WorldWideScience

Sample records for synthase extender units

  1. Promiscuity of a modular polyketide synthase towards natural and non-natural extender units.

    Science.gov (United States)

    Koryakina, Irina; McArthur, John B; Draelos, Matthew M; Williams, Gavin J

    2013-07-21

    Combinatorial biosynthesis approaches that involve modular type I polyketide synthases (PKSs) are proven strategies for the synthesis of polyketides. In general however, such strategies are usually limited in scope and utility due to the restricted substrate specificity of polyketide biosynthetic machinery. Herein, a panel of chemo-enzymatically synthesized acyl-CoA's was used to probe the promiscuity of a polyketide synthase. Promiscuity determinants were dissected, revealing that the KS is remarkably tolerant to a diverse array of extender units, while the AT likely discriminates between extender units that are native to the producing organism. Our data provides a clear blueprint for future enzyme engineering efforts, and sets the stage for harnessing extender unit promiscuity by employing various in vivo polyketide diversification strategies.

  2. Inversion of Extender Unit Selectivity in the Erythromycin Polyketide Synthase by Acyltransferase Domain Engineering.

    Science.gov (United States)

    Koryakina, Irina; Kasey, Christian; McArthur, John B; Lowell, Andrew N; Chemler, Joseph A; Li, Shasha; Hansen, Douglas A; Sherman, David H; Williams, Gavin J

    2017-01-20

    Acyltransferase (AT) domains of polyketide synthases (PKSs) select extender units for incorporation into polyketides and dictate large portions of the structures of clinically relevant natural products. Accordingly, there is significant interest in engineering the substrate specificity of PKS ATs in order to site-selectively manipulate polyketide structure. However, previous attempts to engineer ATs have yielded mutant PKSs with relaxed extender unit specificity, rather than an inversion of selectivity from one substrate to another. Here, by directly screening the extender unit selectivity of mutants from active site saturation libraries of an AT from the prototypical PKS, 6-deoxyerythronolide B synthase, a set of single amino acid substitutions was discovered that dramatically impact the selectivity of the PKS with only modest reductions of product yields. One particular substitution (Tyr189Arg) inverted the selectivity of the wild-type PKS from its natural substrate toward a non-natural alkynyl-modified extender unit while maintaining more than twice the activity of the wild-type PKS with its natural substrate. The strategy and mutations described herein form a platform for combinatorial biosynthesis of site-selectively modified polyketide analogues that are modified with non-natural and non-native chemical functionality.

  3. Starter unit flexibility for engineered product synthesis by the nonreducing polyketide synthase PksA.

    Science.gov (United States)

    Huitt-Roehl, Callie R; Hill, Eric A; Adams, Martina M; Vagstad, Anna L; Li, Jesse W; Townsend, Craig A

    2015-06-19

    Nonreducing polyketide synthases (NR-PKSs) are unique among PKSs in their domain structure, notably including a starter unit:acyl-carrier protein (ACP) transacylase (SAT) domain that selects an acyl group as the primer for biosynthesis, most commonly acetyl-CoA from central metabolism. This clan of mega-enzymes resembles fatty acid synthases (FASs) by sharing both their central chain elongation steps and their capacity for iterative catalysis. In this mode of synthesis, catalytic domains involved in chain extension exhibit substrate plasticity to accommodate growing chains as small as two carbons to 20 or more. PksA is the NR-PKS central to the biosynthesis of the mycotoxin aflatoxin B1 whose SAT domain accepts an unusual hexanoyl starter from a dedicated yeast-like FAS. Explored in this paper is the ability of PksA to utilize a selection of potential starter units as substrates to initiate and sustain extension and cyclization to on-target, programmed polyketide synthesis. Most of these starter units were successfully accepted and properly processed by PksA to achieve biosynthesis of the predicted naphthopyrone product. Analysis of the on-target and derailment products revealed trends of tolerance by individual PksA domains to alternative starter units. In addition, natural and un-natural variants of the active site cysteine were examined and found to be capable of biosynthesis, suggesting possible direct loading of starter units onto the β-ketoacyl synthase (KS) domain. In light of the data assembled here, the predictable synthesis of unnatural products by NR-PKSs is more fully defined.

  4. Extended megadroughts in the southwestern United States during Pleistocene interglacials

    Science.gov (United States)

    Fawcett, P.J.; Werne, J.P.; Anderson, R. Scott; Heikoop, J.M.; Brown, E.T.; Berke, M.A.; Smith, S.J.; Goff, F.; Donohoo-Hurley, L.; Cisneros-Dozal, L. M.; Schouten, S.; Damste, J.S.S.; Huang, Y.; Toney, J.; Fessenden, J.; Woldegabriel, G.; Atudorei, V.; Geissman, J.W.; Allen, Craig D.

    2011-01-01

    The potential for increased drought frequency and severity linked to anthropogenic climate change in the semi-arid regions of the southwestern United States (US) is a serious concern. Multi-year droughts during the instrumental period and decadal-length droughts of the past two millennia were shorter and climatically different from the future permanent, ‘dust-bowl-like’ megadrought conditions, lasting decades to a century, that are predicted as a consequence of warming. So far, it has been unclear whether or not such megadroughts occurred in the southwestern US, and, if so, with what regularity and intensity. Here we show that periods of aridity lasting centuries to millennia occurred in the southwestern US during mid-Pleistocene interglacials. Using molecular palaeotemperature proxies to reconstruct the mean annual temperature (MAT) in mid-Pleistocene lacustrine sediment from the Valles Caldera, New Mexico, we found that the driest conditions occurred during the warmest phases of interglacials, when the MAT was comparable to or higher than the modern MAT. A collapse of drought-tolerant C4 plant communities during these warm, dry intervals indicates a significant reduction in summer precipitation, possibly in response to a poleward migration of the subtropical dry zone. Three MAT cycles ∼2 °C in amplitude occurred within Marine Isotope Stage (MIS) 11 and seem to correspond to the muted precessional cycles within this interglacial. In comparison with MIS 11, MIS 13 experienced higher precessional-cycle amplitudes, larger variations in MAT (4–6 °C) and a longer period of extended warmth, suggesting that local insolation variations were important to interglacial climatic variability in the southwestern US. Comparison of the early MIS 11 climate record with the Holocene record shows many similarities and implies that, in the absence of anthropogenic forcing, the region should be entering a cooler and wetter phase.

  5. Candida bloodstream infections in intensive care units: analysis of the extended prevalence of infection in intensive care unit study

    NARCIS (Netherlands)

    Kett, D.H.; Azoulay, E.; Echeverria, P.M.; Vincent, J.L.; Pickkers, P.; et al.,

    2011-01-01

    OBJECTIVES: To provide a global, up-to-date picture of the prevalence, treatment, and outcomes of Candida bloodstream infections in intensive care unit patients and compare Candida with bacterial bloodstream infection. DESIGN: A retrospective analysis of the Extended Prevalence of Infection in the

  6. An extended theory of planned behavior to predict consumers' willingness to buy mobile slaughter unit meat.

    Science.gov (United States)

    Hoeksma, Djura L; Gerritzen, Marien A; Lokhorst, Anne Marike; Poortvliet, P Marijn

    2017-06-01

    The current study investigated the determinants of consumers' intention to purchase meat from mobile slaughter units (MSU). The theory of planned behavior (TPB) and the value belief norm theory (VBN) were used as conceptual lenses to guide this investigation. We conducted a survey among 329 respondents in the Netherlands who buy meat for themselves and/or for others. The results indicated that (1) TPB and VBN explain a high proportion of the variance in consumers' intention to buy MSU meat, and that (2) an extended TPB that includes peoples' attitude, personal norm, subjective norm, and perceived behavioral control turned out to be the best model to predict willingness to buy MSU meat. Further implications for future research and practice are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Reshaping the eyebrow by follicular unit transplantation from excised eyebrow in extended infrabrow excision blepharoplasty

    Directory of Open Access Journals (Sweden)

    Ichinose A

    2012-02-01

    Full Text Available Kazuhito Konishi1, Isao Sugimoto2, Hirohiko Kakizaki3, Akihiro Ichinose41Kobe Academia Clinic, 2Division of Aesthetic Medical Science, Department of Plastic Surgery, Kobe University Graduate School of Medicine, 3Department of Ophthalmology, Aichi Medical University, Nagoya, Aichi, Japan; 4Department of Plastic Surgery, Graduate School of Medicine, Kobe University, Kobe, Hyogo, JapanPurpose: We report the reshaping of the eyebrow by follicular unit transplantation from excised eyebrow skin in extended infrabrow excision blepharoplasty.Methods: The method was carried out in two patients with moderate or significant dermatochalasis. The areas to be excised from the infrabrow and intrabrow skin were decided upon and the area of hair transplantation was planned in the suprabrow area and the tail of the eyebrow. The skin was removed and the excised intrabrow skin was dissected into single follicular units. Tiny incisions were made with a scalpel, and grafts were inserted using fine forceps.Results: Almost all transplanted eyebrow follicles took successfully, resulting in eyebrows of a desirable shape as planned preoperatively. The reshaped eyebrows had a natural appearance since the transplanted hairs were similar to those of the original eyebrow. The eyelids still looked youthful rather than operated-on. Finally, the evidence of blepharoplasty was hardly visible and patient satisfaction was quite high. The patients felt more ease in opening their eyes and obtained a wider visual field.Conclusion: Our study demonstrated excellent results with hair transplantation from eyebrow to eyebrow, a finding which, to our knowledge, has not been previously reported. Our method can be used for selected patients, especially men, with moderate to severe dermatochalasis, who find a reduction or change in the shape of the eyebrow unacceptable.Keywords: blepharoplasty, dermatochalasis, follicular unit transplantation, eyebrow reconstruction

  8. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  9. Extended Kinship in the United States: Competing Models and the Case of La Familia Chicana.

    Science.gov (United States)

    Sena-Rivera, Jaime

    1979-01-01

    Extended kinship among Chicanos is explored through intensive open-ended interviews with four cases of three generations of Mexican-descent families. "La familia chicana" is posited as a modified extended or kin-integrated family extending over time and space from Mexico at the turn of the century to present day industrial America. (Author)

  10. Extending the ABCDE bundle to the post-intensive care unit setting.

    Science.gov (United States)

    Balas, Michele; Buckingham, Rose; Braley, Tami; Saldi, Sarah; Vasilevskis, Eduard E

    2013-08-01

    A recently proposed interprofessional, evidence-based, multicomponent approach to mitigating the effects of intensive care unit (ICU)-acquired delirium and weakness has the potential to radically transform the way care is delivered to older adults requiring sedation, mechanical ventilation, or both. The Awakening and Breathing Coordination, Delirium Monitoring and Management, and Early Mobility (ABCDE) bundle empowers members of the interdisciplinary ICU team to implement the best available evidence regarding mechanical ventilation, sedation, weakness, and delirium in a safe, effective, and patient-centered manner. Considering that critically ill older adults are cared for in a number of different settings during the course of hospitalization and recovery, the purpose of this article is to explore the rationale and possible benefits of extending the ABCDE bundle into the post-ICU setting. We provide a case study that illustrates how ABCDE bundle adoption could be the key to improving the quality of care provided to seriously ill older adults in the ICU and beyond. Copyright 2013, SLACK Incorporated.

  11. Review of extended burnup research, development and implementation in the United States

    International Nuclear Information System (INIS)

    Lang, P.M.

    1984-01-01

    This paper reviews the results to date of the various research and development projects on burnup extension of LWR fuel being sponsored by the author's organizations. These projects include a large number of test assembly irradiations in power reactors, both of current-design fuel and of several advanced designs. The burnups attained to date are tabulated and the status of postirradiation examination of these assemblies is reviewed. Current U.S. thinking on the implications of these results on possible fuel life limiting phenomena is presented, together with discussion and prioritization of further work to be done. The further work under discussion includes, in addition to other advanced designs and life limiting effects, economic studies to determine optimum burnups under present and projected future cost structures and the design of desirable extended burnup fuel cycles for power reactors. These include low leakage fuel management, improved burnable absorbers to control power distributions, extended cycle lengths, and practical transitions toward extended burnup. Results of recent studies on the impacts of extended burnup on the external fuel cycle operations of fuel fabrication, fresh fuel storage, spent fuel storage, and spent fuel transportation are briefly reviewed. The majority of U.S. utilities have already made positive decisions to implement at least a first step of burnup extension in their operating reactors. The results of a recent survey of such implementation are presented, with estimates of percentage of reactors going to burnup extension and of average and maximum increases in burnups now committed. The discussion of these results includes review of various utility motivations, both for restraint and for pressing forward with burnup extension. A summary of burnup extensions already achieved is also included. (author)

  12. An extended theory of planned behavior to predict consumers' willingness to buy mobile slaughter unit meat

    NARCIS (Netherlands)

    Hoeksma, Djura L.; Gerritzen, Marien A.; Lokhorst, Anne Marike; Poortvliet, Marijn

    2017-01-01

    The current study investigated the determinants of consumers' intention to purchase meat from mobile slaughter units (MSU). The theory of planned behavior (TPB) and the value belief norm theory (VBN) were used as conceptual lenses to guide this investigation. We conducted a survey among 329

  13. An outlier robust unit root test with an application to the extended Nelson-Plosser data

    NARCIS (Netherlands)

    Lucas, André

    1995-01-01

    This paper considers unit root tests based on robust estimators with a high breakdown point and high efficiency. The asymptotic distribution of these tests is derived. Critical values for the test are obtained via simulation. It is found that the size of the classical OLS based Dickey-Fuller test

  14. Falls prevention in hospitals and mental health units: an extended evaluation of the FallSafe quality improvement project.

    Science.gov (United States)

    Healey, Frances; Lowe, Derek; Darowski, Adam; Windsor, Julie; Treml, Jonathan; Byrne, Lisa; Husk, Janet; Phipps, Jill

    2014-07-01

    inpatient falls are a major patient safety issue causing distress, injury and death. Systematic review suggests multifactorial assessment and intervention can reduce falls by 20-30%, but large-scale studies of implementation are few. This paper describes an extended evaluation of the FallSafe quality improvement project, which presented key components of multifactorial assessment and intervention as a care bundle. : data on delivery of falls prevention processes were collected at baseline and for 18 months from nine FallSafe units and nine control units. Data on falls were collected from local risk management systems for 24 months, and data on under-reporting through staff surveys. : in FallSafe units, delivery of seven care bundle components significantly improved; most improvements were sustained after active project support was withdrawn. Twelve-month moving average of reported fall rates showed a consistent downward trend in FallSafe units but not controls. Significant reductions in reported fall rate were found in FallSafe units (adjusted rate ratio (ARR) 0.75, 95% confidence interval (CI) 0.68-0.84 P control units (ARR 0.91, 95% CI 0.81-1.03 P = 0.13). No significant changes in injurious fall rate were found in FallSafe units (ARR 0.86, 95% CI 0.71-1.03 P = 0.11), or controls (ARR 0.88, 95% CI 0.72-1.08 P = 0.13). In FallSafe units, staff certain falls had been reported increased from 60 to 77%. : introducing evidence-based care bundles of multifactorial assessment and intervention using a quality improvement approach resulted in improved delivery of multifactorial assessment and intervention and significant reductions in fall rates, but not in injurious fall rates. © The Author 2013. Published by Oxford University Press on behalf of the British Geriatrics Society. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Fuel and Core Design Verification for Extended Power Up-rate in Ringhals Unit 3

    International Nuclear Information System (INIS)

    Gabrielsson, Petter; Stepniewski, Marek; Almberger, Jan

    2006-01-01

    Vattenfall's Westinghouse 3-loop PWR Ringhals 3 at the western coast of Sweden is scheduled for an extended power up-rate from 2783 to 3160 MWt in 2007, in the frame of the so called GREAT-project. The project will realize an up-rating initially planned and analysed back in 1995, but with a number of significant improvements outlined in this paper. For the licensing of the up-rated power level, a complete revision of the safety analyses, radiological analyses and systems verifications in FSAR is being performed by Westinghouse Electrics Belgium. The work is performed in close cooperation with Vattenfall in the areas of core calculations and input data. For more than a decade, Vattenfall has performed all core design and reload safety evaluations (RSE) for Ringhals, independent of fuel vendors and safety analysts. In GREAT all core parameters in the safety analysis checklist (SAC) used for the safety analyses are determined based upon a set of nine reference loading patterns designed by Vattenfall covering a wide range of fuel and core designs and extreme cycle-to-cycle variations. To facilitate the calculation of SAC parameters Westinghouse has provided a Reload Safety Evaluation Procedure report (RSEP) with detailed specifications for the calculation of all core parameters used in the analyses. The procedure has been automatized by Vattenfall in a set of scripts executing 3D core simulator calculations and extracting the key results. The same tools will be used in Vattenfall's future RSE for Ringhals 3. This approach is taken to obtain consistency between core designs and core calculations for the safety analyses and the cycle specific calculations, to minimize the risk for future violations of the safety analyses. (authors)

  16. Interaction with the small subunit of geranyl diphosphate synthase modifies the chain length specificity of geranylgeranyl diphosphate synthase to produce geranyl diphosphate.

    Science.gov (United States)

    Burke, Charles; Croteau, Rodney

    2002-02-01

    Geranyl diphosphate synthase belongs to a subgroup of prenyltransferases, including farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase, that catalyzes the specific formation, from C(5) units, of the respective C(10), C(15), and C(20) precursors of monoterpenes, sesquiterpenes, and diterpenes. Unlike farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase, which are homodimers, geranyl diphosphate synthase from Mentha is a heterotetramer in which the large subunit shares functional motifs and a high level of amino acid sequence identity (56-75%) with geranylgeranyl diphosphate synthases of plant origin. The small subunit, however, shares little sequence identity with other isoprenyl diphosphate synthases; yet it is absolutely required for geranyl diphosphate synthase catalysis. Coexpression in Escherichia coli of the Mentha geranyl diphosphate synthase small subunit with the phylogenetically distant geranylgeranyl diphosphate synthases from Taxus canadensis and Abies grandis yielded a functional hybrid heterodimer that generated geranyl diphosphate as product in each case. These results indicate that the geranyl diphosphate synthase small subunit is capable of modifying the chain length specificity of geranylgeranyl diphosphate synthase (but not, apparently, farnesyl diphosphate synthase) to favor the production of C(10) chains. Comparison of the kinetic behavior of the parent prenyltransferases with that of the hybrid enzyme revealed that the hybrid possesses characteristics of both geranyl diphosphate synthase and geranylgeranyl diphosphate synthase.

  17. A novel dinuclear Ru(II) complex having a bridging ligand of a rigid and extended structure. Incorporation of an anthraquinone unit and efficient emission quenching

    International Nuclear Information System (INIS)

    Mishra, L.; Choi, Chang-Shik; Araki, Koji

    1997-01-01

    Dinuclear Ru(II) complex having extended conjugation within the bridging ligand was prepared by coupling of the Ru(II) polypyridyl complex having a benzoyl-substituted phenazine unit with diaminoanthraquinone in one step, in which emission from the excited Ru(II) center was efficiently quenched through the anthraquinone unit. (author)

  18. Back to the future: extended dialysis for treatment of acute kidney injury in the intensive care unit.

    Science.gov (United States)

    Kielstein, Jan T; Schiffer, Mario; Hafer, Carsten

    2010-01-01

    On September 11, 1945, Maria Schafstaat was the first patient who successfully underwent a dialysis treatment for acute kidney injury (AKI). The ingenious design of the first dialysis machine, made of cellophane tubing wrapped around a cylinder that rotated in a bath of fluid, together with the brave determination to treat patients with AKI, enabled the Dutch physician W.J. Kolff to save the life of the 67-year-old woman. By treating her for 690 minutes (i.e., 11.5 hours) with a blood flow rate of 116 ml/min, Kolff also set the coordinates of a renal replacement therapy that has enjoyed an unsurpassed renaissance over the last decade for treatment of severely ill patients with AKI in the intensive care unit (ICU). Prolonged dialysis time with low flow rates - these days, called extended dialysis (ED) - combines several advantages of both intermittent and continuous techniques, which makes it an ideal treatment method for ICU patients with AKI. This review summarizes our knowledge of this method, which is increasingly used in many centers worldwide. We reflect on prospective controlled studies in critically ill patients that have documented that small-solute clearance with ED is comparable with that of intermittent hemodialysis and continuous venovenous hemofiltration, as well as on studies showing that patients' cardiovascular stability during ED is similar to that with continuous renal replacement therapy. Furthermore, we report on logistic and economic advantages of this method. We share our view on how extended dialysis offers ample opportunity for a collaborative interaction between nephrologists and intensivists as the nephrology staff, enabling optimal treatment of complex critically ill patients by using the skill and knowledge of 2 indispensable specialties in the ICU. Lastly, we address the problem of ED intensity, which does not seem to have an impact on survival at higher doses, a finding that might be caused by the fact that we still adhere to dosing

  19. The Stereochemistry of Complex Polyketide Biosynthesis by Modular Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    David H. Kwan

    2011-07-01

    Full Text Available Polyketides are a diverse class of medically important natural products whose biosynthesis is catalysed by polyketide synthases (PKSs, in a fashion highly analogous to fatty acid biosynthesis. In modular PKSs, the polyketide chain is assembled by the successive condensation of activated carboxylic acid-derived units, where chain extension occurs with the intermediates remaining covalently bound to the enzyme, with the growing polyketide tethered to an acyl carrier domain (ACP. Carboxylated acyl-CoA precursors serve as activated donors that are selected by the acyltransferase domain (AT providing extender units that are added to the growing chain by condensation catalysed by the ketosynthase domain (KS. The action of ketoreductase (KR, dehydratase (DH, and enoylreductase (ER activities can result in unreduced, partially reduced, or fully reduced centres within the polyketide chain depending on which of these enzymes are present and active. The PKS-catalysed assembly process generates stereochemical diversity, because carbon–carbon double bonds may have either cis- or trans- geometry, and because of the chirality of centres bearing hydroxyl groups (where they are retained and branching methyl groups (the latter arising from use of propionate extender units. This review shall cover the studies that have determined the stereochemistry in many of the reactions involved in polyketide biosynthesis by modular PKSs.

  20. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  1. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  2. Polyketide synthase from Fusarium

    DEFF Research Database (Denmark)

    Kvesel, Kasper; Wimmer, Reinhard; Sørensen, Jens Laurids

    Fungi produce a wide array of secondary metabolites, with interesting bioactivities by help of a number of enzyme complexes. Polyketide synthases (PKS) are a class of multidomain enzymes, producing a class of secondary metabolites called polyketides1,2. Only few structures of PKS’s have been...

  3. 75 FR 17823 - Notice of Proposal To Extend the Memorandum of Understanding Between the Government of the United...

    Science.gov (United States)

    2010-04-07

    ... Under Secretary for Public Diplomacy and Public Affairs, and pursuant to the requirement under 19 U.S.C....state.gov/heritage/culprop . Dated: March 29, 2010. Judith A. McHale, Under Secretary, Public Diplomacy... DEPARTMENT OF STATE [Public Notice 6944] Notice of Proposal To Extend the Memorandum of...

  4. 75 FR 34200 - Notice of Proposal To Extend the Agreement Between the Government of the United States of America...

    Science.gov (United States)

    2010-06-16

    ... Secretary for Public Diplomacy and Public Affairs, and pursuant to the requirement under 19 U.S.C. 2602(f)(1..., Under Secretary, Public Diplomacy and Public Affairs, Department of State. [FR Doc. 2010-14502 Filed 6... DEPARTMENT OF STATE [Public Notice: 7050] Notice of Proposal To Extend the Agreement Between the...

  5. The Impact of an Electronic Medication Administration Record (eMAR) and Computerized Physician Order Entry (CPOE) on Nurse Extender and Unit Clerk Staffing.

    Science.gov (United States)

    Robinson, Edmondo J; Bergey, Meredith R; Brady, Elizabeth; Mapp, Alexandra M; Goldsack, Jennifer C

    2017-12-01

    The aim of this study is to describe the impact of the introduction of health information technology (HIT) on the utilization and payroll costs of nurse extenders and unit clerks in medicine and surgery units in a large regional health system. Long-term policy goals of HIT implementation are reported to include system-level reductions in labor costs, achieved through improved efficiency. Using a retrospective cohort model, we analyzed how hours worked per patient day and staffing costs per patient day varied with the implementation of HIT over time at 2 different hospitals within a health system. Implementation of electronic medication administration records was not associated with significant changes in staffing or labor costs. Both labor hours and costs associated with nurse extenders and unit clerks were significantly reduced after the subsequent addition of computerized provider order entry. Simultaneously, units that did not implement any HIT experienced a significant increase in both labor hours and costs. Health information technology implementation in the inpatient setting is associated with significant savings in labor hours and costs in non-registered nursing roles.

  6. Real-world experience of women using extended-cycle vs monthly-cycle combined oral contraception in the United States: the National Health and Wellness Survey.

    Science.gov (United States)

    Nappi, Rossella E; Lete, Iñaki; Lee, Lulu K; Flores, Natalia M; Micheletti, Marie-Christine; Tang, Boxiong

    2018-01-18

    The real-world experience of women receiving extended-cycle combined oral contraception (COC) versus monthly-cycle COC has not been reported. Data were from the United States 2013 National Health and Wellness Survey. Eligible women (18-50 years old, premenopausal, without hysterectomy) currently using extended-cycle COC (3 months between periods) were compared with women using monthly-cycle COC. Treatment satisfaction (1 "extremely dissatisfied" to 7 "extremely satisfied"), adherence (8-item Morisky Medication Adherence Scale © ), menstrual cycle-related symptoms, health-related quality of life (HRQOL) and health state utilities (Medical Outcomes Short Form Survey-36v2®), depression (9-item Patient Health Questionnaire), sleep difficulties, Work Productivity and Activity Impairment-General Health, and healthcare resource use were assessed using one-way analyses of variance, chi-square tests, and generalized linear models (adjusted for covariates). Participants included 260 (6.7%) women using extended-cycle and 3616 (93.3%) using monthly-cycle COC. Women using extended-cycle COC reported significantly higher treatment satisfaction (P = 0.001) and adherence (P = 0.04) and reduced heavy menstrual bleeding (P = 0.029). A non-significant tendency toward reduced menstrual pain (39.5% versus 47.3%) and menstrual cycle-related symptoms (40.0% versus 48.7%) was found in women using extended-cycle versus monthly-cycle COC. Significantly more women using extended-cycle COC reported health-related diagnoses, indicating preferential prescription for extended-cycle COC among women reporting more health problems. Consistent with this poorer health, more women using extended-cycle COC reported fatigue, headache, and activity impairment (P values < 0.05). There were no other significant differences between groups. This real-world observational study supports extended-cycle COC as a valuable treatment option with high satisfaction, high adherence, and reduced

  7. Cleaning up polyketide synthases.

    Science.gov (United States)

    Kwan, Jason C; Schmidt, Eric W

    2012-03-23

    Complex biosynthetic enzymes such as polyketide synthases make mistakes. In this issue of Chemistry & Biology, Jensen et al. report that a discrete family of acyltransferases is responsible for error correction, hydrolyzing key biosynthetic intermediates from a multi-enzyme complex. This activity might find use in understanding polyketide biosynthesis, particularly in uncultivated organisms and in tailoring the synthesis of small molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  9. Assessment of hydrologic impact of extending exploratory shafts into the Calico Hills nonwelded tuff unit at Yucca Mountain, Nevada

    International Nuclear Information System (INIS)

    Nichols, W.E.; Freshley, M.D.; Rockhold, M.L.

    1991-03-01

    The US Department of Energy (DOE) is performing analyses to address an objection by the US Nuclear Regulatory Commission to plans in the Consultation Draft of the Site Characterization Plan for direct excavation of the Calico Hills nonwelded (CHn) unit within the repository exploration block at Yucca Mountain, Nevada. The excavation was planned as part of site characterization activities for the potential high-level nuclear waste repository at Yucca Mountain. This characterization activities for the potential high-level nuclear waste repository at Yucca Mountain. This characterization activity has been deferred, pending the results of a risk/benefit analysis of alternative methods for obtaining needed characterization data from CHn unit. The benefits from characterizing the CHn unit are generally related to obtaining information leading to improved confidence in predictions of site performance. The risks are generally associated with potential adverse impacts to site performance that result from excavation or other intrusion into the CHn unit. The purpose of the risk/benefit analysis is to produce a recommendation to the Director, Regulatory and Site Evaluation Division. DOE/Yucca Mountain Site Characterization Project Office for a strategy for characterizing the CHn unit. The recommendation will describe characterization activities that are expected to provide the needed information while limiting adverse impacts to site performance to the extent practical. The risk/benefit analysis was supported with scoping calculations to provide a quantitative evaluation of the impacts associated with different strategies. The working group responsible for the risk/benefit analysis requested that these scoping calculations to be supported with more detailed performance assessments for evaluating impacts of different characterization activities. This report summarizes the results of these performance assessment analyses. 9 refs., 30 figs., 1 tab

  10. Genomic Epidemiology of Gonococcal Resistance to Extended-Spectrum Cephalosporins, Macrolides, and Fluoroquinolones in the United States, 2000–2013

    Science.gov (United States)

    Grad, Yonatan H.; Harris, Simon R.; Kirkcaldy, Robert D.; Green, Anna G.; Marks, Debora S.; Bentley, Stephen D.; Trees, David; Lipsitch, Marc

    2016-01-01

    Background. Treatment of Neisseria gonorrhoeae infection is empirical and based on population-wide susceptibilities. Increasing antimicrobial resistance underscores the potential importance of rapid diagnostic tests, including sequence-based tests, to guide therapy. However, the usefulness of sequence-based diagnostic tests depends on the prevalence and dynamics of the resistance mechanisms. Methods. We define the prevalence and dynamics of resistance markers to extended-spectrum cephalosporins, macrolides, and fluoroquinolones in 1102 resistant and susceptible clinical N. gonorrhoeae isolates collected from 2000 to 2013 via the Centers for Disease Control and Prevention's Gonococcal Isolate Surveillance Project. Results. Reduced extended-spectrum cephalosporin susceptibility is predominantly clonal and associated with the mosaic penA XXXIV allele and derivatives (sensitivity 98% for cefixime and 91% for ceftriaxone), but alternative resistance mechanisms have sporadically emerged. Reduced azithromycin susceptibility has arisen through multiple mechanisms and shows limited clonal spread; the basis for resistance in 36% of isolates with reduced azithromycin susceptibility is unclear. Quinolone-resistant N. gonorrhoeae has arisen multiple times, with extensive clonal spread. Conclusions. Quinolone-resistant N. gonorrhoeae and reduced cefixime susceptibility appear amenable to development of sequence-based diagnostic tests, whereas the undefined mechanisms of resistance to ceftriaxone and azithromycin underscore the importance of phenotypic surveillance. The identification of multidrug-resistant isolates highlights the need for additional measures to respond to the threat of untreatable gonorrhea. PMID:27638945

  11. Genomic Epidemiology of Gonococcal Resistance to Extended-Spectrum Cephalosporins, Macrolides, and Fluoroquinolones in the United States, 2000-2013.

    Science.gov (United States)

    Grad, Yonatan H; Harris, Simon R; Kirkcaldy, Robert D; Green, Anna G; Marks, Debora S; Bentley, Stephen D; Trees, David; Lipsitch, Marc

    2016-11-15

     Treatment of Neisseria gonorrhoeae infection is empirical and based on population-wide susceptibilities. Increasing antimicrobial resistance underscores the potential importance of rapid diagnostic tests, including sequence-based tests, to guide therapy. However, the usefulness of sequence-based diagnostic tests depends on the prevalence and dynamics of the resistance mechanisms.  We define the prevalence and dynamics of resistance markers to extended-spectrum cephalosporins, macrolides, and fluoroquinolones in 1102 resistant and susceptible clinical N. gonorrhoeae isolates collected from 2000 to 2013 via the Centers for Disease Control and Prevention's Gonococcal Isolate Surveillance Project.  Reduced extended-spectrum cephalosporin susceptibility is predominantly clonal and associated with the mosaic penA XXXIV allele and derivatives (sensitivity 98% for cefixime and 91% for ceftriaxone), but alternative resistance mechanisms have sporadically emerged. Reduced azithromycin susceptibility has arisen through multiple mechanisms and shows limited clonal spread; the basis for resistance in 36% of isolates with reduced azithromycin susceptibility is unclear. Quinolone-resistant N. gonorrhoeae has arisen multiple times, with extensive clonal spread.  Quinolone-resistant N. gonorrhoeae and reduced cefixime susceptibility appear amenable to development of sequence-based diagnostic tests, whereas the undefined mechanisms of resistance to ceftriaxone and azithromycin underscore the importance of phenotypic surveillance. The identification of multidrug-resistant isolates highlights the need for additional measures to respond to the threat of untreatable gonorrhea. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  12. Assessment of Coping Capability of KORI Unit 1 under Extended Loss AC Power and Loss of Ultimate Heat Sink Initiated by Beyond Design Natural Disaster

    International Nuclear Information System (INIS)

    Kim, Chang Hyun; Ha, Sang Jun; Han, Kee Soo; Park, Chan Eok

    2016-01-01

    In Korea, the government and industry performed comprehensive safety inspection on all domestic nuclear power plants against beyond design basis external events and fifty action items have been issued. In addition to post- Fukushima action items, the stress tests for all domestic nuclear power plants are on the way to enhance the safety of domestic nuclear power plants through finding the vulnerabilities in intentional stress conditions initiated by beyond design natural disaster. This paper presents assessment results of coping capability of KORI Unit 1 under the simultaneous Extended Loss of AC Power (ELAP) and Loss of Ultimate Heat Sink (LUHS) which is a representative plant condition initiated by beyond design natural disaster. The assessment of the coping capability of KORI Unit 1 has been performed under simultaneous the extended loss of AC power and loss of ultimate heat sink initiated by beyond design natural disaster. It is concluded that KORI Unit 1 has the capability, in the event of loss of safety functions by beyond design natural disaster, to sufficiently cool down the reactor core without fuel damage, to keep pressure boundaries of the reactor coolant system in transient condition and to control containment and temperature to maintain the integrity of the containment buildings

  13. Assessment of Coping Capability of KORI Unit 1 under Extended Loss AC Power and Loss of Ultimate Heat Sink Initiated by Beyond Design Natural Disaster

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Hyun; Ha, Sang Jun [KHNP CRI, Daejeon (Korea, Republic of); Han, Kee Soo [Nuclear Engineering Service and Solution (NESS) Co. Ltd., Deajeon (Korea, Republic of); Park, Chan Eok [KEPCO Engineering and Constructd., Deajeon (Korea, Republic of)

    2016-10-15

    In Korea, the government and industry performed comprehensive safety inspection on all domestic nuclear power plants against beyond design basis external events and fifty action items have been issued. In addition to post- Fukushima action items, the stress tests for all domestic nuclear power plants are on the way to enhance the safety of domestic nuclear power plants through finding the vulnerabilities in intentional stress conditions initiated by beyond design natural disaster. This paper presents assessment results of coping capability of KORI Unit 1 under the simultaneous Extended Loss of AC Power (ELAP) and Loss of Ultimate Heat Sink (LUHS) which is a representative plant condition initiated by beyond design natural disaster. The assessment of the coping capability of KORI Unit 1 has been performed under simultaneous the extended loss of AC power and loss of ultimate heat sink initiated by beyond design natural disaster. It is concluded that KORI Unit 1 has the capability, in the event of loss of safety functions by beyond design natural disaster, to sufficiently cool down the reactor core without fuel damage, to keep pressure boundaries of the reactor coolant system in transient condition and to control containment and temperature to maintain the integrity of the containment buildings.

  14. Processes for CO2 capture. Context of thermal waste treatment units. State of the art. Extended abstract

    International Nuclear Information System (INIS)

    Lopez, A.; Roizard, D.; Favre, E.; Dufour, A.

    2013-01-01

    For most of industrial sectors, Greenhouse Gases (GHG) such as carbon dioxide (CO 2 ) are considered as serious pollutants and have to be controlled and treated. The thermal waste treatment units are part of industrial CO 2 emitters, even if they represent a small part of emissions (2,5 % of GHG emissions in France) compared to power plants (13 % of GHG emissions in France, one third of worldwide GHG emissions) or shaper industries (20 % of GHG emissions in France). Carbon Capture and Storage (CCS) can be a solution to reduce CO 2 emissions from industries (power plants, steel and cement industries...). The issues of CCS applied to thermal waste treatment units are quite similar to those related to power plants (CO 2 flow, flue gas temperature and pressure conditions). The problem is to know if the CO 2 produced by waste treatment plants can be captured thanks to the processes already available on the market or that should be available by 2020. It seems technically possible to adapt CCS post-combustion methods to the waste treatment sector. But on the whole, CCS is complex and costly for a waste treatment unit offering small economies of scale. However, regulations concerning impurities for CO 2 transport and storage are not clearly defined at the moment. Consequently, specific studies must be achieved in order to check the technical feasibility of CCS in waste treatment context and clearly define its cost. (authors)

  15. [Advances in isoprene synthase research].

    Science.gov (United States)

    Gou, Yan; Liu, Zhongchuan; Wang, Ganggang

    2017-11-25

    Isoprene emission can lead to significant consequence for atmospheric chemistry. In addition, isoprene is a chemical compound for various industrial applications. In the organisms, isoprene is produced by isoprene synthase that eliminates the pyrophosphate from the dimethylallyl diphosphate. As a key enzyme of isoprene formation, isoprene synthase plays an important role in the process of natural emission and artificial synthesis of isoprene. So far, isoprene synthase has been found in various plants. Isoprene synthases from different sources are of conservative structural and similar biochemical properties. In this review, the biochemical and structural characteristics of isoprene synthases from different sources were compared, the catalytic mechanism of isoprene synthase was discussed, and the perspective application of the enzyme in bioengineering was proposed.

  16. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  17. A national survey of pain clinics within the United Kingdom and Ireland focusing on the multidisciplinary team and the incorporation of the extended nursing role.

    Science.gov (United States)

    Kailainathan, Pungavi; Humble, Stephen; Dawson, Helen; Cameron, Fiona; Gokani, Shyam; Lidder, Gursimren

    2018-02-01

    Inconsistencies in the availability and quality of pain service provision have been noted nationally, as have lengthy waiting times for appointments and lack of awareness of the Pain Clinic role. The 2013 NHS England report stated that specialist pain services must offer multispecialty and multidisciplinary pain clinics. This national survey of multidisciplinary pain service provision in the United Kingdom and Ireland provides a snapshot of pain service provision in order to review and highlight what variations exist in multidisciplinary team (MDT) provision and working patterns. A common perception among clinicians is that financial pressures have led to alternate ways of staff utilisation with variable degrees of success. The survey included 143 pain clinics, focusing principally on MDT working patterns, MDT composition and adoption of the extended role. The results identified that the majority of Pain Clinics utilise the MDT approach. However, provision of critical components such as regular MDT meetings is highly variable as is the composition of the MDT itself and also working patterns of the individual clinicians. The survey reports the successful use of the extended roles for specialist nurses in follow up clinics. In contrast, the survey highlights that a large proportion of clinicians surveyed have reservations about both the effectiveness and the safety of utilising specialist nurses in the extended role to see new referrals of complex pain patients to pain clinics. This survey underlines the essential requirement for incorporation of greater MDT working locally and nationally and allocation of appropriate resources to facilitate this.

  18. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  19. Enhanced Performance of Polymer Solar Cells Comprising Diketopyrrolopyrrole-Based Regular Terpolymer Bearing Two Different π-Extended Donor Units.

    Science.gov (United States)

    Ko, Eun Yi; Park, Gi Eun; Lee, Dae Hee; Um, Hyun Ah; Shin, Jicheol; Cho, Min Ju; Choi, Dong Hoon

    2015-12-30

    New regular and random diketopyrrolopyrrole (DPP)-based terpolymers (i.e., Reg-PBDPPT and Ran-PBDPPT, respectively) bearing DPP as an electron deficient unit and 2,2'-bithiophene and (E)-1,2-di(thiophen-2-yl)ethene as electron donating units were designed and synthesized, and their performance in photovoltaic cells was investigated precisely. The absorption properties and highest occupied molecular orbital (HOMO) of Reg-PBDPPT were found to be different from those of Ran-PBDPPT. The results of grazing incidence X-ray diffraction experiments revealed that Ran-PBDPPT typically had a predominantly edge-on chain orientation on the substrate, whereas Reg-PBDPPT showed mixed chain orientation both in pristine and thermally annealed films. Although Reg-PBDPPT exhibited a lower degree of edge-on chain orientation on the substrate, the corresponding TFTs showed a high hole mobility of 0.42-0.96 cm(2) V(-1) s(-1) and maintained a high current on/off ratio (>10(6)). A polymer solar cell (PSC) composed of Reg-PBDPPT and PC71BM exhibited power conversion efficiencies (PCE) of 5.24-5.45%, which were higher than those of the Ran-PBDPPT-based PSCs. The enhanced efficiency was supported by an increase in the short circuit current, which is strongly related to the unique internal crystalline morphology and pronounced nanophase segregation behavior in the blend films. These results obviously manifested that this synthetic strategy for regular conjugated terpolymers could be employed to control morphological properties to obtain high-performance PSCs.

  20. Fluorescent lamp recycling initiatives in the United States and a recycling proposal based on extended producer responsibility and product stewardship concepts.

    Science.gov (United States)

    Silveira, Geraldo Tr; Chang, Shoou-Yuh

    2011-06-01

    This paper presents an overview of mercury-containing lamp (MCL) recycling initiatives currently available in the world, especially in the United States. The majority of MCLs contain mercury which is a neurotoxin, a persistent pollutant in the environment, and can bioaccumulate in the food chain. Although there are some recycling options in the United States, collection rates are still at 23% of all potential used MCLs. This shows that citizens are either indifferent to or unaware of the recycling alternatives. On the other hand, MCL recycling seems not to be a cost-effective process and, for this reason, in the United States, take-back programmes are still sponsored only by consumers or municipalities. A few retailers have recently initiated limited take-back alternatives and manufacturers have not yet supported financially any consistent recycling alternative in the country. Considering successful experiences, this paper makes a suggestion for an MCL recycling system based on the concepts of extended producer responsibility and product stewardship. A manufacturer-importer advance recycling fee is proposed to finance the collection and recycling system while a MCL-energy recycling fee supported by the energy sector creates a lamp refund process. 'PRO Lamp', a producer responsibility organization, will manage the entire system through a widespread public-private agreement.

  1. Extended icosahedral structures

    CERN Document Server

    Jaric, Marko V

    1989-01-01

    Extended Icosahedral Structures discusses the concepts about crystal structures with extended icosahedral symmetry. This book is organized into six chapters that focus on actual modeling of extended icosahedral crystal structures. This text first presents a tiling approach to the modeling of icosahedral quasiperiodic crystals. It then describes the models for icosahedral alloys based on random connections between icosahedral units, with particular emphasis on diffraction properties. Other chapters examine the glassy structures with only icosahedral orientational order and the extent of tra

  2. Perspectives on extended Deterrence

    International Nuclear Information System (INIS)

    Tertrais, Bruno; Yost, David S.; Bunn, Elaine; Lee, Seok-soo; Levite, Ariel e.; Russell, James A.; Hokayem, Emile; Kibaroglu, Mustafa; Schulte, Paul; Thraenert, Oliver; Kulesa, Lukasz

    2010-05-01

    In November 2009, the Foundation for Strategic Research (Fondation pour la recherche strategique, FRS) convened a workshop on 'The Future of extended Deterrence', which included the participation of some of the best experts of this topic, from the United States, Europe, the Middle East and East Asia, as well as French and NATO officials. This document brings together the papers prepared for this seminar. Several of them were updated after the publication in April 2010 of the US Nuclear Posture Review. The seminar was organized with the support of the French Atomic energy Commission (Commissariat a l'energie atomique - CEA). Content: 1 - The future of extended deterrence: a brainstorming paper (Bruno Tertrais); 2 - US extended deterrence in NATO and North-East Asia (David S. Yost); 3 - The future of US extended deterrence (Elaine Bunn); 4 - The future of extended deterrence: a South Korean perspective (Seok-soo Lee); 5 - Reflections on extended deterrence in the Middle East (Ariel e. Levite); 6 - extended deterrence, security guarantees and nuclear weapons: US strategic and policy conundrums in the Gulf (James A. Russell); 7 - extended deterrence in the Gulf: a bridge too far? (Emile Hokayem); 8 - The future of extended deterrence: the case of Turkey (Mustafa Kibaroglu); 9 - The future of extended deterrence: a UK view (Paul Schulte); 10 - NATO and extended deterrence (Oliver Thraenert); 11 - extended deterrence and assurance in Central Europe (Lukasz Kulesa)

  3. Synthesis, crystal structure and luminescent properties of lanthanide extended structure with asymmetrical dinuclear units based on 2-(methylthio)benzoic acid

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Cristiane K.; Souza, Viviane P. de; Luz, Leonis L. da [Departamento de Química Fundamental, UFPE, 50.740-560 Recife, PE (Brazil); Menezes Vicenti, Juliano R. de [Escola de Química e Alimento, FURG, 96203-900 Rio Grande, RS (Brazil); Burrow, Robert A. [Departamento de Química, UFSM, 97105-900 Santa Maria, RS (Brazil); Severino Alves; Longo, Ricardo L. [Departamento de Química Fundamental, UFPE, 50.740-560 Recife, PE (Brazil); Malvestiti, Ivani, E-mail: ivani@ufpe.br [Departamento de Química Fundamental, UFPE, 50.740-560 Recife, PE (Brazil)

    2016-02-15

    The extended structures [Ln{sub 2}(L){sub 6}(OH{sub 2}){sub 4}] with L=2-(methylthio)benzoato (2-CH{sub 3}S–C{sub 6}H{sub 4}COO{sup −}) and Ln=Tb (1), Eu (2) and Gd (3) were successfully synthesized and characterized. The single crystal structure of compound 1 was determined and showed an extended structure made up of asymmetrical dinuclear units with the formula catena-poly[{Tb(H_2O)_4}-(μ-L-1κO:2κO'){sub 2}-{Tb(L-κO,O')_2}-(μ-L-1κO:2κO'){sub 2}]. In the molecule of 1, there are two distinct metal sites. The Tb atom in site 1 is bound to four coordinated water molecules and four oxygen atoms from four different benzoate ligands, two of which bridge to site 2 Tb atoms on one side and two to site 2 Tb atoms on the other side. The site 2 Tb atom is bound to four oxygen atoms from two chelating benzoate ligands and four oxygen atoms from four different benzoate ligands, two of which bridge to site 1 Tb atoms on one side and two to site 1 Tb atoms on the other side. The bridging benzoate ligands extend the framework in one-dimension with alternating site 1/site 2 Tb atoms. The luminescent properties of these asymmetric dinuclear extended structures are quite peculiar and showed a single emitting lanthanide center. The quantum yields of 1 (ca. 50–55%) is practically independent of the excitation energy, whereas those of 2 are vanishing small (<1%) when excited at the ligand states and become sizable (ca. 10–20%) upon excitation at the intra-4f manifold. To reconcile these experimental observations in conjunction with the spectral data for compounds 1 and 3, a strong interaction between the lanthanide emitting states at sites 1 and 2 was proposed. For compound 1, the numerical solutions of the rate equations provided evidences that when the transition rates between the emitting states at both sites are larger than the highest decaying rate of these states, the system becomes an effective single emitter. This establishes, for the first time

  4. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  5. Trends in Susceptibility Rates and Extended-Spectrum β-Lactamase Production of Klebsiella pneumoniae in Bloodstream Infections Across the United States Veterans Affairs Healthcare System.

