Animal models for testing anti-prion drugs.
Fernández-Borges, Natalia; Elezgarai, Saioa R; Eraña, Hasier; Castilla, Joaquín
2013-01-01
Prion diseases belong to a group of fatal infectious diseases with no effective therapies available. Throughout the last 35 years, less than 50 different drugs have been tested in different experimental animal models without hopeful results. An important limitation when searching for new drugs is the existence of appropriate models of the disease. The three different possible origins of prion diseases require the existence of different animal models for testing anti-prion compounds. Wild type, over-expressing transgenic mice and other more sophisticated animal models have been used to evaluate a diversity of compounds which some of them were previously tested in different in vitro experimental models. The complexity of prion diseases will require more pre-screening studies, reliable sporadic (or spontaneous) animal models and accurate chemical modifications of the selected compounds before having an effective therapy against human prion diseases. This review is intended to put on display the more relevant animal models that have been used in the search of new antiprion therapies and describe some possible procedures when handling chemical compounds presumed to have anti-prion activity prior to testing them in animal models.
Anti-prion activity of Brilliant Blue G.
Directory of Open Access Journals (Sweden)
Yoshifumi Iwamaru
Full Text Available BACKGROUND: Prion diseases are fatal neurodegenerative disorders with no effective therapy currently available. Accumulating evidence has implicated over-activation of P2X7 ionotropic purinergic receptor (P2X7R in the progression of neuronal loss in several neurodegenerative diseases. This has led to the speculation that simultaneous blockade of this receptor and prion replication can be an effective therapeutic strategy for prion diseases. We have focused on Brilliant Blue G (BBG, a well-known P2X7R antagonist, possessing a chemical structure expected to confer anti-prion activity and examined its inhibitory effect on the accumulation of pathogenic isoforms of prion protein (PrPres in a cellular and a mouse model of prion disease in order to determine its therapeutic potential. PRINCIPAL FINDINGS: BBG prevented PrPres accumulation in infected MG20 microglial and N2a neural cells at 50% inhibitory concentrations of 14.6 and 3.2 µM, respectively. Administration of BBG in vivo also reduced PrPres accumulation in the brains of mice with prion disease. However, it did not appear to alleviate the disease progression compared to the vehicle-treated controls, implying a complex role of P2X7R on the neuronal degeneration in prion diseases. SIGNIFICANCE: These results provide novel insights into the pathophysiology of prion diseases and have important implications for the treatment.
Treatment with a non-toxic, self-replicating anti-prion delays or prevents prion disease in vivo.
Diaz-Espinoza, R; Morales, R; Concha-Marambio, L; Moreno-Gonzalez, I; Moda, F; Soto, C
2018-03-01
Transmissible spongiform encephalopathies (TSEs) are fatal neurological disorders caused by prions, which are composed of a misfolded protein (PrP Sc ) that self-propagates in the brain of infected individuals by converting the normal prion protein (PrP C ) into the pathological isoform. Here, we report a novel experimental strategy for preventing prion disease based on producing a self-replicating, but innocuous PrP Sc -like form, termed anti-prion, which can compete with the replication of pathogenic prions. Our results show that a prophylactic inoculation of prion-infected animals with an anti-prion delays the onset of the disease and in some animals completely prevents the development of clinical symptoms and brain damage. The data indicate that a single injection of the anti-prion eliminated ~99% of the infectivity associated to pathogenic prions. Furthermore, this treatment caused significant changes in the profile of regional PrP Sc deposition in the brains of animals that were treated, but still succumbed to the disease. Our findings provide new insights for a mechanistic understanding of prion replication and support the concept that prion replication can be separated from toxicity, providing a novel target for therapeutic intervention.
Lichens: Unexpected anti-prion agents?
Rodriguez, Cynthia M.; Bennett, James P.; Johnson, Christopher J.
2012-01-01
The prion diseases sheep scrapie and cervid chronic wasting disease are transmitted, in part, via an environmental reservoir of infectivity; prions released from infected animals persist in the environment and can cause disease years later. Central to controlling disease transmission is the identification of methods capable of inactivating these agents on the landscape. We have found that certain lichens, common, ubiquitous, symbiotic organisms, possess a serine protease capable of degrading prion protein (PrP) from prion-infected animals. The protease functions against a range of prion strains from various hosts and reduces levels of abnormal PrP by at least two logs. We have now tested more than 20 lichen species from several geographical locations and from various taxa and found that approximately half of these species degrade PrP. Critical next steps include examining the effect of lichens on prion infectivity and cloning the protease responsible for PrP degradation. The impact of lichens on prions in the environment remains unknown. We speculate that lichens could have the potential to degrade prions when they are shed from infected animals onto lichens or into environments where lichens are abundant. In addition, lichens are frequently consumed by cervids and many other animals and the effect of dietary lichens on prion disease transmission should also be considered.
Lim, Yong-beom; Mays, Charles E; Kim, Younghwan; Titlow, William B; Ryou, Chongsuk
2010-03-01
Branched polyamines are effective in inhibiting prions in a cationic surface charge density dependent manner. However, toxicity associated with branched polyamines, in general, often hampers the successful application of the compounds to treat prion diseases. Here, we report that constitutively maintained cationic properties in branched polyamines reduced the intrinsic toxicity of the compounds while retaining the anti-prion activities. In prion-infected neuroblastoma cells, quaternization of amines in polyethyleneimine (PEI) and polyamidoamine (PAMAM) dendrimers markedly increased the nontoxic concentration ranges of the compounds and still supported, albeit reduced, an appreciable level of anti-prion activity in clearing prions from the infected cells. Furthermore, quaternized PEI was able to degrade prions at acidic pH conditions and inhibit the in vitro prion propagation facilitated by conversion of the normal prion protein isoform to its misfolded counterpart, although such activities were decreased by quaternization. Quaternized PAMAM was least effective in degrading prions but efficiently inhibited prion conversion with the same efficacy as unmodified PAMAM. Our results suggest that quaternization represents an effective strategy for developing nontoxic branched polyamines with potent anti-prion activity. This study highlights the importance of polyamine structural control for developing polyamine-based anti-prion agents and understanding of an action mechanism of quaternized branched polyamines. Copyright (c) 2009 Elsevier Ltd. All rights reserved.
Logical design of anti-prion agents using NAGARA
Energy Technology Data Exchange (ETDEWEB)
Ma, Biao; Yamaguchi, Keiichi; Fukuoka, Mayuko [United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Kuwata, Kazuo, E-mail: kuwata@gifu-u.ac.jp [United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Department of Gene and Development, Graduate School of Medicine, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan)
2016-01-22
To accelerate the logical drug design procedure, we created the program “NAGARA,” a plugin for PyMOL, and applied it to the discovery of small compounds called medical chaperones (MCs) that stabilize the cellular form of a prion protein (PrP{sup C}). In NAGARA, we constructed a single platform to unify the docking simulation (DS), free energy calculation by molecular dynamics (MD) simulation, and interfragment interaction energy (IFIE) calculation by quantum chemistry (QC) calculation. NAGARA also enables large-scale parallel computing via a convenient graphical user interface. Here, we demonstrated its performance and its broad applicability from drug discovery to lead optimization with full compatibility with various experimental methods including Western blotting (WB) analysis, surface plasmon resonance (SPR), and nuclear magnetic resonance (NMR) measurements. Combining DS and WB, we discovered anti-prion activities for two compounds and tegobuvir (TGV), a non-nucleoside non-structural protein NS5B polymerase inhibitor showing activity against hepatitis C virus genotype 1. Binding profiles predicted by MD and QC are consistent with those obtained by SPR and NMR. Free energy analyses showed that these compounds stabilize the PrP{sup C} conformation by decreasing the conformational fluctuation of the PrP{sup C}. Because TGV has been already approved as a medicine, its extension to prion diseases is straightforward. Finally, we evaluated the affinities of the fragmented regions of TGV using QC and found a clue for its further optimization. By repeating WB, MD, and QC recursively, we were able to obtain the optimum lead structure. - Highlights: • NAGARA integrates docking simulation, molecular dynamics, and quantum chemistry. • We found many compounds, e.g., tegobuvir (TGV), that exhibit anti-prion activities. • We obtained insights into the action mechanism of TGV as a medical chaperone. • Using QC, we obtained useful information for optimization of the
Directory of Open Access Journals (Sweden)
Kenta Teruya
Full Text Available Our previous study on prion-infected rodents revealed that hydroxypropyl methylcellulose compounds (HPMCs with different molecular weights but similar composition and degree of substitution have different levels of long-lasting anti-prion activity. In this study, we searched these HPMCs for a parameter specifically associated with in vivo anti-prion activity by analyzing in vitro chemical properties and in vivo tissue distributions. Infrared spectroscopic and thermal analyses revealed no differences among HPMCs, whereas pyrene conjugation and spectroscopic analysis revealed that the fluorescence intensity ratio of peak III/peak I correlated with anti-prion activity. This correlation was more clearly demonstrated in the anti-prion activity of the 1-year pre-infection treatment than that of the immediate post-infection treatment. In addition, the intensity ratio of peak III/peak I negatively correlated with the macrophage uptake level of HPMCs in our previous study. However, the in vivo distribution pattern was apparently not associated with anti-prion activity and was different in the representative tissues. These findings suggest that pyrene conjugation and spectroscopic analysis are powerful methods to successfully demonstrate local dielectric differences in HPMCs and provide a feasible parameter denoting the long-lasting anti-prion activity of HPMCs in vivo.
Neurotoxic Antibodies against the Prion Protein Do Not Trigger Prion Replication.
Directory of Open Access Journals (Sweden)
Karl Frontzek
Full Text Available Prions are the infectious agents causing transmissible spongiform encephalopathies (TSE, progressive, inexorably lethal neurological diseases. Antibodies targeting the globular domain (GD of the cellular prion protein PrPC trigger a neurotoxic syndrome morphologically and molecularly similar to prion disease. This phenomenon raises the question whether such antibodies induce infectious prions de novo. Here we exposed cerebellar organotypic cultured slices (COCS to the neurotoxic antibody, POM1. We then inoculated COCS homogenates into tga20 mice, which overexpress PrPC and are commonly utilized as sensitive indicators of prion infectivity. None of the mice inoculated with COCS-derived lysates developed any signs of disease, and all mice survived for at least 200 days post-inoculation. In contrast, all mice inoculated with bona fide prions succumbed to TSE after 55-95 days. Post-mortem analyses did not reveal any signs of prion pathology in mice inoculated with POM1-COCS lysates. Also, lysates from POM1-exposed COCS were unable to convert PrP by quaking. Hence, anti-GD antibodies do not catalyze the generation of prion infectivity. These data indicate that prion replication can be separated from prion toxicity, and suggest that anti-GD antibodies exert toxicity by acting downstream of prion replication.
Directory of Open Access Journals (Sweden)
Zou Zhengyun
2012-04-01
Full Text Available Summary Background Gambogic acid has a marked anti-tumor effect for gastric and colorectal cancers in vitro and in vivo. However, recent investigations on gambogic acid have focused mainly on mono-drug therapy, and its potential role in cancer therapy has not been comprehensively illustrated. This study aimed to assess the interaction between gambogic acid and docetaxel on human gastrointestinal cancer cells and to investigate the mechanism of gambogic acid plus docetaxel treatment-induced apoptotic cell death. Methods MTT assay was used to determine IC50 values in BGC-823, MKN-28, LOVO and SW-116 cells after gambogic acid and docetaxel administration. Median effect analysis was applied for determination of synergism and antagonism. Synergistic interaction between gambogic acid and docetaxel was evaluated using the combination index (CI method. Furthermore, cellular apoptosis was analyzed by Annexin-V and propidium iodide (PI double staining. Additionally, mRNA expression of drug-associated genes, i.e., β-tublin III and tau, and the apoptosis-related gene survivin, were measured by quantitative reverse transcription polymerase chain reaction (qRT-PCR. Results Gambogic acid provided a synergistic effect on the cytotoxicity induced by docetaxel in all four cell lines. The combined application of gambogic acid and docetaxel enhanced apoptosis in gastrointestinal cancer cells. Moreover, gambogic acid markedly decreased the mRNA expression of docetaxel-related genes, including β-tubulin III, tau and survivin, in BGC-823 cells. Conclusions Gambogic acid plus docetaxel produced a synergistic anti-tumor effect in gastrointestinal cancer cells, suggesting that the drug combination may offer a novel treatment option for patients with gastric and colorectal cancers.
Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice.
Giles, Kurt; Berry, David B; Condello, Carlo; Dugger, Brittany N; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B Michael; Olson, Steven H; Prusiner, Stanley B
2016-09-01
Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure-activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Abdulrahman, Basant A; Abdelaziz, Dalia; Thapa, Simrika; Lu, Li; Jain, Shubha; Gilch, Sabine; Proniuk, Stefan; Zukiwski, Alexander; Schatzl, Hermann M
2017-12-14
Prion diseases are fatal infectious neurodegenerative disorders that affect both humans and animals. The autocatalytic conversion of the cellular prion protein (PrP C ) into the pathologic isoform PrP Sc is a key feature in prion pathogenesis. AR-12 is an IND-approved derivative of celecoxib that demonstrated preclinical activity against several microbial diseases. Recently, AR-12 has been shown to facilitate clearance of misfolded proteins. The latter proposes AR-12 to be a potential therapeutic agent for neurodegenerative disorders. In this study, we investigated the role of AR-12 and its derivatives in controlling prion infection. We tested AR-12 in prion infected neuronal and non-neuronal cell lines. Immunoblotting and confocal microscopy results showed that AR-12 and its analogue AR-14 reduced PrP Sc levels after only 72 hours of treatment. Furthermore, infected cells were cured of PrP Sc after exposure of AR-12 or AR-14 for only two weeks. We partially attribute the influence of the AR compounds on prion propagation to autophagy stimulation, in line with our previous findings that drug-induced stimulation of autophagy has anti-prion effects in vitro and in vivo. Taken together, this study demonstrates that AR-12 and the AR-14 analogue are potential new therapeutic agents for prion diseases and possibly protein misfolding disorders involving prion-like mechanisms.
Brain delivery of AAV9 expressing an anti-PrP monovalent antibody delays prion disease in mice.
Moda, Fabio; Vimercati, Chiara; Campagnani, Ilaria; Ruggerone, Margherita; Giaccone, Giorgio; Morbin, Michela; Zentilin, Lorena; Giacca, Mauro; Zucca, Ileana; Legname, Giuseppe; Tagliavini, Fabrizio
2012-01-01
Prion diseases are caused by a conformational modification of the cellular prion protein (PrP (C)) into disease-specific forms, termed PrP (Sc), that have the ability to interact with PrP (C) promoting its conversion to PrP (Sc). In vitro studies demonstrated that anti-PrP antibodies inhibit this process. In particular, the single chain variable fragment D18 antibody (scFvD18) showed high efficiency in curing chronically prion-infected cells. This molecule binds the PrP (C) region involved in the interaction with PrP (Sc) thus halting further prion formation. These findings prompted us to test the efficiency of scFvD18 in vivo. A recombinant Adeno-Associated Viral vector serotype 9 was used to deliver scFvD18 to the brain of mice that were subsequently infected by intraperitoneal route with the mouse-adapted scrapie strain RML. We found that the treatment was safe, prolonged the incubation time of scrapie-infected animals and decreased the burden of total proteinase-resistant PrP (Sc) in the brain, suggesting that scFvD18 interferes with prion replication in vivo. This approach is relevant for designing new therapeutic strategies for prion diseases and other disorders characterized by protein misfolding.
Directory of Open Access Journals (Sweden)
Samuel E Saunders
2011-04-01
Full Text Available Prion interactions with soil may play an important role in the transmission of chronic wasting disease (CWD and scrapie. Prions are known to bind to a wide range of soil surfaces, but the effects of adsorption solution chemistry and long-term soil binding on prion fate and transmission risk are unknown. We investigated HY TME prion protein (PrP(Sc adsorption to soil minerals in aqueous solutions of phosphate buffered saline (PBS, sodium chloride, calcium chloride, and deionized water using western blotting. The replication efficiency of bound prions following adsorption in these solutions was also evaluated by protein misfolding cyclic amplification (PMCA. Aging studies investigated PrP(Sc desorption and replication efficiency up to one year following adsorption in PBS or DI water. Results indicate that adsorption solution chemistry can affect subsequent prion replication or desorption ability, especially after incubation periods of 30 d or longer. Observed effects were minor over the short-term (7 d or less. Results of long-term aging experiments demonstrate that unbound prions or prions bound to a diverse range of soil surfaces can readily replicate after one year. Our results suggest that while prion-soil interactions can vary with solution chemistry, prions bound to soil could remain a risk for transmitting prion diseases after months in the environment.
Directory of Open Access Journals (Sweden)
James B Stanton
Full Text Available Prion diseases, including sheep scrapie, are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrP(C to disease-associated prion protein (PrP(Sc. Chemical inhibition of prion accumulation is widely investigated, often using rodent-adapted prion cell culture models. Using a PrP(Sc-specific ELISA we discovered a monocationic phenyl-furan-benzimidazole (DB772, which has previously demonstrated anti-pestiviral activity and represents a chemical category previously untested for anti-prion activity, that inhibited PrP(Sc accumulation and prion infectivity in primary sheep microglial cell cultures (PRNP 136VV/154RR/171QQ and Rov9 cultures (VRQ-ovinized RK13 cells. We investigated potential mechanisms of this anti-prion activity by evaluating PrP(C expression with quantitative RT-PCR and PrP ELISA, comparing the concentration-dependent anti-prion and anti-pestiviral effects of DB772, and determining the selectivity index. Results demonstrate at least an approximate two-log inhibition of PrP(Sc accumulation in the two cell systems and confirmed that the inhibition of PrP(Sc accumulation correlates with inhibition of prion infectivity. PRNP transcripts and total PrP protein concentrations within cell lysates were not decreased; thus, decreased PrP(C expression is not the mechanism of PrP(Sc inhibition. PrP(Sc accumulation was multiple logs more resistant than pestivirus to DB772, suggesting that the anti-PrP(Sc activity was independent of anti-pestivirus activity. The anti-PrP(Sc selectivity index in cell culture was approximately 4.6 in microglia and 5.5 in Rov9 cells. The results describe a new chemical category that inhibits ovine PrP(Sc accumulation in primary sheep microglia and Rov9 cells, and can be used for future studies into the treatment and mechanism of prion diseases.
Prion infections and anti-PrP antibodies trigger converging neurotoxic pathways.
Directory of Open Access Journals (Sweden)
Uli S Herrmann
2015-02-01
Full Text Available Prions induce lethal neurodegeneration and consist of PrPSc, an aggregated conformer of the cellular prion protein PrPC. Antibody-derived ligands to the globular domain of PrPC (collectively termed GDL are also neurotoxic. Here we show that GDL and prion infections activate the same pathways. Firstly, both GDL and prion infection of cerebellar organotypic cultured slices (COCS induced the production of reactive oxygen species (ROS. Accordingly, ROS scavenging, which counteracts GDL toxicity in vitro and in vivo, prolonged the lifespan of prion-infected mice and protected prion-infected COCS from neurodegeneration. Instead, neither glutamate receptor antagonists nor inhibitors of endoplasmic reticulum calcium channels abolished neurotoxicity in either model. Secondly, antibodies against the flexible tail (FT of PrPC reduced neurotoxicity in both GDL-exposed and prion-infected COCS, suggesting that the FT executes toxicity in both paradigms. Thirdly, the PERK pathway of the unfolded protein response was activated in both models. Finally, 80% of transcriptionally downregulated genes overlapped between prion-infected and GDL-treated COCS. We conclude that GDL mimic the interaction of PrPSc with PrPC, thereby triggering the downstream events characteristic of prion infection.
International Nuclear Information System (INIS)
Xu, Qin; Zhang, Zhiyuan; Zhang, Ping; Chen, Wantao
2008-01-01
Antisense oligonucleotides against hTR (As-ODN-hTR) have shown promising results as treatment strategies for various human malignancies. All-trans retinoic acid (ATRA) is a signalling molecule with important roles in differentiation and apoptosis. Biological responses to ATRA are currently used therapeutically in various human cancers. The aim of this study was to evaluate the anti-tumor effects of As-ODN-hTR combined with ATRA in vivo. In situ human oral squamous cell carcinoma (OSCC) models were established by subcutaneous injection of Tca8113 cells. Mice were treated with sense oligonucleotides against hTR(S-ODN-hTR) alone, As-ODN-hTR alone, ATRA alone, As-ODN-hTR plus ATRA, or S-ODN-hTR plus ATRA. Tumor size and weight were assessed in the mice. Telomerase activity was detected by a TRAP assay, apoptotic cells were evaluated with a Tunel assay, the expression of apoptosis-related proteins (Bcl-2 and Bax) was evaluated by immunohistochemistry and ultrastructural morphological changes in the tumor specimen were examined. Both As-ODN-hTR and ATRA can significantly inhibit tumor growth in this OSCC xenograft solid-tumor model, and the combination of the two agents had a synergistic anti-tumorogenic effect. We also demonstrated that this anti-tumor effect correlated with inhibition of telomerase activity. Furthermore, significant increases in the number of apoptotic cells, typical apoptotic morphology and a downregulation of the anti-apoptotic protein, bcl-2 were observed in the treated tissues. The combination of As-ODN-hTR and ATRA has a synergistic anti-tumor effect. This anti-tumor effect can be mainly attributed to apoptosis induced by a decrease in telomerase activity. Bcl-2 plays an important role in this process. Therefore, combining As-ODN-hTR and ATRA may be an approach for the treatment of human oral squamous cell carcinoma
International Nuclear Information System (INIS)
Han, Young Soo; Song, Jie Young; Yoon, Yeon Sook; Kim, Joon Sik; Park, Byung Young; Lee, Hee Suk; Kim, Min Yung
2004-01-01
Anti-angiogenic composition called Meta-X was made from herbal medicines that are currently used oral drugs for other indications. We examined biochemical properties of Meta-X, and synergistic effect of Meta-X combined with irradiation on the inhibition of tumor growth
Energy Technology Data Exchange (ETDEWEB)
Han, Young Soo; Song, Jie Young; Yoon, Yeon Sook [Korea Institute of Radilolgical and Medical Science, Seoul (Korea, Republic of); Kim, Joon Sik; Park, Byung Young; Lee, Hee Suk; Kim, Min Yung [AngioLab, Seoul (Korea, Republic of)
2004-07-01
Anti-angiogenic composition called Meta-X was made from herbal medicines that are currently used oral drugs for other indications. We examined biochemical properties of Meta-X, and synergistic effect of Meta-X combined with irradiation on the inhibition of tumor growth.
Immunology of Prion Protein and Prions.
Mabbott, Neil A
2017-01-01
Many natural prion diseases are acquired peripherally, such as following the oral consumption of contaminated food or pasture. After peripheral exposure many prion isolates initially accumulate to high levels within the host's secondary lymphoid tissues. The replication of prions within these tissues is essential for their efficient spread to the brain where they ultimately cause neurodegeneration. This chapter describes our current understanding of the critical tissues, cells, and molecules which the prions exploit to mediate their efficient propagation from the site of exposure (such as the intestine) to the brain. Interactions between the immune system and prions are not only restricted to the secondary lymphoid tissues. Therefore, an account of how the activation status of the microglial in the brain can also influence progression of prion disease pathogenesis is provided. Prion disease susceptibility may also be influenced by additional factors such as chronic inflammation, coinfection with other pathogens, and aging. Finally, the potential for immunotherapy to provide a means of safe and effective prophylactic or therapeutic intervention in these currently untreatable diseases is considered. © 2017 Elsevier Inc. All rights reserved.
Bezdíčka, Martin
2013-01-01
The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...
Macedo, E M A; Santos, W C; Sousa, B P; Lopes, E M; Piauilino, C A; Cunha, F V M; Sousa, D P; Oliveira, F A; Almeida, F R C
2016-06-20
Pharmacological treatment of inflammatory pain is usually done by administration of non-steroidal anti-inflammatory drugs (NSAIDs). These drugs present high efficacy, although side effects are common, especially gastrointestinal lesions. One of the pharmacological strategies to minimize such effects is the combination of drugs and natural products with synergistic analgesic effect. The monoterpene terpinolene (TPL) is a chemical constituent of essential oils present in many plant species, which have pharmacological activities, such as analgesic and anti-inflammatory. The association of ineffective doses of TPL and diclofenac (DCF) (3.125 and 1.25 mg/kg po, respectively) presented antinociceptive and anti-inflammatory effects in the acute (0, 1, 2, 3, 4, 5 and 6 h, after treatment) and chronic (10 days) inflammatory hyperalgesia induced by Freund's complete adjuvant (CFA) in the right hind paw of female Wistar rats (170-230 g, n=6-8). The mechanical hyperalgesia was assessed by the Randall Selitto paw pressure test, which determines the paw withdrawal thresholds. The development of edema was quantified by measuring the volume of the hind paw by plethismography. The TPL/DCF association reduced neutrophils, macrophages and lymphocytes in the histological analysis of the paw, following a standard staining protocol with hematoxylin and eosin and the counts were performed with the aid of optical microscopy after chronic oral administration of these drugs. Moreover, the TPL/DCF association did not induce macroscopic gastric lesions. A possible mechanism of action of the analgesic effect is the involvement of 5-HT2A serotonin receptors, because ketanserin completely reversed the antinociceptive effect of the TPL/DCF association. These results suggest that the TPL/DCF association had a synergistic anti-inflammatory and analgesic effect without causing apparent gastric injury, and that the serotonergic system may be involved in the antinociceptive effect of this association.
Directory of Open Access Journals (Sweden)
E.M.A. Macedo
2016-01-01
Full Text Available Pharmacological treatment of inflammatory pain is usually done by administration of non-steroidal anti-inflammatory drugs (NSAIDs. These drugs present high efficacy, although side effects are common, especially gastrointestinal lesions. One of the pharmacological strategies to minimize such effects is the combination of drugs and natural products with synergistic analgesic effect. The monoterpene terpinolene (TPL is a chemical constituent of essential oils present in many plant species, which have pharmacological activities, such as analgesic and anti-inflammatory. The association of ineffective doses of TPL and diclofenac (DCF (3.125 and 1.25 mg/kg po, respectively presented antinociceptive and anti-inflammatory effects in the acute (0, 1, 2, 3, 4, 5 and 6 h, after treatment and chronic (10 days inflammatory hyperalgesia induced by Freund's complete adjuvant (CFA in the right hind paw of female Wistar rats (170-230 g, n=6-8. The mechanical hyperalgesia was assessed by the Randall Selitto paw pressure test, which determines the paw withdrawal thresholds. The development of edema was quantified by measuring the volume of the hind paw by plethismography. The TPL/DCF association reduced neutrophils, macrophages and lymphocytes in the histological analysis of the paw, following a standard staining protocol with hematoxylin and eosin and the counts were performed with the aid of optical microscopy after chronic oral administration of these drugs. Moreover, the TPL/DCF association did not induce macroscopic gastric lesions. A possible mechanism of action of the analgesic effect is the involvement of 5-HT2A serotonin receptors, because ketanserin completely reversed the antinociceptive effect of the TPL/DCF association. These results suggest that the TPL/DCF association had a synergistic anti-inflammatory and analgesic effect without causing apparent gastric injury, and that the serotonergic system may be involved in the antinociceptive effect of this
Classifying prion and prion-like phenomena.
Harbi, Djamel; Harrison, Paul M
2014-01-01
The universe of prion and prion-like phenomena has expanded significantly in the past several years. Here, we overview the challenges in classifying this data informatically, given that terms such as "prion-like", "prion-related" or "prion-forming" do not have a stable meaning in the scientific literature. We examine the spectrum of proteins that have been described in the literature as forming prions, and discuss how "prion" can have a range of meaning, with a strict definition being for demonstration of infection with in vitro-derived recombinant prions. We suggest that although prion/prion-like phenomena can largely be apportioned into a small number of broad groups dependent on the type of transmissibility evidence for them, as new phenomena are discovered in the coming years, a detailed ontological approach might be necessary that allows for subtle definition of different "flavors" of prion / prion-like phenomena.
Baral, Pravas Kumar; Swayampakula, Mridula; Aguzzi, Adriano; James, Michael N G
2018-05-01
Conversion of the cellular prion protein PrP C into its pathogenic isoform PrP S c is the hallmark of prion diseases, fatal neurodegenerative diseases affecting many mammalian species including humans. Anti-prion monoclonal antibodies can arrest the progression of prion diseases by stabilizing the cellular form of the prion protein. Here, we present the crystal structure of the POM6 Fab fragment, in complex with the mouse prion protein (moPrP). The prion epitope of POM6 is in close proximity to the epitope recognized by the purportedly toxic antibody fragment, POM1 Fab also complexed with moPrP. The POM6 Fab recognizes a larger binding interface indicating a likely stronger binding compared to POM1. POM6 and POM1 exhibit distinct biological responses. Structural comparisons of the bound mouse prion proteins from the POM6 Fab:moPrP and POM1 Fab:moPrP complexes reveal several key regions of the prion protein that might be involved in initiating mis-folding events. The structural data of moPrP:POM6 Fab complex are available in the PDB under the accession number www.rcsb.org/pdb/search/structidSearch.do?structureId=6AQ7. © 2018 Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
Julie Jodoin
2009-08-01
Full Text Available Previously, we have shown the loss of anti-Bax function in Creutzfeldt Jakob disease (CJD-associated prion protein (PrP mutants that are unable to generate cytosolic PrP (CyPrP. To determine if the anti-Bax function of PrP modulates the manifestation of prion diseases, we further investigated the anti-Bax function of eight familial Gerstmann-Sträussler-Scheinker Syndrome (GSS-associated PrP mutants. These PrP mutants contained their respective methionine ((M or valine ((V at codon 129. All of the mutants lost their ability to prevent Bax-mediated chromatin condensation or DNA fragmentation in primary human neurons. In the breast carcinoma MCF-7 cells, the F198S(V, D202N(V, P102L(V and Q217R(V retained, whereas the P102L(M, P105L(V, Y145stop(M and Q212P(M PrP mutants lost their ability to inhibit Bax-mediated condensed chromatin. The inhibition of Bax-mediated condensed chromatin depended on the ability of the mutants to generate cytosolic PrP. However, except for the P102L(V, none of the mutants significantly inhibited Bax-mediated caspase activation. These results show that the cytosolic PrP generated from the GSS mutants is not as efficient as wild type PrP in inhibiting Bax-mediated cell death. Furthermore, these results indicate that the anti-Bax function is also disrupted in GSS-associated PrP mutants and is not associated with the difference between CJD and GSS.
PrionHome: a database of prions and other sequences relevant to prion phenomena.
Directory of Open Access Journals (Sweden)
Djamel Harbi
Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic
PrionHome: a database of prions and other sequences relevant to prion phenomena.
Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M
2012-01-01
Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing
Nanomedicine for prion disease treatment: new insights into the role of dendrimers.
McCarthy, James M; Appelhans, Dietmar; Tatzelt, Jörg; Rogers, Mark S
2013-01-01
Despite their devastating impact, no effective therapeutic yet exists for prion diseases at the symptomatic stage in humans or animals. Progress is hampered by the difficulty in identifying compounds that affect PrP (Sc) and the necessity of any potential therapeutic to gain access to the CNS. Synthetic polymers known as dendrimers are a particularly promising candidate in this area. Studies with cell culture models of prion disease and prion infected brain homogenate have demonstrated that numerous species of dendrimers eliminate PrP (Sc) in a dose and time dependent fashion and specific glycodendrimers are capable of crossing the CNS. However, despite their potential a number of important questions remained unanswered such as what makes an effective dendrimer and how dendrimers eliminate prions intracellularly. In a number of recent studies we have tackled these questions and revealed for the first time that a specific dendrimer can inhibit the intracellular conversion of PrP (C) to PrP (Sc) and that a high density of surface reactive groups is a necessity for dendrimers in vitro anti-prion activity. Understanding how a therapeutic works is a vital component in maximising its activity and these studies therefore represent a significant development in the race to find effective treatments for prion diseases.
Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.
Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E
2016-01-01
Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far. Copyright © 2016 Elsevier Inc. All rights reserved.
The Prion Concept and Synthetic Prions.
Legname, Giuseppe; Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.
Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce
2015-06-01
Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by
Recombinant human prion protein inhibits prion propagation in vitro.
Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan
2013-10-09
Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.
Inactivation of Prions and Amyloid Seeds with Hypochlorous Acid.
Directory of Open Access Journals (Sweden)
Andrew G Hughson
2016-09-01
Full Text Available Hypochlorous acid (HOCl is produced naturally by neutrophils and other cells to kill conventional microbes in vivo. Synthetic preparations containing HOCl can also be effective as microbial disinfectants. Here we have tested whether HOCl can also inactivate prions and other self-propagating protein amyloid seeds. Prions are deadly pathogens that are notoriously difficult to inactivate, and standard microbial disinfection protocols are often inadequate. Recommended treatments for prion decontamination include strongly basic (pH ≥~12 sodium hypochlorite bleach, ≥1 N sodium hydroxide, and/or prolonged autoclaving. These treatments are damaging and/or unsuitable for many clinical, agricultural and environmental applications. We have tested the anti-prion activity of a weakly acidic aqueous formulation of HOCl (BrioHOCl that poses no apparent hazard to either users or many surfaces. For example, BrioHOCl can be applied directly to skin and mucous membranes and has been aerosolized to treat entire rooms without apparent deleterious effects. Here, we demonstrate that immersion in BrioHOCl can inactivate not only a range of target microbes, including spores of Bacillus subtilis, but also prions in tissue suspensions and on stainless steel. Real-time quaking-induced conversion (RT-QuIC assays showed that BrioHOCl treatments eliminated all detectable prion seeding activity of human Creutzfeldt-Jakob disease, bovine spongiform encephalopathy, cervine chronic wasting disease, sheep scrapie and hamster scrapie; these findings indicated reductions of ≥103- to 106-fold. Transgenic mouse bioassays showed that all detectable hamster-adapted scrapie infectivity in brain homogenates or on steel wires was eliminated, representing reductions of ≥~105.75-fold and >104-fold, respectively. Inactivation of RT-QuIC seeding activity correlated with free chlorine concentration and higher order aggregation or destruction of proteins generally, including prion
PrP(Sc-specific antibodies with the ability to immunodetect prion oligomers.
Directory of Open Access Journals (Sweden)
Mourad Tayebi
Full Text Available The development of antibodies with binding capacity towards soluble oligomeric forms of PrPSc recognised in the aggregation process in early stage of the disease would be of paramount importance in diagnosing prion diseases before extensive neuropathology has ensued. As blood transfusion appears to be efficient in the transmission of the infectious prion agent, there is an urgent need to develop reagents that would specifically recognize oligomeric forms of the abnormally folded prion protein, PrPSc.To that end, we show that anti-PrP monoclonal antibodies (called PRIOC mAbs derived from mice immunised with native PrP-coated microbeads are able to immunodetect oligomers/multimers of PrPSc. Oligomer-specific immunoreactivity displayed by these PRIOC mAbs was demonstrated as large aggregates of immunoreactive deposits in prion-permissive neuroblastoma cell lines but not in equivalent non-infected or prn-p(0/0 cell lines. In contrast, an anti-monomer PrP antibody displayed diffuse immunoreactivity restricted to the cell membrane. Furthermore, our PRIOC mAbs did not display any binding with monomeric recombinant and cellular prion proteins but strongly detected PrPSc oligomers as shown by a newly developed sensitive and specific ELISA. Finally, PrioC antibodies were also able to bind soluble oligomers formed of Aβ and α-synuclein. These findings demonstrate the potential use of anti-prion antibodies that bind PrPSc oligomers, recognised in early stage of the disease, for the diagnosis of prion diseases in blood and other body fluids.
Yeast prions: structure, biology, and prion-handling systems.
Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E
2015-03-01
A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Martin, Gary R; Sharkey, Keith A; Jirik, Frank R
2015-05-01
The oral uptake of infectious prions represents a common way to acquire a prion disease; thus, host factors, such as gut inflammation and intestinal "leakiness", have the potential to influence infectivity. For example, the ingestion of nonsteroidal anti-inflammatory drugs (NSAIDs) is known to induce intestinal inflammation and increase intestinal permeability. Previously, we reported that normal cellular prion protein (PrP(C)) expression was increased in experimental colitis, and since the level of PrP(C) expressed is a determinant of prion disease propagation, we hypothesized that NSAID administration prior to the oral inoculation of mice with infectious prions would increase intestinal PrP(C) expression and accelerate the onset of neurological disease. In the long-term experiments, one group of mice was gavaged with indomethacin, followed by a second gavage with brain homogenate containing mouse-adapted scrapie (ME7). Control mice received ME7 brain homogenate alone. Brain and splenic tissues were harvested at several time points for immunoblotting, including at the onset of clinical signs of disease. In a second series of experiments, mice were gavaged with indomethacin to assess the acute effects of this treatment on intestinal PrP(C) expression. Acutely, NSAID treatment reduced intestinal PrP(C) expression, and chronically, there was a modest delay in the onset of neurological disease. In contrast to our hypothesis, brief exposure to an NSAID decreased intestinal PrP(C) expression and led to a modest survival advantage following oral ingestion of infectious prions.
Shattuck, Jenifer E; Waechter, Aubrey C; Ross, Eric D
2017-07-04
Prion-like domains are low complexity, intrinsically disordered domains that compositionally resemble yeast prion domains. Many prion-like domains are involved in the formation of either functional or pathogenic protein aggregates. These aggregates range from highly dynamic liquid droplets to highly ordered detergent-insoluble amyloid-like aggregates. To better understand the amino acid sequence features that promote conversion to stable, detergent-insoluble aggregates, we used the prediction algorithm PAPA to identify predicted aggregation-prone prion-like domains with a range of compositions. While almost all of the predicted aggregation-prone domains formed foci when expressed in cells, the ability to form the detergent-insoluble aggregates was highly correlated with glutamine/asparagine (Q/N) content, suggesting that high Q/N content may specifically promote conversion to the amyloid state in vivo. We then used this data set to examine cross-seeding between prion-like proteins. The prion protein Sup35 requires the presence of a second prion, [PIN + ], to efficiently form prions, but this requirement can be circumvented by the expression of various Q/N-rich protein fragments. Interestingly, almost all of the Q/N-rich domains that formed SDS-insoluble aggregates were able to promote prion formation by Sup35, highlighting the highly promiscuous nature of these interactions.
Wang, Piwen; Phan, Tien; Gordon, David; Chung, Seyung; Henning, Susanne M.; Vadgama, Jaydutt V.
2014-01-01
Scope We investigated whether a combination of two promising chemopreventive agents arctigenin and quercetin increases the anti-carcinogenic potency at lower concentrations than necessary when used individually in prostate cancer. Methods and results Androgen-dependent LAPC-4 and LNCaP prostate cancer cells were treated with low doses of arctigenin and quercetin alone or in combination for 48h. The anti-proliferative activity of arctigenin was 10-20 fold stronger than quercetin in both cell lines. Their combination synergistically enhanced the anti-proliferative effect, with a stronger effect in androgen receptor (AR) wild-type LAPC-4 cells than in AR mutated LNCaP cells. Arctigenin demonstrated a strong ability to inhibit AR protein expression in LAPC-4 cells. The combination treatment significantly inhibited both AR and PI3K/Akt pathways compared to control. A protein array analysis revealed that the mixture targets multiple pathways particularly in LAPC-4 cells including Stat3 pathway. The mixture significantly inhibited the expression of several oncogenic microRNAs including miR-21, miR-19b, and miR-148a compared to control. The mixture also enhanced the inhibition of cell migration in both cell lines compared to individual compounds tested. Conclusion The combination of arctigenin and quercetin, that target similar pathways, at low physiological doses, provides a novel regimen with enhanced chemoprevention in prostate cancer. PMID:25380086
Hu, Zhengping; Ye, Liang; Xing, Yingying; Hu, Jinhang; Xi, Tao
2018-01-09
The increased PD-L1 induces poorer prognosis in melanoma. The treatment with PD-1/PD-L1 antibodies have a low response rate. The combination immunotherapies are the encouraging drug development strategy to receive maximal therapeutic benefit. In this study, we investigated the enhanced antitumor and immunomodulatory activity of combined SEP and αPD-L1 in B16-F10 melanoma-bearing mice. The results shown that combined SEP and αPD-L1 presented significant synergistic antitumor effects, increased the frequency of CD8 + and CD4 + T cells in spleen and tumor, cytotoxic activity of CTL in spleen, and IL-2 and IFN-γ levels in splenocytes and tumor. The combination treatment also produced synergistic increase in P-ERK1/2 level in spleen. Immunohistochemistry shown that SEP induced the PD-L1 expression in melanoma tissue possibly by promoting IFN-γ excretion, which led to the synergistic anti-tumor effects of aPD-L1 and SEP. Furthermore, in the purified T lymphocyte from the naive mice, the combination of SEP and αPD-L1 had more potent than SEP or αPD-L1 in promoting T lymphocyte proliferation and cytokines secretion including IL-2 and IFN-γ, at least partially by activating MEK/ERK pathway. Our study provides the scientific basis for a clinical trial that would involve combination of anti-PD-L1 mAb and SEP for sustained melanoma control.
Modulation of prion polymerization and toxicity by rationally designed peptidomimetics.
Srivastava, Ankit; Sharma, Sakshi; Sadanandan, Sandhya; Gupta, Sakshi; Singh, Jasdeep; Gupta, Sarika; Haridas, V; Kundu, Bishwajit
2017-01-01
Misfolding and aggregation of cellular prion protein is associated with a large array of neurological disorders commonly called the transmissible spongiform encephalopathies. Designing inhibitors against prions has remained a daunting task owing to limited information about mechanism(s) of their pathogenic self-assembly. Here, we explore the anti-prion properties of a combinatorial library of bispidine-based peptidomimetics (BPMs) that conjugate amino acids with hydrophobic and aromatic side chains. Keeping the bispidine unit unaltered, a series of structurally diverse BPMs were synthesized and tested for their prion-modulating properties. Administration of Leu- and Trp-BPMs delayed and completely inhibited the amyloidogenic conversion of human prion protein (HuPrP), respectively. We found that each BPM induced the HuPrP to form unique oligomeric nanostructures differing in their biophysical properties, cellular toxicities and response to conformation-specific antibodies. While Leu-BPMs were found to stabilize the oligomers, Trp-BPMs effected transient oligomerization, resulting in the formation of non-toxic, non-fibrillar aggregates. Yet another aromatic residue, Phe, however, accelerated the aggregation process in HuPrP. Molecular insights obtained through MD (molecular dynamics) simulations suggested that each BPM differently engages a conserved Tyr 169 residue at the α2-β2 loop of HuPrP and affects the stability of α2 and α3 helices. Our results demonstrate that this new class of molecules having chemical scaffolds conjugating hydrophobic/aromatic residues could effectively modulate prion aggregation and toxicity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Prions, prion-like prionoids, and neurodegenerative disordersVacancy
Directory of Open Access Journals (Sweden)
Ashok Verma
2016-01-01
Full Text Available Prion diseases or transmissible spongiform encephalopathies are fatal neurodegenerative diseases characterized by the aggregation and deposition of the misfolded prion protein in the brain. α-synuclein (α-syn-associated multiple system atrophy has been recently shown to be caused by a bona fide α-syn prion strain. Several other misfolded native proteins such as β-amyloid, tau and TDP-43 share some aspects of prions although none of them is shown to be transmissible in nature or in experimental animals. However, these prion-like “prionoids” are causal to a variety of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. The remarkable recent discovery of at least two new α-syn prion strains and their transmissibility in transgenic mice and in vitro cell models raises a distinct question as to whether some specific strain of other prionoids could have the capability of disease transmission in a manner similar to prions. In this overview, we briefly describe human and other mammalian prion diseases and comment on certain similarities between prion and prionoid and the possibility of prion-like transmissibility of some prionoid strains.
Prions and prion-like proteins.
Fraser, Paul E
2014-07-18
Prions are self-replicating protein aggregates and are the primary causative factor in a number of neurological diseases in mammals. The prion protein (PrP) undergoes a conformational transformation leading to aggregation into an infectious cellular pathogen. Prion-like protein spreading and transmission of aggregates between cells have also been demonstrated for other proteins associated with Alzheimer disease and Parkinson disease. This protein-only phenomenon may therefore have broader implications in neurodegenerative disorders. The minireviews in this thematic series highlight the recent advances in prion biology and the roles these unique proteins play in disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Prion Protein-specific antibodies that detect multiple TSE Agents with high sensitivity
McCutcheon, S.; Langeveld, J.P.M.; Tan, B.C.; Gill, A.C.; Wolf, de C.A.; Martin, S.; Gonzalez, L.; Alibhai, J.; Alejo Blanco, A.R.; Campbell, L.; Hunter, N.; Houston, E.F.
2014-01-01
This paper describes the generation, characterisation and potential applications of a panel of novel anti-prion protein monoclonal antibodies (mAbs). The mAbs were generated by immunising PRNP null mice, using a variety of regimes, with a truncated form of recombinant ovine prion protein spanning
Human prion diseases: surgical lessons learned from iatrogenic prion transmission.
Bonda, David J; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L; Schonberger, Lawrence B; Cali, Ignazio
2016-07-01
The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood "infectious protein" has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial transmission
Qureshi, Itefaq Hussain; Riaz, Azra; Khan, Rafeeq Alam; Siddiqui, Afaq Ahmed
2017-08-01
Status epilepticus is a life threatening neurological medical emergency. It may cause serious damage to the brain and even death in many cases if not treated properly. There is limited choice of drugs for the short term and long term management of status epilepticus and the dugs recommended for status epilepticus possess various side effects. The present study was designed to investigate synergistic anticonvulsant effects of pregabalin with amlodipine on acute seizure model of epilepsy in mice. Pentylenetetrazole was used to induce acute seizures which mimic status epilepticus. Pregabalin and amlodipine were used in combination to evaluate synergistic anti-seizure effects on acute seizure model of epilepsy in mice. Diazepam and valproate were used as reference dugs. The acute anti-convulsive activity of pregabalin with amlodipine was evaluated in vivo by the chemical induced seizures and their anti-seizure effects were compared with pentylenetetrazole, reference drugs and to their individual effects. The anti-seizure effects of tested drugs were recorded in seconds on seizure characteristics such as latency of onset of threshold seizures, rearing and fallings and Hind limbs tonic extensions. The seizure protection and mortality to the animals exhibited by the drugs were recorded in percentage. Combination regimen of pregabalin with amlodipine exhibited dose dependent significant synergistic anticonvulsant effects on acute seizures which were superior to their individual effects and equivalent to reference drugs.
... with facebook share with twitter share with linkedin Prion Diseases Prion diseases are a related group of ... deer and elk. Why Is the Study of Prion Diseases a Priority for NIAID? Much about TSE ...
Accelerated high fidelity prion amplification within and across prion species barriers.
Directory of Open Access Journals (Sweden)
Kristi M Green
2008-08-01
Full Text Available Experimental obstacles have impeded our ability to study prion transmission within and, more particularly, between species. Here, we used cervid prion protein expressed in brain extracts of transgenic mice, referred to as Tg(CerPrP, as a substrate for in vitro generation of chronic wasting disease (CWD prions by protein misfolding cyclic amplification (PMCA. Characterization of this infectivity in Tg(CerPrP mice demonstrated that serial PMCA resulted in the high fidelity amplification of CWD prions with apparently unaltered properties. Using similar methods to amplify mouse RML prions and characterize the resulting novel cervid prions, we show that serial PMCA abrogated a transmission barrier that required several hundred days of adaptation and subsequent stabilization in Tg(CerPrP mice. While both approaches produced cervid prions with characteristics distinct from CWD, the subtly different properties of the resulting individual prion isolates indicated that adaptation of mouse RML prions generated multiple strains following inter-species transmission. Our studies demonstrate that combined transgenic mouse and PMCA approaches not only expedite intra- and inter-species prion transmission, but also provide a facile means of generating and characterizing novel prion strains.
