing of globotriaosylceramide synthase and assessment of signaling pathway indicated that GCS transfection significantly increased globo series

  17. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  18. Gene Expression and Microarray Investigation of Dendrobium ...

    African Journals Online (AJOL)

    Result: Between the diabetic rat group and the wild-type group, 1339 functional genes showed differences in expression levels (p < 0.05). ... Genes whose expression normalized were mainly those affected by the disease state and associated with glucose and lipid metabolism, cell growth, apoptosis, biosynthesis, olfactory ...

  19. Expression of conserved signalling pathway genes during

    Indian Academy of Sciences (India)

    Hence, we analysed the expression of Notch, Wnt and Sonic Hedgehog (Shh) pathway genes during differentiation of R1 cells into early vascular lineages. Notch-, Wnt-and Shh-mediated signalling is important during embryonic development. Regulation of gene expression through these signalling molecules is a frequently ...

  20. Serial analysis of gene expression (SAGE)

    NARCIS (Netherlands)

    van Ruissen, Fred; Baas, Frank

    2007-01-01

    In 1995, serial analysis of gene expression (SAGE) was developed as a versatile tool for gene expression studies. SAGE technology does not require pre-existing knowledge of the genome that is being examined and therefore SAGE can be applied to many different model systems. In this chapter, the SAGE

  1. Arabidopsis gene expression patterns during spaceflight

    Science.gov (United States)

    Paul, A.-L.; Ferl, R. J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

  2. Fibroblast and keratinocyte gene expression following exposure to extracts of neem plant (Azadirachta indica

    Directory of Open Access Journals (Sweden)

    Takao Someya

    2018-02-01

    Full Text Available This data article provides gene expression profiles, determined by using real-time PCR, of fibroblasts and keratinocytes treated with 0.01% and 0.001% extracts of neem plant (Azadirachta indica, local name “Kohomba” in Sri Lanka, harvested in Sri Lanka. For fibroblasts, the dataset includes expression profiles for genes encoding hyaluronan synthase 1 (HAS1, hyaluronan synthase 2 (HAS2, hyaluronidase-1 (HYAL1, hyaluronidase-2 (HYAL2, versican, aggrecan, CD44, collagen, type I, alpha 1 (COL1A1, collagen, type III, alpha 1 (COL3A1, collagen, type VII, alpha 1 (COL7A1, matrix metalloproteinase 1 (MMP1, acid ceramidase, basic fibroblast growth factor (bFGF, fibroblast growth factor-7 (FGF7, vascular endothelial growth factor (VEGF, interleukin-1 alpha (IL-1α, cyclooxygenase-2 (cox2, transforming growth factor beta (TGF-β, and aquaporin 3 (AQP3. For keratinocytes, the expression profiles are for genes encoding HAS1, HAS2, HYAL1, HYAL2, versican, CD44, IL-1α, cox2, TGF-β, AQP3, Laminin5, collagen, type XVII, alpha 1 (COL17A1, integrin alpha-6 (ITGA6, ceramide synthase 3 (CERS3, elongation of very long chain fatty acids protein 1 (ELOVL1, elongation of very long chain fatty acids protein 4 (ELOVL4, filaggrin (FLG, transglutaminase 1 (TGM1, and keratin 1 (KRT1. The expression profiles are provided as bar graphs.

  3. Endothelial Nitric Oxide Synthase Gene Variation Associated With Chronic Kidney Disease After Liver Transplant

    Science.gov (United States)

    Bambha, Kiran; Kim, W. Ray; Rosen, Charles B.; Pedersen, Rachel A.; Rys, Cynthia; Kolbert, Christopher P.; Cunningham, Julie M.; Therneau, Terry M.

    2010-01-01

    OBJECTIVE: To identify single nucleotide polymorphisms (SNPs) associated with risk of developing chronic kidney disease (CKD), a prevalent comorbidity, after liver transplant (LT). PATIENTS AND METHODS: This study consists of a cohort of adult (≥18 years) primary-LT recipients who had normal renal function before LT and who survived 1 year or more after LT at a high-volume US LT program between January 1, 1990, and December 31, 2000. Patients with adequate renal function (estimated glomerular filtration rate, ≥40 mL/min per 1.73 m2 during follow-up; n=308) and patients with incident CKD (estimated glomerular filtration rate, <40 mL/min per 1.73 m2 after LT; n=92) were identified. To investigate the association of 6 candidate genes with post-LT CKD, we selected SNPs that have been associated with renal function in the literature. Hazard ratios were estimated using Cox regression, adjusted for potential confounding variables. RESULTS: The variant allele (298Asp) of the Glu298Asp SNP in the endothelial nitric oxide synthase gene (NOS3) was significantly associated with CKD after LT (P=.05; adjusted for multiple comparisons). The 5-year incidence of CKD was 70% among patients homozygous for the NOS3 variant allele (298Asp) compared with 42% among those not homozygous for the NOS3 variant allele. Specifically, homozygosity for the NOS3 variant allele conferred a 2.5-fold increased risk of developing CKD after LT (P=.005, adjusted for confounding variables). CONCLUSION: Homozygosity for the variant allele of NOS3 (298Asp) is associated with CKD after LT and may be useful for identifying recipients at higher risk of post-LT CKD. PMID:20810793

  4. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  5. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  6. Expression of Sox genes in tooth development.