    Science.gov (United States)

    Gentry, Chris A; Williams, Riley J

    2015-12-01

    Klebsiella pneumoniae is an important pathogen, increasingly notorious for its ability to become resistant to antimicrobial agents. This study sought to characterize trends in antimicrobial susceptibility rates for K. pneumoniae causing bacteremias across the United States (U.S.) Veterans Healthcare Administration (VHA) from 2007 through 2013 utilizing a national clinical database. K. pneumoniae grew in 9,235 blood cultures from 8,414 patients. Nationally, ampicillin-sulbactam, ceftazidime, cefepime, ertapenem, fluoroquinolones, and amikacin demonstrated statistically significant susceptibility rate increases against K. pneumoniae in the 2010-2013 period versus the 2007-2009 period. No antimicrobial agent had a statistically significant nationwide susceptibility rate decrease. Of the 126 antibiotic-organism pairs tested among 9 U.S. regions, 18 demonstrated statistically significant susceptibility rate increases while 6 demonstrated statistically significant susceptibility rate decreases. The East North Central (eight agents), Mid-Atlantic (five agents), and South Atlantic (four agents) regions demonstrated statistically significant susceptibility rate increases for multiple antimicrobial agents. Of the 70 antibiotic-organism pairs tested among 5 different medical center complexity levels, 11 antibiotics demonstrated statistically significant susceptibility rate increases and 1 demonstrated a statistically significant rate decrease. Extended-spectrum β-lactamase production did not significantly change over the study period across an available nationwide representation of 31 facilities (10.6% in 2007-2009 vs. 9.21% in 2010-2013, p=0.17). The South Atlantic and Mid-Atlantic regions had the highest prevalence of extended-spectrum ß-lactamase production in the two periods, respectively. The recent trend of generally increasing susceptibility rates for K. pneumoniae bloodstream isolates in this nationwide U.S. VHA study contrasts from other U.S. health system reports

  6. Comparative analysis of the substrate specificity of trans- versus cis-acyltransferases of assembly line polyketide synthases.

    Science.gov (United States)

    Dunn, Briana J; Watts, Katharine R; Robbins, Thomas; Cane, David E; Khosla, Chaitan

    2014-06-17

    Due to their pivotal role in extender unit selection during polyketide biosynthesis, acyltransferase (AT) domains are important engineering targets. A subset of assembly line polyketide synthases (PKSs) are serviced by discrete, trans-acting ATs. Theoretically, these trans-ATs can complement an inactivated cis-AT, promoting introduction of a noncognate extender unit. This approach requires a better understanding of the substrate specificity and catalytic mechanism of naturally occurring trans-ATs. We kinetically analyzed trans-ATs from the disorazole and kirromycin synthases and compared them to a representative cis-AT from the 6-deoxyerythronolide B synthase (DEBS). During transacylation, the disorazole AT favored malonyl-CoA over methylmalonyl-CoA by >40000-fold, whereas the kirromycin AT favored ethylmalonyl-CoA over methylmalonyl-CoA by 20-fold. Conversely, the disorazole AT had broader specificity than its kirromycin counterpart for acyl carrier protein (ACP) substrates. The presence of the ACP had little effect on the specificity (k(cat)/K(M)) of the cis-AT domain for carboxyacyl-CoA substrates but had a marked influence on the corresponding specificity parameters for the trans-ATs, suggesting that these enzymes do not act strictly by a canonical ping-pong mechanism. To investigate the relevance of the kinetic analysis of isolated ATs in the context of intact PKSs, we complemented an in vitro AT-null DEBS assembly line with either trans-AT. Whereas the disorazole AT efficiently complemented the mutant PKS at substoichiometric protein ratios, the kirromycin AT was considerably less effective. Our findings suggest that knowledge of both carboxyacyl-CoA and ACP specificity is critical to the choice of a trans-AT in combination with a mutant PKS to generate novel polyketides.

  7. Efficacy of a once-a-week screening programme to control extended-spectrum beta-lactamase-producing bacteria in a neonatal intensive care unit.

    Science.gov (United States)

    Rybczynska, Helena; Melander, Eva; Johansson, Hugo; Lundberg, Fredrik

    2014-06-01

    Extended-spectrum beta-lactamase (ESBL)-producing bacteria are an escalating problem threatening health. Devastating consequences can result in neonatal intensive care units (NICU) due to these bacteria. The aim of this study was to investigate the efficacy of once-a-week screening (July 2010 to September 2012) versus screening on demand (April 2008 to June 2010). The investigation was an open retrospective descriptive study comparing 2 unpaired groups, the first exposed to screening on demand and the second to screening once a week. All other infection control measures were unchanged. Both groups were cared for in the NICU of Skåne University Hospital. Parameters compared were the proportion of cultured neonates, prevalence, time before detection, number of secondary cases, and clinical infections due to ESBL-producing bacteria. The proportion of cultured neonates increased from 28% to 49% (p control the epidemiology of unwanted pathogens among newborn infants. It provides the opportunity for early intervention, thereby avoiding secondary cases and infections. Premature neonates in particular benefit from this approach. The prevalence of ESBL of 1.77% is low from an international perspective. ESBL appear to be introduced onto the ward by mothers colonized with ESBL.

  8. Prediction of inter domain interactions in modular polyketide synthases by docking and correlated mutation analysis.

    Science.gov (United States)

    Yadav, Gitanjali; Anand, Swadha; Mohanty, Debasisa

    2013-01-01

    Polyketide synthases (PKSs) are huge multi-enzymatic protein complexes involved in the biosynthesis of one of the largest families of bioactive natural products, namely polyketides. The specificity of interactions between various catalytic domains of these megasynthases is one of the pivotal factors which control the precise order in which the extender units are joined during the biosynthetic process. Hence, understanding the molecular details of protein-protein interactions in the PKS megasynthases would be crucial for rational design of novel polyketides by domain swapping experiments involving engineered combinations of PKS catalytic domains. We have developed a computational method for exploring the binding interface between two proteins, and used it to identify the interacting residue pairs, which govern the specificity of recognition between acyl carrier protein (ACP) domain and two core catalytic domains, namely the ketosynthase (KS) and acyl transferase (AT). Both of these domain interactions i.e. the KS-ACP and the AT-ACP, are likely to play a major role in channelling of substrates and control of specificity during polyketide biosynthesis. The method, called interface scan, uses a combination of geometric docking and evolutionary information for the identification of the most appropriate mode of association between two proteins. The parameters of interface scan have been standardized based on analysis of contacts in the crystal structure of ACP in complex with ACP synthase (AcpS). Many of the contacts predicted for PKS domains are in agreement with available experiments.

  9. Potato starch synthases

    NARCIS (Netherlands)

    Nazarian-Firouzabadi, Farhad; Visser, Richard G.F.

    2017-01-01

    Starch, a very compact form of glucose units, is the most abundant form of storage polyglucan in nature. The starch synthesis pathway is among the central biochemical pathways, however, our understanding of this important pathway regarding genetic elements controlling this pathway, is still

  10. Characterization of extended-spectrum cephalosporin-resistant Salmonella enterica serovar Heidelberg isolated from food animals, retail meat, and humans in the United States 2009.

    Science.gov (United States)

    Folster, J P; Pecic, G; Singh, A; Duval, B; Rickert, R; Ayers, S; Abbott, J; McGlinchey, B; Bauer-Turpin, J; Haro, J; Hise, K; Zhao, S; Fedorka-Cray, P J; Whichard, J; McDermott, P F

    2012-07-01

    Salmonella enterica is one of the most common causes of foodborne illness in the United States. Although salmonellosis is usually self-limiting, severe infections typically require antimicrobial treatment, and ceftriaxone, an extended-spectrum cephalosporin (ESC), is commonly used in both adults and children. Surveillance conducted by the National Antimicrobial Resistance Monitoring System (NARMS) has shown a recent increase in ESC resistance among Salmonella Heidelberg isolated from food animals at slaughter, retail meat, and humans. ESC resistance among Salmonella in the United States is usually mediated by a plasmid-encoded bla(CMY) β-lactamase. In 2009, we identified 47 ESC-resistant bla(CMY)-positive Heidelberg isolates from humans (n=18), food animals at slaughter (n=16), and retail meats (n=13) associated with a spike in the prevalence of this serovar. Almost 90% (26/29) of the animal and meat isolates were isolated from chicken carcasses or retail chicken meat. We screened NARMS isolates for the presence of bla(CMY), determined whether the gene was plasmid-encoded, examined pulsed-field gel electrophoresis patterns to assess the genetic diversities of the isolates, and categorized the bla(CMY) plasmids by plasmid incompatibility groups and plasmid multi-locus sequence typing (pMLST). All 47 bla(CMY) genes were found to be plasmid encoded. Incompatibility/replicon typing demonstrated that 41 were IncI1 plasmids, 40 of which only conferred bla(CMY)-associated resistance. Six were IncA/C plasmids that carried additional resistance genes. pMLST of the IncI1-bla(CMY) plasmids showed that 27 (65.8%) were sequence type (ST) 12, the most common ST among bla(CMY)-IncI1 plasmids from Heidelberg isolated from humans. Ten plasmids had a new ST profile, ST66, a type very similar to ST12. This work showed that the 2009 increase in ESC resistance among Salmonella Heidelberg was caused mainly by the dissemination of bla(CMY) on IncI1 and IncA/C plasmids in a variety of

  11. Prevalence of Extended Spectrum β-Lactamase-Producing Enterobacteriaceae by Phenotypic and Genotypic Methods in Intensive Care Units in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    2008-08-01

    Full Text Available Background and the purpose of the study: The occurrence of Extended Spectrum β-Lactamase (ESBL-producing Entrobacteriaceae has been steadily increased in recent years, resulting in limitation of therapeutic options. The purpose of this study was to determine prevalence of ESBL-producing Entrobacteriaceae isolated from Intensive Care Units (ICUs and to investigate their phenotypic and genotypic characteristics. Methods: A total of one hundred fifty isolates were collected from urine and urinary catheter, sputum, blood, wound and other clinical samples from patient admitted in ICUs. All isolates were identified by biochemical tests and then were screened for ESBL production by Disk Agar Diffusion (DAD according to the Clinical and Laboratory Standards Institute (CLSI guideline. The species that met screening criteria were further tested for the effects of clavulanic acid by confirmatory method.  ESBL-positive species were tested for blaTEM and blaSHV genes by PCR assay. Results: Of total of 150 bacterial isolates, 133(89.3% isolates were positive in the resistance to all tested cephalosporin indicators; and 89(59.3% isolates were confirmed as ESBL producer. Klebsiella pneumoniae, Escherichia coli and Entrobacter spp. were the most ESBL-producing species. All isolates were sensitive to imipenem. The blaTEM (55.5% was the most common gene detected in ESBL phenotypic-positive isolates using PCR method. Conclusion: The present study shows high prevalence of ESBL-producing Entrobacteriaceae from ICU patients. The increased rate of these species is mainly due to the inadequate and unnecessary antimicrobial therapy.  Rational administration of β-lactams and appropriate infection control policies may reduce prevalence of ESBL-producing bacteria in ICUs.

  12. Risk factors for infection and/or colonisation with extended-spectrum β-lactamase-producing bacteria in the neonatal intensive care unit: a meta-analysis.

    Science.gov (United States)

    Li, Xuan; Xu, Xuan; Yang, Xianxian; Luo, Mei; Liu, Pin; Su, Kewen; Qing, Ying; Chen, Shuai; Qiu, Jingfu; Li, Yingli

    2017-11-01

    Extended-spectrum β-lactamase (ESBL)-producing bacteria are an important cause of healthcare-associated infections in the neonatal intensive care unit (NICU). The aim of this meta-analysis was to identify risk factors associated with infection and/or colonisation with ESBL-producing bacteria in the NICU. Electronic databases were searched for relevant studies published from 1 January 2000 to 1 July 2016. The literature was screened and data were extracted according to the inclusion and exclusion criteria. The Z-test was used to calculate the pooled odds ratio (OR) of the risk factors. ORs and their 95% confidence intervals were used to determine the significance of the risk. A total of 14 studies, including 746 cases and 1257 controls, were identified. Thirteen risk factors were determined to be related to infection and/or colonisation with ESBL-producing bacteria in the NICU: birthweight [standardised mean difference (SMD) = 1.17]; gestational age (SMD = 1.36); Caesarean delivery (OR = 1.76); parenteral nutrition (OR = 7.51); length of stay in the NICU (SMD = 0.72); mechanical ventilation (OR = 4.8); central venous catheter use (OR = 2.85); continuous positive airway pressure (OR = 5.0); endotracheal intubation (OR = 2.82); malformations (OR = 2.89); previous antibiotic use (OR = 6.72); ampicillin/gentamicin (OR = 2.31); and cephalosporins (OR = 6.0). This study identified risk factors for infection and/or colonisation with ESBL-producing bacteria in the NICU, which may provide a theoretical basis for preventive measures and targeted interventions. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  13. Uncovering the structures of modular polyketide synthases.

    Science.gov (United States)

    Weissman, Kira J

    2015-03-01

    The modular polyketide synthases (PKSs) are multienzyme proteins responsible for the assembly of diverse secondary metabolites of high economic and therapeutic importance. These molecular 'assembly lines' consist of repeated functional units called 'modules' organized into gigantic polypeptides. For several decades, concerted efforts have been made to understand in detail the structure and function of PKSs in order to facilitate genetic engineering of the systems towards the production of polyketide analogues for evaluation as drug leads. Despite this intense activity, it has not yet been possible to solve the crystal structure of a single module, let alone a multimodular subunit. Nonetheless, on the basis of analysis of the structures of modular fragments and the study of the related multienzyme of animal fatty acid synthase (FAS), several models of modular PKS architecture have been proposed. This year, however, the situation has changed - three modular structures have been characterized, not by X-ray crystallography, but by the complementary methods of single-particle cryo-electron microscopy and small-angle X-ray scattering. This review aims to compare the cryo-EM structures and SAXS-derived structural models, and to interpret them in the context of previously obtained data and existing architectural proposals. The consequences for genetic engineering of the systems will also be discussed, as well as unresolved questions and future directions.

  14. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...

  15. STRUCTURAL ENZYMOLOGY OF POLYKETIDE SYNTHASES

    OpenAIRE

    Tsai, Shiou-Chuan (Sheryl); Ames, Brian Douglas

    2009-01-01

    This chapter describes structural and associated enzymological studies of polyketide synthases, including isolated single domains and multidomain fragments. The sequence–structure–function relationship of polyketide biosynthesis, compared with homologous fatty acid synthesis, is discussed in detail. Structural enzymology sheds light on sequence and structural motifs that are important for the precise timing, substrate recognition, enzyme catalysis, and protein–protein interactions leading to ...

  16. Extended Emotions

    DEFF Research Database (Denmark)

    Krueger, Joel; Szanto, Thomas

    2016-01-01

    Until recently, philosophers and psychologists conceived of emotions as brain- and body-bound affairs. But researchers have started to challenge this internalist and individualist orthodoxy. A rapidly growing body of work suggests that some emotions incorporate external resources and thus extend...... beyond the neurophysiological confines of organisms; some even argue that emotions can be socially extended and shared by multiple agents. Call this the extended emotions thesis (ExE). In this article, we consider different ways of understanding ExE in philosophy, psychology, and the cognitive sciences....... First, we outline the background of the debate and discuss different argumentative strategies for ExE. In particular, we distinguish ExE from cognate but more moderate claims about the embodied and situated nature of cognition and emotion (Section 1). We then dwell upon two dimensions of ExE: emotions...

  17. Extended thermodynamics

    CERN Document Server

    Müller, Ingo

    1993-01-01

    Physicists firmly believe that the differential equations of nature should be hyperbolic so as to exclude action at a distance; yet the equations of irreversible thermodynamics - those of Navier-Stokes and Fourier - are parabolic. This incompatibility between the expectation of physicists and the classical laws of thermodynamics has prompted the formulation of extended thermodynamics. After describing the motifs and early evolution of this new branch of irreversible thermodynamics, the authors apply the theory to mon-atomic gases, mixtures of gases, relativistic gases, and "gases" of phonons and photons. The discussion brings into perspective the various phenomena called second sound, such as heat propagation, propagation of shear stress and concentration, and the second sound in liquid helium. The formal mathematical structure of extended thermodynamics is exposed and the theory is shown to be fully compatible with the kinetic theory of gases. The study closes with the testing of extended thermodynamics thro...

  18. The lowest-dose, extended-cycle combined oral contraceptive pill with continuous ethinyl estradiol in the United States: a review of the literature on ethinyl estradiol 20 µg/levonorgestrel 100 µg + ethinyl estradiol 10 µg

    Directory of Open Access Journals (Sweden)

    Sheila Krishnan

    2010-08-01

    Full Text Available Sheila Krishnan, Jessica KileyDepartment of Obstetrics and Gynecology, Northwestern University, Chicago, Illinois, USAAbstract: Extended-cycle oral contraceptives (OCs are increasing in popularity in the United States. A new extended-cycle OC that contains the lowest doses of ethinyl estradiol (EE and levonorgestrel (LNG + continuous EE throughout the cycle is now available. It provides 84 days of a low-dose, combined active pill containing levonorgestrel 100 µg and ethinyl estradiol 20 µg. Instead of 7 days of placebo following the active pills, the regimen delivers 7 days of ethinyl estradiol 10 µg. Existing studies reveal a similar efficacy and adverse effect profile compared with other extended-regimen OCs. Specifically, the unscheduled bleeding profile is similar to other extended-cycle OCs and improves with the increase in the duration of use. Although lower daily doses of hormonal exposure have potential benefit, to our knowledge, there are no published studies indicating that this specific regimen offers a lower incidence of hormone-related side effects or adverse events. In summary, this new extended-cycle OC provides patients a low-dose, extended-regimen OC option without sacrificing efficacy or tolerability.Keywords: continuous regimen, ethinyl estradiol, extended cycle, oral contraceptive

  19. Extended ERP

    OpenAIRE

    Müssigmann, Nikolaus

    2005-01-01

    Extended ERP : dynamic strategic supply network development / A. Albani, N. Müssigmann, K. Turowski. - In: ICESAcc 2005 - Second International Conference on Enterprise Systems and Accounting / C. J. Stefanou. - Thessaloniki : Labor. of Enterprise Resources Dep. of Accounting, 2005. - 1 CD-ROM

  20. Microsatellite instability and the association with plasma homocysteine and thymidylate synthase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Lindebjerg, Jan; Crüger, Dorthe G.

    2008-01-01

    The possible associations between microsatellite instability, homocysteine and thymidylate synthase were investigated in tumors and plasma from 130 patients with colorectal cancer. Other analyses included thymidylate synthase and 5,10-methylene-tetrahydrofolate reductase gene polymorphisms......, carcinoembryonic antigen, vitamin B12, and folate. Microsatellite instability of tumors was associated with higher levels of plasma homocysteine (p = 0.008) and higher protein expression of thymidylate synthase (p ... factors. CEA was not associated with neither homocysteine nor microsatellite instability. The data suggests that there is a more pronounced methyl unit deficiency in microsatellite instable tumors....

  1. Extending Puppet

    CERN Document Server

    Franceschi, Alessandro

    2014-01-01

    This book is a clear, detailed and practical guide to learn about designing and deploying you puppet architecture, with informative examples to highlight and explain concepts in a focused manner. This book is designed for users who already have good experience with Puppet, and will surprise experienced users with innovative topics that explore how to design, implement, adapt, and deploy a Puppet architecture. The key to extending Puppet is the development of types and providers, for which you must be familiar with Ruby.

  2. 2010 Joint United States-Canadian Program to explore the limits of the Extended Continental Shelf aboard U.S. Coast Guard Cutter Healy--Cruise HLY1002

    Science.gov (United States)

    Edwards, Brian D.; Childs, Jonathan R.; Triezenberg, Peter J.; Danforth, William W.; Gibbons, Helen

    2013-01-01

    In August and September 2010, the U.S. Geological Survey, in cooperation with Natural Resources Canada, Geological Survey of Canada, conducted bathymetric and geophysical surveys in the Beaufort Sea and eastern Arctic Ocean aboard the U.S. Coast Guard Cutter Healy. The principal objective of this mission to the high Arctic was to acquire data in support of a delineation of the outer limits of the U.S. and Canadian Extended Continental Shelf in the Arctic Ocean, in accordance with the provisions of Article 76 of the United Nations Convention on the Law of the Sea. The Healy was accompanied by the Canadian Coast Guard icebreaker Louis S. St-Laurent. The scientific parties on board the two vessels consisted principally of staff from the U.S. Geological Survey (Healy), and the Geological Survey of Canada and the Canadian Hydrographic Service (Louis). The crew also included marine-mammal observers, Native-community observers, ice observers, and biologists conducting research of opportunity in the Arctic Ocean. Despite interruptions necessitated by three medical emergencies, the joint survey proved largely successful. The Healy collected 7,201 trackline-kilometers of swath (multibeam) bathymetry (47,663 square kilometers) and CHIRP subbottom data, with accompanying marine gravity measurements, and expendable bathythermograph data. The Louis acquired 3,673 trackline-kilometers of multichannel seismic (airgun) deep-penetration reflection data along 25 continuous profiles, as well as 34 sonobuoy refraction stations and 9,500 trackline-kilometers of single-beam bathymetry. The coordinated efforts of the two vessels resulted in seismic-reflection-profile data that were of much higher quality and continuity than if the data had been acquired with a single vessel alone. The equipment-failure rate of the seismic equipment aboard the Louis was greatly reduced when the Healy led as the ice breaker. When ice conditions proved too severe to deploy the seismic system, the Louis led

  3. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  4. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  5. Consciousness extended

    DEFF Research Database (Denmark)

    Carrara-Augustenborg, Claudia

    2012-01-01

    There is no consensus yet regarding a conceptualization of consciousness able to accommodate all the features of such complex phenomenon. Different theoretical and empirical models lend strength to both the occurrence of a non-accessible informational broadcast, and to the mobilization of specific...... brain areas responsible for the emergence of the individual´s explicit and variable access to given segments of such broadcast. Rather than advocating one model over others, this chapter proposes to broaden the conceptualization of consciousness by letting it embrace both mechanisms. Within...... such extended framework, I propose conceptual and functional distinctions between consciousness (global broadcast of information), awareness (individual´s ability to access the content of such broadcast) and unconsciousness (focally isolated neural activations). My hypothesis is that a demarcation in terms...

  6. Extending Experiences

    DEFF Research Database (Denmark)

    A computer game's player is experiencing not only the game as a designer-made artefact, but also a multitude of social and cultural practices and contexts of both computer game play and everyday life. As a truly multidisciplinary anthology, Extending Experiences sheds new light on the mesh...... of possibilities and influences the player engages with. Part one, Experiential Structures of Play, considers some of the key concepts commonly used to address the experience of a computer game player. The second part, Bordering Play, discusses conceptual and practical overlaps of games and everyday life...... and the impacts of setting up, crossing and breaking the boundaries of game and non-game. Part three, Interfaces of Play, looks at games as technological and historical artefacts and commodities. The fourth part, Beyond Design, introduces new models for the practical and theoretical dimensions of game design....

  7. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  8. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  9. Type III polyketide synthases in microorganisms.

    Science.gov (United States)

    Katsuyama, Yohei; Ohnishi, Yasuo

    2012-01-01

    Type III polyketide synthases (PKSs) are simple homodimers of ketosynthases which catalyze the condensation of one to several molecules of extender substrate onto a starter substrate through iterative decarboxylative Claisen condensation reactions. Type III PKSs have been found in bacteria and fungi, as well as plants. Microbial type III PKSs, which are involved in the biosynthesis of some lipidic compounds and various secondary metabolites, have several interesting characteristics that are not shared by plant type III PKSs. Further, many compounds produced by microbial type III PKSs have significant biological functions and/or important pharmaceutical activities. Thus, studies on this class of enzymes will expand our knowledge of the biosynthetic machineries that generate natural products and generate new findings about microbial physiology. The recent development of next-generation DNA sequencing has allowed for an increase in the number of microbial genomes sequenced and the discovery of many microbial type III PKS genes. Here, we describe basic methods to study microbial type III PKSs whose genes are easy to clone. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  11. Crystal structure of riboflavin synthase

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  12. Fluoroquinolone-Resistant and Extended-Spectrum β-Lactamase-Producing Escherichia coli Infections in Patients with Pyelonephritis, United States(1).

    Science.gov (United States)

    Talan, David A; Takhar, Sukhjit S; Krishnadasan, Anusha; Abrahamian, Fredrick M; Mower, William R; Moran, Gregory J

    2016-09-01

    For 2013-2014, we prospectively identified US adults with flank pain, temperature >38.0°C, and a diagnosis of acute pyelonephritis, confirmed by culture. Cultures from 453 (86.9%) of 521 patients grew Escherichia coli. Among E. coli isolates from 272 patients with uncomplicated pyelonephritis and 181 with complicated pyelonephritis, prevalence of fluoroquinolone resistance across study sites was 6.3% (range by site 0.0%-23.1%) and 19.9% (0.0%-50.0%), respectively; prevalence of extended-spectrum β-lactamase (ESBL) production was 2.6% (0.0%-8.3%) and 12.2% (0.0%-17.2%), respectively. Ten (34.5%) of 29 patients with ESBL infection reported no exposure to antimicrobial drugs, healthcare, or travel. Of the 29 patients with ESBL infection and 53 with fluoroquinolone-resistant infection, 22 (75.9%) and 24 (45.3%), respectively, were initially treated with in vitro inactive antimicrobial drugs. Prevalence of fluoroquinolone resistance exceeds treatment guideline thresholds for alternative antimicrobial drug strategies, and community-acquired ESBL-producing E. coli infection has emerged in some US communities.

  13. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    Science.gov (United States)

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS), and we show that these are active biocatalysts for monoterpene production using biocatalysis and metabolic engineering platforms. In metabolically engineered monoterpene-producing E. coli strains, use of bLinS leads to 300-fold higher linalool production compared with the corresponding plant monoterpene synthase. With bCinS, 1,8-cineole is produced with 96% purity compared to 67% from plant species. Structures of bLinS and bCinS, and their complexes with fluorinated substrate analogues, show that these bacterial monoterpene synthases are similar to previously characterized sesquiterpene synthases. Molecular dynamics simulations suggest that these monoterpene synthases do not undergo large-scale conformational changes during the reaction cycle, making them attractive targets for structured-based protein engineering to expand the catalytic scope of these enzymes toward alternative monoterpene scaffolds. Comparison of the bLinS and bCinS structures indicates how their active sites steer reactive carbocation intermediates to the desired acyclic linalool (bLinS) or bicyclic 1,8-cineole (bCinS) products. The work reported here provides the analysis of structures for this important class of monoterpene synthase. This should now guide exploitation of the bacterial enzymes as gateway biocatalysts for the production of other monoterpenes and monoterpenoids. PMID:28966840

  14. Changing plasmid types responsible for extended spectrum cephalosporin resistance inEscherichia coliO157:H7 in the United States, 1996-2009.

    Science.gov (United States)

    Folster, J P; Pecic, G; Stroika, S; Rickert, R; Whichard, J

    2014-06-01

    Escherichia coli O157 is a major cause of foodborne illness. Plasmids are genetic elements that mobilize antimicrobial resistance determinants including bla CMY β-lactamases that confer resistance to extended-spectrum cephalosporins (ESC). ESCs are important for treating a variety of infections. IncA/C plasmids are found among diverse sources, including cattle, the principal source of E. coli O157 infections in humans. IncI1 plasmids are common among E. coli and Salmonella from poultry and other avian sources. To broaden our understanding of reservoirs of bla CMY , we determined the types of plasmids carrying bla CMY among E. coli O157. From 1996 to 2009, 3742 E. coli O157 isolates were tested. Eleven (0.29%) were ceftriaxone resistant and had a bla CMY-2 -containing plasmid. All four isolates submitted before 2001 and a single 2001 isolate had bla CMY encoded on IncA/C plasmids, while all five isolates submitted after 2001 and a single 2001 isolate had bla CMY carried on IncI1 plasmids. The IncI1 plasmids were ST2, ST20, and ST23. We conclude that cephalosporin resistance among E. coli O157:H7 is due to plasmid-encoded bla CMY genes and that plasmid types appear to have shifted from IncA/C to IncI1. This shift suggests either a change in plasmid type among animal reservoirs or that the organism has expanded into avian reservoirs. More analysis of human, retail meat, and food animal isolates is necessary to broaden our understanding of the antimicrobial resistance determinants of ESC resistance among E. coli O157.

  15. Fungal type III polyketide synthases.

    Science.gov (United States)

    Hashimoto, Makoto; Nonaka, Takamasa; Fujii, Isao

    2014-10-01

    This article covers the literature on fungal type III polyketide synthases (PKSs) published from 2005 to 2014. Since the first discovery of fungal type III PKS genes in Aspergillus oryzae, reported in 2005, putative genes for type III PKSs have been discovered in fungal genomes. Compared with type I PKSs, type III PKSs are much less abundant in fungi. However, type III PKSs could have some critical roles in fungi. This article summarizes the studies on fungal type III PKS functional analysis, including Neurospora crassa ORAS, Aspergillus niger AnPKS, Botrytis cinerea BPKS and Aspergillus oryzae CsyA and CsyB. It is mostly in vitro analysis using their recombinant enzymes that has revealed their starter and product specificities. Of these, CsyB was found to be a new kind of type III PKS that catalyses the coupling of two β-keto fatty acyl CoAs. Homology modelling reported in this article supports the importance of the capacity of the acyl binding tunnel and active site cavity in fungal type III PKSs.

  16. Terpene synthases from Cannabis sativa.

    Directory of Open Access Journals (Sweden)

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  17. Central Line–Associated Bloodstream Infection in Hospitalized Children with Peripherally Inserted Central Venous Catheters: Extending Risk Analyses Outside the Intensive Care Unit

    Science.gov (United States)

    Advani, Sonali; Reich, Nicholas G.; Sengupta, Arnab; Gosey, Leslie

    2011-01-01

    Background. Increasingly, peripherally inserted central venous catheters (PICCs) are placed for prolonged intravenous access. Few data exist regarding risk factors for central line–associated bloodstream infection (CLABSI) complicating PICCs in hospitalized children, especially children hospitalized outside the intensive care unit (ICU). Methods. We identified all children with a PICC inserted at The Johns Hopkins Hospital (Baltimore, MD) from 1 January 2003 through 31 December 2009 and used Poisson regression models to identify risk factors for PICC-associated CLABSIs. Results. A total of 2592 PICCs were placed in 1819 children. One hundred sixteen CLABSIs occurred over 44,972 catheter-days (incidence rate [IR], 2.58 cases per 1000 catheter-days; 95% confidence interval [CI], 2.07–3.00 cases per 1000 catheter-days). Independent predictors of CLABSI in the entire cohort included PICC dwell time of ≥21 days (IR ratio [IRR], 1.53; 95% CI, 1.05–2.26), parenteral nutrition as indication for insertion (IRR, 2.24; 95% CI, 1.31–3.84), prior PICC-associated CLABSI (IRR, 2.48; 95% CI, 1.18–5.25), underlying metabolic condition (IRR, 2.07; 95% CI, 1.14–3.74), and pediatric ICU exposure during hospitalization (IRR, 1.80; 95% CI, 1.18–2.75). Risk factors for CLABSI in children without PICU exposure included younger age, underlying malignancy and metabolic conditions, PICCs inserted in the lower extremity, and a prior PICC-associated CLABSI. Conclusions. Prolonged catheter dwell time, pediatric ICU exposure, and administration of parenteral nutrition as the indication for PICC insertion are important predictors of PICC-associated CLABSI in hospitalized children. A careful assessment of these risk factors may be important for future success in preventing CLABSIs in hospitalized children with PICCs. PMID:21454298

  18. Substrate specificity of the acyl transferase domains of EpoC from the epothilone polyketide synthase.

    Science.gov (United States)

    Petković, Hrvoje; Sandmann, Axel; Challis, Iain R; Hecht, Hans-Jürgen; Silakowski, Barbara; Low, Lindsey; Beeston, Nicola; Kuscer, Enej; Garcia-Bernardo, Jose; Leadlay, Peter F; Kendrew, Steven G; Wilkinson, Barrie; Müller, Rolf

    2008-02-07

    The production of epothilone mixtures is a direct consequence of the substrate tolerance of the module 3 acyltransferase (AT) domain of the epothilone polyketide synthase (PKS) which utilises both malonyl- and methylmalonyl-CoA extender units. Particular amino acid motifs in the active site of AT domains influence substrate selection for methylmalonyl-CoA (YASH) or malonyl-CoA (HAFH). This motif appears in hybrid form (HASH) in epoAT3 and may represent the molecular basis for the relaxed specificity of the domain. To investigate this possibility the AT domains from modules 2 and 3 of the epothilone PKS were examined in the heterologous DEBS1-TE model PKS. Substitution of AT1 of DEBS1-TE by epoAT2 and epoAT3 both resulted in functional PKSs, although lower yields of total products were observed when compared to DEBS1-TE (2% and 11.5% respectively). As expected, epoAT3 was significantly more promiscuous in keeping with its nature during epothilone biosynthesis. When the mixed motif (HASH) of epoAT3 within the hybrid PKS was mutated to HAFH (indicative of malonyl-CoA selection) it resulted in a non-productive PKS. When this mixed motif was converted to YASH (indicative of methylmalonyl-CoA selection) the selectivity of the hybrid PKS for methylmalonyl-CoA showed no statistically significant increase, and was associated with a loss of productivity.

  19. Nosocomial blood stream infection in intensive care units at Assiut University Hospitals (Upper Egypt with special reference to extended spectrum β-lactamase producing organisms

    Directory of Open Access Journals (Sweden)

    Mahmoud Mohammed A

    2009-05-01

    Full Text Available Abstract Aim This study investigated the nosocomial blood stream infection (BSI in the adult ICUs in Assiut university hospitals to evaluate the rate of infection in different ICUs, causative microorganisms, antimicrobial resistance, outcome of infection, risk factors, prevalence of extended spectrum B-lactamase producing organisms and molecular typing of Klebsiella pneumoniae strains to highlight the role of environment as a potential source of nosocomial BSI. Methods This study was conducted over a period of 12 months from January 2006 to December 2006. All Patients admitted to the different adult ICUs were monitored daily by attending physicians for subsequent development of nosocomial BSI. Blood cultures were collected from suspected patients to detect the causative organisms. After antimicrobial susceptibility testing, detection of ESBLs was conducted among gram negative isolates. Klebsiella pneumoniae isolates were tested by PCR to determine the most common group of B-lactamase genes responsible for resistance. Klebsiella pneumoniae isolates from infected patients and those isolated from the environment were typed by RAPD technique to investigate the role of environment in transmission of infection. Results The study included 2095 patients who were admitted to different ICUs at Assiut University Hospitals from January 2006 to December 2006. Blood samples were collected from infected patients for blood cultures. The colonies were identified and antibiotic sensitivities were performed. This study showed that the rate of nosocomial BSI was 75 per 1000 ICU admissions with the highest percentages in Trauma ICU (17%. Out of 159 patients with primary bloodstream infection, 61 patients died representing a crude mortality rate of 38%. Analysis of the organisms causing BSI showed that Gram positive organisms were reported in 69.1% (n = 121; MRSA was the most prevalent (18.9%, followed by methicillin resistant coagulase negative Staphylococci (16

  20. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Aromatic Polyketide Synthases (Purification, Characterization, and Antibody Development to Benzalacetone Synthase from Raspberry Fruits).

    Science.gov (United States)

    Borejsza-Wysocki, W.; Hrazdina, G.

    1996-03-01

    p-Hydroxyphenylbutan-2-one, the characteristic aroma compound of raspberries (Rubus idaeus L.), is synthesized from p-coumaryl-coenzyme A and malonyl-coenzyme A in a two-step reaction sequence that is catalyzed by benzalacetone synthase and benzalacetone reductase (W. Borejsza-Wysocki and G. Hrazdina [1994] Phytochemistry 35: 623-628). Benzalacetone synthase condenses one malonate with p-coumarate to form the pathway intermediate p-hydroxyphenylbut-3-ene-2-one (p-hydroxybenzalacetone) in a reaction that is similar to those catalyzed by chalcone and stilbene synthases. We have obtained an enzyme preparation from ripe raspberries that was preferentially enriched in benzalacetone synthase (approximately 170-fold) over chalcone synthase (approximately 14-fold) activity. This preparation was used to characterize benzalacetone synthase and to develop polyclonal antibodies in rabbits. Benzalacetone synthase showed similarity in its molecular properties to chalcone synthase but differed distinctly in its substrate specificity, response to 2-mercaptoethanol and ethylene glycol, and induction in cell-suspension cultures. The product of the enzyme, p-hydroxybenzalacetone, inhibited mycelial growth of the raspberry pathogen Phytophthora fragariae var rubi at 250 [mu]M. We do not know whether the dual activity in the benzalacetone synthase preparation is the result of a bifunctional enzyme or is caused by contamination with chalcone synthase that was also present. The rapid induction of the enzyme in cell-suspension cultures upon addition of yeast extract and the toxicity of its product, p-hydroxybenzalacetone, to phytopathogenic fungi also suggest that the pathway may be part of a plant defense response.

  2. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-11-01

    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  3. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)

    2004-07-01

    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  4. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  5. Chimpanzee culture extends beyond matrilineal family units.

    Science.gov (United States)

    van Leeuwen, Edwin J C; Mundry, Roger; Cronin, Katherine A; Bodamer, Mark; Haun, Daniel B M

    2017-06-19

    The 'grooming handclasp' is one of the most well-established cultural traditions in chimpanzees. A recent study by Wrangham et al.[1] reduced the cultural scope of grooming-handclasp behavior by showing that grooming-handclasp style convergence is "explained by matrilineal relationship rather than conformity" [1]. Given that we previously reported cultural differences in grooming-handclasp style preferences in captive chimpanzees [2], we tested the alternative view posed by Wrangham et al.[1] in the chimpanzee populations that our original results were based on. Using the same outcome variable as Wrangham et al.[1] - the proportion of high-arm grooming featuring palm-to-palm clasping - we found that matrilineal relationships explained neither within-group homogeneity nor between-group heterogeneity, thereby corroborating our original conclusion that grooming-handclasp behavior can represent a group-level cultural tradition in chimpanzees. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-01-01

    Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  7. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi, E-mail: morimoto@phar.kyushu-u.ac.jp [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  8. Silicone chain extender

    DEFF Research Database (Denmark)

    2015-01-01

    The present invention relates to a silicone chain extender, more particularly a chain extender for silicone polymers and copolymers, to a chain extended silicone polymer or copolymer and to a functionalized chain extended silicone polymer or copolymer, to a method for the preparation thereof...

  9. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...

  10. Evolutionary and mechanistic insights from the reconstruction of (+)-humulene synthases from a modern (+)-Germacrene A Synthase

    OpenAIRE

    Gonzalez Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J.; Faraldos, Juan A.; Allemann, Rudolf Konrad

    2014-01-01

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and

  11. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  12. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  13. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  14. Producing alpha-olefins using polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Katz, Leonard; Steen, Eric J.; Keasling, Jay D.

    2018-01-02

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an .alpha.-olefin, such as 1-hexene or butadiene. The present invention also provides for a host cell comprising the PKS and when cultured produces the .alpha.-olefin.

  15. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  16. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  17. Type III Polyketide Synthases: Functional Classification and Phylogenomics.

    Science.gov (United States)

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-01-03

    Polyketide synthases (PKSs) catalyze the sequential condensation of simple acetate units to produce a large class of natural products, including pharmacologically valuable compounds. PKSs are classified into three types on the basis of their domain structures; type III PKSs have the simplest domain structure, although their products have various structures and functions. The sequence-function relationship is fundamental for predicting enzyme functions, but it has not been well investigated in type III PKSs to date. Consequently, the current methods for predicting type III PKS functions are still immature in comparison with those that target type I/II PKSs. In this review we summarize the current functional and phylogenomic knowledge about type III PKSs and propose a new classification of their enzymatic reactions. We also discuss possible directions for the development of better computational tools for functional prediction of type III PKS homologues. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Non-invasive extending prosthesis

    OpenAIRE

    Meswania, Jayantilal Mohanlal

    2006-01-01

    Most sarcomas of the bone occur in patients of a relatively young age including skeletally immature patients. Approximately 50 child sarcomas are treated with limb salvage surgery per year in the United Kingdom. These children need an extendible implant that can be lengthened periodically to keep pace with the growth in the opposite limb. Surgically, invasive devices have been used for the past thirty years with intrinsic problems of infection and long-term recurrent trauma to the patient. To...

  19. Extended Enterprise performance Management

    NARCIS (Netherlands)

    Bobbink, Maria Lammerdina; Hartmann, Andreas

    2014-01-01

    The allegiance of partnering organisations and their employees to an Extended Enterprise performance is its proverbial sword of Damocles. Literature on Extended Enterprises focuses on collaboration, inter-organizational integration and learning to avoid diminishing or missing allegiance becoming an

  20. Syndrome of extended shadow

    International Nuclear Information System (INIS)

    Ginzburg, M.A.

    1987-01-01

    Syndrome of extended shadow is characterized by large (more than one lobe) or total shadow of the lung area. A detailed roentgenological characteristic and intrasyndrome differential diagnosis of extended shadows is given. Ethiology, pathogenesis and pathomorphology as well as clinical picture and methods of investigation of extended shadows are discussed

  1. Engineering of plant type III polyketide synthases.

    Science.gov (United States)

    Wakimoto, Toshiyuki; Morita, Hiroyuki; Abe, Ikuro

    2012-01-01

    Members of the chalcone synthase superfamily of type III polyketide synthases (PKSs) catalyze iterative condensations of CoA thioesters to produce a variety of polyketide scaffolds with remarkable structural diversity and biological activities. The homodimeric type III PKSs share a common three-dimensional overall fold with a conserved Cys-His-Asn catalytic triad; notably, only a slight modification of the active site dramatically expands the catalytic repertoire of the enzymes. In addition, the enzymes exhibit extremely promiscuous substrate specificities, and accept a variety of nonphysiological substrates, making the type III PKSs an excellent platform for the further production of unnatural, novel polyketide scaffolds with promising biological activities. This chapter summarizes recent advances in the engineering of plant type III PKS enzymes in our laboratories, using approaches combining structure-based enzyme engineering and precursor-directed biosynthesis with rationally designed substrate analogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Structure of the ATP Synthase Catalytic Complex (F1) from Escherichia coli in an Autoinhibited conformation

    Energy Technology Data Exchange (ETDEWEB)

    G Cingolani; T Duncan

    2011-12-31

    ATP synthase is a membrane-bound rotary motor enzyme that is critical for cellular energy metabolism in all kingdoms of life. Despite conservation of its basic structure and function, autoinhibition by one of its rotary stalk subunits occurs in bacteria and chloroplasts but not in mitochondria. The crystal structure of the ATP synthase catalytic complex (F{sub 1}) from Escherichia coli described here reveals the structural basis for this inhibition. The C-terminal domain of subunit {var_epsilon} adopts a heretofore unknown, highly extended conformation that inserts deeply into the central cavity of the enzyme and engages both rotor and stator subunits in extensive contacts that are incompatible with functional rotation. As a result, the three catalytic subunits are stabilized in a set of conformations and rotational positions distinct from previous F{sub 1} structures.

  3. Engineering cotton (+)-delta-cadinene synthase to an altered function: germacrene D-4-ol synthase.

    Science.gov (United States)

    Yoshikuni, Yasuo; Martin, Vincent J J; Ferrin, Thomas E; Keasling, Jay D

    2006-01-01

    The combined approaches of rational design and random mutagenesis were applied to generate a sesquiterpene synthase with an altered activity. Due to the lack of a convenient screen for sesquiterpene synthase activity, a high-throughput dual-activity screen was used by fusing (+)-delta-cadinene synthase to chloramphenicol acetyltransferase (CAT). The gene encoding (+)-delta-cadinene synthase was mutagenized using error-prone PCR. The resulting mutant fusion proteins were screened for CAT activity and altered sesquiterpene selectivity. Twenty-one clones producing (+)-delta-cadinene and germacrene D-4-ol in different ratios were isolated from the library. Analysis using a homology model of (+)-delta-cadinene synthase suggested that the G helix plays a very important role in (+)-delta-cadinene formation. Reconstruction of the G helix using site-directed, saturation mutagenesis yielded a mutant, N403P/L405H, that maintained its specific activity and showed higher selectivity to germacrene D-4-ol in vivo (up to 93%).

  4. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  5. Evolution of cyclizing 5-aminolevulinate synthases in the biosynthesis of actinomycete secondary metabolites: outcomes for genetic screening techniques

    Czech Academy of Sciences Publication Activity Database

    Petříčková, Kateřina; Chroňáková, Alica; Zelenka, Tomáš; Chrudimský, Tomáš; Pospíšil, Stanislav; Petříček, Miroslav; Krištůfek, Václav

    2015-01-01

    Roč. 6, AUG 2015 (2015) ISSN 1664-302X R&D Projects: GA MŠk LH12191 Institutional support: RVO:61388971 ; RVO:60077344 Keywords : 5-aminolevulinate synthase * C5N unit * Streptomyces Subject RIV: EE - Microbiology, Virology Impact factor: 4.165, year: 2015

  6. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...... in the sarcolemma as well as the cytoplasm of type I muscle fibres. NADPH diaphorase activity confirmed a higher level of NO synthase activity in the sarcolemma as well as the cytoplasm of type I muscle fibers. Histochemical staining for cytochrome oxidase showed a staining pattern similar to that observed for type...... I NO synthase immunoreactivity and NADPH diaphorase activity. Type III NO synthase immunoreactivity was observed both in the endothelium of larger vessels and of microvessels. The results establish that human skeletal muscle expresses two different constitutive isoforms of NO synthase in different...

  7. Functional plasticity of paralogous diterpene synthases involved in conifer defense

    OpenAIRE

    Keeling, Christopher I.; Weisshaar, Sabrina; Lin, Roy P. C.; Bohlmann, Jörg

    2008-01-01

    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant–herbivore, plant–pollinator, and plant–pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin...

  8. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    Science.gov (United States)

    Croteau, Rodney Bruce [Pullman, WA; Burke, Charles Cullen [Moscow, ID

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  9. Extending Database Integration Technology

    National Research Council Canada - National Science Library

    Buneman, Peter

    1999-01-01

    Formal approaches to the semantics of databases and database languages can have immediate and practical consequences in extending database integration technologies to include a vastly greater range...

  10. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  11. Divinyl ether synthase gene and protein, and uses thereof

    Science.gov (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  12. Vitis vinifera terpenoid cyclases: functional identification of two sesquiterpene synthase cDNAs encoding (+)-valencene synthase and (-)-germacrene D synthase and expression of mono- and sesquiterpene synthases in grapevine flowers and berries.

    Science.gov (United States)

    Lücker, Joost; Bowen, Pat; Bohlmann, Jörg

    2004-10-01

    Valencene is a volatile sesquiterpene emitted from flowers of grapevine, Vitis vinifera L. A full-length cDNA from the cultivar Gewürztraminer was functionally expressed in Escherichia coli and found to encode valencene synthase (VvVal). The two major products formed by recombinant VvVal enzyme activity with farnesyl diphosphate (FPP) as substrate are (+)-valencene and (-)-7-epi-alpha-selinene. Grapevine valencene synthase is closely related to a second sesquiterpene synthase from this species, (-)-germacrene D synthase (VvGerD). VvVal and VvGerD cDNA probes revealed strong signals in Northern hybridizations with RNA isolated from grapevine flower buds. Transcript levels were lower in open pre-anthesis flowers, flowers after anthesis, or at early onset of fruit development. Similar results were obtained using a third probe, (-)-alpha-terpineol synthase, a monoterpenol synthase. Sesquiterpene synthase and monoterpene synthase transcripts were not detected in the mesocarp and exocarp during early stages of fruit development, but transcripts hybridizing with VvVal appeared during late ripening of the berries. Sesquiterpene synthase transcripts were also detected in young seeds.