Genes contributing to prion pathogenesis
DEFF Research Database (Denmark)
Tamgüney, Gültekin; Giles, Kurt; Glidden, David V
2008-01-01
incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...
Choi, Yeong-Gon; Kim, Jae-Il; Choi, Eun-Kyoung; Carp, Richard I; Kim, Yong-Sun
2016-01-01
Previous studies have shown that the Nε-carboxymethyl group is linked to not only one or more N-terminal Lys residues but also to one or more Lys residues of the protease-resistant core region of the pathogenic prion isoform (PrPSc) in prion-infected brains. Using an anti-advanced glycation end product (AGE) antibody, we detected nonenzymatically glycated PrPSc (AGE-PrPSc) in prion-infected brains following concentration by a series of ultracentrifugation steps with a sucrose cushion. In the present study, the levels of in vitro nonenzymatic glycation of PrPSc using sucrose were investigated to determine whether sucrose cushion can artificially and nonenzymatically induce in vitro glycation during ultracentrifugation. The first insoluble pellet fraction following the first ultracentrifugation (PU1st) collected from 263K scrapie-infected brains was incubated with sucrose, glucose or colloidal silica coated with polyvinylpyrrolidone (percoll). None of the compounds in vitro resulted in AGE-PrPSc. Nonetheless, glucose and percoll produced AGEs in vitro from other proteins within PU1st of the infected brains. This reaction could lead to the AGE-modified polymer(s) of nonenzymatic glycation-prone protein(s). This study showed that PrPSc is not nonenzymatically glycated in vitro with sucrose, glucose or percoll and that AGE-modified PrPSc can be isolated and enriched from prion-infected brains.
Kabani, Mehdi; Melki, Ronald
2011-01-01
Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the "non-prion" domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others.
Investigating the synergistic antioxidant effects of some flavonoid and phenolic compounds
Directory of Open Access Journals (Sweden)
H. Hajimehdipoor
2014-04-01
Full Text Available Phenolic and flavonoid compounds are secondary metabolites of plants which possess various activities such as anti-inflammatory, analgesic, anti-diabetes and anticancer effects. It has been established that these compounds can scavenge free radicals produced in the body. Because of this ability, not only the plants containing phenolic and flavonoid compounds but also, the pure compounds are used in medicinal products for prevention and treatment of many disorders. Considering that the golden aim of the pharmaceutical industries is using the most effective compounds with lower concentrations, determination of the best combination of the compounds with synergistic effects is important. In the present study, synergistic antioxidant effects of four phenolic compounds including caffeic acid, gallic acid, rosmarinic acid, chlorogenic acid and two flavonoids, rutin and quercetin, have been investigated by FRAP (Ferric Reducing Antioxidant Power method. The synergistic effect was assessed by comparing the experimental antioxidant activity of the mixtures with calculated theoretical values and the interactions of the compounds were determined. The results showed that combination of gallic acid and caffeic acid demonstrated considerable synergistic effects (137.8% while other combinations were less potent. Among examined substances, rutin was the only one which had no effect on the other compounds. The results of ternary combinations of compounds demonstrated antagonistic effects in some cases. This was more considerable in mixture of rutin, caffeic acid, rosmarinic acid (-21.8%, chlorogenic acid, caffeic acid, rosmarinic acid (-20%, rutin, rosmarinic acid, gallic acid (-18.5% and rutin, chlorogenic acid, caffeic acid (-15.8%, while, combination of quercetin, gallic acid, caffeic acid (59.4% and quercetin, gallic acid, rutin (55.2% showed the most synergistic effects. It was concluded that binary and ternary combination of quercetin, rutin, caffeic acid
Soluble Aβ aggregates can inhibit prion propagation.
Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John
2017-11-01
Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.
International Nuclear Information System (INIS)
Siddiqui, Rafat A; Harvey, Kevin A; Walker, Candace; Altenburg, Jeffrey; Xu, Zhidong; Terry, Colin; Camarillo, Ignacio; Jones-Hall, Yava; Mariash, Cary
2013-01-01
The major obstacles to the successful use of individual nutritional compounds as preventive or therapeutic agents are their efficacy and bioavailability. One approach to overcoming this problem is to use combinations of nutrients to induce synergistic effects. The objective of this research was to investigate the synergistic effects of two dietary components: docosahexaenoic acid (DHA), an omega-3 fatty acid present in cold-water fish, and curcumin (CCM), an herbal nutrient present in turmeric, in an in vivo model of DMBA-induced mammary tumorigenesis in mice. We used the carcinogen DMBA to induce breast tumors in SENCAR mice on control, CCM, DHA, or DHA + CCM diets. Appearance and tumor progression were monitored daily. The tumors were harvested 15 days following their first appearance for morphological and immunohistological analysis. Western analysis was performed to determine expression of maspin and survivin in the tumor tissues. Characterization of tumor growth was analyzed using appropriate statistical methods. Otherwise all other results are reported as mean ± SD and analyzed with one-way ANOVA and Tukey’s post hoc procedure. Analysis of gene microarray data indicates that combined treatment with DHA + CCM altered the profile of “PAM50” genes in the SK-BR-3 cell line from an ER - /Her-2 + to that resembling a “normal-like” phenotype. The in vivo studies demonstrated that DHA + CCM treatment reduced the incidence of breast tumors, delayed tumor initiation, and reduced progression of tumor growth. Dietary treatment had no effect on breast size development, but tumors from mice on a control diet (untreated) were less differentiated than tumors from mice fed CCM or DHA + CCM diets. The synergistic effects also led to increased expression of the pro-apoptotic protein, maspin, but reduced expression of the anti-apoptotic protein, survivin. The SK-BR-3 cells and DMBA-induced tumors, both with an ER - and Her-2 + phenotype, were affected by the
Directory of Open Access Journals (Sweden)
Hongbiao Huang
Full Text Available Combinations of proteasome inhibitors and histone deacetylases (HDAC inhibitors appear to be the most potent to produce synergistic cytotoxicity in preclinical trials. We have recently confirmed that L-carnitine (LC is an endogenous HDAC inhibitor. In the current study, the anti-tumor effect of LC plus proteasome inhibitor bortezomib (velcade, Vel was investigated both in cultured hepatoma cancer cells and in Balb/c mice bearing HepG2 tumor. Cell death and cell viability were assayed by flow cytometry and MTS, respectively. Gene, mRNA expression and protein levels were detected by gene microarray, quantitative real-time PCR and Western blot, respectively. The effect of Vel on the acetylation of histone H3 associated with the p21(cip1 gene promoter was examined by using ChIP assay and proteasome peptidase activity was detected by cell-based chymotrypsin-like (CT-like activity assay. Here we report that (i the combination of LC and Vel synergistically induces cytotoxicity in vitro; (ii the combination also synergistically inhibits tumor growth in vivo; (iii two major pathways are involved in the synergistical effects of the combinational treatment: increased p21(cip1 expression and histone acetylation in vitro and in vivo and enhanced Vel-induced proteasome inhibition by LC. The synergistic effect of LC and Vel in cancer therapy should have great potential in the future clinical trials.
Thermodynamic Stabilization of the Folded Domain of Prion Protein Inhibits Prion Infection in Vivo
Directory of Open Access Journals (Sweden)
Qingzhong Kong
2013-07-01
Full Text Available Prion diseases, or transmissible spongiform encephalopathies (TSEs, are associated with the conformational conversion of the cellular prion protein, PrPC, into a protease-resistant form, PrPSc. Here, we show that mutation-induced thermodynamic stabilization of the folded, α-helical domain of PrPC has a dramatic inhibitory effect on the conformational conversion of prion protein in vitro, as well as on the propagation of TSE disease in vivo. Transgenic mice expressing a human prion protein variant with increased thermodynamic stability were found to be much more resistant to infection with the TSE agent than those expressing wild-type human prion protein, in both the primary passage and three subsequent subpassages. These findings not only provide a line of evidence in support of the protein-only model of TSEs but also yield insight into the molecular nature of the PrPC→PrPSc conformational transition, and they suggest an approach to the treatment of prion diseases.
Cellular Aspects of Prion Replication In Vitro
Grassmann, Andrea; Wolf, Hanna; Hofmann, Julia; Graham, James; Vorberg, Ina
2013-01-01
Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative disorders in mammals that are caused by unconventional agents predominantly composed of aggregated misfolded prion protein (PrP). Prions self-propagate by recruitment of host-encoded PrP into highly ordered β-sheet rich aggregates. Prion strains differ in their clinical, pathological and biochemical characteristics and are likely to be the consequence of distinct abnormal prion protein conformers that stably replicate their alternate states in the host cell. Understanding prion cell biology is fundamental for identifying potential drug targets for disease intervention. The development of permissive cell culture models has greatly enhanced our knowledge on entry, propagation and dissemination of TSE agents. However, despite extensive research, the precise mechanism of prion infection and potential strain effects remain enigmatic. This review summarizes our current knowledge of the cell biology and propagation of prions derived from cell culture experiments. We discuss recent findings on the trafficking of cellular and pathologic PrP, the potential sites of abnormal prion protein synthesis and potential co-factors involved in prion entry and propagation. PMID:23340381
Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel
2013-01-01
Upon prion infection, abnormal prion protein (PrPSc) self-perpetuate by conformational conversion of α-helix-rich PrPC into β sheet enriched form, leading to formation and deposition of PrPSc aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrPSc and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region. PMID:23232499
Oh, Euna; Jeon, Byeonghwa
2015-01-01
The increasing resistance of Campylobacter to clinically important antibiotics, such as fluoroquinolones and macrolides, is a serious public health problem. The objective of this study is to investigate synergistic anti-Campylobacter jejuni activity of fluoroquinolones and macrolides in combination with phenolic compounds. Synergistic antimicrobial activity was measured by performing a checkerboard assay with ciprofloxacin and erythromycin in the presence of 21 phenolic compounds. Membrane permeability changes in C. jejuni by phenolic compounds were determined by measuring the level of intracellular uptake of 1-N-phenylnaphthylamine (NPN). Antibiotic accumulation assays were performed to evaluate the level of ciprofloxacin accumulation in C. jejuni. Six phenolic compounds, including p-coumaric acid, sinapic acid, caffeic acid, vanillic acid, gallic acid, and taxifolin, significantly increased the susceptibility to ciprofloxacin and erythromycin in several human and poultry isolates. The synergistic antimicrobial effect was also observed in ciprofloxacin- and erythromycin-resistant C. jejuni strains. The phenolic compounds also substantially increased membrane permeability and antibiotic accumulation in C. jejuni. Interestingly, some phenolic compounds, such as gallic acid and taxifolin, significantly reduced the expression of the CmeABC multidrug efflux pump. Phenolic compounds increased the NPN accumulation in the cmeB mutant, indicating phenolic compounds may affect the membrane permeability. In this study, we successfully demonstrated that combinational treatment of C. jejuni with antibiotics and phenolic compounds synergistically inhibits C. jejuni by impacting both antimicrobial influx and efflux. PMID:26528273
Spermidine cures yeast of prions
Directory of Open Access Journals (Sweden)
Shaun H. Speldewinde
2015-12-01
Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.
Relaño-Ginés, Aroa; Lehmann, Sylvain; Crozet, Carole
2014-01-01
Scientific advances in stem cell biology and adult neurogenesis have raised the hope that neurodegenerative disorders could benefit from stem cell-based therapy. Adult neurogenesis might be part of the physiological regenerative process, however it might become impaired by the disease's mechanism and therefore contribute to neurodegeneration. In prion disorders this endogenous repair system has rarely been studied. Whether adult neurogenesis plays a role or not in brain repair or in the propagation of prion pathology remains unclear. We have recently investigated the status of adult neural stem cells isolated from prion-infected mice. We were able to show that neural stem cells accumulate and replicate prions thus resulting in an alteration of their neuronal destiny. We also reproduced these results in adult neural stem cells, which were infected in vitro. The fact that endogenous adult neurogenesis could be altered by the accumulation of misfolded prion protein represents another great challenge. Inhibiting prion propagation in these cells would thus help the endogenous neurogenesis to compensate for the injured neuronal system. Moreover, understanding the endogenous modulation of the neurogenesis system would help develop effective neural stem cell-based therapies.
An Enzymatic Treatment of Soil-Bound Prions Effectively Inhibits Replication ▿
Saunders, Samuel E.; Bartz, Jason C.; Vercauteren, Kurt C.; Bartelt-Hunt, Shannon L.
2011-01-01
Chronic wasting disease (CWD) and scrapie can be transmitted through indirect environmental routes, possibly via soil, and a practical decontamination strategy for prion-contaminated soil is currently unavailable. In the laboratory, an enzymatic treatment under environmentally relevant conditions (22°C, pH 7.4) can degrade soil-bound PrPSc below the limits of Western blot detection. We developed and used a quantitative serial protein misfolding cyclic amplification (PMCA) protocol to characterize the amplification efficiency of treated soil samples relative to controls of known infectious titer. Our results suggest large (104- to >106-fold) decreases in soil-bound prion infectivity following enzyme treatment, demonstrating that a mild enzymatic treatment could effectively reduce the risk of prion disease transmission via soil or other environmental surfaces. PMID:21571886
Leske, Henning; Hornemann, Simone; Herrmann, Uli Simon; Zhu, Caihong; Dametto, Paolo; Li, Bei; Laferriere, Florent; Polymenidou, Magdalini; Pelczar, Pawel; Reimann, Regina Rose; Schwarz, Petra; Rushing, Elisabeth Jane; Wüthrich, Kurt; Aguzzi, Adriano
2017-01-01
Resistance to proteolytic digestion has long been considered a defining trait of prions in tissues of organisms suffering from transmissible spongiform encephalopathies. Detection of proteinase K-resistant prion protein (PrPSc) still represents the diagnostic gold standard for prion diseases in humans, sheep and cattle. However, it has become increasingly apparent that the accumulation of PrPSc does not always accompany prion infections: high titers of prion infectivity can be reached also in the absence of protease resistant PrPSc. Here, we describe a structural basis for the phenomenon of protease-sensitive prion infectivity. We studied the effect on proteinase K (PK) resistance of the amino acid substitution Y169F, which removes a single oxygen atom from the β2-α2 loop of the cellular prion protein (PrPC). When infected with RML or the 263K strain of prions, transgenic mice lacking wild-type (wt) PrPC but expressing MoPrP169F generated prion infectivity at levels comparable to wt mice. The newly generated MoPrP169F prions were biologically indistinguishable from those recovered from prion-infected wt mice, and elicited similar pathologies in vivo. Surprisingly, MoPrP169F prions showed greatly reduced PK resistance and density gradient analyses showed a significant reduction in high-density aggregates. Passage of MoPrP169F prions into mice expressing wt MoPrP led to full recovery of protease resistance, indicating that no strain shift had taken place. We conclude that a subtle structural variation in the β2-α2 loop of PrPC affects the sensitivity of PrPSc to protease but does not impact prion replication and infectivity. With these findings a specific structural feature of PrPC can be linked to a physicochemical property of the corresponding PrPSc.
Abdulbaqi, Hayder Raad; Himratul-Aznita, Wan Harun; Baharuddin, Nor Adinar
2016-10-01
Green tea (Gt), leafs of Camellia sinensis var. assamica, is widely consumed as healthy beverage since thousands of years in Asian countries. Chewing sticks (miswak) of Salvadora persica L. (Sp) are traditionally used as natural brush to ensure oral health in developing countries. Both Gt and Sp extracts were reported to have anti-bacterial activity against many dental plaque bacteria. However, their combination has never been tested to have anti-bacterial and anti-adherence effect against primary dental plaque colonizers, playing an initial role in the dental plaque development, which was investigated in this study. Two-fold serial micro-dilution method was used to measure minimal inhibitory concentration (MIC) of aqueous extracts of Gt, Sp and their combinations. Adsorption to hexadecane was used to determine the cell surface hydrophobicity (CSH) of bacterial cells. Glass beads were used to mimic the hard tissue surfaces, and were coated with saliva to develop experimental pellicles for the adhesion of the primary colonizing bacteria. Gt aqueous extracts exhibited better anti-plaque effect than Sp aqueous extracts. Their combination, equivalent to 1/4 and 1/2 of MIC values of Gt and Sp extracts respectively, showed synergistic anti-plaque properties with fractional inhibitory concentration (FIC) equal to 0.75. This combination was found to significantly reduce CSH (pplaque activity, and could be used as a useful active agent to produce oral health care products. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Imperiale Valentina
2007-07-01
Full Text Available Abstract Background A hallmark of prion disease is the transformation of normal cellular prion protein (PrPc into an infectious disease-associated isoform, (PrPsc. Anti-prion protein monoclonal antibodies are invaluable for structure-function studies of PrP molecules. Furthermore recent in vitro and in vivo studies indicate that anti-PrP monoclonal antibodies can prevent the incorporation of PrPc into propagating prions. In the present article, we show two new human phage antibodies, isolated on recombinant hamster prion protein (rHaPrP. Results We adopted an antibody phage display strategy to isolate specific human antibodies directed towards rHaPrP which has been used as a bait for panning the synthetic ETH-2 antibody phage library. Two phage antibodies clones named MA3.B4 and MA3.G3 were isolated and characterized under genetic biochemical and immunocytochemical aspects. The clones were found to recognize the prion protein in ELISA studies. In flow-cytometry studies, these human single chain Fragment variable (scFv phage-antibodies show a well defined pattern of reactivity on human lymphoblastoid and myeloid cells. Conclusion Sequence analysis of the gene encoding for the antibody fragments and antigen recognition patterns determined by flow-cytometry analysis indicate that the isolated scFvs recognize novel epitopes in the PrPc molecule. These new anti PrPc human antibodies are unique reagents for prion protein detection and may represent a biologic platform to develop new reagents to treat PrPsc associated disease.
Yeast prions and human prion-like proteins: sequence features and prediction methods.
Cascarina, Sean M; Ross, Eric D
2014-06-01
Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.
Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.
Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F
2016-05-01
Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.
O’Connor, Tracy; Aguzzi, Adriano
2013-01-01
Prion colonization of secondary lymphoid organs (SLOs) is a critical step preceding neuroinvasion in prion pathogenesis. Follicular dendritic cells (FDCs), which depend on both tumor necrosis factor receptor 1 (TNFR1) and lymphotoxin β receptor (LTβR) signaling for maintenance, are thought to be the primary sites of prion accumulation in SLOs. However, prion titers in RML-infected TNFR1−/− lymph nodes and rates of neuroinvasion in TNFR1−/− mice remain high despite the absence of mature FDCs. Recently, we discovered that TNFR1-independent prion accumulation in lymph nodes relies on LTβR signaling. Loss of LTβR signaling in TNFR1−/− lymph nodes coincided with the de-differentiation of high endothelial venules (HEVs)—the primary sites of lymphocyte entry into lymph nodes. These findings suggest that HEVs are the sites through which prions initially invade lymph nodes from the bloodstream. Identification of HEVs as entry portals for prions clarifies a number of previous observations concerning peripheral prion pathogenesis. However, a number of questions still remain: What is the mechanism by which prions are taken up by HEVs? Which cells are responsible for delivering prions to lymph nodes? Are HEVs the main entry site for prions into lymph nodes or do alternative routes also exist? These questions and others are considered in this article. PMID:23357827
Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2010-10-01
Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.
Leliveld, S. R.; Dame, R.T.; Wuite, G.J.L.; Stitz, L.; Korth, C.
2006-01-01
Insertion of additional octarepeats into the prion protein gene has been genetically linked to familial Creutzfeldt Jakob disease and hence to de novo generation of infectious prions. The pivotal event during prion formation is the conversion of the normal prion protein (PrP
Protease-sensitive synthetic prions.
Directory of Open Access Journals (Sweden)
David W Colby
2010-01-01
Full Text Available Prions arise when the cellular prion protein (PrP(C undergoes a self-propagating conformational change; the resulting infectious conformer is designated PrP(Sc. Frequently, PrP(Sc is protease-resistant but protease-sensitive (s prions have been isolated in humans and other animals. We report here that protease-sensitive, synthetic prions were generated in vitro during polymerization of recombinant (rec PrP into amyloid fibers. In 22 independent experiments, recPrP amyloid preparations, but not recPrP monomers or oligomers, transmitted disease to transgenic mice (n = 164, denoted Tg9949 mice, that overexpress N-terminally truncated PrP. Tg9949 control mice (n = 174 did not spontaneously generate prions although they were prone to late-onset spontaneous neurological dysfunction. When synthetic prion isolates from infected Tg9949 mice were serially transmitted in the same line of mice, they exhibited sPrP(Sc and caused neurodegeneration. Interestingly, these protease-sensitive prions did not shorten the life span of Tg9949 mice despite causing extensive neurodegeneration. We inoculated three synthetic prion isolates into Tg4053 mice that overexpress full-length PrP; Tg4053 mice are not prone to developing spontaneous neurological dysfunction. The synthetic prion isolates caused disease in 600-750 days in Tg4053 mice, which exhibited sPrP(Sc. These novel synthetic prions demonstrate that conformational changes in wild-type PrP can produce mouse prions composed exclusively of sPrP(Sc.
Du, Zhiqiang; Valtierra, Stephanie; Li, Liming
2014-01-01
The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.
Prion protein and scrapie susceptibility
Smits, M.A.; Bossers, A.; Schreuder, B.E.C.
1997-01-01
This article presents briefly current views on the role of prion protein (PrP) in Transmissible Spongiform Encephalopathies or prion diseases and the effect of PrP polymoryhisms on the susceptibility to these diseases, with special emphasis on sheep scrapie. The PrP genotype of sheep apears to be a
Saccharomyces cerevisiae: a sexy yeast with a prion problem.
Kelly, Amy C; Wickner, Reed B
2013-01-01
Yeast prions are infectious proteins that spread exclusively by mating. The frequency of prions in the wild therefore largely reflects the rate of spread by mating counterbalanced by prion growth slowing effects in the host. We recently showed that the frequency of outcross mating is about 1% of mitotic doublings with 23-46% of total matings being outcrosses. These findings imply that even the mildest forms of the [PSI+], [URE3] and [PIN+] prions impart > 1% growth/survival detriment on their hosts. Our estimate of outcrossing suggests that Saccharomyces cerevisiae is far more sexual than previously thought and would therefore be more responsive to the adaptive effects of natural selection compared with a strictly asexual yeast. Further, given its large effective population size, a growth/survival detriment of > 1% for yeast prions should strongly select against prion-infected strains in wild populations of Saccharomyces cerevisiae.
De novo generation of infectious prions with bacterially expressed recombinant prion protein.
Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan
2013-12-01
The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.
A systematic investigation of production of synthetic prions from recombinant prion protein.
Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John
2015-12-01
According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.
PrionScan: an online database of predicted prion domains in complete proteomes.
Espinosa Angarica, Vladimir; Angulo, Alfonso; Giner, Arturo; Losilla, Guillermo; Ventura, Salvador; Sancho, Javier
2014-02-05
Prions are a particular type of amyloids related to a large variety of important processes in cells, but also responsible for serious diseases in mammals and humans. The number of experimentally characterized prions is still low and corresponds to a handful of examples in microorganisms and mammals. Prion aggregation is mediated by specific protein domains with a remarkable compositional bias towards glutamine/asparagine and against charged residues and prolines. These compositional features have been used to predict new prion proteins in the genomes of different organisms. Despite these efforts, there are only a few available data sources containing prion predictions at a genomic scale. Here we present PrionScan, a new database of predicted prion-like domains in complete proteomes. We have previously developed a predictive methodology to identify and score prionogenic stretches in protein sequences. In the present work, we exploit this approach to scan all the protein sequences in public databases and compile a repository containing relevant information of proteins bearing prion-like domains. The database is updated regularly alongside UniprotKB and in its present version contains approximately 28000 predictions in proteins from different functional categories in more than 3200 organisms from all the taxonomic subdivisions. PrionScan can be used in two different ways: database query and analysis of protein sequences submitted by the users. In the first mode, simple queries allow to retrieve a detailed description of the properties of a defined protein. Queries can also be combined to generate more complex and specific searching patterns. In the second mode, users can submit and analyze their own sequences. It is expected that this database would provide relevant insights on prion functions and regulation from a genome-wide perspective, allowing researches performing cross-species prion biology studies. Our database might also be useful for guiding experimentalists
Defining the conformational features of anchorless, poorly neuroinvasive prions.
Directory of Open Access Journals (Sweden)
Cyrus Bett
Full Text Available Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same infectious prion develop fibrillar or nonfibrillar aggregates, respectively, and show a striking divergence in the disease pathogenesis. To better understand how a prion's physical properties govern the pathogenesis, infectious anchorless prions were passaged in mice expressing anchorless prion protein and the resulting prions were biochemically characterized. Serial passage of anchorless prions led to a significant decrease in the incubation period to terminal disease and altered the biochemical properties, consistent with a transmission barrier effect. After an intraperitoneal exposure, anchorless prions were only weakly neuroinvasive, as prion plaques rarely occurred in the brain yet were abundant in extracerebral sites such as heart and adipose tissue. Anchorless prions consistently showed very high stability in chaotropes or when heated in SDS, and were highly resistant to enzyme digestion. Consistent with the results in mice, anchorless prions from a human patient were also highly stable in chaotropes. These findings reveal that anchorless prions consist of fibrillar and highly stable conformers. The additional finding from our group and others that both anchorless and anchored prion fibrils are poorly neuroinvasive strengthens the hypothesis that a fibrillar prion structure impedes efficient CNS invasion.
Prion protein immunocytochemistry helps to establish the true incidence of prion diseases.
Lantos, P L; McGill, I S; Janota, I; Doey, L J; Collinge, J; Bruce, M T; Whatley, S A; Anderton, B H; Clinton, J; Roberts, G W
1992-11-23
Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strüssler-Scheinker disease (GSSD) are transmissible spongiform encephalopathies or prion diseases affecting man. It has been reported that prion diseases may occur without the histological hallmarks of spongiform encephalopathies: vacuolation of the cerebral grey matter, neuronal loss and astrocytosis. These cases without characteristic neuropathology may go undiagnosed and consequently the true incidence of transmissible dementias is likely to have been under-estimated. Immunocytochemistry using antibodies to prion protein gives positive staining of these cases, albeit the pattern of immunostaining differs from that seen in typical forms. Accumulation of prion protein is a molecular hallmark of prion diseases, and thus a reproducible, speedy and cost-efficient immunocytochemical screening of unusual dementias may help to establish the true incidence of prion diseases.
Porcine prion protein amyloid.
Hammarström, Per; Nyström, Sofie
2015-01-01
Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.
Incunabular Immunological Events in Prion Trafficking
Michel, Brady; Meyerett-Reid, Crystal; Johnson, Theodore; Ferguson, Adam; Wyckoff, Christy; Pulford, Bruce; Bender, Heather; Avery, Anne; Telling, Glenn; Dow, Steven; Zabel, Mark D.
2012-01-01
While prions probably interact with the innate immune system immediately following infection, little is known about this initial confrontation. Here we investigated incunabular events in lymphotropic and intranodal prion trafficking by following highly enriched, fluorescent prions from infection sites to draining lymph nodes. We detected biphasic lymphotropic transport of prions from the initial entry site upon peripheral prion inoculation. Prions arrived in draining lymph nodes cell autonomously within two hours of intraperitoneal administration. Monocytes and dendritic cells (DCs) required Complement for optimal prion delivery to lymph nodes hours later in a second wave of prion trafficking. B cells constituted the majority of prion-bearing cells in the mediastinal lymph node by six hours, indicating intranodal prion reception from resident DCs or subcapsulary sinus macrophages or directly from follicular conduits. These data reveal novel, cell autonomous prion lymphotropism, and a prominent role for B cells in intranodal prion movement. PMID:22679554
Prion-Like Domains in Phagobiota
Directory of Open Access Journals (Sweden)
George Tetz
2017-11-01
Full Text Available Prions are molecules characterized by self-propagation, which can undergo a conformational switch leading to the creation of new prions. Prion proteins have originally been associated with the development of mammalian pathologies; however, recently they have been shown to contribute to the environmental adaptation in a variety of prokaryotic and eukaryotic organisms. Bacteriophages are widespread and represent the important regulators of microbiota homeostasis and have been shown to be diverse across various bacterial families. Here, we examined whether bacteriophages contain prion-like proteins and whether these prion-like protein domains are involved in the regulation of homeostasis. We used a computational algorithm, prion-like amino acid composition, to detect prion-like domains in 370,617 publicly available bacteriophage protein sequences, which resulted in the identification of 5040 putative prions. We analyzed a set of these prion-like proteins, and observed regularities in their distribution across different phage families, associated with their interactions with the bacterial host cells. We found that prion-like domains could be found across all phages of various groups of bacteria and archaea. The results obtained in this study indicate that bacteriophage prion-like proteins are predominantly involved in the interactions between bacteriophages and bacterial cell, such as those associated with the attachment and penetration of bacteriophage in the cell, and the release of the phage progeny. These data allow the identification of phage prion-like proteins as novel regulators of the interactions between bacteriophages and bacterial cells.
Energy Technology Data Exchange (ETDEWEB)
Yang, Hao [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); College of Medicine, Yangzhou University, Yangzhou 225001, Jiangsu (China); Institute of Pharmacology and Toxicology, Jiangsu Kanion Pharmaceutical Co., Ltd., Lianyungang 222000, Jiangsu (China); Wang, Juan [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); College of Medicine, Yangzhou University, Yangzhou 225001, Jiangsu (China); Fan, Jin-hong; Zhang, Ya-qi; Zhao, Jun-xian [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); Dai, Xiao-jun [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); Chinese Medicine Hospital of Yangzhou City, Yangzhou 225009, Jiangsu (China); Liu, Qi; Shen, Yan-jun [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); College of Medicine, Yangzhou University, Yangzhou 225001, Jiangsu (China); Liu, Chang [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); Sun, Wei-dong, E-mail: zyykjc@sina.com [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); Chinese Medicine Hospital of Yangzhou City, Yangzhou 225009, Jiangsu (China); Sun, Yun, E-mail: ysun@yzu.edu.cn [Medical and Pharmaceutical Institute, Yangzhou University, Yangzhou 225001, Jiangsu (China); College of Medicine, Yangzhou University, Yangzhou 225001, Jiangsu (China)
2017-01-15
Recently, we reported that Ilexgenin A exhibits anti-cancer activities and induces cell arrest. Here, we investigated the effect of Ilexgenin A on the inflammation, angiogenesis and tumor growth of hepatocellular carcinoma (HCC). Our current study revealed that Ilexgenin A significantly inhibited the inflammatory cytokines TNF-α and IL-6 levels and downregulated pro-angiogenic factor VEGF production and transcription in HepG2 cells. The underlying mechanism for Ilexgenin A effects appears to be through inhibiting STAT3 and PI3K pathways. Furthermore, we found that not only Ilexgenin A inhibited STAT3 and PI3K pathways in HepG2 cells but also blocked these signaling pathways in HUVECs. Most importantly, by employing two HCC xenografts models - HepG2 and H22, we showed that Ilexgenin A reduced tumor growth and exhibited synergy effect with Sorafenib. ELISA assay, histological analysis and immunohistochemistry examination revealed that the expression of VEGF and MVD was significantly decreased after the treatment with Ilexgenin A and the combination. Moreover, Ilexgenin A could enhance caspase-3/7 activity in vitro and transmission electron microscope indicated that the combination induced evident apoptosis of tumor cells and caused the structural changes of mitochondria in vivo. Although no apparent adverse effects occurred during the treatment period, Sorafenib monotherapy elicited hepatotoxicity for specific expression in the increased level of AST and the ratio of AST/ALT. However, the combination could remedy this adverse effect. In conclusion, the results described in the present study identifies Ilexgenin A as a promising therapeutic candidate that modulates inflammation, angiogenesis, and HCC growth. - Highlights: • Ilexgenin A exerts anti-inflammatory and anti-angiogenesis effects in hepatoma. • Ilexgenin A may exert these effects through inhibition of STAT3 and PI3K pathways. • Ilexgenin A exhibits synergistic effects with Sorafenib on hepatoma growth
Fungal prion HET-s as a model for structural complexity and self-propagation in prions.
Wan, William; Stubbs, Gerald
2014-04-08
The highly ordered and reproducible structure of the fungal prion HET-s makes it an excellent model system for studying the inherent properties of prions, self-propagating infectious proteins that have been implicated in a number of fatal diseases. In particular, the HET-s prion-forming domain readily folds into a relatively complex two-rung β-solenoid amyloid. The faithful self-propagation of this fold involves a diverse array of inter- and intramolecular structural features. These features include a long flexible loop connecting the two rungs, buried polar residues, salt bridges, and asparagine ladders. We have used site-directed mutagenesis and X-ray fiber diffraction to probe the relative importance of these features for the formation of β-solenoid structure, as well as the cumulative effects of multiple mutations. Using fibrillization kinetics and chemical stability assays, we have determined the biophysical effects of our mutations on the assembly and stability of the prion-forming domain. We have found that a diversity of structural features provides a level of redundancy that allows robust folding and stability even in the face of significant sequence alterations and suboptimal environmental conditions. Our findings provide fundamental insights into the structural interactions necessary for self-propagation. Propagation of prion structure seems to require an obligatory level of complexity that may not be reproducible in short peptide models.
A naturally occurring variant of the human prion protein completely prevents prion disease.
Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John
2015-06-25
Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.
Advancing prion science: guidance for the National Prion Research Program
National Research Council Canada - National Science Library
Erdtmann, Rick; Sivitz, Laura
2004-01-01
...€™s National Prion Research Program (NPRP). Transmissible spongiform encephalopathies (TSEs), also called prion diseases, are invariably fatal neurodegenerative infectious diseases that include bovine spongiform encephalopathy...
Inactivation of prion infectivity by ionizing rays
Energy Technology Data Exchange (ETDEWEB)
Gominet, M. [Ionisos, ZI les Chatinieres, F01120 Dagneux (France); Vadrot, C.; Austruy, G. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France); Darbord, J.C. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France)], E-mail: darbord@pharmacie.univ-paris5.fr
2007-11-15
Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination.
Inactivation of prion infectivity by ionizing rays
International Nuclear Information System (INIS)
Gominet, M.; Vadrot, C.; Austruy, G.; Darbord, J.C.
2007-01-01
Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination
Protease-resistant prions selectively decrease Shadoo protein.
Directory of Open Access Journals (Sweden)
Joel C Watts
2011-11-01
Full Text Available The central event in prion diseases is the conformational conversion of the cellular prion protein (PrP(C into PrP(Sc, a partially protease-resistant and infectious conformer. However, the mechanism by which PrP(Sc causes neuronal dysfunction remains poorly understood. Levels of Shadoo (Sho, a protein that resembles the flexibly disordered N-terminal domain of PrP(C, were found to be reduced in the brains of mice infected with the RML strain of prions [1], implying that Sho levels may reflect the presence of PrP(Sc in the brain. To test this hypothesis, we examined levels of Sho during prion infection using a variety of experimental systems. Sho protein levels were decreased in the brains of mice, hamsters, voles, and sheep infected with different natural and experimental prion strains. Furthermore, Sho levels were decreased in the brains of prion-infected, transgenic mice overexpressing Sho and in infected neuroblastoma cells. Time-course experiments revealed that Sho levels were inversely proportional to levels of protease-resistant PrP(Sc. Membrane anchoring and the N-terminal domain of PrP both influenced the inverse relationship between Sho and PrP(Sc. Although increased Sho levels had no discernible effect on prion replication in mice, we conclude that Sho is the first non-PrP marker specific for prion disease. Additional studies using this paradigm may provide insight into the cellular pathways and systems subverted by PrP(Sc during prion disease.
Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2013-01-01
Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.
Directory of Open Access Journals (Sweden)
Emmanuel A Asante
Full Text Available Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP gene (PRNP and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc, pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((CtmPrP. Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc was demonstrated in the brains of recipient transgenic mice. This PrP(Sc rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (CtmPrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.
Structure-based view on [PSI(+)] prion properties.
Bondarev, Stanislav A; Zhouravleva, Galina A; Belousov, Mikhail V; Kajava, Andrey V
2015-01-01
Yeast [PSI(+)] prion is one of the most suitable and well characterized system for the investigation of the prion phenomenon. However, until recently, the lack of data on the 3D arrangement of Sup35p prion fibrils hindered progress in this area. The recent arrival in this field of new experimental techniques led to the parallel and in-register superpleated β-structure as a consensus model for Sup35p fibrils. Here, we analyzed the effect of amino acid substitutions of the Sup35 protein through the prism of this structural model. Application of a newly developed computational approach, called ArchCandy, gives us a better understanding of the effect caused by mutations on the fibril forming potential of Sup35 protein. This bioinformatics tool can be used for the design of new mutations with desired modification of prion properties. Thus, we provide examples of how today, having progress toward elucidation of the structural arrangement of Sup35p fibrils, researchers can advance more efficiently to a better understanding of prion [PSI(+)] stability and propagation.
Amyloid cores in prion domains: Key regulators for prion conformational conversion.
Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador
2017-01-02
Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.
Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John
2013-11-01
Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.
Watts, Joel C; Giles, Kurt; Saltzberg, Daniel J; Dugger, Brittany N; Patel, Smita; Oehler, Abby; Bhardwaj, Sumita; Sali, Andrej; Prusiner, Stanley B
2016-11-01
The biochemical and neuropathological properties of bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) prions are faithfully maintained upon transmission to guinea pigs. However, primary and secondary transmissions of BSE and vCJD in guinea pigs result in long incubation periods of ∼450 and ∼350 days, respectively. To determine if the incubation periods of BSE and vCJD prions could be shortened, we generated transgenic (Tg) mice expressing guinea pig prion protein (GPPrP). Inoculation of Tg(GPPrP) mice with BSE and vCJD prions resulted in mean incubation periods of 210 and 199 days, respectively, which shortened to 137 and 122 days upon serial transmission. In contrast, three different isolates of sporadic CJD prions failed to transmit disease to Tg(GPPrP) mice. Many of the strain-specified biochemical and neuropathological properties of BSE and vCJD prions, including the presence of type 2 protease-resistant PrP Sc , were preserved upon propagation in Tg(GPPrP) mice. Structural modeling revealed that two residues near the N-terminal region of α-helix 1 in GPPrP might mediate its susceptibility to BSE and vCJD prions. Our results demonstrate that expression of GPPrP in Tg mice supports the rapid propagation of BSE and vCJD prions and suggest that Tg(GPPrP) mice may serve as a useful paradigm for bioassaying these prion isolates. Variant Creutzfeldt-Jakob disease (vCJD) and bovine spongiform encephalopathy (BSE) prions are two of the prion strains most relevant to human health. However, propagating these strains in mice expressing human or bovine prion protein has been difficult because of prolonged incubation periods or inefficient transmission. Here, we show that transgenic mice expressing guinea pig prion protein are fully susceptible to vCJD and BSE prions but not to sporadic CJD prions. Our results suggest that the guinea pig prion protein is a better, more rapid substrate than either bovine or human prion protein for
Physical, chemical and kinetic factors affecting prion infectivity.
Properzi, Francesca; Badhan, Anjna; Klier, Steffi; Schmidt, Christian; Klöhn, Peter C; Wadsworth, Jonathan D F; Clarke, Anthony R; Jackson, Graham S; Collinge, John
2016-05-03
The mouse-adapted scrapie prion strain RML is one of the most widely used in prion research. The introduction of a cell culture-based assay of RML prions, the scrapie cell assay (SCA) allows more rapid and precise prion titration. A semi-automated version of this assay (ASCA) was applied to explore a range of conditions that might influence the infectivity and properties of RML prions. These include resistance to freeze-thaw procedures; stability to endogenous proteases in brain homogenate despite prolonged exposure to varying temperatures; distribution of infective material between pellet and supernatant after centrifugation, the effect of reducing agents and the influence of detergent additives on the efficiency of infection. Apparent infectivity is increased significantly by interaction with cationic detergents. Importantly, we have also elucidated the relationship between the duration of exposure of cells to RML prions and the transmission of infection. We established that the infection process following contact of cells with RML prions is rapid and followed an exponential time course, implying a single rate-limiting process.
Cleaning, disinfection and sterilization of surface prion contamination.
McDonnell, G; Dehen, C; Perrin, A; Thomas, V; Igel-Egalon, A; Burke, P A; Deslys, J P; Comoy, E
2013-12-01
Prion contamination is a risk during device reprocessing, being difficult to remove and inactivate. Little is known of the combined effects of cleaning, disinfection and sterilization during a typical reprocessing cycle in clinical practice. To investigate the combination of cleaning, disinfection and/or sterilization on reducing the risk of surface prion contamination. In vivo test methods were used to study the impact of cleaning alone and cleaning combined with thermal disinfection and high- or low-temperature sterilization processes. A standardized test method, based on contamination of stainless steel wires with high titres of scrapie-infected brain homogenates, was used to determine infectivity reduction. Traditional chemical methods of surface decontamination against prions were confirmed to be effective, but extended steam sterilization was more variable. Steam sterilization alone reduced the risk of prion contamination under normal or extended exposure conditions, but did show significant variation. Thermal disinfection had no impact in these studies. Cleaning with certain defined formulations in combination with steam sterilization can be an effective prion decontamination process, in particular with alkaline formulations. Low-temperature, gaseous hydrogen peroxide sterilization was also confirmed to reduce infectivity in the presence and absence of cleaning. Prion decontamination is affected by the full reprocessing cycle used on contaminated surfaces. The correct use of defined cleaning, disinfection and sterilization methods as tested in this report in the scrapie infectivity assay can provide a standard precaution against prion contamination. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
A closer look at prion strains
Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto
2013-01-01
Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrPSc), a pathogenic isoform of the host-encoded cellular prion protein (PrPC). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrPSc conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrPSc biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves. PMID:23357828
A Neuronal Culture System to Detect Prion Synaptotoxicity.
Directory of Open Access Journals (Sweden)
Cheng Fang
2016-05-01
Full Text Available Synaptic pathology is an early feature of prion as well as other neurodegenerative diseases. Although the self-templating process by which prions propagate is well established, the mechanisms by which prions cause synaptotoxicity are poorly understood, due largely to the absence of experimentally tractable cell culture models. Here, we report that exposure of cultured hippocampal neurons to PrPSc, the infectious isoform of the prion protein, results in rapid retraction of dendritic spines. This effect is entirely dependent on expression of the cellular prion protein, PrPC, by target neurons, and on the presence of a nine-amino acid, polybasic region at the N-terminus of the PrPC molecule. Both protease-resistant and protease-sensitive forms of PrPSc cause dendritic loss. This system provides new insights into the mechanisms responsible for prion neurotoxicity, and it provides a platform for characterizing different pathogenic forms of PrPSc and testing potential therapeutic agents.
Cell type-specific neuroprotective activity of untranslocated prion protein.
Directory of Open Access Journals (Sweden)
Elena Restelli
2010-10-01
Full Text Available A key pathogenic role in prion diseases was proposed for a cytosolic form of the prion protein (PrP. However, it is not clear how cytosolic PrP localization influences neuronal viability, with either cytotoxic or anti-apoptotic effects reported in different studies. The cellular mechanism by which PrP is delivered to the cytosol of neurons is also debated, and either retrograde transport from the endoplasmic reticulum or inefficient translocation during biosynthesis has been proposed. We investigated cytosolic PrP biogenesis and effect on cell viability in primary neuronal cultures from different mouse brain regions.Mild proteasome inhibition induced accumulation of an untranslocated form of cytosolic PrP in cortical and hippocampal cells, but not in cerebellar granules. A cyclopeptolide that interferes with the correct insertion of the PrP signal sequence into the translocon increased the amount of untranslocated PrP in cortical and hippocampal cells, and induced its synthesis in cerebellar neurons. Untranslocated PrP boosted the resistance of cortical and hippocampal neurons to apoptotic insults but had no effect on cerebellar cells.These results indicate cell type-dependent differences in the efficiency of PrP translocation, and argue that cytosolic PrP targeting might serve a physiological neuroprotective function.
Synergistic anti-glioma effect of a coloaded nano-drug delivery system
Directory of Open Access Journals (Sweden)
Xu H
2016-12-01
Full Text Available Huae Xu,1,* Feng Jia,2,* Pankaj Kumar Singh,3 Shu Ruan,4 Hao Zhang,5,* Xiaolin Li5 1Department of Pharmacy, The First Affiliated Hospital with Nanjing Medical University, Nanjing, 2Department of Neurosurgery, Yancheng City No 1 People’s Hospital, The Fourth Affiliated Hospital of Nantong Medical College, Yancheng, People’s Republic of China; 3Department of Experimental Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA; 4Department of Endocrinology, Yancheng Third Hospital, The Affiliated Hospital of Southeast University Medical College, Yancheng, 5Department of Geriatrics, The First Affiliated Hospital with Nanjing Medical University, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The anti-glioma effect of temozolomide (Tem is sometimes undermined by the emerging resistance. Recently, resveratrol (Res, herbal medicine extracted from grape seeds, has been demonstrated for its potential use in chemosensitization. In the current study, both these drugs were loaded simultaneously into nanoparticles with methoxy poly(ethylene glycol-poly epsilon caprolactone (mPEG-PCL as drug carriers in order to achieve better antitumor efficiency. Tem/Res-coloaded mPEG-PCL nanoparticles were constructed, characterized, and tested for antitumor effect on glioma cells by using in vitro and xenograft model system. The nanoparticle constructs were satisfactory with drug loading content (Res =~12.4%; Tem =~9.3% and encapsulation capacity of >85% for both the drugs. In addition, the coencapsulation led to better in vitro stability of the nanoparticles than Tem-loaded nanoparticles. An in vitro uptake study demonstrated a high uptake efficiency of the nanoparticles by glioma cells. The synergistic antitumor effect against glioma cells was observed in the combinational treatment of Res and Tem. Tem/Res-coloaded nanoparticles induced higher apoptosis in U87 glioma cells as
Fatal Prion Disease in a Mouse Model of Genetic E200K Creutzfeldt-Jakob Disease
Friedman-Levi, Yael; Meiner, Zeev; Canello, Tamar; Frid, Kati; Kovacs, Gabor G.; Budka, Herbert; Avrahami, Dana; Gabizon, Ruth
2011-01-01
Genetic prion diseases are late onset fatal neurodegenerative disorders linked to pathogenic mutations in the prion protein-encoding gene, PRNP. The most prevalent of these is the substitution of Glutamate for Lysine at codon 200 (E200K), causing genetic Creutzfeldt-Jakob disease (gCJD) in several clusters, including Jews of Libyan origin. Investigating the pathogenesis of genetic CJD, as well as developing prophylactic treatments for young asymptomatic carriers of this and other PrP mutations, may well depend upon the availability of appropriate animal models in which long term treatments can be evaluated for efficacy and toxicity. Here we present the first effective mouse model for E200KCJD, which expresses chimeric mouse/human (TgMHu2M) E199KPrP on both a null and a wt PrP background, as is the case for heterozygous patients and carriers. Mice from both lines suffered from distinct neurological symptoms as early as 5–6 month of age and deteriorated to death several months thereafter. Histopathological examination of the brain and spinal cord revealed early gliosis and age-related intraneuronal deposition of disease-associated PrP similarly to human E200K gCJD. Concomitantly we detected aggregated, proteinase K resistant, truncated and oxidized PrP forms on immunoblots. Inoculation of brain extracts from TgMHu2ME199K mice readily induced, the first time for any mutant prion transgenic model, a distinct fatal prion disease in wt mice. We believe that these mice may serve as an ideal platform for the investigation of the pathogenesis of genetic prion disease and thus for the monitoring of anti-prion treatments. PMID:22072968
Fatal prion disease in a mouse model of genetic E200K Creutzfeldt-Jakob disease.