    Science.gov (United States)

    Kawasaki, Katsushige; Kawasaki, Maiko; Watanabe, Momoko; Idrus, Erik; Nagai, Takahiro; Oommen, Shelly; Maeda, Takeyasu; Hagiwara, Nobuko; Que, Jianwen; Sharpe, Paul T; Ohazama, Atsushi

    2015-01-01

    Members of the Sox gene family play roles in many biological processes including organogenesis. We carried out comparative in situ hybridization analysis of seventeen sox genes (Sox1-14, 17, 18, 21) during murine odontogenesis from the epithelial thickening to the cytodifferentiation stages. Localized expression of five Sox genes (Sox6, 9, 13, 14 and 21) was observed in tooth bud epithelium. Sox13 showed restricted expression in the primary enamel knots. At the early bell stage, three Sox genes (Sox8, 11, 17 and 21) were expressed in pre-ameloblasts, whereas two others (Sox5 and 18) showed expression in odontoblasts. Sox genes thus showed a dynamic spatio-temporal expression during tooth development.

  7. Determinants of human adipose tissue gene expression

    DEFF Research Database (Denmark)

    Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José

    2012-01-01

    of environmental and individual factors controlling AT adaptation is therefore essential. Here, expression of 271 transcripts, selected for regulation according to obesity and weight changes, was determined in 515 individuals before, after 8-week low-calorie diet-induced weight loss, and after 26-week ad libitum...... interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index...... on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently...

  8. Altered expression of cyclooxygenase-2, 12-lipoxygenase, inducible nitric oxide synthase-2 and surfactant protein D in lungs of patients with pulmonary injury caused by sulfur mustard.

    Science.gov (United States)

    Tahmasbpour, Eisa; Ghanei, Mostafa; Khor, Abolfazl; Panahi, Yunes

    2018-03-14

    Sulfur mustard (SM) is a strong alkylating toxicant that targets different organs, particularly human lung tissue. Change in genes expression is one of the molecular mechanisms of SM toxicity in damaged tissue. The purpose of this investigation is to characterize the expression of cyclooxygenase-2 (COX-2), 12-lipoxygenase (12-LO), inducible nitric oxide synthase 2 (iNOS2), and surfactant protein D (SFTPD) in lungs of patients who exposed to SM. Lung biopsies were provided from SM-exposed patients (n = 6) and controls (n = 5). Total RNA were extracted from all specimens and then cDNA was synthesized for each sample. Changes in gene expression were measured using RT 2 Profiler ™PCR Array. Pulmonary function tests revealed more obstructive and restrictive spirometric patterns among patients compared to the control group. Expression of COX-2 and 12-LO in the lung of patients was increased by 6.2555 (p = 0.004) and 6.2379-folds (p = 0.002), respectively. In contrast, expression of SF-D and iNOS genes was reduced by 8.5869-fold (p = 0.005) and 2.4466-folds (p = 0.011), respectively. Mustard lungs were associated with overexpression of COX-2 and 12-LO, which are responsible for inflammation, overproduction of free radicals and oxidative stress. Downregulation of iNOS2 and SF-D are probably the reason for lung disease and dysfunction among these patients. Therefore, the expression of these genes could be an important, routine part of the management of such patients.

  9. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    Science.gov (United States)

    Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription–PCR (RT–PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography–tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species. PMID:23008421

  10. Gene set analysis for longitudinal gene expression data

    Directory of Open Access Journals (Sweden)

    Piepho Hans-Peter

    2011-07-01

    Full Text Available Abstract Background Gene set analysis (GSA has become a successful tool to interpret gene expression profiles in terms of biological functions, molecular pathways, or genomic locations. GSA performs statistical tests for independent microarray samples at the level of gene sets rather than individual genes. Nowadays, an increasing number of microarray studies are conducted to explore the dynamic changes of gene expression in a variety of species and biological scenarios. In these longitudinal studies, gene expression is repeatedly measured over time such that a GSA needs to take into account the within-gene correlations in addition to possible between-gene correlations. Results We provide a robust nonparametric approach to compare the expressions of longitudinally measured sets of genes under multiple treatments or experimental conditions. The limiting distributions of our statistics are derived when the number of genes goes to infinity while the number of replications can be small. When the number of genes in a gene set is small, we recommend permutation tests based on our nonparametric test statistics to achieve reliable type I error and better power while incorporating unknown correlations between and within-genes. Simulation results demonstrate that the proposed method has a greater power than other methods for various data distributions and heteroscedastic correlation structures. This method was used for an IL-2 stimulation study and significantly altered gene sets were identified. Conclusions The simulation study and the real data application showed that the proposed gene set analysis provides a promising tool for longitudinal microarray analysis. R scripts for simulating longitudinal data and calculating the nonparametric statistics are posted on the North Dakota INBRE website http://ndinbre.org/programs/bioinformatics.php. Raw microarray data is available in Gene Expression Omnibus (National Center for Biotechnology Information with