  13. Crystallization and preliminary crystallographic analysis of a novel plant type III polyketide synthase that produces pentaketide chromone

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Tsuyoshi; Noguchi, Hiroshi [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: ssugio@rc.m-kagaku.co.jp [ZOEGENE Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: ssugio@rc.m-kagaku.co.jp [School of Pharmaceutical Sciences and the COE21 Program, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: ssugio@rc.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2006-09-01

    Pentaketide chromone synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 1.6 Å. Pentaketide chromone synthase (PCS) from Aloe arborescens is a novel plant-specific type III polyketide synthase that catalyzes the formation of 5,7-dihydroxy-2-methylchromone from five molecules of malonyl-CoA. Recombinant PCS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 73.2, b = 88.4, c = 70.0 Å, α = γ = 90.0, β = 95.6°. Diffraction data were collected to 1.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  14. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  15. Fecal Carriage of Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae Strains Is Associated with Worse Outcome in Patients Hospitalized in the Pediatric Oncology Unit of Beni-Messous Hospital in Algiers, Algeria.

    Science.gov (United States)

    Medboua-Benbalagh, Chafiaa; Touati, Abdelaziz; Kermas, Rachida; Gharout-Sait, Alima; Brasme, Lucien; Mezhoud, Halima; Touati, Djamila; Guillard, Thomas; de Champs, Christophe

    2017-09-01

    The current study aimed to investigate extended-spectrum β-lactamase-producing Enterobacteriaceae (ESBL-E) fecal carriage in children with different cancers admitted in the pediatric oncology unit of Beni-Messous Hospital (Algiers, Algeria). Rectal swabs from children with cancer were sampled from February 2012 to May 2013 within 48 hours following their admission. After species identification and detection of ESBL production by double-disk synergy test (DD test), antibiotic susceptibility was determined by the standard disk diffusion method. Antibiotic resistance genes, including bla genes and plasmid-mediated quinolone resistance (PMQR) genes, were investigated by polymerase chain reaction (PCR). The phylogenetic grouping of Escherichia coli strains was determined by PCR. Of the 171 children studied, 93 (54%) were ESBL carriers. An antibiotic treatment for the last 3 months before admission (p = 0.01), hematological malignancies (p = 0.003), and death (p = 0.0003) were more frequent in the ESBL-E group than in the non-ESBL group. Multivariate analysis showed that hematological malignancies (odds ratio [OR]: 3.9; confidence interval [CI]: 1.1-14.1; p = 0.04) and ESBL-E carriage (OR: 6.2; CI: 1.7-22.00; p = 0.005) were two independent factors associated with increased risk of death. A total of 103 ESBL-E isolates were obtained. Klebsiella pneumoniae and E. coli isolates were the most frequently isolated. PCR amplification showed that all the isolates produced a CTX-M ESBL (CTX-M-15, CTX-M-14, and CTX-M-3). The PMQR genes detected were qnrB, qnrS, and aac(6')-Ib-cr. E. coli isolates were assigned to four major extraintestinal pathogenic E. coli phylogroups, including B2 and D. This study provides, for the first time, insight into epidemiology of the ESBL-E fecal carriage among children with cancer in Algeria.

  16. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  17. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.

    2001-01-01

    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  18. Extended Life Coolant Testing

    Science.gov (United States)

    2016-06-06

    military vehicles. Newer vehicles come factory- filled with ELC, while the Army continues to use traditional supplemental coolant additives (SCA)-based...UNCLASSIFIED TABLE OF CONTENTS EXTENDED LIFE COOLANT TESTING INTERIM REPORT TFLRF No. 478 by Gregory A. T. Hansen Edwin A...longer needed. Do not return it to the originator. UNCLASSIFIED UNCLASSIFIED EXTENDED LIFE COOLANT TESTING INTERIM REPORT TFLRF No

  19. Extended Theories of Gravitation

    Directory of Open Access Journals (Sweden)

    Fatibene Lorenzo

    2013-09-01

    Full Text Available Extended theories of gravitation are naturally singled out by an analysis inspired by the Ehelers-Pirani-Schild framework. In this framework the structure of spacetime is described by a Weyl geometry which is enforced by dynamics. Standard General Relativity is just one possible theory within the class of extended theories of gravitation. Also all Palatini f(R theories are shown to be extended theories of gravitation. This more general setting allows a more general interpretation scheme and more general possible couplings between gravity and matter. The definitions and constructions of extended theories will be reviewed. A general interpretation scheme will be considered for extended theories and some examples will be considered.

  20. Extended family medicine training

    Science.gov (United States)

    Slade, Steve; Ross, Shelley; Lawrence, Kathrine; Archibald, Douglas; Mackay, Maria Palacios; Oandasan, Ivy F.

    2016-01-01

    Abstract Objective To examine trends in family medicine training at a time when substantial pedagogic change is under way, focusing on factors that relate to extended family medicine training. Design Aggregate-level secondary data analysis based on the Canadian Post-MD Education Registry. Setting Canada. Participants All Canadian citizens and permanent residents who were registered in postgraduate family medicine training programs within Canadian faculties of medicine from 1995 to 2013. Main outcome measures Number and proportion of family medicine residents exiting 2-year and extended (third-year and above) family medicine training programs, as well as the types and numbers of extended training programs offered in 2015. Results The proportion of family medicine trainees pursuing extended training almost doubled during the study period, going from 10.9% in 1995 to 21.1% in 2013. Men and Canadian medical graduates were more likely to take extended family medicine training. Among the 5 most recent family medicine exit cohorts (from 2009 to 2013), 25.9% of men completed extended training programs compared with 18.3% of women, and 23.1% of Canadian medical graduates completed extended training compared with 13.6% of international medical graduates. Family medicine programs vary substantially with respect to the proportion of their trainees who undertake extended training, ranging from a low of 12.3% to a high of 35.1% among trainees exiting from 2011 to 2013. Conclusion New initiatives, such as the Triple C Competency-based Curriculum, CanMEDS–Family Medicine, and Certificates of Added Competence, have emerged as part of family medicine education and credentialing. In acknowledgment of the potential effect of these initiatives, it is important that future research examine how pedagogic change and, in particular, extended training shapes the care family physicians offer their patients. As part of that research it will be important to measure the breadth and uptake of

  1. Structural basis for the recruitment of glycogen synthase by glycogenin.

    Science.gov (United States)

    Zeqiraj, Elton; Tang, Xiaojing; Hunter, Roger W; García-Rocha, Mar; Judd, Andrew; Deak, Maria; von Wilamowitz-Moellendorff, Alexander; Kurinov, Igor; Guinovart, Joan J; Tyers, Mike; Sakamoto, Kei; Sicheri, Frank

    2014-07-15

    Glycogen is a primary form of energy storage in eukaryotes that is essential for glucose homeostasis. The glycogen polymer is synthesized from glucose through the cooperative action of glycogen synthase (GS), glycogenin (GN), and glycogen branching enzyme and forms particles that range in size from 10 to 290 nm. GS is regulated by allosteric activation upon glucose-6-phosphate binding and inactivation by phosphorylation on its N- and C-terminal regulatory tails. GS alone is incapable of starting synthesis of a glycogen particle de novo, but instead it extends preexisting chains initiated by glycogenin. The molecular determinants by which GS recognizes self-glucosylated GN, the first step in glycogenesis, are unknown. We describe the crystal structure of Caenorhabditis elegans GS in complex with a minimal GS targeting sequence in GN and show that a 34-residue region of GN binds to a conserved surface on GS that is distinct from previously characterized allosteric and binding surfaces on the enzyme. The interaction identified in the GS-GN costructure is required for GS-GN interaction and for glycogen synthesis in a cell-free system and in intact cells. The interaction of full-length GS-GN proteins is enhanced by an avidity effect imparted by a dimeric state of GN and a tetrameric state of GS. Finally, the structure of the N- and C-terminal regulatory tails of GS provide a basis for understanding phosphoregulation of glycogen synthesis. These results uncover a central molecular mechanism that governs glycogen metabolism.

  2. Strategies in megasynthase engineering - fatty acid synthases (FAS) as model proteins.

    Science.gov (United States)

    Fischer, Manuel; Grininger, Martin

    2017-01-01

    Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS) are responsible for the production of a large spectrum of bioactive polyketides (PK), which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the "assembly-line synthetic concept" of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS) are and will be valuable objects for further developing this field.

  3. Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins

    Directory of Open Access Journals (Sweden)

    Manuel Fischer

    2017-06-01

    Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.

  4. The Extended Enterprise concept

    DEFF Research Database (Denmark)

    Larsen, Lars Bjørn; Vesterager, Johan; Gobbi, Chiara

    1999-01-01

    This paper provides an overview of the work that has been done regarding the Extended Enterprise concept in the Common Concept team of Globeman 21 including references to results deliverables concerning the development of the Extended Enterprise concept. The first section presents the basic concept...... picture from Globeman21, which illustrates the Globeman21 way of realising the Extended Enterprise concept. The second section presents the Globeman21 EE concept in a life cycle perspective, which to a large extent is based on the thoughts and ideas behind GERAM (ISO/DIS 15704)....

  5. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, K

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  6. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed ...

  7. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  8. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    and endothelial nitric oxide synthase (NOS)], and enzymatic NO synthase activity. MRI guided biopsies documented more active plaques than macroscopic examination, and histological examination revealed further lesions. Inducible NOS (iNOS) was the dominant IR isoform, while reactive astrocytes were the dominant i...

  9. Building Extended Families

    Science.gov (United States)

    McKain, Barbara; McKain, Michael

    1970-01-01

    Discusses need for dissolution of the couple" relationship with substitution of the extended family which would permit each member to maintain individuality and to function on own merit. Suggests group living as preferable alternative. (CJ)

  10. Extending mine life

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    Mine layouts, new machines and techniques, research into problem areas of ground control and so on, are highlighted in this report on extending mine life. The main resources taken into account are coal mining, uranium mining, molybdenum and gold mining

  11. Rational extended thermodynamics

    CERN Document Server

    Müller, Ingo

    1998-01-01

    Ordinary thermodynamics provides reliable results when the thermodynamic fields are smooth, in the sense that there are no steep gradients and no rapid changes. In fluids and gases this is the domain of the equations of Navier-Stokes and Fourier. Extended thermodynamics becomes relevant for rapidly varying and strongly inhomogeneous processes. Thus the propagation of high­ frequency waves, and the shape of shock waves, and the regression of small-scale fluctuation are governed by extended thermodynamics. The field equations of ordinary thermodynamics are parabolic while extended thermodynamics is governed by hyperbolic systems. The main ingredients of extended thermodynamics are • field equations of balance type, • constitutive quantities depending on the present local state and • entropy as a concave function of the state variables. This set of assumptions leads to first order quasi-linear symmetric hyperbolic systems of field equations; it guarantees the well-posedness of initial value problems and f...

  12. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  13. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  14. Novel applications of plant polyketide synthases.

    Science.gov (United States)

    Abe, Ikuro

    2012-04-01

    The structurally and mechanistically simple type III polyketide synthases (PKSs) catalyze iterative condensations of CoA thioesters to produce a variety of polyketide scaffolds with remarkably diverse structures and biological activities. By exploiting the enzymes, we combined precursor-directed biosynthesis with nitrogen-containing substrates and structure-based enzyme engineering and generated unnatural, novel polyketide-alkaloid scaffolds with promising biological activities. The nucleophilic nitrogen atom and the engineered enzymes thus facilitated the formation of additional CC and CN bonds during the enzymatic transformations. The methodology will contribute to the further production of chemically and structurally divergent, unnatural natural products, as well as the rational design of novel biocatalysts with unprecedented catalytic functions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Tyrosine nitration affects thymidylate synthase properties.

    Science.gov (United States)

    Dąbrowska-Maś, Elżbieta; Frączyk, Tomasz; Ruman, Tomasz; Radziszewska, Karolina; Wilk, Piotr; Cieśla, Joanna; Zieliński, Zbigniew; Jurkiewicz, Agata; Gołos, Barbara; Wińska, Patrycja; Wałajtys-Rode, Elżbieta; Leś, Andrzej; Nizioł, Joanna; Jarmuła, Adam; Stefanowicz, Piotr; Szewczuk, Zbigniew; Rode, Wojciech

    2012-01-14

    Highly purified preparations of thymidylate synthase, isolated from calf thymus, and L1210 parental and FdUrd-resistant cells, were found to be nitrated, as indicated by a specific reaction with anti-nitro-tyrosine antibodies, suggesting this modification to appear endogenously in normal and tumor tissues. Each human, mouse and Ceanorhabditis elegans recombinant TS preparation, incubated in vitro in the presence of NaHCO(3), NaNO(2) and H(2)O(2) at pH 7.5, underwent tyrosine nitration, leading to a V(max)(app) 2-fold lower following nitration of 1 (with human or C. elegans TS) or 2 (with mouse TS) tyrosine residues per monomer. Enzyme interactions with dUMP, meTHF or 5-fluoro-dUMP were not distinctly influenced. Nitration under the same conditions of model tripeptides of a general formula H(2)N-Gly-X-Gly-COOH (X = Phe, Tyr, Trp, Lys, Arg, His, Ser, Thr, Cys, Gly), monitored by NMR spectroscopy, showed formation of nitro-species only for H-Gly-Tyr-Gly-OH and H-Gly-Phe-Gly-OH peptides, the chemical shifts for nitrated H-Gly-Tyr-Gly-OH peptide being in a very good agreement with the strongest peak found in (15)N-(1)H HMBC spectrum of nitrated protein. MS analysis of nitrated human and C. elegans proteins revealed several thymidylate synthase-derived peptides containing nitro-tyrosine (at positions 33, 65, 135, 213, 230, 258 and 301 in the human enzyme) and oxidized cysteine (human protein Cys(210), with catalytically critical Cys(195) remaining apparently unmodified) residues.

  16. CLYBL is a polymorphic human enzyme with malate synthase and β-methylmalate synthase activity

    Science.gov (United States)

    Strittmatter, Laura; Li, Yang; Nakatsuka, Nathan J.; Calvo, Sarah E.; Grabarek, Zenon; Mootha, Vamsi K.

    2014-01-01

    CLYBL is a human mitochondrial enzyme of unknown function that is found in multiple eukaryotic taxa and conserved to bacteria. The protein is expressed in the mitochondria of all mammalian organs, with highest expression in brown fat and kidney. Approximately 5% of all humans harbor a premature stop polymorphism in CLYBL that has been associated with reduced levels of circulating vitamin B12. Using comparative genomics, we now show that CLYBL is strongly co-expressed with and co-evolved specifically with other components of the mitochondrial B12 pathway. We confirm that the premature stop polymorphism in CLYBL leads to a loss of protein expression. To elucidate the molecular function of CLYBL, we used comparative operon analysis, structural modeling and enzyme kinetics. We report that CLYBL encodes a malate/β-methylmalate synthase, converting glyoxylate and acetyl-CoA to malate, or glyoxylate and propionyl-CoA to β-methylmalate. Malate synthases are best known for their established role in the glyoxylate shunt of plants and lower organisms and are traditionally described as not occurring in humans. The broader role of a malate/β-methylmalate synthase in human physiology and its mechanistic link to vitamin B12 metabolism remain unknown. PMID:24334609

  17. Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

    International Nuclear Information System (INIS)

    Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

    2008-01-01

    The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

  18. Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

    Energy Technology Data Exchange (ETDEWEB)

    Sá-Moura, Bebiana [IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto (Portugal); Albuquerque, Luciana; Empadinhas, Nuno [Centro de Neurociências e Biologia Celular, Departamento de Zoologia, Universidade de Coimbra, Coimbra (Portugal); Costa, Milton S. da [Departamento de Bioquímica, Universidade de Coimbra, Coimbra (Portugal); Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra, E-mail: sribeiro@ibmc.up.pt [IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto (Portugal)

    2008-08-01

    The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6{sub 5}22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6{sub 5}22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative.

  19. Evidence for an iterative module in chain elongation on the azalomycin polyketide synthase

    Directory of Open Access Journals (Sweden)

    Hui Hong

    2016-10-01

    Full Text Available The assembly-line synthases that produce bacterial polyketide natural products follow a modular paradigm in which each round of chain extension is catalysed by a different set or module of enzymes. Examples of deviation from this paradigm, in which a module catalyses either multiple extensions or none are of interest from both a mechanistic and an evolutionary viewpoint. We present evidence that in the biosynthesis of the 36-membered macrocyclic aminopolyol lactones (marginolactones azalomycin and kanchanamycin, isolated respectively from Streptomyces malaysiensis DSM4137 and Streptomyces olivaceus Tü4018, the first extension module catalyses both the first and second cycles of polyketide chain extension. To confirm the integrity of the azl gene cluster, it was cloned intact on a bacterial artificial chromosome and transplanted into the heterologous host strain Streptomyces lividans, which does not possess the genes for marginolactone production. When furnished with 4-guanidinobutyramide, a specific precursor of the azalomycin starter unit, the recombinant S. lividans produced azalomycin, showing that the polyketide synthase genes in the sequenced cluster are sufficient to accomplish formation of the full-length polyketide chain. This provides strong support for module iteration in the azalomycin and kanchanamycin biosynthetic pathways. In contrast, re-sequencing of the gene cluster for biosynthesis of the polyketide β-lactone ebelactone in Streptomyces aburaviensis has shown that, contrary to a recently-published proposal, the ebelactone polyketide synthase faithfully follows the colinear modular paradigm.

  20. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    International Nuclear Information System (INIS)

    Blacklock, Brenda J.; Jaworski, Jan G.

    2006-01-01

    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  1. ASMPKS: an analysis system for modular polyketide synthases

    Directory of Open Access Journals (Sweden)

    Kong Eun-Bae

    2007-09-01

    Full Text Available Abstract Background Polyketides are secondary metabolites of microorganisms with diverse biological activities, including pharmacological functions such as antibiotic, antitumor and agrochemical properties. Polyketides are synthesized by serialized reactions of a set of enzymes called polyketide synthase(PKSs, which coordinate the elongation of carbon skeletons by the stepwise condensation of short carbon precursors. Due to their importance as drugs, the volume of data on polyketides is rapidly increasing and creating a need for computational analysis methods for efficient polyketide research. Moreover, the increasing use of genetic engineering to research new kinds of polyketides requires genome wide analysis. Results We describe a system named ASMPKS (Analysis System for Modular Polyketide Synthesis for computational analysis of PKSs against genome sequences. It also provides overall management of information on modular PKS, including polyketide database construction, new PKS assembly, and chain visualization. ASMPKS operates on a web interface to construct the database and to analyze PKSs, allowing polyketide researchers to add their data to this database and to use it easily. In addition, the ASMPKS can predict functional modules for a protein sequence submitted by users, estimate the chemical composition of a polyketide synthesized from the modules, and display the carbon chain structure on the web interface. Conclusion ASMPKS has powerful computation features to aid modular PKS research. As various factors, such as starter units and post-processing, are related to polyketide biosynthesis, ASMPKS will be improved through further development for study of the factors.

  2. Extending quantum mechanics entails extending special relativity

    International Nuclear Information System (INIS)

    Aravinda, S; Srikanth, R

    2016-01-01

    The complementarity between signaling and randomness in any communicated resource that can simulate singlet statistics is generalized by relaxing the assumption of free will in the choice of measurement settings. We show how to construct an ontological extension for quantum mechanics (QMs) through the oblivious embedding of a sound simulation protocol in a Newtonian spacetime. Minkowski or other intermediate spacetimes are ruled out as the locus of the embedding by virtue of hidden influence inequalities. The complementarity transferred from a simulation to the extension unifies a number of results about quantum non-locality, and implies that special relativity has a different significance for the ontological model and for the operational theory it reproduces. Only the latter, being experimentally accessible, is required to be Lorentz covariant. There may be certain Lorentz non-covariant elements at the ontological level, but they will be inaccessible at the operational level in a valid extension. Certain arguments against the extendability of QM, due to Conway and Kochen (2009) and Colbeck and Renner (2012), are attributed to their assumption that the spacetime at the ontological level has Minkowski causal structure. (paper)

  3. Acetolactate Synthase Activity in Developing Maize (Zea mays L.) Kernels

    Science.gov (United States)

    Muhitch, Michael J.

    1988-01-01

    Acetolactate synthase (EC 4.1.3.18) activity was examined in maize (Zea mays L.) endosperm and embryos as a function of kernel development. When assayed using unpurified homogenates, embryo acetolactate synthase activity appeared less sensitive to inhibition by leucine + valine and by the imidazolinone herbicide imazapyr than endosperm acetolactate synthase activity. Evidence is presented to show that pyruvate decarboxylase contributes to apparent acetolactate synthase activity in crude embryo extracts and a modification of the acetolactate synthase assay is proposed to correct for the presence of pyruvate decarboxylase in unpurified plant homogenates. Endosperm acetolactate synthase activity increased rapidly during early kernel development, reaching a maximum of 3 micromoles acetoin per hour per endosperm at 25 days after pollination. In contrast, embryo activity was low in young kernels and steadily increased throughout development to a maximum activity of 0.24 micromole per hour per embryo by 45 days after pollination. The sensitivity of both endosperm and embryo acetolactate synthase activities to feedback inhibition by leucine + valine did not change during kernel development. The results are compared to those found for other enzymes of nitrogen metabolism and discussed with respect to the potential roles of the embryo and endosperm in providing amino acids for storage protein synthesis. PMID:16665871

  4. An Extended Duopoly Game.

    Science.gov (United States)

    Eckalbar, John C.

    2002-01-01

    Illustrates how principles and intermediate microeconomic students can gain an understanding for strategic price setting by playing a relatively large oligopoly game. Explains that the game extends to a continuous price space and outlines appropriate applications. Offers the Mathematica code to instructors so that the assumptions of the game can…

  5. Extending Critical Performativity

    DEFF Research Database (Denmark)

    Spicer, André; Alvesson, Mats; Kärreman, Dan

    2016-01-01

    from an undue focus on intra-academic debates; engage in author-itarian theoretical policing; feign relevance through symbolic radicalism; and repackage common sense. We take these critiques as an opportunity to offer an extended model of critical performativity that involves focusing on issues...

  6. Parameterization of extended systems

    DEFF Research Database (Denmark)

    Niemann, Hans Henrik

    2006-01-01

    The YJBK parameterization (of all stabilizing controllers) is extended to handle systems with additional sensors and/or actuators. It is shown that the closed loop transfer function is still an affine function in the YJBK parameters in the nominal case. Further, some closed-loop stability results...

  7. Poster Session- Extended Abstracts

    Science.gov (United States)

    Jack D. Alexander III; Jean Findley; Brenda K. Kury; Jan L. Beyers; Douglas S. Cram; Terrell T. Baker; Jon C. Boren; Carl Edminster; Sue A. Ferguson; Steven McKay; David Nagel; Trent Piepho; Miriam Rorig; Casey Anderson; Jeanne Hoadley; Paulette L. Ford; Mark C. Andersen; Ed L. Fredrickson; Joe Truett; Gary W. Roemer; Brenda K. Kury; Jennifer Vollmer; Christine L. May; Danny C. Lee; James P. Menakis; Robert E. Keane; Zhi-Liang Zhu; Carol Miller; Brett Davis; Katharine Gray; Ken Mix; William P. Kuvlesky Jr.; D. Lynn Drawe; Marcia G. Narog; Roger D. Ottmar; Robert E. Vihnanek; Clinton S. Wright; Timothy E. Paysen; Burton K. Pendleton; Rosemary L. Pendleton; Carleton S. White; John Rogan; Doug Stow; Janet Franklin; Jennifer Miller; Lisa Levien; Chris Fischer; Emma Underwood; Robert Klinger; Peggy Moore; Clinton S. Wright

    2008-01-01

    Titles found within Poster Session-Extended Abstracts include:Assessment of emergency fire rehabilitation of four fires from the 2000 fire season on the Vale, Oregon, BLM district: review of the density sampling materials and methods: p. 329 Growth of regreen, seeded for erosion control, in the...

  8. Human hematopoietic prostaglandin D synthase inhibitor complex structures.

    Science.gov (United States)

    Kado, Yuji; Aritake, Kosuke; Uodome, Nobuko; Okano, Yousuke; Okazaki, Nobuo; Matsumura, Hiroyoshi; Urade, Yoshihiro; Inoue, Tsuyoshi

    2012-04-01

    In mast and Th2 cells, hematopoietic prostaglandin (PG) D synthase (H-PGDS) catalyses the isomerization of PGH(2) in the presence of glutathione (GSH) to produce the allergic and inflammatory mediator PGD(2). We determined the X-ray structures of human H-PGDS inhibitor complexes with 1-amino-4-{4-[4-chloro-6-(2-sulpho-phenylamino)-[1,3,5]triazin-2-ylmethyl]-3-sulpho-phenylamino}-9,10-dioxo-9,10-dihydro-anthracene-2-sulphonic acid (Cibacron Blue) and 1-amino-4-(4-aminosulphonyl) phenyl-anthraquinone-2-sulphonic acid (APAS) at 2.0 Å resolution. When complexed with H-PGDS, Cibacron Blue had an IC(50) value of 40 nM and APAS 2.1 μM. The Cibacron Blue molecule was stabilized by four hydrogen bonds and π-π stacking between the anthraquinone ring and Trp104, the ceiling of the active site H-PGDS pocket. Among the four hydrogen bonds, the Cibacron Blue terminal sulphonic group directly interacted with conserved residues Lys112 and Lys198, which recognize the PGH(2) substrate α-chain. In contrast, the APAS anthraquinone ring was inverted to interact with Trp104, while its benzenesulphonic group penetrated the GSH-bound region at the bottom of the active site. Due to the lack of extended aromatic rings, APAS could not directly hydrogen bond with the two conserved lysine residues, thus decreasing the total number of hydrogen bond from four to one. These factors may contribute to the 50-fold difference in the IC(50) values obtained for the two inhibitors.

  9. Functional and evolutionary relationships between terpene synthases from Australian Myrtaceae.

    Science.gov (United States)

    Keszei, Andras; Brubaker, Curt L; Carter, Richard; Köllner, Tobias; Degenhardt, Jörg; Foley, William J

    2010-06-01

    Myrtaceae is one of the chemically most variable and most significant essential oil yielding plant families. Despite an abundance of chemical information, very little work has focussed on the biochemistry of terpene production in these plants. We describe 70 unique partial terpene synthase transcripts and eight full-length cDNA clones from 21 myrtaceous species, and compare phylogenetic relationships and leaf oil composition to reveal clades defined by common function. We provide further support for the correlation between function and phylogenetic relationships by the first functional characterisation of terpene synthases from Myrtaceae: a 1,8-cineole synthase from Eucalyptus sideroxylon and a caryophyllene synthase from Eucalyptusdives. Copyright 2010 Elsevier Ltd. All rights reserved.

  10. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  11. A Therapeutic Connection between Dietary Phytochemicals and ATP Synthase.

    Science.gov (United States)

    Ahmad, Zulfiqar; Hassan, Sherif S; Azim, Sofiya

    2017-11-20

    For centuries, phytochemicals have been used to prevent and cure multiple health ailments. Phytochemicals have been reported to have antioxidant, antidiabetic, antitussive, antiparasitic, anticancer, and antimicrobial properties. Generally, the therapeutic use of phytochemicals is based on tradition or word of mouth with few evidence-based studies. Moreover, molecular level interactions or molecular targets for the majority of phytochemicals are unknown. In recent years, antibiotic resistance by microbes has become a major healthcare concern. As such, the use of phytochemicals with antimicrobial properties has become pertinent. Natural compounds from plants, vegetables, herbs, and spices with strong antimicrobial properties present an excellent opportunity for preventing and combating antibiotic resistant microbial infections. ATP synthase is the fundamental means of cellular energy. Inhibition of ATP synthase may deprive cells of required energy leading to cell death, and a variety of dietary phytochemicals are known to inhibit ATP synthase. Structural modifications of phytochemicals have been shown to increase the inhibitory potency and extent of inhibition. Sitedirected mutagenic analysis has elucidated the binding site(s) for some phytochemicals on ATP synthase. Amino acid variations in and around the phytochemical binding sites can result in selective binding and inhibition of microbial ATP synthase. In this review, the therapeutic connection between dietary phytochemicals and ATP synthase is summarized based on the inhibition of ATP synthase by dietary phytochemicals. Research suggests selective targeting of ATP synthase is a valuable alternative molecular level approach to combat antibiotic resistant microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Engineering fatty acid synthases for directed polyketide production.

    Science.gov (United States)

    Gajewski, Jan; Buelens, Floris; Serdjukow, Sascha; Janßen, Melanie; Cortina, Niña; Grubmüller, Helmut; Grininger, Martin

    2017-04-01

    In this study, we engineered fatty acid synthases (FAS) for the biosynthesis of short-chain fatty acids and polyketides, guided by a combined in vitro and in silico approach. Along with exploring the synthetic capability of FAS, we aim to build a foundation for efficient protein engineering, with the specific goal of harnessing evolutionarily related megadalton-scale polyketide synthases (PKS) for the tailored production of bioactive natural compounds.

  13. Regulation of CDP-diacylglycerol synthase activity in Saccharomyces cerevisiae.

    OpenAIRE

    Homann, M J; Henry, S A; Carman, G M

    1985-01-01

    The addition of ethanolamine or choline to inositol-containing growth medium resulted in a reduction of CTP:phosphatidate cytidylyltransferase (CDP-diacylglycerol synthase; EC 2.7.7.41) activity in Saccharomyces cerevisiae. The reduction of activity did not occur in the absence of inositol. CDP-diacylglycerol synthase activity was not regulated in a S. cerevisiae mutant strain (opi1; an inositol biosynthesis regulatory mutant) by the addition of phospholipid precursors to the growth medium.

  14. Understanding plant cellulose synthases through a comprehensive investigation of the cellulose synthase family sequences.

    Directory of Open Access Journals (Sweden)

    Andrew eCarroll

    2011-03-01

    Full Text Available The development of cellulose as an organizing structure in the plant cell wall was a key event in both the initial colonization and the subsequent domination of the terrestrial ecosystem by vascular plants. A wealth of experimental data has demonstrated the complicated genetic interactions required to form the large synthetic complex that synthesizes cellulose. However, these results are lacking an extensive analysis of the evolution, specialization, and regulation of the proteins that compose this complex. Here we perform an in-depth analysis of the sequences in the cellulose synthase (CesA family. We investigate the phylogeny of the CesA family, with emphasis on evolutionary specialization. We define specialized subfamilies and identify the class-specific regions within the CesA sequence that may explain this specialization. We investigate changes in regulation of CesAs by looking at the conservation of proposed phosphorylation sites. We investigate the conservation of sites where mutations have been documented that impair cellulose synthase function, and compare these sites to those observed in the closest cellulose synthase-like (Csl families to better understand what regions may separate the CesAs from other Csls. Finally we identify two positions with strong conservation of the aromatic trait, but lacking conservation of amino acid identity, which may represent residues important for positioning the sugar substrate for catalysis. These analyses provide useful tools for understanding characterized mutations and post-translational modifications, and for informing further experiments to probe CesA assembly, regulation, and function through site-directed mutagenesis or domain swapping experiments.

  15. Extended Irreversible Thermodynamics

    CERN Document Server

    Jou, David

    2010-01-01

    This is the 4th edition of the highly acclaimed monograph on Extended Irreversible Thermodynamics, a theory that goes beyond the classical theory of irreversible processes. In contrast to the classical approach, the basic variables describing the system are complemented by non-equilibrium quantities. The claims made for extended thermodynamics are confirmed by the kinetic theory of gases and statistical mechanics. The book covers a wide spectrum of applications, and also contains a thorough discussion of the foundations and the scope of the current theories on non-equilibrium thermodynamics. For this new edition, the authors critically revised existing material while taking into account the most recent developments in fast moving fields such as heat transport in micro- and nanosystems or fast solidification fronts in materials sciences. Several fundamental chapters have been revisited emphasizing physics and applications over mathematical derivations. Also, fundamental questions on the definition of non-equil...

  16. Homocystinuria due to cystathionine beta synthase deficiency

    Directory of Open Access Journals (Sweden)

    Rao T

    2008-01-01

    Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

  17. Undecaprenyl diphosphate synthase inhibitors: antibacterial drug leads.

    Science.gov (United States)

    Sinko, William; Wang, Yang; Zhu, Wei; Zhang, Yonghui; Feixas, Ferran; Cox, Courtney L; Mitchell, Douglas A; Oldfield, Eric; McCammon, J Andrew

    2014-07-10

    There is a significant need for new antibiotics due to the rise in drug resistance. Drugs such as methicillin and vancomycin target bacterial cell wall biosynthesis, but methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococci (VRE) have now arisen and are of major concern. Inhibitors acting on new targets in cell wall biosynthesis are thus of particular interest since they might also restore sensitivity to existing drugs, and the cis-prenyl transferase undecaprenyl diphosphate synthase (UPPS), essential for lipid I, lipid II, and thus, peptidoglycan biosynthesis, is one such target. We used 12 UPPS crystal structures to validate virtual screening models and then assayed 100 virtual hits (from 450,000 compounds) against UPPS from S. aureus and Escherichia coli. The most promising inhibitors (IC50 ∼2 μM, Ki ∼300 nM) had activity against MRSA, Listeria monocytogenes, Bacillus anthracis, and a vancomycin-resistant Enterococcus sp. with MIC or IC50 values in the 0.25-4 μg/mL range. Moreover, one compound (1), a rhodanine with close structural similarity to the commercial diabetes drug epalrestat, exhibited good activity as well as a fractional inhibitory concentration index (FICI) of 0.1 with methicillin against the community-acquired MRSA USA300 strain, indicating strong synergism.

  18. The dialogically extended mind

    DEFF Research Database (Denmark)

    Fusaroli, Riccardo; Gangopadhyay, Nivedita; Tylén, Kristian

    2014-01-01

    , we argue that language enhances our cognitive capabilities in a much more radical way: The skilful engagement of public material symbols facilitates evolutionarily unprecedented modes of collective perception, action and reasoning (interpersonal synergies) creating dialogically extended minds. We...... relate our approach to other ideas about collective minds and review a number of empirical studies to identify the mechanisms enabling the constitution of interpersonal cognitive systems....

  19. Extended quantum mechanics

    International Nuclear Information System (INIS)

    Pavel Bona

    2000-01-01

    The work can be considered as an essay on mathematical and conceptual structure of nonrelativistic quantum mechanics which is related here to some other (more general, but also to more special and 'approximative') theories. Quantum mechanics is here primarily reformulated in an equivalent form of a Poisson system on the phase space consisting of density matrices, where the 'observables', as well as 'symmetry generators' are represented by a specific type of real valued (densely defined) functions, namely the usual quantum expectations of corresponding selfjoint operators. It is shown in this paper that inclusion of additional ('nonlinear') symmetry generators (i. e. 'Hamiltonians') into this reformulation of (linear) quantum mechanics leads to a considerable extension of the theory: two kinds of quantum 'mixed states' should be distinguished, and operator - valued functions of density matrices should be used in the role of 'nonlinear observables'. A general framework for physical theories is obtained in this way: By different choices of the sets of 'nonlinear observables' we obtain, as special cases, e.g. classical mechanics on homogeneous spaces of kinematical symmetry groups, standard (linear) quantum mechanics, or nonlinear extensions of quantum mechanics; also various 'quasiclassical approximations' to quantum mechanics are all sub theories of the presented extension of quantum mechanics - a version of the extended quantum mechanics. A general interpretation scheme of extended quantum mechanics extending the usual statistical interpretation of quantum mechanics is also proposed. Eventually, extended quantum mechanics is shown to be (included into) a C * -algebraic (hence linear) quantum theory. Mathematical formulation of these theories is presented. The presentation includes an analysis of problems connected with differentiation on infinite-dimensional manifolds, as well as a solution of some problems connected with the work with only densely defined unbounded

  20. Nitric oxide synthase in ferret brain: localization and characterization.

    Science.gov (United States)

    Matsumoto, T.; Mitchell, J. A.; Schmidt, H. H.; Kohlhaas, K. L.; Warner, T. D.; Förstermann, U.; Murad, F.

    1992-01-01

    1. In the present study, we have investigated the distribution of nitric oxide synthase in the ferret brain. Nitric oxide synthase was determined biochemically and immunochemically. 2. In the rat brain, the highest nitric oxide synthase activity has been detected in the cerebellum. However, in the ferret brain, the highest activity was found in the striatum and the lowest in the cerebellum and cerebral cortex. The enzymatic activity was localized predominantly in the cytosolic fractions, it was dependent on NADPH and Ca2+, and inhibited by NG-nitro-L-arginine or NG-methyl-L-arginine. 3. Western blot analysis revealed that all regions of the ferret brain contained a 160 kD protein crossreacting with an antibody to nitric oxide synthase purified from the rat cerebellum, and the levels of relative intensity of staining by the antibody correlated with the distribution of nitric oxide synthase activity. 4. These results indicate that the ferret brain contains a nitric oxide synthase similar to the rat brain, but the distribution of enzymatic activity in the ferret brain differs markedly from the rat brain. Images Figure 1 PMID:1282076

  1. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Multiclonal Outbreak of Klebsiella pneumoniae Producing Extended-Spectrum β-Lactamase CTX-M-2 and Novel Variant CTX-M-59 in a Neonatal Intensive Care Unit in Brazil▿

    Science.gov (United States)

    de Oliveira Garcia, Doroti; Doi, Yohei; Szabo, Dora; Adams-Haduch, Jennifer M.; Vaz, Tânia M. I.; Leite, Daniela; Padoveze, Maria Clara; Freire, Maristela P.; Silveira, Fernanda P.; Paterson, David L.

    2008-01-01

    An outbreak of cephalosporin-resistant Klebsiella pneumoniae occurred in a neonatal intensive care unit in São Paulo, Brazil. Of the 10 pulsotypes identified during the outbreak and follow-up periods, nine produced CTX-M-2 or its new variant CTX-M-59 and one produced SHV-5. blaCTX-M-2/59 genes were located on closely related plasmids that were transferable. PMID:18347108

  3. Extended Testability Analysis Tool

    Science.gov (United States)

    Melcher, Kevin; Maul, William A.; Fulton, Christopher

    2012-01-01

    The Extended Testability Analysis (ETA) Tool is a software application that supports fault management (FM) by performing testability analyses on the fault propagation model of a given system. Fault management includes the prevention of faults through robust design margins and quality assurance methods, or the mitigation of system failures. Fault management requires an understanding of the system design and operation, potential failure mechanisms within the system, and the propagation of those potential failures through the system. The purpose of the ETA Tool software is to process the testability analysis results from a commercial software program called TEAMS Designer in order to provide a detailed set of diagnostic assessment reports. The ETA Tool is a command-line process with several user-selectable report output options. The ETA Tool also extends the COTS testability analysis and enables variation studies with sensor sensitivity impacts on system diagnostics and component isolation using a single testability output. The ETA Tool can also provide extended analyses from a single set of testability output files. The following analysis reports are available to the user: (1) the Detectability Report provides a breakdown of how each tested failure mode was detected, (2) the Test Utilization Report identifies all the failure modes that each test detects, (3) the Failure Mode Isolation Report demonstrates the system s ability to discriminate between failure modes, (4) the Component Isolation Report demonstrates the system s ability to discriminate between failure modes relative to the components containing the failure modes, (5) the Sensor Sensor Sensitivity Analysis Report shows the diagnostic impact due to loss of sensor information, and (6) the Effect Mapping Report identifies failure modes that result in specified system-level effects.

  4. Classical extended superconformal symmetries

    International Nuclear Information System (INIS)

    Viswanathan, R.R.

    1990-10-01

    Super-covariant differential operators are defined in two dimensions which map supersymmetry doublets to other doublets. The possibility of constructing a closed algebra among the fields appearing in such operators is explored. Such an algebra exists for Grassmann-odd differential operators. A representation for these operators in terms of free-field doublets is constructed. An explicit closed algebra involving fields of spin 2 and 5/2, in addition to the stress tensor and the supersymmetry generator, is constructed from such a free-field representation as an example of a non-linear extended superconformal algebra. (author). 9 refs

  5. Cellulose synthase complex organization and cellulose microfibril structure.

    Science.gov (United States)

    Turner, Simon; Kumar, Manoj

    2018-02-13

    Cellulose consists of linear chains of β-1,4-linked glucose units, which are synthesized by the cellulose synthase complex (CSC). In plants, these chains associate in an ordered manner to form the cellulose microfibrils. Both the CSC and the local environment in which the individual chains coalesce to form the cellulose microfibril determine the structure and the unique physical properties of the microfibril. There are several recent reviews that cover many aspects of cellulose biosynthesis, which include trafficking of the complex to the plasma membrane and the relationship between the movement of the CSC and the underlying cortical microtubules (Bringmann et al. 2012 Trends Plant Sci. 17 , 666-674 (doi:10.1016/j.tplants.2012.06.003); Kumar & Turner 2015 Phytochemistry 112 , 91-99 (doi:10.1016/j.phytochem.2014.07.009); Schneider et al. 2016 Curr. Opin. Plant Biol. 34 , 9-16 (doi:10.1016/j.pbi.2016.07.007)). In this review, we will focus on recent advances in cellulose biosynthesis in plants, with an emphasis on our current understanding of the structure of individual catalytic subunits together with the local membrane environment where cellulose synthesis occurs. We will attempt to relate this information to our current knowledge of the structure of the cellulose microfibril and propose a model in which variations in the structure of the CSC have important implications for the structure of the cellulose microfibril produced.This article is part of a discussion meeting issue 'New horizons for cellulose nanotechnology'. © 2017 The Author(s).

  6. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Distinct Structural Elements Dictate the Specificity of the Type III Pentaketide Synthase from Neurospora crassa

    Energy Technology Data Exchange (ETDEWEB)

    Rubin-Pitel, Sheryl B.; Zhang, Houjin; Vu, Trang; Brunzelle, Joseph S.; Zhao, Huimin; Nair, Satish K. (UIUC); (NWU)

    2009-01-15

    The fungal type III polyketide synthase 2'-oxoalkylresorcyclic acid synthase (ORAS) primes with a range of acyl-Coenzyme A thioesters (C{sub 4}--C{sub 20}) and extends using malonyl-Coenzyme A to produce pyrones, resorcinols, and resorcylic acids. To gain insight into this unusual substrate specificity and product profile, we have determined the crystal structures of ORAS to 1.75 {angstrom} resolution, the Phe-252{yields}Gly site-directed mutant to 2.1 {angstrom} resolution, and a binary conplex of ORAS with eicosanoic acid to 2.0 {angstrom} resolution. The structures reveal a distinct rearrangement of structural elements near the active site that allows accomodation of long-chain fatty acid esters and a reorientation of the gating mechanism that controls cyclization and polyketide chain length. The roles of these structural elements are further elucidated by characterization of various structure-based site-directed variants. These studies establish an unexpected plasticity to the PKS fold, unanticipated from structural studies of other members of this enzyme family.

  8. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  9. Lunar Prospector Extended Mission

    Science.gov (United States)

    Folta, David; Beckman, Mark; Lozier, David; Galal, Ken

    1999-01-01

    The National Aeronautics and Space Administration (NASA) selected Lunar Prospector (LP) as one of the discovery missions to conduct solar system exploration science investigations. The mission is NASA's first lunar voyage to investigate key science objectives since Apollo and was launched in January 1998. In keeping with discovery program requirements to reduce total mission cost and utilize new technology, Lunar Prospector's mission design and control focused on the use of innovative and proven trajectory analysis programs. As part of this effort, the Ames Research Center and the Goddard Space Flight Center have become partners in the Lunar Prospector trajectory team to provide the trajectory analysis, maneuver planning, orbit determination support, and product generation. At the end of 1998, Lunar Prospector completed its one-year primary mission at 100 km altitude above the lunar surface. On December 19, 1998, Lunar Prospector entered the extended mission phase. Initially the mission orbit was lowered from 100 km to a mean altitude of 40 km. The altitude of Lunar Prospector varied between 25 and 55 km above the mean lunar geode due to lunar potential effects. After one month, the lunar potential model was updated based upon the new tracking data at 40 km. On January 29, 1999, the altitude was lowered again to a mean altitude of 30 km. This altitude varies between 12 and 48 km above the mean lunar geode. Since the minimum altitude is very close to the mean geode, various approaches were employed to get accurate lunar surface elevation including Clementine altimetry and line of sight analysis. Based upon the best available terrain maps, Lunar Prospector will reach altitudes of 8 km above lunar mountains in the southern polar and far side regions. This extended mission phase of six months will enable LP to obtain science data up to 3 orders of magnitude better than at the mission orbit. This paper details the trajectory design and orbit determination planning and

  10. Crystallization, preliminary X-ray diffraction and structure solution of MosA, a dihydrodipicolinate synthase from Sinorhizobium meliloti L5-30

    International Nuclear Information System (INIS)

    Leduc, Yvonne A.; Phenix, Christopher P.; Puttick, Jennifer; Nienaber, Kurt; Palmer, David R. J.; Delbaere, Louis T. J.

    2005-01-01

    MosA from S. meliloti L5-30 has been crystallized in solution with pyruvate and the 2.3 Å resolution structure has been solved by molecular replacement using E. coli dihydrodipicolinate synthase as the model. The structure of MosA, a dihydrodipicolinate synthase and reported methyltransferase from Sinorhizobium meliloti, has been solved using molecular replacement with Escherichia coli dihydrodipicolinate synthase as the model. A crystal grown in the presence of pyruvate diffracted X-rays to 2.3 Å resolution using synchrotron radiation and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 69.14, b = 138.87, c = 124.13 Å

  11. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance.

    Science.gov (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg

    2014-08-22

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Extended Power Up-rates

    International Nuclear Information System (INIS)

    Jon Ball

    2006-01-01

    Full text of publication follows: Nuclear energy is a reliable and cost-competitive global source of power. With rising oil and gas prices, nuclear continues to provide economic and environmental benefits. Extended Power Up-rate (EPU) provides a means for existing nuclear assets to generate increased power and substantially reduce electrical generation costs. GE Energy's Nuclear Business is the global leader in boiling water reactor (BWR) technology. The experience-base of plants that have successfully achieved EPU includes Spain, Switzerland, Sweden, Germany and the United States. The GE experience-base includes fourteen BWRs with over fifty-eight reactor-years of operating experience at EPU conditions. Other than the expected plant modifications needed to accommodate higher steam flows, flow-induced vibration (FIV) has been identified as the major area of concern when up-rating. Two plants have experienced damage to their steam dryers that has lead to an extensive program to improve the understanding of the effects of up-rates. This program includes extensive in-plant data collection, the development of a scale model test facility to study components susceptible to FIV and improvements in analytical techniques for evaluating loading on reactor internals. As global energy demands increase, oil and gas prices escalate, and environmental concerns over greenhouse effects challenge us to find environmentally friendly sources of energy, Nuclear is the most viable and economical source of power in the world. With a focused effort on plant reliability, existing plants can undergo Extended Power Up-rate, and continue to meet the ever-increasing energy demands in the world. (author)

  13. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  14. A Comparative Analysis of Acyl-Homoserine Lactone Synthase Assays.