Directory of Open Access Journals (Sweden)
Yael Friedman-Levi
2011-11-01
Full Text Available Genetic prion diseases are late onset fatal neurodegenerative disorders linked to pathogenic mutations in the prion protein-encoding gene, PRNP. The most prevalent of these is the substitution of Glutamate for Lysine at codon 200 (E200K, causing genetic Creutzfeldt-Jakob disease (gCJD in several clusters, including Jews of Libyan origin. Investigating the pathogenesis of genetic CJD, as well as developing prophylactic treatments for young asymptomatic carriers of this and other PrP mutations, may well depend upon the availability of appropriate animal models in which long term treatments can be evaluated for efficacy and toxicity. Here we present the first effective mouse model for E200KCJD, which expresses chimeric mouse/human (TgMHu2M E199KPrP on both a null and a wt PrP background, as is the case for heterozygous patients and carriers. Mice from both lines suffered from distinct neurological symptoms as early as 5-6 month of age and deteriorated to death several months thereafter. Histopathological examination of the brain and spinal cord revealed early gliosis and age-related intraneuronal deposition of disease-associated PrP similarly to human E200K gCJD. Concomitantly we detected aggregated, proteinase K resistant, truncated and oxidized PrP forms on immunoblots. Inoculation of brain extracts from TgMHu2ME199K mice readily induced, the first time for any mutant prion transgenic model, a distinct fatal prion disease in wt mice. We believe that these mice may serve as an ideal platform for the investigation of the pathogenesis of genetic prion disease and thus for the monitoring of anti-prion treatments.
Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos
2011-01-01
Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE–like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion. PMID:21888788
Directory of Open Access Journals (Sweden)
W. Bodemer
2016-09-01
BSE is always unknown. Telemetry revealed a shift in sleep–wake cycles early on, long before behavioral changes or clinical symptoms appeared. Pathology confirmed non-neuronal tissue as hidden places where prions exist. The rhesus model also allowed first comparative studies of epigenetic modifications on RNA in peripheral blood and brain tissue collected from uninfected and prion-infected animals. To conclude, our studies clearly demonstrated that this model is valid since progression to disease is almost identical to human CJD.
The many shades of prion strain adaptation.
Baskakov, Ilia V
2014-01-01
In several recent studies transmissible prion disease was induced in animals by inoculation with recombinant prion protein amyloid fibrils produced in vitro. Serial transmission of amyloid fibrils gave rise to a new class of prion strains of synthetic origin. Gradual transformation of disease phenotypes and PrP(Sc) properties was observed during serial transmission of synthetic prions, a process that resembled the phenomenon of prion strain adaptation. The current article discusses the remarkable parallels between phenomena of prion strain adaptation that accompanies cross-species transmission and the evolution of synthetic prions occurring within the same host. Two alternative mechanisms underlying prion strain adaptation and synthetic strain evolution are discussed. The current article highlights the complexity of the prion transmission barrier and strain adaptation and proposes that the phenomenon of prion adaptation is more common than previously thought.
Epigenetic dominance of prion conformers.
Directory of Open Access Journals (Sweden)
Eri Saijo
2013-10-01
Full Text Available Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A at (OvPrP-A136 infected with SSBP/1 scrapie prions propagated a relatively stable (S prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V at 136 (OvPrP-V136 infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U, diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to
International Nuclear Information System (INIS)
Zhou, Xuezhang; Zhang, Yuyan; Li, Yong; Hao, Xiujing; Liu, Xiaoming; Wang, Yujiong
2012-01-01
In this study, the anti-proliferative and anticancer activity of azithromycin (AZM) was examined. In the presence of AZM, cell growth was inhibited more effectively in Hela and SGC-7901 cancer cells, relative to transformed BHK-21 cells. The respective 50% inhibition of cell growth (IC 50 ) values for Hela, SGC-7901 and BHK-21 were 15.66, 26.05 and 91.00 µg/mL at 72 h post incubation, indicative of a selective cytotoxicity against cancer cells. Cell apoptosis analysis using Hoechst nuclear staining and annexin V-FITC binding assay further demonstrated that AZM was capable of inducing apoptosis in both cancer cells and transformed cells. The apoptosis induced by AZM was partly through a caspase-dependent mechanism with an up-regulation of apoptotic protein cleavage PARP and caspase-3 products, as well as a down-regulation of anti-apoptotic proteins, Mcl-1, bcl-2 and bcl-X1. More importantly, a combination of AZM and a low dose of the common anti-cancer chemotherapeutic agent vincristine (VCR), produced a selectively synergistic effect on apoptosis of Hela and SGC-7901 cells, but not BHK-21 cells. In the presence of 12.50 μg/mL of VCR, the respective IC 50 values of Hela, SGC-7901 and BHK-21 cells to AZM were reduced to 9.47 µg/mL, 8.43 µg/mL and 40.15 µg/mL at 72 h after the incubation, suggesting that the cytotoxicity of AZM had a selective anti-cancer effect on cancer over transformed cells in vitro. These results imply that AZM may be a potential anticancer agent for use in chemotherapy regimens, and it may minimize side effects via reduction of dosage and enhancing the effectiveness common chemotherapeutic drugs
Destabilization and recovery of a yeast prion after mild heat shock.
Newnam, Gary P; Birchmore, Jennifer L; Chernoff, Yury O
2011-05-06
Yeast prion [PSI(+)] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI(+)] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI(+)]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI(+)] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock led to [PSI(+)] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. The dynamics of prion aggregation during destabilization and recovery are consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e.g., Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI(+)] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division and confirm that the effects of Hsps on prions are physiologically relevant. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ultraviolet-ozone treatment reduces levels of disease-associated prion protein and prion infectivity
Johnson, C.J.; Gilbert, P.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.
2009-01-01
Background. Transmissible spongiform encephalopathies (TSEs) are a group of fatal neurodegenerative diseases caused by novel infectious agents referred to as prions. Prions appear to be composed primarily, if not exclusively, of a misfolded isoform of the cellular prion protein. TSE infectivity is remarkably stable and can resist many aggressive decontamination procedures, increasing human, livestock and wildlife exposure to TSEs. Findings. We tested the hypothesis that UV-ozone treatment reduces levels of the pathogenic prion protein and inactivates the infectious agent. We found that UV-ozone treatment decreased the carbon and prion protein content in infected brain homogenate to levels undetectable by dry-ashing carbon analysis or immunoblotting, respectively. After 8 weeks of ashing, UV-ozone treatment reduced the infectious titer of treated material by a factor of at least 105. A small amount of infectivity, however, persisted despite UV-ozone treatment. When bound to either montmorillonite clay or quartz surfaces, PrPTSE was still susceptible to degradation by UV-ozone. Conclusion. Our findings strongly suggest that UV-ozone treatment can degrade pathogenic prion protein and inactivate prions, even when the agent is associated with surfaces. Using larger UV-ozone doses or combining UV-ozone treatment with other decontaminant methods may allow the sterilization of TSE-contaminated materials. ?? 2009 Aiken et al; licensee BioMed Central Ltd.
Nyström, Sofie; Hammarström, Per
2015-05-11
Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.
Prion replication without host adaptation during interspecies transmissions.
Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C
2017-01-31
Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.
Generating Bona Fide Mammalian Prions with Internal Deletions.
Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel
2016-08-01
disorders. Other aggregation-prone proteins appear to have a prion-like mode of expansion in brains, such as in Alzheimer's or Parkinson's diseases. To date, the resolution of prion structure remains elusive. Thus, to genetically define the landscape of regions critical for prion conversion, we tested the effect of short deletions. We found that, surprisingly, removal of a portion of PrP, the C terminus of alpha-helix H2, did not hamper prion formation but generated infectious agents with an internal deletion that showed characteristics essentially similar to those of original infecting strains. Thus, we demonstrate that completeness of the residues inside prions is not necessary for maintaining infectivity and the main strain-specific information, while reporting one of the few if not the only bona fide prions with an internal deletion. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Shami, Paul J; Maciag, Anna E; Eddington, Jordan K; Udupi, Vidya; Kosak, Ken M; Saavedra, Joseph E; Keefer, Larry K
2009-11-01
We have designed prodrugs that release nitric oxide (NO) on metabolism by glutathione S-transferases (GST). This design exploits the upregulation of GST in acute myeloid leukemia (AML) cells. O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate (JS-K, a member of this class) has potent anti-leukemic activity. HL-60 myeloid leukemia cells were used for in vitro studies of the combination of JS-K with daunorubicin (DAUNO), cytarabine (ARA-C) or etoposide (ETOP) using the median effect method to determine synergistic, antagonistic, or additive effects. Combinations of JS-K added simultaneously, 2h before or 2h after the other compounds were used. JS-K and DAUNO were antagonistic in all three drug sequences. JS-K and ETOP were also antagonistic but to a lesser degree. JS-K and ARA-C showed strong synergy. The combination index at the 50% fraction affected was 0.37+/-0.23, 0.24+/-0.27, and 0.15+/-0.11 for simultaneous, JS-K first and ARA-C first additions, respectively. JS-K by itself induced DNA strand breaks at relatively high concentrations. However, at submicromolar concentrations, it significantly augmented ARA-C-induced DNA strand breaks. NMR spectroscopy revealed no evidence of chemical interaction between JS-K and the other chemotherapeutic agents. We conclude that ARA-C and JS-K have synergistic anti-leukemic activity and warrant further exploration in combination.
High prevalence of a fungal prion
Debets, A.J.M.; Dalstra, H.J.P.; Slakhorst, S.M.; Koopmanschap-Memelink, A.B.; Hoekstra, R.F.; Saupe, S.J.
2012-01-01
Prions are infectious proteins that cause fatal diseases in mammals. Prions have also been found in fungi, but studies on their role in nature are scarce. The proposed biological function of fungal prions is debated and varies from detrimental to benign or even beneficial. [Het-s] is a prion of the
Directory of Open Access Journals (Sweden)
Nicola Franscini
Full Text Available BACKGROUND: Prions are known to cause transmissible spongiform encephalopathies (TSE after accumulation in the central nervous system. There is increasing evidence that prions are also present in body fluids and that prion infection by blood transmission is possible. The low concentration of the proteinaceous agent in body fluids and its long incubation time complicate epidemiologic analysis and estimation of spreading and thus the risk of human infection. This situation is particularly unsatisfactory for food and pharmaceutical industries, given the lack of sensitive tools for monitoring the infectious agent. METHODOLOGY/PRINCIPAL FINDINGS: We have developed an adsorption matrix, Alicon PrioTrap, which binds with high affinity and specificity to prion proteins. Thus we were able to identify prion protein (PrP(C--the precursor of prions (PrP(Sc--in milk from humans, cows, sheep, and goats. The absolute amount of PrP(C differs between the species (from microg/l range in sheep to ng/l range in human milk. PrP(C is also found in homogenised and pasteurised off-the-shelf milk, and even ultrahigh temperature treatment only partially diminishes endogenous PrP(C concentration. CONCLUSIONS/SIGNIFICANCE: In view of a recent study showing evidence of prion replication occurring in the mammary gland of scrapie infected sheep suffering from mastitis, the appearance of PrP(C in milk implies the possibility that milk of TSE-infected animals serves as source for PrP(Sc.
Directory of Open Access Journals (Sweden)
Gordon Hayward
2016-12-01
Full Text Available An acoustic prion assay has been demonstrated for sheep brain samples. Only five false positives and no false negatives were observed in a test of 45 positive and 45 negative samples. The acoustic prion sensor was constructed using a thickness shear mode quartz resonator coated with a covalently bound recombinant prion protein. The characteristic indicator of a scrapie infected sheep brain sample was an observed shoulder in the frequency decrease in response to a sample.The response of the sensor aligns with a conformational shift in the surface protein and with the propagation mechanism of the disease. This alignment is evident in the response timing and shape, dependence on concentration, cross species behaviour and impact of blood plasma. This alignment is far from sufficient to prove the mechanism of the sensor but it does offer the possibility of a rapid and inexpensive additional tool to explore prion disease. Keywords: Prions, Thickness shear mode quartz sensor
Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure
Energy Technology Data Exchange (ETDEWEB)
Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald
2015-09-01
Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.
Mabbott, Neil A
2012-01-01
Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrP (Sc), an abnormally folded isoform of the cellular prion protein (PrP (C)), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases.
Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.
Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald
2015-01-01
Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.
Controlling the prion propensity of glutamine/asparagine-rich proteins.
Paul, Kacy R; Ross, Eric D
2015-01-01
The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve.
Bistaffa, Edoardo; Rossi, Martina; De Luca, Chiara M G; Moda, Fabio
2017-01-01
Prions are the infectious agents that cause devastating and untreatable disorders known as Transmissible Spongiform Encephalopathies (TSEs). The pathologic events and the infectious nature of these transmissible agents are not completely understood yet. Due to the difficulties in inactivating prions, working with them requires specific recommendations and precautions. Moreover, with the advent of innovative technologies, such as the Protein Misfolding Cyclic Amplification (PMCA) and the Real Time Quaking-Induced Conversion (RT-QuIC), prions could be amplified in vitro and the infectious features of the amplified products need to be carefully assessed. © 2017 Elsevier Inc. All rights reserved.
Tavares, Evandro; Macedo, Joana A; Paulo, Pedro M R; Tavares, Catarina; Lopes, Carlos; Melo, Eduardo P
2014-07-01
Prion diseases are associated to the conversion of the prion protein into a misfolded pathological isoform. The mechanism of propagation of protein misfolding by protein templating remains largely unknown. Neuroblastoma cells were transfected with constructs of the prion protein fused to both CFP-GPI-anchored and to YFP-GPI-anchored and directed to its cell membrane location. Live-cell FRET imaging between the prion protein fused to CFP or YFP was measured giving consistent values of 10±2%. This result was confirmed by fluorescence lifetime imaging microscopy and indicates intermolecular interactions between neighbor prion proteins. In particular, considering that a maximum FRET efficiency of 17±2% was determined from a positive control consisting of a fusion CFP-YFP-GPI-anchored. A stable cell clone expressing the two fusions containing the prion protein was also selected to minimize cell-to-cell variability. In both, stable and transiently transfected cells, the FRET efficiency consistently increased in the presence of infectious prions - from 4±1% to 7±1% in the stable clone and from 10±2% to 16±1% in transiently transfected cells. These results clearly reflect an increased clustering of the prion protein on the membrane in the presence of infectious prions, which was not observed in negative control using constructs without the prion protein and upon addition of non-infected brain. Our data corroborates the recent view that the primary site for prion conversion is the cell membrane. Since our fluorescent cell clone is not susceptible to propagate infectivity, we hypothesize that the initial event of prion infectivity might be the clustering of the GPI-anchored prion protein. Copyright © 2014 Elsevier B.V. All rights reserved.
Enzymatic Digestion of Chronic Wasting Disease Prions Bound to Soil
SAUNDERS, SAMUEL E.; BARTZ, JASON C.; VERCAUTEREN, KURT C.; BARTELT-HUNT, SHANNON L.
2010-01-01
Chronic wasting disease (CWD) and sheep scrapie can be transmitted via indirect environmental routes, and it is known that soil can serve as a reservoir of prion infectivity. Given the strong interaction between the prion protein (PrP) and soil, we hypothesized that binding to soil enhances prion resistance to enzymatic digestion, thereby facilitating prion longevity in the environment and providing protection from host degradation. We characterized the performance of a commercially available subtilisin enzyme, the Prionzyme, to degrade soil-bound and unbound CWD and HY TME PrP as a function of pH, temperature, and treatment time. The subtilisin enzyme effectively degraded PrP adsorbed to a wide range of soils and soil minerals below the limits of detection. Signal loss occurred rapidly at high pH (12.5) and within 7 d under conditions representative of the natural environment (pH 7.4, 22°C). We observed no apparent difference in enzyme effectiveness between bound and unbound CWD PrP. Our results show that although adsorbed prions do retain relative resistance to enzymatic digestion compared with other brain homogenate proteins, they can be effectively degraded when bound to soil. Our results also suggest a topical application of a subtilisin enzyme solution may be an effective decontamination method to limit disease transmission via environmental ‘hot spots’ of prion infectivity. PMID:20450190
The complexity and implications of yeast prion domains
2011-01-01
Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731
Accelerating Yeast Prion Biology using Droplet Microfluidics
Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David
2012-02-01
Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.
Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K
2014-07-01
Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have
Prions (PrPSc) are molecular pathogens that are able to convert the isosequential normal cellular prion protein (PrPC) into a prion. The only demonstrated differences between PrPC and PrPSc is conformational, they are isoforms. A given host can be infected by more than one kind or strain of prion. F...
Crowell, Jenna; Wiley, James A.; Bessen, Richard A.
2015-01-01
Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain. PMID:25822718
Directory of Open Access Journals (Sweden)
Jenna Crowell
Full Text Available Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain.
Role of Prion Replication in the Strain-dependent Brain Regional Distribution of Prions.
Hu, Ping Ping; Morales, Rodrigo; Duran-Aniotz, Claudia; Moreno-Gonzalez, Ines; Khan, Uffaf; Soto, Claudio
2016-06-10
One intriguing feature of prion diseases is their strain variation. Prion strains are differentiated by the clinical consequences they generate in the host, their biochemical properties, and their potential to infect other animal species. The selective targeting of these agents to specific brain structures have been extensively used to characterize prion strains. However, the molecular basis dictating strain-specific neurotropism are still elusive. In this study, isolated brain structures from animals infected with four hamster prion strains (HY, DY, 139H, and SSLOW) were analyzed for their content of protease-resistant PrP(Sc) Our data show that these strains have different profiles of PrP deposition along the brain. These patterns of accumulation, which were independent of regional PrP(C) production, were not reproduced by in vitro replication when different brain regions were used as substrate for the misfolding-amplification reaction. On the contrary, our results show that in vitro replication efficiency depended exclusively on the amount of PrP(C) present in each part of the brain. Our results suggest that the variable regional distribution of PrP(Sc) in distinct strains is not determined by differences on prion formation, but on other factors or cellular pathways. Our findings may contribute to understand the molecular mechanisms of prion pathogenesis and strain diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B
2012-02-28
Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.
Directory of Open Access Journals (Sweden)
Laura McCulloch
2011-12-01
Full Text Available Prion diseases are characterised by the accumulation of PrP(Sc, an abnormally folded isoform of the cellular prion protein (PrP(C, in affected tissues. Following peripheral exposure high levels of prion-specific PrP(Sc accumulate first upon follicular dendritic cells (FDC in lymphoid tissues before spreading to the CNS. Expression of PrP(C is mandatory for cells to sustain prion infection and FDC appear to express high levels. However, whether FDC actively replicate prions or simply acquire them from other infected cells is uncertain. In the attempts to-date to establish the role of FDC in prion pathogenesis it was not possible to dissociate the Prnp expression of FDC from that of the nervous system and all other non-haematopoietic lineages. This is important as FDC may simply acquire prions after synthesis by other infected cells. To establish the role of FDC in prion pathogenesis transgenic mice were created in which PrP(C expression was specifically "switched on" or "off" only on FDC. We show that PrP(C-expression only on FDC is sufficient to sustain prion replication in the spleen. Furthermore, prion replication is blocked in the spleen when PrP(C-expression is specifically ablated only on FDC. These data definitively demonstrate that FDC are the essential sites of prion replication in lymphoid tissues. The demonstration that Prnp-ablation only on FDC blocked splenic prion accumulation without apparent consequences for FDC status represents a novel opportunity to prevent neuroinvasion by modulation of PrP(C expression on FDC.
Direct Detection of Soil-Bound Prions
Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro
2007-01-01
Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252
Direct detection of soil-bound prions.
Directory of Open Access Journals (Sweden)
Sacha Genovesi
Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.
Correlation of cellular factors and differential scrapie prion permissiveness in ovine microglia
Prion diseases are fatal neurodegenerative disorders by which the native cellular prion protein (PrP-C) is misfolded into an accumulating, disease-associated isoform (PrP-D). To improve the understanding of prion pathogenesis and develop effective treatments, it is essential to elucidate factors con...
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Prions: the danger of biochemical weapons
Directory of Open Access Journals (Sweden)
Eric Almeida Xavier
2014-09-01
Full Text Available The knowledge of biotechnology increases the risk of using biochemical weapons for mass destruction. Prions are unprecedented infectious pathogens that cause a group of fatal neurodegenerative diseases by a novel mechanism. They are transmissible particles that are devoid of nucleic acid. Due to their singular characteristics, Prions emerge as potential danger since they can be used in the development of such weapons. Prions cause fatal infectious diseases, and to date there is no therapeutic or prophylactic approach against these diseases. Furthermore, Prions are resistant to food-preparation treatments such as high heat and can find their way from the digestive system into the nervous system; recombinant Prions are infectious either bound to soil particles or in aerosols. Therefore, lethal Prions can be developed by malicious researchers who could use it to attack political enemies since such weapons cause diseases that could be above suspicion.
Glycosaminoglycan sulphation affects the seeded misfolding of a mutant prion protein.
Directory of Open Access Journals (Sweden)
Victoria A Lawson
Full Text Available BACKGROUND: The accumulation of protease resistant conformers of the prion protein (PrP(res is a key pathological feature of prion diseases. Polyanions, including RNA and glycosaminoglycans have been identified as factors that contribute to the propagation, transmission and pathogenesis of prion disease. Recent studies have suggested that the contribution of these cofactors to prion propagation may be species specific. METHODOLOGY/PRINCIPAL FINDING: In this study a cell-free assay was used to investigate the molecular basis of polyanion stimulated PrP(res formation using brain tissue or cell line derived murine PrP. Enzymatic depletion of endogenous nucleic acids or heparan sulphate (HS from the PrP(C substrate was found to specifically prevent PrP(res formation seeded by mouse derived PrP(Sc. Modification of the negative charge afforded by the sulphation of glycosaminoglycans increased the ability of a familial PrP mutant to act as a substrate for PrP(res formation, while having no effect on PrP(res formed by wildtype PrP. This difference may be due to the observed differences in the binding of wild type and mutant PrP for glycosaminoglycans. CONCLUSIONS/SIGNIFICANCE: Cofactor requirements for PrP(res formation are host species and prion strain specific and affected by disease associated mutations of the prion protein. This may explain both species and strain dependent propagation characteristics and provide insights into the underlying mechanisms of familial prion disease. It further highlights the challenge of designing effective therapeutics against a disease which effects a range of mammalian species, caused by range of aetiologies and prion strains.
2011-11-17
... (FIFRA), and to amend its regulations to expressly include prion within the regulatory definition of pest... observed by the user including, but not limited to, microorganisms infectious to man in any area of the... prion within the regulatory definition of pest. EPA currently considers a prion to be a pest under FIFRA...
Glycoform-selective prion formation in sporadic and familial forms of prion disease
Xiao, X.; Yuan, J.; Haïk, S.; Cali, I.; Zhan, Y.; Moudjou, M.; Li, B.; Laplanche, J.L.; Laude, H.; Langeveld, J.P.M.; Gambetti, P.
2013-01-01
The four glycoforms of the cellular prion protein (PrP(C)) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrP(Sc)) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrP(Sc) in the recently identified
Prions cause protein misfolding diseases, such as transmissible spongiform encephalopathy. They propagate infections by converting a normal cellular prion protein into a prion (PrPSc). PrPC and PrPSc are isosequential and differ only in their respective conformations. PrPC is monomeric and sensit...
Efficient prion disease transmission through common environmental materials.
Pritzkow, Sandra; Morales, Rodrigo; Lyon, Adam; Concha-Marambio, Luis; Urayama, Akihiko; Soto, Claudio
2018-03-02
Prion diseases are a group of fatal neurodegenerative diseases associated with a protein-based infectious agent, termed prion. Compelling evidence suggests that natural transmission of prion diseases is mediated by environmental contamination with infectious prions. We hypothesized that several natural and man-made materials, commonly found in the environments of wild and captive animals, can bind prions and may act as vectors for disease transmission. To test our hypothesis, we exposed surfaces composed of various common environmental materials ( i.e. wood, rocks, plastic, glass, cement, stainless steel, aluminum, and brass) to hamster-adapted 263K scrapie prions and studied their attachment and retention of infectivity in vitro and in vivo Our results indicated that these surfaces, with the sole exception of brass, efficiently bind, retain, and release prions. Prion replication was studied in vitro using the protein misfolding cyclic amplification technology, and infectivity of surface-bound prions was analyzed by intracerebrally challenging hamsters with contaminated implants. Our results revealed that virtually all prion-contaminated materials transmitted the disease at high rates. To investigate a more natural form of exposure to environmental contamination, we simply housed animals with large contaminated spheres made of the different materials under study. Strikingly, most of the hamsters developed classical clinical signs of prion disease and typical disease-associated brain changes. Our findings suggest that prion contamination of surfaces commonly present in the environment can be a source of disease transmission, thus expanding our understanding of the mechanisms for prion spreading in nature. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Prions and neuro degenerative diseases | Nair | African Journal of ...
African Journals Online (AJOL)
Prion is a disease-causing agent that is neither bacterial nor fungal nor viral and contains no genetic material. A prion is a protein that occurs normally in a harmless form. By folding into an aberrant shape, the normal prion turns into a rogue agent. It then co-opts other normal prions to become rogue prions. Prions have ...
Grass Plants Bind, Retain, Uptake, and Transport Infectious Prions
Directory of Open Access Journals (Sweden)
Sandra Pritzkow
2015-05-01
Full Text Available Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrPSc to plants. Small quantities of PrPSc contained in diluted brain homogenate or in excretory materials (urine and feces can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrPSc for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves. These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease.
Synergistic effects of irradiation of waste water
International Nuclear Information System (INIS)
Woodbridge, D.D.; Cooper, P.C.; Vandenburg, A.J.; Musselman, H.D.; Lowe, H.N.; Florida Inst. of Tech., Melbourne; Army Facilities Engineering Support Agency, Fort Belvoir, Va.
1975-01-01
Theoretical considerations of the use of high level radiation in the treatment of waste water have failed to consider the effects of the hydrated electron and the potential of possible synergistic effects of combining chlorine, oxygen, and irradiation. An extensive testing program at the University Center for Pollution Research of Florida Institute of Technology over the past four years has shown that irradiation of waste water samples immersed in an aqueous environment provide bacterial kill and reduction in organic pollution far greater than that obtained from theoretical considerations of G values and earlier experiments where the waste samples were not immersed in an aqueous environment. These testing programs have investigated the synergistic effects of combining oxygen and irradiation. Each of these combined treatments resulted in an increased bacterial kill factor. Tests on Staphylococcus aureus bacteria and fecal streptococcus bacteria indicate that the synergistic effects observed for fecal coliform bacteria also apply to the pathogenic bacteria. A statistical analysis of the data obtained shows the interrelationships between the various effects on the bacteria. A definite shielding factor due to the turbidity of the waste water has been shown to exist. Synergistic effects have been shown to significantly offset the shielding effects. Optimization of these synergistic effects can greatly increase the effectiveness of irradiation in the treatment of waste water. (orig.) [de
Prion-based memory of heat stress in yeast.
Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D
2017-05-04
Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices. We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.
S. pombe placed on the prion map
Directory of Open Access Journals (Sweden)
Jacqueline Hayles
2017-02-01
Full Text Available Schizosaccharomyces pombe has been used extensively as a model organism, however it is only recently that the first prion in this organism, a copper transporter protein encoded by ctr4, has been conclusively demonstrated. Prions are found in a wide range of organisms and have been implicated in a number of human neurodegenerative diseases. Research into the biology of prions has been carried out mainly in the budding yeast Saccharomyces cerevisiae, however there are many questions still to be addressed. Now, with the identification of the Ctr4 prion in S. pombe, further work in the two yeasts and comparisons of prion biology in these organisms should lead to a greater understanding of prions and their role in disease.
Prions: Beyond a Single Protein
Das, Alvin S.
2016-01-01
SUMMARY Since the term protein was first coined in 1838 and protein was discovered to be the essential component of fibrin and albumin, all cellular proteins were presumed to play beneficial roles in plants and mammals. However, in 1967, Griffith proposed that proteins could be infectious pathogens and postulated their involvement in scrapie, a universally fatal transmissible spongiform encephalopathy in goats and sheep. Nevertheless, this novel hypothesis had not been evidenced until 1982, when Prusiner and coworkers purified infectious particles from scrapie-infected hamster brains and demonstrated that they consisted of a specific protein that he called a “prion.” Unprecedentedly, the infectious prion pathogen is actually derived from its endogenous cellular form in the central nervous system. Unlike other infectious agents, such as bacteria, viruses, and fungi, prions do not contain genetic materials such as DNA or RNA. The unique traits and genetic information of prions are believed to be encoded within the conformational structure and posttranslational modifications of the proteins. Remarkably, prion-like behavior has been recently observed in other cellular proteins—not only in pathogenic roles but also serving physiological functions. The significance of these fascinating developments in prion biology is far beyond the scope of a single cellular protein and its related disease. PMID:27226089
Ovine recombinant PrP as an inhibitor of ruminant prion propagation in vitro.
Workman, Rob G; Maddison, Ben C; Gough, Kevin C
2017-07-04
Prion diseases are fatal and incurable neurodegenerative diseases of humans and animals. Despite years of research, no therapeutic agents have been developed that can effectively manage or reverse disease progression. Recently it has been identified that recombinant prion proteins (rPrP) expressed in bacteria can act as inhibitors of prion replication within the in vitro prion replication system protein misfolding cyclic amplification (PMCA). Here, within PMCA reactions amplifying a range of ruminant prions including distinct Prnp genotypes/host species and distinct prion strains, recombinant ovine VRQ PrP displayed consistent inhibition of prion replication and produced IC50 values of 122 and 171 nM for ovine scrapie and bovine BSE replication, respectively. These findings illustrate the therapeutic potential of rPrPs with distinct TSE diseases.
Prion pathogenesis and secondary lymphoid organs (SLO)
Mabbott, Neil A.
2012-01-01
Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrPSc, an abnormally folded isoform of the cellular prion protein (PrPC), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases. PMID:22895090
Garcia, Carolina P; Lamarque, Alicia L; Comba, Andrea; Berra, María A; Silva, Renata A; Labuckas, Diana O; Das, Undurti N; Eynard, Aldo R; Pasqualini, Maria E
2015-04-01
The aim of this study was to determine the effects of some polyunsaturated fatty acids plus phytomelatonin from walnuts in the development of mammary gland adenocarcinoma. BALB/c mice were fed a semisynthetic diet supplemented with either 6% walnut oil and 8% walnut flour containing phytomelatonin (walnut diet: WD); or 6% corn oil plus commercial melatonin (melatonin diet: MD), or the control group (CD), which received only 6% of corn oil. Membrane fatty acids of tumor cells (TCs) were analyzed by gas liquid chromatography, cyclooxygenase (COX) and lipoxygenase (LOX) derivatives, and plasma melatonin by high-performance liquid chromatography; apoptosis and tumor-infiltrating lymphocytes by flow cytometry. TCs from the MD and WD mice showed significant decreases in linoleic acid compared with the CD group (P < 0.05). Significantly lower levels of LOX-[13(S)-HODE] were found in TCs from the MD and WD group than in CD (P < 0.0001). COX-[12(S)-HHT] was lower and 12 LOX-[12(S)-HETE] was higher in TCs from the MD group than form the WD and CD arms (P < 0.05). Plasma melatonin, apoptosis, tumor infiltration, and survival time were significantly lower in CD mice than in MD and WD mice (P < 0.05). This study shows that melatonin, along with polyunsaturated fatty acids, exerts a selective inhibition of some COX and LOX activities and has a synergistic anti-tumor effect on a mammary gland adenocarcinoma model. Published by Elsevier Inc.
A simple, versatile and sensitive cell-based assay for prions from various species.
Directory of Open Access Journals (Sweden)
Zaira E Arellano-Anaya
Full Text Available Detection and quantification of prion infectivity is a crucial step for various fundamental and applied aspects of prion research. Identification of cell lines highly sensitive to prion infection led to the development of cell-based titration procedures aiming at replacing animal bioassays, usually performed in mice or hamsters. However, most of these cell lines are only permissive to mouse-adapted prions strains and do not allow titration of prions from other species. In this study, we show that epithelial RK13, a cell line permissive to mouse and bank vole prion strains and to natural prion agents from sheep and cervids, enables a robust and sensitive detection of mouse and ovine-derived prions. Importantly, the cell culture work is strongly reduced as the RK13 cell assay procedure designed here does not require subcultivation of the inoculated cultures. We also show that prions effectively bind to culture plastic vessel and are quantitatively detected by the cell assay. The possibility to easily quantify a wider range of prions, including rodent experimental strains but also natural agents from sheep and cervids, should prompt the spread of cell assays for routine prion titration and lead to valuable information in fundamental and applied studies.
Masim, Frances Camille P; Tsai, Cheng-Hsien; Lin, Yi-Feng; Fu, Ming-Lai; Liu, Minghua; Kang, Fei; Wang, Ya-Fen
2017-11-03
The increasing number of bacteria-related problems and presence of trace amounts of phosphate in treated wastewater effluents have become a growing concern in environmental research. The use of antibacterial agents and phosphate adsorbents for the treatment of wastewater effluents is of great importance. In this study, the potential applications of a synthesized polyaniline (PANI)-zirconium dioxide (ZrO 2 ) composite as an antibacterial, phosphate adsorbent and anti-corrosion material were systematically investigated. The results of an antibacterial test reveal an effective area of inhibition of 14 and 18 mm for the Escherichia coli and Staphylococcus aureus bacterial strains, respectively. The antibacterial efficiency of the PANI-ZrO 2 composite is twice that of commercial ZrO 2 . In particular, the introduction of PANI increased the specific surface area and roughness of the composite material, which was beneficial to increase the contact area with bacterial and phosphate. The experimental results demonstrated that phosphate adsorption studies using 200 mg P/L phosphate solution showed a significant phosphate removal efficiency of 64.4%, and the maximum adsorption capacity of phosphate on the solid surface of PANI-ZrO 2 is 32.4 mg P/g. Furthermore, PANI-ZrO 2 coated on iron substrate was tested for anti-corrosion studies by a natural salt spray test (7.5% NaCl), which resulted in the formation of no rust. To the best of our knowledge, no works have been reported on the synergistic effects of the PANI-ZrO 2 composite as an antibacterial, anti-corrosion, and phosphate adsorbent material. PANI-ZrO 2 composite is expected to be a promising comprehensive treatment method for water filters in the aquaculture industry and for use in water purification applications.
Xia, Hongping; Lee, Kee Wah; Chen, Jianxiang; Kong, Shik Nie; Sekar, Karthik; Deivasigamani, Amudha; Seshachalam, Veerabrahma Pratap; Goh, Brian Kim Poh; Ooi, London Lucien; Hui, Kam M
2017-01-01
Sorafenib is currently the only US Food and Drug Administration (FDA)-approved molecular inhibitor for the systemic therapy of advanced hepatocellular carcinoma (HCC). Aspirin has been studied extensively as an anti-inflammation, cancer preventive and therapeutic agent. However, the potential synergistic therapeutic effects of sorafenib and aspirin on advanced HCC treatment have not been well studied. Drug combination studies and their synergy quantification were performed using the combination index method of Chou-Talalay. The synergistic therapeutic effects of sorafenib and aspirin were evaluated using an orthotopic mouse model of HCC and comprehensive gene profiling analyses were conducted to identify key factors mediating the synergistic therapeutic effects of sorafenib and aspirin. Sorafenib was determined to act synergistically on HCC cells with aspirin in vitro. Using Hep3B and HuH7 HCC cells, it was demonstrated that sorafenib and aspirin acted synergistically to induce apoptosis. Mechanistic studies demonstrated that combining sorafenib and aspirin yielded significant synergistically anti-tumor effects by simultaneously silencing ACSL4 and the induction of GADD45B expression in HCC cells both in vitro and in the orthotopic HCC xenograft mouse model. Importantly, clinical evidence has independently corroborated that survival of HCC patients expressing ACSL4highGADD45Blow was significantly poorer compared to patients with ACSL4lowGADD45Bhigh, thus demonstrating the potential clinical value of combining aspirin and sorafenib for HCC patients expressing ACSL4highGADD45Blow. In conclusion, sorafenib and aspirin provide synergistic therapeutic effects on HCC cells that are achieved through simultaneous silencing of ACSL4 and induction of GADD45B expression. Targeting HCC with ACSL4highGADD45Blow expression with aspirin and sorafenib could provide potential synergistic therapeutic benefits. PMID:28900541
Soutyrine, Andrei; Yogasingam, Nishandan; Huang, Hongsheng; Mitchell, Gordon
2015-08-01
Prion protein (PrP) binding to natural and synthetic porphyrins has been previously demonstrated but the effects of endogenous heme interactions with PrP remain uncertain. This study investigated implications of this interaction in blood-based peroxidase-linked prion immunodetection and seeded conversion of cellular prion (PrP(C)) into disease associated form (PrP(Sc)). Heme binding to recombinant PrP(C) enhanced intrinsic peroxidase activity (POD) by 2.5-fold and POD inherent to denatured blood accounted for over 84% of luminol-based substrate oxidation in a prion immunodetection assay. An immuno-capture assay showed that 75-98% of blood POD was attributable to binding of PrP(C) with endogenous heme. Additionally, 10 μM heme inhibited (PPrP(C) to PrP(Sc) through the protein misfolding cycling amplification assay. We conclude that the observed effects can interfere with cell-free conversion and peroxidase-linked immunodetection of prions in blood-based assays. These results indicate that heme-PrP interactions could modulate intrinsic POD and protect PrP(C) from conversion into PrP(Sc). Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Grass plants bind, retain, uptake, and transport infectious prions.
Pritzkow, Sandra; Morales, Rodrigo; Moda, Fabio; Khan, Uffaf; Telling, Glenn C; Hoover, Edward; Soto, Claudio
2015-05-26
Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrP(Sc)) to plants. Small quantities of PrP(Sc) contained in diluted brain homogenate or in excretory materials (urine and feces) can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrP(Sc) for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves). These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Cali, I.; Castellani, R.; Alshekhlee, A.; Cohen, Y.; Blevins, J.; Yuan, J.; Langeveld, J.P.M.; Parchi, P.; Safar, J.G.; Zou, W.Q.; Gambetti, P.
2009-01-01
Five phenotypically distinct subtypes have been identified in sporadic Creutzfeldt-Jakob disease (sCJD), based on the methionine/valine polymorphic genotype of codon 129 of the prion protein (PrP) gene and the presence of either one of the two protease K-resistant scrapie prion protein (PrPSc) types
Daus, Martin L
2016-01-04
In 1982, the term "prions" (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being "heretical" but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the "protein-only hypothesis" expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.
Homma, Takujiro; Ishibashi, Daisuke; Nakagaki, Takehiro; Satoh, Katsuya; Sano, Kazunori; Atarashi, Ryuichiro; Nishida, Noriyuki
2014-03-28
Prion diseases are neurodegenerative disorders characterized by the aggregation of abnormally folded prion protein (PrP(Sc)). In this study, we focused on the mechanism of clearance of PrP(Sc), which remains unclear. p62 is a cytosolic protein known to mediate both the formation and degradation of aggregates of abnormal proteins. The levels of p62 protein increased in prion-infected brains and persistently infected cell cultures. Upon proteasome inhibition, p62 co-localized with PrP(Sc), forming a large aggregate in the perinuclear region, hereafter referred to as PrP(Sc)-aggresome. These aggregates were surrounded with autophagosome marker LC3 and lysosomes in prion-infected cells. Moreover, transient expression of the phosphomimic form of p62, which has enhanced ubiquitin-binding activity, reduced the amount of PrP(Sc) in prion-infected cells, indicating that the activation of p62 could accelerate the clearance of PrP(Sc). Our findings would thus suggest that p62 could be a target for the therapeutic control of prion diseases.
Torres, Juan-María; Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos
2011-01-01
Bovine spongiform encephalopathy (BSE) and BSErelated disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profi les of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molec...
Synergistic neurotrophic effects of piracetam and thiotriazoline
Directory of Open Access Journals (Sweden)
O. A. Gromova
2016-01-01
Full Text Available The paper considers the synergy between the nootropic drug piracetam and the metabolic agent thiotriazoline that maintains energy metabolism and survival of neurons and other types of cells. Piracetam, a nootropic drug, a chemical pyrrolidone derivative, is used in neurological, psychiatric, and narcological practice. There is evidence on the positive effect of piracetam in elderly and senile patients with coronary heart disease. This drug is supposed to stimulate redox processes, to enhance glucose utilization, and to improve regional blood flow in the ischemic brain regions. Due to its action, the drug activates glycolytic processes and elevates ATP concentrations in brain tissue. Thiotriazoline is a compound that has antioxidant, anti-ischemic properties. The co-administration of piracetam and thiothriazoline is an innovation area in the treatment of stroke and other brain damages, especially in insulin resistance and high blood glucose levels. The paper considers the neurobiological properties of thiotriazoline and piracetam, which synergistically exert neuroprotective and neurotrophic effects.
Statistical Mechanics of Prion Diseases
International Nuclear Information System (INIS)
Slepoy, A.; Singh, R. R. P.; Pazmandi, F.; Kulkarni, R. V.; Cox, D. L.
2001-01-01
We present a two-dimensional, lattice based, protein-level statistical mechanical model for prion diseases (e.g., mad cow disease) with concomitant prion protein misfolding and aggregation. Our studies lead us to the hypothesis that the observed broad incubation time distribution in epidemiological data reflect fluctuation dominated growth seeded by a few nanometer scale aggregates, while much narrower incubation time distributions for innoculated lab animals arise from statistical self-averaging. We model ''species barriers'' to prion infection and assess a related treatment protocol
Transmissible Spongiform Encephalopathies (Prion Diseases)
... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ...
Overview of synergistic aging effects
International Nuclear Information System (INIS)
Steigelmann, W.; Farber, M.
1982-01-01
Proper, technically defensible qualification of materials and equipment for nuclear power facilities requires that the effects of combined environment exposures be addressed. The full significance of synergistic effects resulting from combined stresses still remains largely an unknown to be provided for by use of conservatisms, allowing a sizeable margin in test programs and analyses to account for possible combined effects. However, these margins, when applied to sequential aging tests, may under- or over-estimate the qualified life of the material or equipment. Experimentation with radiation dose-rate effects, simultaneous vs. sequential ordered exposures, and other combined environment testing are highlighted in this paper to provide an overview of the current state-of-knowledge concerning synergistic effects and their significance to qualification programs
Experimental Models of Inherited PrP Prion Diseases.
Watts, Joel C; Prusiner, Stanley B
2017-11-01
The inherited prion protein (PrP) prion disorders, which include familial Creutzfeldt-Jakob disease, Gerstmann-Sträussler-Scheinker disease, and fatal familial insomnia, constitute ∼10%-15% of all PrP prion disease cases in humans. Attempts to generate animal models of these disorders using transgenic mice expressing mutant PrP have produced variable results. Although many lines of mice develop spontaneous signs of neurological illness with accompanying prion disease-specific neuropathological changes, others do not. Furthermore, demonstrating the presence of protease-resistant PrP species and prion infectivity-two of the hallmarks of the PrP prion disorders-in the brains of spontaneously sick mice has proven particularly challenging. Here, we review the progress that has been made toward developing accurate mouse models of the inherited PrP prion disorders. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.
The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion
Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe
2015-10-01
The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.
Directory of Open Access Journals (Sweden)
Kohtaro Miyazawa
Full Text Available In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population.
Resistance of soil-bound prions to rumen digestion.
Directory of Open Access Journals (Sweden)
Samuel E Saunders
Full Text Available Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrP(c from complete digestion, while both unbound and soil-bound infectious PrP(Sc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD and scrapie in the environment.
Resistance of Soil-Bound Prions to Rumen Digestion
Saunders, Samuel E.; Bartelt-Hunt, Shannon L.; Bartz, Jason C.
2012-01-01
Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrPc from complete digestion, while both unbound and soil-bound infectious PrPSc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD) and scrapie in the environment. PMID:22937149
Sun, Wenlong; Sang, Yuanbin; Zhang, Bowei; Yu, Xiaoxia; Xu, Qinmin; Xiu, Zhilong; Dong, Yuesheng
2017-03-01
Prediabetes is defined as blood glucose levels above normal but below diabetes thresholds, and up to 70% of individuals with prediabetes will eventually develop diabetes if left untreated. Acarbose, the first FDA approved anti-prediabetes agent, has some disadvantages, such as reducing the risk of diabetes by only 36%, side effects and limited effects on complications. The aim of this study is to develop a new agent to treat prediabetes and to investigate the anti-prediabetes effects and mechanisms of acarbose and an Oroxylum indicum seed extract (OISE) in prediabetic mice. The combined drugs can reduce the dose of acarbose by 80% and reduce the risk of diabetes by 75%, which is one fold higher than acarbose monotherapy. The combined drugs showed synergistic anti-prediabetes effects and could be effective in preventing the complications of prediabetes. The combined drugs could improve glucose tolerance, improve lipid metabolism and reduce oxidative stress and tissue damage. For the mechanisms, the combined drugs can reduce synergistically postprandial hyperglycaemia by inhibiting α-glucosidase. Furthermore, baicalein in OISE was demonstrated to be a major component in reducing oxidative stress and chrysin was the primary compound that activated PPARγ. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Lack of prion transmission by sexual or parental routes in experimentally infected hamsters.
Morales, Rodrigo; Pritzkow, Sandra; Hu, Ping Ping; Duran-Aniotz, Claudia; Soto, Claudio
2013-01-01
Prion diseases are a group of neurodegenerative disorders affecting humans as well as captive and wild animals. The mechanisms and routes governing the natural spread of prions are not completely understood and several hypotheses have been proposed. In this study, we analyzed the effect of gender in prion incubation period, as well as the possibility of prion transmission by sexual and parental contact using 263K infected hamsters as a model. Our results show that males have significantly longer incubation periods compared with females when exposed to the same quantity of infectious material. Importantly, no evidence of sexual or parental prion transmission was found, even 500 d after sexual contact or birth, respectively. Western blotting and PMCA were unable to detect sub-clinical levels of PrP(Sc) in experimental subjects, suggesting a complete absence of prion transmission by these routes. Our results show that sexual and parental transmission of prions does not occur in this model. It remains to be studied whether this conclusion is valid also for other prion strains and species.
Yamaguchi, Yoshitaka; Miyata, Hironori; Uchiyama, Keiji; Ootsuyama, Akira; Inubushi, Sachiko; Mori, Tsuyoshi; Muramatsu, Naomi; Katamine, Shigeru; Sakaguchi, Suehiro
2012-01-01
Accumulating lines of evidence indicate that the N-terminal domain of prion protein (PrP) is involved in prion susceptibility in mice. In this study, to investigate the role of the octapeptide repeat (OR) region alone in the N-terminal domain for the susceptibility and pathogenesis of prion disease, we intracerebrally inoculated RML scrapie prions into tg(PrPΔOR)/Prnp(0/0) mice, which express mouse PrP missing only the OR region on the PrP-null background. Incubation times of these mice were not extended. Protease-resistant PrPΔOR, or PrP(Sc)ΔOR, was easily detectable but lower in the brains of these mice, compared to that in control wild-type mice. Consistently, prion titers were slightly lower and astrogliosis was milder in their brains. However, in their spinal cords, PrP(Sc)ΔOR and prion titers were abundant and astrogliosis was as strong as in control wild-type mice. These results indicate that the role of the OR region in prion susceptibility and pathogenesis of the disease is limited. We also found that the PrP(Sc)ΔOR, including the pre-OR residues 23-50, was unusually protease-resistant, indicating that deletion of the OR region could cause structural changes to the pre-OR region upon prion infection, leading to formation of a protease-resistant structure for the pre-OR region.