  11. Positron emission tomography imaging of gene expression

    International Nuclear Information System (INIS)

    Tang Ganghua

    2001-01-01

    The merging of molecular biology and nuclear medicine is developed into molecular nuclear medicine. Positron emission tomography (PET) of gene expression in molecular nuclear medicine has become an attractive area. Positron emission tomography imaging gene expression includes the antisense PET imaging and the reporter gene PET imaging. It is likely that the antisense PET imaging will lag behind the reporter gene PET imaging because of the numerous issues that have not yet to be resolved with this approach. The reporter gene PET imaging has wide application into animal experimental research and human applications of this approach will likely be reported soon

  12. Reliable reference genes for normalization of gene expression data in tea plants (Camellia sinensis exposed to metal stresses.

    Directory of Open Access Journals (Sweden)

    Ming-Le Wang

    Full Text Available Tea plants [Camellia sinensis (L. O. Kuntze] are an important leaf-type crop that are widely used for the production of non-alcoholic beverages in the world. Exposure to excessive amounts of heavy metals adversely affects the quality and yield of tea leaves. To analyze the molecular responses of tea plants to heavy metals, a reliable quantification of gene expression is important and of major importance herein is the normalization of the measured expression levels for the target genes. Ideally, stably expressed reference genes should be evaluated in all experimental systems. In this study, 12 candidate reference genes (i.e., 18S rRNA, Actin, CYP, EF-1α, eIF-4α, GAPDH, MON1, PP2AA3, TBP, TIP41, TUA, and UBC were cloned from tea plants, and the stability of their expression was examined systematically in 60 samples exposed to diverse heavy metals (i.e., manganese, aluminum, copper, iron, and zinc. Three Excel-based algorithms (geNorm, NormFinder, and BestKeeper were used to evaluate the expression stability of these genes. PP2AA3 and 18S rRNA were the most stably expressed genes, even though their expression profiles exhibited some variability. Moreover, commonly used reference genes (i.e., GAPDH and TBP were the least appropriate reference genes for most samples. To further validate the suitability of the analyzed reference genes, the expression level of a phytochelatin synthase gene (i.e., CsPCS1 was determined using the putative reference genes for data normalizations. Our results may be beneficial for future studies involving the quantification of relative gene expression levels in tea plants.

  13. Photosynthetic gene expression in higher plants.

    Science.gov (United States)

    Berry, James O; Yerramsetty, Pradeep; Zielinski, Amy M; Mure, Christopher M

    2013-11-01

    Within the chloroplasts of higher plants and algae, photosynthesis converts light into biological energy, fueling the assimilation of atmospheric carbon dioxide into biologically useful molecules. Two major steps, photosynthetic electron transport and the Calvin-Benson cycle, require many gene products encoded from chloroplast as well as nuclear genomes. The expression of genes in both cellular compartments is highly dynamic and influenced by a diverse range of factors. Light is the primary environmental determinant of photosynthetic gene expression. Working through photoreceptors such as phytochrome, light regulates photosynthetic genes at transcriptional and posttranscriptional levels. Other processes that affect photosynthetic gene expression include photosynthetic activity, development, and biotic and abiotic stress. Anterograde (from nucleus to chloroplast) and retrograde (from chloroplast to nucleus) signaling insures the highly coordinated expression of the many photosynthetic genes between these different compartments. Anterograde signaling incorporates nuclear-encoded transcriptional and posttranscriptional regulators, such as sigma factors and RNA-binding proteins, respectively. Retrograde signaling utilizes photosynthetic processes such as photosynthetic electron transport and redox signaling to influence the expression of photosynthetic genes in the nucleus. The basic C3 photosynthetic pathway serves as the default form used by most of the plant species on earth. High temperature and water stress associated with arid environments have led to the development of specialized C4 and CAM photosynthesis, which evolved as modifications of the basic default expression program. The goal of this article is to explain and summarize the many gene expression and regulatory processes that work together to support photosynthetic function in plants.