    Science.gov (United States)

    Shin, Daniel; Frane, Nicole D; Brecht, Ryan M; Keeler, Jesse; Nagarajan, Rajesh

    2015-12-01

    Quorum sensing is cell-to-cell communication that allows bacteria to coordinate attacks on their hosts by inducing virulent gene expression, biofilm production, and other cellular functions, including antibiotic resistance. AHL synthase enzymes synthesize N-acyl-l-homoserine lactones, commonly referred to as autoinducers, to facilitate quorum sensing in Gram-negative bacteria. Studying the synthases, however, has proven to be a difficult road. Two assays, including a radiolabeled assay and a colorimetric (DCPIP) assay are well-documented in literature to study AHL synthases. In this paper, we describe additional methods that include an HPLC-based, C-S bond cleavage and coupled assays to investigate this class of enzymes. In addition, we compare and contrast each assay for both acyl-CoA- and acyl-ACP-utilizing synthases. The expanded toolkit described in this study should facilitate mechanistic studies on quorum sensing signal synthases and expedite discovery of antivirulent compounds. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Heterologous expression of an active chitin synthase from Rhizopus oryzae.

    Science.gov (United States)

    Salgado-Lugo, Holjes; Sánchez-Arreguín, Alejandro; Ruiz-Herrera, José

    2016-12-01

    Chitin synthases are highly important enzymes in nature, where they synthesize structural components in species belonging to different eukaryotic kingdoms, including kingdom Fungi. Unfortunately, their structure and the molecular mechanism of synthesis of their microfibrilar product remain largely unknown, probably because no fungal active chitin synthases have been isolated, possibly due to their extreme hydrophobicity. In this study we have turned to the heterologous expression of the transcript from a small chitin synthase of Rhizopus oryzae (RO3G_00942, Chs1) in Escherichia coli. The enzyme was active, but accumulated mostly in inclusion bodies. High concentrations of arginine or urea solubilized the enzyme, but their dilution led to its denaturation and precipitation. Nevertheless, use of urea permitted the purification of small amounts of the enzyme. The properties of Chs1 (Km, optimum temperature and pH, effect of GlcNAc) were abnormal, probably because it lacks the hydrophobic transmembrane regions characteristic of chitin synthases. The product of the enzyme showed that, contrasting with chitin made by membrane-bound Chs's and chitosomes, was only partially in the form of short microfibrils of low crystallinity. This approach may lead to future developments to obtain active chitin synthases that permit understanding their molecular mechanism of activity, and microfibril assembly. Copyright © 2016. Published by Elsevier Inc.

  16. Extended biorthogonal matrix polynomials

    Directory of Open Access Journals (Sweden)

    Ayman Shehata

    2017-01-01

    Full Text Available The pair of biorthogonal matrix polynomials for commutative matrices were first introduced by Varma and Tasdelen in [22]. The main aim of this paper is to extend the properties of the pair of biorthogonal matrix polynomials of Varma and Tasdelen and certain generating matrix functions, finite series, some matrix recurrence relations, several important properties of matrix differential recurrence relations, biorthogonality relations and matrix differential equation for the pair of biorthogonal matrix polynomials J(A,B n (x, k and K(A,B n (x, k are discussed. For the matrix polynomials J(A,B n (x, k, various families of bilinear and bilateral generating matrix functions are constructed in the sequel.

  17. Extending rational maps

    Science.gov (United States)

    Martin, Gaven J.

    We investigate when a rational endomorphism of the Riemann sphere overline{C} extends to a mapping of the upper half-space {H3 which is rational with respect to some measurable conformal structure. Such an extension has the property that it and all its iterates have uniformly bounded distortion. Such maps are called uniformly quasiregular. We show that, in the space of rational mappings of degree d , such an extension is possible in the structurally stable component where there is a single (attracting) component of the Fatou set and the Julia set is a Cantor set. We show that generally outside of this set no such extension is possible. In particular, polynomials can never admit such an extension.

  18. Extending juvenility in grasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaeppler, Shawn; de Leon Gatti, Natalia; Foerster, Jillian

    2017-04-11

    The present invention relates to compositions and methods for modulating the juvenile to adult developmental growth transition in plants, such as grasses (e.g. maize). In particular, the invention provides methods for enhancing agronomic properties in plants by modulating expression of GRMZM2G362718, GRMZM2G096016, or homologs thereof. Modulation of expression of one or more additional genes which affect juvenile to adult developmental growth transition such as Glossy15 or Cg1, in conjunction with such modulation of expression is also contemplated. Nucleic acid constructs for down-regulation of GRMZM2G362718 and/or GRMZM2G096016 are also contemplated, as are transgenic plants and products produced there from, that demonstrate altered, such as extended juvenile growth, and display associated phenotypes such as enhanced yield, improved digestibility, and increased disease resistance. Plants described herein may be used, for example, as improved forage or feed crops or in biofuel production.

  19. Extended Poisson Exponential Distribution

    Directory of Open Access Journals (Sweden)

    Anum Fatima

    2015-09-01

    Full Text Available A new mixture of Modified Exponential (ME and Poisson distribution has been introduced in this paper. Taking the Maximum of Modified Exponential random variable when the sample size follows a zero truncated Poisson distribution we have derived the new distribution, named as Extended Poisson Exponential distribution. This distribution possesses increasing and decreasing failure rates. The Poisson-Exponential, Modified Exponential and Exponential distributions are special cases of this distribution. We have also investigated some mathematical properties of the distribution along with Information entropies and Order statistics of the distribution. The estimation of parameters has been obtained using the Maximum Likelihood Estimation procedure. Finally we have illustrated a real data application of our distribution.

  20. Extending over time

    DEFF Research Database (Denmark)

    Christensen, Tanya Karoli; Jensen, Torben Juel; Christensen, Marie Herget

    Studies of general extenders (GEs), such as Eng. and stuff like that, or something, typically find that it is a feature of youth speech, sometimes correlated with sex and class (e.g. Dubois 1992, Stubbe and Holmes 1995, Cheshire 2007, Tagliamonte and Denis 2010, Pichler and Levey 2011), but only...... including pronoun headed phrases, e.g. og (alt) det der ‘and (all) that there’, and clausal variants, e.g. og jeg ved ikke hvad ‘and I don’t know what’. The results indicate that Danish GEs in general are already gram-maticalized to a large extent. Regarding social factors, our data support the general...... finding that GEs are more frequent in youth speech. Adolescents have the highest relative frequency of GEs, and speakers tend to decrease their GE use during their life span, whilst participating in community changes regarding the use of the different GE types. Furthermore, the results suggest...

  1. Biochemistry and Crystal Structure of Ectoine Synthase: A Metal-Containing Member of the Cupin Superfamily.

    Directory of Open Access Journals (Sweden)

    Nils Widderich

    Full Text Available Ectoine is a compatible solute and chemical chaperone widely used by members of the Bacteria and a few Archaea to fend-off the detrimental effects of high external osmolarity on cellular physiology and growth. Ectoine synthase (EctC catalyzes the last step in ectoine production and mediates the ring closure of the substrate N-gamma-acetyl-L-2,4-diaminobutyric acid through a water elimination reaction. However, the crystal structure of ectoine synthase is not known and a clear understanding of how its fold contributes to enzyme activity is thus lacking. Using the ectoine synthase from the cold-adapted marine bacterium Sphingopyxis alaskensis (Sa, we report here both a detailed biochemical characterization of the EctC enzyme and the high-resolution crystal structure of its apo-form. Structural analysis classified the (SaEctC protein as a member of the cupin superfamily. EctC forms a dimer with a head-to-tail arrangement, both in solution and in the crystal structure. The interface of the dimer assembly is shaped through backbone-contacts and weak hydrophobic interactions mediated by two beta-sheets within each monomer. We show for the first time that ectoine synthase harbors a catalytically important metal co-factor; metal depletion and reconstitution experiments suggest that EctC is probably an iron-dependent enzyme. We found that EctC not only effectively converts its natural substrate N-gamma-acetyl-L-2,4-diaminobutyric acid into ectoine through a cyclocondensation reaction, but that it can also use the isomer N-alpha-acetyl-L-2,4-diaminobutyric acid as its substrate, albeit with substantially reduced catalytic efficiency. Structure-guided site-directed mutagenesis experiments targeting amino acid residues that are evolutionarily highly conserved among the extended EctC protein family, including those forming the presumptive iron-binding site, were conducted to functionally analyze the properties of the resulting EctC variants. An assessment of

  2. Optical technologies in extended-reach access networks

    DEFF Research Database (Denmark)

    Wong, Elaine; Amaya Fernández, Ferney Orlando; Tafur Monroy, Idelfonso

    2009-01-01

    The merging of access and metro networks has been proposed as a solution to lower the unit cost of customer bandwidth. This paper reviews some of the recent advances and challenges in extended-reach optical access networks....

  3. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    International Nuclear Information System (INIS)

    Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi

    2008-01-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1

  4. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota, E-mail: kuroki.ryota@jaea.go.jp [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)

    2008-03-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.

  5. Market Diffusion of Extended Cycle Hormonal Contraceptives

    Directory of Open Access Journals (Sweden)

    Megen Leeds Schumacher

    2012-01-01

    Full Text Available Background: Extended cycle hormonal contraceptives (e.g. Seasonale, Seasonique when introduced in 2003 were considered a very novel approach to contraception. The idea of manipulating the menstrual cycle so that women would experience just four menstruations a year was radical and was assumed to be responsible for the slow acceptance rate among the general public. Objective: This report analyzes two different aspects of the acceptance of this unique idea in the population. The first was the level of usage of extended cycle hormonal contraceptives in the general population, which was measured by a review of sales figures over time in the United States. The second was an examination of market diffusion as it relates to consumer perceptions regarding the characteristics of these products. Methods: To determine the degree of usage of extended cycle hormonal contraceptives the yearly sales, in terms of units sold, were compared with that of other leading methods of hormonal contraception. Along with the data, survey answers were obtained from 65 women who volunteered to participate in the study. Participants were selected randomly to represent the target population to assess the level of awareness about the benefits, risks, and any other concerns regarding the use of extended cycle hormonal contraceptives. Results: The yearly sales data of units sold showed a definitive increase in the sales of extended cycle hormonal contraceptives since their release on the market. The survey results showed an overwhelming awareness in the study population about the extended regimen. However, only about half of the women in the survey group were aware of its benefits. The main concern reported was the perceived significant side effect profile. Conclusion: Though awareness about the extended cycle hormonal contraception regimen was widespread, the survey population was not well informed about the advantages and the disadvantages regarding the degree of severity of

  6. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Science.gov (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  7. Understanding Plant Cellulose Synthases through a Comprehensive Investigation of the Cellulose Synthase Family Sequences.

    Science.gov (United States)

    Carroll, Andrew; Specht, Chelsea D

    2011-01-01

    The development of cellulose as an organizing structure in the plant cell wall was a key event in both the initial colonization and the subsequent domination of the terrestrial ecosystem by vascular plants. A wealth of experimental data has demonstrated the complicated genetic interactions required to form the large synthetic complex that synthesizes cellulose. However, these results are lacking an extensive analysis of the evolution, specialization, and regulation of the proteins that compose this complex. Here we perform an in-depth analysis of the sequences in the cellulose synthase (CesA) family. We investigate the phylogeny of the CesA family, with emphasis on evolutionary specialization. We define specialized clades and identify the class-specific regions within the CesA sequence that may explain this specialization. We investigate changes in regulation of CesAs by looking at the conservation of proposed phosphorylation sites. We investigate the conservation of sites where mutations have been documented that impair CesA function, and compare these sites to those observed in the closest cellulose synthase-like (Csl) families to better understand what regions may separate the CesAs from other Csls. Finally we identify two positions with strong conservation of the aromatic trait, but lacking conservation of amino acid identity, which may represent residues important for positioning the sugar substrate for catalysis. These analyses provide useful tools for understanding characterized mutations and post-translational modifications, and for informing further experiments to probe CesA assembly, regulation, and function through site-directed mutagenesis or domain swapping experiments.

  8. Evaluation of meat, fruit and vegetables from retail stores in five United Kingdom regions as sources of extended-spectrum beta-lactamase (ESBL)-producing and carbapenem-resistant Escherichia coli.

    Science.gov (United States)

    Randall, L P; Lodge, M P; Elviss, N C; Lemma, F L; Hopkins, K L; Teale, C J; Woodford, N

    2017-01-16

    We determined the prevalence and types of extended-spectrum β-lactamase (ESBL)-producing and carbapenem-resistant Escherichia coli in raw retail beef, chicken, pork, fruit and vegetables in five UK regions in 2013-14. Raw meat (n=397), and fruit and vegetable samples (n=400) were purchased from retail stores in London, East Anglia, North West England, Scotland and Wales. Samples were tested for the presence of ESBL-producing E. coli by plating enriched samples on CHROMagar CTX and CHROMagar ESBL, for AmpC-type E. coli by plating on "CHROMagar FOX" (CHROMagar ECC+16mg/L cefoxitin), and for carbapenem-resistant E. coli by plating on CHROMagar KPC. Additionally, pre-enrichment counts were performed on the above agars, and on CHROMagar ECC. Isolates of interest were characterised by MALDI-ToF to confirm identification, by PCR for bla CIT, bla CTX-M, bla OXA , bla SHV and bla TEM genes; ESBL or bla CIT genes were sequenced. Only 1.9% and 2.5% of beef and pork samples, respectively were positive for ESBL-producing E. coli after enrichment compared with 65.4% of chicken samples. 85.6% positive samples from chicken meat carried bla CTX-M-1 ; bla CTX-M-15 was not detected. None of the fruits or vegetables yielded ESBL-producing E. coli and none of the meat, fruit or vegetable samples yielded carbapenem-resistant E. coli. Retail chicken was more frequently a source of ESBL-producing E. coli than were beef, pork, fruit or vegetables. None of the foodstuffs yielded E. coli with CTX-M-15 ESBL, which dominates in human clinical isolates in the UK, and none yielded carbapenem-resistant E. coli. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  9. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    International Nuclear Information System (INIS)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong

    2006-01-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°

  10. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He, E-mail: liangyh@pku.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, Peking University, Beijing 100871 (China); Department of Biochemistry and Molecular Biology, College of Life Sciences, Peking University, Beijing 100871 (China)

    2006-10-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.

  11. Enzymatic Assays to Investigate Acyl-Homoserine Lactone Autoinducer Synthases.

    Science.gov (United States)

    Shin, Daniel; Nagarajan, Rajesh

    2018-01-01

    Bacteria use chemical molecules called autoinducers as votes to poll their numerical strength in a colony. This polling mechanism, commonly referred to as quorum sensing, enables bacteria to build a social network and provide a collective response for fighting off common threats. In Gram-negative bacteria, AHL synthases synthesize acyl-homoserine lactone (AHL) autoinducers to turn on the expression of several virulent genes including biofilm formation, protease secretion, and toxin production. Therefore, inhibiting AHL signal synthase would limit quorum sensing and virulence. In this chapter, we describe four enzymatic methods that could be adopted to investigate a broad array of AHL synthases. The enzymatic assays described here should accelerate our mechanistic understanding of quorum-sensing signal synthesis that could pave the way for discovery of potent antivirulence compounds.

  12. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  13. Extended genomes: symbiosis and evolution.

    Science.gov (United States)

    Hurst, Gregory D D

    2017-10-06

    Many aspects of an individual's biology derive from its interaction with symbiotic microbes, which further define many aspects of the ecology and evolution of the host species. The centrality of microbes in the function of individual organisms has given rise to the concept of the holobiont-that an individual's biology is best understood as a composite of the 'host organism' and symbionts within. This concept has been further elaborated to posit the holobiont as a unit of selection. In this review, I critically examine whether it is useful to consider holobionts as a unit of selection. I argue that microbial heredity-the direct passage of microbes from parent to offspring-is a key factor determining the degree to which the holobiont can usefully be considered a level of selection. Where direct vertical transmission (VT) is common, microbes form part of extended genomes whose dynamics can be modelled with simple population genetics, but that nevertheless have subtle quantitative distinctions from the classic mutation/selection model for nuclear genes. Without direct VT, the correlation between microbial fitness and host individual fitness erodes, and microbe fitness becomes associated with host survival only (rather than reproduction). Furthermore, turnover of microbes within a host may lessen associations between microbial fitness with host survival, and in polymicrobial communities, microbial fitness may derive largely from the ability to outcompete other microbes, to avoid host immune clearance and to minimize mortality through phage infection. These competing selection pressures make holobiont fitness a very minor consideration in determining symbiont evolution. Nevertheless, the importance of non-heritable microbes in organismal function is undoubted-and as such the evolutionary and ecological processes giving rise to variation and evolution of the microbes within and between host individuals represent a key research area in biology.

  14. Identification and characterization of a chondroitin synthase from Avibacterium paragallinarum.

    Science.gov (United States)

    Wang, Ting-Ting; Zhu, Chen-Ye; Zheng, Shuang; Meng, Cai-Cai; Wang, Tian-Tian; Meng, Dan-Hua; Li, Yi-Jun; Zhu, Hao-Miao; Wang, Feng-Shan; Sheng, Ju-Zheng

    2018-04-03

    Avibacterium paragallinarum is a Gram-negative bacterium that causes infectious coryza in chicken. It was reported that the capsule polysaccharides extracted from Av. paragallinarum genotype A contained chondroitin. Chondroitin synthase of Av. paragallinarum (ApCS) encoded by one gene within the presumed capsule biosynthesis gene cluster exhibited considerable homology to identified bacterial chondroitin synthases. Herein, we report the identification and characterization of ApCS. This enzyme indeed displays chondroitin synthase activity involved in the biosynthesis of the capsule. ApCS is a bifunctional protein catalyzing the elongation of the chondroitin chain by alternatively transferring the glucuronic acid (GlcA) and N-acetyl-D-galactosamine (GalNAc) residues from their nucleotide forms to the non-reducing ends of the saccharide chains. GlcA with a para-nitrophenyl group (pNP) could serve as the acceptor for ApCS; this enzyme shows a stringent donor tolerance when the acceptor is as small as this monosaccharide. Then, UDP-GalNAc and GlcA-pNP were injected sequentially through the chip-immobilized chondroitin synthases, and the surface plasmon resonance data demonstrated that the up-regulated extent caused by the binding of the donor is one possibly essential factor in successful polymerization reaction. This conclusion will, therefore, enhance the understanding of the mode of action of glycosyltransferase. Surprisingly, high activity at near-zero temperature as well as weak temperature dependence of this novel bacterial chondroitin synthase indicate that ApCS was a cold-active enzyme. From all accounts, ApCS becomes the fourth known bacterial chondroitin synthase, and the potential applications in artificial chondroitin sulfate and glycosaminoglycan synthetic approaches make it an attractive glycosyltransferase for further investigation.

  15. Extended lactation in dairy cows

    DEFF Research Database (Denmark)

    Sorensen, Annette; Muir, D. Donald; Knight, Christopher Harold

    2008-01-01

    Twelve spring-calving and twelve winter-calving cows were managed for extended lactation cycles of 18-months duration, with the former group then completing a second extended lactation. Half of the cows were fed according to standard management practice for the herd; the other half received suppl...... interventions, the results lend support to the economic arguments in favour of extended lactation cycles. The likely welfare benefits of extended lactation are also discussed....

  16. Extended resection in the treatment of colorectal cancer.

    Science.gov (United States)

    Montesani, C; Ribotta, G; De Milito, R; Pronio, A; D'Amato, A; Narilli, P; Jaus, M

    1991-08-01

    Between 1975 and 1990, 525 patients underwent resection of colorectal cancer in our unit. Of these, 38 had tumour invading adjacent structures and underwent an extended resection. Overall, there were 67 cases treated palliatively. Of these, three were in the group of 38 having an extended resection. When the groups of radical not extended (n = 423) and radical extended resections (n = 35) were compared, respective values for mortality (1.9% vs 0) and morbidity (12.8% vs 11.3%) were not different. Respective local recurrence rates (13% vs 26%) were significantly greater after extended resection. Five-year survival after extended resection was 30%, no different from the general survival rate for standard resections for T2-3 node-positive tumours. Extended resection is thus a safe and important approach for locally advanced tumours.

  17. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    Yan Ping Lim

    2016-06-01

    Full Text Available Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalcone synthase in plants to novel PKSs in bacteria and fungi. To date, at least 15 families of type III PKSs have been characterized, highlighting the utility of PKSs in the development of natural product libraries for therapeutic development.

  18. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2010-05-31

    inhibitors into the clinic. fatty acid synthase, thioesterase, inhibitors, drug development U U U UU 44 USAMRMC Table of Contents ...targeting. Ursolic acid , a pentacyclic triterpenoid acid , as well as the tea polyphenols, epigallocatechin gallate (EGCG) and epicatechin gallate...2007,  6(7), 2120‐2126.  73.  Liu, Y., Tian, W., Ma, X., and Ding, W. Evaluation of  inhibition of  fatty  acid  synthase by  ursolic   acid : positive

  19. LAP6/POLYKETIDE SYNTHASE A and LAP5/POLYKETIDE SYNTHASE B Encode Hydroxyalkyl α-Pyrone Synthases Required for Pollen Development and Sporopollenin Biosynthesis in Arabidopsis thaliana[C][W][OA

    Science.gov (United States)

    Kim, Sung Soo; Grienenberger, Etienne; Lallemand, Benjamin; Colpitts, Che C.; Kim, Sun Young; Souza, Clarice de Azevedo; Geoffroy, Pierrette; Heintz, Dimitri; Krahn, Daniel; Kaiser, Markus; Kombrink, Erich; Heitz, Thierry; Suh, Dae-Yeon; Legrand, Michel; Douglas, Carl J.

    2010-01-01

    Plant type III polyketide synthases (PKSs) catalyze the condensation of malonyl-CoA units with various CoA ester starter molecules to generate a diverse array of natural products. The fatty acyl-CoA esters synthesized by Arabidopsis thaliana ACYL-COA SYNTHETASE5 (ACOS5) are key intermediates in the biosynthesis of sporopollenin, the major constituent of exine in the outer pollen wall. By coexpression analysis, we identified two Arabidopsis PKS genes, POLYKETIDE SYNTHASE A (PKSA) and PKSB (also known as LAP6 and LAP5, respectively) that are tightly coexpressed with ACOS5. Recombinant PKSA and PKSB proteins generated tri-and tetraketide α-pyrone compounds in vitro from a broad range of potential ACOS5-generated fatty acyl-CoA starter substrates by condensation with malonyl-CoA. Furthermore, substrate preference profile and kinetic analyses strongly suggested that in planta substrates for both enzymes are midchain- and ω-hydroxylated fatty acyl-CoAs (e.g., 12-hydroxyoctadecanoyl-CoA and 16-hydroxyhexadecanoyl-CoA), which are the products of sequential actions of anther-specific fatty acid hydroxylases and acyl-CoA synthetase. PKSA and PKSB are specifically and transiently expressed in tapetal cells during microspore development in Arabidopsis anthers. Mutants compromised in expression of the PKS genes displayed pollen exine layer defects, and a double pksa pksb mutant was completely male sterile, with no apparent exine. These results show that hydroxylated α-pyrone polyketide compounds generated by the sequential action of ACOS5 and PKSA/B are potential and previously unknown sporopollenin precursors. PMID:21193570

  20. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Khatkar, Anurag; Sharma, Sunil

    2018-03-29

    Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

  1. The purification, crystallization and preliminary X-ray diffraction analysis of dihydrodipicolinate synthase from Clostridium botulinum

    Energy Technology Data Exchange (ETDEWEB)

    Dobson, Renwick C. J., E-mail: rdobson@unimelb.edu.au; Atkinson, Sarah C. [Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Road, University of Melbourne, Parkville, Victoria 3010 (Australia); Gorman, Michael A. [St Vincents Institute, 9 Princes Street, Fitzroy, Victoria 3065 (Australia); Newman, Janet M. [CSIRO Division of Molecular and Health Technologies, 343 Royal Parade, Parkville, Victoria 3052 (Australia); Parker, Michael W. [Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Road, University of Melbourne, Parkville, Victoria 3010 (Australia); St Vincents Institute, 9 Princes Street, Fitzroy, Victoria 3065 (Australia); Perugini, Matthew A. [Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Road, University of Melbourne, Parkville, Victoria 3010 (Australia)

    2008-03-01

    Dihydrodipicolinate synthase (DHDPS), an enzyme in the lysine-biosynthetic pathway, is a promising target for antibiotic development against pathogenic bacteria. Here, the expression, purification, crystallization and preliminary diffraction analysis of DHDPS from C. botulinum are reported. In recent years, dihydrodipicolinate synthase (DHDPS; EC 4.2.1.52) has received considerable attention from both mechanistic and structural viewpoints. This enzyme, which is part of the diaminopimelate pathway leading to lysine, couples (S)-aspartate-β-semialdehyde with pyruvate via a Schiff base to a conserved active-site lysine. In this paper, the expression, purification, crystallization and preliminary X-ray diffraction analysis of DHDPS from Clostridium botulinum, an important bacterial pathogen, are presented. The enzyme was crystallized in a number of forms, predominantly using PEG precipitants, with the best crystal diffracting to beyond 1.9 Å resolution and displaying P4{sub 2}2{sub 1}2 symmetry. The unit-cell parameters were a = b = 92.9, c = 60.4 Å. The crystal volume per protein weight (V{sub M}) was 2.07 Å{sup 3} Da{sup −1}, with an estimated solvent content of 41%. The structure of the enzyme will help guide the design of novel therapeutics against the C. botulinum pathogen.

  2. The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.

    Science.gov (United States)

    Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra

    2016-04-01

    The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.

  3. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    Energy Technology Data Exchange (ETDEWEB)

    Pasquo, Alessandra [ENEA Casaccia Research Centre, Dipartimento BIOTEC, Sezione Genetica e Genomica Vegetale, PO Box 2400, I-00100 Rome (Italy); Bonamore, Alessandra; Franceschini, Stefano; Macone, Alberto; Boffi, Alberto; Ilari, Andrea, E-mail: andrea.ilari@uniroma1.it [Istituto di Biologia e Patologia Molecolari, CNR (IBPM) and Department Of Biochemical Sciences, University of Roma ‘La Sapienza’, Piazza Aldo Moro 5, 00179 Roma (Italy); ENEA Casaccia Research Centre, Dipartimento BIOTEC, Sezione Genetica e Genomica Vegetale, PO Box 2400, I-00100 Rome (Italy)

    2008-04-01

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.

  4. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    Science.gov (United States)

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu

    2012-01-01

    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  5. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    Division of Plant Biotechnology, Institute of Forest Genetics and Tree Breeding, P.B. No. 1061 ... known as forest red gum has an extensive natural distribu- ...... mechanical stress. Plant J. 22, 495–502. Wu A., Hu J. S. and Liu J. 2009 Functional analysis of a cotton cel- lulose synthase A4 gene promoter in transgenic tobacco ...

  6. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  7. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative ...

  8. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    2014-12-26

    Dec 26, 2014 ... RESEARCH ARTICLE. Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. MANISHA PATNAIK1,5, PALLABI PATI1, SURENDRA N. SWAIN2, MANOJ K.

  9. Contribution of granule bound starch synthase in kernel modification

    African Journals Online (AJOL)

    ACSS

    The stability of both GBSS and zein proteins coupled with the use of SDS-PAGE implied that only one was more reliable and required further validation. It was clear from this study, that kernel modification was regulated by complex genetic interactions. Fairly distinct systems such as the starch synthases, zein proteins and ...

  10. Biosynthesis of polyketides by trans-AT polyketide synthases.

    OpenAIRE

    Helfrich Eric J N; Piel Jörn

    2016-01-01

    This review discusses the biosynthesis of natural products that are generated by trans AT polyketide synthases a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  11. Biosynthesis of polyketides by trans-AT polyketide synthases.

    Science.gov (United States)

    Helfrich, Eric J N; Piel, Jörn

    2016-02-01

    This review discusses the biosynthesis of natural products that are generated by trans-AT polyketide synthases, a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  12. Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 ...

    African Journals Online (AJOL)

    HP

    Purpose: To explore the antioxidant properties of the methanol extract of Pericarpium Zanthoxyli and its effect on inducible nitric oxide synthase (iNOS), cycleooxygenase-2 (COX-2) and lipopolysaccharides (LPS)-induced cell damage in macrophage cells. Methods: Anti-oxidant activities were tested by measuring free ...

  13. Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 ...

    African Journals Online (AJOL)

    Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 and Lipid Peroxidation by Methanol Extract of Pericarpium Zanthoxyli. ... Production of iNOS induced by LPS was significantly (p < 0.05) inhibited by the extract, suggesting that the extract inhibits nitric oxide (NO) production by suppressing iNOS expression.

  14. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  15. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  16. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    This study was undertaken to investigate the association of aldosterone synthase C-344T, angiotensin II type I receptor A1166C and 11- hydroxysteroid dehydrogenase type 2 G534A polymorphisms with essential hypertension in the population of Odisha, India. A total of 246 hypertensive subjects (males, 159; females, ...

  17. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    NARCIS (Netherlands)

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  18. A functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.J.; van Leeuwen, H.; Koopman, J.; Faddeeva-Vakhrusheva, A.; Suring, W.J.; de Boer, T.E.; Mariën, A.G.H.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  19. Functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.; van Leeuwen, H.; Koopman, J.; Faddeeva, A.; Suring, W.; de Boer, T.E.; Mariën, J.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    2013-01-01

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  20. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along with ...

  1. Functional plasticity of paralogous diterpene synthases involved in conifer defense.

    Science.gov (United States)

    Keeling, Christopher I; Weisshaar, Sabrina; Lin, Roy P C; Bohlmann, Jörg

    2008-01-22

    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant-herbivore, plant-pollinator, and plant-pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin acids found in the defensive oleoresin of conifers. Although these paralogous enzymes are 91% identical at the amino acid level, one is a single-product enzyme, whereas the other is a multiproduct enzyme that forms completely different products. We used a rational approach of homology modeling, protein sequence comparison, domain swapping, and a series of reciprocal site-directed mutagenesis to identify the specific residues that direct the different product outcomes. A one-amino acid mutation switched the levopimaradiene/abietadiene synthase into producing isopimaradiene and sandaracopimaradiene and none of its normal products. Four mutations were sufficient to reciprocally reverse the product profiles for both of these paralogous enzymes while maintaining catalytic efficiencies similar to the wild-type enzymes. This study illustrates how neofunctionalization can result from relatively minor changes in protein sequence, increasing the diversity of secondary metabolites important for conifer defense.

  2. Expression of Inducible Nitric Oxide Synthase in the Epithelial ...

    African Journals Online (AJOL)

    Conclusion: iNOS was over expressed in OKCs when compared with DC and RC suggesting that iNOS may contribute to the aggressive behavior of OKC. This is yet another evidence to support that OKC is the neoplasm. Keywords: Dentigerous cyst, Immunohistochemistry, Inducible nitric oxide synthase, Odontogenic ...

  3. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  4. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  5. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  6. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  7. Cryo-EM structure of the yeast ATP synthase.

    Science.gov (United States)

    Lau, Wilson C Y; Baker, Lindsay A; Rubinstein, John L

    2008-10-24

    We have used electron cryomicroscopy of single particles to determine the structure of the ATP synthase from Saccharomyces cerevisiae. The resulting map at 24 A resolution can accommodate atomic models of the F(1)-c(10) subcomplex, the peripheral stalk subcomplex, and the N-terminal domain of the oligomycin sensitivity conferral protein. The map is similar to an earlier electron cryomicroscopy structure of bovine mitochondrial ATP synthase but with important differences. It resolves the internal structure of the membrane region of the complex, especially the membrane embedded subunits b, c, and a. Comparison of the yeast ATP synthase map, which lacks density from the dimer-specific subunits e and g, with a map of the bovine enzyme that included e and g indicates where these subunits are located in the intact complex. This new map has allowed construction of a model of subunit arrangement in the F(O) motor of ATP synthase that dictates how dimerization of the complex via subunits e and g might occur.

  8. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  9. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as the

  10. Nucleotide variation at the methionine synthase locus in an ...

    African Journals Online (AJOL)

    Nucleotide variation at the methionine synthase (MetE) locus within and among populations of an endangered forest tree Fokienia hodginsii in Vietnam was investigated in the present study. A total of 12 populations were sampled across Vietnam. The length of the sequenced locus varied from 1567 to 1559 bp. A total of 42 ...

  11. The space of extended orthomorphisms in a Riesz space

    NARCIS (Netherlands)

    De Pagter, B.

    1984-01-01

    We study the space Orth°°(L) of extended orthomorphisms in an Archimedean Riesz space L and its analogies with the complete ring of quotients of a commutative ring with unit element. It is shown that for any uniformly complete /-algebra A with unit element, Orth°°(?) is isomorphic with the complete

  12. Detailed characterization of the substrate specificity of mouse wax synthase.

    Science.gov (United States)

    Miklaszewska, Magdalena; Kawiński, Adam; Banaś, Antoni

    2013-01-01

    Wax synthases are membrane-associated enzymes catalysing the esterification reaction between fatty acyl-CoA and a long chain fatty alcohol. In living organisms, wax esters function as storage materials or provide protection against harmful environmental influences. In industry, they are used as ingredients for the production of lubricants, pharmaceuticals, and cosmetics. Currently the biological sources of wax esters are limited to jojoba oil. In order to establish a large-scale production of desired wax esters in transgenic high-yielding oilseed plants, enzymes involved in wax esters synthesis from different biological resources should be characterized in detail taking into consideration their substrate specificity. Therefore, this study aims at determining the substrate specificity of one of such enzymes -- the mouse wax synthase. The gene encoding this enzyme was expressed heterologously in Saccharomyces cerevisiae. In the in vitro assays (using microsomal fraction from transgenic yeast), we evaluated the preferences of mouse wax synthase towards a set of combinations of 11 acyl-CoAs with 17 fatty alcohols. The highest activity was observed for 14:0-CoA, 12:0-CoA, and 16:0-CoA in combination with medium chain alcohols (up to 5.2, 3.4, and 3.3 nmol wax esters/min/mg microsomal protein, respectively). Unsaturated alcohols longer than 18°C were better utilized by the enzyme in comparison to the saturated ones. Combinations of all tested alcohols with 20:0-CoA, 22:1-CoA, or Ric-CoA were poorly utilized by the enzyme, and conjugated acyl-CoAs were not utilized at all. Apart from the wax synthase activity, mouse wax synthase also exhibited a very low acyl-CoA:diacylglycerol acyltransferase activity. However, it displayed neither acyl-CoA:monoacylglycerol acyltransferase, nor acyl-CoA:sterol acyltransferase activity.

  13. Pseudouridine synthase 1: a site-specific synthase without strict sequence recognition requirements

    Science.gov (United States)

    Sibert, Bryan S.; Patton, Jeffrey R.

    2012-01-01

    Pseudouridine synthase 1 (Pus1p) is an unusual site-specific modification enzyme in that it can modify a number of positions in tRNAs and can recognize several other types of RNA. No consensus recognition sequence or structure has been identified for Pus1p. Human Pus1p was used to determine which structural or sequence elements of human tRNASer are necessary for pseudouridine (Ψ) formation at position 28 in the anticodon stem-loop (ASL). Some point mutations in the ASL stem of tRNASer had significant effects on the levels of modification and compensatory mutation, to reform the base pair, restored a wild-type level of Ψ formation. Deletion analysis showed that the tRNASer TΨC stem-loop was a determinant for modification in the ASL. A mini-substrate composed of the ASL and TΨC stem-loop exhibited significant Ψ formation at position 28 and a number of mutants were tested. Substantial base pairing in the ASL stem (3 out of 5 bp) is required, but the sequence of the TΨC loop is not required for modification. When all nucleotides in the ASL stem other than U28 were changed in a single mutant, but base pairing was retained, a near wild-type level of modification was observed. PMID:22102571

  14. Tetrahydrobiopterin, but not L-arginine, decreases NO synthase uncoupling in cells expressing high levels of endothelial NO synthase

    NARCIS (Netherlands)

    Bevers, LM; Braam, B; Post, JA; van Zonneveld, AJ; Rabelink, TJ; Koomans, HA; Verhaar, MC; Joles, JA

    Endothelial NO synthase (eNOS) produces superoxide when depleted of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) and L-arginine by uncoupling the electron flow from NO production. High expression of eNOS has been reported to have beneficial effects in atherosclerotic arteries after relatively short

  15. Irreducibility conditions for extended superfields

    International Nuclear Information System (INIS)

    Sokatchev, E.

    1981-05-01

    The irreducible supermultiplets contained in an extended superfield are presented as sets of covariant derivatives of the superfield. Differential irreducibility constraints are easily obtained from this decomposition. (author)

  16. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  17. Mechanism of Germacradien-4-ol Synthase-Controlled Water Capture

    Science.gov (United States)

    2016-01-01

    The sesquiterpene synthase germacradiene-4-ol synthase (GdolS) from Streptomyces citricolor is one of only a few known high-fidelity terpene synthases that convert farnesyl diphosphate (FDP) into a single hydroxylated product. Crystals of unliganded GdolS-E248A diffracted to 1.50 Å and revealed a typical class 1 sesquiterpene synthase fold with the active site in an open conformation. The metal binding motifs were identified as D80DQFD and N218DVRSFAQE. Some bound water molecules were evident in the X-ray crystal structure, but none were obviously positioned to quench a putative final carbocation intermediate. Incubations in H218O generated labeled product, confirming that the alcohol functionality arises from nucleophilic capture of the final carbocation by water originating from solution. Site-directed mutagenesis of amino acid residues from both within the metal binding motifs and without identified by sequence alignment with aristolochene synthase from Aspergillus terreus generated mostly functional germacradien-4-ol synthases. Only GdolS-N218Q generated radically different products (∼50% germacrene A), but no direct evidence of the mechanism of incorporation of water into the active site was obtained. Fluorinated FDP analogues 2F-FDP and 15,15,15-F3-FDP were potent noncompetitive inhibitors of GdolS. 12,13-DiF-FDP generated 12,13-(E)-β-farnesene upon being incubated with GdolS, suggesting stepwise formation of the germacryl cation during the catalytic cycle. Incubation of GdolS with [1-2H2]FDP and (R)-[1-2H]FDP demonstrated that following germacryl cation formation a [1,3]-hydride shift generates the final carbocation prior to nucleophilic capture. The stereochemistry of this shift is not defined, and the deuteron in the final product was scrambled. Because no clear candidate residue for binding of a nucleophilic water molecule in the active site and no significant perturbation of product distribution from the replacement of active site residues were

  18. On core stability and extendability

    OpenAIRE

    Shellshear, Evan

    2007-01-01

    This paper investigates conditions under which the core of a TU cooperative game is stable. In particular the author extends the idea of extendability to find new conditions under which the core is stable. It is also shown that these new conditions are not necessary for core stability.

  19. Extending cosmology: the metric approach

    OpenAIRE

    Mendoza, S.

    2012-01-01

    Comment: 2012, Extending Cosmology: The Metric Approach, Open Questions in Cosmology; Review article for an Intech "Open questions in cosmology" book chapter (19 pages, 3 figures). Available from: http://www.intechopen.com/books/open-questions-in-cosmology/extending-cosmology-the-metric-approach

  20. Structural and Kinetic Properties of Lumazine Synthase Isoenzymes in the Order Rhizobiales

    Energy Technology Data Exchange (ETDEWEB)

    Klinke,S.; Zylberman, V.; Bonomi, H.; Haase, I.; Guimaraes, B.; Braden, B.; Bacher, A.; Fischer, M.; Goldbaum, F.

    2007-01-01

    6, 7-Dimethyl-8-ribityllumazine synthase (lumazine synthase; LS) catalyzes the penultimate step in the biosynthesis of riboflavin in plants and microorganisms. This protein is known to exhibit different quaternary assemblies between species, existing as free pentamers, decamers (dimers of pentamers) and icosahedrally arranged dodecamers of pentamers. A phylogenetic analysis on eubacterial, fungal and plant LSs allowed us to classify them into two categories: Type I LSs (pentameric or icosahedral) and Type II LSs (decameric). The Rhizobiales represent an order of ?-proteobacteria that includes, among others, the genera Mesorhizobium, Agrobacterium and Brucella. Here, we present structural and kinetic studies on several LSs from Rhizobiales. Interestingly, Mesorhizobium and Brucella encode both a Type-I LS and a Type-II LS called RibH1 and RibH2, respectively. We show that Type II LSs appear to be almost inactive, whereas Type I LSs present a highly variable catalytic activity according to the genus. Additionally, we have solved four RibH1/RibH2 crystallographic structures from the genera Mesorhizobium and Brucella. The relationship between the active-site architecture and catalytic properties in these isoenzymes is discussed, and a model that describes the enzymatic behavior is proposed. Furthermore, sequence alignment studies allowed us to extend our results to the genus Agrobacterium. Our results suggest that the selective pressure controlling the riboflavin pathway favored the evolution of catalysts with low reaction rates, since the excess of flavins in the intracellular pool in Rhizobiales could act as a negative factor when these bacteria are exposed to oxidative or nitrosative stress.

  1. Biosynthesis of aliphatic polyketides by type III polyketide synthase and methyltransferase in Bacillus subtilis.

    Science.gov (United States)

    Nakano, Chiaki; Ozawa, Hiroki; Akanuma, Genki; Funa, Nobutaka; Horinouchi, Sueharu

    2009-08-01

    Type III polyketide synthases (PKSs) synthesize a variety of aromatic polyketides in plants, fungi, and bacteria. The bacterial genome projects predicted that probable type III PKS genes are distributed in a wide variety of gram-positive and -negative bacteria. The gram-positive model microorganism Bacillus subtilis contained the bcsA-ypbQ operon, which appeared to encode a type III PKS and a methyltransferase, respectively. Here, we report the characterization of bcsA (renamed bpsA, for Bacillus pyrone synthase, on the basis of its function) and ypbQ, which are involved in the biosynthesis of aliphatic polyketides. In vivo analysis demonstrated that BpsA was a type III PKS catalyzing the synthesis of triketide pyrones from long-chain fatty acyl-coenzyme A (CoA) thioesters as starter substrates and malonyl-CoA as an extender substrate, and YpbQ was a methyltransferase acting on the triketide pyrones to yield alkylpyrone methyl ethers. YpbQ thus was named BpsB because of its functional relatedness to BpsA. In vitro analysis with histidine-tagged BpsA revealed that it used broad starter substrates and produced not only triketide pyrones but also tetraketide pyrones and alkylresorcinols. Although the aliphatic polyketides were expected to localize in the membrane and play some role in modulating the rigidity and properties of the membrane, no detectable phenotypic changes were observed for a B. subtilis mutant containing a whole deletion of the bpsA-bpsB operon.

  2. Permeability transition in human mitochondria persists in the absence of peripheral stalk subunits of ATP synthase.

    Science.gov (United States)

    He, Jiuya; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-08-22

    The opening of a nonspecific channel, known as the permeability transition pore (PTP), in the inner membranes of mitochondria can be triggered by calcium ions, leading to swelling of the organelle, disruption of the inner membrane and ATP synthesis, and cell death. Pore opening can be inhibited by cyclosporin A mediated via cyclophilin D. It has been proposed that the pore is associated with the dimeric ATP synthase and the oligomycin sensitivity conferral protein (OSCP), a component of the enzyme's peripheral stalk, provides the site at which cyclophilin D interacts. Subunit b contributes a central α-helical structure to the peripheral stalk, extending from near the top of the enzyme's catalytic domain and crossing the membrane domain of the enzyme via two α-helices. We investigated the possible involvement of the subunit b and the OSCP in the PTP by generating clonal cells, HAP1-Δb and HAP1-ΔOSCP, lacking the membrane domain of subunit b or the OSCP, respectively, in which the corresponding genes, ATP5F1 and ATP5O , had been disrupted. Both cell lines preserve the characteristic properties of the PTP; therefore, the membrane domain of subunit b does not contribute to the PTP, and the OSCP does not provide the site of interaction with cyclophilin D. The membrane subunits ATP6, ATP8, and subunit c have been eliminated previously from possible participation in the PTP; thus, the only subunits of ATP synthase that could participate in pore formation are e, f, g, diabetes-associated protein in insulin-sensitive tissues (DAPIT), and the 6.8-kDa proteolipid.

  3. Functional loss of two ceramide synthases elicits autophagy-dependent lifespan extension in C. elegans.

    Directory of Open Access Journals (Sweden)

    Mai-Britt Mosbech

    Full Text Available Ceramide and its metabolites constitute a diverse group of lipids, which play important roles as structural entities of biological membranes as well as regulators of cellular growth, differentiation, and development. The C. elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2, and lagr-1. HYL-1 function is required for synthesis of ceramides and sphingolipids containing very long acyl-chains (≥C24, while HYL-2 is required for synthesis of ceramides and sphingolipids containing shorter acyl-chains (≤C22. Here we show that functional loss of HYL-2 decreases lifespan, while loss of HYL-1 or LAGR-1 does not affect lifespan. We show that loss of HYL-1 and LAGR-1 functions extend lifespan in an autophagy-dependent manner, as knock down of the autophagy-associated gene ATG-12 abolishes hyl-1;lagr-1 longevity. The transcription factors PHA-4/FOXA, DAF-16/FOXO, and SKN-1 are also required for the observed lifespan extension, as well as the increased number of autophagosomes in hyl-1;lagr-1 animals. Both autophagic events and the transcription factors PHA-4/FOXA, DAF-16, and SKN-1 have previously been associated with dietary restriction-induced longevity. Accordingly, we find that hyl-1;lagr-1 animals display reduced feeding, increased resistance to heat, and reduced reproduction. Collectively, our data suggest that specific sphingolipids produced by different ceramide synthases have opposing roles in determination of C. elegans lifespan. We propose that loss of HYL-1 and LAGR-1 result in dietary restriction-induced autophagy and consequently prolonged longevity.

  4. Extended Active Disturbance Rejection Controller

    Science.gov (United States)

    Gao, Zhiqiang (Inventor); Tian, Gang (Inventor)

    2016-01-01

    Multiple designs, systems, methods and processes for controlling a system or plant using an extended active disturbance rejection control (ADRC) based controller are presented. The extended ADRC controller accepts sensor information from the plant. The sensor information is used in conjunction with an extended state observer in combination with a predictor that estimates and predicts the current state of the plant and a co-joined estimate of the system disturbances and system dynamics. The extended state observer estimates and predictions are used in conjunction with a control law that generates an input to the system based in part on the extended state observer estimates and predictions as well as a desired trajectory for the plant to follow.

  5. Scale-invariant extended inflation

    International Nuclear Information System (INIS)

    Holman, R.; Kolb, E.W.; Vadas, S.L.; Wang, Y.