Soil clay content underlies prion infection odds
David, Walter W.; Walsh, D.P.; Farnsworth, Matthew L.; Winkelman, D.L.; Miller, M.W.
2011-01-01
Environmental factors-especially soil properties-have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings. ?? 2011 Macmillan Publishers Limited. All rights reserved.
Vucković, Sonja M; Tomić, Maja A; Stepanović-Petrović, Radica M; Ugresić, Nenad; Prostran, Milica S; Bosković, Bogdan
2006-11-01
In this study, the effects of yohimbine (alpha2-adrenoceptor antagonist) and clonidine (alpha2-adrenoceptor agonist) on anti-hyperalgesia induced by carbamazepine and oxcarbazepine in a rat model of inflammatory pain were investigated. Carbamazepine (10-40 mg/kg; i.p.) and oxcarbazepine (40-160 mg/kg; i.p.) caused a significant dose-dependent reduction of the paw inflammatory hyperalgesia induced by concanavalin A (Con A, intraplantarly) in a paw pressure test in rats. Yohimbine (1-3 mg/kg; i.p.) significantly depressed the anti-hyperalgesic effects of carbamazepine and oxcarbazepine, in a dose- and time-dependent manner. Both drug mixtures (carbamazepine-clonidine and oxcarbazepine-clonidine) administered in fixed-dose fractions of the ED50 (1/2, 1/4 and 1/8) caused significant and dose-dependent reduction of the hyperalgesia induced by Con A. Isobolographic analysis revealed a significant synergistic (supra-additive) anti-hyperalgesic effect of both combinations tested. These results indicate that anti-hyperalgesic effects of carbamazepine and oxcarbazepine are, at least partially, mediated by activation of adrenergic alpha2-receptors. In addition, synergistic interaction for anti-hyperalgesia between carbamazepine and clonidine, as well as oxcarbazepine and clonidine in a model of inflammatory hyperalgesia, was demonstrated.
Molecular Pathology of Human Prion Diseases
Directory of Open Access Journals (Sweden)
2009-03-01
Full Text Available Prion diseases are fatal neurodegenerative conditions in humans and animals. In this review, we summarize the molecular background of phenotypic variability, relation of prion protein (PrP to other proteins associated with neurodegenerative diseases, and pathogenesis of neuronal vulnerability. PrP exists in different forms that may be present in both diseased and non-diseased brain, however, abundant disease-associated PrP together with tissue pathology characterizes prion diseases and associates with transmissibility. Prion diseases have different etiological background with distinct pathogenesis and phenotype. Mutations of the prion protein gene are associated with genetic forms. The codon 129 polymorphism in combination with the Western blot pattern of PrP after proteinase K digestion serves as a basis for molecular subtyping of sporadic Creutzfeldt-Jakob disease. Tissue damage may result from several parallel, interacting or subsequent pathways that involve cellular systems associated with synapses, protein processing, oxidative stress, autophagy, and apoptosis.
Shimizu, Tomofumi; Shibuya, Nobuhiko; Narukawa, Yuji; Oshima, Naohiro; Hada, Noriyasu; Kiuchi, Fumiyuki
2018-01-01
Scutellaria root, the root of Scutellaria baicalensis Georgi, is a crude drug used for inflammatory diseases. In our previous report, the combination of flavonoids contained in Scutellaria root have been found to inhibit PGE 2 production more strongly than individual flavonoids. Here, to investigate the mechanism of the synergistic effect, we examined the effects of an equimolar mixture (F-mix) of baicalein (1), wogonin (2) and oroxylin A (3) on the production of PGE 2 in LPS-treated J774.1 cells. Although 1 and 3 inhibited COX-2 activity, the F-mix showed no synergistic effect on COX-2 inhibition. Therefore, we investigated the steps leading to the activation of COX-2 protein. Compounds 1-3 and F-mix inhibited the expression of COX-2 protein. However, only 2 inhibited the expression of COX-2 mRNA among the flavonoids, and the F-mix showed no synergistic effect. Only 1 inhibited NF-κB translocation into the nucleus, and the F-mix showed no synergistic effect. Although 2 did not affect NF-κB translocation, it strongly inhibited NF-κB-dependent transcriptional activity, and the F-mix inhibited the activity slightly more than 2. Compounds 1-3 also inhibited NO production, and the F-mix showed a synergistic effect. However, the effects of each flavonoid on the expression of iNOS mRNA were not consistent with those on COX-2 mRNA. Because the flavonoids inhibit different steps in the production of PGE 2 and NO, and their mixture did not show apparent synergistic effects in each step, we conclude that the synergistic effect of the flavonoid mixture reflects the total effect of the flavonoids inhibiting different steps in the NF-κB signalling pathway.
Aerosols transmit prions to immunocompetent and immunodeficient mice.
Directory of Open Access Journals (Sweden)
Johannes Haybaeck
Full Text Available Prions, the agents causing transmissible spongiform encephalopathies, colonize the brain of hosts after oral, parenteral, intralingual, or even transdermal uptake. However, prions are not generally considered to be airborne. Here we report that inbred and crossbred wild-type mice, as well as tga20 transgenic mice overexpressing PrP(C, efficiently develop scrapie upon exposure to aerosolized prions. NSE-PrP transgenic mice, which express PrP(C selectively in neurons, were also susceptible to airborne prions. Aerogenic infection occurred also in mice lacking B- and T-lymphocytes, NK-cells, follicular dendritic cells or complement components. Brains of diseased mice contained PrP(Sc and transmitted scrapie when inoculated into further mice. We conclude that aerogenic exposure to prions is very efficacious and can lead to direct invasion of neural pathways without an obligatory replicative phase in lymphoid organs. This previously unappreciated risk for airborne prion transmission may warrant re-thinking on prion biosafety guidelines in research and diagnostic laboratories.
International Nuclear Information System (INIS)
Wang Ying; He Qingyu; Chen Hongming; Chiu Jenfu
2007-01-01
The anti-estrogen tamoxifen and vitamin A-related compound, all-trans retinoic acid (RA), in combination act synergistically to inhibit the growth of MCF-7 human breast cancer cells. In the present study, we applied two-dimensional gel electrophoresis based proteomic approach to globally analyze this synergistic effect of RA and tamoxifen. Proteomic study revealed that multiple clusters of proteins were involved in RA and tamoxifen-induced apoptosis in MCF-7 breast cancer cells, including post-transcriptional and splicing factors, proteins related to cellular proliferation or differentiation, and proteins related to energy production and internal degradation systems. The negative growth factor-transforming growth factor β (TGFβ) was secreted by RA and/or tamoxifen treatment and was studies as a potential mediator of the synergistic effects of RA and tamoxifen in apoptosis. By comparing protein alterations in treatments of RA and tamoxifen alone or in combination to those of TGFβ treatment, or co-treatment with TGFβ inhibitor SB 431542, proteomic results showed that a number of proteins were involved in TGFβ signaling pathway. These results provide valuable insights into the mechanisms of RA and tamoxifen-induced TGFβ signaling pathway in breast cancer cells
Agarwal, Drishti; Sharma, Manish; Dixit, Sandeep K; Dutta, Roshan K; Singh, Ashok K; Gupta, Rinkoo D; Awasthi, Satish K
2015-02-05
Emergence of drug-resistant parasite strains has surfaced as a major obstacle in attempts to ameliorate malaria. Current treatment regimen of malaria relies on the concept of artemisinin-based combination therapy (ACT). Fluoroquinolone analogues, compounds 10, 12 and 18 were investigated for their anti-malarial interaction in combination with artemisinin in vitro, against Plasmodium falciparum 3D7 strain, employing fixed-ratio combination isobologram method. In addition, the efficacy of these compounds was evaluated intraperitoneally in BALB/c mice infected with chloroquine-resistant Plasmodium berghei ANKA strain in the Peters' four-day suppressive test. Promising results were obtained in the form of synergistic or additive interactions. Compounds 10 and 12 were found to have highly synergistic interactions with artemisinin. Antiplasmodial effect was further verified by the convincing ED50 values of these compounds, which ranged between 2.31 and 3.09 (mg/kg BW). In vivo studies substantiated the potential of the fluoroquinolone derivatives to be developed as synergistic partners for anti-malarial drug combinations.
Prions, From Structure to Epigenetics and Neuronal Functions
Lindquist, Susan
2012-02-01
Prions are a unique type of protein that can misfold and convert other proteins to the same shape. The well-characterized yeast prion [PSI+] is formed from an inactive amyloid fiber conformation of the translation-termination factor, Sup35. This altered conformation is passed from mother cells to daughters, acting as a template to perpetuate the prion state and providing a mechanism of protein-based inheritance. We employed a variety of methods to determine the structure of Sup35 amyloid fibrils. First, using fluorescent tags and cross-linking we identified specific segments of the protein monomer that form intermolecular contacts in a ``Head-to-Head,'' ``Tail-to-Tail'' fashion while a central region forms intramolecular contacts. Then, using peptide arrays we mapped the region responsible for the prion transmission barrier between two different yeast species. We have also used optical tweezers to reveal that the non-covalent intermolecular contacts between monomers are unusually strong, and maintain fibril integrity even under forces that partially unfold individual monomers and extend fibril length. Based on the handful of known yeast prion proteins we predicted sequences that could be responsible for prion-like amyloid folding. Our screen identified 19 new candidate prions, whose protein-folding properties and diverse cellular functions we have characterized using a combination of genetic and biochemical techniques. Prion-driven phenotypic diversity increases under stress, and can be amplified by the dynamic maturation of prion-initiating states. These qualities allow prions to act as ``bet-hedging'' devices that facilitate the adaptation of yeast to stressful environments, and might speed the evolution of new traits. Together with Kandel and Si, we have also found that a regulatory protein that plays an important role in synaptic plasticity behaves as a prion in yeast. Cytoplasmic polyAdenylation element binding protein, CPEB, maintains synapses by promoting
Bergasa-Caceres, Fernando; Rabitz, Herschel A.
2014-01-01
A model of protein folding kinetics is applied to study the combined effects of protein flexibility and macromolecular crowding on protein folding rate and stability. It is found that the increase in stability and folding rate promoted by macromolecular crowding is damped for proteins with highly flexible native structures. The model is applied to the folding dynamics of the murine prion protein (121-231). It is found that the high flexibility of the native isoform of the murine prion protein (121-231) reduces the effects of macromolecular crowding on its folding dynamics. The relevance of these findings for the pathogenic mechanism are discussed.
Intraperitoneal Infection of Wild-Type Mice with Synthetically Generated Mammalian Prion.
Directory of Open Access Journals (Sweden)
Xinhe Wang
2015-07-01
Full Text Available The prion hypothesis postulates that the infectious agent in transmissible spongiform encephalopathies (TSEs is an unorthodox protein conformation based agent. Recent successes in generating mammalian prions in vitro with bacterially expressed recombinant prion protein provide strong support for the hypothesis. However, whether the pathogenic properties of synthetically generated prion (rec-Prion recapitulate those of naturally occurring prions remains unresolved. Using end-point titration assay, we showed that the in vitro prepared rec-Prions have infectious titers of around 104 LD50/μg. In addition, intraperitoneal (i.p. inoculation of wild-type mice with rec-Prion caused prion disease with an average survival time of 210-220 days post inoculation. Detailed pathological analyses revealed that the nature of rec-Prion induced lesions, including spongiform change, disease specific prion protein accumulation (PrP-d and the PrP-d dissemination amongst lymphoid and peripheral nervous system tissues, the route and mechanisms of neuroinvasion were all typical of classical rodent prions. Our results revealed that, similar to naturally occurring prions, the rec-Prion has a titratable infectivity and is capable of causing prion disease via routes other than direct intra-cerebral challenge. More importantly, our results established that the rec-Prion caused disease is pathogenically and pathologically identical to naturally occurring contagious TSEs, supporting the concept that a conformationally altered protein agent is responsible for the infectivity in TSEs.
Prion Amplification and Hierarchical Bayesian Modeling Refine Detection of Prion Infection
Wyckoff, A. Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J.; Pulford, Bruce; Wild, Margaret; Antolin, Michael; Vercauteren, Kurt; Zabel, Mark
2015-02-01
Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.
Prion amplification and hierarchical Bayesian modeling refine detection of prion infection.
Wyckoff, A Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J; Pulford, Bruce; Wild, Margaret; Antolin, Michael; VerCauteren, Kurt; Zabel, Mark
2015-02-10
Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.
Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F
2018-03-15
The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Inactivation of animal and human prions by hydrogen peroxide gas plasma sterilization.
Rogez-Kreuz, C; Yousfi, R; Soufflet, C; Quadrio, I; Yan, Z-X; Huyot, V; Aubenque, C; Destrez, P; Roth, K; Roberts, C; Favero, M; Clayette, P
2009-08-01
Prions cause various transmissible spongiform encephalopathies. They are highly resistant to the chemical and physical decontamination and sterilization procedures routinely used in healthcare facilities. The decontamination procedures recommended for the inactivation of prions are often incompatible with the materials used in medical devices. In this study, we evaluated the use of low-temperature hydrogen peroxide gas plasma sterilization systems and other instrument-processing procedures for inactivating human and animal prions. We provide new data concerning the efficacy of hydrogen peroxide against prions from in vitro or in vivo tests, focusing on the following: the efficiency of hydrogen peroxide sterilization and possible interactions with enzymatic or alkaline detergents, differences in the efficiency of this treatment against different prion strains, and the influence of contaminating lipids. We found that gaseous hydrogen peroxide decreased the infectivity of prions and/or the level of the protease-resistant form of the prion protein on different surface materials. However, the efficiency of this treatment depended strongly on the concentration of hydrogen peroxide and the delivery system used in medical devices, because these effects were more pronounced for the new generation of Sterrad technology. The Sterrad NX sterilizer is 100% efficient (0% transmission and no protease-resistant form of the prion protein signal detected on the surface of the material for the mouse-adapted bovine spongiform encephalopathy 6PB1 strain and a variant Creutzfeldt-Jakob disease strain). Thus, gaseous or vaporized hydrogen peroxide efficiently inactivates prions on the surfaces of medical devices.
Directory of Open Access Journals (Sweden)
Takayuki Kondo
2017-11-01
Full Text Available In the process of drug development, in vitro studies do not always adequately predict human-specific drug responsiveness in clinical trials. Here, we applied the advantage of human iPSC-derived neurons, which offer human-specific drug responsiveness, to screen and evaluate therapeutic candidates for Alzheimer’s disease (AD. Using AD patient neurons with nearly 100% purity from iPSCs, we established a robust and reproducible assay for amyloid β peptide (Aβ, a pathogenic molecule in AD, and screened a pharmaceutical compound library. We acquired 27 Aβ-lowering screen hits, prioritized hits by chemical structure-based clustering, and selected 6 leading compounds. Next, to maximize the anti-Aβ effect, we selected a synergistic combination of bromocriptine, cromolyn, and topiramate as an anti-Aβ cocktail. Finally, using neurons from familial and sporadic AD patients, we found that the cocktail showed a significant and potent anti-Aβ effect on patient cells. This human iPSC-based platform promises to be useful for AD drug development.
Selfish prion of Rnq1 mutant in yeast.
Kurahashi, Hiroshi; Shibata, Shoichiro; Ishiwata, Masao; Nakamura, Yoshikazu
2009-05-01
[PIN(+)] is a prion form of Rnq1 in Saccharomyces cerevisiae and is necessary for the de novo induction of a second prion, [PSI(+)]. We previously isolated a truncated form of Rnq1, named Rnq1Delta100, as a [PSI(+)]-eliminating factor in S. cerevisiae. Rnq1Delta100 deletes the N-terminal non-prion domain of Rnq1, and eliminates [PSI(+)] in [PIN(+)] yeast. Here we found that [PIN(+)] is transmissible to Rnq1Delta100 in the absence of full-length Rnq1, forming a novel prion variant [RNQ1Delta100(+)]. [RNQ1Delta100(+)] has similar [PIN(+)] properties as it stimulates the de novo induction of [PSI(+)] and is eliminated by the null hsp104Delta mutation, but not by Hsp104 overproduction. In contrast, [RNQ1Delta100(+)] inherits the inhibitory activity and hampers the maintenance of [PSI(+)] though less efficiently than [PIN(+)] made of Rnq1-Rnq1Delta100 co-aggregates. Interestingly, [RNQ1Delta100(+)] prion was eliminated by de novo [PSI(+)] induction. Thus, the [RNQ1Delta100(+)] prion demonstrates selfish activity to eliminate a heterologous prion in S. cerevisiae, showing the first instance of a selfish prion variant in living organisms.
Synergistic effects of irradiation of waste-water
International Nuclear Information System (INIS)
Woodbridge, D.D.
1975-01-01
Water is an absolute necessity for all forms of animal and plant life. As man's requirements for water increase, the need for better methods of purification also increase. Technology has been slow to develop new methods of water treatment for the direct utilization of waste-water. Many new construction projects are at a standstill because waste-water treatment methods have not been developed to handle adequately the ever-increasing flow of sewage. Theoretical considerations of the use of high-level radiation in the treatment of waste-water have failed to consider the effects of the hydrated electron, and the potential of the possible synergistic effects of combining chlorine, oxygen and irradiation. An extensive testing programme at the University Center for Pollution Research of the Florida Institute of Technology over the past four years has shown that irradiation of waste-water samples immersed in an aqueous environment provide bacterial kill and reduction in organic pollution far greater than that obtained from theoretical considerations of G values and earlier experiments where the waste samples were not immersed in an aqueous environment. These testing programmes have investigated the synergistic effects of combining oxygen and irradiation. Each of these combined treatments resulted in an increased bacterial kill factor. Tests on Staphylococcus aureus bacteria and faecal streptococcus bacteria indicate that the synergistic effects observed for faecal coliform bacteria also apply to the pathogenic bacteria. A statistical analysis of the data obtained shows the relationships between the various effects on the bacteria. A definite shielding factor from the turbidity of the waste-water has been shown to exist. Synergistic effects have been shown to offset significantly the shielding effects. Optimization of these synergistic effects can greatly increase the effectiveness of irradiation in the treatment of waste-water. (author)
A closer look at prion strains: characterization and important implications.
Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto
2013-01-01
Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrP (Sc) ), a pathogenic isoform of the host-encoded cellular prion protein (PrP (C) ). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrP (Sc) conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrP (Sc) biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves.
Effect of metal ions on de novo aggregation of full-length prion protein
International Nuclear Information System (INIS)
Giese, Armin; Levin, Johannes; Bertsch, Uwe; Kretzschmar, Hans
2004-01-01
It is well established that the prion protein (PrP) contains metal ion binding sites with specificity for copper. Changes in copper levels have been suggested to influence incubation time in experimental prion disease. Therefore, we studied the effect of heavy metal ions (Cu 2+ , Mn 2+ , Ni 2+ , Co 2+ , and Zn 2+ ) in vitro in a model system that utilizes changes in the concentration of SDS to induce structural conversion and aggregation of recombinant PrP. To quantify and characterize PrP aggregates, we used fluorescently labelled PrP and cross-correlation analysis as well as scanning for intensely fluorescent targets in a confocal single molecule detection system. We found a specific strong pro-aggregatory effect of Mn 2+ at low micromolar concentrations that could be blocked by nanomolar concentration of Cu 2+ . These findings suggest that metal ions such as copper and manganese may also affect PrP conversion in vivo
Directory of Open Access Journals (Sweden)
Martin L. Daus
2016-01-01
Full Text Available In 1982, the term “prions” (proteinaceous infectious particles was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid can store and transmit information similarly to DNA was initially even denoted as being “heretical” but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the “protein-only hypothesis” expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.
Directory of Open Access Journals (Sweden)
Jia Meng
Full Text Available With the trend of an increasing aged population worldwide, Alzheimer's disease (AD, an age-related neurodegenerative disorder, as one of the major causes of dementia in elderly people is of growing concern. Despite the many hard efforts attempted during the past several decades in trying to elucidate the pathological mechanisms underlying AD and putting forward potential therapeutic strategies, there is still a lack of effective treatments for AD. The efficacy of many potential therapeutic drugs for AD is of main concern in clinical practice. For example, large bodies of evidence show that the anti-tumor histone deacetylase (HDAC inhibitor, suberoylanilidehydroxamic acid (SAHA, may be of benefit for the treatment of AD; however, its extensive inhibition of HDACs makes it a poor therapeutic. Moreover, the natural flavonoid, curcumin, may also have a potential therapeutic benefit against AD; however, it is plagued by low bioavailability. Therefore, the integrative effects of SAHA and curcumin were investigated as a protection against amyloid-beta neurotoxicity in vitro. We hypothesized that at low doses their synergistic effect would improve therapeutic selectivity, based on experiments that showed that at low concentrations SAHA and curcumin could provide comprehensive protection against Aβ25-35-induced neuronal damage in PC12 cells, strongly implying potent synergism. Furthermore, network analysis suggested that the possible mechanism underlying their synergistic action might be derived from restoration of the damaged functional link between Akt and the CBP/p300 pathway, which plays a crucial role in the pathological development of AD. Thus, our findings provided a feasible avenue for the application of a synergistic drug combination, SAHA and curcumin, in the treatment of AD.
Prions in Variably Protease-Sensitive Prionopathy: An Update
Zou, W.Q.; Gambetti, P.; Xiao, X.; Yuan, J.; Langeveld, J.P.M.; Pirisinu, L.
2013-01-01
Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably
Prescott, Matthew; Mitchell, James; Totti, Stella; Lee, Judy; Velliou, Eirini; Bussemaker, Madeleine
2018-01-01
The presence of ultrasound-induced cavitation in sonodynamic therapy (SDT) treatments has previously enhanced the activity and delivery of certain sonosensitisers in biological systems. The purpose of this work was to investigate the potential for two novel anti-cancer agents from natural derivatives, sanguinarine and ginger root extract (GRE), as sonosensitisers in an SDT treatment with in vitro PANC-1 cells. Both anti-cancer compounds had a dose-dependent cytotoxicity in the presence of PANC-1 cells. A range of six discreet ultrasound power-frequency configurations were tested and it was found that the cell death caused directly by ultrasound was likely due to the sonomechanical effects of cavitation. Combined treatment used dosages of 100μM sanguinarine or 1mM of GRE with 15s sonication at 500kHz and 10W. The sanguinarine-SDT and GRE-SDT treatments showed a 6% and 17% synergistic increase in observed cell death, respectively. Therefore both sanguinarine and GRE were found to be effective sonosensitisers and warrant further development for SDT, with a view to maximising the magnitude of synergistic increase in toxicity. Copyright © 2017 Elsevier B.V. All rights reserved.
New insights into structural determinants of prion protein folding and stability.
Benetti, Federico; Legname, Giuseppe
2015-01-01
Prions are the etiological agent of fatal neurodegenerative diseases called prion diseases or transmissible spongiform encephalopathies. These maladies can be sporadic, genetic or infectious disorders. Prions are due to post-translational modifications of the cellular prion protein leading to the formation of a β-sheet enriched conformer with altered biochemical properties. The molecular events causing prion formation in sporadic prion diseases are still elusive. Recently, we published a research elucidating the contribution of major structural determinants and environmental factors in prion protein folding and stability. Our study highlighted the crucial role of octarepeats in stabilizing prion protein; the presence of a highly enthalpically stable intermediate state in prion-susceptible species; and the role of disulfide bridge in preserving native fold thus avoiding the misfolding to a β-sheet enriched isoform. Taking advantage from these findings, in this work we present new insights into structural determinants of prion protein folding and stability.
Hwang, Soyoun; Greenlee, Justin J; Nicholson, Eric M
2017-01-01
Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from the normal cellular prion protein to the pathogenic misfolded conformation (PrPSc). This conversion has been used for in vitro assays including serial protein misfolding amplification and real-time quaking induced conversion (RT-QuIC). RT-QuIC can be used for the detection of prions in a variety of biological tissues from humans and animals. Extensive work has been done to demonstrate that RT-QuIC is a rapid, specific, and highly sensitive prion detection assay. RT-QuIC uses recombinant prion protein to detect minute amounts of PrPSc. RT-QuIC has been successfully used to detect PrPSc from different prion diseases with a variety of substrates including hamster, human, sheep, bank vole, bovine and chimeric forms of prion protein. However, recombinant bovine prion protein has not been used to detect transmissible mink encephalopathy (TME) or to differentiate types of bovine spongiform encephalopathy (BSE) in samples from cattle. We evaluated whether PrPSc from TME and BSE infected cattle can be detected with RT-QuIC using recombinant bovine prion proteins, and optimized the reaction conditions to specifically detect cattle TME and to discriminate between classical and atypical BSE by conversion efficiency. We also found that substrate composed of the disease associated E211K mutant protein can be effective for the detection of TME in cattle and that wild type prion protein appears to be a practical substrate to discriminate between the different types of BSEs.
Disturbed vesicular trafficking of membrane proteins in prion disease.
Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro
2013-01-01
The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.
Chronic wasting disease prion infection of differentiated neurospheres.
Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A
2017-07-04
A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.
Prion search and cellular prion protein expression in stranded dolphins.
Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C
2012-01-01
The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.
Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures
Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi
2013-01-01
The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992
Rapid antemortem detection of CWD prions in deer saliva.
Directory of Open Access Journals (Sweden)
Davin M Henderson
Full Text Available Chronic wasting disease (CWD is an efficiently transmitted prion disease of cervids, now identified in 22 United States, 2 Canadian provinces and Korea. One hallmark of CWD is the shedding of infectious prions in saliva, as demonstrated by bioassay in deer. It is also clear that the concentration of prions in saliva, blood, urine and feces is much lower than in the nervous system or lymphoid tissues. Rapid in vitro detection of CWD (and other prions in body fluids and excreta has been problematic due to the sensitivity limits of direct assays (western blotting, ELISA and the presence of inhibitors in these complex biological materials that hamper detection. Here we use real-time quaking induced conversion (RT-QuIC to demonstrate CWD prions in both diluted and prion-enriched saliva samples from asymptomatic and symptomatic white-tailed deer. CWD prions were detected in 14 of 24 (58.3% diluted saliva samples from CWD-exposed white-tailed deer, including 9 of 14 asymptomatic animals (64.2%. In addition, a phosphotungstic acid enrichment enhanced the RT-QuIC assay sensitivity, enabling detection in 19 of 24 (79.1% of the above saliva samples. Bioassay in Tg[CerPrP] mice confirmed the presence of infectious prions in 2 of 2 RT-QuIC-positive saliva samples so examined. The modified RT-QuIC analysis described represents a non-invasive, rapid ante-mortem detection of prions in complex biologic fluids, excreta, or environmental samples as well as a tool for exploring prion trafficking, peripheralization, and dissemination.
Translational errors as an early event in prion conversion.
Hatin, I; Bidou, L; Cullin, C; Rousset, J P
2001-01-01
A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.
Effects of Androgen Ablation on Anti-Tumor Immunity
National Research Council Canada - National Science Library
Kast, Martin
2004-01-01
.... This AA induced autoimmune-like response exerts limited anti-tumor activity in a murine prostate cancer model, but could be synergistic with CTLA-4 blockade that promotes the development of autoreactive T cell...
Wyckoff, A. Christy; Lockwood, Krista L.; Meyerett-Reid, Crystal; Michel, Brady A.; Bender, Heather; VerCauteren, Kurt C.; Zabel, Mark D.
2013-01-01
Prions, the infectious agent of scrapie, chronic wasting disease and other transmissible spongiform encephalopathies, are misfolded proteins that are highly stable and resistant to degradation. Prions are known to associate with clay and other soil components, enhancing their persistence and surprisingly, transmissibility. Currently, few detection and quantification methods exist for prions in soil, hindering an understanding of prion persistence and infectivity in the environment. Variability in apparent infectious titers of prions when bound to soil has complicated attempts to quantify the binding capacity of soil for prion infectivity. Here, we quantify the prion adsorption capacity of whole, sandy loam soil (SLS) typically found in CWD endemic areas in Colorado; and purified montmorillonite clay (Mte), previously shown to bind prions, by BioAssay of Subtracted Infectivity in Complex Solutions (BASICS). We incubated prion positive 10% brain homogenate from terminally sick mice infected with the Rocky Mountain Lab strain of mouse-adapted prions (RML) with 10% SLS or Mte. After 24 hours samples were centrifuged five minutes at 200×g and soil-free supernatant was intracerebrally inoculated into prion susceptible indicator mice. We used the number of days post inoculation to clinical disease to calculate the infectious titer remaining in the supernatant, which we subtracted from the starting titer to determine the infectious prion binding capacity of SLS and Mte. BASICS indicated SLS bound and removed ≥ 95% of infectivity. Mte bound and removed lethal doses (99.98%) of prions from inocula, effectively preventing disease in the mice. Our data reveal significant prion-binding capacity of soil and the utility of BASICS to estimate prion loads and investigate persistence and decomposition in the environment. Additionally, since Mte successfully rescued the mice from prion disease, Mte might be used for remediation and decontamination protocols. PMID:23484043
Mammalian prions: tolerance to sequence changes-how far?
Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel
2013-01-01
Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.
Dissociation of recombinant prion autocatalysis from infectivity.
Noble, Geoffrey P; Supattapone, Surachai
2015-01-01
Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.
Zabel, Mark D.; Reid, Crystal
2015-01-01
Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. PMID:26449713
Directory of Open Access Journals (Sweden)
Ma S
2013-10-01
Full Text Available Shilin Ma,1 Fen Chen,1 Xiaohui Ye,2 Yingjie Dong,2 Yingna Xue,1 Heming Xu,1 Wenji Zhang,1 Shuangshuang Song,1 Li Ai,2 Naixian Zhang,2 Weisan Pan1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, 2Liaoning Institute of Pharmaceutical Industry, Liaoning, The People's Republic of China Abstract: The purpose of this study was to develop a docetaxel microemulsion containing an anti-tumor synergistic ingredient (Brucea javanica oil and to investigate the characteristics of the microemulsion. Brucea javanica oil contains oleic acid and linoleic acids that have been shown by animal and human studies to inhibit tumor formation. The microemulsion containing Brucea javanica oil, medium-chain triglyceride, soybean lecithin, Solutol®HS 15, PEG 400, and water was developed for docetaxel intravenous administration. A formulation with higher drug content, lower viscosity, and smaller particle size was developed. The droplet size distribution of the dispersed phase of the optimized microemulsion was 13.5 nm, determined using a dynamic light scattering technique. The small droplet size enabled the microemulsion droplets to escape from uptake and phagocytosis by the reticuloendothelial system and increased the circulation time of the drug. The zeta potential was -41.3 mV. The optimized microemulsion was pale yellow, transparent, and non-opalescent in appearance. The value of the combination index was 0.58, showing that there was a synergistic effect when docetaxel was combined with Brucea javanica oil. After a single intravenous infusion dose (10 mg/kg in male Sprague Dawley rats, the area under the curve of the microemulsion was higher and the half-time was longer compared with that of docetaxel solution alone, and showed superior pharmacokinetic characteristics. These results indicate that this preparation of docetaxel in emulsion is likely to provide an excellent prospect for clinical tumor treatment. Keywords: microemulsion, docetaxel
Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred
2012-01-01
Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380
Directory of Open Access Journals (Sweden)
Paula Stewart
Full Text Available Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE during the bovine spongiform encephalopathy (BSE epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD remains an open question. Variation in the host-encoded prion protein (PrP(C largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo and pine marten (Martes martes were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus and mountain lion (Puma concolor from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.
Secretin receptor involvement in prion-infected cells and animals.
Kimura, Tomohiro; Nishizawa, Keiko; Oguma, Ayumi; Nishimura, Yuki; Sakasegawa, Yuji; Teruya, Kenta; Nishijima, Ichiko; Doh-ura, Katsumi
2015-07-08
The cellular mechanisms behind prion biosynthesis and metabolism remain unclear. Here we show that secretin signaling via the secretin receptor regulates abnormal prion protein formation in prion-infected cells. Animal studies demonstrate that secretin receptor deficiency slightly, but significantly, prolongs incubation time in female but not male mice. This gender-specificity is consistent with our finding that prion-infected cells are derived from females. Therefore, our results provide initial insights into the reasons why age of disease onset in certain prion diseases is reported to occur slightly earlier in females than males. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Detection of prion infectivity in fat tissues of scrapie-infected mice.
Directory of Open Access Journals (Sweden)
Brent Race
2008-12-01
Full Text Available Distribution of prion infectivity in organs and tissues is important in understanding prion disease pathogenesis and designing strategies to prevent prion infection in animals and humans. Transmission of prion disease from cattle to humans resulted in banning human consumption of ruminant nervous system and certain other tissues. In the present study, we surveyed tissue distribution of prion infectivity in mice with prion disease. We show for the first time detection of infectivity in white and brown fat. Since high amounts of ruminant fat are consumed by humans and also incorporated into animal feed, fat-containing tissues may pose a previously unappreciated hazard for spread of prion infection.
Unaltered Prion Pathogenesis in a Mouse Model of High-Fat Diet-Induced Insulin Resistance.
Directory of Open Access Journals (Sweden)
Caihong Zhu
Full Text Available Epidemiological, clinical, and experimental animal studies suggest a strong correlation between insulin resistance and Alzheimer's disease. In fact, type-2 diabetes is considered an important risk factor of developing Alzheimer's disease. In addition, impaired insulin signaling in the Alzheimer's disease brain may promote Aβ production, impair Aβ clearance and induce tau hyperphosphorylation, thereby leading to deterioration of the disease. The pathological prion protein, PrPSc, deposits in the form of extracellular aggregates and leads to dementia, raising the question as to whether prion pathogenesis may also be affected by insulin resistance. We therefore established high-fat diet-induced insulin resistance in tga20 mice, which overexpress the prion protein. We then inoculated the insulin-resistant mice with prions. We found that insulin resistance in tga20 mice did not affect prion disease progression, PrPSc deposition, astrogliosis or microglial activation, and had no effect on survival. Our study demonstrates that in a mouse model, insulin resistance does not significantly contribute to prion pathogenesis.
Localization of A11-reactive oligomeric species in prion diseases
DEFF Research Database (Denmark)
Aidt, Frederik H; Hasholt, Lis F; Christiansen, Michael
2013-01-01
To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases.......To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases....
Synthetic Prions Provide Clues for Understanding Prion Diseases.
Imberdis, Thibaut; Harris, David A
2016-04-01
This Commentary highlights the article by Makarava et al that discusses the formation of synthetic prions and the role of substrate levels in their evolution. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
A role for astroglia in prion diseases.
Aguzzi, Adriano; Liu, Yingjun
2017-12-04
In this issue of JEM, Krejciova et al. (https://doi.org/10.1084/jem.20161547) report that astrocytes derived from human iPSCs can replicate human CJD prions. These observations provide a new, potentially very valuable model for studying human prions in cellula and for identifying antiprion compounds that might serve as clinical candidates. Furthermore, they add to the evidence that astrocytes may not be just innocent bystanders in prion diseases. © 2017 Aguzzi and Liu.
Herencia y memoria: ¿un nuevo rol para los priones?
Directory of Open Access Journals (Sweden)
Vladimir Ávila Ávila
2008-04-01
Full Text Available Los priones causan las encefalopatías espongiformes enmamíferos y humanos. Los agregados de proteínaspresentes en estas entidades son similares a las de otrasenfermedades neurodegenerativas como la enfermedad deAlzheimer. Sin embargo, hallazgos recientes sugieren quebajo circunstancias específicas los priones podríanparticipar de muchos procesos biológicos. En organismosdel reino fungi los priones actúan como elementosgenéticos para la herencia de fenotipos ante condicionesmedio ambientales adversas; un modelo en Aplysiamuestra que podrían existir proteínas de característicassimilares a los priones en organismos superiorescumpliendo funciones en los procesos de formación de lamemoria como la CPEB (Proteína de unión al elemento depoliadenilación. ¿Pueden los priones en realidad participaren los procesos biológicos? Aquí revisamos algunosdetalles de las enfermedades causadas por priones en elhombre, los priones como elementos genéticos y laimportancia de la capacidad de los priones para guardarinformación en los procesos de la memoria.
Prions amplify through degradation of the VPS10P sorting receptor sortilin.
Uchiyama, Keiji; Tomita, Mitsuru; Yano, Masashi; Chida, Junji; Hara, Hideyuki; Das, Nandita Rani; Nykjaer, Anders; Sakaguchi, Suehiro
2017-06-01
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains through constitutive conformational conversion of the cellular prion protein, PrPC, into PrPSc. However, the cellular mechanism by which PrPSc is progressively accumulated in prion-infected neurons remains unknown. Here, we show that PrPSc is progressively accumulated in prion-infected cells through degradation of the VPS10P sorting receptor sortilin. We first show that sortilin interacts with PrPC and PrPSc and sorts them to lysosomes for degradation. Consistently, sortilin-knockdown increased PrPSc accumulation in prion-infected cells. In contrast, overexpression of sortilin reduced PrPSc accumulation in prion-infected cells. These results indicate that sortilin negatively regulates PrPSc accumulation in prion-infected cells. The negative role of sortilin in PrPSc accumulation was further confirmed in sortilin-knockout mice infected with prions. The infected mice had accelerated prion disease with early accumulation of PrPSc in their brains. Interestingly, sortilin was reduced in prion-infected cells and mouse brains. Treatment of prion-infected cells with lysosomal inhibitors, but not proteasomal inhibitors, increased the levels of sortilin. Moreover, sortilin was reduced following PrPSc becoming detectable in cells after infection with prions. These results indicate that PrPSc accumulation stimulates sortilin degradation in lysosomes. Taken together, these results show that PrPSc accumulation of itself could impair the sortilin-mediated sorting of PrPC and PrPSc to lysosomes for degradation by stimulating lysosomal degradation of sortilin, eventually leading to progressive accumulation of PrPSc in prion-infected cells.
Heterogeneous seeding of HET-s(218–289) and the mutability of prion structures
Energy Technology Data Exchange (ETDEWEB)
Wan, William; Stubbs, Gerald
2014-02-18
One fundamental property of prions is the formation of strains—prions that have distinct biological effects, despite a common amino acid sequence. The strain phenomenon is thought to be caused by the formation of different molecular structures, each encoding for a particular biological activity. While the precise mechanism of the formation of strains is unknown, they tend to arise following environmental changes, such as passage between different species. One possible mechanism discussed here is heterogeneous seeding; the formation of a prion nucleated by a different molecular structure. While heterogeneous seeding is not the only mechanism of prion mutation, it is consistent with some observations on species adaptation and drug resistance. Heterogeneous seeding provides a useful framework to understand how prions can adapt to new environmental conditions and change biological phenotypes.
An assessment of the long-term persistence of prion infectivity in aquatic environments
International Nuclear Information System (INIS)
Marín-Moreno, Alba; Espinosa, Juan-Carlos; Fernández-Borges, Natalia; Píquer, Juan; Girones, Rosina; Andreoletti, Olivier; Torres, Juan-María
2016-01-01
The environment plays a key role in horizontal transmission of prion diseases, since prions are extremely resistant to classical inactivation procedures. In prior work, we observed the high stability of bovine spongiform encephalopathy (BSE) infectivity when these prions were incubated in aqueous media such as phosphate-buffered saline (PBS) or wastewater for nearly nine months. As a continuation of this experiment, the same samples were maintained in PBS or wastewater for five additional years and residual BSE infectivity was assessed in bovine PrP C transgenic mice. Over this long time period (more than six years), BSE infectivity was reduced by three and one orders of magnitude in wastewater and PBS respectively. To rule out a possible agent specific effect, sheep scrapie prions were subjected to the same experimental protocol, using eight years as the experimental end-point. No significant reduction in scrapie infectivity was observed over the first nine months of wastewater incubation while PBS incubation for eight years only produced a two logarithmic unit reduction in infectivity. By contrast, the dynamics of PrP Res persistence was different, disappearing progressively over the first year. The long persistence of prion infectivity observed in this study for two different agents provides supporting evidence of the assumed high stability of these agents in aquatic environments and that environmental processes or conventional wastewater treatments with low retention times would have little impact on prion infectivity. These results could have great repercussions in terms of risk assessment and safety for animals and human populations. - Highlights: • Prion infectivity resists long term incubations in aquatic environments. • Infectivity persistence in wastewater is reduced when compared to PBS. • In this study PrPRes fails as a marker for prion detection. • Mice bioassay is the most powerful tool for assessing prion presence. • Wastewater conventional
An assessment of the long-term persistence of prion infectivity in aquatic environments
Energy Technology Data Exchange (ETDEWEB)
Marín-Moreno, Alba; Espinosa, Juan-Carlos; Fernández-Borges, Natalia; Píquer, Juan [Centro de Investigación en Sanidad Animal, CISA-INIA, Carretera Algete-El Casar S/n, Valdeolmos, 28130 Madrid (Spain); Girones, Rosina [Department of Microbiology, University of Barcelona, Diagonal 643, 08028 Barcelona (Spain); Andreoletti, Olivier [UMR INRA-ENVT 1225, Interactions Hôte Agent Pathogène, Ecole Nationale Vétérinaire de Toulouse, Toulouse (France); Torres, Juan-María, E-mail: jmtorres@inia.es [Centro de Investigación en Sanidad Animal, CISA-INIA, Carretera Algete-El Casar S/n, Valdeolmos, 28130 Madrid (Spain)
2016-11-15
The environment plays a key role in horizontal transmission of prion diseases, since prions are extremely resistant to classical inactivation procedures. In prior work, we observed the high stability of bovine spongiform encephalopathy (BSE) infectivity when these prions were incubated in aqueous media such as phosphate-buffered saline (PBS) or wastewater for nearly nine months. As a continuation of this experiment, the same samples were maintained in PBS or wastewater for five additional years and residual BSE infectivity was assessed in bovine PrP{sup C} transgenic mice. Over this long time period (more than six years), BSE infectivity was reduced by three and one orders of magnitude in wastewater and PBS respectively. To rule out a possible agent specific effect, sheep scrapie prions were subjected to the same experimental protocol, using eight years as the experimental end-point. No significant reduction in scrapie infectivity was observed over the first nine months of wastewater incubation while PBS incubation for eight years only produced a two logarithmic unit reduction in infectivity. By contrast, the dynamics of PrP{sup Res} persistence was different, disappearing progressively over the first year. The long persistence of prion infectivity observed in this study for two different agents provides supporting evidence of the assumed high stability of these agents in aquatic environments and that environmental processes or conventional wastewater treatments with low retention times would have little impact on prion infectivity. These results could have great repercussions in terms of risk assessment and safety for animals and human populations. - Highlights: • Prion infectivity resists long term incubations in aquatic environments. • Infectivity persistence in wastewater is reduced when compared to PBS. • In this study PrPRes fails as a marker for prion detection. • Mice bioassay is the most powerful tool for assessing prion presence. • Wastewater
Defining the Conformational Features of Anchorless, Poorly Neuroinvasive Prions
Bett, C.; Kurt, T.D.; Lucero, M.; Trejo, M.; Rozemuller, A.J.M.; Kong, Q.Z.; Nilsson, K.P.R.; Masliah, E.; Oldstone, M.B.; Sigurdson, C.J.
2013-01-01
Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same
Molecular pathogenesis of sporadic prion diseases in man
Safar, Jiri G.
2012-01-01
The yeast, fungal and mammalian prions determine heritable and infectious traits that are encoded in alternative conformations of proteins. They cause lethal sporadic, familial and infectious neurodegenerative conditions in man, including Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), kuru, sporadic fatal insomnia (SFI) and likely variable protease-sensitive prionopathy (VPSPr). The most prevalent of human prion diseases is sporadic (s)CJD. Recent advances in amplification and detection of prions led to considerable optimism that early and possibly preclinical diagnosis and therapy might become a reality. Although several drugs have already been tested in small numbers of sCJD patients, there is no clear evidence of any agent’s efficacy. Therefore, it remains crucial to determine the full spectrum of sCJD prion strains and the conformational features in the pathogenic human prion protein governing replication of sCJD prions. Research in this direction is essential for the rational development of diagnostic as well as therapeutic strategies. Moreover, there is growing recognition that fundamental processes involved in human prion propagation – intercellular induction of protein misfolding and seeded aggregation of misfolded host proteins – are of far wider significance. This insight leads to new avenues of research in the ever-widening spectrum of age-related human neurodegenerative diseases that are caused by protein misfolding and that pose a major challenge for healthcare. PMID:22421210
Genesis of mammalian prions: from non-infectious amyloid fibrils to a transmissible prion disease.
Directory of Open Access Journals (Sweden)
Natallia Makarava
2011-12-01
Full Text Available The transmissible agent of prion disease consists of a prion protein in its abnormal, β-sheet rich state (PrP(Sc, which is capable of replicating itself according to the template-assisted mechanism. This mechanism postulates that the folding pattern of a newly recruited polypeptide chain accurately reproduces that of a PrP(Sc template. Here we report that authentic PrP(Sc and transmissible prion disease can be generated de novo in wild type animals by recombinant PrP (rPrP amyloid fibrils, which are structurally different from PrP(Sc and lack any detectable PrP(Sc particles. When induced by rPrP fibrils, a long silent stage that involved two serial passages preceded development of the clinical disease. Once emerged, the prion disease was characterized by unique clinical, neuropathological, and biochemical features. The long silent stage to the disease was accompanied by significant transformation in neuropathological properties and biochemical features of the proteinase K-resistant PrP material (PrPres before authentic PrP(Sc evolved. The current work illustrates that transmissible prion diseases can be induced by PrP structures different from that of authentic PrP(Sc and suggests that a new mechanism different from the classical templating exists. This new mechanism designated as "deformed templating" postulates that a change in the PrP folding pattern from the one present in rPrP fibrils to an alternative specific for PrP(Sc can occur. The current work provides important new insight into the mechanisms underlying genesis of the transmissible protein states and has numerous implications for understanding the etiology of neurodegenerative diseases.
Directory of Open Access Journals (Sweden)
Lukasz Kurgan
2008-01-01
Full Text Available The exact mechanisms of prion misfolding and factors that predispose an individual to prion diseases are largely unknown. Our approach to identifying candidate factors in-silico relies on contrasting the C-terminal domain of PrPC sequences from two groups of vertebrate species: those that have been found to suffer from prion diseases, and those that have not. We propose that any significant differences between the two groups are candidate factors that may predispose individuals to develop prion disease, which should be further analyzed by wet-lab investigations. Using an array of computational methods we identified possible point mutations that could predispose PrPC to misfold into PrPSc. Our results include confirmatory findings such as the V210I mutation, and new findings including P137M, G142D, G142N, D144P, K185T, V189I, H187Y and T191P mutations, which could impact structural stability. We also propose new hypotheses that give insights into the stability of helix-2 and -3. These include destabilizing effects of Histidine and T188-T193 segment in helix-2 in the disease-prone prions, and a stabilizing effect of Leucine on helix-3 in the disease-resistant prions.
Regulation of the Hsp104 middle domain activity is critical for yeast prion propagation.