  14. Identification and Validation of Housekeeping Genes for Gene Expression Analysis of Cancer Stem Cells

    Science.gov (United States)

    Lemma, Silvia; Avnet, Sofia; Salerno, Manuela; Chano, Tokuhiro; Baldini, Nicola

    2016-01-01

    The characterization of cancer stem cell (CSC) subpopulation, through the comparison of the gene expression signature in respect to the native cancer cells, is particularly important for the identification of novel and more effective anticancer strategies. However, CSC have peculiar characteristics in terms of adhesion, growth, and metabolism that possibly implies a different modulation of the expression of the most commonly used housekeeping genes (HKG), like b-actin (ACTB). Although it is crucial to identify which are the most stable HKG genes to normalize the data derived from quantitative Real-Time PCR analysis to obtain robust and consistent results, an exhaustive validation of reference genes in CSC is still missing. Here, we isolated CSC spheres from different musculoskeletal sarcomas and carcinomas as a model to investigate on the stability of the mRNA expression of 15 commonly used HKG, in respect to the native cells. The selected genes were analysed for the variation coefficient and compared using the popular algorithms NormFinder and geNorm to evaluate stability ranking. As a result, we found that: 1) Tata Binding Protein (TBP), Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide (YWHAZ), Peptidylprolyl isomerase A (PPIA), and Hydroxymethylbilane synthase (HMBS) are the most stable HKG for the comparison between CSC and native cells; 2) at least four reference genes should be considered for robust results; 3) the use of ACTB should not be recommended, 4) specific HKG should be considered for studies that are focused only on a specific tumor type, like sarcoma or carcinoma. Our results should be taken in consideration for all the studies of gene expression analysis of CSC, and will substantially contribute for future investigations aimed to identify novel anticancer therapy based on CSC targeting. PMID:26894994

  15. Ethylene-Related Gene Expression Networks in Wood Formation

    Directory of Open Access Journals (Sweden)

    Carolin Seyfferth

    2018-03-01

    Full Text Available Thickening of tree stems is the result of secondary growth, accomplished by the meristematic activity of the vascular cambium. Secondary growth of the stem entails developmental cascades resulting in the formation of secondary phloem outwards and secondary xylem (i.e., wood inwards of the stem. Signaling and transcriptional reprogramming by the phytohormone ethylene modifies cambial growth and cell differentiation, but the molecular link between ethylene and secondary growth remains unknown. We addressed this shortcoming by analyzing expression profiles and co-expression networks of ethylene pathway genes using the AspWood transcriptome database which covers all stages of secondary growth in aspen (Populus tremula stems. ACC synthase expression suggests that the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC is synthesized during xylem expansion and xylem cell maturation. Ethylene-mediated transcriptional reprogramming occurs during all stages of secondary growth, as deduced from AspWood expression profiles of ethylene-responsive genes. A network centrality analysis of the AspWood dataset identified EIN3D and 11 ERFs as hubs. No overlap was found between the co-expressed genes of the EIN3 and ERF hubs, suggesting target diversification and hence independent roles for these transcription factor families during normal wood formation. The EIN3D hub was part of a large co-expression gene module, which contained 16 transcription factors, among them several new candidates that have not been earlier connected to wood formation and a VND-INTERACTING 2 (VNI2 homolog. We experimentally demonstrated Populus EIN3D function in ethylene signaling in Arabidopsis thaliana. The ERF hubs ERF118 and ERF119 were connected on the basis of their expression pattern and gene co-expression module composition to xylem cell expansion and secondary cell wall formation, respectively. We hereby establish data resources for ethylene-responsive genes and

  16. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  17. Inducible nitric oxide synthase expression is upregulated in oral submucous fibrosis

    Directory of Open Access Journals (Sweden)

    Rajendran R

    2007-01-01

    Full Text Available Objective: We tested the hypothesis that inducible nitric oxide synthase (iNOS modulates angiogenesis in human models and this information could be extrapolated in elucidating the pathophysiology of oral submucous fibrosis (OSF. A hypothesis which looks inadequate, but is deep rooted in literature is the epithelial alteration ("atrophy" seen in OSF and the events that lead to its causation. This aspect was tried to be addressed and an alternative pathogenetic pathway for the disease is proposed. Materials and Methods: This immunohistochemical study sought to investigate the expression of iNOS in OSF samples (n= 30 a using monospecific antibody (SC- 2050, Santa Cruz Biotechnology, Inc to the protein and also to correlate it with different grades of epithelial dysplasia associated with the disease. Twenty (20 healthy adults acted as controls. Results: iNOS staining was not demonstrated in normal oral epithelium. In oral epithelial dysplasia, staining was seen in all cases (100% in the basal layers of the epithelium and in 30% of cases it extended into the parabasal compartments as well. iNOS staining was uniformly positive in moderate dysplasia with an increase in intensity and distribution noted as the severity of dysplasia progressed. There were highly significant differences in overall positivity for iNOS in epithelium between cases and controls (Mann-Whitney U = 11.000, Wilcoxon W = 221.00, P = 0.000. Significant comparisons were made of mild Vs moderate dysplasia (Mann-Whitney U = 48.000, P = 0.014 Conclusions: This study supports our earlier morphological assessment (image analysis of the nature of vascularity in OSF mucosa. The significant vasodilation noticed in these cases argues against the concept of ischemic atrophy of the epithelium. This observation of vascularity and iNOS expression helped to explain the vasodilation noticed (sinusoids in this disease; NO being a net vasodilator. The mechanism of activation of iNOS in dysplasia is