    1991-01-01

    We propose a model of extended inflation which makes use of the nonlinear realization of scale invariance involving the dilaton coupled to an inflaton field whose potential admits a metastable ground state. The resulting theory resembles the Jordan-Brans-Dicke version of extended inflation. However, quantum effects, in the form of the conformal anomaly, generate a mass for the dilaton, thus allowing our model to evade the problems of the original version of extended inflation. We show that extended inflation can occur for a wide range of inflaton potentials with no fine-tuning of dimensionless parameters required. Furthermore, we also find that it is quite natural for the extended-inflation period to be followed by an epoch of slow-rollover inflation as the dilaton settles down to the minimum of its induced potential

  6. Response to: Chimpanzee culture extends beyond matrilineal family units.

    Science.gov (United States)

    Wrangham, Richard W; Worthington, Steven; Bernard, Andrew B; Koops, Kathelijne; Machanda, Zarin P; Muller, Martin N

    2017-06-19

    We thank van Leeuwen et al.[1] for their response to our finding that matrilineal relationships strongly influence the style of high-arm grooming in wild chimpanzees of the Kanyawara community. We agree with them that grooming styles could be transmitted by different mechanisms in different contexts, and we appreciate their effort to assess whether the transmission of grooming styles within two captive groups in Chimfunshi accords with our result. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Extending Topological Abelian Groups by the Unit Circle

    Directory of Open Access Journals (Sweden)

    Hugo J. Bello

    2013-01-01

    Full Text Available A twisted sum in the category of topological Abelian groups is a short exact sequence 0→Y→X→Z→0 where all maps are assumed to be continuous and open onto their images. The twisted sum splits if it is equivalent to 0→Y→Y×Z→Z→0. We study the class STG of topological groups G for which every twisted sum 0→→X→G→0 splits. We prove that this class contains Hausdorff locally precompact groups, sequential direct limits of locally compact groups, and topological groups with ℒ∞ topologies. We also prove that it is closed by taking open and dense subgroups, quotients by dually embedded subgroups, and coproducts. As means to find further subclasses of STG, we use the connection between extensions of the form 0→→X→G→0 and quasi-characters on G, as well as three-space problems for topological groups. The subject is inspired on some concepts known in the framework of topological vector spaces such as the notion of -space, which were interpreted for topological groups by Cabello.

  8. HISTORY OF BIOMONITORING IN THE UNITED STATES - EXTENDED ABSTRACT

    Science.gov (United States)

    Biomonitoring of ecological systems has a long history dating back several centuries when high levels of industrial and urban pollution caused discolored rivers, noxious smells, fish kills, and other obvious indicators of ecosystem dysfunction. As a result, significant environmen...

  9. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...... and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has...

  10. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases.

    Science.gov (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E

    1990-09-11

    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  11. Use of linalool synthase in genetic engineering of scent production

    Science.gov (United States)

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  12. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal...... and sex showed no such changes. Our data support the hypothesis that NO is a pathogenic factor in MS, and that NOS IR is strongly expressed in brain regions appearing normal by MRI...

  14. PKMiner: a database for exploring type II polyketide synthases

    OpenAIRE

    Kim Jinki; Yi Gwan-Su

    2012-01-01

    Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyke...

  15. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    OpenAIRE

    Yan Ping Lim; Maybelle K. Go; Wen Shan Yew

    2016-01-01

    Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs) using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalc...

  16. ASMPKS: an analysis system for modular polyketide synthases

    OpenAIRE

    Kong Eun-Bae; Tae Hongseok; Park Kiejung

    2007-01-01

    Abstract Background Polyketides are secondary metabolites of microorganisms with diverse biological activities, including pharmacological functions such as antibiotic, antitumor and agrochemical properties. Polyketides are synthesized by serialized reactions of a set of enzymes called polyketide synthase(PKS)s, which coordinate the elongation of carbon skeletons by the stepwise condensation of short carbon precursors. Due to their importance as drugs, the volume of data on polyketides is rapi...

  17. Deficiency of mitochondrial ATP synthase of nuclear genetic origin

    Czech Academy of Sciences Publication Activity Database

    Sperl, W.; Ješina, Pavel; Zeman, J.; Mayr, J. A.; DeMeirleir, L.; VanCoster, R.; Pícková, Andrea; Hansíková, H.; Houšťková, H.; Krejčík, Zdeněk; Koch, J.; Smet, J.; Muss, W.; Holme, E.; Houštěk, Josef

    2006-01-01

    Roč. 16, č. 11 (2006), s. 821-829 ISSN 0960-8966 R&D Projects: GA MZd(CZ) NR7790; GA MŠk(CZ) 1M0520 Grant - others:CZ-AT(CZ) 6-06-3 Institutional research plan: CEZ:AV0Z50110509 Keywords : mitochondria * ATP synthase * disease Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.615, year: 2006

  18. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Czech Academy of Sciences Publication Activity Database

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius

    2012-01-01

    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539

  19. Use of linalool synthase in genetic engineering of scent production

    Energy Technology Data Exchange (ETDEWEB)

    Pichersky, E.

    1998-12-15

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed. 5 figs.

  20. Dihydrodipicolinate synthase in opaque and floury maize mutants

    NARCIS (Netherlands)

    Varisi, V.A.; Medici, L.O.; Meer, van der I.M.; Lea, P.J.; Azevedo, J.L.

    2007-01-01

    Dihydrodipicolinate synthase (DHDPS, EC 4.2.1.52) was isolated and studied in four high-lysine maize mutants (Oh43o1, Oh43o2, Oh43fl1 and Oh43fl2). The activity of DHDPS was analyzed at 16, 20, and 24 DAP and characterized in the presence of the amino acids, lysine, S-(2-aminoethyl)-l-cysteine

  1. Nitric oxide synthase isoforms in spontaneous and salt hypertension

    Czech Academy of Sciences Publication Activity Database

    Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef

    2007-01-01

    Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  2. The cellulose synthase superfamily in fully sequenced plants and algae

    Directory of Open Access Journals (Sweden)

    Xu Ying

    2009-07-01

    Full Text Available Abstract Background The cellulose synthase superfamily has been classified into nine cellulose synthase-like (Csl families and one cellulose synthase (CesA family. The Csl families have been proposed to be involved in the synthesis of the backbones of hemicelluloses of plant cell walls. With 17 plant and algal genomes fully sequenced, we sought to conduct a genome-wide and systematic investigation of this superfamily through in-depth phylogenetic analyses. Results A single-copy gene is found in the six chlorophyte green algae, which is most closely related to the CslA and CslC families that are present in the seven land plants investigated in our analyses. Six proteins from poplar, grape and sorghum form a distinct family (CslJ, providing further support for the conclusions from two recent studies. CslB/E/G/H/J families have evolved significantly more rapidly than their widely distributed relatives, and tend to have intragenomic duplications, in particular in the grape genome. Conclusion Our data suggest that the CslA and CslC families originated through an ancient gene duplication event in land plants. We speculate that the single-copy Csl gene in green algae may encode a mannan synthase. We confirm that the rest of the Csl families have a different evolutionary origin than CslA and CslC, and have proposed a model for the divergence order among them. Our study provides new insights about the evolution of this important gene family in plants.

  3. Iterative polyketide biosynthesis by modular polyketide synthases in bacteria.

    Science.gov (United States)

    Chen, Haotong; Du, Liangcheng

    2016-01-01

    Modular polyketide synthases (type I PKSs) in bacteria are responsible for synthesizing a significant percentage of bioactive natural products. This group of synthases has a characteristic modular organization, and each module within a PKS carries out one cycle of polyketide chain elongation; thus each module is non-iterative in function. It was possible to predict the basic structure of a polyketide product from the module organization of the PKSs, since there generally existed a co-linearity between the number of modules and the number of chain elongations. However, more and more bacterial modular PKSs fail to conform to the canonical rules, and a particularly noteworthy group of non-canonical PKSs is the bacterial iterative type I PKSs. This review covers recent examples of iteratively used modular PKSs in bacteria. These non-canonical PKSs give rise to a large array of natural products with impressive structural diversity. The molecular mechanism behind the iterations is often unclear, presenting a new challenge to the rational engineering of these PKSs with the goal of generating new natural products. Structural elucidation of these synthase complexes and better understanding of potential PKS-PKS interactions as well as PKS-substrate recognition may provide new prospects and inspirations for the discovery and engineering of new bioactive polyketides.

  4. Regulation of expression, activity and localization of fungal chitin synthases

    Science.gov (United States)

    Rogg, Luise E.; Fortwendel, Jarrod R.; Juvvadi, Praveen R.; Steinbach, William J.

    2013-01-01

    The fungal cell wall represents an attractive target for pharmacologic inhibition, as many of the components are fungal-specific. Though targeted inhibition of β-glucan synthesis is effective treatment for certain fungal infections, the ability of the cell wall to dynamically compensate via the cell wall integrity pathway may limit overall efficacy. To date, chitin synthesis inhibitors have not been successfully deployed in the clinical setting. Fungal chitin synthesis is a complex and highly regulated process. Regulation of chitin synthesis occurs on multiple levels, thus targeting of these regulatory pathways may represent an exciting alternative approach. A variety of signaling pathways have been implicated in chitin synthase regulation, at both transcriptional and post-transcriptional levels. Recent research suggests that localization of chitin synthases likely represents a major regulatory mechanism. However, much of the regulatory machinery is not necessarily shared among different chitin synthases. Thus, an in depth understanding of the precise roles of each protein in cell wall maintenance and repair will be essential to identifying the most likely therapeutic targets. PMID:21526913

  5. The Structural Basis of Erwinia rhapontici Isomaltulose Synthase

    Science.gov (United States)

    Xu, Zheng; Li, Sha; Li, Jie; Li, Yan; Feng, Xiaohai; Wang, Renxiao; Xu, Hong; Zhou, Jiahai

    2013-01-01

    Sucrose isomerase NX-5 from Erwiniarhapontici efficiently catalyzes the isomerization of sucrose to isomaltulose (main product) and trehalulose (by-product). To investigate the molecular mechanism controlling sucrose isomer formation, we determined the crystal structures of native NX-5 and its mutant complexes E295Q/sucrose and D241A/glucose at 1.70 Å, 1.70 Å and 2.00 Å, respectively. The overall structure and active site architecture of NX-5 resemble those of other reported sucrose isomerases. Strikingly, the substrate binding mode of NX-5 is also similar to that of trehalulose synthase from Pseudomonasmesoacidophila MX-45 (MutB). Detailed structural analysis revealed the catalytic RXDRX motif and the adjacent 10-residue loop of NX-5 and isomaltulose synthase PalI from Klebsiella sp. LX3 adopt a distinct orientation from those of trehalulose synthases. Mutations of the loop region of NX-5 resulted in significant changes of the product ratio between isomaltulose and trehalulose. The molecular dynamics simulation data supported the product specificity of NX-5 towards isomaltulose and the role of the loop330-339 in NX-5 catalysis. This work should prove useful for the engineering of sucrose isomerase for industrial carbohydrate biotransformations. PMID:24069347

  6. Extended asymptotic functions - some examples

    International Nuclear Information System (INIS)

    Todorov, T.D.

    1981-01-01

    Several examples of extended asymptotic functions of two variables are given. This type of asymptotic functions has been introduced as an extension of continuous ordinary functions. The presented examples are realizations of some Schwartz distributions delta(x), THETA(x), P(1/xsup(n)) and can be multiplied in the class of the asymptotic functions as opposed to the theory of Schwartz distributions. The examples illustrate the method of construction of extended asymptotic functions similar to the distributions. The set formed by the extended asymptotic functions is also considered. It is shown, that this set is not closed with respect to addition and multiplication

  7. Cosmological dynamics of extended chameleons

    Energy Technology Data Exchange (ETDEWEB)

    Tamanini, Nicola [Institut de Physique Théorique, CEA-Saclay, CNRS UMR 3681, Université Paris-Saclay, F-91191 Gif-sur-Yvette (France); Wright, Matthew, E-mail: nicola.tamanini@cea.fr, E-mail: matthew.wright.13@ucl.ac.uk [Department of Mathematics, University College London, Gower Street, London, WC1E 6BT (United Kingdom)

    2016-04-01

    We investigate the cosmological dynamics of the recently proposed extended chameleon models at both background and linear perturbation levels. Dynamical systems techniques are employed to fully characterize the evolution of the universe at the largest distances, while structure formation is analysed at sub-horizon scales within the quasi-static approximation. The late time dynamical transition from dark matter to dark energy domination can be well described by almost all extended chameleon models considered, with no deviations from ΛCDM results at both background and perturbation levels. The results obtained in this work confirm the cosmological viability of extended chameleons as alternative dark energy models.

  8. Cosmological dynamics of extended chameleons

    International Nuclear Information System (INIS)

    Tamanini, Nicola; Wright, Matthew

    2016-01-01

    We investigate the cosmological dynamics of the recently proposed extended chameleon models at both background and linear perturbation levels. Dynamical systems techniques are employed to fully characterize the evolution of the universe at the largest distances, while structure formation is analysed at sub-horizon scales within the quasi-static approximation. The late time dynamical transition from dark matter to dark energy domination can be well described by almost all extended chameleon models considered, with no deviations from ΛCDM results at both background and perturbation levels. The results obtained in this work confirm the cosmological viability of extended chameleons as alternative dark energy models.

  9. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  10. Structural Analysis of Thymidylate Synthase from Kaposi's Sarcoma-Associated Herpesvirus with the Anticancer Drug Raltitrexed.

    Directory of Open Access Journals (Sweden)

    Yong Mi Choi

    Full Text Available Kaposi's sarcoma-associated herpesvirus (KSHV is a highly infectious human herpesvirus that causes Kaposi's sarcoma. KSHV encodes functional thymidylate synthase, which is a target for anticancer drugs such as raltitrexed or 5-fluorouracil. Thymidylate synthase catalyzes the conversion of 2'-deoxyuridine-5'-monophosphate (dUMP to thymidine-5'-monophosphate (dTMP using 5,10-methylenetetrahydrofolate (mTHF as a co-substrate. The crystal structures of thymidylate synthase from KSHV (apo, complexes with dUMP (binary, and complexes with both dUMP and raltitrexed (ternary were determined at 1.7 Å, 2.0 Å, and 2.4 Å, respectively. While the ternary complex structures of human thymidylate synthase and E. coli thymidylate synthase had a closed conformation, the ternary complex structure of KSHV thymidylate synthase was observed in an open conformation, similar to that of rat thymidylate synthase. The complex structures of KSHV thymidylate synthase did not have a covalent bond between the sulfhydryl group of Cys219 and C6 atom of dUMP, unlike the human thymidylate synthase. The catalytic Cys residue demonstrated a dual conformation in the apo structure, and its sulfhydryl group was oriented toward the C6 atom of dUMP with no covalent bond upon ligand binding in the complex structures. These structural data provide the potential use of antifolates such as raltitrexed as a viral induced anticancer drug and structural basis to design drugs for targeting the thymidylate synthase of KSHV.

  11. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  12. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe Brandt; Von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  13. Quasi-extended asymptotic functions

    International Nuclear Information System (INIS)

    Todorov, T.D.

    1979-01-01

    The class F of ''quasi-extended asymptotic functions'' is introduced. It contains all extended asymptotic functions as well as some new asymptotic functions very similar to the Schwartz distributions. On the other hand, every two quasiextended asymptotic functions can be multiplied as opposed to the Schwartz distributions; in particular, the square delta 2 of an asymptotic function delta similar to Dirac's delta-function, is constructed as an example

  14. Topological defects in extended inflation

    International Nuclear Information System (INIS)

    Copeland, E.J.; Kolb, E.W.; Chicago Univ., IL; Liddle, A.R.

    1990-04-01

    We consider the production of topological defects, especially cosmic strings, in extended inflation models. In extended inflation, the Universe passes through a first-order phase transition via bubble percolation, which naturally allows defects to form at the end of inflation. The correlation length, which determines the number density of the defects, is related to the mean size of bubbles when they collide. This mechanism allows a natural combination of inflation and large-scale structure via cosmic strings. 18 refs

  15. Some problems with extended inflation

    International Nuclear Information System (INIS)

    Weinberg, E.J.

    1989-01-01

    The recently proposed extended inflation scenario is examined. Upper bounds on the Brans-Dicke parameter ω are obtained by requiring that the recovery from the supercooled regime be such that the presently observed Universe could have emerged. These bounds are well below the present-day experimental limits, implying that one must use models which have a potential to fix the present value of the Brans-Dicke-like scalar field. The implications for extended inflation in such models are discussed

  16. Topological defects in extended inflation

    International Nuclear Information System (INIS)

    Copeland, E.J.; Kolb, E.W.; Liddle, A.R.

    1990-01-01

    We consider the production of topological defects, especially cosmic strings, in extended-inflation models. In extended inflation, the Universe passes through a first-order phase transition via bubble percolation, which naturally allows defects to form at the end of inflation. The correlation length, which determines the number density of the defects, is related to the mean size of the bubbles when they collide. This mechanism allows a natural combination of inflation and large-scale structure via cosmic strings

  17. CELLULOSE SYNTHASE INTERACTIVE1 Is Required for Fast Recycling of Cellulose Synthase Complexes to the Plasma Membrane in Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Lei; Singh, Abhishek; Bashline, Logan; Li, Shundai; Yingling, Yaroslava G.; Gu, Ying

    2015-10-06

    Plants are constantly subjected to various biotic and abiotic stresses and have evolved complex strategies to cope with these stresses. For example, plant cells endocytose plasma membrane material under stress and subsequently recycle it back when the stress conditions are relieved. Cellulose biosynthesis is a tightly regulated process that is performed by plasma membrane-localized cellulose synthase (CESA) complexes (CSCs). However, the regulatory mechanism of cellulose biosynthesis under abiotic stress has not been well explored. In this study, we show that small CESA compartments (SmaCCs) or microtubule-associated cellulose synthase compartments (MASCs) are critical for fast recovery of CSCs to the plasma membrane after stress is relieved in Arabidopsis thaliana. This SmaCC/MASC-mediated fast recovery of CSCs is dependent on CELLULOSE SYNTHASE INTERACTIVE1 (CSI1), a protein previously known to represent the link between CSCs and cortical microtubules. Independently, AP2M, a core component in clathrin-mediated endocytosis, plays a role in the formation of SmaCCs/MASCs. Together, our study establishes a model in which CSI1-dependent SmaCCs/MASCs are formed through a process that involves endocytosis, which represents an important mechanism for plants to quickly regulate cellulose synthesis under abiotic stress.

  18. Why an extended evolutionary synthesis is necessary.

    Science.gov (United States)

    Müller, Gerd B

    2017-10-06

    Since the last major theoretical integration in evolutionary biology-the modern synthesis (MS) of the 1940s-the biosciences have made significant advances. The rise of molecular biology and evolutionary developmental biology, the recognition of ecological development, niche construction and multiple inheritance systems, the '-omics' revolution and the science of systems biology, among other developments, have provided a wealth of new knowledge about the factors responsible for evolutionary change. Some of these results are in agreement with the standard theory and others reveal different properties of the evolutionary process. A renewed and extended theoretical synthesis, advocated by several authors in this issue, aims to unite pertinent concepts that emerge from the novel fields with elements of the standard theory. The resulting theoretical framework differs from the latter in its core logic and predictive capacities. Whereas the MS theory and its various amendments concentrate on genetic and adaptive variation in populations, the extended framework emphasizes the role of constructive processes, ecological interactions and systems dynamics in the evolution of organismal complexity as well as its social and cultural conditions. Single-level and unilinear causation is replaced by multilevel and reciprocal causation. Among other consequences, the extended framework overcomes many of the limitations of traditional gene-centric explanation and entails a revised understanding of the role of natural selection in the evolutionary process. All these features stimulate research into new areas of evolutionary biology.

  19. Extended likelihood inference in reliability

    International Nuclear Information System (INIS)

    Martz, H.F. Jr.; Beckman, R.J.; Waller, R.A.

    1978-10-01

    Extended likelihood methods of inference are developed in which subjective information in the form of a prior distribution is combined with sampling results by means of an extended likelihood function. The extended likelihood function is standardized for use in obtaining extended likelihood intervals. Extended likelihood intervals are derived for the mean of a normal distribution with known variance, the failure-rate of an exponential distribution, and the parameter of a binomial distribution. Extended second-order likelihood methods are developed and used to solve several prediction problems associated with the exponential and binomial distributions. In particular, such quantities as the next failure-time, the number of failures in a given time period, and the time required to observe a given number of failures are predicted for the exponential model with a gamma prior distribution on the failure-rate. In addition, six types of life testing experiments are considered. For the binomial model with a beta prior distribution on the probability of nonsurvival, methods are obtained for predicting the number of nonsurvivors in a given sample size and for predicting the required sample size for observing a specified number of nonsurvivors. Examples illustrate each of the methods developed. Finally, comparisons are made with Bayesian intervals in those cases where these are known to exist

  20. Extender for securing a closure

    Science.gov (United States)

    Thomas, II, Patrick A.

    2012-10-02

    An apparatus for securing a closure such as door or a window that opens and closes by movement relative to a fixed structure such as a wall or a floor. Many embodiments provide a device for relocating a padlock from its normal location where it secures a fastener (such as a hasp) to a location for the padlock that is more accessible for locking and unlocking the padlock. Typically an extender is provided, where the extender has a hook at a first end that is disposed through the eye of the staple of the hasp, and at an opposing second end the extender has an annulus, such as a hole in the extender or a loop or ring affixed to the extender. The shackle of the padlock may be disposed through the annulus and may be disposed through the eye of a second staple to secure the door or window in a closed or open position. Some embodiments employ a rigid sheath to enclose at least a portion of the extender. Typically the rigid sheath has an open state where the hook is exposed outside the sheath and a closed state where the hook is disposed within the sheath.

  1. Physiological and psychological impacts of extended work hours in logging operations

    Science.gov (United States)

    Dana Mitchell; Tom Gallagher

    2007-01-01

    A study was initiated in 2006 to develop an understanding of the considerations of using extended work hours in the logging industry in the southeastern United States. Through semistructured interviews, it was obvious that loggers were individually creating ways of successfully implementing extended working hours without understanding the impacts that extended working...

  2. 76 FR 78246 - Extension of the Extended Missing Parts Pilot Program

    Science.gov (United States)

    2011-12-16

    ...] Extension of the Extended Missing Parts Pilot Program AGENCY: United States Patent and Trademark Office... better gauge whether the Extended Missing Parts Program offers sufficient benefits to the patent... in the Extended Missing Parts Pilot Program by using Form PTO/SB/421. For utility patent applications...

  3. Chemistry with an Artificial Primer of Polyhydroxybutyrate Synthase Suggests a Mechanism for Chain Termination

    Science.gov (United States)

    2015-01-01

    Polyhydroxybutyrate (PHB) synthases (PhaCs) catalyze the conversion of 3-(R)-hydroxybutyryl CoA (HBCoA) to PHB, which is deposited as granules in the cytoplasm of microorganisms. The class I PhaC from Caulobacter crescentus (PhaCCc) is a highly soluble protein with a turnover number of 75 s–1 and no lag phase in coenzyme A (CoA) release. Studies with [1-14C]HBCoA and PhaCCc monitored by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and autoradiography reveal that the rate of elongation is much faster than the rate of initiation. Priming with the artificial primer [3H]sTCoA and monitoring for CoA release reveal a single CoA/PhaC, suggesting that the protein is uniformly loaded and that the elongation process could be studied. Reaction of sT-PhaCCc with [1-14C]HBCoA revealed that priming with sTCoA increased the uniformity of elongation, allowing distinct polymerization species to be observed by SDS–PAGE and autoradiography. However, in the absence of HBCoA, [3H]sT-PhaC unexpectedly generates [3H]sDCoA with a rate constant of 0.017 s–1. We propose that the [3H]sDCoA forms via attack of CoA on the oxoester of the [3H]sT-PhaC chain, leaving the synthase attached to a single HB unit. Comparison of the relative rate constants of thiolysis by CoA and elongation by PhaCCc, and the size of the PHB polymer generated in vivo, suggests a mechanism for chain termination and reinitiation. PMID:25741756

  4. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer c....... solfataricus CTP synthase according to a structural alignment with the E. coli enzyme all have large thermal parameters in the dimeric form. Furthermore, they are seen to undergo substantial movement upon tetramerization....

  5. Small angle X-ray scattering studies on the X-ray induced aggregation of malate synthase

    International Nuclear Information System (INIS)

    Zipper, P.; Durchschlag, H.

    1980-01-01

    Malate synthase was investigated by the small-angle X-ray scattering technique in aqueous solution. Measurements extending for several hours revealed a continuous increase of the intensity in the innermost portion of the scattering curve. There is clear evidence that this increase was caused by an X-ray induced aggregation of enzyme particles during the performance of the small-angle X-ray scattering experiment. The monitoring of the aggregation process in situ by means of small-angle X-ray scattering led to a model of the way how the aggregation might proceed. The analysis of the scattering curves of malate synthase taken at various stages of aggregation established the retention of the thickness factor of the native enzyme and the occurrence of one and later on of two cross-section factors. The process of aggregation was also reflected by the increase of extension of the distance distribution function. Measurements of enzymic activity and small-angle X-ray scattering on samples, which had been X-irradiated with a defined dose prior to the measurements, established two different series of efficiency for the protection of the enzyme against aggregation and inactivation. The results showed that there is no direct relation between the extent of aggregation and the loss of enzymic activity. (orig./MG) [de

  6. Extended Year, Extended Contracts: Increasing Teacher Salary Options.

    Science.gov (United States)

    Gandara, Patricia

    1992-01-01

    Reports on an attempt to raise teacher salaries through an extended contract made possible through year-round school schedules. Teacher satisfaction with the 1987 experiment in three California schools (the Orchard Plan) has been high. Elements that have contributed to job satisfaction are discussed. (SLD)

  7. Extended cognition in science communication.

    Science.gov (United States)

    Ludwig, David

    2014-11-01

    The aim of this article is to propose a methodological externalism that takes knowledge about science to be partly constituted by the environment. My starting point is the debate about extended cognition in contemporary philosophy and cognitive science. Externalists claim that human cognition extends beyond the brain and can be partly constituted by external devices. First, I show that most studies of public knowledge about science are based on an internalist framework that excludes the environment we usually utilize to make sense of science and does not allow the possibility of extended knowledge. In a second step, I argue that science communication studies should adopt a methodological externalism and accept that knowledge about science can be partly realized by external information resources such as Wikipedia. © The Author(s) 2013.

  8. Differential inequalities imposed by the extended hypergeometric function.

    Science.gov (United States)

    Ibrahim, Rabha W; Ahmad, M Z; Al-Janaby, Hiba F

    2016-01-01

    Recently, the generalized hypergeometric function is extended by utilizing the Beta function. Based on this type of function, we introduce a new operator in the open unit disk. The present article investigates some subordination and superordination results for certain normalized analytic functions in the open unit disk, which are acted upon by the generalized Noor integral operator. Some of outcomes improve and generalize previously known outcomes.

  9. Shear rheology of extended nanoparticles

    Science.gov (United States)

    Petersen, Matt K.; Lane, J. Matthew D.; Grest, Gary S.

    2010-07-01

    Nonequilibrium molecular-dynamics simulations are presented for the shear rheology of suspensions of extended “jack”-shaped nanoparticles in an explicit solvent. The shear viscosity is measured for two jack-shaped nanoparticle suspensions for volume fractions from 0.01 to 0.15 and compared to spherical nanoparticles of the same mass. Large differences, in some cases, orders of magnitude, are observed for both the equilibrium viscosity and diffusion constant as the shape of the nanoparticle is varied. The source of enhanced viscosity is the very large effective volume swept out by these extended nanoparticles which allows them to become highly entangled even at low volume fraction.

  10. Effective operators and extended symmetry

    CERN Document Server

    Frère, J M; Moreno, J M; Orloff, J

    1994-01-01

    In this note we expand on our previous study of the implications of LEP1 results for future colliders. We extend the effective operator-based analysis of De R\\'ujula et al. to a larger symmetry group, and show at which cost their expectations can be relaxed. Of particular interest to experiment is a rephrasing of our previous results in terms of the Renard et al. parametrization for the gauge boson self-couplings (slightly extended to include $\\delta g_{\\gamma}$). We suggest the use of a ($\\delta g_{\\gamma}$, $\\delta g_{Z}$) plot to confront the expectations of various models.

  11. Adjustable extender for instrument module

    International Nuclear Information System (INIS)

    Sevec, J.B.; Stein, A.D.

    1975-01-01

    A blank extender module used to mount an instrument module in front of its console for repair or test purposes has been equipped with a rotatable mount and means for locking the mount at various angles of rotation for easy accessibility. The rotatable mount includes a horizontal conduit supported by bearings within the blank module. The conduit is spring-biased in a retracted position within the blank module and in this position a small gear mounted on the conduit periphery is locked by a fixed pawl. The conduit and instrument mount can be pulled into an extended position with the gear clearing the pawl to permit rotation and adjustment of the instrument

  12. Exclusion Bounds for Extended Anyons

    Science.gov (United States)

    Larson, Simon; Lundholm, Douglas

    2018-01-01

    We introduce a rigorous approach to the many-body spectral theory of extended anyons, that is quantum particles confined to two dimensions that interact via attached magnetic fluxes of finite extent. Our main results are many-body magnetic Hardy inequalities and local exclusion principles for these particles, leading to estimates for the ground-state energy of the anyon gas over the full range of the parameters. This brings out further non-trivial aspects in the dependence on the anyonic statistics parameter, and also gives improvements in the ideal (non-extended) case.

  13. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  14. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  15. Bifunctional recombinant fusion enzyme between maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase of thermophilic microorganism Metallosphaera hakonensis.

    Science.gov (United States)

    Seo, Ju-Seok; An, Ju Hee; Cheong, Jong-Joo; Choi, Yang Do; Kim, Chung Ho

    2008-09-01

    MhMTS and MhMTH are trehalose (alpha-D-glucopyranosyl- [1,1]-alpha-D-glucopyranose) biosynthesis genes of the thermophilic microorganism Metallosphaera hakonensis, and encode a maltooligosyltrehalose synthase (MhMTS) and a maltooligosyltrehalose trehalohydrolase (MhMTH), respectively. In this study, the two genes were fused inframe in a recombinant DNA, and expressed in Escherichia coli to produce a bifunctional fusion enzyme, MhMTSH. Similar to the two-step reactions with MhMTS and MhMTH, the fusion enzyme catalyzed the sequential reactions on maltopentaose, maltotriosyltrehalose formation, and following hydrolysis, producing trehalose and maltotriose. Optimum conditions for the fusion enzyme-catalyzed trehalose synthesis were around 70 degrees and pH 5.0-6.0. The MhMTSH fusion enzyme exhibited a high degree of thermostability, retaining 80% of the activity when pre-incubated at 70 degrees for 48 h. The stability was gradually abolished by incubating the fusion enzyme at above 80 degrees . The MhMTSH fusion enzyme was active on various sizes of maltooligosaccharides, extending its substrate specificity to soluble starch, the most abundant natural source of trehalose production.

  16. C. elegans aging is modulated by hydrogen sulfide and the sulfhydrylase/cysteine synthase cysl-2.

    Science.gov (United States)

    Qabazard, Bedoor; Ahmed, Samanza; Li, Ling; Arlt, Volker M; Moore, Philip K; Stürzenbaum, Stephen R

    2013-01-01

    Exogenous hydrogen sulfide (H2S) administration and endogenous H2S metabolism were explored in the nematode C. elegans. Chronic treatment with a slow-releasing H2S donor, GYY4137, extended median survival by 17-23% and increased tolerance towards oxidative and endoplasmic reticulum (ER) stress. Also, cysl-2, a sulfhydrylase/cysteine synthase in C. elegans, was transcriptionally upregulated by GYY4137 treatment and the deletion of cysl-2 resulted in a significant reduction in lifespan which was partially recovered by the supplementation of GYY4137. Likewise, a mammalian cell culture system, GYY4137 was able to protect bovine aortic endothelial cells (BAECs) from oxidative stress and (H2O2)-induced cell death. Taken together, this provides further support that H2S exerts a protective function which is consistent with the longevity dividend theory. Overall, this study underlines the therapeutic potential of a slow-releasing H2S donor as regulators of the aging and cellular stress pathways.

  17. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  18. C. elegans aging is modulated by hydrogen sulfide and the sulfhydrylase/cysteine synthase cysl-2.

    Directory of Open Access Journals (Sweden)

    Bedoor Qabazard

    Full Text Available Exogenous hydrogen sulfide (H2S administration and endogenous H2S metabolism were explored in the nematode C. elegans. Chronic treatment with a slow-releasing H2S donor, GYY4137, extended median survival by 17-23% and increased tolerance towards oxidative and endoplasmic reticulum (ER stress. Also, cysl-2, a sulfhydrylase/cysteine synthase in C. elegans, was transcriptionally upregulated by GYY4137 treatment and the deletion of cysl-2 resulted in a significant reduction in lifespan which was partially recovered by the supplementation of GYY4137. Likewise, a mammalian cell culture system, GYY4137 was able to protect bovine aortic endothelial cells (BAECs from oxidative stress and (H2O2-induced cell death. Taken together, this provides further support that H2S exerts a protective function which is consistent with the longevity dividend theory. Overall, this study underlines the therapeutic potential of a slow-releasing H2S donor as regulators of the aging and cellular stress pathways.

  19. Extreme promiscuity of a bacterial and a plant diterpene synthase enables combinatorial biosynthesis.

    Science.gov (United States)

    Jia, Meirong; Potter, Kevin C; Peters, Reuben J

    2016-09-01

    Diterpenes are widely distributed across many biological kingdoms, where they serve a diverse range of physiological functions, and some have significant industrial utility. Their biosynthesis involves class I diterpene synthases (DTSs), whose activity can be preceded by that of class II diterpene cyclases (DTCs). Here, a modular metabolic engineering system was used to examine the promiscuity of DTSs. Strikingly, both a bacterial and plant DTS were found to exhibit extreme promiscuity, reacting with all available precursors with orthogonal activity, producing an olefin or hydroxyl group, respectively. Such DTS promiscuity enables combinatorial biosynthesis, with remarkably high yields for these unoptimized non-native enzymatic combinations (up to 15mg/L). Indeed, it was possible to readily characterize the 13 unknown products. Notably, 16 of the observed diterpenes were previously inaccessible, and these results provide biosynthetic routes that are further expected to enable assembly of more extended pathways to produce additionally elaborated 'non-natural' diterpenoids. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  20. Applying and extending Oracle Spatial

    CERN Document Server

    Simon Gerard Greener, Siva Ravada

    2013-01-01

    This book is an advanced practical guide to applying and extending Oracle Spatial.This book is for existing users of Oracle and Oracle Spatial who have, at a minimum, basic operational experience of using Oracle or an equivalent database. Advanced skills are not required.

  1. Ghosts in extended quasidilaton theories

    Science.gov (United States)

    Golovnev, Alexey; Trukhin, Aleksandr

    2017-11-01

    We report on our independent investigations of the puzzle of cosmological perturbations in extended quasidilaton. We confirm the claims of presence of the Boulware-Deser ghost. We use both the language of cosmological perturbations with broken diffeomorphisms and the Stückelberg approach.

  2. Extended memory management under RTOS

    Science.gov (United States)

    Plummer, M.

    1981-01-01

    A technique for extended memory management in ROLM 1666 computers using FORTRAN is presented. A general software system is described for which the technique can be ideally applied. The memory manager interface with the system is described. The protocols by which the manager is invoked are presented, as well as the methods used by the manager.

  3. Extended duration orbiter (EDO) insignia

    Science.gov (United States)

    1990-01-01

    Extended duration orbiter (EDO) insignia incorporates a space shuttle orbiter with payload bay doors (PLBDs) open and a spacelab module inside. Trailing the orbiter are the initials EDO. The EDO-modified Columbia, Orbiter Vehicle (OV) 102, will be flown for the first EDO mission, STS-50.

  4. Extended Duration Orbiter Medical Project

    Science.gov (United States)

    Leach, C. S.; Pool, S. L.; Sawin, C. F.; Nicogossian, A. E.

    1990-01-01

    The Extended Duration Orbiter (EDO) program addresses a need for more time to perform experiments and other tasks during Space Shuttle missions. As a part of this program, the Extended Duration Orbiter Medical Project (EDOMP) has been instituted to obtain information about physiologic effects of extending mission duration and the effectiveness of countermeasures against factors that might compromise crew health, safety, or performance on extended-duration missions. Only those investigations that address and characterize operational problems, develop countermeasures, or evaluate the effectiveness of countermeasures will be pursued. The EDOMP investigations will include flight-associated Detailed Supplementary Objectives as well as ground-based studies simulating the influence of microgravity. Investigator teams have been formed in the following areas: biomedical physiology, cardiovascular and fluid/electrolyte physiology, environmental health, muscle and exercise physiology, and neurophysiology. Major operational questions must be answered in each of these areas, and investigations have been designed to answer them. The EDO program will proceed only after countermeasures have been shown to be effective in preventing or mitigating the adverse changes they have been designed to attenuate. The program is underway and will continue on each Shuttle flight as the manifest builds toward a 16-day orbital flight.

  5. Extended unemployment and UI benefits

    OpenAIRE

    Robert G. Valletta; Katherine Kuang

    2010-01-01

    During the current labor market downturn, unemployment duration has reached levels well above its previous highs. Analysis of unemployment data suggests that extended unemployment insurance benefits have not been important factors in the increase in the duration of unemployment or in the elevated unemployment rate.

  6. Engage, Enhance, and Extend Learning!

    Science.gov (United States)

    Keren-Kolb, Liz

    2013-01-01

    Educators often say that technology is more than a gimmick or add-on, and that it should engage, enhance, or extend learning in ways that traditional tools do not. Yet they seldom stop to define these terms, and they can be confusing, especially for teachers and preservice teachers. Recently, while collaborating on an English language arts and…

  7. Loss of Ceramide Synthases Elicits a PHA-4/FoxA-, SKN-1-, and Autophagy-Dependent Lifespan Extension in C. elegans

    DEFF Research Database (Denmark)

    Jensen, Mai-Britt Mosbech; Færgeman, Nils J.; Ejsing, Christer S.

    2011-01-01

    , these lipid species are recognized as bioactive signalling molecules involved in regulation of cell growth, differentiation, senescence, and apoptosis, and thus a delicate equilibrium between the levels of these interconvertible lipid species underlies the balance between cell survival and death. The C....... elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2, and lagr-1. Here we show that functional loss of HYL-1 and LAGR-1 depletes 43:1;3 sphingolipids and extends lifespan in a PHA-4-, SKN-1-, and ATG-12-dependent manner. The transcription factors PHA-4 and SKN-1 as well as ATG-12, which...

  8. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  9. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  10. Molecular cloning and spatiotemporal expression of prostaglandin F synthase and microsomal prostaglandin E synthase-1 in porcine endometrium.

    Science.gov (United States)

    Waclawik, Agnieszka; Rivero-Muller, Adolfo; Blitek, Agnieszka; Kaczmarek, Monika M; Brokken, Leon J S; Watanabe, Kikuko; Rahman, Nafis A; Ziecik, Adam J

    2006-01-01

    Endometrial prostaglandins (PGs) and the PGE2/PGF2alpha ratio play an important role in regulating the estrous cycle and establishment of pregnancy. The enzymes downstream of cyclooxygenase-2 may determine the PGE2/PGF2alpha ratio in the porcine uterus. Thus, we have cloned porcine PGF synthase (PGFS) and microsomal PGE synthase-1 (mPGES-1) and characterized their expression in porcine endometrium during the estrous cycle and early pregnancy. PGFS and mPGES-1 amino acid sequences possessed a high degree (>67% and >77%, respectively) of identity with the other mammalian homologs. There was little modulation of mPGES-1 throughout the estrous cycle; however, PGFS expression was highly up-regulated in endometrium around the time of luteolysis. During early pregnancy, PGFS at the protein level showed a time-dependent increase (low on d 10-13, intermediate on d 14-23, and high on d 24-25). In pregnancy, expression of mPGES-1 was intermediate on d 10-11 and low on d 14-17 and then increased after d 22, reaching the maximum on d 24-25. Immunohistochemistry showed localization of PGFS and mPGES-1 proteins mainly in luminal and glandular epithelium. Concluding, the spatiotemporal expression of PGFS throughout the estrous cycle indicates an involvement of PGFS in regulating luteolysis in the pig. The comparison of endometrial PGFS and mPGES-1 expression on d 10-13 of the estrous cycle and pregnancy suggest a supportive role of these enzymes in determining the increase of uterine PGE2/PGF2alpha ratio during maternal recognition of pregnancy. Moreover, high expression of both PG synthases after initiation of implantation may indicate their significant role in placentation.

  11. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    Science.gov (United States)

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer.

  12. Construction of extended exponential general linear methods 524 ...

    African Journals Online (AJOL)

    This paper introduces a new approach for constructing higher order of EEGLM which have become very popular and novel due to its enviable stability properties. This paper also shows that methods 524 is stable with its characteristics root lies in a unit circle. Numerical experiments indicate that Extended Exponential ...

  13. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

    Science.gov (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

    2004-08-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  14. Structure-function features of a Mycoplasma glycolipid synthase derived from structural data integration, molecular simulations, and mutational analysis.

    Science.gov (United States)

    Romero-García, Javier; Francisco, Carles; Biarnés, Xevi; Planas, Antoni

    2013-01-01

    Glycoglycerolipids are structural components of mycoplasma membranes with a fundamental role in membrane properties and stability. Their biosynthesis is mediated by glycosyltransferases (GT) that catalyze the transfer of glycosyl units from a sugar nucleotide donor to diacylglycerol. The essential function of glycolipid synthases in mycoplasma viability, and the absence of glycoglycerolipids in animal host cells make these GT enzymes a target for drug discovery by designing specific inhibitors. However, rational drug design has been hampered by the lack of structural information for any mycoplasma GT. Most of the annotated GTs in pathogenic mycoplasmas belong to family GT2. We had previously shown that MG517 in Mycoplasma genitalium is a GT-A family GT2 membrane-associated glycolipid synthase. We present here a series of structural models of MG517 obtained by homology modeling following a multiple-template approach. The models have been validated by mutational analysis and refined by long scale molecular dynamics simulations. Based on the models, key structure-function relationships have been identified: The N-terminal GT domain has a GT-A topology that includes a non-conserved variable region involved in acceptor substrate binding. Glu193 is proposed as the catalytic base in the GT mechanism, and Asp40, Tyr126, Tyr169, Ile170 and Tyr218 define the substrates binding site. Mutation Y169F increases the enzyme activity and significantly alters the processivity (or sequential transferase activity) of the enzyme. This is the first structural model of a GT-A glycoglycerolipid synthase and provides preliminary insights into structure and function relationships in this family of enzymes.

  15. Structural and functional analysis of validoxylamine A 7'-phosphate synthase ValL involved in validamycin A biosynthesis.

    Directory of Open Access Journals (Sweden)

    Lina Zheng

    Full Text Available Validamycin A (Val-A is an effective antifungal agent widely used in Asian countries as crop protectant. Validoxylamine A, the core structure and intermediate of Val-A, consists of two C(7-cyclitol units connected by a rare C-N bond. In the Val-A biosynthetic gene cluster in Streptomyces hygroscopicus 5008, the ORF valL was initially annotated as a validoxylamine A 7'-phosphate(V7P synthase, whose encoded 497-aa protein shows high similarity with trehalose 6-phosphate(T6P synthase. Gene inactivation of valL abolished both validoxylamine A and validamycin A productivity, and complementation with a cloned valL recovered 10% production of the wild-type in the mutant, indicating the involvement of ValL in validoxylamine A biosynthesis. Also we determined the structures of ValL and ValL/trehalose complex. The structural data indicates that ValL adopts the typical fold of GT-B protein family, featuring two Rossmann-fold domains and an active site at domain junction. The residues in the active site are arranged in a manner homologous to that of Escherichia coli (E.coli T6P synthase OtsA. However, a significant discrepancy is found in the active-site loop region. Also noticeable structural variance is found around the active site entrance in the apo ValL structure while the region takes an ordered configuration upon binding of product analog trehalose. Furthermore, the modeling of V7P in the active site of ValL suggests that ValL might have a similar SNi-like mechanism as OtsA.

  16. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-05-01

    The R and S enantionmers of S-adenosyl-3-(/sup 2/H)3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with (1,4-/sup 2/H/sub 4/)-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral (/sup 2/H/sub 5/)spermidines were isolated and converted to their N/sub 1/,N/sub 7/-dibocspermidine-N/sub 4/-(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz /sup 1/H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral (/sup 2/H/sub 3/)dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH/sub 3/) in all cases studied to date.

  17. Ack kinase regulates CTP synthase filaments during Drosophila oogenesis.

    Science.gov (United States)

    Strochlic, Todd I; Stavrides, Kevin P; Thomas, Sam V; Nicolas, Emmanuelle; O'Reilly, Alana M; Peterson, Jeffrey R

    2014-11-01

    The enzyme CTP synthase (CTPS) dynamically assembles into macromolecular filaments in bacteria, yeast, Drosophila, and mammalian cells, but the role of this morphological reorganization in regulating CTPS activity is controversial. During Drosophila oogenesis, CTPS filaments are transiently apparent in ovarian germline cells during a period of intense genomic endoreplication and stockpiling of ribosomal RNA. Here, we demonstrate that CTPS filaments are catalytically active and that their assembly is regulated by the non-receptor tyrosine kinase DAck, the Drosophila homologue of mammalian Ack1 (activated cdc42-associated kinase 1), which we find also localizes to CTPS filaments. Egg chambers from flies deficient in DAck or lacking DAck catalytic activity exhibit disrupted CTPS filament architecture and morphological defects that correlate with reduced fertility. Furthermore, ovaries from these flies exhibit reduced levels of total RNA, suggesting that DAck may regulate CTP synthase activity. These findings highlight an unexpected function for DAck and provide insight into a novel pathway for the developmental control of an essential metabolic pathway governing nucleotide biosynthesis. © 2014 The Authors.

  18. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  19. Tomato linalool synthase is induced in trichomes by jasmonic acid

    Science.gov (United States)

    van Schie, Chris C. N.; Haring, Michel A.

    2007-01-01

    Tomato (Lycopersicon esculentum) plants emit a blend of volatile organic compounds, which mainly consists of terpenes. Upon herbivory or wounding, the emission of several terpenes increases. We have identified and characterized the first two tomato monoterpene synthases, LeMTS1 and LeMTS2. Although these proteins were highly homologous, recombinant LeMTS1 protein produced (R)-linalool from geranyl diphosphate (GPP) and (E)-nerolidol from farnesyl diphosphate (FPP), while recombinant LeMTS2 produced β-phellandrene, β-myrcene, and sabinene from GPP. In addition, these genes were expressed in different tissues: LeMTS1 was expressed in flowers, young leaves, stems, and petioles, while LeMTS2 was strongest expressed in stems and roots. LeMTS1 expression in leaves was induced by spider mite-infestation, wounding and jasmonic acid (JA)-treatment, while LeMTS2 did not respond to these stimuli. The expression of LeMTS1 in stems and petioles was predominantly detected in trichomes and could be induced by JA. Because JA treatment strongly induced emission of linalool and overexpression of LeMTS1 in tomato resulted in increased production of linalool, we propose that LeMTS1 is a genuine linalool synthase. Our results underline the importance of trichomes in JA-induced terpene emission in tomato. PMID:17440821

  20. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  1. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    DEFF Research Database (Denmark)

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph

    2017-01-01

    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  2. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  3. Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found ...

  4. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...

  5. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  6. The localization of chitin synthase in membranous vesicles (chitosomes) in Neurospora crassa

    NARCIS (Netherlands)

    Sietsma, JH; Din, AB; Ziv, [No Value; Sjollema, KA; Yarden, O

    Polyclonal anti-chitin synthase antibodies raised against the Saccharomyces cerevisiae CHS2 gene product were used to identify and localize chitin synthase in the filamentous ascomycete Neurospora crassa. A single band of approximately 110 kDa was observed in Western blots of total protein extracts

  7. Organellar and cytosolic localization of four phosphoribosyl diphosphate synthase isozymes in spinach

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1999-01-01

    ) required inorganic phosphate for activity, whereas the others were phosphate independent. PRPP synthase isozymes 2 and 3 contained 76 and 87 amino acid extensions, respectively, at their N-terminal ends in comparison with other PRPP synthases. Isozyme 2 was synthesized in vitro and shown to be imported...