Directory of Open Access Journals (Sweden)
Jennifer E Dulle
Full Text Available Molecular chaperones play a significant role in preventing protein misfolding and aggregation. Indeed, some protein conformational disorders have been linked to changes in the chaperone network. Curiously, in yeast, chaperones also play a role in promoting prion maintenance and propagation. While many amyloidogenic proteins are associated with disease in mammals, yeast prion proteins, and their ability to undergo conformational conversion into a prion state, are proposed to play a functional role in yeast biology. The chaperone Hsp104, a AAA+ ATPase, is essential for yeast prion propagation. Hsp104 fragments large prion aggregates to generate a population of smaller oligomers that can more readily convert soluble monomer and be transmitted to daughter cells. Here, we show that the middle (M domain of Hsp104, and its mobility, plays an integral part in prion propagation. We generated and characterized mutations in the M-domain of Hsp104 that are predicted to stabilize either a repressed or de-repressed conformation of the M-domain (by analogy to ClpB in bacteria. We show that the predicted stabilization of the repressed conformation inhibits general chaperone activity. Mutation to the de-repressed conformation, however, has differential effects on ATP hydrolysis and disaggregation, suggesting that the M-domain is involved in coupling these two activities. Interestingly, we show that changes in the M-domain differentially affect the propagation of different variants of the [PSI+] and [RNQ+] prions, which indicates that some prion variants are more sensitive to changes in the M-domain mobility than others. Thus, we provide evidence that regulation of the M-domain of Hsp104 is critical for efficient prion propagation. This shows the importance of elucidating the function of the M-domain in order to understand the role of Hsp104 in the propagation of different prions and prion variants.
Nordvall, Maria; Dziegiel, Morten; Hegaard, Hanne Kristine; Bidstrup, Mogens; Jonsbo, Finn; Christensen, Birgit; Hedegaard, Morten
2009-10-01
The objective was to determine clinical consequences of various specificities for the infant/fetus. The population was patients referred between 1998 and 2005 to the tertiary center because of detected red blood cell (RBC) alloimmunization. Altogether 455 infants were delivered by 390 alloimmunized women. This was a retrospective cohort study. Data were obtained from the blood bank register and the obstetric and neonatal database. As indicators of hemolytic activity of the antibodies, the frequency of the therapeutic interventions intrauterine transfusion, exchange transfusion, and simple transfusion was used. Anti-D was the most common antibody (46.6%), followed by anti-K (15.4%). A combination of antibodies was detected in 27%. All three types of therapeutic intervention were significantly more frequent in women with anti-D plus an additional antibody than in women with anti-D as the sole antibody. The anti-D titer closely paralleled the clinical importance of the antibody. One case of anti-s with a titer of 512 required all three types of transfusion. Anti-D was the single most frequent and harmful specificity closely followed by anti-K. Combinations of antibody specificities were more harmful than single specificities, and a potentially synergistic effect should be considered.
Prion diseases: immunotargets and therapy
Directory of Open Access Journals (Sweden)
Burchell JT
2016-06-01
Full Text Available Jennifer T Burchell, Peter K Panegyres Neurodegenerative Disorders Research Pty Ltd, West Perth, Western Australia, Australia Abstract: Transmissible spongiform encephathalopathies or prion diseases are a group of neurological disorders characterized by neuronal loss, spongiform degeneration, and activation of astrocytes or microglia. These diseases affect humans and animals with an extremely high prevalence in some species such as deer and elk in North America. Although rare in humans, they result in a devastatingly swift neurological progression with dementia and ataxia. Patients usually die within a year of diagnosis. Prion diseases are familial, sporadic, iatrogenic, or transmissible. Human prion diseases include Kuru, sporadic, iatrogenic, and familial forms of Creutzfeldt–Jakob disease, variant Creutzfeldt–Jakob disease, Gerstmann–Sträussler–Scheinker disease, and fatal familial insomnia. The causative agent is a misfolded version of the physiological prion protein called PrPSc in the brain. There are a number of therapeutic options currently under investigation. A number of small molecules have had some success in delaying disease progression in animal models and mixed results in clinical trials, including pentosan polysulfate, quinacrine, and amphotericin B. More promisingly, immunotherapy has reported success in vitro and in vivo in animal studies and clinical trials. The three main branches of immunotherapy research are focus on antibody vaccines, dendritic cell vaccines, and adoptive transfer of physiological prion protein-specific CD4+ T-lymphocytes. Vaccines utilizing antibodies generally target disease-specific epitopes that are only exposed in the misfolded PrPSc conformation. Vaccines utilizing antigen-loaded dendritic cell have the ability to bypass immune tolerance and prime CD4+ cells to initiate an immune response. Adoptive transfer of CD4+ T-cells is another promising target as this cell type can orchestrate the
Molecular Modeling of Prion Transmission to Humans
Directory of Open Access Journals (Sweden)
Etienne Levavasseur
2014-10-01
Full Text Available Using different prion strains, such as the variant Creutzfeldt-Jakob disease agent and the atypical bovine spongiform encephalopathy agents, and using transgenic mice expressing human or bovine prion protein, we assessed the reliability of protein misfolding cyclic amplification (PMCA to model interspecies and genetic barriers to prion transmission. We compared our PMCA results with in vivo transmission data characterized by attack rates, i.e., the percentage of inoculated mice that developed the disease. Using 19 seed/substrate combinations, we observed that a significant PMCA amplification was only obtained when the mouse line used as substrate is susceptible to the corresponding strain. Our results suggest that PMCA provides a useful tool to study genetic barriers to transmission and to study the zoonotic potential of emerging prion strains.
Ionic Liquids: The Synergistic Catalytic Effect in the Synthesis of Cyclic Carbonates
Directory of Open Access Journals (Sweden)
Flora T.T. Ng
2013-10-01
Full Text Available This review presents the synergistic effect in the catalytic system of ionic liquids (ILs for the synthesis of cyclic carbonate from carbon dioxide and epoxide. The emphasis of this review is on three aspects: the catalytic system of metal-based ionic liquids, the catalytic system of hydrogen bond-promoted ionic liquids and supported ionic liquids. Metal and ionic liquids show a synergistic effect on the cycloaddition reactions of epoxides. The cations and anions of ionic liquids show a synergistic effect on the cycloaddition reactions. The functional groups in cations or supports combined with the anions have a synergistic effect on the cycloaddition reactions. Synergistic catalytic effects of ILs play an important role of promoting the cycloaddition reactions of epoxides. The design of catalytic system of ionic liquids will be possible if the synergistic effect on a molecular level is understood.
Current and future molecular diagnostics for prion diseases.
Lehto, Marty T; Peery, Harry E; Cashman, Neil R
2006-07-01
It is now widely held that the infectious agents underlying the transmissible spongiform encephalopathies are prions, which are primarily composed of a misfolded, protease-resistant isoform of the host prion protein. Untreatable prion disorders include some human diseases, such as Creutzfeldt-Jakob disease, and diseases of economically important animals, such as bovine spongiform encephalopathy (cattle) and chronic wasting disease (deer and elk). Detection and diagnosis of prion disease (and presymptomatic incubation) is contingent upon developing novel assays, which exploit properties uniquely possessed by this misfolded protein complex, rather than targeting an agent-specific nucleic acid. This review highlights some of the conventional and disruptive technologies developed to respond to this challenge.
Reduction of prion infectivity in packed red blood cells
International Nuclear Information System (INIS)
Morales, Rodrigo; Buytaert-Hoefen, Kimberley A.; Gonzalez-Romero, Dennisse; Castilla, Joaquin; Hansen, Eric T.; Hlavinka, Dennis; Goodrich, Raymond P.; Soto, Claudio
2008-01-01
The link between a new variant form of Creutzfeldt-Jakob disease (vCJD) and the consumption of prion contaminated cattle meat as well as recent findings showing that vCJD can be transmitted by blood transfusion have raised public health concerns. Currently, a reliable test to identify prions in blood samples is not available. The purpose of this study was to evaluate the possibility to remove scrapie prion protein (PrP Sc ) and infectivity from red blood cell (RBC) suspensions by a simple washing procedure using a cell separation and washing device. The extent of prion removal was assessed by Western blot, PMCA and infectivity bioassays. Our results revealed a substantial removal of infectious prions (≥3 logs of infectivity) by all techniques used. These data suggest that a significant amount of infectivity present in RBC preparations can be removed by a simple washing procedure. This technology may lead to increased safety of blood products and reduce the risk of further propagation of prion diseases.
Small stress molecules inhibit aggregation and neurotoxicity of prion peptide 106-126
International Nuclear Information System (INIS)
Kanapathipillai, Mathumai; Ku, Sook Hee; Girigoswami, Koyeli; Park, Chan Beum
2008-01-01
In prion diseases, the posttranslational modification of host-encoded prion protein PrP c yields a high β-sheet content modified protein PrP sc , which further polymerizes into amyloid fibrils. PrP106-126 initiates the conformational changes leading to the conversion of PrP c to PrP sc . Molecules that can defunctionalize such peptides can serve as a potential tool in combating prion diseases. In microorganisms during stressed conditions, small stress molecules (SSMs) are formed to prevent protein denaturation and maintain protein stability and function. The effect of such SSMs on PrP106-126 amyloid formation is explored in the present study using turbidity, atomic force microscopy (AFM), and cellular toxicity assay. Turbidity and AFM studies clearly depict that the SSMs-ectoine and mannosylglyceramide (MGA) inhibit the PrP106-126 aggregation. Our study also connotes that ectoine and MGA offer strong resistance to prion peptide-induced toxicity in human neuroblastoma cells, concluding that such molecules can be potential inhibitors of prion aggregation and toxicity
Chapuis, Jérôme; Moudjou, Mohammed; Reine, Fabienne; Herzog, Laetitia; Jaumain, Emilie; Chapuis, Céline; Quadrio, Isabelle; Boulliat, Jacques; Perret-Liaudet, Armand; Dron, Michel; Laude, Hubert; Rezaei, Human; Béringue, Vincent
2016-02-05
Mammalian prions are proteinaceous pathogens responsible for a broad range of fatal neurodegenerative diseases in humans and animals. These diseases can occur spontaneously, such as Creutzfeldt-Jakob disease (CJD) in humans, or be acquired or inherited. Prions are primarily formed of macromolecular assemblies of the disease-associated prion protein PrP(Sc), a misfolded isoform of the host-encoded prion protein PrP(C). Within defined host-species, prions can exist as conformational variants or strains. Based on both the M/V polymorphism at codon 129 of PrP and the electrophoretic signature of PrP(Sc) in the brain, sporadic CJD is classified in different subtypes, which may encode different strains. A transmission barrier, the mechanism of which remains unknown, limits prion cross-species propagation. To adapt to the new host, prions have the capacity to 'mutate' conformationally, leading to the emergence of a variant with new biological properties. Here, we transmitted experimentally one rare subtype of human CJD, designated cortical MM2 (129 MM with type 2 PrP(Sc)), to transgenic mice overexpressing either human or the VRQ allele of ovine PrP(C). In marked contrast with the reported absence of transmission to knock-in mice expressing physiological levels of human PrP, this subtype transmitted faithfully to mice overexpressing human PrP, and exhibited unique strain features. Onto the ovine PrP sequence, the cortical MM2 subtype abruptly evolved on second passage, thereby allowing emergence of a pair of strain variants with distinct PrP(Sc) biochemical characteristics and differing tropism for the central and lymphoid tissues. These two strain components exhibited remarkably distinct replicative properties in cell-free amplification assay, allowing the 'physical' cloning of the minor, lymphotropic component, and subsequent isolation in ovine PrP mice and RK13 cells. Here, we provide in-depth assessment of the transmissibility and evolution of one rare subtype of
Prion disease tempo determined by host-dependent substrate reduction
Mays, C.E.; Kim, C.; Haldiman, T.; Merwe, v.d. J.; Lau, A.; Yang, J.; Grams, J.; Bari, Di M.A.; Nonno, R.; Telling, G.C.; Kong, Q.; Langeveld, J.P.M.; McKenzie, D.; Westaway, D.; Safar, J.G.
2014-01-01
The symptoms of prion infection can take years or decades to manifest following the initial exposure. Molecular markers of prion disease include accumulation of the misfolded prion protein (PrPSc), which is derived from its cellular precursor (PrPC), as well as downregulation of the PrP-like Shadoo
Lions and prions and deer demise.
Directory of Open Access Journals (Sweden)
Michael W Miller
Full Text Available BACKGROUND: Contagious prion diseases--scrapie of sheep and chronic wasting disease of several species in the deer family--give rise to epidemics that seem capable of compromising host population viability. Despite this prospect, the ecological consequences of prion disease epidemics in natural populations have received little consideration. METHODOLOGY/PRINCIPAL FINDINGS: Using a cohort study design, we found that prion infection dramatically lowered survival of free-ranging adult (>2-year-old mule deer (Odocoileus hemionus: estimated average life expectancy was 5.2 additional years for uninfected deer but only 1.6 additional years for infected deer. Prion infection also increased nearly fourfold the rate of mountain lions (Puma concolor preying on deer, suggesting that epidemics may alter predator-prey dynamics by facilitating hunting success. Despite selective predation, about one fourth of the adult deer we sampled were infected. High prevalence and low survival of infected deer provided a plausible explanation for the marked decline in this deer population since the 1980s. CONCLUSION: Remarkably high infection rates sustained in the face of intense predation show that even seemingly complete ecosystems may offer little resistance to the spread and persistence of contagious prion diseases. Moreover, the depression of infected populations may lead to local imbalances in food webs and nutrient cycling in ecosystems in which deer are important herbivores.
Key points concerning amyloid infectivity and prion-like neuronal invasion
Directory of Open Access Journals (Sweden)
Alba eEspargaró
2016-04-01
Full Text Available Amyloid aggregation has been related to an increasing number of human illnesses, from Alzheimer and Parkinson’s diseases to Creutzfeldt-Jakob disease. Traditionally only prions have been considered as infectious agents with a high capacity of propagation. Although recent publications have showed that many amyloid proteins, including amyloid β-peptide, α-synuclein and tau protein, also propagate in a prion-like manner, the link between propagation of pathological proteins and neurotoxicity has not been evidenced. The extremely low infectivity in natural conditions of the most of non-prion amyloids is far from the spreading capacity displayed by the prions. However, it is important to elucidate the key factors that cause non-prion amyloids become infectious agents. In recent years, important advances in the understanding of the amyloid processes of amyloid-like proteins and unrelated prions (i.e., yeast and fungal prions have yielded essential information that can be applied to shed light on the prion phenomenon in mammals and humans. As shown in this review, recent evidences suggest that there are key factors that could dramatically modulate the prion capacity of proteins in the amyloid conformation. The concentration of nuclei, the presence of oligomers, and the toxicity, resistance and localization of these aggregates could be key factors affecting their spreading. In short, those factors that favor the high concentration of extracellular nuclei or oligomers, characterized by a small size, with a low toxicity could dramatically increase prion propensity; whereas low concentrations of highly toxic intracellular amyloids, with a large size, would prevent infectivity.
Genetic human prion disease modelled in PrP transgenic Drosophila.
Thackray, Alana M; Cardova, Alzbeta; Wolf, Hanna; Pradl, Lydia; Vorberg, Ina; Jackson, Walker S; Bujdoso, Raymond
2017-09-20
Inherited human prion diseases, such as fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD), are associated with autosomal dominant mutations in the human prion protein gene PRNP and accumulation of PrP Sc , an abnormal isomer of the normal host protein PrP C , in the brain of affected individuals. PrP Sc is the principal component of the transmissible neurotoxic prion agent. It is important to identify molecular pathways and cellular processes that regulate prion formation and prion-induced neurotoxicity. This will allow identification of possible therapeutic interventions for individuals with, or at risk from, genetic human prion disease. Increasingly, Drosophila has been used to model human neurodegenerative disease. An important unanswered question is whether genetic prion disease with concomitant spontaneous prion formation can be modelled in Drosophila We have used pUAST/PhiC31-mediated site-directed mutagenesis to generate Drosophila transgenic for murine or hamster PrP (prion protein) that carry single-codon mutations associated with genetic human prion disease. Mouse or hamster PrP harbouring an FFI (D178N) or fCJD (E200K) mutation showed mild Proteinase K resistance when expressed in Drosophila Adult Drosophila transgenic for FFI or fCJD variants of mouse or hamster PrP displayed a spontaneous decline in locomotor ability that increased in severity as the flies aged. Significantly, this mutant PrP-mediated neurotoxic fly phenotype was transferable to recipient Drosophila that expressed the wild-type form of the transgene. Collectively, our novel data are indicative of the spontaneous formation of a PrP-dependent neurotoxic phenotype in FFI- or CJD-PrP transgenic Drosophila and show that inherited human prion disease can be modelled in this invertebrate host. © 2017 The Author(s).
Rossi, C C; Santos-Gandelman, J F; Barros, E M; Alvarez, V M; Laport, M S; Giambiagi-deMarval, M
2016-09-01
Staphylococcus haemolyticus is an opportunistic human pathogen that usually gains entry into the host tissue in association with medical device contamination. Biofilm formation is a key factor for the establishment of this bacterium and its arrangement and dynamics can be influenced by the synthesis of biosurfactants. Biosurfactants are structurally diverse amphiphilic molecules with versatile biotechnological applications, but information on their production by staphylococci is still scarce. In this work, two Staph. haemolyticus strains, showing high potential for biosurfactant production - as observed by four complementary methods - were investigated. Biosurfactant extracts were produced and studied for their capacity to inhibit the growth and biofilm formation by other bacterial human pathogens. The biosurfactant produced by the one of the strains inhibited the growth of most bacteria tested and subinhibitory concentrations of the biosurfactant were able to decrease biofilm formation and showed synergistic effects with tetracycline. Because these results were also positive when the biosurfactants were tested against the producing strains, it is likely that biosurfactant production by Staph. haemolyticus may be an unexplored virulence factor, important for competition and biofilm formation by the bacterium, in addition to the biotechnological potential. This work is the first to show the production of biosurfactants by Staphylococcus haemolyticus strains. Extracts showed antimicrobial, anti-adhesive and synergistic properties against a variety of relevant human pathogens, including the producing strains. In addition to the biotechnological potential, biosurfactants produced by Staph. haemolyticus are potentially undescribed virulence determinants in their producing strains. © 2016 The Society for Applied Microbiology.
Synthetic prions with novel strain-specified properties.
Moda, Fabio; Le, Thanh-Nhat T; Aulić, Suzana; Bistaffa, Edoardo; Campagnani, Ilaria; Virgilio, Tommaso; Indaco, Antonio; Palamara, Luisa; Andréoletti, Olivier; Tagliavini, Fabrizio; Legname, Giuseppe
2015-12-01
Prions are infectious proteins that possess multiple self-propagating structures. The information for strains and structural specific barriers appears to be contained exclusively in the folding of the pathological isoform, PrP(Sc). Many recent studies determined that de novo prion strains could be generated in vitro from the structural conversion of recombinant (rec) prion protein (PrP) into amyloidal structures. Our aim was to elucidate the conformational diversity of pathological recPrP amyloids and their biological activities, as well as to gain novel insights in characterizing molecular events involved in mammalian prion conversion and propagation. To this end we generated infectious materials that possess different conformational structures. Our methodology for the prion conversion of recPrP required only purified rec full-length mouse (Mo) PrP and common chemicals. Neither infected brain extracts nor amplified PrP(Sc) were used. Following two different in vitro protocols recMoPrP converted to amyloid fibrils without any seeding factor. Mouse hypothalamic GT1 and neuroblastoma N2a cell lines were infected with these amyloid preparations as fast screening methodology to characterize the infectious materials. Remarkably, a large number of amyloid preparations were able to induce the conformational change of endogenous PrPC to harbor several distinctive proteinase-resistant PrP forms. One such preparation was characterized in vivo habouring a synthetic prion with novel strain specified neuropathological and biochemical properties.
Aβ seeds and prions: How close the fit?
Rasmussen, Jay; Jucker, Mathias; Walker, Lary C
2017-07-04
The prion paradigm is increasingly invoked to explain the molecular pathogenesis of neurodegenerative diseases involving the misfolding and aggregation of proteins other than the prion protein (PrP). Extensive evidence from in vitro and in vivo studies indicates that misfolded and aggregated Aβ peptide, which is the probable molecular trigger for Alzheimer's disease, manifests all of the key characteristics of canonical mammalian prions. These features include a β-sheet rich architecture, tendency to polymerize into amyloid, templated corruption of like protein molecules, ability to form structurally and functionally variant strains, systematic spread by neuronal transport, and resistance to inactivation by heat and formaldehyde. In addition to Aβ, a growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases. As such, the expanded prion paradigm could conceptually unify fundamental and translational investigations of these disorders.
Directory of Open Access Journals (Sweden)
Lisa eGasperini
2014-08-01
Full Text Available The cellular prion protein (PrPC has been widely investigated ever since its conformational isoform, the prion (or PrPSc, was identified as the etiological agent of prion disorders. The high homology shared by the PrPC-encoding gene among mammals, its high turnover rate and expression in every tissue strongly suggest that PrPC may possess key physiological functions. Therefore, defining PrPC roles, properties and fate in the physiology of mammalian cells would be fundamental to understand its pathological involvement in prion diseases. Since the incidence of these neurodegenerative disorders is enhanced in aging, understanding PrPC functions in this life phase may be of crucial importance. Indeed, a large body of evidence suggests that PrPC plays a neuroprotective and antioxidant role. Moreover, it has been suggested that PrPC is involved in Alzheimer disease, another neurodegenerative pathology that develops predominantly in the aging population. In prion diseases, PrPC function is likely lost upon protein aggregation occurring in the course of the disease. Additionally, the aging process may alter PrPC biochemical properties, thus influencing its propensity to convert into PrPSc. Both phenomena may contribute to the disease development and progression. In Alzheimer disease, PrPC has a controversial role because its presence seems to mediate β-amyloid toxicity, while its down-regulation correlates with neuronal death. The role of PrPC in aging has been investigated from different perspectives, often leading to contrasting results. The putative protein functions in aging have been studied in relation to memory, behavior and myelin maintenance. In aging mice, PrPC changes in subcellular localization and post-translational modifications have been explored in an attempt to relate them to different protein roles and propensity to convert into PrPSc. Here we provide an overview of the most relevant studies attempting to delineate PrPC functions and
Ma, Shilin; Chen, Fen; Ye, Xiaohui; Dong, Yingjie; Xue, Yingna; Xu, Heming; Zhang, Wenji; Song, Shuangshuang; Ai, Li; Zhang, Naixian; Pan, Weisan
2013-01-01
The purpose of this study was to develop a docetaxel microemulsion containing an anti-tumor synergistic ingredient (Brucea javanica oil) and to investigate the characteristics of the microemulsion. Brucea javanica oil contains oleic acid and linoleic acids that have been shown by animal and human studies to inhibit tumor formation. The microemulsion containing Brucea javanica oil, medium-chain triglyceride, soybean lecithin, Solutol®HS 15, PEG 400, and water was developed for docetaxel intravenous administration. A formulation with higher drug content, lower viscosity, and smaller particle size was developed. The droplet size distribution of the dispersed phase of the optimized microemulsion was 13.5 nm, determined using a dynamic light scattering technique. The small droplet size enabled the microemulsion droplets to escape from uptake and phagocytosis by the reticuloendothelial system and increased the circulation time of the drug. The zeta potential was -41.3 mV. The optimized microemulsion was pale yellow, transparent, and non-opalescent in appearance. The value of the combination index was 0.58, showing that there was a synergistic effect when docetaxel was combined with Brucea javanica oil. After a single intravenous infusion dose (10 mg/kg) in male Sprague Dawley rats, the area under the curve of the microemulsion was higher and the half-time was longer compared with that of docetaxel solution alone, and showed superior pharmacokinetic characteristics. These results indicate that this preparation of docetaxel in emulsion is likely to provide an excellent prospect for clinical tumor treatment.
Kim, Eun Young; Rajasekaran, Ganesan; Shin, Song Yub
2017-08-18
KR-12-a5 is a 12-meric α-helical antimicrobial peptide (AMP) with dual antimicrobial and anti-inflammatory activities designed from human cathelicidin LL-37. We designed and synthesized a series of d-amino acid-substituted analogs of KR-12-a5 with the aim of developing novel α-helical AMPs that possess higher cell selectivity than KR-12-a5, while maintaining the anti-inflammatory activity. d-amino acid incorporation into KR-12-a5 induced a significant improvement in the cell selectivity by 2.6- to 13.6-fold as compared to KR-12-a5, while maintaining the anti-inflammatory activity. Among the three analogs, KR-12-a5 (6- D L) with d-amino acid in the polar-nonpolar interface (Leu 6 ) showed the highest cell selectivity (therapeutic index: 61.2). Similar to LL-37, KR-12-a5 and its analogs significantly inhibited the expression and secretion of NO, TNF-α, IL-6 and MCP-1 from LPS-stimulated RAW264.7 cells. KR-12-a5 and its analogs showed a more potent antimicrobial activity against antibiotic-resistant bacteria, including clinically isolated MRSA, MDRPA, and VREF than LL-37 and melittin. Furthermore, compared to LL-37, KR-12-a5 and its analogs showed greater synergistic effects with conventional antibiotics, such as chloramphenicol, ciprofloxacin, and oxacillin against MDRPA; KR-12-a5 and its analogs had a FICI range between 0.25 and 0.5, and LL-37 had a range between 0.75 and 1.5. KR-12-a5 and its analogs were found to be more effective anti-biofilm agents against MDRPA than LL-37. In addition, KR-12-a5 and its analogs maintained antimicrobial activity in physiological salts and human serum. SYTOX Green uptake and membrane depolarization studies revealed that KR-12-a5 and its analogs kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Taken together, our results suggest that KR-12-a5 and its analogs can be developed further as novel antimicrobial/anti-inflammatory agents to treat antibiotic-resistant infections. Copyright
A prolonged chronological lifespan is an unexpected benefit of the [PSI+] prion in yeast.
Wang, Kai; Melki, Ronald; Kabani, Mehdi
2017-01-01
Self-replicating 'proteinaceous infectious particles' or prions are responsible for complex heritable traits in the yeast Saccharomyces cerevisiae. Our current understanding of the biology of yeast prions stems from studies mostly done in the context of actively dividing cells in optimal laboratory growth conditions. Evidence suggest that fungal prions exist in the wild where most cells are in a non-dividing quiescent state, because of imperfect growth conditions, scarcity of nutrients and competition. We know little about the faithful transmission of yeast prions in such conditions and their physiological consequences throughout the lifespan of yeast cells. We addressed this issue for the [PSI+] prion that results from the self-assembly of the translation release factor Sup35p into insoluble fibrillar aggregates. [PSI+] leads to increased nonsense suppression and confers phenotypic plasticity in response to environmental fluctuations. Here, we report that while [PSI+] had little to no effect on growth per se, it dramatically improved the survival of yeast cells in stationary phase. Remarkably, prolonged chronological lifespan persisted even after [PSI+] was cured from the cells, suggesting that prions may facilitate the acquisition of complex new traits. Such an important selective advantage may contribute to the evolutionary conservation of the prion-forming ability of Sup35p orthologues in distantly related yeast species.
Strain-dependent profile of misfolded prion protein aggregates.
Morales, Rodrigo; Hu, Ping Ping; Duran-Aniotz, Claudia; Moda, Fabio; Diaz-Espinoza, Rodrigo; Chen, Baian; Bravo-Alegria, Javiera; Makarava, Natallia; Baskakov, Ilia V; Soto, Claudio
2016-02-15
Prions are composed of the misfolded prion protein (PrP(Sc)) organized in a variety of aggregates. An important question in the prion field has been to determine the identity of functional PrP(Sc) aggregates. In this study, we used equilibrium sedimentation in sucrose density gradients to separate PrP(Sc) aggregates from three hamster prion strains (Hyper, Drowsy, SSLOW) subjected to minimal manipulations. We show that PrP(Sc) aggregates distribute in a wide range of arrangements and the relative proportion of each species depends on the prion strain. We observed a direct correlation between the density of the predominant PrP(Sc) aggregates and the incubation periods for the strains studied. The relative presence of PrP(Sc) in fractions of different sucrose densities was indicative of the protein deposits present in the brain as analyzed by histology. Interestingly, no association was found between sensitivity to proteolytic degradation and aggregation profiles. Therefore, the organization of PrP molecules in terms of the density of aggregates generated may determine some of the particular strain properties, whereas others are independent from it. Our findings may contribute to understand the mechanisms of strain variation and the role of PrP(Sc) aggregates in prion-induced neurodegeneration.
Advancing prion science: guidance for the National Prion Research Program
National Research Council Canada - National Science Library
Erdtmann, Rick; Sivitz, Laura
2004-01-01
In Advancing Prion Science , the Institute of Medicine’s Committee on Transmissible Spongiform Encephalopathies Assessment of Relevant Science recommends priorities for research and investment to the Department of Defenseâ...
Prion Infectivity in Fat of Deer with Chronic Wasting Disease▿
Race, Brent; Meade-White, Kimberly; Race, Richard; Chesebro, Bruce
2009-01-01
Chronic wasting disease (CWD) is a neurodegenerative prion disease of cervids. Some animal prion diseases, such as bovine spongiform encephalopathy, can infect humans; however, human susceptibility to CWD is unknown. In ruminants, prion infectivity is found in central nervous system and lymphoid tissues, with smaller amounts in intestine and muscle. In mice, prion infectivity was recently detected in fat. Since ruminant fat is consumed by humans and fed to animals, we determined infectivity t...
Protein Misfolding Cyclic Amplification of Infectious Prions.
Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies, or prion diseases, are a group of incurable disorders caused by the accumulation of an abnormally folded prion protein (PrP Sc ) in the brain. According to the "protein-only" hypothesis, PrP Sc is the infectious agent able to propagate the disease by acting as a template for the conversion of the correctly folded prion protein (PrP C ) into the pathological isoform. Recently, the mechanism of PrP C conversion has been mimicked in vitro using an innovative technique named protein misfolding cyclic amplification (PMCA). This technology represents a great tool for studying diverse aspects of prion biology in the field of basic research and diagnosis. Moreover, PMCA can be expanded for the study of the misfolding process associated to other neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and frontotemporal lobar degeneration. © 2017 Elsevier Inc. All rights reserved.
Pathways of Prion Spread during Early Chronic Wasting Disease in Deer.
Hoover, Clare E; Davenport, Kristen A; Henderson, Davin M; Denkers, Nathaniel D; Mathiason, Candace K; Soto, Claudio; Zabel, Mark D; Hoover, Edward A
2017-05-15
Among prion infections, two scenarios of prion spread are generally observed: (i) early lymphoid tissue replication or (ii) direct neuroinvasion without substantial antecedent lymphoid amplification. In nature, cervids are infected with chronic wasting disease (CWD) prions by oral and nasal mucosal exposure, and studies of early CWD pathogenesis have implicated pharyngeal lymphoid tissue as the earliest sites of prion accumulation. However, knowledge of chronological events in prion spread during early infection remains incomplete. To investigate this knowledge gap in early CWD pathogenesis, we exposed white-tailed deer to CWD prions by mucosal routes and performed serial necropsies to assess PrP CWD tissue distribution by real-time quaking-induced conversion (RT-QuIC) and tyramide signal amplification immunohistochemistry (TSA-IHC). Although PrP CWD was not detected by either method in the initial days (1 and 3) postexposure, we observed PrP CWD seeding activity and follicular immunoreactivity in oropharyngeal lymphoid tissues at 1 and 2 months postexposure (MPE). At 3 MPE, PrP CWD replication had expanded to all systemic lymphoid tissues. By 4 MPE, the PrP CWD burden in all lymphoid tissues had increased and approached levels observed in terminal disease, yet there was no evidence of nervous system invasion. These results indicate the first site of CWD prion entry is in the oropharynx, and the initial phase of prion amplification occurs in the oropharyngeal lymphoid tissues followed by rapid dissemination to systemic lymphoid tissues. This lymphoid replication phase appears to precede neuroinvasion. IMPORTANCE Chronic wasting disease (CWD) is a universally fatal transmissible spongiform encephalopathy affecting cervids, and natural infection occurs through oral and nasal mucosal exposure to infectious prions. Terminal disease is characterized by PrP CWD accumulation in the brain and lymphoid tissues of affected animals. However, the initial sites of prion
Comparative analysis of the prion protein gene sequences in African lion.
Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming
2006-10-01
The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.
Cytosolic PrP Can Participate in Prion-Mediated Toxicity
Thackray, Alana M.; Zhang, Chang; Arndt, Tina
2014-01-01
ABSTRACT Prion diseases are characterized by a conformational change in the normal host protein PrPC. While the majority of mature PrPC is tethered to the plasma membrane by a glycosylphosphatidylinositol anchor, topological variants of this protein can arise during its biosynthesis. Here we have generated Drosophila transgenic for cytosolic ovine PrP in order to investigate its toxic potential in flies in the absence or presence of exogenous ovine prions. While cytosolic ovine PrP expressed in Drosophila was predominantly detergent insoluble and showed resistance to low concentrations of proteinase K, it was not overtly detrimental to the flies. However, Drosophila transgenic for cytosolic PrP expression exposed to classical or atypical scrapie prion inocula showed a faster decrease in locomotor activity than similar flies exposed to scrapie-free material. The susceptibility to classical scrapie inocula could be assessed in Drosophila transgenic for panneuronal expression of cytosolic PrP, whereas susceptibility to atypical scrapie required ubiquitous PrP expression. Significantly, the toxic phenotype induced by ovine scrapie in cytosolic PrP transgenic Drosophila was transmissible to recipient PrP transgenic flies. These data show that while cytosolic PrP expression does not adversely affect Drosophila, this topological PrP variant can participate in the generation of transmissible scrapie-induced toxicity. These observations also show that PrP transgenic Drosophila are susceptible to classical and atypical scrapie prion strains and highlight the utility of this invertebrate host as a model of mammalian prion disease. IMPORTANCE During prion diseases, the host protein PrPC converts into an abnormal conformer, PrPSc, a process coupled to the generation of transmissible prions and neurotoxicity. While PrPC is principally a glycosylphosphatidylinositol-anchored membrane protein, the role of topological variants, such as cytosolic PrP, in prion-mediated toxicity and
Prion protein self-interaction in prion disease therapy approaches
Rigter, A.; Priem, J.; Langeveld, J.P.M.; Bossers, A.
2011-01-01
Transmissible spongiform encephalopathies (TSEs) or prion diseases are unique disorders that are not caused by infectious micro-organisms (bacteria or fungi), viruses or parasites, but rather seem to be the result of an infectious protein. TSEs are comprised of fatal neurodegenerative disorders
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-04-02
The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-01-01
The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089
The ribosome-associated complex antagonizes prion formation in yeast.
Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M
2015-01-01
The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.
Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.
Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane
2017-10-06
Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Glycoform-Selective Prion Formation in Sporadic and Familial Forms of Prion Disease
Xiao, Xiangzhu; Yuan, Jue; Haïk, Stéphane; Cali, Ignazio; Zhan, Yian; Moudjou, Mohammed; Li, Baiya; Laplanche, Jean-Louis; Laude, Hubert; Langeveld, Jan; Gambetti, Pierluigi; Kitamoto, Tetsuyuki; Kong, Qingzhong; Brandel, Jean-Philippe; Cobb, Brian A.; Petersen, Robert B.; Zou, Wen-Quan
2013-01-01
The four glycoforms of the cellular prion protein (PrPC) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrPSc) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrPSc in the recently identified variably protease-sensitive prionopathy (VPSPr) is the absence of a diglycosylated form, also notable in familial Creutzfeldt-Jakob disease (fCJD), which is linked to mutations in PrP either from Val to Ile at residue 180 (fCJDV180I) or from Thr to Ala at residue 183 (fCJDT183A). Here we report that fCJDV180I, but not fCJDT183A, exhibits a proteinase K (PK)-resistant PrP (PrPres) that is markedly similar to that observed in VPSPr, which exhibits a five-step ladder-like electrophoretic profile, a molecular hallmark of VPSPr. Remarkably, the absence of the diglycosylated PrPres species in both fCJDV180I and VPSPr is likewise attributable to the absence of PrPres glycosylated at the first N-linked glycosylation site at residue 181, as in fCJDT183A. In contrast to fCJDT183A, both VPSPr and fCJDV180I exhibit glycosylation at residue 181 on di- and monoglycosylated (mono181) PrP prior to PK-treatment. Furthermore, PrPV180I with a typical glycoform profile from cultured cells generates detectable PrPres that also contains the diglycosylated PrP in addition to mono- and unglycosylated forms upon PK-treatment. Taken together, our current in vivo and in vitro studies indicate that sporadic VPSPr and familial CJDV180I share a unique glycoform-selective prion formation pathway in which the conversion of diglycosylated and mono181 PrPC to PrPSc is inhibited, probably by a dominant-negative effect, or by other co-factors. PMID:23527023
International Nuclear Information System (INIS)
Yang Chiming
2003-01-01
Owing to the high oxygen-respiration in the brain of mammals, oxidative damage to prion protein has been suggested to be an additional factor. A large body of intriguing features of scrapie and prion diseases have provided multiple lines of indirect chemistry evidence, suggesting that the infectious agents may be putative forms of sequence-specific prion radicals (SSPR) and/or their immediate precursors in the transmissible spongiform encephalopathies (TSE). Here a molecular mechanism corresponding to the self-replication of scrapie protein mediated by prion free-radical processes, consonant with 'protein-only' hypotheses is proposed. This new theory may not only aid our understanding of the occurrence of prions, but also provides new insight into the possible chemistry principles underlying the neutrodegenerative disorders. It is anticipated that future studies based on this suggestion and chemistry principles of genetic diseases may allow us to determine an effective approach to stop mad cow disease and its human version, new variant of Creutzfeldt-Jakob disease (v CJD)
Race, Brent; Meade-White, Kimberly; Race, Richard; Baumann, Frank; Aguzzi, Adriano; Chesebro, Bruce
2009-01-01
Prion protein (PrP) is a host-encoded membrane-anchored glycoprotein which is required for susceptibility to prion disease. PrP may also be important for normal brain functions such as hippocampal spatial memory. Previously transgenic mice expressing amino terminally truncated mouse PrP (Δ32–134) spontaneously developed a fatal disease associated with degeneration of cerebellar granular neurons as well as vacuolar degeneration of deep cerebellar and brain stem white matter. This disease could...
A prolonged chronological lifespan is an unexpected benefit of the [PSI+] prion in yeast.
Directory of Open Access Journals (Sweden)
Kai Wang
Full Text Available Self-replicating 'proteinaceous infectious particles' or prions are responsible for complex heritable traits in the yeast Saccharomyces cerevisiae. Our current understanding of the biology of yeast prions stems from studies mostly done in the context of actively dividing cells in optimal laboratory growth conditions. Evidence suggest that fungal prions exist in the wild where most cells are in a non-dividing quiescent state, because of imperfect growth conditions, scarcity of nutrients and competition. We know little about the faithful transmission of yeast prions in such conditions and their physiological consequences throughout the lifespan of yeast cells. We addressed this issue for the [PSI+] prion that results from the self-assembly of the translation release factor Sup35p into insoluble fibrillar aggregates. [PSI+] leads to increased nonsense suppression and confers phenotypic plasticity in response to environmental fluctuations. Here, we report that while [PSI+] had little to no effect on growth per se, it dramatically improved the survival of yeast cells in stationary phase. Remarkably, prolonged chronological lifespan persisted even after [PSI+] was cured from the cells, suggesting that prions may facilitate the acquisition of complex new traits. Such an important selective advantage may contribute to the evolutionary conservation of the prion-forming ability of Sup35p orthologues in distantly related yeast species.
The expanding universe of prion diseases.
Watts, Joel C; Balachandran, Aru; Westaway, David
2006-03-01
Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C). Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE) the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD) and sporadic fatal insomnia (sFI), bovine amyloidotic spongiform encephalopathy (BASE), and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD) of North American deer (Odocoileus Specis) and Rocky Mountain elk (Cervus elaphus nelsoni) is undergoing a dramatic spread across North America. While amplification (BSE) and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk) can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.
Yuan, Qi; Eckland, Thomas; Telling, Glenn; Bartz, Jason; Bartelt-Hunt, Shannon
2015-01-01
Prions enter the environment from infected hosts, bind to a wide range of soil and soil minerals, and remain highly infectious. Environmental sources of prions almost certainly contribute to the transmission of chronic wasting disease in cervids and scrapie in sheep and goats. While much is known about the introduction of prions into the environment and their interaction with soil, relatively little is known about prion degradation and inactivation by natural environmental processes. In this study, we examined the effect of repeated cycles of drying and wetting on prion fitness and determined that 10 cycles of repeated drying and wetting could reduce PrPSc abundance, PMCA amplification efficiency and extend the incubation period of disease. Importantly, prions bound to soil were more susceptible to inactivation by repeated cycles of drying and wetting compared to unbound prions, a result which may be due to conformational changes in soil-bound PrPSc or consolidation of the bonding between PrPSc and soil. This novel finding demonstrates that naturally-occurring environmental process can degrade prions. PMID:25665187
Synergistic effect of Ebselen and gamma radiation on breast cancer cells.
Thabet, Noura M; Moustafa, Enas M
2017-08-01
To explore the synergistic effect of a seleno-organic compound Ebselen (Ebs) and/or γ-radiation to exert antitumor effects on human breast cancer (MCF-7) cell line in vitro. Ebs cytotoxicity at various concentrations (10, 25, 50 and 75 μg), cell proliferation and clonogenic assay of Ebs and/or γ-radiation (at 1, 3 and 6 Gy), expression of p-IκBα and NF-κB, inflammatory cytokines levels (TNF-α, IL-2, INF-γ, IL-10 and TGF-β), apoptotic factors (Caspase-3, Granzyme-B and TRAIL) and angiogenic factor (VEGF) were investigated. The results showed that the effective dosage of this combination was observed at 25 μg/ml of Ebs with γ-radiation at 6 Gy. Data displayed a significant reduction in NF-κB mRNA along with an elevation in granzyme-B mRNA and TRAIL mRNA expression. Furthermore, protein expression of caspase-3 was elevated, whereas p-IκBα and p-NF-κB(p65) protein expression was reduced significantly. Also, a significant decline in TNF-α, IL-2, INF-γ, TGF-β with a significant increase in IL-10 levels were revealed. Meanwhile, a significant decrease in VEGF level and proliferation capacity were observed. We conclude that a combination of Ebs with radiotherapy has a major antitumor efficiency in inducing apoptosis and inhibiting cancer cell progression, due to the synergistic effect in regulating gene and protein expression, and in a modulating response of pro-and anti-inflammatory cytokines.
Co-delivery of chemotherapeutics and proteins for synergistic therapy.
He, Chaoliang; Tang, Zhaohui; Tian, Huayu; Chen, Xuesi
2016-03-01
Combination therapy with chemotherapeutics and protein therapeutics, typically cytokines and antibodies, has been a type of crucial approaches for synergistic cancer treatment. However, conventional approaches by simultaneous administration of free chemotherapeutic drugs and proteins lead to limitations for further optimizing the synergistic effects, due to the distinct in vivo pharmacokinetics and distribution of small drugs and proteins, insufficient tumor selectivity and tumor accumulation, unpredictable drug/protein ratios at tumor sites, short half-lives, and serious systemic adverse effects. Consequently, to obtain optimal synergistic anti-tumor efficacy, considerable efforts have been devoted to develop the co-delivery systems for co-incorporating chemotherapeutics and proteins into a single carrier system and subsequently releasing the dual or multiple payloads at desired target sites in a more controllable manner. The co-delivery systems result in markedly enhanced blood stability and in vivo half-lives of the small drugs and proteins, elevated tumor accumulation, as well as the capability of delivering the multiple agents to the same target sites with rational drug/protein ratios, which may facilitate maximizing the synergistic effects and therefore lead to optimal antitumor efficacy. This review emphasizes the recent advances in the co-delivery systems for chemotherapeutics and proteins, typically cytokines and antibodies, for systemic or localized synergistic cancer treatment. Moreover, the proposed mechanisms responsible for the synergy of chemotherapeutic drugs and proteins are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.
Prions and animal transmissible spongiform encephalopathies
Directory of Open Access Journals (Sweden)
Juntes Polona
2017-01-01
Full Text Available Background. Transmissible spongiform encephalopathies (TSEs or prion diseases are a unique group of neurodegenerative diseases of animals and humans, which always have a fatal outcome and are transmissible among animals of the same or different species. Scope and Approach. The aim of this work is to review some recent data about animal TSEs, with the emphasis on their causative agents and zoonotic potential, and to discuss why the surveillance and control measures over animal TSEs should remain in force. Key Findings and Conclusions. We still have incomplete knowledge of prions and prion diseases. Scrapie has been present for a very long time and controlled with varied success. Bovine spongiform encephalopathy (BSE emerged unnoticed, and spread within a few years to epidemic proportions, entailing enormous economic consequences and public concerns. Currently, the classical BSE epidemic is under control, but atypical cases do, and probably will, persist in bovine populations. The Chronic Wasting Disease (CWD of the cervids has been spreading in North America and has recently been detected in Europe. Preventive measures for the control of classical BSE remain in force, including the feed ban and removal of specified risk materials. However, active BSE surveillance has considerably decreased. In the absence of such preventive and control measures, atypical BSE cases in healthy slaughtered bovines might persist in the human food chain, and BSE prions might resurface. Moreover, other prion strains might emerge and spread undetected if the appropriate preventive and surveillance measures were to cease, leaving behind inestimable consequences.
Zhang, Xiu-Zhen; Wang, Ling; Liu, Dong-Wu; Tang, Guang-Yan; Zhang, Hong-Yu
2014-09-01
This study aims at evaluating the anticancer effects of berberine hydrochloride (berberine) and d-limonene, alone and in combination, on human gastric carcinoma cell line MGC803 to determine whether berberine and d-limonene work synergistically and elucidate their mechanisms. MGC803 cells were treated with berberine and d-limonene, alone and in combination, for 24-48 h. The inhibitory effects of these drugs on growth were determined by MTT assay. The combination index and drug reduction index were calculated with the Chou-Talalay method based on the median-effect principle. Flow cytometry and laser scanning confocal microscopy were employed to evaluate the effects of both drugs on cell-cycle perturbation and apoptosis, generation of reactive oxygen species (ROS), mitochondrial membrane potential, and expression of Bcl-2 and caspase-3 in MGC803 cells. Berberine or d-limonene alone can inhibit the growth of MGC803 cells in a dose- and time-dependent manner. Berberine and d-limonene at a combination ratio of 1:4 exhibited a synergistic effect on anti-MGC803 cells. The two drugs distinctly induced intracellular ROS generation, reduced the mitochondrial transmembrane potential (ΔΨm), enhanced the expression of caspase-3, and decreased the expression of Bcl-2. The combination of berberine and d-limonene showed more remarkable effects compared with drugs used singly in MGC803 cells. The combination of berberine and d-limonene exerted synergistic anticancer effects on MGC803 cells by cell-cycle arrest, ROS production, and apoptosis induction through the mitochondria-mediated intrinsic pathway.