  18. Interaction between cysteine synthase and serine O-acetyltransferase proteins and their stage specific expression in Leishmania donovani.

    Science.gov (United States)

    Singh, Kuljit; Singh, Krishn Pratap; Equbal, Asif; Suman, Shashi S; Zaidi, Amir; Garg, Gaurav; Pandey, Krishna; Das, Pradeep; Ali, Vahab

    2016-12-01

    Leishmania possess a unique trypanothione redox metabolism with undebated roles in protection from oxidative damage and drug resistance. The biosynthesis of trypanothione depends on l-cysteine bioavailability which is regulated by cysteine biosynthesis pathway. The de novo cysteine biosynthesis pathway is comprised of serine O-acetyltransferase (SAT) and cysteine synthase (CS) enzymes which sequentially mediate two consecutive steps of cysteine biosynthesis, and is absent in mammalian host. However, despite the apparent dependency of redox metabolism on cysteine biosynthesis pathway, the role of SAT and CS in redox homeostasis has been unexplored in Leishmania parasites. Herein, we have characterized CS and SAT to investigate their interaction and relative abundance of these proteins in promastigote vs. amastigote growth stages of L. donovani. CS and SAT genes of L. donovani (LdCS and LdSAT) were cloned, expressed, and fusion proteins purified to homogeneity with affinity column chromatography. Purified LdCS contains PLP as cofactor and showed optimum enzymatic activity at pH 7.5. Enzyme kinetics showed that LdCS catalyses the synthesis of cysteine using O-acetylserine and sulfide with a K m of 15.86 mM and 0.17 mM, respectively. Digitonin fractionation and indirect immunofluorescence microscopy showed that LdCS and LdSAT are localized in the cytoplasm of promastigotes. Size exclusion chromatography, co-purification, pull down and immuno-precipitation assays demonstrated a stable complex formation between LdCS and LdSAT proteins. Furthermore, LdCS and LdSAT proteins expression/activity was upregulated in amastigote growth stage of the parasite. Thus, the stage specific differential expression of LdCS and LdSAT suggests that it may have a role in the redox homeostasis of Leishmania. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  19. Development of gene expression assays measuring immune ...

    African Journals Online (AJOL)

    Using qPCR, the relative expression stability of the reference genes ACTB, GAPDH, YWHAZ and TBP in these samples was determined as well as the mean fold change in the expression of IFNG, CXCL8, CXCL9, CXCL10 and CXCL11 in M. bovis-antigen stimulated blood. The expression of YWHAZ and TBP showed ...

  20. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  1. Caleydo: connecting pathways and gene expression.

    Science.gov (United States)

    Streit, Marc; Lex, Alexander; Kalkusch, Michael; Zatloukal, Kurt; Schmalstieg, Dieter

    2009-10-15

    Understanding the relationships between pathways and the altered expression of their components in disease conditions can be addressed in a visual data analysis process. Caleydo uses novel visualization techniques to support life science experts in their analysis of gene expression data in the context of pathways and functions of individual genes. Pathways and gene expression visualizations are placed in a 3D scene where selected entities (i.e. genes) are visually connected. This allows Caleydo to seamlessly integrate interactive gene expression visualization with cross-database pathway exploration. The Caleydo visualization framework is freely available on www.caleydo.org for non-commercial use. It runs on Windows and Linux and requires a 3D capable graphics card.

  2. Application of an optimized electroporation procedure for replacement of the polyhydroxyalkanoate synthase I gene in Nocardia corallina.

    Science.gov (United States)

    Valentin, H E; Dennis, D

    1996-07-01

    To develop a system for gene replacement in Nocardia corallina, a protocol for electroporation was optimized by systematic alterations of growth conditions, field strength, time constant and the electroporation buffer. Transformation efficiencies of 0.5 x 10(6) - 3 x 10(6) transformants/microgram plasmid DNA were obtained routinely. The gene encoding the polyhydroxyalkanoate (PHA) synthase I of N. corallina was cloned and interrupted by insertion of a kanamycin-resistance gene. The resulting plasmid was introduced into N. corallina by electroporation to inactivate the wild-type gene by homologous recombination. Kanamycin-resistant clones were screened by Southern hybridization for the absence of the wild-type gene and analyzed for PHA accumulation.