  8. Domain swapping of Citrus limon monoterpene synthases: impact on enzymatic activity and product specifity.

    NARCIS (Netherlands)

    Tamer, el M.K.; Lucker, J.; Bosch, D.; Verhoeven, H.A.; Verstappen, F.W.A.; Schwab, W.; Tunen, van A.J.; Voragen, A.G.J.; Maagd, de R.A.; Bouwmeester, H.J.

    2003-01-01

    Monoterpene cyclases are the key enzymes in the monoterpene biosynthetic pathway, as they catalyze the cyclization of the ubiquitous geranyl diphosphate (GDP) to the specific monoterpene skeletons. From Citrus limon, four monoterpene synthase-encoding cDNAs for a P-pinene synthase named

  9. KORRIGAN1 Interacts Specifically with Integral Components of the Cellulose Synthase Machinery

    NARCIS (Netherlands)

    Mansoori Zangir, N.; Timmers, J.F.P.; Desprez, T.; Lessa Alvim Kamei, C.; Dees, D.C.T.; Vincken, J.P.; Visser, R.G.F.; Höfte, H.; Vernhettes, S.; Trindade, L.M.

    2014-01-01

    Cellulose is synthesized by the so called rosette protein complex and the catalytic subunits of this complex are the cellulose synthases (CESAs). It is thought that the rosette complexes in the primary and secondary cell walls each contains at least three different non-redundant cellulose synthases.

  10. The Primary Diterpene Synthase Products of Picea abies Levopimaradiene/Abietadiene Synthase (PaLAS) Are Epimers of a Thermally Unstable Diterpenol*

    OpenAIRE

    Keeling, Christopher I.; Madilao, Lina L.; Zerbe, Philipp; Dullat, Harpreet K.; Bohlmann, Jörg

    2011-01-01

    The levopimaradiene/abietadiene synthase from Norway spruce (Picea abies; PaLAS) has previously been reported to produce a mixture of four diterpene hydrocarbons when incubated with geranylgeranyl diphosphate as the substrate: levopimaradiene, abietadiene, neoabietadiene, and palustradiene. However, variability in the assay products observed by GC-MS of this and orthologous conifer diterpene synthases over the past 15 years suggested that these diterpenes may not be the initial enzyme assay p...

  11. Extended life aluminide fuel. Final report

    International Nuclear Information System (INIS)

    Miller, L.G.; Beeston, J.M.

    1986-06-01

    As the price of fuel fabrication, shipment of both new and spent fuel, and fuel reprocessing continue to rise at a rapid rate, researchers look for alternate methods to keep reactor fuel costs within their limited funding. Extended fuel element lifetimes, without jeopardizing reactor safety, can reduce fuel costs by up to a factor of two. The Extended Life Aluminide (ELAF) program was started at the Idaho National Engineering Laboratory (INEL) as a joint project of the United States Department of Energy (DOE), the University of Missouri, and the Massachusetts Institute of Technology research reactors. Fuel plates of Advanced Test Reactor (ATR) type construction were fabricated at Atomics International and irradiated in the ATR at the INEL. Four fuel matrix compositions were tested (i.e., 50 vol% UAl/sub x/ cores for reference, and 40, 45 and 50 vol% UAl 2 cores). The 50 vol% UAl 2 cores contained up to 3 grams U-235 per cm 3 of core. Three plates of each composition were irradiated to peak burnup levels of 3 x 10 21 fission/cm 3 of core. The only observed damage was due to external corrosion at similar rates experienced by UAl/sub x/ fuel elements in test reactors

  12. Extending Conceptual Schemas with Business Process Information

    Directory of Open Access Journals (Sweden)

    Marco Brambilla

    2010-01-01

    Full Text Available The specification of business processes is becoming a more and more critical aspect for organizations. Such processes are specified as workflow models expressing the logical precedence among the different business activities (i.e., the units of work. Typically, workflow models are managed through specific subsystems, called workflow management systems, to ensure a consistent behavior of the applications with respect to the organization business process. However, for small organizations and/or simple business processes, the complexity and capabilities of these dedicated workflow engines may be overwhelming. In this paper, we therefore, advocate for a different and lightweight approach, consisting in the integration of the business process specification within the system conceptual schema. We show how a workflow-extended conceptual schema can be automatically obtained, which serves both to enforce the organization business process and to manage all its relevant domain data in a unified way. This extended model can be directly processed with current CASE tools, for instance, to generate an implementation of the system (including its business process in any technological platform.

  13. cDNA isolation, functional expression, and characterization of (+)-alpha-pinene synthase and (-)-alpha-pinene synthase from loblolly pine (Pinus taeda): stereocontrol in pinene biosynthesis.

    Science.gov (United States)

    Phillips, Michael A; Wildung, Mark R; Williams, David C; Hyatt, David C; Croteau, Rodney

    2003-03-15

    The complex mixture of monoterpenes, sesquiterpenes, and diterpenes that comprises oleoresin provides the primary defense of conifers against bark beetles and their associated fungal pathogens. Monoterpene synthases produce the turpentine fraction of oleoresin, which allows mobilization of the diterpene resin acid component (rosin) and is also toxic toward invading insects; this is particularly the case for alpha-pinene, a prominent bicyclic monoterpene of pine turpentine. The stereochemistry of alpha-pinene is a critical determinant of host defense capability and has implications for host selection, insect pheromone biosynthesis, and tritrophic-level interactions. Pines produce both enantiomers of alpha-pinene, which appear to arise through antipodal reaction mechanisms by distinct enzymes. Using a cDNA library constructed with mRNA from flushing needles of loblolly pine (Pinus taeda), we employed a homology-based cloning strategy to isolate, and confirm by functional expression, the genes encoding (+)-(3R:5R)-alpha-pinene synthase, (-)-(3S:5S)-alpha-pinene synthase, and several other terpene synthases. The pinene synthases, which produce mirror-image products, share only 66% amino acid identity (72% similarity) but are similar in general properties to other monoterpene synthases of gymnosperms. The stereochemical control of monoterpene cyclization reactions, the evolution of "antipodal" enzymes, and the implications of turpentine composition in ecological interactions are discussed.

  14. Departies: conceptualizing extended youth parties

    DEFF Research Database (Denmark)

    Fjær, Eivind Grip; Tutenges, Sébastien

    2017-01-01

    Every year, millions of young people travel away from home to party for days or weeks on end in permissive environments, such as music festivals, dance parties, and nightlife resorts. The studies that have been conducted on these extended youth parties have focused primarily on specific risk......-taking behaviors, such as drug use and violence. Here, we scrutinize the research on extended youth parties to identify general changes that young people undergo at these events. We call these celebrations departies, because they center on the organization and facilitation of momentary departures from...... immoral; (4) stylistically, by altering their stylistic expressions through dress, demeanor, and consumption; and (5) experientially, because the parties generate mood and mind alterations. These are overlapping and intertwined elements, the combination of which amounts to a distinct type of youth party...

  15. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    Science.gov (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  16. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  17. Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum.

    Science.gov (United States)

    Brodelius, Maria; Lundgren, Anneli; Mercke, Per; Brodelius, Peter E

    2002-07-01

    A clone encoding farnesyl diphosphate synthase (FPPS) was obtained by PCR from a cDNA library made from young leaves of Artemisia annua. A cDNA clone encoding the tobacco epi-aristolochene synthase (eAS) was kindly supplied by J. Chappell (University of Kentucky, Lexington, KY, USA). Two fusions were constructed, i.e. FPPS/eAS and eAS/FPPS. The stop codon of the N-terminal enzyme was removed and replaced by a short peptide (Gly-Ser-Gly) to introduce a linker between the two ORFs. These two fusions and the two single cDNA clones were separately introduced into a bacterial expression vector (pET32). Escherichia coli was transformed with the expression vectors and enzymatically active soluble proteins were obtained after induction with isopropyl thio-beta-d-thiogalactoside. The recombinant enzymes were purified using immobilized metal affinity chromatography on Co2+ columns. The fusion enzymes produced epi-aristolochene from isopentenyl diphosphate through a coupled reaction. The Km values of FPPS and eAS for isopentenyl diphosphate and farnesyl diphosphate, respectively, were essentially the same for the single and fused enzymes. The bifunctional enzymes showed a more efficient conversion of isopentenyl diphosphate to epi-aristolochene than the corresponding amount of single enzymes.

  18. Expression, crystallization and structure elucidation of γ-terpinene synthase from Thymus vulgaris.

    Science.gov (United States)

    Rudolph, Kristin; Parthier, Christoph; Egerer-Sieber, Claudia; Geiger, Daniel; Muller, Yves A; Kreis, Wolfgang; Müller-Uri, Frieder

    2016-01-01

    The biosynthesis of γ-terpinene, a precursor of the phenolic isomers thymol and carvacrol found in the essential oil from Thymus sp., is attributed to the activitiy of γ-terpinene synthase (TPS). Purified γ-terpinene synthase from T. vulgaris (TvTPS), the Thymus species that is the most widely spread and of the greatest economical importance, is able to catalyze the enzymatic conversion of geranyl diphosphate (GPP) to γ-terpinene. The crystal structure of recombinantly expressed and purified TvTPS is reported at 1.65 Å resolution, confirming the dimeric structure of the enzyme. The putative active site of TvTPS is deduced from its pronounced structural similarity to enzymes from other species of the Lamiaceae family involved in terpenoid biosynthesis: to (+)-bornyl diphosphate synthase and 1,8-cineole synthase from Salvia sp. and to (4S)-limonene synthase from Mentha spicata.

  19. Black holes from extended inflation

    International Nuclear Information System (INIS)

    Hsu, S.D.H.; Lawrence Berkeley Lab., CA

    1990-01-01

    It is argued that models of extended inflation, in which modified Einstein gravity allows a graceful exit from the false vacuum, lead to copious production of black holes. The critical temperature of the inflationary phase transition must be >10 8 GeV in order to avoid severe cosmological problems in a universe dominated by black holes. We speculate on the possibility that the interiors of false vacuum regions evolve into baby universes. (orig.)

  20. Locating and extending livelihoods research

    DEFF Research Database (Denmark)

    Prowse, Martin

    2008-01-01

    Much poverty and development research is not explicit about its methodology or philosophical foundations. Based on the extended case method of Burawoy and the epistemological standpoint of critical realism, this paper discusses a methodological approach for reflexive inductive livelihoods researc...... that overcomes the unproductive social science dualism of positivism and social constructivism. The approach is linked to a conceptual framework and a menu of research methods that can be sequenced and iterated in light of research questions....

  1. Extended producer responsibility in oligopoly

    OpenAIRE

    Hiroaki Ino

    2007-01-01

    I investigate the optimal environmental tax under a policy based on extended producer responsibility (EPR) in oligopoly markets. I introduce the recycling market and explicitly consider how these policies affect the incentive for recycling. I derive the optimal tax rule, which depends on the weighted sum of the markup in the product market and the markdown in the recycling market. In contrast to the existing works that emphasize that the optimal tax rate is lower than the marginal external da...

  2. Acyl hydrolases from trans-AT polyketide synthases target acetyl units on acyl carrier proteins.

    Science.gov (United States)

    Jenner, Matthew; Afonso, Jose P; Kohlhaas, Christoph; Karbaum, Petra; Frank, Sarah; Piel, Jörn; Oldham, Neil J

    2016-04-18

    Acyl hydrolase (AH) domains are a common feature of trans-AT PKSs. They have been hypothesised to perform a proofreading function by removing acyl chains from stalled sites. This study determines the substrate tolerance of the AH PedC for a range of acyl-ACPs. Clear preference towards short, linear acyl-ACPs is shown, with acetyl-ACP the best substrate. These results imply a more targeted housekeeping role for PedC: namely the removal of unwanted acetyl groups from ACP domains caused by erroneous transfer of acetyl-CoA, or possibly by decarboxylation of malonyl-ACP.

  3. Mechanical strainer unit

    International Nuclear Information System (INIS)

    Kraeling, J.B.; Netkowicz, R.J.; Schnall, I.H.

    1983-01-01

    The mechanical strainer unit is connected to a flanged conduit which originates in and extends out of a suppression chamber in a nuclear reactor. The strainer includes a plurality of centrally apertured plates positioned along a common central axis and in parallel and spaced relationship. The plates have a plurality of bores radially spaced about the central axis. Spacer means such as washers are positioned between adjacent plates to maintain the plates is spaced relationship and form communicating passages of a predetermined size to the central apertures. Connecting means such as bolts or studs extend through the aligned bores to maintain the unit in assembled relationship and secure the unit to the pipe. By employing perforated plates and blocking off certain of the communicating passages, a dual straining effect can be achieved

  4. ATP synthase from slow and fast growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    NARCIS (Netherlands)

    Haagsma, A.C.; Driessen, N.N.; Hahn, M.M.; Lill, H.; Bald, D.

    2010-01-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme

  5. ATP synthase in slow- and fast-growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    NARCIS (Netherlands)

    Haagsma, A.C.; Driessen, N.N.; Hahn, M.M.; Lill, H.; Bald, D.

    2010-01-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme

  6. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  7. Illuminating the diversity of aromatic polyketide synthases in Aspergillus nidulans.

    Science.gov (United States)

    Ahuja, Manmeet; Chiang, Yi-Ming; Chang, Shu-Lin; Praseuth, Mike B; Entwistle, Ruth; Sanchez, James F; Lo, Hsien-Chun; Yeh, Hsu-Hua; Oakley, Berl R; Wang, Clay C C

    2012-05-16

    Genome sequencing has revealed that fungi have the ability to synthesize many more natural products (NPs) than are currently known, but methods for obtaining suitable expression of NPs have been inadequate. We have developed a successful strategy that bypasses normal regulatory mechanisms. By efficient gene targeting, we have replaced, en masse, the promoters of nonreducing polyketide synthase (NR-PKS) genes, key genes in NP biosynthetic pathways, and other genes necessary for NR-PKS product formation or release. This has allowed us to determine the products of eight NR-PKSs of Aspergillus nidulans, including seven novel compounds, as well as the NR-PKS genes required for the synthesis of the toxins alternariol (8) and cichorine (19).

  8. Noncovalent Intermediate of Thymidylate Synthase: Fact or Fiction?

    Science.gov (United States)

    Kholodar, Svetlana A; Kohen, Amnon

    2016-07-06

    Thymidylate synthase is an attractive target for antibiotic and anticancer drugs due to its essential role in the de novo biosynthesis of the DNA nucleotide thymine. The enzymatic reaction is initiated by a nucleophilic activation of the substrate via formation of a covalent bond to an active site cysteine. The traditionally accepted mechanism is then followed by a series of covalently bound intermediates, where that bond is only cleaved upon product release. Recent computational and experimental studies suggest that the covalent bond between the protein and substrate is actually quite labile. Importantly, these findings predict the existence of a noncovalently bound bisubstrate intermediate, not previously anticipated, which could be the target of a novel class of drugs inhibiting DNA biosynthesis. Here we report the synthesis of the proposed intermediate and findings supporting its chemical and kinetic competence. These findings substantiate the predicted nontraditional mechanism and the potential of this intermediate as a new drug lead.

  9. Tryptophan Synthase Uses an Atypical Mechanism To Achieve Substrate Specificity.

    Science.gov (United States)

    Buller, Andrew R; van Roye, Paul; Murciano-Calles, Javier; Arnold, Frances H

    2016-12-27

    Tryptophan synthase (TrpS) catalyzes the final steps in the biosynthesis of l-tryptophan from l-serine (Ser) and indole-3-glycerol phosphate (IGP). We report that native TrpS can also catalyze a productive reaction with l-threonine (Thr), leading to (2S,3S)-β-methyltryptophan. Surprisingly, β-substitution occurs in vitro with a 3.4-fold higher catalytic efficiency for Ser over Thr using saturating indole, despite a >82000-fold preference for Ser in direct competition using IGP. Structural data identify a novel product binding site, and kinetic experiments clarify the atypical mechanism of specificity: Thr binds efficiently but decreases the affinity for indole and disrupts the allosteric signaling that regulates the catalytic cycle.

  10. Catalysis and Sulfa Drug Resistance in Dihydropteroate Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Mi-Kyung; Wu, Yinan; Li, Zhenmei; Zhao, Ying; Waddell, M. Brett; Ferreira, Antonio M.; Lee, Richard E.; Bashford, Donald; White, Stephen W. (SJCH)

    2013-04-08

    The sulfonamide antibiotics inhibit dihydropteroate synthase (DHPS), a key enzyme in the folate pathway of bacteria and primitive eukaryotes. However, resistance mutations have severely compromised the usefulness of these drugs. We report structural, computational, and mutagenesis studies on the catalytic and resistance mechanisms of DHPS. By performing the enzyme-catalyzed reaction in crystalline DHPS, we have structurally characterized key intermediates along the reaction pathway. Results support an S{sub N}1 reaction mechanism via formation of a novel cationic pterin intermediate. We also show that two conserved loops generate a substructure during catalysis that creates a specific binding pocket for p-aminobenzoic acid, one of the two DHPS substrates. This substructure, together with the pterin-binding pocket, explains the roles of the conserved active-site residues and reveals how sulfonamide resistance arises.

  11. Atomic model for the dimeric FOregion of mitochondrial ATP synthase.

    Science.gov (United States)

    Guo, Hui; Bueler, Stephanie A; Rubinstein, John L

    2017-11-17

    Mitochondrial adenosine triphosphate (ATP) synthase produces the majority of ATP in eukaryotic cells, and its dimerization is necessary to create the inner membrane folds, or cristae, characteristic of mitochondria. Proton translocation through the membrane-embedded F O region turns the rotor that drives ATP synthesis in the soluble F 1 region. Although crystal structures of the F 1 region have illustrated how this rotation leads to ATP synthesis, understanding how proton translocation produces the rotation has been impeded by the lack of an experimental atomic model for the F O region. Using cryo-electron microscopy, we determined the structure of the dimeric F O complex from Saccharomyces cerevisiae at a resolution of 3.6 angstroms. The structure clarifies how the protons travel through the complex, how the complex dimerizes, and how the dimers bend the membrane to produce cristae. Copyright © 2017, American Association for the Advancement of Science.

  12. Plant diterpene synthases: exploring modularity and metabolic diversity for bioengineering.

    Science.gov (United States)

    Zerbe, Philipp; Bohlmann, Jörg

    2015-07-01

    Plants produce thousands of diterpenoid natural products; some of which are of significant industrial value as biobased pharmaceuticals (taxol), fragrances (sclareol), food additives (steviosides), and commodity chemicals (diterpene resin acids). In nature, diterpene synthase (diTPS) enzymes are essential for generating diverse diterpene hydrocarbon scaffolds. While some diTPSs also form oxygenated compounds, more commonly, oxygenation is achieved by cytochrome P450-dependent mono-oxygenases. Recent genome-, transcriptome-, and metabolome-guided gene discovery and enzyme characterization identified novel diTPS functions that form the core of complex modular pathway systems. Insights into diterpene metabolism may translate into the development of new bioengineered microbial and plant-based production systems. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

    Directory of Open Access Journals (Sweden)

    Mei Lan Jin

    2017-11-01

    Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  14. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Enhanced Symbiotic Performance by Rhizobium tropici Glycogen Synthase Mutants

    Science.gov (United States)

    Marroquí, Silvia; Zorreguieta, Angeles; Santamaría, Carmen; Temprano, Francisco; Soberón, Mario; Megías, Manuel; Downie, J. Allan

    2001-01-01

    We isolated a Tn5-induced Rhizobium tropici mutant that has enhanced capacity to oxidize N,N-dimethyl-p-phenylendiamine (DMPD) and therefore has enhanced respiration via cytochrome oxidase. The mutant had increased levels of the cytochromes c1 and CycM and a small increase in the amount of cytochrome aa3. In plant tests, the mutant increased the dry weight of Phaseolus vulgaris plants by 20 to 38% compared with the control strain, thus showing significantly enhanced symbiotic performance. The predicted product of the mutated gene is homologous to glycogen synthases from several bacteria, and the mutant lacked glycogen. The DNA sequence of the adjacent gene region revealed six genes predicted to encode products homologous to the following gene products from Escherichia coli: glycogen phosphorylase (glgP), glycogen branching enzyme (glgB), ADP glucose pyrophosphorylase (glgC), glycogen synthase (glgA), phosphoglucomutase (pgm), and glycogen debranching enzyme (glgX). All six genes are transcribed in the same direction, and analysis with lacZ gene fusions suggests that the first five genes are organized in one operon, although pgm appears to have an additional promoter; glgX is transcribed independently. Surprisingly, the glgA mutant had decreased levels of high-molecular-weight exopolysaccharide after growth on glucose, but levels were normal after growth on galactose. A deletion mutant was constructed in order to generate a nonpolar mutation in glgA. This mutant had a phenotype similar to that of the Tn5 mutant, indicating that the enhanced respiration and symbiotic nitrogen fixation and decreased exopolysaccharide were due to mutation of glgA and not to a polar effect on a downstream gene. PMID:11208782

  16. Intestinal nitric oxide synthase activity changes during experimental colon obstruction.

    Science.gov (United States)

    Palásthy, Zsolt; Kaszaki, József; Lázár, György; Nagy, Sándor; Boros, Mihály

    2006-08-01

    The experiments in this study were designed to follow the time course of nitric oxide (NO) synthesis in the large bowel during acute mechanical ileus. Occlusion of the mid-transverse colon was maintained for 420 min in anesthetized dogs. Strain-gauge transducers were used to analyze motility changes on the hepatic and lienal flexures, respectively. Constitutive NO synthase (cNOS) and inducible NOS (iNOS) activities were determined in tissue biopsies, and plasma nitrite/nitrate (NOx) level was measured in the portal blood. Following completion of the baseline studies, the animals were treated with either 7-nitroindazole (7-NI, selective neuronal NOS inhibitor), or N-nitro-L-arginine (NNA, non-selective NOS inhibitor). In the sham-operated group the cNOS activities differed significantly in the oral and aboral tissue samples (oral: 102.9; versus aboral: 62.1 fmol/mg protein/min). The obstruction elicited a significant increase in portal NOx and elevated tissue inducible NO synthase (iNOS) activity. NNA treatment decreased the motility index in both intestinal segments for 60 min, but 120 min later the motility index was significantly elevated (2.5-fold increase in the oral part, and 1.8-fold enhancement in the aboral segment, respectively). Treatment with 7-NI decreased the cNOS activity in the oral and aboral parts by approximately 40% and 70%, respectively, and suppressed the motility increase in the aboral colon segment. The motility of the colon was either significantly increased or decreased, depending on the type and selectivity of the NOS inhibitor compounds applied. NO of neuronal origin is a transmitter that stimulates peristaltic activity; but an increased iNOS/nNOS ratio significantly moderates the obstruction-induced motility increase.

  17. Analysis of the Thiocapsa pfennigii polyhydroxyalkanoate synthase: subcloning, molecular characterization and generation of hybrid synthases with the corresponding Chromatium vinosum enzyme.

    Science.gov (United States)

    Liebergesell, M; Rahalkar, S; Steinbüchel, A

    2000-08-01

    The PHA synthase structural gene of Thiocapsa pfennigii was identified and subcloned on a 2.8-kbp BamHI restriction fragment, which was cloned recently from a genomic 15.6-kbp EcoRI restriction fragment. Nucleotide sequence analysis of this fragment revealed three open reading frames (ORFs), representing coding regions. Two ORFs encoded for the PhaE (Mr 40,950) and PhaC (Mr 40,190) subunits of the PHA synthase from T. pfennigii and exhibited high homology with the corresponding proteins of the Chromatium vinosum (52.8% and 85.2% amino acid identity) and the Thiocystis violacea (52.5% and 82.4%) PHA synthases, respectively. This confirmed that the T. pfennigii PHA synthase was composed of two different subunits. Also, with respect to the molecular organization of phaE and phaC, this region of the T. pfennigii genome resembled very much the corresponding regions of C. vinosum and of Thiocystis violacea. A recombinant strain of Pseudomonas putida, which overexpressed phaE and phaC from T. pfennigii, was used to isolate the PHA synthase by a two-step procedure including chromatography on Procion Blue H-ERD and hydroxyapatite. The isolated PHA synthase consisted of two proteins exhibiting the molecular weights predicted for PhaE and PhaC. Hybrid PHA synthases composed of PhaE from T. pfennigii and PhaC from C. vinosum and vice versa were constructed and functionally expressed in a PHA-negative mutant of P. putida; and the resulting PHAs were analyzed.

  18. [Double-antisense ACC oxidase and ACC synthase fusion gene introduced into tomato by Agrobacterium-mediated transformation and analysis the ethylene production of transgenic plants].

    Science.gov (United States)

    Xiong, Ai Sheng; Yao, Quan Hong; Li, Xian; Fan, Hui Qin; Peng, Ri He

    2003-12-01

    The tomato fruit-specific promoter 2A11 was amplified from tomato genomic DNA using PCR techniques. Total RNA was isolated from ripen fruit of tomato, then ACC oxidase gene and ACC synthase gene were obtained using reverse-transcription polymerase chain reaction. The fusion encoding ACC oxidase and ACC synthase gene was obtained through ACC oxidase gene and ACC synthase gene ligation. The fusion gene was then inserted into a plant binary vector pYPX145 in an inverted orientation. Finally, the binary plant expression vector pOSACC was constructed in which the double-antisense fusion gene was controlled by fruit-specific 2A11 promoter. By using hypocotyls and cotyledon petioles as explants, the unit of double-antisense fusion gene was successfully introduced into tomato (Lycopersicon esculentum Mill) cultivar "Hezuo 903" by Agrobacterium tumefaciens-mediated transformation. 105 transgenic plants were obtained through 200 mg/L kanamycin selection and GUS assay. Two lines of DR-1 and DR-2 were obtained through selecting the characteristics of prolonged shelf life and agriculture. The transgenic plants showed the characteristics of prolonged shelf life over 50 d. The amount of ethylene released from DR-1 and DR-2 fruits were reduced significantly to about 9.5% of that released by non-transformed controls.

  19. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD

    2015-10-26

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  20. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid.

    Science.gov (United States)

    Hagen, Andrew; Poust, Sean; Rond, Tristan de; Fortman, Jeffrey L; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2016-01-15

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design-build-test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS' first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to "debug" PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  1. Extended inflation with induced gravity

    International Nuclear Information System (INIS)

    Accetta, F.S.; Trester, J.J.; Department of Physics, Yale University, New Haven, Connecticut 06520)

    1989-01-01

    We consider a recently proposed extended model of inflation which improves upon the original old inflation scenario by achieving a graceful exit from the false-vacuum phase. In this paper extended inflation is generalized to include a potential V(phi) for the Brans-Dicke-type field phi. We find that whereas a graceful exit can still be had, the inclusion of a potential places constraints on the percolation time scale for exiting the inflationary phase. Additional constraints on V(phi) and the false-vacuum energy density rho /sub F/ from density and gravitational-wave perturbations are discussed. For initially small values of phi the false vacuum undergoes power-law inflation, while for initially large values of phi the expansion is exponential. Within true-vacuum regions slow-rolling inflation can occur. As a result, this model generically leads to multiple episodes of inflation. We discuss the significance these multiple episodes of inflation may have on the formation of large-scale structure and the production of voids

  2. A photocrosslinking assay for reporting protein interactions in polyketide and fatty acid synthases.

    Science.gov (United States)

    Ye, Zhixia; Bair, Morgan; Desai, Hemant; Williams, Gavin J

    2011-11-01

    Understanding protein-protein interactions that occur between ACP and KS domains of polyketide synthases and fatty acid synthases is critical to improving the scope and efficiency of combinatorial biosynthesis efforts aimed at producing non-natural polyketides. Here, we report a facile strategy for rapidly reporting such ACP-KS interactions based on the incorporation of an amino acid with photocrosslinking functionality. Crucially, this photocrosslinking strategy can be applied to any polyketide or fatty acid synthase regardless of substrate specificity, and can be adapted to a high-throughput format for directed evolution studies. This journal is © The Royal Society of Chemistry 2011

  3. Probing the selectivity and protein·protein interactions of a nonreducing fungal polyketide synthase using mechanism-based crosslinkers.

    Science.gov (United States)

    Bruegger, Joel; Haushalter, Robert W; Haushalter, Bob; Vagstad, Anna L; Vagstad, Anna; Shakya, Gaurav; Mih, Nathan; Townsend, Craig A; Burkart, Michael D; Tsai, Shiou-Chuan

    2013-09-19

    Protein·protein interactions, which often involve interactions among an acyl carrier protein (ACP) and ACP partner enzymes, are important for coordinating polyketide biosynthesis. However, the nature of such interactions is not well understood, especially in the fungal nonreducing polyketide synthases (NR-PKSs) that biosynthesize toxic and pharmaceutically important polyketides. Here, we employ mechanism-based crosslinkers to successfully probe ACP and ketosynthase (KS) domain interactions in NR-PKSs. We found that crosslinking efficiency is closely correlated with the strength of ACP·KS interactions and that KS demonstrates strong starter unit selectivity. We further identified positively charged surface residues by KS mutagenesis, which mediates key interactions with the negatively charged ACP surface. Such complementary/matching contact pairs can serve as "adapter surfaces" for future efforts to generate new polyketides using NR-PKSs. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Transgenic peas (Pisum sativum) expressing polygalacturonase inhibiting protein from raspberry (Rubus idaeus) and stilbene synthase from grape (Vitis vinifera).

    Science.gov (United States)

    Richter, A; Jacobsen, H-J; de Kathen, A; de Lorenzo, G; Briviba, K; Hain, R; Ramsay, G; Kiesecker, H

    2006-11-01

    The pea (Pisum sativum L.) varieties Baroness (United Kingdome) and Baccara (France) were transformed via Agrobacterium tumefaciens-mediated gene transfer with pGPTV binary vectors containing the bar gene in combination with two different antifungal genes coding for polygalacturonase-inhibiting protein (PGIP) from raspberry (Rubus idaeus L.) driven by a double 35S promoter, or the stilbene synthase (Vst1) from grape (Vitis vinifera L.) driven by its own elicitor-inducible promoter. Transgenic lines were established and transgenes combined via conventional crossing. Resveratrol, produced by Vst1 transgenic plants, was detected using HPLC and the PGIP expression was determined in functional inhibition assays against fungal polygalacturonases. Stable inheritance of the antifungal genes in the transgenic plants was demonstrated.

  5. Functional identification of valerena-1,10-diene synthase, a terpene synthase catalyzing a unique chemical cascade in the biosynthesis of biologically active sesquiterpenes in Valeriana officinalis.

    Science.gov (United States)

    Yeo, Yun-Soo; Nybo, S Eric; Chittiboyina, Amar G; Weerasooriya, Aruna D; Wang, Yan-Hong; Góngora-Castillo, Elsa; Vaillancourt, Brieanne; Buell, C Robin; DellaPenna, Dean; Celiz, Mary Dawn; Jones, A Daniel; Wurtele, Eve Syrkin; Ransom, Nick; Dudareva, Natalia; Shaaban, Khaled A; Tibrewal, Nidhi; Chandra, Suman; Smillie, Troy; Khan, Ikhlas A; Coates, Robert M; Watt, David S; Chappell, Joe

    2013-02-01

    Valerian is an herbal preparation from the roots of Valeriana officinalis used as an anxiolytic and sedative and in the treatment of insomnia. The biological activities of valerian are attributed to valerenic acid and its putative biosynthetic precursor valerenadiene, sesquiterpenes, found in V. officinalis roots. These sesquiterpenes retain an isobutenyl side chain whose origin has been long recognized as enigmatic because a chemical rationalization for their biosynthesis has not been obvious. Using recently developed metabolomic and transcriptomic resources, we identified seven V. officinalis terpene synthase genes (VoTPSs), two that were functionally characterized as monoterpene synthases and three that preferred farnesyl diphosphate, the substrate for sesquiterpene synthases. The reaction products for two of the sesquiterpene synthases exhibiting root-specific expression were characterized by a combination of GC-MS and NMR in comparison to the terpenes accumulating in planta. VoTPS7 encodes for a synthase that biosynthesizes predominately germacrene C, whereas VoTPS1 catalyzes the conversion of farnesyl diphosphate to valerena-1,10-diene. Using a yeast expression system, specific labeled [(13)C]acetate, and NMR, we investigated the catalytic mechanism for VoTPS1 and provide evidence for the involvement of a caryophyllenyl carbocation, a cyclobutyl intermediate, in the biosynthesis of valerena-1,10-diene. We suggest a similar mechanism for the biosynthesis of several other biologically related isobutenyl-containing sesquiterpenes.

  6. Functional Identification of Valerena-1,10-diene Synthase, a Terpene Synthase Catalyzing a Unique Chemical Cascade in the Biosynthesis of Biologically Active Sesquiterpenes in Valeriana officinalis*

    Science.gov (United States)

    Yeo, Yun-Soo; Nybo, S. Eric; Chittiboyina, Amar G.; Weerasooriya, Aruna D.; Wang, Yan-Hong; Góngora-Castillo, Elsa; Vaillancourt, Brieanne; Buell, C. Robin; DellaPenna, Dean; Celiz, Mary Dawn; Jones, A. Daniel; Wurtele, Eve Syrkin; Ransom, Nick; Dudareva, Natalia; Shaaban, Khaled A.; Tibrewal, Nidhi; Chandra, Suman; Smillie, Troy; Khan, Ikhlas A.; Coates, Robert M.; Watt, David S.; Chappell, Joe

    2013-01-01

    Valerian is an herbal preparation from the roots of Valeriana officinalis used as an anxiolytic and sedative and in the treatment of insomnia. The biological activities of valerian are attributed to valerenic acid and its putative biosynthetic precursor valerenadiene, sesquiterpenes, found in V. officinalis roots. These sesquiterpenes retain an isobutenyl side chain whose origin has been long recognized as enigmatic because a chemical rationalization for their biosynthesis has not been obvious. Using recently developed metabolomic and transcriptomic resources, we identified seven V. officinalis terpene synthase genes (VoTPSs), two that were functionally characterized as monoterpene synthases and three that preferred farnesyl diphosphate, the substrate for sesquiterpene synthases. The reaction products for two of the sesquiterpene synthases exhibiting root-specific expression were characterized by a combination of GC-MS and NMR in comparison to the terpenes accumulating in planta. VoTPS7 encodes for a synthase that biosynthesizes predominately germacrene C, whereas VoTPS1 catalyzes the conversion of farnesyl diphosphate to valerena-1,10-diene. Using a yeast expression system, specific labeled [13C]acetate, and NMR, we investigated the catalytic mechanism for VoTPS1 and provide evidence for the involvement of a caryophyllenyl carbocation, a cyclobutyl intermediate, in the biosynthesis of valerena-1,10-diene. We suggest a similar mechanism for the biosynthesis of several other biologically related isobutenyl-containing sesquiterpenes. PMID:23243312

  7. Topics in Extended Dynamical Systems

    Science.gov (United States)

    Bhagavatula, Ravi S.

    This thesis consists of three chapters. Each chapter is self-contained and is devoted to the investigation of a particular topic in extended dynamical systems. In the first chapter, an approach based on Langevin equations is implemented to understand the non-Gaussian nature of the probability distribution function (PDF) of local diffusive variables in extended dynamical systems, e.g., a passive scalar advected by turbulent velocity fluctuations. Two mechanisms are proposed for the origin of non-Gaussian tails: One relies on the nature of temporal correlations of the fluctuations that couple additively to the diffusive field, leading to exponential and stretched exponential tails in the PDF; the other depends on multiplicative coupling between the diffusive field and the fluctuations, producing algebraic tails in the PDF. The mechanisms are illustrated using models for a passive scalar and also a current driven Josephson junction array. This study indicates that shapes of local PDFs in turbulent states are non-universal and crucially depend on local couplings and time scales. The second chapter establishes the existence of a class of locally conserving chaotic (deterministic) systems that exhibit Generic Scale Invariance--algebraic decay of spatial and temporal correlations without tuning parameters. This study also reveals the similarity between noise and chaos in extended systems as far as long-wavelength and long -time behavior is concerned. Specifically, a two dimensional coupled-map lattice model with a conserved density is numerically shown to exhibit, in agreement with heuristic arguments, algebraic decay of spatio-temporal correlations in chaotic states with simple predictable exponents. The third chapter investigates scaling behavior of earthquakes in seismic zone models in which an earthquake is modeled by a quasi-static description that ignores short -time dynamics during an earthquake. The models incorporate the essential feature of long-ranged stress

  8. Unit Manning

    National Research Council Canada - National Science Library

    McGinniss, Mike

    2003-01-01

    .... Army Alaska, will be the first Army unit manned under the Unit Manning Initiative. The Army's intent for unit manning is to improve combat readiness and cohesion while setting conditions for improved soldier and family well...

  9. Extended uncertainty from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Costa Filho, Raimundo N., E-mail: rai@fisica.ufc.br [Departamento de Física, Universidade Federal do Ceará, Caixa Postal 6030, Campus do Pici, 60455-760 Fortaleza, Ceará (Brazil); Braga, João P.M., E-mail: philipe@fisica.ufc.br [Instituto de Ciências Exatas e da Natureza-ICEN, Universidade da Integração Internacional da Lusofonia Afro-Brasileira-UNILAB, Campus dos Palmares, 62785-000 Acarape, Ceará (Brazil); Lira, Jorge H.S., E-mail: jorge.lira@mat.ufc.br [Departamento de Matemática, Universidade Federal do Ceará, Caixa Postal 6030, Campus do Pici, 60455-760 Fortaleza, Ceará (Brazil); Andrade, José S., E-mail: soares@fisica.ufc.br [Departamento de Física, Universidade Federal do Ceará, Caixa Postal 6030, Campus do Pici, 60455-760 Fortaleza, Ceará (Brazil)

    2016-04-10

    A translation operator acting in a space with a diagonal metric is introduced to describe the motion of a particle in a quantum system. We show that the momentum operator and, as a consequence, the uncertainty relation now depend on the metric. It is also shown that, for any metric expanded up to second order, this formalism naturally leads to an extended uncertainty principle (EUP) with a minimum momentum dispersion. The Ehrenfest theorem is modified to include an additional term related to a tidal force arriving from the space curvature introduced by the metric. For one-dimensional systems, we show how to map a harmonic potential to an effective potential in Euclidean space using different metrics.

  10. Learning Extended Finite State Machines

    Science.gov (United States)

    Cassel, Sofia; Howar, Falk; Jonsson, Bengt; Steffen, Bernhard

    2014-01-01

    We present an active learning algorithm for inferring extended finite state machines (EFSM)s, combining data flow and control behavior. Key to our learning technique is a novel learning model based on so-called tree queries. The learning algorithm uses the tree queries to infer symbolic data constraints on parameters, e.g., sequence numbers, time stamps, identifiers, or even simple arithmetic. We describe sufficient conditions for the properties that the symbolic constraints provided by a tree query in general must have to be usable in our learning model. We have evaluated our algorithm in a black-box scenario, where tree queries are realized through (black-box) testing. Our case studies include connection establishment in TCP and a priority queue from the Java Class Library.

  11. Harmonic superspaces of extended supersymmetry

    International Nuclear Information System (INIS)

    Ivanov, E.; Kalitzin, S.; Nguyen Ai Viet; Ogievetsky, V.

    1984-01-01

    The main technical apparatus of the harmonic superspace approach to extended SUSY, the calculus of harmonic variables on homogeneous spaces of the SUSY automorphism groups, is presented in detail for N=2, 3, 4. The basic harmonics for the coset manifolds G/H with G=SU(2), H=U(1); G=SU(3), H=SU(2)xU(1) and H=U(1)xU(1); G=SU(4), H=SU(3)xU(1), H=SU(2)xSU(2)xU(1), H=SU(2)xU(1)xU(1) and H=U(1)xU(1)xU(1); G=USp(2), H=SU(2)xSU(2), H=SU(2)xU(1) and H=U(1)xU(1) are tabulated a number of useful relations among them

  12. Extended mission life support systems

    Science.gov (United States)

    Quattrone, P. D.

    1985-01-01

    Extended manned space missions which include interplanetary missions require regenerative life support systems. Manned mission life support considerations are placed in perspective and previous manned space life support system technology, activities and accomplishments in current supporting research and technology (SR&T) programs are reviewed. The life support subsystem/system technologies required for an enhanced duration orbiter (EDO) and a space operations center (SOC), regenerative life support functions and technology required for manned interplanetary flight vehicles, and future development requirements are outlined. The Space Shuttle Orbiters (space transportation system) is space cabin atmosphere is maintained at Earth ambient pressure of 14.7 psia (20% O2 and 80% N2). The early Shuttle flights will be seven-day flights, and the life support system flight hardware will still utilize expendables.

  13. Extended uncertainty from first principles

    International Nuclear Information System (INIS)

    Costa Filho, Raimundo N.; Braga, João P.M.; Lira, Jorge H.S.; Andrade, José S.

    2016-01-01

    A translation operator acting in a space with a diagonal metric is introduced to describe the motion of a particle in a quantum system. We show that the momentum operator and, as a consequence, the uncertainty relation now depend on the metric. It is also shown that, for any metric expanded up to second order, this formalism naturally leads to an extended uncertainty principle (EUP) with a minimum momentum dispersion. The Ehrenfest theorem is modified to include an additional term related to a tidal force arriving from the space curvature introduced by the metric. For one-dimensional systems, we show how to map a harmonic potential to an effective potential in Euclidean space using different metrics.

  14. Hamiltonian dynamics of extended objects

    International Nuclear Information System (INIS)

    Capovilla, R; Guven, J; Rojas, E

    2004-01-01

    We consider relativistic extended objects described by a reparametrization-invariant local action that depends on the extrinsic curvature of the worldvolume swept out by the object as it evolves. We provide a Hamiltonian formulation of the dynamics of such higher derivative models which is motivated by the ADM formulation of general relativity. The canonical momenta are identified by looking at boundary behaviour under small deformations of the action; the relationship between the momentum conjugate to the embedding functions and the conserved momentum density is established. The canonical Hamiltonian is constructed explicitly; the constraints on the phase space, both primary and secondary, are identified and the role they play in the theory is described. The multipliers implementing the primary constraints are identified in terms of the ADM lapse and shift variables and Hamilton's equations are shown to be consistent with the Euler-Lagrange equations

  15. Hamiltonian dynamics of extended objects

    Energy Technology Data Exchange (ETDEWEB)

    Capovilla, R [Departamento de FIsica, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo Postal 14-740, 07000 Mexico, DF (Mexico); Guven, J [School of Theoretical Physics, Dublin Institute for Advanced Studies, 10 Burlington Road, Dublin 4 (Ireland); Rojas, E [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, Apdo Postal 70-543, 04510 Mexico, DF (Mexico)

    2004-12-07

    We consider relativistic extended objects described by a reparametrization-invariant local action that depends on the extrinsic curvature of the worldvolume swept out by the object as it evolves. We provide a Hamiltonian formulation of the dynamics of such higher derivative models which is motivated by the ADM formulation of general relativity. The canonical momenta are identified by looking at boundary behaviour under small deformations of the action; the relationship between the momentum conjugate to the embedding functions and the conserved momentum density is established. The canonical Hamiltonian is constructed explicitly; the constraints on the phase space, both primary and secondary, are identified and the role they play in the theory is described. The multipliers implementing the primary constraints are identified in terms of the ADM lapse and shift variables and Hamilton's equations are shown to be consistent with the Euler-Lagrange equations.

  16. The Extended Virgo Cluster Catalog

    Science.gov (United States)

    Rey, Soo-Chang

    2015-08-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg2 or 60.1 Mpc2. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s-1. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  17. Oral hydromorphone extended-release.

    Science.gov (United States)

    Guay, David R P

    2010-12-01

    To review the chemistry, pharmacodynamics, pharmacokinetics, efficacy, tolerability, dosing, and role of the Osmotic-controlled Release Oral delivery System (OROS) hydromorphone extended-release (ER) tablets. A MEDLINE/PUBMED search (1986-August 2010) was conducted to identify studies in the English language, with additional references being obtained from their bibliographies. All studies of hydromorphone ER were reviewed. This is the second long-acting hydromorphone formulation to receive approval by the Food and Drug Administration (a twice-daily formulation was approved in September 2004, but was subsequently withdrawn in July 2005). Hydromorphone is a semi-synthetic mu-opioid receptor agonist structurally similar to morphine, hydrocodone, and oxymorphone. OROS ER technology allows once-daily dosing. Clinical trials have focused on the convertibility of (an) other opioid(s) to hydromorphone ER in chronic malignant and nonmalignant pain. This product displays the expected opioid side effects, being comparable to oxycodone controlled-release. Coadministration with ethanol does not produce the degree of "dose-dumping" seen with the former hydromorphone twice-daily product or oxymorphone ER. Hydromorphone ER is indicated for the management of moderate-to-severe pain in opioidtolerant patients requiring continuous, around-the-clock opioid analgesia for an extended period of time. Dosage adjustment is recommended in patients with moderate hepatic impairment (Child-Pugh class B) and moderate renal impairment (creatinine clearance of 30-60 mL/min). Hydromorphone ER is the newest oral opioid to enter a crowded marketplace now totaling 15 different Schedule 2 opioids (including tapentadol), and tramadol, available in oral, parenteral, rectal, transdermal, transmucosal, and intranasal formulations. It does not appear to have any unique assets or liabilities and should be considered as one of many oral opioids available for the management of persistent pain of moderate

  18. THE EXTENDED VIRGO CLUSTER CATALOG

    International Nuclear Information System (INIS)

    Kim, Suk; Rey, Soo-Chang; Lee, Youngdae; Chung, Jiwon; Pak, Mina; Yi, Wonhyeong; Lee, Woong; Jerjen, Helmut; Lisker, Thorsten; Sung, Eon-Chang

    2014-01-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg 2 or 60.1 Mpc 2 . It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s –1 . In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths

  19. THE EXTENDED VIRGO CLUSTER CATALOG

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Suk; Rey, Soo-Chang; Lee, Youngdae; Chung, Jiwon; Pak, Mina; Yi, Wonhyeong; Lee, Woong [Department of Astronomy and Space Science, Chungnam National University, 99 Daehak-ro, Daejeon 305-764 (Korea, Republic of); Jerjen, Helmut [Research School of Astronomy and Astrophysics, The Australian National University, Cotter Road, Weston, ACT 2611 (Australia); Lisker, Thorsten [Astronomisches Rechen-Institut, Zentrum für Astronomie der Universität Heidelberg (ZAH), Mönchhofstraße 12-14, D-69120 Heidelberg (Germany); Sung, Eon-Chang [Korea Astronomy and Space Science institute, 776 Daedeokdae-ro, Daejeon 305-348 (Korea, Republic of)

    2015-01-01

    We present a new catalog of galaxies in the wider region of the Virgo cluster, based on the Sloan Digital Sky Survey (SDSS) Data Release 7. The Extended Virgo Cluster Catalog (EVCC) covers an area of 725 deg{sup 2} or 60.1 Mpc{sup 2}. It is 5.2 times larger than the footprint of the classical Virgo Cluster Catalog (VCC) and reaches out to 3.5 times the virial radius of the Virgo cluster. We selected 1324 spectroscopically targeted galaxies with radial velocities less than 3000 km s{sup –1}. In addition, 265 galaxies that have been overlooked in the SDSS spectroscopic survey but have available redshifts in the NASA Extragalactic Database are also included. Our selection process secured a total of 1589 galaxies, 676 of which are not included in the VCC. The certain and possible cluster members are defined by means of redshift comparison with a cluster infall model. We employed two independent and complementary galaxy classification schemes: the traditional morphological classification based on the visual inspection of optical images and a characterization of galaxies from their spectroscopic features. SDSS u, g, r, i, and z passband photometry of all EVCC galaxies was performed using Source Extractor. We compare the EVCC galaxies with the VCC in terms of morphology, spatial distribution, and luminosity function. The EVCC defines a comprehensive galaxy sample covering a wider range in galaxy density that is significantly different from the inner region of the Virgo cluster. It will be the foundation for forthcoming galaxy evolution studies in the extended Virgo cluster region, complementing ongoing and planned Virgo cluster surveys at various wavelengths.