Ferrucci, M; Ryskalin, L; Biagioni, F; Gambardella, S; Busceti, C L; Falleni, A; Lazzeri, G; Fornai, F
2017-07-01
The cellular prion protein (PrPc) is physiologically expressed within selective brain areas of mammals. Alterations in the secondary structure of this protein lead to scrapie-like prion protein (PrPsc), which precipitates in the cell. PrPsc has been detected in infectious, inherited or sporadic neurodegenerative disorders. Prion protein metabolism is dependent on autophagy and ubiquitin proteasome. Despite not being fully elucidated, the physiological role of prion protein relates to chaperones which rescue cells under stressful conditions.Methamphetamine (METH) is a widely abused drug which produces oxidative stress in various brain areas causing mitochondrial alterations and protein misfolding. These effects produce a compensatory increase of chaperones while clogging cell clearing pathways. In the present study, we explored whether METH administration modifies the amount of PrPc. Since high levels of PrPc when the clearing systems are clogged may lead to its misfolding into PrPsc, we further tested whether METH exposure triggers the appearance of PrPsc. We analysed the effects of METH and dopamine administration in PC12 and striatal cells by using SDS-PAGE Coomassie blue, immune- histochemistry and immune-gold electron microscopy. To analyze whether METH administration produces PrPsc aggregates we used antibodies directed against PrP following exposure to proteinase K or sarkosyl which digest folded PrPc but misfolded PrPsc. We fond that METH triggers PrPsc aggregates in DA-containing cells while METH is not effective in primary striatal neurons which do not produce DA. In the latter cells exogenous DA is needed to trigger PrPsc accumulation similarly to what happens in DA containing cells under the effects of METH. The present findings, while fostering novel molecular mechanisms involving prion proteins, indicate that, cell pathology similar to prion disorders can be mimicked via a DA-dependent mechanism by a drug of abuse.
Infectious prion diseases in humans: cannibalism, iatrogenicity and zoonoses.
Haïk, Stéphane; Brandel, Jean-Philippe
2014-08-01
In contrast with other neurodegenerative disorders associated to protein misfolding, human prion diseases include infectious forms (also called transmitted forms) such as kuru, iatrogenic Creutzfeldt-Jakob disease and variant Creutzfeldt-Jakob disease. The transmissible agent is thought to be solely composed of the abnormal isoform (PrP(Sc)) of the host-encoded prion protein that accumulated in the central nervous system of affected individuals. Compared to its normal counterpart, PrP(Sc) is β-sheet enriched and aggregated and its propagation is based on an autocatalytic conversion process. Increasing evidence supports the view that conformational variations of PrP(Sc) encoded the biological properties of the various prion strains that have been isolated by transmission studies in experimental models. Infectious forms of human prion diseases played a pivotal role in the emergence of the prion concept and in the characterization of the very unconventional properties of prions. They provide a unique model to understand how prion strains are selected and propagate in humans. Here, we review and discuss how genetic factors interplay with strain properties and route of transmission to influence disease susceptibility, incubation period and phenotypic expression in the light of the kuru epidemics due to ritual endocannibalism, the various series iatrogenic diseases secondary to extractive growth hormone treatment or dura mater graft and the epidemics of variant Creutzfeldt-Jakob disease linked to dietary exposure to the agent of bovine spongiform encephalopathy. Copyright © 2014 Elsevier B.V. All rights reserved.
Drori, Ariel; Shabat, Yehudit; Ben Ya'acov, Ami; Danay, Ofer; Levanon, Dan; Zolotarov, Lidya; Ilan, Yaron
2016-04-01
Vitamin D has been known for its anti-inflammatory properties. Extracts derived from Lentinula edodes (Shiitake) edible mushroom exert an anti-inflammatory effect. These extracts contain high levels of ergosterol, which converts into ergocalciferol (vitamin D2) following exposure to ultraviolet light, followed by absorption and hydroxylation into the active form 25-hydroxyvitamin D [25(OH)D]. To determine the anti-inflammatory effect of overexpression of vitamin D in edible mushrooms, L. edodes mushrooms were exposed to ultraviolet-B light, freeze-dried, followed by measurement of vitamin D2 contents, in their dry weight. C57B1/6 mice were orally treated with vitamin D2-enriched or nonenriched mushroom extract prior and during concanavalin A-immune-mediated liver injury. Exposure to ultraviolet light increased vitamin D2 content in Shiitake edible mushrooms. Following feeding of vitamin D-enriched mushroom extracts to mice with immune-mediated hepatitis, a significant decrease in liver damage was noted. This was shown by a decrease in alanine aminotransferase and aspartate aminotransferase serum levels, a decrease in proportion of mice with severe liver injury, and by improvement in liver histology. These effects were associated with a decrease in serum interferon gamma levels. A synergistic effect was noted between the anti-inflammatory effect of the mushroom extracts and that of vitamin D. Oral administration of vitamin D-enriched L. edodes edible mushroom exerts a synergistic anti-inflammatory effect in the immune-mediated hepatitis. The data support its potential use as safe immunomodulatory adjuvant for the treatment of HCV and nonalcoholic steatohepatitis.
Moreno, Julie A.; Telling, Glenn C.
2018-01-01
Prions represent a new paradigm of protein-mediated information transfer. In the case of mammals, prions are the cause of fatal, transmissible neurodegenerative diseases, sometimes referred to as transmissible spongiform encephalopathies (TSE’s), which frequently occur as epidemics. An increasing body of evidence indicates that the canonical mechanism of conformational corruption of cellular prion protein (PrPC) by the pathogenic isoform (PrPSc) that is the basis of prion formation in TSE’s, is common to a spectrum of proteins associated with various additional human neurodegenerative disorders, including the more common Alzheimer’s and Parkinson’s diseases. The peerless infectious properties of TSE prions, and the unparalleled tools for their study, therefore enable elucidation of mechanisms of template-mediated conformational propagation that are generally applicable to these related disease states. Many unresolved issues remain including the exact molecular nature of the prion, the detailed cellular and molecular mechanisms of prion propagation, and the means by which prion diseases can be both genetic and infectious. In addition, we know little about the mechanism by which neurons degenerate during prion diseases. Tied to this, the physiological role of the normal form of the prion protein remains unclear and it is uncertain whether or not loss of this function contributes to prion pathogenesis. The factors governing the transmission of prions between species remain unclear, in particular the means by which prion strains and PrP primary structure interact to affect inter-species prion transmission. Despite all these unknowns, advances in our understanding of prions have occurred because of their transmissibility to experimental animals and the development of transgenic (Tg) mouse models has done much to further our understanding about various aspects of prion biology. In this review we will focus on advances in our understanding of prion biology that
Praziquantel synergistically enhances paclitaxel efficacy to inhibit cancer cell growth.
Directory of Open Access Journals (Sweden)
Zhen Hua Wu
Full Text Available The major challenges we are facing in cancer therapy with paclitaxel (PTX are the drug resistance and severe side effects. Massive efforts have been made to overcome these clinical challenges by combining PTX with other drugs. In this study, we reported the first preclinical data that praziquantel (PZQ, an anti-parasite agent, could greatly enhance the anticancer efficacy of PTX in various cancer cell lines, including PTX-resistant cell lines. Based on the combination index value, we demonstrated that PZQ synergistically enhanced PTX-induced cell growth inhibition. The co-treatment of PZQ and PTX also induced significant mitotic arrest and activated the apoptotic cascade. Moreover, PZQ combined with PTX resulted in a more pronounced inhibition of tumor growth compared with either drug alone in a mouse xenograft model. We tried to investigate the possible mechanisms of this synergistic efficacy induced by PZQ and PTX, and we found that the co-treatment of the two drugs could markedly decrease expression of X-linked inhibitor of apoptosis protein (XIAP, an anti-apoptotic protein. Our data further demonstrated that down-regulation of XIAP was required for the synergistic interaction between PZQ and PTX. Together, this study suggested that the combination of PZQ and PTX may represent a novel and effective anticancer strategy for optimizing PTX therapy.
How do PrPSc Prions Spread between Host Species, and within Hosts?
Directory of Open Access Journals (Sweden)
Neil A. Mabbott
2017-11-01
Full Text Available Prion diseases are sub-acute neurodegenerative diseases that affect humans and some domestic and free-ranging animals. Infectious prion agents are considered to comprise solely of abnormally folded isoforms of the cellular prion protein known as PrPSc. Pathology during prion disease is restricted to the central nervous system where it causes extensive neurodegeneration and ultimately leads to the death of the host. The first half of this review provides a thorough account of our understanding of the various ways in which PrPSc prions may spread between individuals within a population, both horizontally and vertically. Many natural prion diseases are acquired peripherally, such as by oral exposure, lesions to skin or mucous membranes, and possibly also via the nasal cavity. Following peripheral exposure, some prions accumulate to high levels within the secondary lymphoid organs as they make their journey from the site of infection to the brain, a process termed neuroinvasion. The replication of PrPSc prions within secondary lymphoid organs is important for their efficient spread to the brain. The second half of this review describes the key tissues, cells and molecules which are involved in the propagation of PrPSc prions from peripheral sites of exposure (such as the lumen of the intestine to the brain. This section also considers how additional factors such as inflammation and aging might influence prion disease susceptibility.
Ma, Shilin; Chen, Fen; Ye, Xiaohui; Dong, Yingjie; Xue, Yingna; Xu, Heming; Zhang, Wenji; Song, Shuangshuang; Ai, Li; Zhang, Naixian; Pan, Weisan
2013-01-01
The purpose of this study was to develop a docetaxel microemulsion containing an anti-tumor synergistic ingredient (Brucea javanica oil) and to investigate the characteristics of the microemulsion. Brucea javanica oil contains oleic acid and linoleic acids that have been shown by animal and human studies to inhibit tumor formation. The microemulsion containing Brucea javanica oil, medium-chain triglyceride, soybean lecithin, Solutol®HS 15, PEG 400, and water was developed for docetaxel intravenous administration. A formulation with higher drug content, lower viscosity, and smaller particle size was developed. The droplet size distribution of the dispersed phase of the optimized microemulsion was 13.5 nm, determined using a dynamic light scattering technique. The small droplet size enabled the microemulsion droplets to escape from uptake and phagocytosis by the reticuloendothelial system and increased the circulation time of the drug. The zeta potential was −41.3 mV. The optimized microemulsion was pale yellow, transparent, and non-opalescent in appearance. The value of the combination index was 0.58, showing that there was a synergistic effect when docetaxel was combined with Brucea javanica oil. After a single intravenous infusion dose (10 mg/kg) in male Sprague Dawley rats, the area under the curve of the microemulsion was higher and the half-time was longer compared with that of docetaxel solution alone, and showed superior pharmacokinetic characteristics. These results indicate that this preparation of docetaxel in emulsion is likely to provide an excellent prospect for clinical tumor treatment. PMID:24179332
International Nuclear Information System (INIS)
Colegial, Carlos; Silva, Federico; Perez, Carlos
1999-01-01
The encephalopathy spongyform for prions are neuro degenerative illness that can be sporadic or transferable, for infectious or hereditary mechanisms. Their investigation has outlined enormous challenges and in the historical journey in search of its cause two doctors have received the Nobel prize of medicine Carleton Gajdusek, for its works in New Guinea where it described the infectious transmission for cannibalistic rites that it took to studies of experimental transmission in chimpanzees and to its theory of the slow virus; later on, Stanley Prusiner developed its experimental works in hamsters, throwing to the neurobiology the prion concept (particles infectious proteinaceous not viral). The paper narrates the history of a patient that died in the San Juan de Dios of Bogota Hospital by cause of this prionic illness and clinical and pathological aspects are discussed
Li, Huafei; Sun, Yun; Chen, Di; Zhao, He; Zhao, Mengxin; Zhu, Xiandi; Ke, Changhong; Zhang, Ge; Jiang, Cheng; Zhang, Li; Zhang, Fulei; Wei, Huafeng; Li, Wei
2015-10-01
Simultaneously blocking multiple mediators offers new hope for the treatment of complex diseases. However, the curative potential of current combination therapy by chronological administration of separate monoclonal antibodies (mAbs) or multi-specific mAbs is still moderate due to inconvenient manipulation, low cooperative effectors, poor pharmacokinetics and insufficient tumor accumulation. Here, we describe a facile strategy that arms distinct mAbs with cooperative effectors onto a long chain to form a multicomponent comb-like nano mAb. Unlike dissociative parental mAbs, the multifunctional mAb nanoarray (PL-RB) constructed from type I/II anti-CD20 mAbs shows good pharmacokinetics. This PL-RB simultaneously targets distinct epitopes on a single antigen (Ag) and neighboring Ags on different lymphocytes. This unique intra- and intercellular Ag cross-linking endows the multifunctional mAb nanoarray with potent apoptosis activity. The exceptional apoptosis, complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC) that are synchronously evoked by the nano PL-RB are further synergistically promoted via enhanced permeability and retention (EPR), which resulted in high intratumor accumulation and excellent anti-lymphoma efficiency.
Homogenous photocatalytic decontamination of prion infected stainless steel and titanium surfaces.
Berberidou, Chrysanthi; Xanthopoulos, Konstantinos; Paspaltsis, Ioannis; Lourbopoulos, Athanasios; Polyzoidou, Eleni; Sklaviadis, Theodoros; Poulios, Ioannis
2013-01-01
Prions are notorious for their extraordinary resistance to traditional methods of decontamination, rendering their transmission a public health risk. Iatrogenic Creutzfeldt-Jakob disease (iCJD) via contaminated surgical instruments and medical devices has been verified both experimentally and clinically. Standard methods for prion inactivation by sodium hydroxide or sodium hypochlorite have failed, in some cases, to fully remove prion infectivity, while they are often impractical for routine applications. Prion accumulation in peripheral tissues and indications of human-to-human bloodborne prion transmission, highlight the need for novel, efficient, yet user-friendly methods of prion inactivation. Here we show both in vitro and in vivo that homogenous photocatalytic oxidation, mediated by the photo-Fenton reagent, has the potential to inactivate the pathological prion isoform adsorbed on metal substrates. Photocatalytic oxidation with 224 μg mL(-1) Fe (3+), 500 μg mL(-1) h(-1) H 2O 2, UV-A for 480 min lead to 100% survival in golden Syrian hamsters after intracranial implantation of stainless steel wires infected with the 263K prion strain. Interestingly, photocatalytic treatment of 263K infected titanium wires, under the same experimental conditions, prolonged the survival interval significantly, but failed to eliminate infectivity, a result that we correlate with the increased adsorption of PrP(Sc) on titanium, in comparison to stainless steel. Our findings strongly indicate that our, user--and environmentally--friendly protocol can be safely applied to the decontamination of prion infected stainless steel surfaces.
Unraveling the key to the resistance of canids to prion diseases.
Directory of Open Access Journals (Sweden)
Natalia Fernández-Borges
2017-11-01
Full Text Available One of the characteristics of prions is their ability to infect some species but not others and prion resistant species have been of special interest because of their potential in deciphering the determinants for susceptibility. Previously, we developed different in vitro and in vivo models to assess the susceptibility of species that were erroneously considered resistant to prion infection, such as members of the Leporidae and Equidae families. Here we undertake in vitro and in vivo approaches to understand the unresolved low prion susceptibility of canids. Studies based on the amino acid sequence of the canine prion protein (PrP, together with a structural analysis in silico, identified unique key amino acids whose characteristics could orchestrate its high resistance to prion disease. Cell- and brain-based PMCA studies were performed highlighting the relevance of the D163 amino acid in proneness to protein misfolding. This was also investigated by the generation of a novel transgenic mouse model carrying this substitution and these mice showed complete resistance to disease despite intracerebral challenge with three different mouse prion strains (RML, 22L and 301C known to cause disease in wild-type mice. These findings suggest that dog D163 amino acid is primarily, if not totally, responsible for the prion resistance of canids.
Structural determinants of phenotypic diversity and replication rate of human prions.
Directory of Open Access Journals (Sweden)
Jiri G Safar
2015-04-01
Full Text Available The infectious pathogen responsible for prion diseases is the misfolded, aggregated form of the prion protein, PrPSc. In contrast to recent progress in studies of laboratory rodent-adapted prions, current understanding of the molecular basis of human prion diseases and, especially, their vast phenotypic diversity is very limited. Here, we have purified proteinase resistant PrPSc aggregates from two major phenotypes of sporadic Creutzfeldt-Jakob disease (sCJD, determined their conformational stability and replication tempo in vitro, as well as characterized structural organization using recently emerged approaches based on hydrogen/deuterium (H/D exchange coupled with mass spectrometry. Our data clearly demonstrate that these phenotypically distant prions differ in a major way with regard to their structural organization, both at the level of the polypeptide backbone (as indicated by backbone amide H/D exchange data as well as the quaternary packing arrangements (as indicated by H/D exchange kinetics for histidine side chains. Furthermore, these data indicate that, in contrast to previous observations on yeast and some murine prion strains, the replication rate of sCJD prions is primarily determined not by conformational stability but by specific structural features that control the growth rate of prion protein aggregates.
Methods and Protocols for Developing Prion Vaccines.
Marciniuk, Kristen; Taschuk, Ryan; Napper, Scott
2016-01-01
Prion diseases denote a distinct form of infectivity that is based in the misfolding of a self-protein (PrP(C)) into a pathological, infectious conformation (PrP(Sc)). Efforts to develop vaccines for prion diseases have been complicated by the potential dangers that are associated with induction of immune responses against a self-protein. As a consequence, there is considerable appeal for vaccines that specifically target the misfolded prion conformation. Such conformation-specific immunotherapy is made possible through the identification of vaccine targets (epitopes) that are exclusively presented as a consequence of misfolding. An immune response directed against these targets, termed disease-specific epitopes (DSEs), has the potential to spare the function of the native form of the protein while clearing, or neutralizing, the infectious isomer. Although identification of DSEs represents a critical first step in the induction of conformation-specific immune responses, substantial efforts are required to translate these targets into functional vaccines. Due to the poor immunogenicity that is inherent to self-proteins, and that is often associated with short peptides, substantial efforts are required to overcome tolerance-to-self and maximize the resultant immune response following DSE-based immunization. This often includes optimization of target sequences in terms of immunogenicity and development of effective formulation and delivery strategies for the associated peptides. Further, these vaccines must satisfy additional criteria from perspectives of specificity (PrP(C) vs. PrP(Sc)) and safety (antibody-induced template-driven misfolding of PrP(C)). The emphasis of this report is on the steps required to translate DSEs into prion vaccines and subsequent evaluation of the resulting immune responses.
Quinacrine reactivity with prion proteins and prion-derived peptides
Czech Academy of Sciences Publication Activity Database
Zawada, Zbigniew; Šafařík, Martin; Dvořáková, E.; Janoušková, O.; Březinová, Anna; Stibor, Ivan; Holada, K.; Bouř, Petr; Hlaváček, Jan; Šebestík, Jaroslav
2013-01-01
Roč. 44, č. 5 (2013), s. 1279-1292 ISSN 0939-4451 R&D Projects: GA ČR GA203/07/1517 Institutional support: RVO:61388963 Keywords : quinacrine * prion protein and peptide model reactions * solid phase and recombinant synthesis Subject RIV: CE - Biochemistry Impact factor: 3.653, year: 2013
Hannaoui, Samia; Maatouk, Layal; Privat, Nicolas; Levavasseur, Etienne; Faucheux, Baptiste A; Haïk, Stéphane
2013-03-01
Prion diseases, or transmissible spongiform encephalopathies (TSEs), are fatal neurodegenerative disorders that occur in humans and animals. The neuropathological hallmarks of TSEs are spongiosis, glial proliferation, and neuronal loss. The only known specific molecular marker of TSEs is the abnormal isoform (PrP(Sc)) of the host-encoded prion protein (PrP(C)), which accumulates in the brain of infected subjects and forms infectious prion particles. Although this transmissible agent lacks a specific nucleic acid component, several prion strains have been isolated. Prion strains are characterized by differences in disease outcome, PrP(Sc) distribution patterns, and brain lesion profiles at the terminal stage of the disease. The molecular factors and cellular mechanisms involved in strain-specific neuronal tropism and toxicity remain largely unknown. Currently, no cellular model exists to facilitate in vitro studies of these processes. A few cultured cell lines that maintain persistent scrapie infections have been developed, but only two of them have shown the cytotoxic effects associated with prion propagation. In this study, we have developed primary neuronal cultures to assess in vitro neuronal tropism and toxicity of different prion strains (scrapie strains 139A, ME7, and 22L). We have tested primary neuronal cultures enriched in cerebellar granular, striatal, or cortical neurons. Our results showed that (i) a strain-specific neuronal tropism operated in vitro; (ii) the cytotoxic effect varied among strains and neuronal cell types; (iii) prion propagation and toxicity occurred in two kinetic phases, a replicative phase followed by a toxic phase; and (iv) neurotoxicity peaked when abnormal PrP accumulation reached a plateau.
Cholesterol Balance in Prion Diseases and Alzheimer’s Disease
Hannaoui, Samia; Shim, Su Yeon; Cheng, Yo Ching; Corda, Erica; Gilch, Sabine
2014-01-01
Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI) anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD): whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD. PMID:25419621
Cholesterol Balance in Prion Diseases and Alzheimer’s Disease
Directory of Open Access Journals (Sweden)
Samia Hannaoui
2014-11-01
Full Text Available Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD: whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD.
Madsen-Bouterse, Sally A; Schneider, David A; Zhuang, Dongyue; Dassanayake, Rohana P; Balachandran, Aru; Mitchell, Gordon B; O'Rourke, Katherine I
2016-09-01
Development of mice expressing either ovine (Tg338) or cervid (TgElk) prion protein (PrP) have aided in characterization of scrapie and chronic wasting disease (CWD), respectively. Experimental inoculation of sheep with CWD prions has demonstrated the potential for interspecies transmission but, infection with CWD versus classical scrapie prions may be difficult to differentiate using validated diagnostic platforms. In this study, mouse bioassay in Tg338 and TgElk was utilized to evaluate transmission of CWD versus scrapie prions from small ruminants. Mice (≥5 per homogenate) were inoculated with brain homogenates from clinically affected sheep or goats with naturally acquired classical scrapie, white-tailed deer with naturally acquired CWD (WTD-CWD) or sheep with experimentally acquired CWD derived from elk (sheep-passaged-CWD). Survival time (time to clinical disease) and attack rates (brain accumulation of protease resistant PrP, PrPres) were determined. Inoculation with classical scrapie prions resulted in clinical disease and 100 % attack rates in Tg338, but no clinical disease at endpoint (>300 days post-inoculation, p.i.) and low attack rates (6.8 %) in TgElk. Inoculation with WTD-CWD prions yielded no clinical disease or brain PrPres accumulation in Tg338 at endpoint (>500 days p.i.), but rapid onset of clinical disease (~121 days p.i.) and 100 % attack rate in TgElk. Sheep-passaged-CWD resulted in transmission to both mouse lines with 100 % attack rates at endpoint in Tg338 and an attack rate of ~73 % in TgElk with some culled due to clinical disease. These primary transmission observations demonstrate the potential of bioassay in Tg338 and TgElk to help differentiate possible infection with CWD versus classical scrapie prions in sheep and goats.
Synergistic effects of leflunomide and benazepril in streptozotocin-induced diabetic nephropathy.
Jin, Hua; Piao, Shang Guo; Jin, Ji Zhe; Jin, Ying Shun; Cui, Zhen Hua; Jin, Hai Feng; Zheng, Hai Lan; Li, Jin Ji; Jiang, Yu Ji; Yang, Chul Woo; Li, Can
2014-01-01
Leflunomide (LEF) and benazepril have renoprotective effects on diabetic nephropathy (DN) through their anti-inflammatory and anti-fibrotic activities. This study investigated whether combined treatment using LEF and benazepril affords superior protection compared with the respective monotherapies. Diabetes was induced with streptozotocin (STZ, 65 mg/kg) by intraperitoneal injection in male Wistar rats. Two weeks after STZ injection, diabetic rats were treated daily for 12 weeks with LEF (10 mg/kg), benazepril (10 mg/kg), or a combination of both. Basic parameters (body weight, fasting blood glucose level, and 24 h urinary protein excretion), histopathology, inflammatory [inflammatory cell infiltration (ED-1), monocyte chemoattractant protein-1 (MCP-1), and Toll-like receptor-2 (TLR-2)] and glomerulosclerotic factors [transforming growth factor-β1 (TGF-β1) and connective tissue growth factor (CTGF)], and oxidative stress (8-hydroxy-2'-deoxyguanosine, 8-OHdG) were studied. Benazepril or LEF treatment significantly prevented body weight loss and 24 h urinary protein excretion induced by diabetes; combined treatment with LEF and benazepril further improved these parameters compared with giving each drug alone (all p benazepril and was further reduced by the combined administration of the two drugs (p benazepril provides synergistic effects in preventing DN. 2014 S. Karger AG, Basel
Patterns of [PSI+] aggregation allow insights into cellular organization of yeast prion aggregates
Tyedmers, Jens
2012-01-01
The yeast prion phenomenon is very widespread and mounting evidence suggests that it has an impact on cellular regulatory mechanisms related to phenotypic responses to changing environments. Studying the aggregation patterns of prion amyloids during different stages of the prion life cycle is a first key step to understand major principles of how and where cells generate, organize and turn-over prion aggregates. The induction of the [PSI+] state involves the actin cytoskeleton and quality control compartments such as the Insoluble Protein Deposit (IPOD). An initially unstable transitional induction state can be visualized by overexpression of the prion determinant and displays characteristic large ring- and ribbon-shaped aggregates consisting of poorly fragmented bundles of very long prion fibrils. In the mature prion state, the aggregation pattern is characterized by highly fragmented, shorter prion fibrils that form aggregates, which can be visualized through tagging with fluorescent proteins. The number of aggregates formed varies, ranging from a single large aggregate at the IPOD to multiple smaller ones, depending on several parameters discussed. Aggregate units below the resolution of light microscopy that are detectable by fluorescence correlation spectroscopy are in equilibrium with larger aggregates in this stage and can mediate faithful inheritance of the prion state. Loss of the prion state is often characterized by reduced fragmentation of prion fibrils and fewer, larger aggregates. PMID:22449721
Cohen, Mark; Appleby, Brian; Safar, Jiri G
2016-01-01
Vast evidence on human prions demonstrates that variable disease phenotypes, rates of propagation, and targeting of distinct brain structures are determined by unique conformers (strains) of pathogenic prion protein (PrP(Sc)). Recent progress in the development of advanced biophysical tools that inventory structural characteristics of amyloid beta (Aβ) in the brain cortex of phenotypically diverse Alzheimer's disease (AD) patients, revealed unique spectrum of oligomeric particles in the cortex of rapidly progressive cases, implicating these structures in variable rates of propagation in the brain, and in distict disease manifestation. Since only ∼30% of phenotypic diversity of AD can be explained by polymorphisms in risk genes, these and transgenic bioassay data argue that structurally distinct Aβ particles play a major role in the diverse pathogenesis of AD, and may behave as distinct prion-like strains encoding diverse phenotypes. From these observations and our growing understanding of prions, there is a critical need for new strain-specific diagnostic strategies for misfolded proteins causing these elusive disorders. Since targeted drug therapy can induce mutation and evolution of prions into new strains, effective treatments of AD will require drugs that enhance clearance of pathogenic conformers, reduce the precursor protein, or inhibit the conversion of precursors into prion-like states.
Park, Yang-Nim; Zhao, Xiaohong; Yim, Yang-In; Todor, Horia; Ellerbrock, Robyn; Reidy, Michael; Eisenberg, Evan; Masison, Daniel C.
2014-01-01
The [PSI+] yeast prion is formed when Sup35 misfolds into amyloid aggregates. [PSI+], like other yeast prions, is dependent on the molecular chaperone Hsp104, which severs the prion seeds so that they pass on as the yeast cells divide. Surprisingly, however, overexpression of Hsp104 also cures [PSI+]. Several models have been proposed to explain this effect: inhibition of severing, asymmetric segregation of the seeds between mother and daughter cells, and dissolution of the prion seeds. First, we found that neither the kinetics of curing nor the heterogeneity in the distribution of the green fluorescent protein (GFP)-labeled Sup35 foci in partially cured yeast cells is compatible with Hsp104 overexpression curing [PSI+] by inhibiting severing. Second, we ruled out the asymmetric segregation model by showing that the extent of curing was essentially the same in mother and daughter cells and that the fluorescent foci did not distribute asymmetrically, but rather, there was marked loss of foci in both mother and daughter cells. These results suggest that Hsp104 overexpression cures [PSI+] by dissolution of the prion seeds in a two-step process. First, trimming of the prion seeds by Hsp104 reduces their size, and second, their amyloid core is eliminated, most likely by proteolysis. PMID:24632242
Park, Yang-Nim; Zhao, Xiaohong; Yim, Yang-In; Todor, Horia; Ellerbrock, Robyn; Reidy, Michael; Eisenberg, Evan; Masison, Daniel C; Greene, Lois E
2014-05-01
The [PSI(+)] yeast prion is formed when Sup35 misfolds into amyloid aggregates. [PSI(+)], like other yeast prions, is dependent on the molecular chaperone Hsp104, which severs the prion seeds so that they pass on as the yeast cells divide. Surprisingly, however, overexpression of Hsp104 also cures [PSI(+)]. Several models have been proposed to explain this effect: inhibition of severing, asymmetric segregation of the seeds between mother and daughter cells, and dissolution of the prion seeds. First, we found that neither the kinetics of curing nor the heterogeneity in the distribution of the green fluorescent protein (GFP)-labeled Sup35 foci in partially cured yeast cells is compatible with Hsp104 overexpression curing [PSI(+)] by inhibiting severing. Second, we ruled out the asymmetric segregation model by showing that the extent of curing was essentially the same in mother and daughter cells and that the fluorescent foci did not distribute asymmetrically, but rather, there was marked loss of foci in both mother and daughter cells. These results suggest that Hsp104 overexpression cures [PSI(+)] by dissolution of the prion seeds in a two-step process. First, trimming of the prion seeds by Hsp104 reduces their size, and second, their amyloid core is eliminated, most likely by proteolysis.
Synthetic prions and other human neurodegenerative proteinopathies.
Le, Nhat Tran Thanh; Narkiewicz, Joanna; Aulić, Suzana; Salzano, Giulia; Tran, Hoa Thanh; Scaini, Denis; Moda, Fabio; Giachin, Gabriele; Legname, Giuseppe
2015-09-02
Transmissible spongiform encephalopathies (TSE) are a heterogeneous group of neurodegenerative disorders. The common feature of these diseases is the pathological conversion of the normal cellular prion protein (PrP(C)) into a β-structure-rich conformer-termed PrP(Sc). The latter can induce a self-perpetuating process leading to amplification and spreading of pathological protein assemblies. Much evidence suggests that PrP(Sc) itself is able to recruit and misfold PrP(C) into the pathological conformation. Recent data have shown that recombinant PrP(C) can be misfolded in vitro and the resulting synthetic conformers are able to induce the conversion of PrP(C) into PrP(Sc)in vivo. In this review we describe the state-of-the-art of the body of literature in this field. In addition, we describe a cell-based assay to test synthetic prions in cells, providing further evidence that synthetic amyloids are able to template conversion of PrP into prion inclusions. Studying prions might help to understand the pathological mechanisms governing other neurodegenerative diseases. Aggregation and deposition of misfolded proteins is a common feature of several neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and other disorders. Although the proteins implicated in each of these diseases differ, they share a common prion mechanism. Recombinant proteins are able to aggregate in vitro into β-rich amyloid fibrils, sharing some features of the aggregates found in the brain. Several studies have reported that intracerebral inoculation of synthetic aggregates lead to unique pathology, which spread progressively to distal brain regions and reduced survival time in animals. Here, we review the prion-like features of different proteins involved in neurodegenerative disorders, such as α-synuclein, superoxide dismutase-1, amyloid-β and tau. Copyright © 2014 Elsevier B.V. All rights reserved.
Natural and synthetic prion structure from X-ray fiber diffraction
Energy Technology Data Exchange (ETDEWEB)
Wille, Holger; Bian, Wen; McDonald, Michele; Kendall, Amy; Colby, David W.; Bloch, Lillian; Ollesch, Julian; Borovinskiy, Alexander L.; Cohen, Fred E.; Prusiner, Stanley B.; Stubbs, Gerald; (Vanderbilt); (UCSF)
2009-10-21
A conformational isoform of the mammalian prion protein (PrP{sup Sc}) is the sole component of the infectious pathogen that causes the prion diseases. We have obtained X-ray fiber diffraction patterns from infectious prions that show cross-{beta} diffraction: meridional intensity at 4.8 {angstrom} resolution, indicating the presence of {beta} strands running approximately at right angles to the filament axis and characteristic of amyloid structure. Some of the patterns also indicated the presence of a repeating unit along the fiber axis, corresponding to four {beta}-strands. We found that recombinant (rec) PrP amyloid differs substantially from highly infectious brain-derived prions, both in structure as demonstrated by the diffraction data, and in heterogeneity as shown by electron microscopy. In addition to the strong 4.8 {angstrom} meridional reflection, the recPrP amyloid diffraction is characterized by strong equatorial intensity at approximately 10.5 {angstrom}, absent from brain-derived prions, and indicating the presence of stacked {beta}-sheets. Synthetic prions recovered from transgenic mice inoculated with recPrP amyloid displayed structural characteristics and homogeneity similar to those of naturally occurring prions. The relationship between the structural differences and prion infectivity is uncertain, but might be explained by any of several hypotheses: only a minority of recPrP amyloid possesses a replication-competent conformation, the majority of recPrP amyloid has to undergo a conformational maturation to acquire replication competency, or inhibitory forms of recPrP amyloid interfere with replication during the initial transmission.
Role of Prion Protein Aggregation in Neurotoxicity
Directory of Open Access Journals (Sweden)
Tullio Florio
2012-07-01
Full Text Available In several neurodegenerative diseases, such as Parkinson, Alzheimer’s, Huntington, and prion diseases, the deposition of aggregated misfolded proteins is believed to be responsible for the neurotoxicity that characterizes these diseases. Prion protein (PrP, the protein responsible of prion diseases, has been deeply studied for the peculiar feature of its misfolded oligomers that are able to propagate within affected brains, inducing the conversion of the natively folded PrP into the pathological conformation. In this review, we summarize the available experimental evidence concerning the relationship between aggregation status of misfolded PrP and neuronal death in the course of prion diseases. In particular, we describe the main findings resulting from the use of different synthetic (mainly PrP106-126 and recombinant PrP-derived peptides, as far as mechanisms of aggregation and amyloid formation, and how these different spatial conformations can affect neuronal death. In particular, most data support the involvement of non-fibrillar oligomers rather than actual amyloid fibers as the determinant of neuronal death.
Mapping of possible prion protein self interaction domains using peptide arrays
Rigter, A.; Langeveld, J.P.M.; Timmers-Parohi, D.; Jacobs, J.G.; Moonen, P.L.J.M.; Bossers, A.
2007-01-01
Background The common event in transmissible spongiform encephalopathies (TSEs) or prion diseases is the conversion of host-encoded protease sensitive cellular prion protein (PrPC) into strain dependent isoforms of scrapie associated protease resistant isoform (PrPSc) of prion protein (PrP). These
Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.
Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio
2017-06-01
In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of
Implications of prion adaptation and evolution paradigm for human neurodegenerative diseases.
Kabir, M Enamul; Safar, Jiri G
2014-01-01
There is a growing body of evidence indicating that number of human neurodegenerative diseases, including Alzheimer disease, Parkinson disease, fronto-temporal dementias, and amyotrophic lateral sclerosis, propagate in the brain via prion-like intercellular induction of protein misfolding. Prions cause lethal neurodegenerative diseases in humans, the most prevalent being sporadic Creutzfeldt-Jakob disease (sCJD); they self-replicate and spread by converting the cellular form of prion protein (PrP(C)) to a misfolded pathogenic conformer (PrP(Sc)). The extensive phenotypic heterogeneity of human prion diseases is determined by polymorphisms in the prion protein gene, and by prion strain-specific conformation of PrP(Sc). Remarkably, even though informative nucleic acid is absent, prions may undergo rapid adaptation and evolution in cloned cells and upon crossing the species barrier. In the course of our investigation of this process, we isolated distinct populations of PrP(Sc) particles that frequently co-exist in sCJD. The human prion particles replicate independently and undergo competitive selection of those with lower initial conformational stability. Exposed to mutant substrate, the winning PrP(Sc) conformers are subject to further evolution by natural selection of the subpopulation with the highest replication rate due to the lowest stability. Thus, the evolution and adaptation of human prions is enabled by a dynamic collection of distinct populations of particles, whose evolution is governed by the selection of progressively less stable, faster replicating PrP(Sc) conformers. This fundamental biological mechanism may explain the drug resistance that some prions gained after exposure to compounds targeting PrP(Sc). Whether the phenotypic heterogeneity of other neurodegenerative diseases caused by protein misfolding is determined by the spectrum of misfolded conformers (strains) remains to be established. However, the prospect that these conformers may evolve and
The expanding universe of prion diseases.
Directory of Open Access Journals (Sweden)
2006-03-01
Full Text Available Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C. Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases-including human diseases variant Creutzfeldt-Jakob disease (vCJD and sporadic fatal insomnia (sFI, bovine amyloidotic spongiform encephalopathy (BASE, and Nor98 of sheep-have been identified in the last ten years, and chronic wasting disease (CWD of North American deer (Odocoileus Specis and Rocky Mountain elk (Cervus elaphus nelsoni is undergoing a dramatic spread across North America. While amplification (BSE and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.
The expanding universe of prion diseases.
Directory of Open Access Journals (Sweden)
Joel C Watts
2006-03-01
Full Text Available Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C. Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD and sporadic fatal insomnia (sFI, bovine amyloidotic spongiform encephalopathy (BASE, and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD of North American deer (Odocoileus Specis and Rocky Mountain elk (Cervus elaphus nelsoni is undergoing a dramatic spread across North America. While amplification (BSE and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.
Molecular modeling of the conformational dynamics of the cellular prion protein
Nguyen, Charles; Colling, Ian; Bartz, Jason; Soto, Patricia
2014-03-01
Prions are infectious agents responsible for transmissible spongiform encephalopathies (TSEs), a type of fatal neurodegenerative disease in mammals. Prions propagate biological information by conversion of the non-pathological version of the prion protein to the infectious conformation, PrPSc. A wealth of knowledge has shed light on the nature and mechanism of prion protein conversion. In spite of the significance of this problem, we are far from fully understanding the conformational dynamics of the cellular isoform. To remedy this situation we employ multiple biomolecular modeling techniques such as docking and molecular dynamics simulations to map the free energy landscape and determine what specific regions of the prion protein are most conductive to binding. The overall goal is to characterize the conformational dynamics of the cell form of the prion protein, PrPc, to gain insight into inhibition pathways against misfolding. NE EPSCoR FIRST Award to Patricia Soto.
Repetitive immunization enhances the susceptibility of mice to peripherally administered prions.
Directory of Open Access Journals (Sweden)
Juliane Bremer
Full Text Available The susceptibility of humans and animals to prion infections is determined by the virulence of the infectious agent, by genetic modifiers, and by hitherto unknown host and environmental risk factors. While little is known about the latter two, the activation state of the immune system was surmised to influence prion susceptibility. Here we administered prions to mice that were repeatedly immunized by two initial injections of CpG oligodeoxynucleotides followed by repeated injections of bovine serum albumin/alum. Immunization greatly reduced the required dosage of peripherally administered prion inoculum necessary to induce scrapie in 50% of mice. No difference in susceptibility was observed following intracerebral prion challenge. Due to its profound impact onto scrapie susceptibility, the host immune status may determine disease penetrance after low-dose prion exposure, including those that may give rise to iatrogenic and variant Creutzfeldt-Jakob disease.
IMPY, a potential β-amyloid imaging probe for detection of prion deposits in scrapie-infected mice
International Nuclear Information System (INIS)
Song, P.-J.; Bernard, Serge; Sarradin, Pierre; Vergote, Jackie; Barc, Celine; Chalon, Sylvie; Kung, M.-P.; Kung, Hank F.; Guilloteau, Denis
2008-01-01
Introduction: A potential single-photon emission computed tomography imaging agent for labeling of Aβ plaques of Alzheimer's disease, IMPY (2-(4'-dimethylaminophenyl)-6-iodo-imidazo[1,2-a]pyridine), would be effective in detection of prion amyloid deposits in transmissible spongiform encephalopathies (TSEs). Methods: In vitro autoradiographic studies were carried out with [ 125 I]IMPY on brain sections from scrapie-infected mice and age-matched controls. Competition study was performed to evaluate the prion deposit binding specificity with nonradioactive IMPY. Results: Binding of [ 125 I]IMPY was observed in infected brain sections, while on age-matched control brain sections, there was no or very low labeling. Prion deposit binding was confirmed by histoblots with prion protein-specific monoclonal antibody 2D6. In the presence of nonradioactive IMPY, the binding of [ 125 I]IMPY was significantly inhibited in all regions studied. Conclusions: These findings indicate that IMPY can detect the prion deposits in vitro in scrapie-infected mice. Labeled with 123 I, this ligand may be useful to quantitate prion deposit burdens in TSEs by in vivo imaging
Li, Lanlan; Zhu, Yongchang; Zhou, Shuangyan; An, Xiaoli; Zhang, Yan; Bai, Qifeng; He, Yong-Xing; Liu, Huanxiang; Yao, Xiaojun
2017-12-20
Resveratrol and its derivatives have been shown to display beneficial effects to neurodegenerative diseases. However, the molecular mechanism of resveratrol and its derivatives on prion conformational conversion is poorly understood. In this work, the interaction mechanism between prion and resveratrol as well as its derivatives was investigated using steady-state fluorescence quenching, Thioflavin T binding assay, Western blotting, and molecular dynamics simulation. Protein fluorescence quenching method and Thioflavin T assay revealed that resveratrol and its derivatives could interact with prion and interrupt prion fibril formation. Molecular dynamics simulation results indicated that resveratrol can stabilize the PrP 127-147 peptide mainly through π-π stacking interactions between resveratrol and Tyr128. The hydrogen bonds interactions between resveratrol and the PrP 127-147 peptide could further reduce the flexibility and the propensity to aggregate. The results of this study not only can provide useful information about the interaction mechanism between resveratrol and prion, but also can provide useful clues for further design of new inhibitors inhibiting prion aggregation.
Diagnostic and prognostic value of human prion detection in cerebrospinal fluid.
Foutz, Aaron; Appleby, Brian S; Hamlin, Clive; Liu, Xiaoqin; Yang, Sheng; Cohen, Yvonne; Chen, Wei; Blevins, Janis; Fausett, Cameron; Wang, Han; Gambetti, Pierluigi; Zhang, Shulin; Hughson, Andrew; Tatsuoka, Curtis; Schonberger, Lawrence B; Cohen, Mark L; Caughey, Byron; Safar, Jiri G
2017-01-01
Several prion amplification systems have been proposed for detection of prions in cerebrospinal fluid (CSF), most recently, the measurements of prion seeding activity with second-generation real-time quaking-induced conversion (RT-QuIC). The objective of this study was to investigate the diagnostic performance of the RT-QuIC prion test in the broad phenotypic spectrum of prion diseases. We performed CSF RT-QuIC testing in 2,141 patients who had rapidly progressive neurological disorders, determined diagnostic sensitivity and specificity in 272 cases that were autopsied, and evaluated the impact of mutations and polymorphisms in the PRNP gene, and type 1 or type 2 human prions on diagnostic performance. The 98.5% diagnostic specificity and 92% sensitivity of CSF RT-QuIC in a blinded retrospective analysis matched the 100% specificity and 95% sensitivity of a blind prospective study. The CSF RT-QuIC differentiated 94% of cases of sporadic Creutzfeldt-Jakob disease (sCJD) MM1 from the sCJD MM2 phenotype, and 80% of sCJD VV2 from sCJD VV1. The mixed prion type 1-2 and cases heterozygous for codon 129 generated intermediate CSF RT-QuIC patterns, whereas genetic prion diseases revealed distinct profiles for each PRNP gene mutation. The diagnostic performance of the improved CSF RT-QuIC is superior to surrogate marker tests for prion diseases such as 14-3-3 and tau proteins, and together with PRNP gene sequencing the test allows the major prion subtypes to be differentiated in vivo. This differentiation facilitates prediction of the clinicopathological phenotype and duration of the disease-two important considerations for envisioned therapeutic interventions. ANN NEUROL 2017;81:79-92. © 2016 American Neurological Association.
Using small molecule reagents to help distinguish among prion structural models
The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...
Persistence of pathogenic prion protein during simulated wastewater treatment processes
Hinckley, G.T.; Johnson, C.J.; Jacobson, K.H.; Bartholomay, C.; Mcmahon, K.D.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.
2008-01-01
Transmissible spongiform encephalopathies (TSEs, prion diseases) are a class of fatal neurodegenerative diseases affecting a variety of mammalian species including humans. A misfolded form of the prion protein (PrP TSE) is the major, if not sole, component of the infectious agent. Prions are highly resistant to degradation and to many disinfection procedures suggesting that, if prions enter wastewater treatment systems through sewers and/or septic systems (e.g., from slaughterhouses, necropsy laboratories, rural meat processors, private game dressing) or through leachate from landfills that have received TSE-contaminated material, prions could survive conventional wastewater treatment Here, we report the results of experiments examining the partitioning and persistence of PrPTSE during simulated wastewater treatment processes including activated and mesophilic anaerobic sludge digestion. Incubation with activated sludge did not result in significant PrPTSE degradation. PrPTSE and prion infectivity partitioned strongly to activated sludge solids and are expected to enter biosolids treatment processes. A large fraction of PrPTSE survived simulated mesophilic anaerobic sludge digestion. The small reduction in recoverable PrPTSE after 20-d anaerobic sludge digestion appeared attributable to a combination of declining extractability with time and microbial degradation. Our results suggest that if prions were to enter municipal wastewater treatment systems, most would partition to activated sludge solids, survive mesophilic anaerobic digestion, and be present in treated biosolids. ?? 2008 American Chemical Society.
The Prion Protein Preference of Sporadic Creutzfeldt-Jakob Disease Subtypes*
Klemm, Helen M. J.; Welton, Jeremy M.; Masters, Colin L.; Klug, Genevieve M.; Boyd, Alison; Hill, Andrew F.; Collins, Steven J.; Lawson, Victoria A.
2012-01-01
Sporadic Creutzfeldt-Jakob disease (CJD) is the most prevalent manifestation of the transmissible spongiform encephalopathies or prion diseases affecting humans. The disease encompasses a spectrum of clinical phenotypes that have been correlated with molecular subtypes that are characterized by the molecular mass of the protease-resistant fragment of the disease-related conformation of the prion protein and a polymorphism at codon 129 of the gene encoding the prion protein. A cell-free assay of prion protein misfolding was used to investigate the ability of these sporadic CJD molecular subtypes to propagate using brain-derived sources of the cellular prion protein (PrPC). This study confirmed the presence of three distinct sporadic CJD molecular subtypes with PrPC substrate requirements that reflected their codon 129 associations in vivo. However, the ability of a sporadic CJD molecular subtype to use a specific PrPC substrate was not determined solely by codon 129 as the efficiency of prion propagation was also influenced by the composition of the brain tissue from which the PrPC substrate was sourced, thus indicating that nuances in PrPC or additional factors may determine sporadic CJD subtype. The results of this study will aid in the design of diagnostic assays that can detect prion disease across the diversity of sporadic CJD subtypes. PMID:22930754
Directory of Open Access Journals (Sweden)
Jiri Ruzicka
2018-01-01
Full Text Available Systematic inflammatory response after spinal cord injury (SCI is one of the factors leading to lesion development and a profound degree of functional loss. Anti-inflammatory compounds, such as curcumin and epigallocatechin gallate (EGCG are known for their neuroprotective effects. In this study, we investigated the effect of combined therapy of curcumin and EGCG in a rat model of acute SCI induced by balloon compression. Immediately after SCI, rats received curcumin, EGCG, curcumin + EGCG or saline [daily intraperitoneal doses (curcumin, 6 mg/kg; EGCG 17 mg/kg] and weekly intramuscular doses (curcumin, 60 mg/kg; EGCG 17 mg/kg] for 28 days. Rats were evaluated using behavioral tests (the Basso, Beattie, and Bresnahan (BBB open-field locomotor test, flat beam test. Spinal cord tissue was analyzed using histological methods (Luxol Blue-cresyl violet staining and immunohistochemistry (anti-glial fibrillary acidic protein, anti-growth associated protein 43. Cytokine levels (interleukin-1β, interleukin-4, interleukin-2, interleukin-6, macrophage inflammatory protein 1-alpha, and RANTES were measured using Luminex assay. Quantitative polymerase chain reaction was performed to determine the relative expression of genes (Sort1, Fgf2, Irf5, Mrc1, Olig2, Casp3, Gap43, Gfap, Vegf, NfκB, Cntf related to regenerative processes in injured spinal cord. We found that all treatments displayed significant behavioral recovery, with no obvious synergistic effect after combined therapy of curcumin and ECGC. Curcumin and EGCG alone or in combination increased axonal sprouting, decreased glial scar formation, and altered the levels of macrophage inflammatory protein 1-alpha, interleukin-1β, interleukin-4 and interleukin-6 cytokines. These results imply that although the expected synergistic response of this combined therapy was less obvious, aspects of tissue regeneration and immune responses in severe SCI were evident.