  3. Adaptive Evolution of Gene Expression in Drosophila.

    Science.gov (United States)

    Nourmohammad, Armita; Rambeau, Joachim; Held, Torsten; Kovacova, Viera; Berg, Johannes; Lässig, Michael

    2017-08-08

    Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Differential gene expression during Trypanosoma cruzi metacyclogenesis

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Krieger

    1999-09-01

    Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

  5. EXPRESSION OF BACTERIOOPSIN GENES IN ESCHERICHIA COLI

    OpenAIRE

    TSUJIUCHI, Yutaka; IWASA, Tatsuo; TOKUNAGA, Fumio

    1994-01-01

    An inducible expression vector pUBO was constructed with native codons in order to express the gene of Bacteriorhodopsin (BOP) in Escherichia coli (E. coli). Vector pUBO contains lac-promoter followed by the partial structural gene of lacZ and the structural gene of BOP. The expression of this fusion protein was detected by ELISA with anti-BOP antiserum. The fusion protein obtained from E. coli trnsformed with pUBO formed approximately 0.1% of the total protein of the E. coli membrane fraction.

  6. Differential expression of cell adhesion genes

    DEFF Research Database (Denmark)

    Stein, Wilfred D; Litman, Thomas; Fojo, Tito

    2005-01-01

    that compare cells grown in suspension to similar cells grown attached to one another as aggregates have suggested that it is adhesion to the extracellular matrix of the basal membrane that confers resistance to apoptosis and, hence, resistance to cytotoxins. The genes whose expression correlates with poor...... survival might, therefore, act through such a matrix-to-cell suppression of apoptosis. Indeed, correlative mining of gene expression and patient survival databases suggests that poor survival in patients with metastatic cancer correlates highly with tumor expression of a common theme: the genes involved...

  7. Expression of glycogen synthase and phosphofructokinase in muscle from type 1 (insulin-dependent) diabetic patients before and after intensive insulin treatment

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...

  8. Insight into the expression variation of metal-responsive genes in the seedling of date palm (Phoenix dactylifera).

    Science.gov (United States)

    Chaâbene, Zayneb; Rorat, Agnieszka; Rekik Hakim, Imen; Bernard, Fabien; Douglas, Grubb C; Elleuch, Amine; Vandenbulcke, Franck; Mejdoub, Hafedh

    2018-04-01

    Phytochelatin synthase and metallothionein gene expressions were monitored via qPCR in order to investigate the molecular mechanisms involved in Cd and Cr detoxification in date palm (Phoenix dactylifera). A specific reference gene validation procedure using BestKeeper, NormFinder and geNorm programs allowed selection of the three most stable reference genes in a context of Cd or Cr contamination among six reference gene candidates, namely elongation factor α1, actin, aldehyde dehydrogenase, SAND family, tubulin 6 and TaTa box binding protein. Phytochelatin synthase (pcs) and metallothionein (mt) encoding gene expression were induced from the first days of exposure. At low Cd stress (0.02 mM), genes were still up-regulated until 60th day of exposure. At the highest metal concentrations, however, pcs and mt gene expressions decreased. pcs encoding gene was significantly up-regulated under Cr exposure, and was more responsive to increasing Cr concentration than mt encoding gene. Moreover, exposure to Cd or Cr influenced clearly seed germination and hypocotyls elongation. Thus, the results have proved that both analyzed genes participate in metal detoxification and their expression is regulated at transcriptional level in date palm subjected to Cr and Cd stress. Consequently, variations of expression of mt and pcs genes may serve as early-warning biomarkers of metal stress in this species. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Nitric oxide synthase expression and apoptotic cell death in brains of AIDS and AIDS dementia patients

    NARCIS (Netherlands)

    Vincent, V. A.; de Groot, C. J.; Lucassen, P. J.; Portegies, P.; Troost, D.; Tilders, F. J.; van Dam, A. M.

    1999-01-01

    To determine the occurrence and cellular localization of inducible nitric oxide synthase (iNOS), NOS activity and its association with cell death in brains of AIDS and AIDS dementia complex (ADC) patients. Post-mortem cerebral cortex tissue of eight AIDS patients, eight ADC patients and eight

  10. Astrocytes and microglia express inducible nitric oxide synthase in mice with experimental allergic encephalomyelitis

    DEFF Research Database (Denmark)

    Tran, E H; Hardin-Pouzet, H; Verge, G

    1997-01-01

    Nitric oxide (NO), produced by inducible NO synthase (iNOS), may play a role in inflammatory demyelinating diseases of the central nervous system (CNS). We show upregulation of iNOS mRNA in CNS of SJL/J mice with experimental allergic encephalomyelitis (EAE). Using antibodies against mouse i...