  20. Evidence of Allosteric Enzyme Regulation via Changes in Conformational Dynamics: A Hydrogen/Deuterium Exchange Investigation of Dihydrodipicolinate Synthase.

    Science.gov (United States)

    Sowole, Modupeola A; Simpson, Sarah; Skovpen, Yulia V; Palmer, David R J; Konermann, Lars

    2016-09-27

    Dihydrodipicolinate synthase is a tetrameric enzyme of the diaminopimelate pathway in bacteria and plants. The protein catalyzes the condensation of pyruvate (Pyr) and aspartate semialdehyde en route to the end product lysine (Lys). Dihydrodipicolinate synthase from Campylobacter jejuni (CjDHDPS) is allosterically inhibited by Lys. CjDHDPS is a promising antibiotic target, as highlighted by the recent development of a potent bis-lysine (bisLys) inhibitor. The mechanism whereby Lys and bisLys allosterically inhibit CjDHDPS remains poorly understood. In contrast to the case for other allosteric enzymes, crystallographically detectable conformational changes in CjDHDPS upon inhibitor binding are very minor. Also, it is difficult to envision how Pyr can access the active site; the available X-ray data seemingly imply that each turnover step requires diffusion-based mass transfer through a narrow access channel. This study employs hydrogen/deuterium exchange mass spectrometry for probing the structure and dynamics of CjDHDPS in a native solution environment. The deuteration kinetics reveal that the most dynamic protein regions are in the direct vicinity of the substrate access channel. This finding is consistent with the view that transient opening/closing fluctuations facilitate access of the substrate to the active site. Under saturating conditions, both Lys and bisLys cause dramatically reduced dynamics in the inhibitor binding region. In addition, rigidification extends to regions close to the substrate access channel. This finding strongly suggests that allosteric inhibitors interfere with conformational fluctuations that are required for CjDHDPS substrate turnover. In particular, our data imply that Lys and bisLys suppress opening/closing events of the access channel, thereby impeding diffusion of the substrate into the active site. Overall, this work illustrates why allosteric control does not have to be associated with crystallographically detectable large

  1. Influence of extenders on thermal and elastic properties of segmented copolyetheresteramids

    NARCIS (Netherlands)

    Niesten, M.C.E.J.; Gaymans, R.J.; Bosch, H.

    2001-01-01

    Copolyetheresteramides with bisesterdiamide units of a uniform length were synthesized in the current study, and the dynamic mechanical and elastic properties of the copolymers produced were studied. Diols are used to extend the length of uniform bisesterdiamide hard segments. Extenders have a

  2. 75 FR 50033 - Generalized System of Preferences (GSP): Notice Extending Deadline for Submission of Petitions...

    Science.gov (United States)

    2010-08-16

    ... OFFICE OF THE UNITED STATES TRADE REPRESENTATIVE Generalized System of Preferences (GSP): Notice Extending Deadline for Submission of Petitions for the 2010 Annual GSP Product Review AGENCY: Office of the... treatment under the Generalized System of Preferences (GSP) program. This notice extends the deadline for...

  3. 78 FR 2256 - Extension of the Extended Missing Parts Pilot Program

    Science.gov (United States)

    2013-01-10

    ...] Extension of the Extended Missing Parts Pilot Program AGENCY: United States Patent and Trademark Office... better gauge whether the Extended Missing Parts Program offers sufficient benefits to the patent... Missing Parts Pilot Program by using Form PTO/AIA/421. For utility patent [[Page 2257

  4. Engineering Isoprene Synthase Expression and Activity in Cyanobacteria.

    Science.gov (United States)

    Chaves, Julie E; Rueda-Romero, Paloma; Kirst, Henning; Melis, Anastasios

    2017-12-15

    Efforts to heterologously produce quantities of isoprene hydrocarbons (C 5 H 8 ) renewably from CO 2 and H 2 O through the photosynthesis of cyanobacteria face barriers, including low levels of recombinant enzyme accumulation compounded by their slow innate catalytic activity. The present work sought to alleviate the "expression level" barrier upon placing the isoprene synthase (IspS) enzyme in different fusion configurations with the cpcB protein, the highly expressed β-subunit of phycocyanin. Different cpcB*IspS fusion constructs were made, distinguished by the absence or presence of linker amino acids between the two proteins. Composition of linker amino acids was variable with lengths of 7, 10, 16, and 65 amino acids designed to test for optimal activity of the IspS through spatial positioning between the cpcB and IspS. Results showed that fusion constructs with the highly expressed cpcB gene, as the leader sequence, improved transgene expression in the range of 61 to 275-fold over what was measured with the unfused IspS control. However, the specific activity of the IspS enzyme was attenuated in all fusion transformants, possibly because of allosteric effects exerted by the leader cpcB fusion protein. This inhibition varied depending on the nature of the linker amino acids between the cpcB and IspS proteins. In terms of isoprene production, the results further showed a trade-off between specific activity and transgenic enzyme accumulation. For example, the cpcB*L7*IspS strain showed only about 10% the isoprene synthase specific-activity of the unfused cpcB-IspS control, but it accumulated 254-fold more IspS enzyme. The latter more than countered the slower specific activity and made the cpcB*L7*IspS transformant the best isoprene producing strain in this work. Isoprene to biomass yield ratios improved from 0.2 mg g -1 in the unfused cpcB-IspS control to 5.4 mg g -1 in the cpcB*L7*IspS strain, a 27-fold improvement.

  5. Self-assembled containers based on extended tetrathiafulvalene.

    Science.gov (United States)

    Bivaud, Sébastien; Goeb, Sébastien; Croué, Vincent; Dron, Paul I; Allain, Magali; Sallé, Marc

    2013-07-10

    Two original self-assembled containers constituted each by six electroactive subunits are described. They are synthesized from a concave tetratopic π-extended tetrathiafulvalene ligand bearing four pyridyl units and cis-M(dppf)(OTf)2 (M = Pd or Pt; dppf = 1,1'-bis(diphenylphosphino)ferrocene; OTf = trifluoromethane-sulfonate) complexes. Both fully characterized assemblies present an oblate spheroidal cavity that can incorporate one perylene molecule.

  6. Molecular cloning and characterization of drimenol synthase from valerian plant (Valeriana officinalis).

    Science.gov (United States)

    Kwon, Moonhyuk; Cochrane, Stephen A; Vederas, John C; Ro, Dae-Kyun

    2014-12-20

    Drimenol, a sesquiterpene alcohol, and its derivatives display diverse bio-activities in nature. However, a drimenol synthase gene has yet to be identified. We identified a new sesquiterpene synthase cDNA (VoTPS3) in valerian plant (Valeriana officinalis). Purification and NMR analyses of the VoTPS3-produced terpene, and characterization of the VoTPS3 enzyme confirmed that VoTPS3 synthesizes (-)-drimenol. In feeding assays, possible reaction intermediates, farnesol and drimenyl diphosphate, could not be converted to drimenol, suggesting that the intermediate remains tightly bound to VoTPS3 during catalysis. A mechanistic consideration of (-)-drimenol synthesis suggests that drimenol synthase is likely to use a protonation-initiated cyclization, which is rare for sesquiterpene synthases. VoTPS3 can be used to produce (-)-drimenol, from which useful drimane-type terpenes can be synthesized. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  7. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

    2001-01-01

    beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  8. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.

    Science.gov (United States)

    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-02-23

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids.

  9. SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

    Directory of Open Access Journals (Sweden)

    DURDI QUJEQ

    1999-10-01

    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  10. The Structure of Sucrose Synthase-1 from Arabidopsis thaliana and Its Functional Implications

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Yi; Anderson, Spencer; Zhang, Yanfeng; Garavito, R. Michael (MSU); (NWU)

    2014-10-02

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. During growth and development, plants control carbon distribution by coordinating sites of sucrose synthesis and cleavage in different plant organs and different cellular locations. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, provides a direct and reversible means to regulate sucrose flux. Depending on the metabolic environment, sucrose synthase alters its cellular location to participate in cellulose, callose, and starch biosynthesis through its interactions with membranes, organelles, and cytoskeletal actin. The x-ray crystal structure of sucrose synthase isoform 1 from Arabidopsis thaliana (AtSus1) has been determined as a complex with UDP-glucose and as a complex with UDP and fructose, at 2.8- and 2.85-{angstrom} resolutions, respectively. The AtSus1 structure provides insights into sucrose catalysis and cleavage, as well as the regulation of sucrose synthase and its interactions with cellular targets.

  11. A close look at a ketosynthase from a trans-acyltransferase modular polyketide synthase.

    Science.gov (United States)

    Gay, Darren C; Gay, Glen; Axelrod, Abram J; Jenner, Matthew; Kohlhaas, Christoph; Kampa, Annette; Oldham, Neil J; Piel, Jörn; Keatinge-Clay, Adrian T

    2014-03-04

    The recently discovered trans-acyltransferase modular polyketide synthases catalyze the biosynthesis of a wide range of bioactive natural products in bacteria. Here we report the structure of the second ketosynthase from the bacillaene trans-acyltransferase polyketide synthase. This 1.95 Å resolution structure provides the highest resolution view available of a modular polyketide synthase ketosynthase and reveals a flanking subdomain that is homologous to an ordered linker in cis-acyltransferase modular polyketide synthases. The structure of the cysteine-to-serine mutant of the ketosynthase acylated by its natural substrate provides high-resolution details of how a native polyketide intermediate is bound and helps explain the basis of ketosynthase substrate specificity. The substrate range of the ketosynthase was further investigated by mass spectrometry. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Characterization of α-isopropylmalate synthases containing different copy numbers of tandem repeats in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Palittapongarnpim Prasit

    2009-06-01

    Full Text Available Abstract Background Alpha-isopropylmalate synthase (α-IPMS is the key enzyme that catalyzes the first committed step in the leucine biosynthetic pathway. The gene encoding α-IPMS in Mycobacterium tuberculosis, leuA, is polymorphic due to the insertion of 57-bp repeat units referred to as Variable Number of Tandem Repeats (VNTR. The role of the VNTR found within the M. tuberculosis genome is unclear. To investigate the role of the VNTR in leuA, we compared two α-IPMS proteins with different numbers of amino acid repeats, one with two copies and the other with 14 copies. We have cloned leuA with 14 copies of the repeat units into the pET15b expression vector with a His6-tag at the N-terminus, as was previously done for the leuA gene with two copies of the repeat units. Results The recombinant His6-α-IPMS proteins with two and 14 copies (α-IPMS-2CR and α-IPMS-14CR, respectively of the repeat units were purified by immobilized metal ion affinity chromatography and gel filtration. Both enzymes were found to be dimers by gel filtration. Both enzymes work well at pH values of 7–8.5 and temperatures of 37–42°C. However, α-IPMS-14CR tolerates pH values and temperatures outside of this range better than α-IPMS-2CR does. α-IPMS-14CR has higher affinity than α-IPMS-2CR for the two substrates, α-ketoisovalerate and acetyl CoA. Furthermore, α-IPMS-2CR was feedback inhibited by the end product l-leucine, whereas α-IPMS-14CR was not. Conclusion The differences in the kinetic properties and the l-leucine feedback inhibition between the two M. tuberculosis α-IPMS proteins containing low and high numbers of VNTR indicate that a large VNTR insertion affects protein structure and function. Demonstration of l-leucine binding to α-IPMS-14CR would confirm whether or not α-IPMS-14CR responds to end-product feedback inhibition.

  13. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  14. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.).

    Science.gov (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D

    2008-04-30

    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  15. A domain swapping approach to elucidate differential regiospecific hydroxylation by geraniol and linalool synthases from perilla.

    Science.gov (United States)

    Sato-Masumoto, Naoko; Ito, Michiho

    2014-06-01

    Geraniol and linalool are acyclic monoterpenes found in plant essential oils that have attracted much attention for their commercial use and in pharmaceutical studies. They are synthesized from geranyl diphosphate (GDP) by geraniol and linalool synthases, respectively. Both synthases are very similar at the amino acid level and share the same substrate; however, the position of the GDP to which they introduce hydroxyl groups is different. In this study, the mechanisms underlying the regiospecific hydroxylation of geraniol and linalool synthases were investigated using a domain swapping approach and site-directed mutagenesis in perilla. Sequences of the synthases were divided into ten domains (domains I to IV-4), and each corresponding domain was exchanged between both enzymes. It was shown that different regions were important for the formation of geraniol and linalool, namely, domains IV-1 and -4 for geraniol, and domains III-b, III-d, and IV-4 for linalool. These results suggested that the conformation of carbocation intermediates and their electron localization were seemingly to be different between geraniol and linalool synthases. Further, five amino acids in domain IV-4 were apparently indispensable for the formation of geraniol and linalool. According to three-dimensional structural models of the synthases, these five residues seemed to be responsible for the different spatial arrangement of the amino acid at H524 in the case of geraniol synthase, while N526 is the corresponding residue in linalool synthase. These results suggested that the side-chains of these five amino acids, in combination with several relevant domains, localized the positive charge in the carbocation intermediate to determine the position of the introduced hydroxyl group. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  17. Improvement in the quality of hematopoietic prostaglandin D synthase crystals in a microgravity environment

    International Nuclear Information System (INIS)

    Tanaka, Hiroaki; Tsurumura, Toshiharu; Aritake, Kosuke; Furubayashi, Naoki; Takahashi, Sachiko; Yamanaka, Mari; Hirota, Erika; Sano, Satoshi; Sato, Masaru; Kobayashi, Tomoyuki; Tanaka, Tetsuo; Inaka, Koji; Urade, Yoshihiro

    2011-01-01

    Crystals of hematopoietic prostaglandin D synthase grown in microgravity show improved quality. Human hematopoietic prostaglandin synthase, one of the better therapeutic target enzymes for allergy and inflammation, was crystallized with 22 inhibitors and in three inhibitor-free conditions in microgravity. Most of the space-grown crystals showed better X-ray diffraction patterns than the terrestrially grown ones, indicating the advantage of a microgravity environment on protein crystallization, especially in the case of this protein

  18. Extended Operation of Stirling Convertors at NASA Glenn Research Center

    Science.gov (United States)

    Oriti, Salvatore, M.

    2012-01-01

    NASA Glenn Research Center (GRC) has been supporting development of free-piston Stirling conversion technology for spaceflight electrical power generation since 1999. GRC has also been supporting the development of the Advanced Stirling Radioisotope Generator (ASRG) since 2006. A key element of the ASRG project is providing life, reliability, and performance data for the Advanced Stirling Convertor (ASC). The Thermal Energy Conversion branch at GRC is conducting extended operation of several free-piston Stirling convertors. The goal of this effort is to generate long-term performance data (tens of thousands of hours) on multiple units to build a life and reliability database. Currently, GRC is operating 18 convertors. This hardware set includes Technology Demonstration Convertors (TDCs) from Infinia Corporation, of which one pair (TDCs #13 and #14) has accumulated over 60,000 hr (6.8 years) of operation. Also under test are various Sunpower, Inc. convertors that were fabricated during the ASC development activity, including ASC-0, ASC-E (including those in the ASRG engineering unit), and ASC-E2. The ASC-E2s also completed, or are in progress of completing workmanship vibration testing, performance mapping, and extended operation. Two ASC-E2 units will also be used for durability testing, during which components will be stressed to levels above nominal mission usage. Extended operation data analyses from these tests are covered in this paper.

  19. Interface unit

    NARCIS (Netherlands)

    Keyson, D.V.; Freudenthal, A.; De Hoogh, M.P.A.; Dekoven, E.A.M.

    2001-01-01

    The invention relates to an interface unit comprising at least a display unit for communication with a user, which is designed for being coupled with a control unit for at least one or more parameters in a living or working environment, such as the temperature setting in a house, which control unit

  20. Comparative study of Chalcone synthase promoters across plant families

    Directory of Open Access Journals (Sweden)

    Francisco Buitrago

    2009-07-01

    Full Text Available En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los genes duplicados son variables en la composición del elemento Cis, sugiriendo que estos genes pueden estarse expresando de maneras diferentes.

  1. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Directory of Open Access Journals (Sweden)

    Stêfany Bruno De Assis Cau

    2012-06-01

    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  2. Two Distinct Cardiolipin Synthases Operate in Agrobacterium tumefaciens.

    Science.gov (United States)

    Czolkoss, Simon; Fritz, Christiane; Hölzl, Georg; Aktas, Meriyem

    2016-01-01

    Cardiolipin (CL) is a universal component of energy generating membranes. In most bacteria, it is synthesized via the condensation of two molecules phosphatidylglycerol (PG) by phospholipase D-type cardiolipin synthases (PLD-type Cls). In the plant pathogen and natural genetic engineer Agrobacterium tumefaciens CL comprises up to 15% of all phospholipids in late stationary growth phase. A. tumefaciens harbors two genes, atu1630 (cls1) and atu2486 (cls2), coding for PLD-type Cls. Heterologous expression of either cls1 or cls2 in Escherichia coli resulted in accumulation of CL supporting involvement of their products in CL synthesis. Expression of cls1 and cls2 in A. tumefaciens is constitutive and irrespective of the growth phase. Membrane lipid profiling of A. tumefaciens mutants suggested that Cls2 is required for CL synthesis at early exponential growth whereas both Cls equally contribute to CL production at later growth stages. Contrary to many bacteria, which suffer from CL depletion, A. tumefaciens tolerates large changes in CL content since the CL-deficient cls1/cls2 double mutant showed no apparent defects in growth, stress tolerance, motility, biofilm formation, UV-stress and tumor formation on plants.

  3. Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

    2012-02-01

    Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

  4. Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

    International Nuclear Information System (INIS)

    Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.

    2008-01-01

    Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups

  5. SUCROSE SYNTHASE: ELUCIDATION OF COMPLEX POST-TRANSLATIONAL REGULATORY MECHANISMS

    Energy Technology Data Exchange (ETDEWEB)

    Steven C. Huber

    2009-05-12

    Studies have focused on the enzyme sucrose synthase, which plays an important role in the metabolism of sucrose in seeds and tubers. There are three isoforms of SUS in maize, referred to as SUS1, SUS-SH1, and SUS2. SUS is generally considered to be tetrameric protein but recent evidence suggests that SUS can also occur as a dimeric protein. The formation of tetrameric SUS is regulated by sucrose concentration in vitro and this could also be an important factor in the cellular localization of the protein. We found that high sucrose concentrations, which promote tetramer formation, also inhibit the binding of SUS1 to actin filaments in vitro. Previously, high sucrose concentrations were shown to promote SUS association with the plasma membrane. The specific regions of the SUS molecule involved in oligomerization are not known, but we identified a region of the SUS1 moelcule by bioinformatic analysis that was predicted to form a coiled coil. We demonstrated that this sequence could, in fact, self-associate as predicted for a coiled coil, but truncation analysis with the full-length recombinant protein suggested that it was not responsible for formation of dimers or tetramers. However, the coiled coil may function in binding of other proteins to SUS1. Overall, sugar availability may differentially influence the binding of SUS to cellular structures, and these effects may be mediated by changes in the oligomeric nature of the enzyme.

  6. Evolution of Efficient Modular Polyketide Synthases by Homologous Recombination.

    Science.gov (United States)

    Chemler, Joseph A; Tripathi, Ashootosh; Hansen, Douglas A; O'Neil-Johnson, Mark; Williams, Russell B; Starks, Courtney; Park, Sung Ryeol; Sherman, David H

    2015-08-26

    The structural scaffolds of many complex natural products are produced by multifunctional type I polyketide synthase (PKS) enzymes that operate as biosynthetic assembly lines. The modular nature of these mega-enzymes presents an opportunity to construct custom biocatalysts built in a lego-like fashion by inserting, deleting, or exchanging native or foreign domains to produce targeted variants of natural polyketides. However, previously engineered PKS enzymes are often impaired resulting in limited production compared to native systems. Here, we show a versatile method for generating and identifying functional chimeric PKS enzymes for synthesizing custom macrolactones and macrolides. PKS genes from the pikromycin and erythromycin pathways were hybridized in Saccharomyces cerevisiae to generate hybrid libraries. We used a 96-well plate format for plasmid purification, transformations, sequencing, protein expression, in vitro reactions and analysis of metabolite formation. Active chimeric enzymes were identified with new functionality. Streptomyces venezuelae strains that expressed these PKS chimeras were capable of producing engineered macrolactones. Furthermore, a macrolactone generated from selected PKS chimeras was fully functionalized into a novel macrolide analogue. This method permits the engineering of PKS pathways as modular building blocks for the production of new antibiotic-like molecules.

  7. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  8. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Science.gov (United States)

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Conservation and Role of Electrostatics in Thymidylate Synthase.

    Science.gov (United States)

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C

    2015-11-27

    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  10. Hyperbaric oxygen upregulates cochlear constitutive nitric oxide synthase

    Directory of Open Access Journals (Sweden)

    Kao Ming-Ching

    2011-02-01

    Full Text Available Abstract Background Hyperbaric oxygen therapy (HBOT is a known adjuvant for treating ischemia-related inner ear diseases. Controversies still exist in the role of HBOT in cochlear diseases. Few studies to date have investigated the cellular changes that occur in inner ears after HBOT. Nitric oxide, which is synthesized by nitric oxide synthase (NOS, is an important signaling molecule in cochlear physiology and pathology. Here we investigated the effects of hyperbaric oxygen on eardrum morphology, cochlear function and expression of NOS isoforms in cochlear substructures after repetitive HBOT in guinea pigs. Results Minor changes in the eardrum were observed after repetitive HBOT, which did not result in a significant hearing threshold shift by tone burst auditory brainstem responses. A differential effect of HBOT on the expression of NOS isoforms was identified. Upregulation of constitutive NOS (nNOS and eNOS was found in the substructures of the cochlea after HBOT, but inducible NOS was not found in normal or HBOT animals, as shown by immunohistochemistry. There was no obvious DNA fragmentation present in this HBOT animal model. Conclusions The present evidence indicates that the customary HBOT protocol may increase constitutive NOS expression but such upregulation did not cause cell death in the treated cochlea. The cochlear morphology and auditory function are consequently not changed through the protocol.

  11. Two Distinct Cardiolipin Synthases Operate in Agrobacterium tumefaciens.

    Directory of Open Access Journals (Sweden)

    Simon Czolkoss

    Full Text Available Cardiolipin (CL is a universal component of energy generating membranes. In most bacteria, it is synthesized via the condensation of two molecules phosphatidylglycerol (PG by phospholipase D-type cardiolipin synthases (PLD-type Cls. In the plant pathogen and natural genetic engineer Agrobacterium tumefaciens CL comprises up to 15% of all phospholipids in late stationary growth phase. A. tumefaciens harbors two genes, atu1630 (cls1 and atu2486 (cls2, coding for PLD-type Cls. Heterologous expression of either cls1 or cls2 in Escherichia coli resulted in accumulation of CL supporting involvement of their products in CL synthesis. Expression of cls1 and cls2 in A. tumefaciens is constitutive and irrespective of the growth phase. Membrane lipid profiling of A. tumefaciens mutants suggested that Cls2 is required for CL synthesis at early exponential growth whereas both Cls equally contribute to CL production at later growth stages. Contrary to many bacteria, which suffer from CL depletion, A. tumefaciens tolerates large changes in CL content since the CL-deficient cls1/cls2 double mutant showed no apparent defects in growth, stress tolerance, motility, biofilm formation, UV-stress and tumor formation on plants.

  12. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  13. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    DEFF Research Database (Denmark)

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  14. Squalene synthase as a target for Chagas disease therapeutics.

    Directory of Open Access Journals (Sweden)

    Na Shang

    2014-05-01

    Full Text Available Trypanosomatid parasites are the causative agents of many neglected tropical diseases and there is currently considerable interest in targeting endogenous sterol biosynthesis in these organisms as a route to the development of novel anti-infective drugs. Here, we report the first x-ray crystallographic structures of the enzyme squalene synthase (SQS from a trypanosomatid parasite, Trypanosoma cruzi, the causative agent of Chagas disease. We obtained five structures of T. cruzi SQS and eight structures of human SQS with four classes of inhibitors: the substrate-analog S-thiolo-farnesyl diphosphate, the quinuclidines E5700 and ER119884, several lipophilic bisphosphonates, and the thiocyanate WC-9, with the structures of the two very potent quinuclidines suggesting strategies for selective inhibitor development. We also show that the lipophilic bisphosphonates have low nM activity against T. cruzi and inhibit endogenous sterol biosynthesis and that E5700 acts synergistically with the azole drug, posaconazole. The determination of the structures of trypanosomatid and human SQS enzymes with a diverse set of inhibitors active in cells provides insights into SQS inhibition, of interest in the context of the development of drugs against Chagas disease.

  15. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Directory of Open Access Journals (Sweden)

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  16. Phosphorylation Regulates myo-Inositol-3-phosphate Synthase

    Science.gov (United States)

    Deranieh, Rania M.; He, Quan; Caruso, Joseph A.; Greenberg, Miriam L.

    2013-01-01

    myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using 32Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS. PMID:23902760

  17. A quantum extended Kalman filter

    International Nuclear Information System (INIS)

    Emzir, Muhammad F; Woolley, Matthew J; Petersen, Ian R

    2017-01-01

    In quantum physics, a stochastic master equation (SME) estimates the state (density operator) of a quantum system in the Schrödinger picture based on a record of measurements made on the system. In the Heisenberg picture, the SME is a quantum filter. For a linear quantum system subject to linear measurements and Gaussian noise, the dynamics may be described by quantum stochastic differential equations (QSDEs), also known as quantum Langevin equations, and the quantum filter reduces to a so-called quantum Kalman filter. In this article, we introduce a quantum extended Kalman filter (quantum EKF), which applies a commutative approximation and a time-varying linearization to systems of nonlinear QSDEs. We will show that there are conditions under which a filter similar to a classical EKF can be implemented for quantum systems. The boundedness of estimation errors and the filtering problem with ‘state-dependent’ covariances for process and measurement noises are also discussed. We demonstrate the effectiveness of the quantum EKF by applying it to systems that involve multiple modes, nonlinear Hamiltonians, and simultaneous jump-diffusive measurements. (paper)

  18. The Extended Mission Rover (EMR)

    Science.gov (United States)

    Shields, W.; Halecki, Anthony; Chung, Manh; Clarke, Ken; Frankle, Kevin; Kassemkhani, Fariba; Kuhlhoff, John; Lenzini, Josh; Lobdell, David; Morgan, Sam

    A key component in ensuring America's status as a leader in the global community is its active pursuit of space exploration. On the twentieth anniversary of Apollo 11, President George Bush challenged the nation to place a man on the moon permanently and to conduct human exploration of Mars in the 21st century. The students of the FAMU/FSU College of Engineering hope to make a significant contribution to this challenge, America's Space Exploration Initiative (SEI), with their participation in the NASA/USRA Advanced Design Program. The project selected by the 1991/1992 Aerospace Design group is the design of an Extended Mission Rover (EMR) for use on the lunar surface. This vehicle will serve as a mobile base to provide future astronauts with a 'shirt-sleeve' living and working environment. Some of the proposed missions are planetary surface exploration, construction and maintenance, hardware setup, and in situ resource experimentation. This vehicle will be put into use in the 2010-2030 time frame.

  19. Extended attention span training system

    Science.gov (United States)

    Pope, Alan T.; Bogart, Edward H.

    1991-01-01

    Attention Deficit Disorder (ADD) is a behavioral disorder characterized by the inability to sustain attention long enough to perform activities such as schoolwork or organized play. Treatments for this disorder include medication and brainwave biofeedback training. Brainwave biofeedback training systems feed back information to the trainee showing him how well he is producing the brainwave pattern that indicates attention. The Extended Attention Span Training (EAST) system takes the concept a step further by making a video game more difficult as the player's brainwaves indicate that attention is waning. The trainee can succeed at the game only by maintaining an adequate level of attention. The EAST system is a modification of a biocybernetic system that is currently being used to assess the extent to which automated flight management systems maintain pilot engagement. This biocybernetic system is a product of a program aimed at developing methods to evaluate automated flight deck designs for compatibility with human capabilities. The EAST technology can make a contribution in the fields of medical neuropsychology and neurology, where the emphasis is on cautious, conservative treatment of youngsters with attention disorders.

  20. Purification and Biochemical Properties of Phytochromobilin Synthase from Etiolated Oat Seedlings1

    Science.gov (United States)

    McDowell, Michael T.; Lagarias, J. Clark

    2001-01-01

    Plant phytochromes are dependent on the covalent attachment of the linear tetrapyrrole chromophore phytochromobilin (PΦB) for photoactivity. In planta, biliverdin IXα (BV) is reduced by the plastid-localized, ferredoxin (Fd)-dependent enzyme PΦB synthase to yield 3Z-PΦB. Here, we describe the >50,000-fold purification of PΦB synthase from etioplasts from dark-grown oat (Avena sativa L. cv Garry) seedlings using traditional column chromatography and preparative electrophoresis. Thus, PΦB synthase is a very low abundance enzyme with a robust turnover rate. We estimate the turnover rate to be >100 s−1, which is similar to that of mammalian NAD(P)H-dependent BV reductase. Oat PΦB synthase is a monomer with a subunit mass of 29 kD. However, two distinct charged forms of the enzymes were identified by native isoelectric focusing. The ability of PΦB synthase to reduce BV is dependent on reduced 2Fe-2S Fds. A Km for spinach (Spinacea oleracea) Fd was determined to be 3 to 4 μm. PΦB synthase has a high affinity for its bilin substrate, with a sub-micromolar Km for BV. PMID:11500553

  1. Purification and biochemical properties of phytochromobilin synthase from etiolated oat seedlings.

    Science.gov (United States)

    McDowell, M T; Lagarias, J C

    2001-08-01

    Plant phytochromes are dependent on the covalent attachment of the linear tetrapyrrole chromophore phytochromobilin (P Phi B) for photoactivity. In planta, biliverdin IX alpha (BV) is reduced by the plastid-localized, ferredoxin (Fd)-dependent enzyme P Phi B synthase to yield 3Z-P Phi B. Here, we describe the >50,000-fold purification of P Phi B synthase from etioplasts from dark-grown oat (Avena sativa L. cv Garry) seedlings using traditional column chromatography and preparative electrophoresis. Thus, P Phi B synthase is a very low abundance enzyme with a robust turnover rate. We estimate the turnover rate to be >100 s(-1), which is similar to that of mammalian NAD(P)H-dependent BV reductase. Oat P Phi B synthase is a monomer with a subunit mass of 29 kD. However, two distinct charged forms of the enzymes were identified by native isoelectric focusing. The ability of P Phi B synthase to reduce BV is dependent on reduced 2Fe-2S Fds. A K(m) for spinach (Spinacea oleracea) Fd was determined to be 3 to 4 microM. P Phi B synthase has a high affinity for its bilin substrate, with a sub-micromolar K(m) for BV.

  2. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Directory of Open Access Journals (Sweden)

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  3. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  4. The role of NO synthase isoforms in PDT-induced injury of neurons and glial cells

    Science.gov (United States)

    Kovaleva, V. D.; Berezhnaya, E. V.; Uzdensky, A. B.

    2015-03-01

    Nitric oxide (NO) is an important second messenger, involved in the implementation of various cell functions. It regulates various physiological and pathological processes such as neurotransmission, cell responses to stress, and neurodegeneration. NO synthase is a family of enzymes that synthesize NO from L-arginine. The activity of different NOS isoforms depends both on endogenous and exogenous factors. In particular, it is modulated by oxidative stress, induced by photodynamic therapy (PDT). We have studied the possible role of NOS in the regulation of survival and death of neurons and surrounding glial cells under photo-oxidative stress induced by photodynamic treatment (PDT). The crayfish stretch receptor consisting of a single identified sensory neuron enveloped by glial cells is a simple but informative model object. It was photosensitized with alumophthalocyanine photosens (10 nM) and irradiated with a laser diode (670 nm, 0.4 W/cm2). Antinecrotic and proapoptotic effects of NO on the glial cells were found using inhibitory analysis. We have shown the role of inducible NO synthase in photoinduced apoptosis and involvement of neuronal NO synthase in photoinduced necrosis of glial cells in the isolated crayfish stretch receptor. The activation of NO synthase was evaluated using NADPH-diaphorase histochemistry, a marker of neurons expressing the enzyme. The activation of NO synthase in the isolated crayfish stretch receptor was evaluated as a function of time after PDT. Photodynamic treatment induced transient increase in NO synthase activity and then slowly inhibited this enzyme.

  5. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  6. Linalool and linalool nerolidol synthases in roses, several genes for little scent.

    Science.gov (United States)

    Magnard, Jean-Louis; Bony, Aurélie Rius; Bettini, Fabienne; Campanaro, Ausilia; Blerot, Bernard; Baudino, Sylvie; Jullien, Frédéric

    2018-03-11

    Roses are widely appreciated for the appearance of their flowers and for their fragrance. This latter character results from the combination of different odorant molecules among which monoterpenes are often prevalent constituents. In this study, we report the cloning and characterization of three rose monoterpene synthases. In vitro functional characterization of these enzymes showed that one is a (-)-(3R)-linalool synthase whereas the others have a dual (+)-(3S)-linalool nerolidol synthase activity. However, given that the characterized rose cultivars were only able to produce the (-)-(3R)-linalool stereoisomer, the linalool nerolidol synthases are probably not active in planta. Furthermore, these three enzymes were also characterized by a weak expression level as assessed by RT-qPCR and by the low abundance of the corresponding sequences in an EST library. This characteristic is likely to explain why linalool is generally a minor constituent in rose flowers' scents. On this basis, we propose that in roses the monoterpene biosynthesis effort is focused on the production of acyclic monoterpenes derived from geraniol through the recently characterized Nudix biosynthesis pathway, at the expense of conventional monoterpene biosynthesis via terpene synthases such as linalool or linalool nerolidol synthases. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  7. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  8. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S. (Univ. of Texas Medical School, Houston (United States))

    1991-03-15

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-({sup 35}S)methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate.

  9. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  10. The Extended Baryonic Halo of NGC 3923

    Directory of Open Access Journals (Sweden)

    Bryan W. Miller

    2017-07-01

    Full Text Available Galaxy halos and their globular cluster systems build up over time by the accretion of small satellites. We can learn about this process in detail by observing systems with ongoing accretion events and comparing the data with simulations. Elliptical shell galaxies are systems that are thought to be due to ongoing or recent minor mergers. We present preliminary results of an investigation of the baryonic halo—light profile, globular clusters, and shells/streams—of the shell galaxy NGC 3923 from deep Dark Energy Camera (DECam g and i-band imaging. We present the 2D and radial distributions of the globular cluster candidates out to a projected radius of about 185 kpc, or ∼ 37 R e , making this one of the most extended cluster systems studied. The total number of clusters implies a halo mass of M h ∼ 3 × 10 13 M ⊙ . Previous studies had identified between 22 and 42 shells, making NGC 3923 the system with the largest number of shells. We identify 23 strong shells and 11 that are uncertain. Future work will measure the halo mass and mass profile from the radial distributions of the shell, N-body models, and line-of-sight velocity distribution (LOSVD measurements of the shells using the Multi Unit Spectroscopic Explorer (MUSE.

  11. Prevalência de sepse por bactérias Gram negativas produtoras de beta-lactamase de espectro estendido em Unidade de Cuidados Intensivos Neonatal Prevalence of extended-spectrum beta-lactamase producing Gram-negative bacterial sepsis in a Neonatal Intensive Care Unit

    Directory of Open Access Journals (Sweden)

    Carla Regina Tragante

    2008-03-01

    Full Text Available OBJETIVO: Determinar a prevalência e a mortalidade de sepse neonatal por bactérias Gram negativas produtoras de beta-lactamase de espectro estendido (ESBL em Unidade de Cuidados Intensivos Neonatal. MÉTODOS: Trata-se de um estudo retrospectivo e descritivo de 236 recém-nascidos com suspeita de sepse entre 2000 e 2004. O diagnóstico de sepse foi confirmado pela presença de sinais clínicos associada à positividade da hemocultura. A triagem para bactérias ESBL foi realizada segundo os critérios do National Committee for Clinical Laboratory Standards. RESULTADOS: 84 (36% recém-nascidos apresentaram hemocultura positiva, sendo a Klebsiella pneumoniae o agente mais prevalente (47%. A análise dos neonatos com infecção por Klebsiella pneumoniae mostrou que sete destas eram ESBL, perfazendo uma taxa de infecção de 0,4%. Todos os recém-nascidos com Klebsiella pneumoniae ESBL - exceto um - foram hospitalizados por mais de 21 dias e necessitaram de ventilação mecânica; todos tinham cateter central, nutrição parenteral e antibióticos de largo espectro. A mortalidade ocorreu em 36 (43% dos 84 neonatos com sepse confirmada. Dentre os óbitos, as hemoculturas mostraram Gram negativos (67% e fungos (19%. Em relação à Klebsiella pneumoniae ESBL, três recém-nascidos (43% morreram. CONCLUSÕES: A prevalência de sepse por Klebsiella pneumoniae ESBL no período do estudo foi de 0,4% e a mortalidade de 43%. É importante a detecção e o controle da disseminação deste tipo de microrganismo por seu impacto negativo na sobrevida de recém-nascidos prematuros e/ou doentes.OBJECTIVE: To determine the neonatal sepsis prevalence and the mortality of extended-spectrum beta-lactamase producing Gram-negative bacteria (ESBL in a Neonatal Intensive Care Unit. METHODS: This is a descriptive and retrospective study of 236 newborn infants with sepsis suspicion from 2000 to 2004. The diagnosis was confirmed by clinical signs and positive blood culture

  12. Structural basis for substrate activation and regulation by cystathionine beta-synthase (CBS) domains in cystathionine [beta]-synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)

    2011-08-17

    The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.

  13. Functional analysis of (4S)-limonene synthase mutants reveals determinants of catalytic outcome in a model monoterpene synthase

    Science.gov (United States)

    Srividya, Narayanan; Davis, Edward M.; Croteau, Rodney B.; Lange, B. Markus

    2015-01-01

    Crystal structural data for (4S)-limonene synthase [(4S)-LS] of spearmint (Mentha spicata L.) were used to infer which amino acid residues are in close proximity to the substrate and carbocation intermediates of the enzymatic reaction. Alanine-scanning mutagenesis of 48 amino acids combined with enzyme fidelity analysis [percentage of (−)-limonene produced] indicated which residues are most likely to constitute the active site. Mutation of residues W324 and H579 caused a significant drop in enzyme activity and formation of products (myrcene, linalool, and terpineol) characteristic of a premature termination of the reaction. A double mutant (W324A/H579A) had no detectable enzyme activity, indicating that either substrate binding or the terminating reaction was impaired. Exchanges to other aromatic residues (W324H, W324F, W324Y, H579F, H579Y, and H579W) resulted in enzyme catalysts with significantly reduced activity. Sequence comparisons across the angiosperm lineage provided evidence that W324 is a conserved residue, whereas the position equivalent to H579 is occupied by aromatic residues (H, F, or Y). These results are consistent with a critical role of W324 and H579 in the stabilization of carbocation intermediates. The potential of these residues to serve as the catalytic base facilitating the terminal deprotonation reaction is discussed. PMID:25733883

  14. Enhanced (S)-linalool production by fusion expression of farnesyl diphosphate synthase and linalool synthase in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deng, Yu; Sun, Mingxue; Xu, Sha; Zhou, Jingwen

    2016-07-01

    In order to improve the availability of geranyl diphosphate (GPP) in the mevalonate pathway for enhancing (S)-linalool production in Saccharomyces cerevisiae. A (S)-linalool synthase (LIS): AaLS1 from Actinidia arguta was coexpressed with FPPS with different peptide linkers to redirect the flux from geranyl diphosphate (GPP) to (S)-linalool production in S. cerevisiae. The strain with the best peptide linker ((GGGGS)3 ), produced 101·55 ± 2·97 μg l(-1) (S)-linalool, a 69·7% increase compared to those with two independent LIS and FPPS expressed. In a 3-l fermenter, the (S)-linalool titre was further improved to 240·64 ± 5·31 μg l(-1) . The results demonstrate that the fusion proteins catalysing consecutive steps in a metabolic pathway significantly improved the (S)-linalool production with GPP as precursor. The fusion protein strategy co-expressing AaLS1 and FPPS, assembled with a long peptide linker made S. cerevisiae produced the highest reported (S)-Linalool titre to date. © 2016 The Society for Applied Microbiology.

  15. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases.

    Science.gov (United States)

    Tang, Yi; Lee, Taek Soon; Khosla, Chaitan

    2004-02-01

    Bacterial aromatic polyketides such as tetracycline and doxorubicin are a medicinally important class of natural products produced as secondary metabolites by actinomyces bacteria. Their backbones are derived from malonyl-CoA units by polyketide synthases (PKSs). The nascent polyketide chain is synthesized by the minimal PKS, a module consisting of four dissociated enzymes. Although the biosynthesis of most aromatic polyketide backbones is initiated through decarboxylation of a malonyl building block (which results in an acetate group), some polyketides, such as the estrogen receptor antagonist R1128, are derived from nonacetate primers. Understanding the mechanism of nonacetate priming can lead to biosynthesis of novel polyketides that have improved pharmacological properties. Recent biochemical analysis has shown that nonacetate priming is the result of stepwise activity of two dissociated PKS modules with orthogonal molecular recognition features. In these PKSs, an initiation module that synthesizes a starter unit is present in addition to the minimal PKS module. Here we describe a general method for the engineered biosynthesis of regioselectively modified aromatic polyketides. When coexpressed with the R1128 initiation module, the actinorhodin minimal PKS produced novel hexaketides with propionyl and isobutyryl primer units. Analogous octaketides could be synthesized by combining the tetracenomycin minimal PKS with the R1128 initiation module. Tailoring enzymes such as ketoreductases and cyclases were able to process the unnatural polyketides efficiently. Based upon these findings, hybrid PKSs were engineered to synthesize new anthraquinone antibiotics with predictable functional group modifications. Our results demonstrate that (i) bimodular aromatic PKSs present a general mechanism for priming aromatic polyketide backbones with nonacetate precursors; (ii) the minimal PKS controls polyketide chain length by counting the number of atoms incorporated into the

  16. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases.

    Directory of Open Access Journals (Sweden)

    Yi Tang

    2004-02-01

    Full Text Available Bacterial aromatic polyketides such as tetracycline and doxorubicin are a medicinally important class of natural products produced as secondary metabolites by actinomyces bacteria. Their backbones are derived from malonyl-CoA units by polyketide synthases (PKSs. The nascent polyketide chain is synthesized by the minimal PKS, a module consisting of four dissociated enzymes. Although the biosynthesis of most aromatic polyketide backbones is initiated through decarboxylation of a malonyl building block (which results in an acetate group, some polyketides, such as the estrogen receptor antagonist R1128, are derived from nonacetate primers. Understanding the mechanism of nonacetate priming can lead to biosynthesis of novel polyketides that have improved pharmacological properties. Recent biochemical analysis has shown that nonacetate priming is the result of stepwise activity of two dissociated PKS modules with orthogonal molecular recognition features. In these PKSs, an initiation module that synthesizes a starter unit is present in addition to the minimal PKS module. Here we describe a general method for the engineered biosynthesis of regioselectively modified aromatic polyketides. When coexpressed with the R1128 initiation module, the actinorhodin minimal PKS produced novel hexaketides with propionyl and isobutyryl primer units. Analogous octaketides could be synthesized by combining the tetracenomycin minimal PKS with the R1128 initiation module. Tailoring enzymes such as ketoreductases and cyclases were able to process the unnatural polyketides efficiently. Based upon these findings, hybrid PKSs were engineered to synthesize new anthraquinone antibiotics with predictable functional group modifications. Our results demonstrate that (i bimodular aromatic PKSs present a general mechanism for priming aromatic polyketide backbones with nonacetate precursors; (ii the minimal PKS controls polyketide chain length by counting the number of atoms

  17. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  18. Inducible nitric oxide synthase haplotype associated with migraine and aura.

    Science.gov (United States)

    de O S Mansur, Thiago; Gonçalves, Flavia M; Martins-Oliveira, Alisson; Speciali, Jose G; Dach, Fabiola; Lacchini, Riccardo; Tanus-Santos, Jose E

    2012-05-01

    Migraine is a complex neurological disorder with a clear neurogenic inflammatory component apparently including enhanced nitric oxide (NO) formation. Excessive NO amounts possibly contributing to migraine are derived from increased expression and activity of inducible NO synthase (iNOS). We tested the hypothesis that two functional, clinically relevant iNOS genetic polymorphisms (C(-1026)A-rs2779249 and G2087A-rs2297518) are associated with migraine with or without aura. We studied 142 healthy women without migraine (control group) and 200 women with migraine divided into two groups: 148 with migraine without aura (MWA) and 52 with aura (MA). Genotypes were determined by real-time polymerase chain reaction using the Taqman(®) allele discrimination assays. The PHASE 2.1 software was used to estimate the haplotypes. The A allele for the G2087A polymorphism was more commonly found in the MA group than in the MWA group (28 vs. 18%; P 0.05). The haplotype combining both A alleles for the two polymorphisms was more commonly found in the MA group than in the control group or in the MWA group (19 vs. 10 or 8%; P = 0.0245 or 0.0027, respectively). Our findings indicate that the G2087A and the C(-1026)A polymorphism in the iNOS gene affect the susceptibility to migraine with aura when their effects are combined within haplotypes, whereas the G2087A affects the susceptibility to aura in migraine patients. These finding may have therapeutic implications when examining the effects of selective iNOS inhibitors.

  19. Discriminating the reaction types of plant type III polyketide synthases.

    Science.gov (United States)

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-07-01

    Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  20. Hyaluronan synthase mediates dye translocation across liposomal membranes

    Directory of Open Access Journals (Sweden)

    Medina Andria P

    2012-01-01

    Full Text Available Abstract Background Hyaluronan (HA is made at the plasma membrane and secreted into the extracellular medium or matrix by phospolipid-dependent hyaluronan synthase (HAS, which is active as a monomer. Since the mechanism by which HA is translocated across membranes is still unresolved, we assessed the presence of an intraprotein pore within HAS by adding purified Streptococcus equisimilis HAS (SeHAS to liposomes preloaded with the fluorophore Cascade Blue (CB. Results CB translocation (efflux was not observed with mock-purified material from empty vector control E. coli membranes, but was induced by SeHAS, purified from membranes, in a time- and dose-dependent manner. CB efflux was eliminated or greatly reduced when purified SeHAS was first treated under conditions that inhibit enzyme activity: heating, oxidization or cysteine modification with N-ethylmaleimide. Reduced CB efflux also occurred with SeHAS K48E or K48F mutants, in which alteration of K48 within membrane domain 2 causes decreased activity and HA product size. The above results used liposomes containing bovine cardiolipin (BCL. An earlier study testing many synthetic lipids found that the best activating lipid for SeHAS is tetraoleoyl cardiolipin (TO-CL and that, in contrast, tetramyristoyl cardiolipin (TM-CL is an inactivating lipid (Weigel et al, J. Biol. Chem. 281, 36542, 2006. Consistent with the effects of these CL species on SeHAS activity, CB efflux was more than 2-fold greater in liposomes made with TO-CL compared to TM-CL. Conclusions The results indicate the presence of an intraprotein pore in HAS and support a model in which HA is translocated to the exterior by HAS itself.