Ruzicka, Jiri; Urdzikova, Lucia Machova; Svobodova, Barbora; Amin, Anubhav G; Karova, Kristyna; Dubisova, Jana; Zaviskova, Kristyna; Kubinova, Sarka; Schmidt, Meic; Jhanwar-Uniyal, Meena; Jendelova, Pavla
2018-01-01
Systematic inflammatory response after spinal cord injury (SCI) is one of the factors leading to lesion development and a profound degree of functional loss. Anti-inflammatory compounds, such as curcumin and epigallocatechin gallate (EGCG) are known for their neuroprotective effects. In this study, we investigated the effect of combined therapy of curcumin and EGCG in a rat model of acute SCI induced by balloon compression. Immediately after SCI, rats received curcumin, EGCG, curcumin + EGCG or saline [daily intraperitoneal doses (curcumin, 6 mg/kg; EGCG 17 mg/kg)] and weekly intramuscular doses (curcumin, 60 mg/kg; EGCG 17 mg/kg)] for 28 days. Rats were evaluated using behavioral tests (the Basso, Beattie, and Bresnahan (BBB) open-field locomotor test, flat beam test). Spinal cord tissue was analyzed using histological methods (Luxol Blue-cresyl violet staining) and immunohistochemistry (anti-glial fibrillary acidic protein, anti-growth associated protein 43). Cytokine levels (interleukin-1β, interleukin-4, interleukin-2, interleukin-6, macrophage inflammatory protein 1-alpha, and RANTES) were measured using Luminex assay. Quantitative polymerase chain reaction was performed to determine the relative expression of genes (Sort1, Fgf2, Irf5, Mrc1, Olig2, Casp3, Gap43, Gfap, Vegf, NfκB, Cntf) related to regenerative processes in injured spinal cord. We found that all treatments displayed significant behavioral recovery, with no obvious synergistic effect after combined therapy of curcumin and ECGC. Curcumin and EGCG alone or in combination increased axonal sprouting, decreased glial scar formation, and altered the levels of macrophage inflammatory protein 1-alpha, interleukin-1β, interleukin-4 and interleukin-6 cytokines. These results imply that although the expected synergistic response of this combined therapy was less obvious, aspects of tissue regeneration and immune responses in severe SCI were evident.
Probing Early Misfolding Events in Prion Protein Mutants by NMR Spectroscopy
Directory of Open Access Journals (Sweden)
Gregor Ilc
2013-08-01
Full Text Available The post-translational conversion of the ubiquitously expressed cellular form of the prion protein, PrPC, into its misfolded and pathogenic isoform, known as prion or PrPSc, plays a key role in prion diseases. These maladies are denoted transmissible spongiform encephalopathies (TSEs and affect both humans and animals. A prerequisite for understanding TSEs is unraveling the molecular mechanism leading to the conversion process whereby most α-helical motifs are replaced by β-sheet secondary structures. Importantly, most point mutations linked to inherited prion diseases are clustered in the C-terminal domain region of PrPC and cause spontaneous conversion to PrPSc. Structural studies with PrP variants promise new clues regarding the proposed conversion mechanism and may help identify “hot spots” in PrPC involved in the pathogenic conversion. These investigations may also shed light on the early structural rearrangements occurring in some PrPC epitopes thought to be involved in modulating prion susceptibility. Here we present a detailed overview of our solution-state NMR studies on human prion protein carrying different pathological point mutations and the implications that such findings may have for the future of prion research.
Inactivation of Template-Directed Misfolding of Infectious Prion Protein by Ozone
Ding, Ning; Price, Luke M.; Braithwaite, Shannon L.; Balachandran, Aru; Belosevic, Miodrag
2012-01-01
Misfolded prions (PrPSc) are well known for their resistance to conventional decontamination processes. The potential risk of contamination of the water environment, as a result of disposal of specified risk materials (SRM), has raised public concerns. Ozone is commonly utilized in the water industry for inactivation of microbial contaminants and was tested in this study for its ability to inactivate prions (263K hamster scrapie = PrPSc). Treatment variables included initial ozone dose (7.6 to 25.7 mg/liter), contact time (5 s and 5 min), temperature (4°C and 20°C), and pH (pH 4.4, 6.0, and 8.0). Exposure of dilute suspensions of the infected 263K hamster brain homogenates (IBH) (0.01%) to ozone resulted in the in vitro destruction of the templating properties of PrPSc, as measured by the protein misfolding cyclic amplification (PMCA) assay. The highest levels of prion inactivation (≥4 log10) were observed with ozone doses of 13.0 mg/liter, at pH 4.4 and 20°C, resulting in a CT (the product of residual ozone concentration and contact time) value as low as 0.59 mg · liter−1 min. A comparison of ozone CT requirements among various pathogens suggests that prions are more susceptible to ozone degradation than some model bacteria and protozoa and that ozone treatment may be an effective solution for inactivating prions in water and wastewater. PMID:22138993
Yeast prions form infectious amyloid inclusion bodies in bacteria
Directory of Open Access Journals (Sweden)
Espargaró Alba
2012-06-01
Full Text Available Abstract Background Prions were first identified as infectious proteins associated with fatal brain diseases in mammals. However, fungal prions behave as epigenetic regulators that can alter a range of cellular processes. These proteins propagate as self-perpetuating amyloid aggregates being an example of structural inheritance. The best-characterized examples are the Sup35 and Ure2 yeast proteins, corresponding to [PSI+] and [URE3] phenotypes, respectively. Results Here we show that both the prion domain of Sup35 (Sup35-NM and the Ure2 protein (Ure2p form inclusion bodies (IBs displaying amyloid-like properties when expressed in bacteria. These intracellular aggregates template the conformational change and promote the aggregation of homologous, but not heterologous, soluble prionogenic molecules. Moreover, in the case of Sup35-NM, purified IBs are able to induce different [PSI+] phenotypes in yeast, indicating that at least a fraction of the protein embedded in these deposits adopts an infectious prion fold. Conclusions An important feature of prion inheritance is the existence of strains, which are phenotypic variants encoded by different conformations of the same polypeptide. We show here that the proportion of infected yeast cells displaying strong and weak [PSI+] phenotypes depends on the conditions under which the prionogenic aggregates are formed in E. coli, suggesting that bacterial systems might become useful tools to generate prion strain diversity.
Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.
Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D
2011-11-01
Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.
Prions And Prion Diseases | Obi | African Journal of Clinical and ...
African Journals Online (AJOL)
Patients also may experience involuntary jerking movements called myoclonus, unusual sensation, insomnia, and confusion or memory problems. In the later stages of the disease, patients may have severe mental impairment (dementia) and may lose the ability to move or speak. Well known prion diseases include scrapie ...
Energy Technology Data Exchange (ETDEWEB)
Xu, Zhenhe; Kibria, Md Golam; AlOtaibi, Bandar; Duchesne, Paul N.; Besteiro, Lucas V.; Gao, Yu; Zhang, Qingzhe; Mi, Zetian; Zhang, Peng; Govorov, Alexander O.; Mai, Liqiang; Chaker, Mohamed; Ma, Dongling
2018-02-01
Synergistic effect in alloys and plasmonic effect have both been explored for increasing the efficiency of water splitting. In depth understanding and comparison of their respective contributions in certain promising systems is highly desired for catalyst development, yet rarely investigated so far. We report herein our thorough investigations on a series of highly interesting nanocomposites composed of Pt, Au and C3N4 nanocomponents, which are designed to benefit from both synergistic and plasmonic effects. Detailed analyses led to an important conclusion that the contribution from the synergistic effect was at least 3.5 times that from the plasmonic effect in the best performing sample, Pt50Au50 alloy decorated C3N4. It showed remarkable turnover frequency of >1.6 mmol h-1 g-1 at room temperature. Our work provides physical insights for catalyst development by rationally designing samples to compare long-known synergistic effect with recently emerging, attractive plasmonic effect and represents the first case study in the field.
2007-06-01
is not known. Obtaining structural information on the misfolded isoform of prion may lead to preventative therapies and treatments of prion diseases...the misfolded prion isoform may allow for the development of drug therapies or early detection systems for prion diseases, or illuminate mechanistic...showing fluorescence intensity as a function of time and energy for 2,6-p-toluidinonapththalene adsorbed to egg L-α- lecithin vesicles. The steady
SYNERGISTIC ANTIBACTERIAL EFFECT OF STEM BARK ...
African Journals Online (AJOL)
userpc
ABSTRACT. The study was aimed at screening the stem bark extracts of Faidherbia albida and Psidium guajava for synergistic antibacterial effect against methicillin resistant Staphylococcus aureus (MRSA). The powdered plant materials were extracted with methanol using cold maceration technique and the extracts were ...
Phenomenological theory of synergistic effects in plasma-wall interaction
International Nuclear Information System (INIS)
Itoh, N.; Hasebe, Y.
1986-01-01
A phenomenological theory for synergistic effects under multi-species particle bombardement has been developed. The theory is based on a model in which two free-energy minima are assumed to be overcome under actions of radiation for a process to be completed. The synergistic factor, the ratio of the yield of the process under irradiation with two species of particles to the summation of the yields of the process under irradiation with each of two component species, is obtained as a function of the beam flux for several parameters relevant to thermodynamic and radiation-enhanced processes. The criterion for the synergistic effect is obtained. The theory has been shown to be able to explain the yield-flux relation obtained by Haasz et al. for hydrogen-induced methane formation from graphite. (orig.)
International Nuclear Information System (INIS)
Lutz, Kira; Urbach, Horst
2015-01-01
The prion diseases of the brain, especially Creutzfeldt-Jakob disease, are rare fatal neurodegenerative disorders. A definitive CJD diagnosis is currently only possible by a brain biopsy or post mortem autopsy. The diagnosis of Creutzfeldt-Jakob disease is based on clinical signs, pathognomonic EEG, on typical MRI findings and the examination of the cerebrospinal fluid. Using the MRI the diagnosis Creutzfeldt-Jakob disease can be confirmed or excluded with high certainty. The MRI examination should contain diffusion-weighted and FLAIR imaging sequences. This review article provides an overview of the prion diseases of the brain with the corresponding imaging findings.
Evidence that bank vole PrP is a universal acceptor for prions.
Directory of Open Access Journals (Sweden)
Joel C Watts
2014-04-01
Full Text Available Bank voles are uniquely susceptible to a wide range of prion strains isolated from many different species. To determine if this enhanced susceptibility to interspecies prion transmission is encoded within the sequence of the bank vole prion protein (BVPrP, we inoculated Tg(M109 and Tg(I109 mice, which express BVPrP containing either methionine or isoleucine at polymorphic codon 109, with 16 prion isolates from 8 different species: humans, cattle, elk, sheep, guinea pigs, hamsters, mice, and meadow voles. Efficient disease transmission was observed in both Tg(M109 and Tg(I109 mice. For instance, inoculation of the most common human prion strain, sporadic Creutzfeldt-Jakob disease (sCJD subtype MM1, into Tg(M109 mice gave incubation periods of ∼200 days that were shortened slightly on second passage. Chronic wasting disease prions exhibited an incubation time of ∼250 days, which shortened to ∼150 days upon second passage in Tg(M109 mice. Unexpectedly, bovine spongiform encephalopathy and variant CJD prions caused rapid neurological dysfunction in Tg(M109 mice upon second passage, with incubation periods of 64 and 40 days, respectively. Despite the rapid incubation periods, other strain-specified properties of many prion isolates--including the size of proteinase K-resistant PrPSc, the pattern of cerebral PrPSc deposition, and the conformational stability--were remarkably conserved upon serial passage in Tg(M109 mice. Our results demonstrate that expression of BVPrP is sufficient to engender enhanced susceptibility to a diverse range of prion isolates, suggesting that BVPrP may be a universal acceptor for prions.
Giese, A; Bieschke, J; Eigen, M; Kretzschmar, H A
2000-01-01
Prion diseases are characterized by the cerebral deposition of an aggregated pathological isoform of the prion protein (PrP(Sc)) which constitutes the principal component of the transmissible agent termed prion. In order to develop a highly sensitive method for the detection of PrP(Sc) aggregates in biological samples such as cerebrospinal fluid (CSF), we used a method based on Fluorescence Correlation Spectroscopy (FCS), a technique which allows detection of single fluorescently labeled molecules in solution. Within the FCS setup, fluorescent photons emitted by molecules passing an open volume element defined by the beam of an excitation laser focussed into a diffraction-limited spot are imaged confocally onto a single photon counting detector. Aggregates of PrP(Sc) could be labeled by co-aggregation of probe molecules such as monomeric recombinant PrP or PrP-specific antibodies tagged with a fluorescent dye. In addition to slow diffusion, labeled aggregates are characterized by high fluorescence intensity, which allows detection and quantification by analysis of fluorescence intensity distribution. To improve detection of rare target particles, the accessible volume element was increased by scanning for intensely fluorescent targets (SIFT). To further improve sensitivity and specificity, two different probes were used simultaneously in a two-color setup. In a diagnostic model system of CSF spiked with purified prion rods, dual-color SIFT was more sensitive than Western blot analysis. In addition, a PrP(Sc)-specific signal was also detected in a number of CSF samples derived from CJD patients but not in controls.
Rebels with a cause: molecular features and physiological consequences of yeast prions.
Garcia, David M; Jarosz, Daniel F
2014-02-01
Prions are proteins that convert between structurally and functionally distinct states, at least one of which is self-perpetuating. The prion fold templates the conversion of native protein, altering its structure and function, and thus serves as a protein-based element of inheritance. Molecular chaperones ensure that these prion aggregates are divided and faithfully passed from mother cells to their daughters. Prions were originally identified as the cause of several rare neurodegenerative diseases in mammals, but the last decade has brought great progress in understanding their broad importance in biology and evolution. Most prion proteins regulate information flow in signaling networks, or otherwise affect gene expression. Consequently, switching into and out of prion states creates diverse new traits – heritable changes based on protein structure rather than nucleic acid. Despite intense study of the molecular mechanisms of this paradigm-shifting, epigenetic mode of inheritance, many key questions remain. Recent studies in yeast that support the view that prions are common, often beneficial elements of inheritance that link environmental stress to the appearance of new traits.
Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W.; Mohri, Shirou; Kitamoto, Tetsuyuki
2013-01-01
To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype. PMID:23792955
Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W; Mohri, Shirou; Kitamoto, Tetsuyuki
2013-07-26
To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype.
Effects of polymorphisms in ovine and caprine prion protein alleles on cell-free conversion
Directory of Open Access Journals (Sweden)
Eiden Martin
2011-02-01
Full Text Available Abstract In sheep polymorphisms of the prion gene (PRNP at the codons 136, 154 and 171 strongly influence the susceptibility to scrapie and bovine spongiform encephalopathy (BSE infections. In goats a number of other gene polymorphisms were found which are suspected to trigger similar effects. However, no strong correlation between polymorphisms and TSE susceptibility in goats has yet been obtained from epidemiological studies and only a low number of experimental challenge data are available at present. We have therefore studied the potential impact of these polymorphisms in vitro by cell-free conversion assays using mouse scrapie strain Me7. Mouse scrapie brain derived PrPSc served as seeds and eleven recombinant single mutation variants of sheep and goat PrPC as conversion targets. With this approach it was possible to assign reduced conversion efficiencies to specific polymorphisms, which are associated to low frequency in scrapie-affected goats or found only in healthy animals. Moreover, we could demonstrate a dominant-negative inhibition of prion polymorphisms associated with high susceptibility by alleles linked to low susceptibility in vitro.
Uchiyama, Keiji; Miyata, Hironori; Yano, Masashi; Yamaguchi, Yoshitaka; Imamura, Morikazu; Muramatsu, Naomi; Das, Nandita Rani; Chida, Junji; Hara, Hideyuki; Sakaguchi, Suehiro
2014-01-01
Prion infection induces conformational conversion of the normal prion protein PrPC, into the pathogenic isoform PrPSc, in prion diseases. It has been shown that PrP-knockout (Prnp0/0) mice transgenically reconstituted with a mouse-hamster chimeric PrP lacking N-terminal residues 23-88, or Tg(MHM2Δ23-88)/Prnp 0/0 mice, neither developed the disease nor accumulated MHM2ScΔ23-88 in their brains after inoculation with RML prions. In contrast, RML-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice developed the disease with abundant accumulation of MHM2ScΔ23-88 in their brains. These results indicate that MHM2Δ23-88 itself might either lose or greatly reduce the converting capacity to MHM2ScΔ23-88, and that the co-expressing wild-type PrPC can stimulate the conversion of MHM2Δ23-88 to MHM2ScΔ23-88 in trans. In the present study, we confirmed that Tg(MHM2Δ23-88)/Prnp 0/0 mice remained resistant to RML prions for up to 730 days after inoculation. However, we found that Tg(MHM2Δ23-88)/Prnp 0/0 mice were susceptible to 22L prions, developing the disease with prolonged incubation times and accumulating MHM2ScΔ23-88 in their brains. We also found accelerated conversion of MHM2Δ23-88 into MHM2ScΔ23-88 in the brains of RML- and 22L-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice. However, wild-type PrPSc accumulated less in the brains of these inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice, compared with RML- and 22L-inoculated Prnp 0/+ mice. These results show that MHM2Δ23-88 itself can convert into MHM2ScΔ23-88 without the help of the trans-acting PrPC, and that, irrespective of prion strains inoculated, the co-expressing wild-type PrPC stimulates the conversion of MHM2Δ23-88 into MHM2ScΔ23-88, but to the contrary, the co-expressing MHM2Δ23-88 disturbs the conversion of wild-type PrPC into PrPSc.
Energy Technology Data Exchange (ETDEWEB)
Song, P.-J. [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Bernard, Serge [IFR135, F-37000 Tours (France); INRA, UR1282, IASP, 37380 Nouzilly (France)], E-mail: bernard@tours.inra.fr; Sarradin, Pierre [INRA, UR1282, IASP, 37380 Nouzilly (France); Vergote, Jackie [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Barc, Celine [INRA, UR1282, IASP, 37380 Nouzilly (France); Chalon, Sylvie [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Kung, M.-P.; Kung, Hank F. [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Pharmacology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Guilloteau, Denis [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France)
2008-02-15
Introduction: A potential single-photon emission computed tomography imaging agent for labeling of A{beta} plaques of Alzheimer's disease, IMPY (2-(4'-dimethylaminophenyl)-6-iodo-imidazo[1,2-a]pyridine), would be effective in detection of prion amyloid deposits in transmissible spongiform encephalopathies (TSEs). Methods: In vitro autoradiographic studies were carried out with [{sup 125}I]IMPY on brain sections from scrapie-infected mice and age-matched controls. Competition study was performed to evaluate the prion deposit binding specificity with nonradioactive IMPY. Results: Binding of [{sup 125}I]IMPY was observed in infected brain sections, while on age-matched control brain sections, there was no or very low labeling. Prion deposit binding was confirmed by histoblots with prion protein-specific monoclonal antibody 2D6. In the presence of nonradioactive IMPY, the binding of [{sup 125}I]IMPY was significantly inhibited in all regions studied. Conclusions: These findings indicate that IMPY can detect the prion deposits in vitro in scrapie-infected mice. Labeled with {sup 123}I, this ligand may be useful to quantitate prion deposit burdens in TSEs by in vivo imaging.
Kraus, Allison; Raymond, Gregory J; Race, Brent; Campbell, Katrina J; Hughson, Andrew G; Anson, Kelsie J; Raymond, Lynne D; Caughey, Byron
2017-11-01
. Here we have compared the combined effects of prion seeding and mutations of prion protein (PrP) on the structure and transmission properties of synthetic PrP aggregates. Our results highlight the influence of specific sequence features in the normally unstructured region of PrP that influence the infectious and neuropathogenic properties of PrP-derived aggregates. Copyright © 2017 American Society for Microbiology.
Prion disease. The characteristics and diagnostic points in Japan
International Nuclear Information System (INIS)
Sanjo, Nobuo; Mizusawa, Hidehiro
2010-01-01
Prion disease develops when normal prion proteins change into transmissible abnormal prion proteins and the converted proteins accumulate in the brain. The Japanese Creutzfeldt-Jakob Disease (CJD) Surveillance Committee has identified 1,320 patients with prion diseases in the 10 years since 1999 (classified into 3 types: sporadic, 77.2%; hereditary, 16.7%; and environmentally acquired, 6.1%). Compared with patients in other countries, a relatively larger number of Japanese patients characteristically have dura mater graft-associated CJD and hereditary prion diseases. All the environmentally acquired cases, except 1 case of variant CJD, were acquired from dura grafts. Although most patients were diagnosed with a classical subtype of sporadic CJD (sCJD), whose features include rapidly progressing dementia, myoclonus, hyperintensity in the cerebral cortex and basal ganglia in diffusion-weighted magnetic resonance imaging, and periodic synchronous discharge in electroencephalography, the number of cases with atypical symptoms, such as MM2 (0.8%), MV2 (0.2%), VV1 (0%), and VV2 (0.2%) subtypes of sCJD cases, was not negligible. Appropriate diagnosis should be made based on clinical features, neuroradiological findings, cerebrospinal fluid (CSF) findings (14-3-3 and total tau proteins), and genetic analysis of polymorphisms. Hereditary prion diseases are classified into 3 major phenotypes: familial CJD (fCJD); Gerstmann-Straeussler-Scheinker disease (GSS), which mainly presents as spinocerebellar ataxia; and fatal familial insomnia. Many mutations of the prion protein gene have been identified, but V1801 (fCJD), P102L (GSS), and E200K (fCJD) mutations were the most common among the fCJD cases in Japan. Without a family history, genetic testing is necessary to distinguish even seemingly ''sporadic'' CJD from fCJD. Accurate diagnosis is important for clarification of the pathological process, prevention of secondary infection, and also psychological support. (author)
Chen, Songjie; Hu, Hui; Miao, Shushu; Zheng, Jiayong; Xie, Zhijian; Zhao, Hui
2017-05-01
Oral squamous cell carcinoma is one of the most common neoplasm in the world. Despite the improvements in diagnosis and treatment, the outcome is still poor now. Thus, the development of novel therapeuticapproaches is needed. The aim of this study is to assess the synergistic anti-tumor effect of andrographolide with cisplatin (DDP) in oral squamous cell carcinoma CAL-27 cells in vitro and in vivo. We performed Cell Counting Kit-8 proliferation assay, apoptosis assay, and western blotting on CAL-27 cells treated with andrographolide, DDP or the combination in vitro. In vivo, we also treated CAL-27 xenografts with andrographolide or the combination, and performed terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay and immunohistochemical analysis of Ki-67. The results showed the combination of andrographolide and DDP synergistically inhibited CAL-27 cell proliferation in vitro and caused tumor regression in vivo in the CAL-27 xenografts. In addition, the synergistic anti-tumor effect of andrographolide with synergistic was due to an enhanced apoptosis. Moreover, the combination therapy upregulated the expression level of p-p53 in vitro and decreased Ki-67 expression in vivo. Our data indicate that the combination treatment of andrographolide and DDP results in synergistic anti-tumor growth activity against oral squamous cell carcinoma CAL-27 in vitro and in vivo. These results demonstrated that combination of andrographolide with DDP was likely to represent a potential therapeutic strategy for oral squamous cell carcinoma.
Cho, Byoung Ok; Che, Denis Nchang; Yin, Hong Hua; Shin, Jae Young; Jang, Seon Il
2017-05-01
Atopic dermatitis, a chronic relapsing and pruritic inflammation of the skin also thought to be involved in, or caused by immune system destruction is an upsetting health problem due to its continuously increasing incidence especially in developed countries. Mast cell infiltration in atopic dermatitis skin lesions and its IgE-mediated activation releases various cytokines and chemokines that have been implicated in the pathogenesis of atopic dermatitis. This study was aimed at investigating synergistic anti-inflammatory, anti-pruritic and anti-atopic dermatitis effects of Diospyros lotus leaf extract (DLE) and Muscat bailey A grapefruit stem extract (GFSE) in atopic dermatitis-like induced skin lesions in mice. Combinations of DLE and GFSE inhibited TNF-α and IL-6 production more than DLE or GFSE in PMA plus calcium ionophore A23187-activated HMC-1 cells. DLE and GFSE synergistically inhibited compound 48/80-induced dermal infiltration of mast cells and reduced scratching behavior than DLE or GFSE. Furthermore, DLE and GFSE synergistically showed a stronger ameliorative effect in skin lesions by reducing clinical scores; dermal infiltration of mast cells; ear and dorsal skin thickness; serum IgE and IL-4 production in atopic dermatitis-like mice. Collectively, these results suggest that DLE and GFSE synergistically exhibit anti-atopic dermatitis effects in atopic dermatitis-like skin lesions in mice. Copyright © 2017. Published by Elsevier Masson SAS.
International Nuclear Information System (INIS)
Mylonaki, Effie; Manika, Katerina; Zarogoulidis, Paul; Domvri, Kalliopi; Voutsas, Vasilis; Zarogoulidis, Kostas; Mourelatos, Dionysios
2012-01-01
Highlights: ► SCEs in vivo, a possible predictor of tumor chemoresponse. ► In vivo exposure to combined treatment, applying the SCE assay. ► Aminophylline enhances DNA instability induced by chemotherapy in vivo. ► In vivo synergistic effect of Aminophylline with the chemotherapeutic agents. - Abstract: Background: The anti-cancer and cytogenetic effects of aminophylline (AM) have been demonstrated in several clinical trials. The aim of the present study was to investigate the in vivo cytogenetic effects of AM in newly diagnosed patients with small cell (SCLC) and non-small cell lung cancer (NSCLC), receiving chemotherapy for the first time. Methods: Sister chromatid exchanges (SCEs) and proliferation rate index (PRI) were evaluated in peripheral blood lymphocyte cultures from six patients with SCLC and six patients with NSCLC after the in vitro addition of AM and after the in vivo administration of AM in patients receiving chemotherapy. Results: The in vitro addition of AM significantly increased SCEs only in SCLC patients (p 0.05). Conclusions: These observations suggest that AM enhances the results of concurrently administered chemotherapy by synergistically increasing its cytogenetic effects in patients with lung cancer
Effects of peptidyl-prolyl isomerase 1 depletion in animal models of prion diseases.
Legname, Giuseppe; Virgilio, Tommaso; Bistaffa, Edoardo; De Luca, Chiara Maria Giulia; Catania, Marcella; Zago, Paola; Isopi, Elisa; Campagnani, Ilaria; Tagliavini, Fabrizio; Giaccone, Giorgio; Moda, Fabio
2018-04-20
Pin1 is a peptidyl-prolyl isomerase that induces the cis-trans conversion of specific Ser/Thr-Pro peptide bonds in phosphorylated proteins, leading to conformational changes through which Pin1 regulates protein stability and activity. Since down-regulation of Pin1 has been described in several neurodegenerative disorders, including Alzheimer's Disease (AD), Parkinson's Disease (PD) and Huntington's Disease (HD), we investigated its potential role in prion diseases. Animals generated on wild-type (Pin1 +/+ ), hemizygous (Pin1 +/- ) or knock-out (Pin1 -/- ) background for Pin1 were experimentally infected with RML prions. The study indicates that, neither the total depletion nor reduced levels of Pin1 significantly altered the clinical and neuropathological features of the disease.
Sporn, Zachary A; Hines, Justin K
2015-01-01
Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.
A bovine cell line that can be infected by natural sheep scrapie prions.
Directory of Open Access Journals (Sweden)
Anja M Oelschlegel
Full Text Available Cell culture systems represent a crucial part in basic prion research; yet, cell lines that are susceptible to prions, especially to field isolated prions that were not adapted to rodents, are very rare. The purpose of this study was to identify and characterize a cell line that was susceptible to ruminant-derived prions and to establish a stable prion infection within it. Based on species and tissue of origin as well as PrP expression rate, we pre-selected a total of 33 cell lines that were then challenged with natural and with mouse propagated BSE or scrapie inocula. Here, we report the successful infection of a non-transgenic bovine cell line, a sub-line of the bovine kidney cell line MDBK, with natural sheep scrapie prions. This cell line retained the scrapie infection for more than 200 passages. Selective cloning resulted in cell populations with increased accumulation of PrPres, although this treatment was not mandatory for retaining the infection. The infection remained stable, even under suboptimal culture conditions. The resulting infectivity of the cells was confirmed by mouse bioassay (Tgbov mice, Tgshp mice. We believe that PES cells used together with other prion permissive cell lines will prove a valuable tool for ongoing efforts to understand and defeat prions and prion diseases.
Prion pathogenesis is unaltered in the absence of SIRPα-mediated "don't-eat-me" signaling.
Directory of Open Access Journals (Sweden)
Mario Nuvolone
Full Text Available Prion diseases are neurodegenerative conditions caused by misfolding of the prion protein, leading to conspicuous neuronal loss and intense microgliosis. Recent experimental evidence point towards a protective role of microglia against prion-induced neurodegeneration, possibly through elimination of prion-containing apoptotic bodies. The molecular mechanisms by which microglia recognize and eliminate apoptotic cells in the context of prion diseases are poorly defined. Here we investigated the possible involvement of signal regulatory protein α (SIRPα, a key modulator of host cell phagocytosis; SIRPα is encoded by the Sirpa gene that is genetically linked to the prion gene Prnp. We found that Sirpa transcripts are highly enriched in microglia cells within the brain. However, Sirpa mRNA levels were essentially unaltered during the course of experimental prion disease despite upregulation of other microglia-enriched transcripts. To study the involvement of SIRPα in prion pathogenesis in vivo, mice expressing a truncated SIRPα protein unable to inhibit phagocytosis were inoculated with rodent-adapted scrapie prions of the 22L strain. Homozygous and heterozygous Sirpa mutants and wild-type mice experienced similar incubation times after inoculation with either of two doses of 22L prions. Moreover, the extent of neuronal loss, microgliosis and abnormal prion protein accumulation was not significantly affected by Sirpa genotypes. Collectively, these data indicate that SIRPα-mediated phagocytosis is not a major determinant in prion disease pathogenesis. It will be important to search for additional candidates mediating prion phagocytosis, as this mechanism may represent an important target of antiprion therapies.
Directory of Open Access Journals (Sweden)
Maxime Belondrade
Full Text Available The prevalence of variant Creutzfeldt-Jakob disease (vCJD in the population remains uncertain, although it has been estimated that 1 in 2000 people in the United Kingdom are positive for abnormal prion protein (PrPTSE by a recent survey of archived appendix tissues. The prominent lymphotropism of vCJD prions raises the possibility that some surgical procedures may be at risk of iatrogenic vCJD transmission in healthcare facilities. It is therefore vital that decontamination procedures applied to medical devices before their reprocessing are thoroughly validated. A current limitation is the lack of a rapid model permissive to human prions. Here, we developed a prion detection assay based on protein misfolding cyclic amplification (PMCA technology combined with stainless-steel wire surfaces as carriers of prions (Surf-PMCA. This assay allowed the specific detection of minute quantities (10-8 brain dilution of either human vCJD or ovine scrapie PrPTSE adsorbed onto a single steel wire, within a two week timeframe. Using Surf-PMCA we evaluated the performance of several reference and commercially available prion-specific decontamination procedures. Surprisingly, we found the efficiency of several marketed reagents to remove human vCJD PrPTSE was lower than expected. Overall, our results demonstrate that Surf-PMCA can be used as a rapid and ultrasensitive assay for the detection of human vCJD PrPTSE adsorbed onto a metallic surface, therefore facilitating the development and validation of decontamination procedures against human prions.
Role of galectin-3 in prion infections of the CNS
International Nuclear Information System (INIS)
Mok, Simon W.F.; Riemer, Constanze; Madela, Kazimierz; Hsu, Daniel K.; Liu, Fu-Tong; Gueltner, Sandra; Heise, Ines; Baier, Michael
2007-01-01
Galectin-3 is a multi-functional protein and participates in mediating inflammatory reactions. The pronounced overexpression of galectin-3 in prion-infected brain tissue prompted us to study the role of this protein in a murine prion model. Immunofluorescence double-labelling identified microglia as the major cell type expressing galectin-3. Ablation of galectin-3 did not affect PrP Sc -deposition and development of gliosis. However, galectin-3 -/- -mice showed prolonged survival times upon intracerebral and peripheral scrapie infections. Moreover, protein levels of the lysosomal activation marker LAMP-2 were markedly reduced in prion-infected galectin-3 -/- -mice suggesting a role of galectin-3 in regulation of lysosomal functions. Lower mRNA levels of Beclin-1 and Atg5 in prion-infected wild-type and galectin-3 -/- -mice indicated an impairment of autophagy although autophagosome formation was unchanged. The results point towards a detrimental role of galectin-3 in prion infections of the CNS and suggest that endo-/lysosomal dysfunction in combination with reduced autophagy may contribute to disease development
Pin1 and neurodegeneration: a new player for prion disorders?
Directory of Open Access Journals (Sweden)
Elisa Isopi
2015-07-01
Full Text Available Pin1 is a peptidyl-prolyl isomerase that catalyzes the cis/trans conversion of phosphorylated proteins at serine or threonine residues which precede a proline. The peptidyl-prolyl isomerization induces a conformational change of the proteins involved in cell signaling process. Pin1 dysregulation has been associated with some neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and Huntington's disease. Proline-directed phosphorylation is a common regulator of these pathologies and a recent work showed that it is also involved in prion disorders. In fact, prion protein phosphorylation at the Ser-43-Pro motif induces prion protein conversion into a disease-associated form. Furthermore, phosphorylation at Ser-43-Pro has been observed to increase in the cerebral spinal fluid of sporadic Creutzfeldt-Jakob Disease patients. These findings provide new insights into the pathogenesis of prion disorders, suggesting Pin1 as a potential new player in the disease. In this paper, we review the mechanisms underlying Pin1 involvement in the aforementioned neurodegenerative pathologies focusing on the potential role of Pin1 in prion disorders.
Speldewinde, Shaun H.; Tuite, Mick F.
2017-01-01
Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054
Directory of Open Access Journals (Sweden)
Rupak Pathak
2016-11-01
Full Text Available Statins; a class of routinely prescribed cholesterol-lowering drugs; inhibit 3-hydroxy-3-methylglutaryl-coenzymeA reductase (HMGCR and strongly induce endothelial thrombomodulin (TM; which is known to have anti-inflammatory; anti-coagulation; anti-oxidant; and radioprotective properties. However; high-dose toxicity limits the clinical use of statins. The vitamin E family member gamma-tocotrienol (GT3 also suppresses HMGCR activity and induces TM expression without causing significant adverse side effects; even at high concentrations. To investigate the synergistic effect of statins and GT3 on TM; a low dose of atorvastatin and GT3 was used to treat human primary endothelial cells. Protein-level TM expression was measured by flow cytometry. TM functional activity was determined by activated protein C (APC generation assay. Expression of Kruppel-like factor 2 (KLF2, one of the key transcription factors of TM, was measured by quantitative reverse transcription polymerase chain reaction (qRT-PCR. TM expression increased in a dose-dependent manner after both atorvastatin and GT3 treatment. A combined treatment of a low-dose of atorvastatin and GT3 synergistically up-regulated TM expression and functional activity. Finally; atorvastatin and GT3 synergistically increased KLF2 expression. These findings suggest that combined treatment of statins with GT3 may provide significant health benefits in treating a number of pathophysiological conditions; including inflammatory and cardiovascular diseases.
Magnetocaloric Effect and Thermoelectric Cooling - A Synergistic Cooling Technology
2018-01-16
Thermoelectric Cooling - A Synergistic Cooling Technology Sb. GRANT NUMBER N00173-14-1-G016 Sc. PROGRAM ELEMENT NUMBER 82-2020-17 6. AUTHOR(S) 5d...Magnetocaloric Effect and Thermoelectric Cooling - A Synergistic Cooling Technology NRL Grant N00173-14-l-G016 CODE 8200: Spacecraft Engineering Department...82-11-0 1: Space and Space Systems Technology General Engineering & Research, L.L.C. Technical & Administrative point of contact: Dr. Robin
Assessment of the PrPc Amino-Terminal Domain in Prion Species Barriers.
Davenport, Kristen A; Henderson, Davin M; Mathiason, Candace K; Hoover, Edward A
2016-12-01
Chronic wasting disease (CWD) in cervids and bovine spongiform encephalopathy (BSE) in cattle are prion diseases that are caused by the same protein-misfolding mechanism, but they appear to pose different risks to humans. We are interested in understanding the differences between the species barriers of CWD and BSE. We used real-time, quaking-induced conversion (RT-QuIC) to model the central molecular event in prion disease, the templated misfolding of the normal prion protein, PrP c , to a pathogenic, amyloid isoform, scrapie prion protein, PrP Sc We examined the role of the PrP c amino-terminal domain (N-terminal domain [NTD], amino acids [aa] 23 to 90) in cross-species conversion by comparing the conversion efficiency of various prion seeds in either full-length (aa 23 to 231) or truncated (aa 90 to 231) PrP c We demonstrate that the presence of white-tailed deer and bovine NTDs hindered seeded conversion of PrP c , but human and bank vole NTDs did the opposite. Additionally, full-length human and bank vole PrP c s were more likely to be converted to amyloid by CWD prions than were their truncated forms. A chimera with replacement of the human NTD by the bovine NTD resembled human PrP c The requirement for an NTD, but not for the specific human sequence, suggests that the NTD interacts with other regions of the human PrP c to increase promiscuity. These data contribute to the evidence that, in addition to primary sequence, prion species barriers are controlled by interactions of the substrate NTD with the rest of the substrate PrP c molecule. We demonstrate that the amino-terminal domain of the normal prion protein, PrP c , hinders seeded conversion of bovine and white-tailed deer PrP c s to the prion forms, but it facilitates conversion of the human and bank vole PrP c s to the prion forms. Additionally, we demonstrate that the amino-terminal domain of human and bank vole PrP c s requires interaction with the rest of the molecule to facilitate conversion by CWD
The tip of the iceberg: RNA-binding proteins with prion-like domains in neurodegenerative disease
King, Oliver D.; Gitler, Aaron D.; Shorter, James
2012-01-01
Prions are self-templating protein conformers that are naturally transmitted between individuals and promote phenotypic change. In yeast, prion-encoded phenotypes can be beneficial, neutral or deleterious depending upon genetic background and environmental conditions. A distinctive and portable ‘prion domain’ enriched in asparagine, glutamine, tyrosine and glycine residues unifies the majority of yeast prion proteins. Deletion of this domain precludes prionogenesis and appending this domain to reporter proteins can confer prionogenicity. An algorithm designed to detect prion domains has successfully identified 19 domains that can confer prion behavior. Scouring the human genome with this algorithm enriches a select group of RNA-binding proteins harboring a canonical RNA recognition motif (RRM) and a putative prion domain. Indeed, of 210 human RRM-bearing proteins, 29 have a putative prion domain, and 12 of these are in the top 60 prion candidates in the entire genome. Startlingly, these RNA-binding prion candidates are inexorably emerging, one by one, in the pathology and genetics of devastating neurodegenerative disorders, including: amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U), Alzheimer’s disease and Huntington’s disease. For example, FUS and TDP-43, which rank 1st and 10th among RRM-bearing prion candidates, form cytoplasmic inclusions in the degenerating motor neurons of ALS patients and mutations in TDP-43 and FUS cause familial ALS. Recently, perturbed RNA-binding proteostasis of TAF15, which is the 2nd ranked RRM-bearing prion candidate, has been connected with ALS and FTLD-U. We strongly suspect that we have now merely reached the tip of the iceberg. We predict that additional RNA-binding prion candidates identified by our algorithm will soon surface as genetic modifiers or causes of diverse neurodegenerative conditions. Indeed, simple prion-like transfer mechanisms involving the
Clay components in soil dictate environmental stability and bioavailability of cervid prions in mice
Directory of Open Access Journals (Sweden)
A. Christy Wyckoff
2016-11-01
Full Text Available Chronic wasting disease affects cervids and is the only known prion disease to affect free-ranging wildlife populations. CWD spread continues unabated, and exact mechanisms of its seemingly facile spread among deer and elk across landscapes in North America remain elusive. Here we confirm that naturally contaminated soil contains infectious CWD prions that can be transmitted to susceptible model organisms. We show that smectite clay content of soil potentiates prion binding capacity of different soil types from CWD endemic and non-endemic areas, likely contributing to environmental stability of bound prions. The smectite clay montmorillonite (Mte increased prion retention and bioavailability in vivo. Trafficking experiments in live animals fed bound and unbound prions showed that mice retained significantly more Mte-bound than unbound prions. Mte promoted rapid uptake of prions from the stomach to the intestines via enterocytes and M cells, and then to macrophages and eventually CD21+ B cells in Peyer’s patches and spleens. These results confirm clay components in soil as an important vector in CWD transmission at both environmental and organismal levels.□
Abu-Serie, Marwa M; Habashy, Noha H; Attia, Wafaa E
2018-05-10
Since oxidative stress and inflammation are two linked factors in the pathogenesis of several human diseases. Thus identification of effective treatment is of great importance. Edible mushroom and microalgae are rich in the effective antioxidant phytochemicals. Hence, their beneficial effects on oxidative stress-associated inflammation are extremely required to be investigated. This study evaluated the functional constituents, antioxidant and anti-inflammatory activities of Malaysian Ganoderma lucidum aqueous extract (GLE) and Egyptian Chlorella vulgaris ethanolic extract (CVE). Also, the synergistic, addictive or antagonistic activities of the combination between the two extracts (GLE-CVE) were studied. Expression of inducible nitric oxide synthase, cyclooxygenase-2, and nuclear factor-kappa B, as well as levels of nitric oxide, tumor necrosis factor (TNF)-α, lipid peroxidation, reduced glutathione and antioxidant enzymes were determined using in vitro model of lipopolysaccharide-stimulated white blood cells.
Pros and cons of a prion-like pathogenesis in Parkinson's disease
Directory of Open Access Journals (Sweden)
Brotchie Jonathan M
2011-06-01
Full Text Available Abstract Background Parkinson's disease (PD is a slowly progressive neurodegenerative disorder which affects widespread areas of the brainstem, basal ganglia and cerebral cortex. A number of proteins are known to accumulate in parkinsonian brains including ubiquitin and α-synuclein. Prion diseases are sporadic, genetic or infectious disorders with various clinical and histopathological features caused by prion proteins as infectious proteinaceous particles transmitting a misfolded protein configuration through brain tissue. The most important form is Creutzfeldt-Jakob disease which is associated with a self-propagating pathological precursor form of the prion protein that is physiologically widely distributed in the central nervous system. Discussion It has recently been found that α-synuclein may behave similarly to the prion precursor and propagate between cells. The post-mortem proof of α-synuclein containing Lewy bodies in embryonic dopamine cells transplants in PD patient suggests that the misfolded protein might be transmitted from the diseased host to donor neurons reminiscent of prion behavior. The involvement of the basal ganglia and brainstem in the degenerative process are other congruencies between Parkinson's and Creutzfeldt-Jakob disease. However, a number of issues advise caution before categorizing Parkinson's disease as a prion disorder, because clinical appearance, brain imaging, cerebrospinal fluid and neuropathological findings exhibit fundamental differences between both disease entities. Most of all, infectiousness, a crucial hallmark of prion diseases, has never been observed in PD so far. Moreover, the cellular propagation of the prion protein has not been clearly defined and it is, therefore, difficult to assess the molecular similarities between the two disease entities. Summary At the current state of knowledge, the molecular pathways of transmissible pathogenic proteins are not yet fully understood. Their exact
Determining lower threshold concentrations for synergistic effects
DEFF Research Database (Denmark)
Bjergager, Maj-Britt Andersen; Dalhoff, Kristoffer; Kretschmann, Andreas
2017-01-01
which proven synergists cease to act as synergists towards the aquatic crustacean Daphnia magna. To do this, we compared several approaches and test-setups to evaluate which approach gives the most conservative estimate for the lower threshold for synergy for three known azole synergists. We focus...... on synergistic interactions between the pyrethroid insecticide, alpha-cypermethrin, and one of the three azole fungicides prochloraz, propiconazole or epoxiconazole measured on Daphnia magna immobilization. Three different experimental setups were applied: A standard 48h acute toxicity test, an adapted 48h test...... of immobile organisms increased more than two-fold above what was predicted by independent action (vertical assessment). All three tests confirmed the hypothesis of the existence of a lower azole threshold concentration below which no synergistic interaction was observed. The lower threshold concentration...
The most common hereditary prion disease is human Creutzfeldt-Jakob disease (CJD) associated with a mutation in the prion gene (PRNP) resulting in a glutamic acid to lysine substitution at position 200 (E200K) in the prion protein. Models of E200K CJD in transgenic mice have proven interesting but h...
Enzymatic formulation capable of degrading scrapie prion under mild digestion conditions.
Directory of Open Access Journals (Sweden)
Emeka A Okoroma
Full Text Available The prion agent is notoriously resistant to common proteases and conventional sterilisation procedures. The current methods known to destroy prion infectivity such as incineration, alkaline and thermal hydrolysis are harsh, destructive, environmentally polluting and potentially hazardous, thus limit their applications for decontamination of delicate medical and laboratory devices, remediation of prion contaminated environment and for processing animal by-products including specified risk materials and carcases. Therefore, an environmentally friendly, non-destructive enzymatic degradation approach is highly desirable. A feather-degrading Bacillus licheniformis N22 keratinase has been isolated which degraded scrapie prion to undetectable level of PrP(Sc signals as determined by Western Blot analysis. Prion infectivity was verified by ex vivo cell-based assay. An enzymatic formulation combining N22 keratinase and biosurfactant derived from Pseudomonas aeruginosa degraded PrP(Sc at 65 °C in 10 min to undetectable level -. A time-course degradation analysis carried out at 50 °C over 2 h revealed the progressive attenuation of PrP(Sc intensity. Test of residual infectivity by standard cell culture assay confirmed that the enzymatic formulation reduced PrP(Sc infectivity to undetectable levels as compared to cells challenged with untreated standard scrapie sheep prion (SSBP/1 (p-value = 0.008 at 95% confidence interval. This novel enzymatic formulation has significant potential application for prion decontamination in various environmentally friendly systems under mild treatment conditions.