  11. Cloning, expression, purification and characterization of recombinant (+)-germacrene D synthase from Zingiber officinale.

    Science.gov (United States)

    Picaud, Sarah; Olsson, Mikael E; Brodelius, Maria; Brodelius, Peter E

    2006-08-01

    A cDNA clone encoding a sesquiterpene synthase, (+)-germacrene D synthase, has been isolated from ginger (Zingiber officinale). The full-length cDNA (AY860846) contains a 1650-bp open reading frame coding for 550 amino acids (63.8kDa) with a theoretical pI=5.59. The deduced amino acid sequence is 30-46% identical with sequences of other sesquiterpene synthases from angiosperms. The recombinant enzyme, produced in Escherichia coli, catalyzed the formation of a major product, (+)-germacrene D (50.2% of total sesquiterpenoids produced) and a co-product, germacrene B (17.1%) and a number of minor by-products. The optimal pH for the recombinant enzyme is around 7.5. Substantial (+)-germacrene D synthase activity is observed in the presence of Mg2+, Mn2+, Ni2+ or Co2+, while the enzyme is inactive when Cu2+ or Zn2+ is used. The Km- and kcat-values are 0.88 microM and 3.34 x 10(-3) s(-1), respectively. A reaction mechanism involving a double 1,2-hydride shift has been established using deuterium labeled substrates in combination with GC-MS analysis.

  12. Drosophila melanogaster gene expression changes after spaceflight.

    Data.gov (United States)

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  13. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  14. The UbiI (VisC) Aerobic Ubiquinone Synthase Is Required for Expression of Type 1 Pili, Biofilm Formation, and Pathogenesis in Uropathogenic Escherichia coli.

    Science.gov (United States)

    Floyd, Kyle A; Mitchell, Courtney A; Eberly, Allison R; Colling, Spencer J; Zhang, Ellisa W; DePas, William; Chapman, Matthew R; Conover, Matthew; Rogers, Bridget R; Hultgren, Scott J; Hadjifrangiskou, Maria

    2016-10-01

    Uropathogenic Escherichia coli (UPEC), which causes the majority of urinary tract infections (UTI), uses pilus-mediated adherence to initiate biofilm formation in the urinary tract. Oxygen gradients within E. coli biofilms regulate expression and localization of adhesive type 1 pili. A transposon mutant screen for strains defective in biofilm formation identified the ubiI (formerly visC) aerobic ubiquinone synthase gene as critical for UPEC biofilm formation. In this study, we characterized a nonpolar ubiI deletion mutant and compared its behavior to that of wild-type bacteria grown under aerobic and anoxic conditions. Consistent with its function as an aerobic ubiquinone-8 synthase, deletion of ubiI in UPEC resulted in reduced membrane potential, diminished motility, and reduced expression of chaperone-usher pathway pili. Loss of aerobic respiration was previously shown to negatively impact expression of type 1 pili. To determine whether this reduction in type 1 pili was due to an energy deficit, wild-type UPEC and the ubiI mutant were compared for energy-dependent phenotypes under anoxic conditions, in which quinone synthesis is undertaken by anaerobic quinone synthases. Under anoxic conditions, the two strains exhibited wild-type levels of motility but produced diminished numbers of type 1 pili, suggesting that the reduction of type 1 pilus expression in the absence of oxygen is not due to a cellular energy deficit. Acute- and chronic-infection studies in a mouse model of UTI revealed a significant virulence deficit in the ubiI mutant, indicating that UPEC encounters enough oxygen in the bladder to induce aerobic ubiquinone synthesis during infection. The majority of urinary tract infections are caused by uropathogenic E. coli, a bacterium that can respire in the presence and absence of oxygen. The bladder environment is hypoxic, with oxygen concentrations ranging from 4% to 7%, compared to 21% atmospheric oxygen. This work provides evidence that aerobic

  15. Influence of environmental ammonia on the production of nitric oxide and expression of inducible nitric oxide synthase in the freshwater air-breathing catfish (Heteropneustes fossilis)

    International Nuclear Information System (INIS)