  1. Insights into the reactivation of cobalamin-dependent methionine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.; (Michigan)

    2009-12-10

    Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{sup CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.

  2. Platensimycin activity against mycobacterial beta-ketoacyl-ACP synthases.

    Directory of Open Access Journals (Sweden)

    Alistair K Brown

    2009-07-01

    Full Text Available There is an urgent need for the discovery and development of new drugs against Mycobacterium tuberculosis, the causative agent of tuberculosis, especially due to the recent emergence of multi-drug and extensively-drug resistant strains. Herein, we have examined the susceptibility of mycobacteria to the natural product platensimycin.We have demonstrated that platensimycin has bacteriostatic activity against the fast growing Mycobacterium smegmatis (MIC = 14 microg/ml and against Mycobacterium tuberculosis (MIC = 12 microg/ml. Growth in the presence of paltensimycin specifically inhibited the biosynthesis of mycolic acids suggesting that the antibiotic targeted the components of the mycolate biosynthesis complex. Given the inhibitory activity of platensimycin against beta-ketoacyl-ACP synthases from Staphylococcus aureus, M. tuberculosis KasA, KasB or FabH were overexpressed in M. smegmatis to establish whether these mycobacterial KAS enzymes were targets of platensimycin. In M. smegmatis overexpression of kasA or kasB increased the MIC of the strains from 14 microg/ml, to 30 and 124 microg/ml respectively. However, overexpression of fabH on did not affect the MIC. Additionally, consistent with the overexpression data, in vitro assays using purified proteins demonstrated that platensimycin inhibited Mt-KasA and Mt-KasB, but not Mt-FabH.Our results have shown that platensimycin is active against mycobacterial KasA and KasB and is thus an exciting lead compound against M. tuberculosis and the development of new synthetic analogues.

  3. Decoding the substrate supply to human neuronal nitric oxide synthase.

    Directory of Open Access Journals (Sweden)

    Alexandra Simon

    Full Text Available Nitric oxide, produced by the neuronal nitric oxide synthase (nNOS from L-arginine is an important second messenger molecule in the central nervous system: It influences the synthesis and release of neurotransmitters and plays an important role in long-term potentiation, long-term depression and neuroendocrine secretion. However, under certain pathological conditions such as Alzheimer's or Parkinson's disease, stroke and multiple sclerosis, excessive NO production can lead to tissue damage. It is thus desirable to control NO production in these situations. So far, little is known about the substrate supply to human nNOS as a determinant of its activity. Measuring bioactive NO via cGMP formation in reporter cells, we demonstrate here that nNOS in both, human A673 neuroepithelioma and TGW-nu-I neuroblastoma cells can be fast and efficiently nourished by extracellular arginine that enters the cells via membrane transporters (pool I that is freely exchangeable with the extracellular space. When this pool was depleted, NO synthesis was partially sustained by intracellular arginine sources not freely exchangeable with the extracellular space (pool II. Protein breakdown made up by far the largest part of pool II in both cell types. In contrast, citrulline to arginine conversion maintained NO synthesis only in TGW-nu-I neuroblastoma, but not A673 neuroepithelioma cells. Histidine mimicked the effect of protease inhibitors causing an almost complete nNOS inhibition in cells incubated additionally in lysine that depletes the exchangeable arginine pool. Our results identify new ways to modulate nNOS activity by modifying its substrate supply.

  4. Prostaglandin endoperoxide H synthases: peroxidase hydroperoxide specificity and cyclooxygenase activation.

    Science.gov (United States)

    Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L

    2007-06-22

    The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  6. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  7. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  8. Identification of a Glycogen Synthase Kinase-3[beta] Inhibitor that Attenuates Hyperactivity in CLOCK Mutant Mice

    Energy Technology Data Exchange (ETDEWEB)

    Kozikowski, Alan P.; Gunosewoyo, Hendra; Guo, Songpo; Gaisina, Irina N.; Walter, Richard L.; Ketcherside, Ariel; McClung, Colleen A.; Mesecar, Andrew D.; Caldarone, Barbara (Psychogenics); (Purdue); (UIC); (UTSMC)

    2012-05-02

    Bipolar disorder is characterized by a cycle of mania and depression, which affects approximately 5 million people in the United States. Current treatment regimes include the so-called 'mood-stabilizing drugs', such as lithium and valproate that are relatively dated drugs with various known side effects. Glycogen synthase kinase-3{beta} (GSK-3{beta}) plays a central role in regulating circadian rhythms, and lithium is known to be a direct inhibitor of GSK-3{beta}. We designed a series of second generation benzofuran-3-yl-(indol-3-yl)maleimides containing a piperidine ring that possess IC{sub 50} values in the range of 4 to 680 nM against human GSK-3{beta}. One of these compounds exhibits reasonable kinase selectivity and promising preliminary absorption, distribution, metabolism, and excretion (ADME) data. The administration of this compound at doses of 10 to 25 mg kg{sup -1} resulted in the attenuation of hyperactivity in amphetamine/chlordiazepoxide-induced manic-like mice together with enhancement of prepulse inhibition, similar to the effects found for valproate (400 mg kg{sup -1}) and the antipsychotic haloperidol (1 mg kg{sup -1}). We also tested this compound in mice carrying a mutation in the central transcriptional activator of molecular rhythms, the CLOCK gene, and found that the same compound attenuates locomotor hyperactivity in response to novelty. This study further demonstrates the use of inhibitors of GSK-3{beta} in the treatment of manic episodes of bipolar/mood disorders, thus further validating GSK-3{beta} as a relevant therapeutic target in the identification of new therapies for bipolar patients.

  9. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

    Science.gov (United States)

    Gauba, Esha; Guo, Lan; Du, Heng

    2017-01-01

    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  10. Purification, crystallization and preliminary X-ray diffraction studies to near-atomic resolution of dihydrodipicolinate synthase from methicillin-resistant Staphylococcus aureus

    International Nuclear Information System (INIS)

    Burgess, Benjamin R.; Dobson, Renwick C. J.; Dogovski, Con; Jameson, Geoffrey B.; Parker, Michael W.; Perugini, Matthew A.

    2008-01-01

    Dihydrodipicolinate synthase (DHDPS), an enzyme of the lysine-biosynthetic pathway, is a promising target for antibiotic development against pathogenic bacteria. Here, the expression, purification, crystallization and preliminary diffraction analysis to 1.45 Å resolution of DHDPS from methicillin-resistant S. aureus is reported. In recent years, dihydrodipicolinate synthase (DHDPS; EC 4.2.1.52) has received considerable attention from both mechanistic and structural viewpoints. DHDPS is part of the diaminopimelate pathway leading to lysine, coupling (S)-aspartate-β-semialdehyde with pyruvate via a Schiff base to a conserved active-site lysine. In this paper, the cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of DHDPS from methicillin-resistant Staphylococcus aureus, an important bacterial pathogen, are reported. The enzyme was crystallized in a number of forms, predominantly from PEG precipitants, with the best crystal diffracting to beyond 1.45 Å resolution. The space group was P1 and the unit-cell parameters were a = 65.4, b = 67.6, c = 78.0 Å, α = 90.1, β = 68.9, γ = 72.3°. The crystal volume per protein weight (V M ) was 2.34 Å 3 Da −1 , with an estimated solvent content of 47% for four monomers per asymmetric unit. The structure of the enzyme will help to guide the design of novel therapeutics against the methicillin-resistant S. aureus pathogen

  11. Crystallization and preliminary X-ray crystallographic analysis of dihydrouridine synthase from Thermus thermophilus and its complex with tRNA

    International Nuclear Information System (INIS)

    Yu, Futao; Tanaka, Yoshikazu; Yamamoto, Shiho; Nakamura, Akiyoshi; Kita, Shunsuke; Hirano, Nagisa; Tanaka, Isao; Yao, Min

    2011-01-01

    Crystals of dihydrouridine synthase from Thermus thermophilus and its complex with tRNA were obtained and X-ray diffraction data were collected to 1.70 and 3.51 Å resolution, respectively. Dihydrouridine synthase (Dus) is responsible for catalyzing dihydrouridine formation in RNA by the reduction of uridine. To elucidate its RNA-recognition mechanism, Dus from Thermus thermophilus (TthDus) and its complex with tRNA were crystallized. Diffraction data sets were collected from crystals of native and selenomethionine-substituted TthDus to resolutions of 1.70 and 2.30 Å, respectively. These crystals belonged to space group P1. Preliminary X-ray crystallographic analysis showed that two molecules of TthDus were contained in an asymmetric unit. In addition, diffraction data were collected to 3.51 Å resolution from a crystal of selenomethionine-substituted TthDus in complex with tRNA, which belonged to space group P4 1 2 1 2. Preliminary structural analysis showed that the asymmetric unit contained two TthDus–tRNA complexes

  12. Studies on the Expression of Sesquiterpene Synthases Using Promoter-?-Glucuronidase Fusions in Transgenic Artemisia annua L

    OpenAIRE

    Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.

    2013-01-01

    In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expressio...

  13. Biosynthesis of the microtubule-destabilizing diterpene pseudolaric acid B from golden larch involves an unusual diterpene synthase

    OpenAIRE

    Mafu, Sibongile; Karunanithi, Prema Sambandaswami; Palazzo, Teresa Ann; Harrod, Bronwyn Lee; Rodriguez, Selina Marakana; Mollhoff, Iris Natalie; O’Brien, Terrence Edward; Tong, Shen; Fiehn, Oliver; Tantillo, Dean J.; Bohlmann, Jörg; Zerbe, Philipp

    2017-01-01

    Diterpenes play important roles in plant biology and serve as industrial bioproducts and therapeutics, including the anticancer drug Taxol. Enzymes of the diterpene synthase family produce the many core structural scaffolds that form the foundation of the large diversity of biologically active diterpenes. This paper describes the identification and the mechanism of a distinct diterpene synthase, pseudolaratriene synthase, from the golden larch tree, Pseudolarix amabilis. The enzyme catalyzes ...

  14. An extended data envelopment analysis for the decision-making

    Directory of Open Access Journals (Sweden)

    Xiao-Li Meng

    2017-10-01

    Full Text Available Abstract Based on the CCR model, we propose an extended data envelopment analysis to evaluate the efficiency of decision making units with historical input and output data. The contributions of the work are threefold. First, the input and output data of the evaluated decision making unit are variable over time, and time series method is used to analyze and predict the data. Second, there are many sample decision making units, which are divided into several ordered sample standards in terms of production strategy, and the constraint condition consists of one of the sample standards. Furthermore, the efficiency is illustrated by considering the efficiency relationship between the evaluated decision making unit and sample decision making units from constraint condition. Third, to reduce the computation complexity, we introduce an algorithm based on the binary search tree in the model to choose the sample standard that has similar behavior with the evaluated decision making unit. Finally, we provide two numerical examples to illustrate the proposed model.

  15. Optimized green fluorescent protein fused to FoF1-ATP synthase for single-molecule FRET using a fast anti-Brownian electrokinetic trap

    Science.gov (United States)

    Dienerowitz, Maria; Ilchenko, Mykhailo; Su, Bertram; Deckers-Hebestreit, Gabriele; Mayer, Günter; Henkel, Thomas; Heitkamp, Thomas; Börsch, Michael

    2016-02-01

    Observation times of freely diffusing single molecules in solution are limited by the photophysics of the attached fluorescence markers and by a small observation volume in the femtolitre range that is required for a sufficient signal-to-background ratio. To extend diffusion-limited observation times through a confocal detection volume, A. E. Cohen and W. E. Moerner have invented and built the ABELtrap -- a microfluidic device to actively counteract Brownian motion of single nanoparticles with an electrokinetic trap. Here we present a version of an ABELtrap with a laser focus pattern generated by electro-optical beam deflectors and controlled by a programmable FPGA chip. This ABELtrap holds single fluorescent nanoparticles for more than 100 seconds, increasing the observation time of fluorescent nanoparticles compared to free diffusion by a factor of 10000. To monitor conformational changes of individual membrane proteins in real time, we record sequential distance changes between two specifically attached dyes using Förster resonance energy transfer (smFRET). Fusing the a-subunit of the FoF1-ATP synthase with mNeonGreen results in an improved signal-to-background ratio at lower laser excitation powers. This increases our measured trap duration of proteoliposomes beyond 2 s. Additionally, we observe different smFRET levels attributed to varying distances between the FRET donor (mNeonGreen) and acceptor (Alexa568) fluorophore attached at the a- and c-subunit of the FoF1-ATP synthase respectively.

  16. Cost savings from extended life nuclear plants

    International Nuclear Information System (INIS)

    Forest, L.R. Jr.; Deutsch, T.R.; Schenler, W.W.

    1988-01-01

    The study assesses the costs and benefits of nuclear plant life extension (NUPLEX) for the United States of America as a whole under widely varying economic assumptions and for individual U.S. nuclear facilities under baseline assumptions. The study also presents a cost-benefit analysis of the nuclear industry's planned advanced light water reactor (ALWR). Under baseline economic assumptions and using U.S. average costs of fuel and of nonfuel operations and maintenance, it is found that NUPLEX saves future electricity users about 3 U.S. cents/kW·h (3.7 cents/kW·h versus 7.2 cents/kW·h) compared with new coal fired (NEWCOAL) plants, which are viewed as the most likely competing option to NUPLEX. Under optimistic assumptions the savings swell to almost 10 cents/kW·h. More notably, however, NUPLEX still saves money under unlikely pessimistic assumptions. While NUPLEX is probably advantageous for most existing U.S. nuclear facilities, it appears more so for some than others. Preliminary evidence indicates that PLEX refurbishment may cost somewhat less on average for PWRs than for BWRs and will almost certainly cost less for newer vintage plants than for older vintages. In addition, PLEX (avoided cost) benefits are especially great for those regions in which alternative coal fired power is comparatively expensive because of relatively high delivered coal prices. On the basis of these and other considerations, the authors developed a parametric method for ranking existing plants in terms of the relative attractiveness of NUPLEX. The ALWR program calls for a simple evolutionary redesign of LWRs, incorporating the lessons learned in building and operating the current generation of nuclear units. In accordance with the utility developmental goals on construction costs, operating performance, and service life, the ALWR offers power at a substantially lower cost than NEWCOAL plants. The assumptions of extended operating life contributes to the cost advantage. The

  17. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2015-01-01

    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  18. CELLULOSE SYNTHASE-LIKE A2, a glucomannan synthase, is involved in maintaining adherent mucilage structure in Arabidopsis seed.

    Science.gov (United States)

    Yu, Li; Shi, Dachuan; Li, Junling; Kong, Yingzhen; Yu, Yanchong; Chai, Guohua; Hu, Ruibo; Wang, Juan; Hahn, Michael G; Zhou, Gongke

    2014-04-01

    Mannans are hemicellulosic polysaccharides that are considered to have both structural and storage functions in the plant cell wall. However, it is not yet known how mannans function in Arabidopsis (Arabidopsis thaliana) seed mucilage. In this study, CELLULOSE SYNTHASE-LIKE A2 (CSLA2; At5g22740) expression was observed in several seed tissues, including the epidermal cells of developing seed coats. Disruption of CSLA2 resulted in thinner adherent mucilage halos, although the total amount of the adherent mucilage did not change compared with the wild type. This suggested that the adherent mucilage in the mutant was more compact compared with that of the wild type. In accordance with the role of CSLA2 in glucomannan synthesis, csla2-1 mucilage contained 30% less mannosyl and glucosyl content than did the wild type. No appreciable changes in the composition, structure, or macromolecular properties were observed for nonmannan polysaccharides in mutant mucilage. Biochemical analysis revealed that cellulose crystallinity was substantially reduced in csla2-1 mucilage; this was supported by the removal of most mucilage cellulose through treatment of csla2-1 seeds with endo-β-glucanase. Mutation in CSLA2 also resulted in altered spatial distribution of cellulose and an absence of birefringent cellulose microfibrils within the adherent mucilage. As with the observed changes in crystalline cellulose, the spatial distribution of pectin was also modified in csla2-1 mucilage. Taken together, our results demonstrate that glucomannans synthesized by CSLA2 are involved in modulating the structure of adherent mucilage, potentially through altering cellulose organization and crystallization.

  19. Mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase: a control enzyme in ketogenesis.

    Science.gov (United States)

    Hegardt, F G

    1999-03-15

    Cytosolic and mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthases were first recognized as different chemical entities in 1975, when they were purified and characterized by Lane's group. Since then, the two enzymes have been studied extensively, one as a control site of the cholesterol biosynthetic pathway and the other as an important control site of ketogenesis. This review describes some key developments over the last 25 years that have led to our current understanding of the physiology of mitochondrial HMG-CoA synthase in the HMG-CoA pathway and in ketogenesis in the liver and small intestine of suckling animals. The enzyme is regulated by two systems: succinylation and desuccinylation in the short term, and transcriptional regulation in the long term. Both control mechanisms are influenced by nutritional and hormonal factors, which explains the incidence of ketogenesis in diabetes and starvation, during intense lipolysis, and in the foetal-neonatal and suckling-weaning transitions. The DNA-binding properties of the peroxisome-proliferator-activated receptor and other transcription factors on the nuclear-receptor-responsive element of the mitochondrial HMG-CoA synthase promoter have revealed how ketogenesis can be regulated by fatty acids. Finally, the expression of mitochondrial HMG-CoA synthase in the gonads and the correction of auxotrophy for mevalonate in cells deficient in cytosolic HMG-CoA synthase suggest that the mitochondrial enzyme may play a role in cholesterogenesis in gonadal and other tissues.

  20. Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis.

    Science.gov (United States)

    Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A

    1999-04-15

    The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

  1. Biotechnical production of trehalose through the trehalose synthase pathway: current status and future prospects.

    Science.gov (United States)

    Cai, Xue; Seitl, Ines; Mu, Wanmeng; Zhang, Tao; Stressler, Timo; Fischer, Lutz; Jiang, Bo

    2018-04-01

    Trehalose (α-D-glucopyranosyl-(1 → 1)-α-D-glucopyranoside) is a non-reducing disaccharide composed of two glucose molecules linked by an α,α-1,1-glycosidic bond. It possesses physicochemical properties, which account for its biological roles in a variety of prokaryotic and eukaryotic organisms and invertebrates. Intensive studies of trehalose gradually uncovered its functions, and its applications in foods, cosmetics, and pharmaceuticals have increased every year. Currently, trehalose is industrially produced by the two-enzyme method, which was first developed in 1995 using maltooligosyltrehalose synthase (EC 5.4.99.15) and subsequently using maltooligosyltrehalose trehalohydrolase (EC 3.2.1.141), with starch as the substrate. This biotechnical method has lowered the price of trehalose and expanded its applications. However, when trehalose synthase (EC 5.4.99.16) was later discovered, this method for trehalose production using maltose as the substrate soon became a popular topic because of its simplicity and potential in industrial production. Since then, many trehalose synthases have been studied. This review summarizes the sources and characteristics of reported trehalose synthases, and the most recent advances on structural analysis of trehalose synthase, catalytic mechanism, molecular modification, and usage in industrial production processes.

  2. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.

    Science.gov (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul

    2016-01-01

    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. Association of a Soybean Raffinose Synthase Gene with Low Raffinose and Stachyose Seed Phenotype

    Directory of Open Access Journals (Sweden)

    Emily C. Dierking

    2008-11-01

    Full Text Available Oligosaccharides are an important component of soybean [ (L. Merr.] meal in terms of metabolizable energy for monogastric animals. Sucrose, raffinose, and stachyose are the three main oligosaccharides present in soybean meal. Of the three, only sucrose is nutritionally useful. When raffinose and stachyose are fermented by microbes present in the gut, the results are flatulence and discomfort, which ultimately lead to poor weight gain. The long term objective of this research is ultimately to increase the nutritional value of soybean meal by elevating the metabolizable energy at the expense of raffinose and stachyose through the manipulation of soybean raffinose synthase, the key enzyme for raffinose and stachyose biosynthesis. The objectives of this work were to develop molecular genetic information about soybean raffinose synthases and to evaluate the candidate raffinose synthase genes in a soybean germplasm accession (PI 200508 that contains low levels of raffinose and stachyose. Our results indicate the soybean genome contains at least two expressed genes similar to other characterized raffinose synthases. A novel allele of one of these putative soybean raffinose synthase genes was discovered from the PI 200508 that completely associates with the low raffinose and stachyose phenotype. Molecular marker assays specific for the PI 200508 allele were developed to allow direct selection for the low raffinose and low stachyose phenotype.

  4. Mitochondrial ATP synthases cluster as discrete domains that reorganize with the cellular demand for oxidative phosphorylation.

    Science.gov (United States)

    Jimenez, Laure; Laporte, Damien; Duvezin-Caubet, Stephane; Courtout, Fabien; Sagot, Isabelle

    2014-02-15

    Mitochondria are double membrane-bounded organelles that form a dynamic tubular network. Mitochondria energetic functions depend on a complex internal architecture. Cristae, inner membrane invaginations that fold into the matrix space, are proposed to be the site of oxidative phosphorylation, reactions by which ATP synthase produces ATP. ATP synthase is also thought to have a role in crista morphogenesis. To date, the exploration of the processes regulating mitochondrial internal compartmentalization have been mostly limited to electron microscopy. Here, we describe ATP synthase localization in living yeast cells and show that it clusters as discrete inner membrane domains. These domains are dynamic within the mitochondrial network. They are impaired in mutants defective in crista morphology and partially overlap with the crista-associated MICOS-MINOS-MITOS complex. Finally, ATP synthase occupancy increases with the cellular demand for OXPHOS. Overall our data suggest that domains in which ATP synthases are clustered correspond to mitochondrial cristae. Being able to follow mitochondrial sub-compartments in living yeast cells opens new avenues to explore the mechanisms involved in inner membrane remodeling, an architectural feature crucial for mitochondrial activities.

  5. Heterologous expression of dammarenediol synthase gene in an engineered Saccharomyces cerevisiae.

    Science.gov (United States)

    Liang, Y-L; Zhao, S-J; Xu, L-X; Zhang, X-Y

    2012-11-01

    Dammarenediol production by an engineered yeast Saccharomyces cerevisiae was investigated. A dammarenediol-producing engineered yeast was constructed by heterologous expression of the dammarenediol synthase gene from Panax ginseng hairy roots through RT-PCR. Fermentation was carried out in a 5-L GRJY-bioreactor with an inoculum size of 1% v/v at 30°C. Dammarenediol detection was performed with silica gel chromatography and HPLC. Determination of dammarenediol synthase activity subcellular distribution was carried out by surveying the enzyme activity in microsomes, lipid particles and total yeast homogenate. When cultured under aerobic conditions, the engineered yeast could produce dammarenediol up to 250μgl(-1). However, when an anaerobic shift strategy was employed, dammarenediol accumulated at a level as twice as that under aerobic condition. The dammarenediol synthase and dammarenediol were mainly localized in lipid particles. Dammarenediol could be heterologously produced in engineered yeast. The heterologously expressed dammarenediol synthase is mainly localized in lipid particles. Anaerobic shift strategy could enhance the dammarenediol level in the engineered yeast. This study showed that the high-value plant product dammarenediol could be produced by heterologous expression of the according gene in yeast. Furthermore, the anaerobic shift strategy could be potentially applied in oxidosqualene-derived compounds production in yeast. Here, the information about subcellular distribution of heterologously expressed dammarenediol synthase in the engineered yeast was also provided. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  6. PKMiner: a database for exploring type II polyketide synthases

    Directory of Open Access Journals (Sweden)

    Kim Jinki

    2012-08-01

    Full Text Available Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyketide chemotypes in various actinobacterial genomes will thus enable the discovery or synthesis of novel polyketides in the most plausible microorganisms. Description We performed a comprehensive computational analysis of type II PKSs and their gene clusters in actinobacterial genomes. By identifying type II PKS subclasses from the sequence analysis of 280 known type II PKSs, we developed highly accurate domain classifiers for these subclasses and derived prediction rules for aromatic polyketide chemotypes generated by different combinations of type II PKS domains. Using 319 available actinobacterial genomes, we predicted 231 type II PKSs from 40 PKS gene clusters in 25 actinobacterial genomes, and polyketide chemotypes corresponding to 22 novel PKS gene clusters in 16 genomes. These results showed that the microorganisms capable of producing aromatic polyketides are specifically distributed within a certain suborder of Actinomycetales such as Catenulisporineae, Frankineae, Micrococcineae, Micromonosporineae, Pseudonocardineae, Streptomycineae, and Streptosporangineae. Conclusions We could identify the novel candidates of type II PKS gene clusters and their polyketide chemotypes in actinobacterial genomes by comprehensive analysis of type II PKSs and prediction of aromatic polyketides. The genome analysis results indicated that the specific suborders in actinomycetes could be used as prolific taxa for polyketide synthesis. The chemotype-prediction rules with

  7. PKMiner: a database for exploring type II polyketide synthases.

    Science.gov (United States)

    Kim, Jinki; Yi, Gwan-Su

    2012-08-08

    Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyketide chemotypes in various actinobacterial genomes will thus enable the discovery or synthesis of novel polyketides in the most plausible microorganisms. We performed a comprehensive computational analysis of type II PKSs and their gene clusters in actinobacterial genomes. By identifying type II PKS subclasses from the sequence analysis of 280 known type II PKSs, we developed highly accurate domain classifiers for these subclasses and derived prediction rules for aromatic polyketide chemotypes generated by different combinations of type II PKS domains. Using 319 available actinobacterial genomes, we predicted 231 type II PKSs from 40 PKS gene clusters in 25 actinobacterial genomes, and polyketide chemotypes corresponding to 22 novel PKS gene clusters in 16 genomes. These results showed that the microorganisms capable of producing aromatic polyketides are specifically distributed within a certain suborder of Actinomycetales such as Catenulisporineae, Frankineae, Micrococcineae, Micromonosporineae, Pseudonocardineae, Streptomycineae, and Streptosporangineae. We could identify the novel candidates of type II PKS gene clusters and their polyketide chemotypes in actinobacterial genomes by comprehensive analysis of type II PKSs and prediction of aromatic polyketides. The genome analysis results indicated that the specific suborders in actinomycetes could be used as prolific taxa for polyketide synthesis. The chemotype-prediction rules with the suggested type II PKS modules derived using this resource

  8. Dihydropteroate Synthase of Mycobacterium leprae and Dapsone Resistance

    Science.gov (United States)

    Williams, Diana L.; Spring, Laynette; Harris, Eugene; Roche, Paul; Gillis, Thomas P.

    2000-01-01

    Two Mycobacterium leprae genes, folP1 and folP2, encoding putative dihydropteroate synthases (DHPS), were studied for enzymatic activity and for the presence of mutations associated with dapsone resistance. Each gene was cloned and expressed in a folP knockout mutant of Escherichia coli (C600ΔfolP::Kmr). Expression of M. leprae folP1 in C600ΔfolP::Kmr conferred growth on a folate-deficient medium, and bacterial lysates exhibited DHPS activity. This recombinant displayed a 256-fold-greater sensitivity to dapsone (measured by the MIC) than wild-type E. coli C600, and 50-fold less dapsone was required to block (expressed as the 50% inhibitory concentration [IC50]) the DHPS activity of this recombinant. When the folP1 genes of several dapsone-resistant M. leprae clinical isolates were sequenced, two missense mutations were identified. One mutation occurred at codon 53, substituting an isoleucine for a threonine residue (T53I) in the DHPS-1, and a second mutation occurred in codon 55, substituting an arginine for a proline residue (P55R). Transformation of the C600ΔfolP::Kmr knockout with plasmids carrying either the T53I or the P55R mutant allele did not substantially alter the DHPS activity compared to levels produced by recombinants containing wild-type M. leprae folP1. However, both mutations increased dapsone resistance, with P55R having the greatest affect on dapsone resistance by increasing the MIC 64-fold and the IC50 68-fold. These results prove that the folP1 of M. leprae encodes a functional DHPS and that mutations within this gene are associated with the development of dapsone resistance in clinical isolates of M. leprae. Transformants created with M. leprae folP2 did not confer growth on the C600ΔfolP::Kmr knockout strain, and DNA sequences of folP2 from dapsone-susceptible and -resistant M. leprae strains were identical, indicating that this gene does not encode a functional DHPS and is not involved in dapsone resistance in M. leprae. PMID:10817704

  9. Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis.

    Science.gov (United States)

    Kato, Shota; Takaichi, Shinichi; Ishikawa, Takahiro; Asahina, Masashi; Takahashi, Senji; Shinomura, Tomoko

    2016-01-05

    Euglena gracilis, a unicellular phytoflagellate within Euglenida, has attracted much attention as a potential feedstock for renewable energy production. In outdoor open-pond cultivation for biofuel production, excess direct sunlight can inhibit photosynthesis in this alga and decrease its productivity. Carotenoids play important roles in light harvesting during photosynthesis and offer photoprotection for certain non-photosynthetic and photosynthetic organisms including cyanobacteria, algae, and higher plants. Although, Euglenida contains β-carotene and xanthophylls (such as zeaxanthin, diatoxanthin, diadinoxanthin and 9'-cis neoxanthin), the pathway of carotenoid biosynthesis has not been elucidated. To clarify the carotenoid biosynthetic pathway in E. gracilis, we searched for the putative E. gracilis geranylgeranyl pyrophosphate (GGPP) synthase gene (crtE) and phytoene synthase gene (crtB) by tblastn searches from RNA-seq data and obtained their cDNAs. Complementation experiments in Escherichia coli with carotenoid biosynthetic genes of Pantoea ananatis showed that E. gracilis crtE (EgcrtE) and EgcrtB cDNAs encode GGPP synthase and phytoene synthase, respectively. Phylogenetic analyses indicated that the predicted proteins of EgcrtE and EgcrtB belong to a clade distinct from a group of GGPP synthase and phytoene synthase proteins, respectively, of algae and higher plants. In addition, we investigated the effects of light stress on the expression of crtE and crtB in E. gracilis. Continuous illumination at 460 or 920 μmol m(-2) s(-1) at 25 °C decreased the E. gracilis cell concentration by 28-40 % and 13-91 %, respectively, relative to the control light intensity (55 μmol m(-2) s(-1)). When grown under continuous light at 920 μmol m(-2) s(-1), the algal cells turned reddish-orange and showed a 1.3-fold increase in the crtB expression. In contrast, EgcrtE expression was not significantly affected by the light-stress treatments examined. We identified genes

  10. Extending Abdominal Aortic Aneurysm Detection to Older Age Groups

    DEFF Research Database (Denmark)

    Makrygiannis, Georgios; Labalue, Philippe; Erpicum, Marie

    2016-01-01

    . Current screening policies (e.g., men aged 65-74 years), however, do not account for aging and increased life expectancy of Western populations. This study investigated AAA detection by extending the target population to older age groups (75-85 years). METHODS: AAA screening was conducted in the County......-74 age group but rose to 7.3% in the age-extended group (75-85 years). Further in addition to age, height, current smoking, history of coronary artery disease, hypercholesterolemia, peripheral artery disease of the lower limbs, and varicose veins were significantly associated with the presence of AAA......BACKGROUND: There is evident benefit in terms of reduced aneurysm-related mortality from screening programs of abdominal aortic aneurysm (AAA) in men aged 65 years and more. Recent studies in the United Kingdom and Sweden have shown a decline of the prevalence of AAA in the general population...

  11. Inducible nitric oxide synthase expression is upregulated in oral submucous fibrosis

    Directory of Open Access Journals (Sweden)

    Rajendran R

    2007-01-01

    Full Text Available Objective: We tested the hypothesis that inducible nitric oxide synthase (iNOS modulates angiogenesis in human models and this information could be extrapolated in elucidating the pathophysiology of oral submucous fibrosis (OSF. A hypothesis which looks inadequate, but is deep rooted in literature is the epithelial alteration ("atrophy" seen in OSF and the events that lead to its causation. This aspect was tried to be addressed and an alternative pathogenetic pathway for the disease is proposed. Materials and Methods: This immunohistochemical study sought to investigate the expression of iNOS in OSF samples (n= 30 a using monospecific antibody (SC- 2050, Santa Cruz Biotechnology, Inc to the protein and also to correlate it with different grades of epithelial dysplasia associated with the disease. Twenty (20 healthy adults acted as controls. Results: iNOS staining was not demonstrated in normal oral epithelium. In oral epithelial dysplasia, staining was seen in all cases (100% in the basal layers of the epithelium and in 30% of cases it extended into the parabasal compartments as well. iNOS staining was uniformly positive in moderate dysplasia with an increase in intensity and distribution noted as the severity of dysplasia progressed. There were highly significant differences in overall positivity for iNOS in epithelium between cases and controls (Mann-Whitney U = 11.000, Wilcoxon W = 221.00, P = 0.000. Significant comparisons were made of mild Vs moderate dysplasia (Mann-Whitney U = 48.000, P = 0.014 Conclusions: This study supports our earlier morphological assessment (image analysis of the nature of vascularity in OSF mucosa. The significant vasodilation noticed in these cases argues against the concept of ischemic atrophy of the epithelium. This observation of vascularity and iNOS expression helped to explain the vasodilation noticed (sinusoids in this disease; NO being a net vasodilator. The mechanism of activation of iNOS in dysplasia is

  12. Conservation and divergence of Starch Synthase III genes of monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Bhavya Priyadarshini Mishra

    Full Text Available Starch Synthase (SS plays an important role in extending the α-1,4 glucan chains during starch biosynthesis by catalyzing the transfer of the glucosyl moiety from ADP-glucose to the non-reducing end of a pre-existing glucan chain. SS has five distinct isoforms of which SSIII is involved in the formation of longer glucan chain length. Here we report identification and detailed characterization of 'true' orthologs of the well-characterized maize SSIII (ZmSSIII, among six monocots and two dicot species. ZmSSIII orthologs have nucleotide sequence similarity ranging from 56-81%. Variation in gene size among various orthologs ranged from 5.49 kb in Arabidopsis to 11.62 kb in Brachypodium and the variation was mainly due to intron size and indels present in the exons 1 and 3. Number of exons and introns were highly conserved among all orthologs however. While the intron number was conserved, intron phase showed variation at group, genera and species level except for intron 1 and 5. Several species, genera, and class specific cis-acting regulatory elements were identified in the promoter region. The predicted protein size of the SSIII orthologs ranged from 1094 amino acid (aa in Arabidopsis to 1688 aa in Brachypodium with sequence identity ranging from 60%-89%. The N-terminal region of the protein was highly variable whereas the C-terminal region containing the Glycosyltransferase domain was conserved with >80% sequence similarity among the orthologs. In addition to confirming the known motifs, eleven novel motifs possibly providing species, genera and group specific functions, were identified in the three carbohydrate binding domains. Despite of significant sequence variation among orthologs, most of the motifs and their relative distances are highly conserved among the orthologs. The 3-D structure of catalytic region of SSIII orthologs superimposed with higher confidence confirming the presence of similar binding sites with five unidentified

  13. Rice Cellulose SynthaseA8 Plant-Conserved Region Is a Coiled-Coil at the Catalytic Core Entrance

    Energy Technology Data Exchange (ETDEWEB)

    Rushton, Phillip S.; Olek, Anna T.; Makowski, Lee; Badger, John; Steussy, C. Nicklaus; Carpita, Nicholas C.; Stauffacher, Cynthia V. (NEU); (Purdue)

    2016-11-22

    The crystallographic structure of a rice (Oryza sativa) cellulose synthase, OsCesA8, plant-conserved region (P-CR), one of two unique domains in the catalytic domain of plant CesAs, was solved to 2.4 Å resolution. Two antiparallel α-helices form a coiled-coil domain linked by a large extended connector loop containing a conserved trio of aromatic residues. The P-CR structure was fit into a molecular envelope for the P-CR domain derived from small-angle X-ray scattering data. The P-CR structure and molecular envelope, combined with a homology-based chain trace of the CesA8 catalytic core, were modeled into a previously determined CesA8 small-angle X-ray scattering molecular envelope to produce a detailed topological model of the CesA8 catalytic domain. The predicted position for the P-CR domain from the molecular docking models places the P-CR connector loop into a hydrophobic pocket of the catalytic core, with the coiled-coil aligned near the entrance of the substrate UDP-glucose into the active site. In this configuration, the P-CR coiled-coil alone is unlikely to regulate substrate access to the active site, but it could interact with other domains of CesA, accessory proteins, or other CesA catalytic domains to control substrate delivery.

  14. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  15. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  16. Progress challenges and opportunities for the re-engineering of trans-AT polyketide synthases.

    Science.gov (United States)

    Till, M; Race, P R

    2014-05-01

    Polyketides are a structurally and functionally diverse family of bioactive natural products that are used extensively as pharmaceuticals and agrochemicals. In bacteria these molecules are biosynthesized by giant, multi-functional enzymatic complexes, termed modular polyketide synthases (PKSs), that function in assembly-line like fashion to fuse and tailor simple carboxylic acid monomers into a vast array of elaborate chemical scaffolds. Modifying PKSs through targeted synthase re-engineering is a promising approach for accessing functionally-optimized polyketides. Due to their highly mosaic architectures the recently identified trans-AT family of modular synthases appear inherently more amenable to re-engineering than their well studied cis-AT counterparts. Here, we review recent progress in the re-engineering of trans-AT PKSs, summarize opportunities for harnessing the biosynthetic potential of these systems, and highlight challenges that such re-engineering approaches present.

  17. Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.

    Science.gov (United States)

    Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-06-01

    The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  18. Proposed mechanism for diterpene synthases in the formation of phomactatriene and taxadiene.

    Science.gov (United States)

    Tokiwano, Tetsuo; Endo, Taeko; Tsukagoshi, Tae; Goto, Hitoshi; Fukushi, Eri; Oikawa, Hideaki

    2005-08-07

    To obtain insight into how the cyclization pathway is controlled, the mechanism of diterpene synthase reactions (the putative phomactatriene synthase and taxadiene synthases) involving the same intermediate was investigated in detail. The mechanism of the initial transformation of GGDP to verticillen-12-yl cation (A+) was proposed based on the labelling pattern of phomactatriene (9a) obtained in the feeding experiments with 13C-labelled acetates. To obtain information on the reaction pathway of A+ to 9a and taxadiene, reactions of verticillol with various acids were conducted. Structural determination of products allowed us to propose a reaction pathway via cations A+, D+, E+, F+ and G+. Identification of hydrocarbons in mycelial extracts of phomactin-producing fungus supported the proposed reaction mechanism. Based on the results of ab initio calculations for highly flexible cation intermediates, a mechanism is proposed.

  19. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    Science.gov (United States)

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  20. Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, S; Eng, CH; Katz, L; Keasling, JD

    2013-06-04

    LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.

  1. Extended Producer Responsibility in the Aviation Sector

    OpenAIRE

    Brito, Marisa; Laan, Erwin; Irion, B.D.

    2007-01-01

    textabstractIn this paper we investigate recent initiatives with respect to extended producer responsibility in the aviation sector. We compare those with the existing practices in the automobile sector and the emerging regulations in the shipping sector. We describe the challenges and the lessons to be learned from the evolution and state of extended producer responsibility in these two industries.

  2. Extended, Embodied Cognition and Second Language Acquisition

    Science.gov (United States)

    Atkinson, Dwight

    2010-01-01

    A "cognitivist" approach to cognition has traditionally dominated second language acquisition (SLA) studies. In this article, I examine two alternative approaches--"extended cognition" and "embodied cognition"--for how they might help us conceptualize SLA. More specifically, I present: (i) summaries of extended and embodied cognition, followed by…

  3. Functional Characterization of Nine Norway Spruce TPS Genes and Evolution of Gymnosperm Terpene Synthases of the TPS-d Subfamily1[w

    Science.gov (United States)

    Martin, Diane M.; Fäldt, Jenny; Bohlmann, Jörg

    2004-01-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (−)-limonene synthase, (−)-α/β-pinene synthase, and (−)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-α-farnesene synthase, and E-α-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed. PMID:15310829

  4. Solution structure of the tandem acyl carrier protein domains from a polyunsaturated fatty acid synthase reveals beads-on-a-string configuration.

    Directory of Open Access Journals (Sweden)

    Uldaeliz Trujillo

    Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of

  5. Solution Structure of the Tandem Acyl Carrier Protein Domains from a Polyunsaturated Fatty Acid Synthase Reveals Beads-on-a-String Configuration

    KAUST Repository

    Trujillo, Uldaeliz

    2013-02-28

    The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP

  6. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  7. Crystal Structure of Albaflavenone Monooxygenase Containing a Moonlighting Terpene Synthase Active Site

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Bin; Lei, Li; Vassylyev, Dmitry G.; Lin, Xin; Cane, David E.; Kelly, Steven L.; Yuan, Hang; Lamb, David C.; Waterman, Michael R.; (Vanderbilt); (UAB); (Brown); (Swansea)

    2010-01-08

    Albaflavenone synthase (CYP170A1) is a monooxygenase catalyzing the final two steps in the biosynthesis of this antibiotic in the soil bacterium, Streptomyces coelicolor A3(2). Interestingly, CYP170A1 shows no stereo selection forming equal amounts of two albaflavenol epimers, each of which is oxidized in turn to albaflavenone. To explore the structural basis of the reaction mechanism, we have studied the crystal structures of both ligand-free CYP170A1 (2.6 {angstrom}) and complex of endogenous substrate (epi-isozizaene) with CYP170A1 (3.3 {angstrom}). The structure of the complex suggests that the proximal epi-isozizaene molecules may bind to the heme iron in two orientations. In addition, much to our surprise, we have found that albaflavenone synthase also has a second, completely distinct catalytic activity corresponding to the synthesis of farnesene isomers from farnesyl diphosphate. Within the cytochrome P450 {alpha}-helical domain both the primary sequence and x-ray structure indicate the presence of a novel terpene synthase active site that is moonlighting on the P450 structure. This includes signature sequences for divalent cation binding and an {alpha}-helical barrel. This barrel is unusual because it consists of only four helices rather than six found in all other terpene synthases. Mutagenesis establishes that this barrel is essential for the terpene synthase activity of CYP170A1 but not for the monooxygenase activity. This is the first bifunctional P450 discovered to have another active site moonlighting on it and the first time a terpene synthase active site is found moonlighting on another protein.

  8. Generating Units

    Data.gov (United States)

    Department of Homeland Security — Generating Units are any combination of physically connected generators, reactors, boilers, combustion turbines, and other prime movers operated together to produce...

  9. Transcriptional regulation of mitochondrial HMG-CoA synthase in the control of ketogenesis.

    Science.gov (United States)

    Hegardt, F G

    1998-10-01

    Mitochondrial and cytosolic HMG-CoA synthases are encoded by two different genes. Control of ketogenesis is exerted by transcriptional regulation of mitochondrial HMG-CoA synthase. Fasting, cAMP, and fatty acids increase its transcriptional rate, while refeeding and insulin repress it. Fatty acids increase transcription through peroxisomal proliferator regulatory element (PPRE), to which peroxisome proliferator activated receptor (PPAR) can bind. Other transcription factors such as chicken ovalbumin upstream promoter transcription factor (COUP-TF) and hepatocyte nuclear factor 4 (HNF-4) compete for the PPRE site, modulating the response of PPAR.

  10. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  11. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  12. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana.

    Science.gov (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  13. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. The primary diterpene synthase products of Picea abies levopimaradiene/abietadiene synthase (PaLAS) are epimers of a thermally unstable diterpenol.

    Science.gov (United States)

    Keeling, Christopher I; Madilao, Lina L; Zerbe, Philipp; Dullat, Harpreet K; Bohlmann, Jörg

    2011-06-17

    The levopimaradiene/abietadiene synthase from Norway spruce (Picea abies; PaLAS) has previously been reported to produce a mixture of four diterpene hydrocarbons when incubated with geranylgeranyl diphosphate as the substrate: levopimaradiene, abietadiene, neoabietadiene, and palustradiene. However, variability in the assay products observed by GC-MS of this and orthologous conifer diterpene synthases over the past 15 years suggested that these diterpenes may not be the initial enzyme assay products but are rather the products of dehydration of an unstable alcohol. We have identified epimers of the thermally unstable allylic tertiary alcohol 13-hydroxy-8(14)-abietene as the products of PaLAS. The identification of these compounds, not previously described in conifers, as the initial products of PaLAS has considerable implications for our understanding of the complexity of the biosynthetic pathway of the structurally diverse diterpene resin acids of conifer defense.

  15. The Symmetry behind Extended Flavour Democracy and Large Leptonic Mixing

    CERN Document Server

    Silva-Marcos, Joaquim I

    2002-01-01

    We show that there is a minimal discrete symmetry which leads to the extended flavour democracy scenario constraining the Dirac neutrino, the charged lepton and the Majorana neutrino mass term ($M_R$) to be all proportional to the democratic matrix, with all elements equal. In particular, this discrete symmetry forbids other large contributions to $M_R$, such as a term proportional to the unit matrix, which would normally be allowed by a $S_{3L}\\times S_{3R}$ permutation symmetry. This feature is crucial in order to obtain large leptonic mixing, without violating 't Hooft's, naturalness principle.

  16. On the extended and Allan spectra and topological radii

    Directory of Open Access Journals (Sweden)

    Hugo Arizmendi-Peimbert

    2012-01-01

    Full Text Available In this paper we prove that the extended spectrum \\(\\Sigma(x\\, defined by W. Żelazko, of an element \\(x\\ of a pseudo-complete locally convex unital complex algebra \\(A\\ is a subset of the spectrum \\(\\sigma_A(x\\, defined by G.R. Allan. Furthermore, we prove that they coincide when \\(\\Sigma(x\\ is closed. We also establish some order relations between several topological radii of \\(x\\, among which are the topological spectral radius \\(R_t(x\\ and the topological radius of boundedness \\(\\beta_t(x\\.

  17. Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.

    1999-01-01

    cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison...

  18. Biallelic variants in WARS2 encoding mitochondrial tryptophanyl-tRNA synthase in six individuals with mitochondrial encephalopathy

    NARCIS (Netherlands)

    Wortmann, Saskia B.; Timal, Sharita; Venselaar, Hanka; Wintjes, Liesbeth T.; Kopajtich, Robert; Feichtinger, Rene G.; Onnekink, Carla; Muhlmeister, Mareike; Brandt, Ulrich; Smeitink, Jan A.; Veltman, Joris A.; Sperl, Wolfgang; Lefeber, Dirk; Pruijn, Ger; Stojanovic, Vesna; Freisinger, Peter; von Spronsen, Francjan; Derks, Terry G. J.; Veenstra-Knol, Hermine E.; Mayr, Johannes A.; Rotig, Agnes; Tarnopolsky, Mark; Prokisch, Holger; Rodenburg, Richard J.

    2017-01-01

    Mitochondrial protein synthesis involves an intricate interplay between mitochondrial DNA encoded RNAs and nuclear DNA encoded proteins, such as ribosomal proteins and aminoacyl-tRNA synthases. Eukaryotic cells contain 17 mitochondria-specific aminoacyl-tRNA synthases. WARS2 encodes mitochondrial

  19. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    Science.gov (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  20. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical and reco...