    Choudhury, Mahua G.; Saha, Nirmalendu

    2012-01-01

    Highlights: ► High environmental ammonia caused more production and accumulation of NO in air-breathing catfish (Heteropneustes fossilis). ► Hyper-ammonia stress caused induction and zonal specific expression of iNOS enzyme protein, mRNA expression in different tissues. ► Activation of NFκB that resulted under hyper-ammonia stress was believed to be the cause of induction of iNOS gene. - Abstract: Nitric oxide (NO) is a highly versatile and unique ubiquitous signaling molecule, and is known to play diverse physiological functions in mammals including those of adaptation to various stresses. The present study reports on the influence of exposure to high external ammonia (HEA) on the production of nitric oxide (NO) and the expression of inducible nitric oxide synthase (iNOS), that produces NO from L-arginine in the freshwater air-breathing catfish (Heteropneustes fossilis), which is reported to tolerate a very HEA. Some levels of NO were found to be present in all the tissues and also in plasma of control fish, which further enhanced significantly in fishes treated with high concentrations of environmental ammonia (25 and 50 mM ammonium chloride) for 7 days, accompanied by more efflux of NO from the perfused liver. This was accomplished by the induction of iNOS activity in different tissues of fish exposed to HEA, which otherwise was not detectable in control fish. Exposure to 25 mM ammonium chloride also led to a significant expression of iNOS protein in different tissues, followed by further increase at 50 mM ammonium chloride. Further, there was an increase in the expression of iNOS mRNA in ammonia-treated fish, thus suggesting that the expression of iNOS gene under hyper-ammonia stress was probably regulated at the transcriptional level. Immunocytochemical analysis indicated that the expression of iNOS in different tissues was zonal specific and not expressed uniformly throughout the organ. Hyper-ammonia stress also led to activation and nuclear

  16. Influence of environmental ammonia on the production of nitric oxide and expression of inducible nitric oxide synthase in the freshwater air-breathing catfish (Heteropneustes fossilis)

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Mahua G. [Biochemical Adaptation Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022 (India); Saha, Nirmalendu, E-mail: nsaha@nehu.ac.in [Biochemical Adaptation Laboratory, Department of Zoology, North-Eastern Hill University, Shillong 793022 (India)

    2012-07-15

    Highlights: Black-Right-Pointing-Pointer High environmental ammonia caused more production and accumulation of NO in air-breathing catfish (Heteropneustes fossilis). Black-Right-Pointing-Pointer Hyper-ammonia stress caused induction and zonal specific expression of iNOS enzyme protein, mRNA expression in different tissues. Black-Right-Pointing-Pointer Activation of NF{kappa}B that resulted under hyper-ammonia stress was believed to be the cause of induction of iNOS gene. - Abstract: Nitric oxide (NO) is a highly versatile and unique ubiquitous signaling molecule, and is known to play diverse physiological functions in mammals including those of adaptation to various stresses. The present study reports on the influence of exposure to high external ammonia (HEA) on the production of nitric oxide (NO) and the expression of inducible nitric oxide synthase (iNOS), that produces NO from L-arginine in the freshwater air-breathing catfish (Heteropneustes fossilis), which is reported to tolerate a very HEA. Some levels of NO were found to be present in all the tissues and also in plasma of control fish, which further enhanced significantly in fishes treated with high concentrations of environmental ammonia (25 and 50 mM ammonium chloride) for 7 days, accompanied by more efflux of NO from the perfused liver. This was accomplished by the induction of iNOS activity in different tissues of fish exposed to HEA, which otherwise was not detectable in control fish. Exposure to 25 mM ammonium chloride also led to a significant expression of iNOS protein in different tissues, followed by further increase at 50 mM ammonium chloride. Further, there was an increase in the expression of iNOS mRNA in ammonia-treated fish, thus suggesting that the expression of iNOS gene under hyper-ammonia stress was probably regulated at the transcriptional level. Immunocytochemical analysis indicated that the expression of iNOS in different tissues was zonal specific and not expressed uniformly

  17. [Effect of endophytic fungi on expression amount of key enzyme genes in saponins biosynthesis and Eleutherococcus senticosus saponins content].

    Science.gov (United States)

    Xing, Zhaobin; Long, Yuehong; Lao, Fengyun; He, Shan; Liang, Nengsong; Li, Baocai

    2012-07-01

    To analyze the effect of endophytic fungi on expression amount of key enzyme genes SS (squalene synthase gene), SE (squalene epoxidase gene) and bAS (beta-amyrin synthase gene) in saponin biosynthesis and saponins content in Eleutherococcus senticosus. Wound method was used for back meeting the endophytic fungi to E. senticosus. With GAPDH as internal control gene, the expression of key enzyme genes was detected by real time PCR method. E. senticosus saponins content was measured by spectrophotometry method. When wound method back meeting P116-1a and P116-1b after 30 d, the expression content of SS improved significantly (P endophytic fungi, the expression of SE were significantly higher than the control (P endophytic fungi form 60 d to 120 d, the expression of bAS was significantly higher than the control (P endophytic fungi improved E. senticosus saponins content significantly (P Endophytic fungi P116-1a, P116-1b, P1094 and P312-1 significantly effected the expression of key enzyme genes SS, SE and bAS and then affected E. senticosus saponins content. Among the genes, bAS was key target gene.

  18. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    Science.gov (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  19. PRAME gene expression profile in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Tânia Maria Vulcani-Freitas

    2011-02-01

    Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

  20. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    Science.gov (United States)