Khalifé, Manal; Reine, Fabienne; Paquet-Fifield, Sophie; Castille, Johan; Herzog, Laetitia; Vilotte, Marthe; Moudjou, Mohammed; Moazami-Goudarzi, Katayoun; Makhzami, Samira; Passet, Bruno; Andréoletti, Olivier; Vilette, Didier; Laude, Hubert; Béringue, Vincent; Vilotte, Jean-Luc
2016-02-01
Mammalian prions are proteinaceous infectious agents composed of misfolded assemblies of the host-encoded, cellular prion protein (PrP). Physiologically, the N-terminal polybasic region of residues 23 to 31 of PrP has been shown to be involved in its endocytic trafficking and interactions with glycosaminoglycans or putative ectodomains of membrane-associated proteins. Several recent reports also describe this PrP region as important for the toxicity of mutant prion proteins and the efficiency of prion propagation, both in vitro and in vivo. The question remains as to whether the latter observations made with mouse PrP and mouse prions would be relevant to other PrP species/prion strain combinations given the dramatic impact on prion susceptibility of minimal amino acid substitutions and structural variations in PrP. Here, we report that transgenic mouse lines expressing ovine PrP with a deletion of residues 23 to 26 (KKRP) or mutated in this N-terminal region (KQHPH instead of KKRPK) exhibited a variable, strain-dependent susceptibility to prion infection with regard to the proportion of affected mice and disease tempo relative to findings in their wild-type counterparts. Deletion has no major effect on 127S scrapie prion pathogenesis, whereas mutation increased by almost 3-fold the survival time of the mice. Deletion marginally affected the incubation time of scrapie LA19K and ovine bovine spongiform encephalopathy (BSE) prions, whereas mutation caused apparent resistance to disease. Recent reports suggested that the N-terminal polybasic region of the prion protein could be a therapeutic target to prevent prion propagation or toxic signaling associated with more common neurodegenerative diseases such as Alzheimer's disease. Mutating or deleting this region in ovine PrP completes the data previously obtained with the mouse protein by identifying the key amino acid residues involved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Genetic prion disease: no role for the immune system in disease pathogenesis?
Friedman-Levi, Yael; Binyamin, Orli; Frid, Kati; Ovadia, Haim; Gabizon, Ruth
2014-08-01
Prion diseases, which can manifest by transmissible, sporadic or genetic etiologies, share several common features, such as a fatal neurodegenerative outcome and the aberrant accumulation of proteinase K (PK)-resistant PrP forms in the CNS. In infectious prion diseases, such as scrapie in mice, prions first replicate in immune organs, then invade the CNS via ascending peripheral tracts, finally causing death. Accelerated neuroinvasion and death occurs when activated prion-infected immune cells infiltrate into the CNS, as is the case for scrapie-infected mice induced for experimental autoimmune encephalomyelitis (EAE), a CNS inflammatory insult. To establish whether the immune system plays such a central role also in genetic prion diseases, we induced EAE in TgMHu2ME199K mice, a line mimicking for late onset genetic Creutzfeldt Jacob disease (gCJD), a human prion disease. We show here that EAE induction of TgMHu2ME199K mice neither accelerated nor aggravated prion disease manifestation. Concomitantly, we present evidence that PK-resistant PrP forms were absent from CNS immune infiltrates, and most surprisingly also from lymph nodes and spleens of TgMHu2ME199K mice at all ages and stages of disease. These results imply that the mechanism of genetic prion disease differs widely from that of the infectious presentation, and that the conversion of mutant PrPs into PK resistant forms occurs mostly/only in the CNS. If the absence of pathogenic PrP forms form immune organs is also true for gCJD patients, it may suggest their blood is devoid of prion infectivity. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.
2015-10-01
The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.
Do prion protein gene polymorphisms induce apoptosis in non ...
Indian Academy of Sciences (India)
2016-08-26
Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...
Investigating the conformational stability of prion strains through a kinetic replication model.
Directory of Open Access Journals (Sweden)
Mattia Zampieri
2009-07-01
Full Text Available Prion proteins are known to misfold into a range of different aggregated forms, showing different phenotypic and pathological states. Understanding strain specificities is an important problem in the field of prion disease. Little is known about which PrP(Sc structural properties and molecular mechanisms determine prion replication, disease progression and strain phenotype. The aim of this work is to investigate, through a mathematical model, how the structural stability of different aggregated forms can influence the kinetics of prion replication. The model-based results suggest that prion strains with different conformational stability undergoing in vivo replication are characterizable in primis by means of different rates of breakage. A further role seems to be played by the aggregation rate (i.e. the rate at which a prion fibril grows. The kinetic variability introduced in the model by these two parameters allows us to reproduce the different characteristic features of the various strains (e.g., fibrils' mean length and is coherent with all experimental observations concerning strain-specific behavior.
Directory of Open Access Journals (Sweden)
Jean-Noël Arsac
Full Text Available Transmissible spongiform encephalopathies (TSEs are a group of fatal neurodegenerative diseases associated with a misfolded form of host-encoded prion protein (PrP. Some of them, such as classical bovine spongiform encephalopathy in cattle (BSE, transmissible mink encephalopathy (TME, kuru and variant Creutzfeldt-Jakob disease in humans, are acquired by the oral route exposure to infected tissues. We investigated the possible transmission by the oral route of a panel of strains derived from ruminant prion diseases in a transgenic mouse model (TgOvPrP4 overexpressing the ovine prion protein (A136R154Q171 under the control of the neuron-specific enolase promoter. Sources derived from Nor98, CH1641 or 87V scrapie sources, as well as sources derived from L-type BSE or cattle-passaged TME, failed to transmit by the oral route, whereas those derived from classical BSE and classical scrapie were successfully transmitted. Apart from a possible effect of passage history of the TSE agent in the inocula, this implied the occurrence of subtle molecular changes in the protease-resistant prion protein (PrPres following oral transmission that can raises concerns about our ability to correctly identify sheep that might be orally infected by the BSE agent in the field. Our results provide proof of principle that transgenic mouse models can be used to examine the transmissibility of TSE agents by the oral route, providing novel insights regarding the pathogenesis of prion diseases.
Differentially expressed genes in iron-induced prion protein conversion
International Nuclear Information System (INIS)
Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong
2016-01-01
The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.
Prion propagation in cells expressing PrP glycosylation mutants.
Salamat, Muhammad K; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert
2011-04-01
Infection by prions involves conversion of a host-encoded cell surface protein (PrP(C)) to a disease-related isoform (PrP(Sc)). PrP(C) carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrP(C) glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrP(Sc) and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrP(Sc), while PrP(C) with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrP(C), were able to form infectious PrP(Sc). Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection.
Differences in the curing of [PSI+] prion by various methods of Hsp104 inactivation.
Directory of Open Access Journals (Sweden)
Yang-Nim Park
Full Text Available [PSI(+] yeast, containing the misfolded amyloid conformation of Sup35 prion, is cured by inactivation of Hsp104. There has been controversy as to whether inactivation of Hsp104 by guanidine treatment or by overexpression of the dominant negative Hsp104 mutant, Hsp104-2KT, cures [PSI(+] by the same mechanism- inhibition of the severing of the prion seeds. Using live cell imaging of Sup35-GFP, overexpression of Hsp104-2KT caused the foci to increase in size, then decrease in number, and finally disappear when the cells were cured, similar to that observed in cells cured by depletion of Hsp104. In contrast, guanidine initially caused an increase in foci size but then the foci disappeared before the cells were cured. By starving the yeast to make the foci visible in cells grown with guanidine, the number of cells with foci was found to correlate exactly with the number of [PSI(+] cells, regardless of the curing method. Therefore, the fluorescent foci are the prion seeds required for maintenance of [PSI(+] and inactivation of Hsp104 cures [PSI(+] by preventing severing of the prion seeds. During curing with guanidine, the reduction in seed size is an Hsp104-dependent effect that cannot be explained by limited severing of the seeds. Instead, in the presence of guanidine, Hsp104 retains an activity that trims or reduces the size of the prion seeds by releasing Sup35 molecules that are unable to form new prion seeds. This Hsp104 activity may also occur in propagating yeast.
Prion protein accumulation in lipid rafts of mouse aging brain.
Directory of Open Access Journals (Sweden)
Federica Agostini
Full Text Available The cellular form of the prion protein (PrP(C is a normal constituent of neuronal cell membranes. The protein misfolding causes rare neurodegenerative disorders known as transmissible spongiform encephalopathies or prion diseases. These maladies can be sporadic, genetic or infectious. Sporadic prion diseases are the most common form mainly affecting aging people. In this work, we investigate the biochemical environment in which sporadic prion diseases may develop, focusing our attention on the cell membrane of neurons in the aging brain. It is well established that with aging the ratio between the most abundant lipid components of rafts undergoes a major change: while cholesterol decreases, sphingomyelin content rises. Our results indicate that the aging process modifies the compartmentalization of PrP(C. In old mice, this change favors PrP(C accumulation in detergent-resistant membranes, particularly in hippocampi. To confirm the relationship between lipid content changes and PrP(C translocation into detergent-resistant membranes (DRMs, we looked at PrP(C compartmentalization in hippocampi from acid sphingomyelinase (ASM knockout (KO mice and synaptosomes enriched in sphingomyelin. In the presence of high sphingomyelin content, we observed a significant increase of PrP(C in DRMS. This process is not due to higher levels of total protein and it could, in turn, favor the onset of sporadic prion diseases during aging as it increases the PrP intermolecular contacts into lipid rafts. We observed that lowering sphingomyelin in scrapie-infected cells by using fumonisin B1 led to a 50% decrease in protease-resistant PrP formation. This may suggest an involvement of PrP lipid environment in prion formation and consequently it may play a role in the onset or development of sporadic forms of prion diseases.
Low copper and high manganese levels in prion protein plaques
Johnson, Christopher J.; Gilbert, P.U.P.A.; Abrecth, Mike; Baldwin, Katherine L.; Russell, Robin E.; Pedersen, Joel A.; McKenzie, Debbie
2013-01-01
Accumulation of aggregates rich in an abnormally folded form of the prion protein characterize the neurodegeneration caused by transmissible spongiform encephalopathies (TSEs). The molecular triggers of plaque formation and neurodegeneration remain unknown, but analyses of TSE-infected brain homogenates and preparations enriched for abnormal prion protein suggest that reduced levels of copper and increased levels of manganese are associated with disease. The objectives of this study were to: (1) assess copper and manganese levels in healthy and TSE-infected Syrian hamster brain homogenates; (2) determine if the distribution of these metals can be mapped in TSE-infected brain tissue using X-ray photoelectron emission microscopy (X-PEEM) with synchrotron radiation; and (3) use X-PEEM to assess the relative amounts of copper and manganese in prion plaques in situ. In agreement with studies of other TSEs and species, we found reduced brain levels of copper and increased levels of manganese associated with disease in our hamster model. We also found that the in situ levels of these metals in brainstem were sufficient to image by X-PEEM. Using immunolabeled prion plaques in directly adjacent tissue sections to identify regions to image by X-PEEM, we found a statistically significant relationship of copper-manganese dysregulation in prion plaques: copper was depleted whereas manganese was enriched. These data provide evidence for prion plaques altering local transition metal distribution in the TSE-infected central nervous system.
Directory of Open Access Journals (Sweden)
Mulualem E Tilahun
Full Text Available Staphylococcal enterotoxin B (SEB is one of a family of toxins secreted by Staphylococcus aureus that act as superantigens, activating a large fraction of the T-cell population and inducing production of high levels of inflammatory cytokines that can cause toxic shock syndrome (TSS and death. Extracellular engagement of the TCR of T-cells and class II MHC of antigen presenting cells by SEB triggers the activation of many intracellular signaling processes. We engineered chimeric antibodies to block the extracellular engagement of cellular receptors by SEB and used a statin to inhibit intracellular signaling. Chimeric human-mouse antibodies directed against different neutralizing epitopes of SEB synergistically inhibited its activation of human T-cells in vitro. In the in vivo model of lethal toxic shock syndrome (TSS in HLA-DR3 transgenic mice, two of these antibodies conferred significant partial protection when administered individually, but offered complete protection in a synergistic manner when given together. Similarly, in vivo, lovastatin alone conferred only partial protection from TSS similar to single anti-SEB antibodies. However, used in combination with one chimeric neutralizing anti-SEB antibody, lovastatin provided complete protection against lethal TSS in HLA-DR3 transgenic mice. These experiments demonstrate that in vivo protection against lethal doses of SEB can be achieved by a statin of proven clinical safety and chimeric human-mouse antibodies, agents now widely used and known to be of low immunogenicity in human hosts.
Zhao, Xiaofei; Kong, Feng; Wang, Lei; Zhang, Han
2017-01-01
Choroidal melanoma is the most common primary malignant intraocular tumor, and very few effective therapies are available to treat it. Our study aimed to understand whether pemetrexed plus cisplatin exerts a beneficial synergistic effect in human choroidal melanoma cells and to delineate the underlying molecular mechanism. To accomplish these aims, we treated choroidal melanoma cells with pemetrexed and cisplatin and assessed cell survival with SRB and MTT assays. Proteins were detected using western blotting analysis. NOXA and CHOP were knocked down with siRNA. We found that pemetrexed or cisplatin alone inhibited survival and induced apoptosis in human choroidal melanoma cells. Furthermore, the expression levels of c-FLIP, an anti-apoptotic protein in the extrinsic apoptosis pathway, and Mcl-1, an anti-apoptotic protein in the intrinsic apoptosis pathway, were decreased by pemetrexed or cisplatin respectively, while the expression of a pro-apoptotic protein in the intrinsic apoptosis pathway, NOXA, was up-regulated. Moreover, pemetrexed or cisplatin alone increased the protein expression of the endoplasmic reticulum stress markers IRE1α, Bip and CHOP. Silencing CHOP expression reduced NOXA expression. These findings suggest that the pemetrexed or cisplatin induced intrinsic apoptosis via activation of the ER stress response. Importantly, combining the two compounds more strongly induced apoptosis. Following the cotreatment, CHOP and NOXA expression increased, while c-FLIP and Mcl-1 expression decreased, and these effects were more pronounced than when using either compound alone. This result suggests that pemetrexed and cisplatin synergistically activate ER stress response-induced apoptosis in choroidal melanoma cells. To summarize, the c-FLIP and NOXA/Mcl-1 axis participated in the synergistic effect of pemetrexed plus cisplatin in human choroidal melanoma cells. Intrinsic apoptosis was induced via activation of the ER stress response. Our study provides
A dominant-negative mutant inhibits multiple prion variants through a common mechanism.
Directory of Open Access Journals (Sweden)
Fen Pei
2017-10-01
Full Text Available Prions adopt alternative, self-replicating protein conformations and thereby determine novel phenotypes that are often irreversible. Nevertheless, dominant-negative prion mutants can revert phenotypes associated with some conformations. These observations suggest that, while intervention is possible, distinct inhibitors must be developed to overcome the conformational plasticity of prions. To understand the basis of this specificity, we determined the impact of the G58D mutant of the Sup35 prion on three of its conformational variants, which form amyloids in S. cerevisiae. G58D had been previously proposed to have unique effects on these variants, but our studies suggest a common mechanism. All variants, including those reported to be resistant, are inhibited by G58D but at distinct doses. G58D lowers the kinetic stability of the associated amyloid, enhancing its fragmentation by molecular chaperones, promoting Sup35 resolubilization, and leading to amyloid clearance particularly in daughter cells. Reducing the availability or activity of the chaperone Hsp104, even transiently, reverses curing. Thus, the specificity of inhibition is determined by the sensitivity of variants to the mutant dosage rather than mode of action, challenging the view that a unique inhibitor must be developed to combat each variant.
Synergistic Enhancement of Cancer Therapy Using a Combination of Ceramide and Docetaxel
Directory of Open Access Journals (Sweden)
Li-Xia Feng
2014-03-01
Full Text Available Ceramide (CE-based combination therapy (CE combination as a novel therapeutic strategy has attracted great attention in the field of anti-cancer therapy. The principal purposes of this study were to investigate the synergistic effect of CE in combination with docetaxel (DTX (CE + DTX and to explore the synergy mechanisms of CE + DTX. The 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT and combination index (CI assay showed that simultaneous administration of CE and DTX with a molar ratio of 0.5:1 could generate the optimal synergistic effect on murine malignant melanoma cell (B16, CI = 0.31 and human breast carcinoma cell (MCF-7, CI = 0.48. The apoptosis, cell cycle, and cytoskeleton destruction study demonstrated that CE could target and destruct the microfilament actin, subsequently activate Caspase-3 and induce apoptosis. Meanwhile, DTX could target and disrupt the microtubules cytoskeleton, leading to a high proportion of cancer cells in G2/M-phase arrest. Moreover, CE plus DTX could cause a synergistic destruction of cytoskeleton, which resulted in a significantly higher apoptosis and a significantly higher arrest in G2/M arrest comparing with either agent alone (p < 0.01. The in vivo antitumor study evaluated in B16 tumor-bearing mice also validated the synergistic effects. All these results suggested that CE could enhance the antitumor activity of DTX in a synergistic manner, which suggest promising application prospects of CE + DTX combination treatment.
Directory of Open Access Journals (Sweden)
Christine R Langlois
2016-11-01
Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.
Hara, Hideyuki; Miyata, Hironori; Das, Nandita Rani; Chida, Junji; Yoshimochi, Tatenobu; Uchiyama, Keiji; Watanabe, Hitomi; Kondoh, Gen; Yokoyama, Takashi; Sakaguchi, Suehiro
2018-01-01
Conformational conversion of the cellular isoform of prion protein, PrP C , into the abnormally folded, amyloidogenic isoform, PrP Sc , is a key pathogenic event in prion diseases, including Creutzfeldt-Jakob disease in humans and scrapie and bovine spongiform encephalopathy (BSE) in animals. We previously reported that the octapeptide repeat (OR) region could be dispensable for converting PrP C into PrP Sc after infection with RML prions. We demonstrated that mice transgenically expressing mouse PrP with deletion of the OR region on the PrP knockout background, designated Tg(PrPΔOR)/ Prnp 0 / 0 mice, did not show reduced susceptibility to RML scrapie prions, with abundant accumulation of PrP Sc ΔOR in their brains. We show here that Tg(PrPΔOR)/ Prnp 0 / 0 mice were highly resistant to BSE prions, developing the disease with markedly elongated incubation times after infection with BSE prions. The conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed in their brains. These results suggest that the OR region may have a crucial role in the conversion of PrP C into PrP Sc after infection with BSE prions. However, Tg(PrPΔOR)/ Prnp 0 / 0 mice remained susceptible to RML and 22L scrapie prions, developing the disease without elongated incubation times after infection with RML and 22L prions. PrP Sc ΔOR accumulated only slightly less in the brains of RML- or 22L-infected Tg(PrPΔOR)/ Prnp 0 / 0 mice than PrP Sc in control wild-type mice. Taken together, these results indicate that the OR region of PrP C could play a differential role in the pathogenesis of BSE prions and RML or 22L scrapie prions. IMPORTANCE Structure-function relationship studies of PrP C conformational conversion into PrP Sc are worthwhile to understand the mechanism of the conversion of PrP C into PrP Sc We show here that, by inoculating Tg(PrPΔOR)/ Prnp 0 / 0 mice with the three different strains of RML, 22L, and BSE prions, the OR region could play a differential role in the conversion of
International Nuclear Information System (INIS)
Haigh, Cathryn L.; Drew, Simon C.
2015-01-01
The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation
Energy Technology Data Exchange (ETDEWEB)
Haigh, Cathryn L., E-mail: chaigh@unimelb.edu.au [Department of Pathology, The University of Melbourne, Victoria 3010 (Australia); Drew, Simon C., E-mail: sdrew@unimelb.edu.au [Florey Department of Neuroscience and Mental Health, The University of Melbourne, Victoria 3010 (Australia)
2015-06-05
The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation.
Synergistic effects in mixed Escherichia coli biofilms
DEFF Research Database (Denmark)
Reisner, A.; Holler, B.M.; Molin, Søren
2006-01-01
Bacterial biofilms, often composed of multiple species and genetically distinct strains, develop under complex influences of cell-cell interactions. Although detailed knowledge about the mechanisms underlying formation of single-species laboratory biofilms has emerged, little is known about...... the pathways governing development of more complex heterogeneous communities. In this study, we established a laboratory model where biofilm-stimulating effects due to interactions between genetically diverse strains of Escherichia coli were monitored. Synergistic induction of biofilm formation resulting from...... the cocultivation of 403 undomesticated E. coli strains with a characterized E. coli K-12 strain was detected at a significant frequency. The survey suggests that different mechanisms underlie the observed stimulation, yet synergistic development of biofilm within the subset of E. coli isolates (n = 56) exhibiting...
Engineered bacterial hydrophobic oligopeptide repeats in a synthetic yeast prion, [REP-PSI+
Directory of Open Access Journals (Sweden)
Fátima eGasset-Rosa
2015-04-01
Full Text Available The yeast translation termination factor Sup35p, by aggregating as the [PSI+] prion, enables ribosomes to read-through stop codons, thus expanding the diversity of the Saccharomyces cerevisiae proteome. Yeast prions are functional amyloids that replicate by templating their conformation on native protein molecules, then assembling as large aggregates and fibers. Prions propagate epigenetically from mother to daughter cells by fragmentation of such assemblies. In the N-terminal prion-forming domain, Sup35p has glutamine/asparagine-rich oligopeptide repeats (OPRs, which enable propagation through chaperone-elicited shearing. We have engineered chimeras by replacing the polar OPRs in Sup35p by up to five repeats of a hydrophobic amyloidogenic sequence from the synthetic bacterial prionoid RepA-WH1. The resulting hybrid, [REP-PSI+], i was functional in a stop codon read-through assay in S. cerevisiae; ii generates weak phenotypic variants upon both its expression or transformation into [psi-] cells; iii these variants correlated with high molecular weight aggregates resistant to SDS during electrophoresis; and iv according to fluorescence microscopy, the fusion of the prion domains from the engineered chimeras to the reporter protein mCherry generated perivacuolar aggregate foci in yeast cells. All these are signatures of bona fide yeast prions. As assessed through biophysical approaches, the chimeras assembled as oligomers rather than as the fibers characteristic of [PSI+]. These results suggest that it is the balance between polar and hydrophobic residues in OPRs what determines prion conformational dynamics. In addition, our findings illustrate the feasibility of enabling new propagation traits in yeast prions by engineering OPRs with heterologous amyloidogenic sequence repeats.
Modelling synergistic effects of appetite regulating hormones
DEFF Research Database (Denmark)
Schmidt, Julie Berg; Ritz, Christian
2016-01-01
We briefly reviewed one definition of dose addition, which is applicable within the framework of generalized linear models. We established how this definition of dose addition corresponds to effect addition in case only two doses per compound are considered for evaluating synergistic effects. The....... The link between definitions was exemplified for an appetite study where two appetite hormones were studied....
Synergistic effect of Glomus fasciculatum and Trichoderma ...
African Journals Online (AJOL)
The plants treated with both fungus and mycorrhizal (F+M) treatment showed the maximum uptake of metals and thus the synergistic effect of these fungi can be exploited in decontamination of metals from tannery sludge. Key words: Phytoextraction, tannery sludge, heavy metals, resistant rhizosphere fungi, Arbuscular ...
Imberdis, Thibaut; Ayrolles-Torro, Adeline; Duarte Rodrigues, Alysson; Torrent, Joan; Alvarez-Martinez, Maria Teresa; Kovacs, Gabor G; Verdier, Jean-Michel; Robitzer, Mike; Perrier, Véronique
2016-01-26
Prion diseases are characterized by the accumulation in the central nervous system of an abnormally folded isoform of the prion protein, named PrP(Sc). Aggregation of PrP(Sc) into oligomers and fibrils is critically involved in the pathogenesis of prion diseases. Oligomers are supposed to be the key neurotoxic agents in prion disease, so modulation of prion aggregation pathways with small molecules can be a valuable strategy for studying prion pathogenicity and for developing new diagnostic and therapeutic approaches. We previously identified thienyl pyrimidine compounds that induce SDS-resistant PrP(Sc) (rSDS-PrP(Sc)) oligomers in prion-infected samples. Due to the low effective doses of the thienyl pyrimidine hits, we synthesized a quaterthiophene-bis-triazine compound, called MR100 to better evaluate their diagnostic and therapeutic potentials. This molecule exhibits a powerful activity inducing rSDS-PrP(Sc) oligomers at nanomolar concentrations in prion-infected cells. Fluorescence interaction studies of MR100 with mouse PrP fibrils showed substantial modification of the spectrum, and the interaction was confirmed in vitro by production of rSDS-oligomer species upon incubation of MR100 with fibrils in SDS-PAGE gel. We further explored whether MR100 compound has a potential to be used in the diagnosis of prion diseases. Our results showed that: (i) MR100 can detect rSDS-oligomers in prion-infected brain homogenates of various species, including human samples from CJD patients; (ii) A protocol, called "Rapid Centrifugation Assay" (RCA), was developed based on MR100 property of inducing rSDS-PrP(Sc) oligomers only in prion-infected samples, and avoiding the protease digestion step. RCA allows the detection of both PK-sensitive and PK-resistant PrP(Sc) species in rodents samples but also from patients with different CJD forms (sporadic and new variant); (iii) A correlation could be established between the amount of rSDS-PrP(Sc) oligomers revealed by MR100 and the
Transmission Properties of Human PrP 102L Prions Challenge the Relevance of Mouse Models of GSS.
Asante, Emmanuel A; Grimshaw, Andrew; Smidak, Michelle; Jakubcova, Tatiana; Tomlinson, Andrew; Jeelani, Asif; Hamdan, Shyma; Powell, Caroline; Joiner, Susan; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2015-07-01
Inherited prion disease (IPD) is caused by autosomal-dominant pathogenic mutations in the human prion protein (PrP) gene (PRNP). A proline to leucine substitution at PrP residue 102 (P102L) is classically associated with Gerstmann-Sträussler-Scheinker (GSS) disease but shows marked clinical and neuropathological variability within kindreds that may be caused by variable propagation of distinct prion strains generated from either PrP 102L or wild type PrP. To-date the transmission properties of prions propagated in P102L patients remain ill-defined. Multiple mouse models of GSS have focused on mutating the corresponding residue of murine PrP (P101L), however murine PrP 101L, a novel PrP primary structure, may not have the repertoire of pathogenic prion conformations necessary to accurately model the human disease. Here we describe the transmission properties of prions generated in human PrP 102L expressing transgenic mice that were generated after primary challenge with ex vivo human GSS P102L or classical CJD prions. We show that distinct strains of prions were generated in these mice dependent upon source of the inoculum (either GSS P102L or CJD brain) and have designated these GSS-102L and CJD-102L prions, respectively. GSS-102L prions have transmission properties distinct from all prion strains seen in sporadic and acquired human prion disease. Significantly, GSS-102L prions appear incapable of transmitting disease to conventional mice expressing wild type mouse PrP, which contrasts strikingly with the reported transmission properties of prions generated in GSS P102L-challenged mice expressing mouse PrP 101L. We conclude that future transgenic modeling of IPDs should focus exclusively on expression of mutant human PrP, as other approaches may generate novel experimental prion strains that are unrelated to human disease.
The Structural Architecture of an Infectious Mammalian Prion Using Electron Cryomicroscopy.
Directory of Open Access Journals (Sweden)
Ester Vázquez-Fernández
2016-09-01
Full Text Available The structure of the infectious prion protein (PrPSc, which is responsible for Creutzfeldt-Jakob disease in humans and bovine spongiform encephalopathy, has escaped all attempts at elucidation due to its insolubility and propensity to aggregate. PrPSc replicates by converting the non-infectious, cellular prion protein (PrPC into the misfolded, infectious conformer through an unknown mechanism. PrPSc and its N-terminally truncated variant, PrP 27-30, aggregate into amorphous aggregates, 2D crystals, and amyloid fibrils. The structure of these infectious conformers is essential to understanding prion replication and the development of structure-based therapeutic interventions. Here we used the repetitive organization inherent to GPI-anchorless PrP 27-30 amyloid fibrils to analyze their structure via electron cryomicroscopy. Fourier-transform analyses of averaged fibril segments indicate a repeating unit of 19.1 Å. 3D reconstructions of these fibrils revealed two distinct protofilaments, and, together with a molecular volume of 18,990 Å3, predicted the height of each PrP 27-30 molecule as ~17.7 Å. Together, the data indicate a four-rung β-solenoid structure as a key feature for the architecture of infectious mammalian prions. Furthermore, they allow to formulate a molecular mechanism for the replication of prions. Knowledge of the prion structure will provide important insights into the self-propagation mechanisms of protein misfolding.
Synergistic effects of iron powder on intumescent flame retardant polypropylene system
Directory of Open Access Journals (Sweden)
2009-06-01
Full Text Available The effects of iron powder as a synergistic agent on the flame retardancy of intumescent flame retardant polypropylene composites (IFR-PP were studied. The thermogravimetric analysis (TGA and cone calorimeter (CONE were used to evaluate the synergistic effects of iron powder (Fe. The TGA data showed that Fe could enhance the thermal stability of the IFR-PP systems at high temperature and effectively increase the char residue formation. The CONE results revealed that Fe and IFR could clearly change the decomposition behavior of PP and form a char layer on the surface of the composites, consequently resulting in efficient reduction of the flammability parameters, such as heat release rate (HRR, mass loss (ML, Mass loss rate (MLR, total heat release (THR, carbon monoxide and so on. Thus, a suitable amount of Fe plays a synergistic effect in the flame retardancy of IFR composites.
Prying into the Prion Hypothesis for Parkinson's Disease.
Brundin, Patrik; Melki, Ronald
2017-10-11
In Parkinson's disease, intracellular α-synuclein inclusions form in neurons. We suggest that prion-like behavior of α-synuclein is a key component in Parkinson's disease pathogenesis. Although multiple molecular changes are involved in the triggering of the disease process, we propose that neuron-to-neuron transfer is a crucial event that is essential for Lewy pathology to spread from one brain region to another. In this review, we describe key findings in human postmortem brains, cultured cells, and animal models of disease that support the idea that α-synuclein can act as a prion. We consider potential triggers of the α-synuclein misfolding and why the aggregates escape cellular degradation under disease conditions. We also discuss whether different strains of α-synuclein fibrils can underlie differences in cellular and regional distribution of aggregates in different synucleinopathies. Our conclusion is that α-synuclein probably acts as a prion in human diseases, and a deeper understanding of this step in the pathogenesis of Parkinson's disease can facilitate the development of disease-modifying therapies in the future. Dual Perspectives Companion Paper: Parkinson's Disease Is Not Simply a Prion Disorder, by D. James Surmeier, José A. Obeso, and Glenda M. Halliday. Copyright © 2017 the authors 0270-6474/17/379808-11$15.00/0.
Potential contribution of exosomes to the prion-like propagation of lesions in Alzheimer’s disease
Directory of Open Access Journals (Sweden)
Valerie eVingtdeux
2012-07-01
Full Text Available Since the discovery of prion diseases, the concept that a transmissible pathogen could be a protein has emerged. As such, this transmissible protein agent can transfer its pathological mis-folded shape to the same but normally folded protein thus leading to the propagation of a disease. This idea is now extrapolate to several neurological diseases associated with protein mis-folding and aggregation, such as Alzheimer’s disease. Alzheimer’s disease (AD is a slowly developing dementing disease characterized by the coexistence of two types of lesions: the parenchymal amyloid deposits and the intraneuronal neurofibrillary tangles (NFT. Amyloid deposits are composed of amyloid-beta peptides that derive from sequential cleavages of its precursor named amyloid protein precursor. Neurofibrillary tangle is characterized by intraneuronal aggregation of abnormally modified microtubule-associated Tau proteins. A synergistic relationship between the two lesions may trigger the progression of the disease. Thus, starting in the medial temporal lobe and slowly progressing through temporal, frontal, parietal and occipital cortex, the progression of NFT is well correlated with clinical expression of the disease. However, little is known about the mechanism driving the spatiotemporal propagation of these lesions ultimately leading to the disease. A growing number of studies suggest a prion-like diffusion of amyloid deposits and NFT. In the present chapter, we will develop the current hypotheses regarding the molecular and cellular mechanisms driving the development and spreading of Alzheimer disease lesions from the window of multivesicular bodies and exosomes.
Directory of Open Access Journals (Sweden)
Kurt C VerCauteren
Full Text Available Avian scavengers, such as American crows (Corvus brachyrhynchos, have potential to translocate infectious agents (prions of transmissible spongiform encephalopathy (TSE diseases including chronic wasting disease, scrapie, and bovine spongiform encephalopathy. We inoculated mice with fecal extracts obtained from 20 American crows that were force-fed material infected with RML-strain scrapie prions. These mice all evinced severe neurological dysfunction 196-231 d postinoculation (x =198; 95% CI: 210-216 and tested positive for prion disease. Our results suggest a large proportion of crows that consume prion-positive tissue are capable of passing infectious prions in their feces (ˆp=1.0; 95% CI: 0.8-1.0. Therefore, this common, migratory North American scavenger could play a role in the geographic spread of TSE diseases.
Yeast prion architecture explains how proteins can be genes
Wickner, Reed
2013-03-01
Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452
Differential overexpression of SERPINA3 in human prion diseases.
Vanni, S; Moda, F; Zattoni, M; Bistaffa, E; De Cecco, E; Rossi, M; Giaccone, G; Tagliavini, F; Haïk, S; Deslys, J P; Zanusso, G; Ironside, J W; Ferrer, I; Kovacs, G G; Legname, G
2017-11-15
Prion diseases are fatal neurodegenerative disorders with sporadic, genetic or acquired etiologies. The molecular alterations leading to the onset and the spreading of these diseases are still unknown. In a previous work we identified a five-gene signature able to distinguish intracranially BSE-infected macaques from healthy ones, with SERPINA3 showing the most prominent dysregulation. We analyzed 128 suitable frontal cortex samples, from prion-affected patients (variant Creutzfeldt-Jakob disease (vCJD) n = 20, iatrogenic CJD (iCJD) n = 11, sporadic CJD (sCJD) n = 23, familial CJD (gCJD) n = 17, fatal familial insomnia (FFI) n = 9, Gerstmann-Sträussler-Scheinker syndrome (GSS)) n = 4), patients with Alzheimer disease (AD, n = 14) and age-matched controls (n = 30). Real Time-quantitative PCR was performed for SERPINA3 transcript, and ACTB, RPL19, GAPDH and B2M were used as reference genes. We report SERPINA3 to be strongly up-regulated in the brain of all human prion diseases, with only a mild up-regulation in AD. We show that this striking up-regulation, both at the mRNA and at the protein level, is present in all types of human prion diseases analyzed, although to a different extent for each specific disorder. Our data suggest that SERPINA3 may be involved in the pathogenesis and the progression of prion diseases, representing a valid tool for distinguishing different forms of these disorders in humans.
Energy Technology Data Exchange (ETDEWEB)
Wang, Bin; Xu, Bingqian, E-mail: bxu@engr.uga.edu [Single Molecule Study Laboratory, College of Engineering and Nanoscale Science, and Engineering Center, University of Georgia, Athens, Georgia 30605 (United States); Lou, Zhichao [Single Molecule Study Laboratory, College of Engineering and Nanoscale Science, and Engineering Center, University of Georgia, Athens, Georgia 30605 (United States); College of Materials Science and Technology, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China); Zhang, Haiqian [College of Materials Science and Technology, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China)
2016-03-21
The electrostatic surface potential (ESP) of prion oligomers has critical influences on the aggregating processes of the prion molecules. The atomic force microscopy (AFM) and structural simulation were combined to investigate the molecular basis of the full-length human recombinant prion oligomerization on mica surfaces. The high resolution non-intrusive AFM images showed that the prion oligomers formed different patterns on mica surfaces at different buffer pH values. The basic binding units for the large oligomers were determined to be prion momoners (Ms), dimers (Ds), and trimers (Ts). The forming of the D and T units happened through the binding of hydrophobic β-sheets of the M units. In contrast, the α-helices of these M, D, and T units were the binding areas for the formation of large oligomers. At pH 4.5, the binding units M, D, and T showed clear polarized ESP distributions on the surface domains, while at pH 7.0, they showed more evenly distributed ESPs. Based on the conformations of oligomers observed from AFM images, the D and T units were more abundantly on mica surface at pH 4.5 because the ESP re-distribution of M units helped to stabilize these larger oligomers. The amino acid side chains involved in the binding interfaces were stabilized by hydrogen bonds and electrostatic interactions. The detailed analysis of the charged side chains at pH 4.5 indicated that the polarized ESPs induced the aggregations among M, D, and T to form larger oligomers. Therefore, the hydrogen bonds and electrostatic interactions worked together to form the stabilized prion oligomers.
International Nuclear Information System (INIS)
Wang, Bin; Xu, Bingqian; Lou, Zhichao; Zhang, Haiqian
2016-01-01
The electrostatic surface potential (ESP) of prion oligomers has critical influences on the aggregating processes of the prion molecules. The atomic force microscopy (AFM) and structural simulation were combined to investigate the molecular basis of the full-length human recombinant prion oligomerization on mica surfaces. The high resolution non-intrusive AFM images showed that the prion oligomers formed different patterns on mica surfaces at different buffer pH values. The basic binding units for the large oligomers were determined to be prion momoners (Ms), dimers (Ds), and trimers (Ts). The forming of the D and T units happened through the binding of hydrophobic β-sheets of the M units. In contrast, the α-helices of these M, D, and T units were the binding areas for the formation of large oligomers. At pH 4.5, the binding units M, D, and T showed clear polarized ESP distributions on the surface domains, while at pH 7.0, they showed more evenly distributed ESPs. Based on the conformations of oligomers observed from AFM images, the D and T units were more abundantly on mica surface at pH 4.5 because the ESP re-distribution of M units helped to stabilize these larger oligomers. The amino acid side chains involved in the binding interfaces were stabilized by hydrogen bonds and electrostatic interactions. The detailed analysis of the charged side chains at pH 4.5 indicated that the polarized ESPs induced the aggregations among M, D, and T to form larger oligomers. Therefore, the hydrogen bonds and electrostatic interactions worked together to form the stabilized prion oligomers.
Wang, Bin; Lou, Zhichao; Zhang, Haiqian; Xu, Bingqian
2016-03-01
The electrostatic surface potential (ESP) of prion oligomers has critical influences on the aggregating processes of the prion molecules. The atomic force microscopy (AFM) and structural simulation were combined to investigate the molecular basis of the full-length human recombinant prion oligomerization on mica surfaces. The high resolution non-intrusive AFM images showed that the prion oligomers formed different patterns on mica surfaces at different buffer pH values. The basic binding units for the large oligomers were determined to be prion momoners (Ms), dimers (Ds), and trimers (Ts). The forming of the D and T units happened through the binding of hydrophobic β-sheets of the M units. In contrast, the α-helices of these M, D, and T units were the binding areas for the formation of large oligomers. At pH 4.5, the binding units M, D, and T showed clear polarized ESP distributions on the surface domains, while at pH 7.0, they showed more evenly distributed ESPs. Based on the conformations of oligomers observed from AFM images, the D and T units were more abundantly on mica surface at pH 4.5 because the ESP re-distribution of M units helped to stabilize these larger oligomers. The amino acid side chains involved in the binding interfaces were stabilized by hydrogen bonds and electrostatic interactions. The detailed analysis of the charged side chains at pH 4.5 indicated that the polarized ESPs induced the aggregations among M, D, and T to form larger oligomers. Therefore, the hydrogen bonds and electrostatic interactions worked together to form the stabilized prion oligomers.
Maddox, Ryan A; Blase, J L; Mercaldo, N D; Harvey, A R; Schonberger, L B; Kukull, W A; Belay, E D
2015-12-01
Brain tissue analysis is necessary to confirm prion diseases. Clinically unsuspected cases may be identified through neuropathologic testing. National Alzheimer's Coordinating Center (NACC) Minimum and Neuropathologic Data Set for 1984 to 2005 were reviewed. Eligible patients had dementia, underwent autopsy, had available neuropathologic data, belonged to a currently funded Alzheimer's Disease Center (ADC), and were coded as having an Alzheimer's disease clinical diagnosis or a nonprion disease etiology. For the eligible patients with neuropathology indicating prion disease, further clinical information, collected from the reporting ADC, determined whether prion disease was considered before autopsy. Of 6000 eligible patients in the NACC database, 7 (0.12%) were clinically unsuspected but autopsy-confirmed prion disease cases. The proportion of patients with dementia with clinically unrecognized but autopsy-confirmed prion disease was small. Besides confirming clinically suspected cases, neuropathology is useful to identify unsuspected clinically atypical cases of prion disease. © The Author(s) 2015.
Synergistic effect of Elephantopus scaber L and Sauropus ...
African Journals Online (AJOL)
Synergistic effect of Elephantopus scaber L and Sauropus androgynus L ... Hematopoietic cells were isolated from bone marrow at 12 days post-infection. Prolactin ... breast milk after birth [2]. .... hosts as a natural means of protection against.
Diagnostic approaches for viruses and prions in stem cell banks
International Nuclear Information System (INIS)
Cobo, Fernando; Talavera, Paloma; Concha, Angel
2006-01-01
Some stem cell lines may contain an endogenous virus or can be contaminated with exogenous viruses (even of animal origin) and may secrete viral particles or express viral antigens on their surface. Moreover, certain biotechnological products (e.g. bovine fetal serum, murine feeder cells) may contain prion particles. Viral and prion contamination of cell cultures and 'feeder' cells, which is a common risk in all biotechnological products derived from the cell lines, is the most challenging and potentially serious outcome to address, due to the difficulty involved in virus and prion detection and the potential to cause serious disease in recipients of these cell products. Stem cell banks should introduce adequate quality assurance programs like the microbiological control program and can provide researchers with valuable support in the standardization and safety of procedures and protocols used for the viral and prion testing and in validation programs to assure the quality and safety of the cells
Synergistic Antimicrobial Effect of Tribulus terrestris and Bitter Almond Extracts
Directory of Open Access Journals (Sweden)
Hamid Abtahi
2014-12-01
Full Text Available Background: The antimicrobial effects of the extracts of different kinds of plants have been demonstrated in several studies. However, no study has been conducted so far on the synergistic effects of two herbal extracts on their germicidal effects. In this study, in addition to antibacterial effects of the aqueous, methanol or ethanol extracts of Tribulus terrestris and bitter almond on some bacteria, the synergistic effects of the extracts of these two plants were also evaluated. Materials and Methods: In this experimental study, water, methanol and ethanol extracts of seeds were screened against some bacterial strains. Seeds were extracted by percolation method. Aliquots of the extracts at variable concentrations were then incubated with different bacterial strains, and the antimicrobial activities of the extracts from seeds were determined by MIC. Three antibiotics were used as reference compounds for antibacterial activities. Seeds extract inhibited significantly the growth of the tested bacterial strains. Results: The greatest synergistic effect of T. terrestris and bitter almond extracts is detected in methanol and aqueous extracts. Among the bacterial strains tested, Staphylococcus aureus was most susceptibility. Conclusion: The results showed the highest antibacterial effect in the combination of methanol extract of T. terrestris and the aqueous extract of the bitter almond.
Ai Tran, Hoang Ngoc; Sousa, Fernanda; Moda, Fabio; Mandal, Subhra; Chanana, Munish; Vimercati, Chiara; Morbin, Michela; Krol, Silke; Tagliavini, Fabrizio; Legname, Giuseppe
2010-12-01
Gold nanoparticles coated with oppositely charged polyelectrolytes, such as polyallylamine hydrochloride and polystyrenesulfonate, were examined for potential inhibition of prion protein aggregation and prion (PrPSc) conversion and replication. Different coatings, finishing with a positive or negative layer, were tested, and different numbers of layers were investigated for their ability to interact and reduce the accumulation of PrPSc in scrapie prion infected ScGT1 and ScN2a cells. The particles efficiently hampered the accumulation of PrPSc in ScN2a cells and showed curing effects on ScGT1 cells with a nanoparticle concentration in the picomolar range. Finally, incubation periods of prion-infected mice treated with nanomolar concentrations of gold nanoparticles were significantly longer compared to untreated controls.
CWDPRNP: A tool for cervid prion sequence analysis in program R
Miller, William L.; Walter, W. David
2017-01-01
Chronic wasting disease is a fatal, neurological disease caused by an infectious prion protein, which affects economically and ecologically important members of the family Cervidae. Single nucleotide polymorphisms within the prion protein gene have been linked to differential susceptibility to the disease in many species. Wildlife managers are seeking to determine the frequencies of disease-associated alleles and genotypes and delineate spatial genetic patterns. The CWDPRNP package, implemented in program R, provides a unified framework for analyzing prion protein gene variability and spatial structure.
Alteration of the chronic wasting disease species barrier by in vitro prion amplification
Kurt, Timothy D.; Seelig, Davis M.; Schneider, Jay R.; Johnson, Christopher J.; Telling, Glenn C.; Heisey, Dennis M.; Hoover, Edward A.
2011-01-01
Chronic wasting disease (CWD) is a transmissible spongiform encephalopathy (TSE) of cervids now detected in 19 states of the United States, three Canadian provinces, and South Korea. Whether noncervid species can be infected by CWD and thereby serve as reservoirs for the infection is not known. To investigate this issue, we previously used serial protein misfolding cyclic amplification (sPMCA) to demonstrate that CWD prions can amplify in brain homogenates from several species sympatric with cervids, including prairie voles (Microtus ochrogaster) and field mice (Peromyscus spp.). Here, we show that prairie voles are susceptible to mule deer CWD prions in vivo and that sPMCA amplification of CWD prions in vole brain enhances the infectivity of CWD for this species. Prairie voles inoculated with sPMCA products developed clinical signs of TSE disease approximately 300 days prior to, and more consistently than, those inoculated with CWD prions from deer brain. Moreover, the deposition patterns and biochemical properties of protease-resistant form of PrP (PrPRES) in the brains of affected voles differed from those in cervidized transgenic (CerPrP) mice infected with CWD. In addition, voles inoculated orally with sPMCA products developed clinical signs of TSE and were positive for PrPRES deposition, whereas those inoculated orally with deer-origin CWD prions did not. These results demonstrate that transspecies sPMCA of CWD prions can enhance the infectivity and adapt the host range of CWD prions and thereby may be useful to assess determinants of prion species barriers.
Matveenko, A G; Belousov, M V; Bondarev, S A; Moskalenko, S E; Zhouravleva, G A
2016-01-01
Translation termination is an important step in gene expression. Its correct processing is governed by eRF1 (Sup45) and eRF3 (Sup35) proteins. In Saccharomyces cerevisiae, mutations in the corresponding genes, as well as Sup35 aggregation in [PSI^(+)] cells that propagate the prion form of Sup35 lead to inaccurate stop codon recognition and, consequently, nonsense suppression. The presence of stronger prion variants results in the more efficient suppression of nonsense mutations. Previously, we proposed a synthetic lethality test that enables the identification of genes that may influence either translation termination factors or [PSI^(+)] manifestation. This is based on the fact that the combination of sup45 mutations with the strong [PSI^(+)] prion variant in diploids is lethal. In this work, a set of genes that were previously shown to enhance nonsense suppression was analyzed. It was found that ABF1, FKH2, and REB1 overexpression decreased the growth of strains in a prion-dependent manner and, thus, might influence [PSI^(+)] prion toxicity. It was also shown that the synthetic lethality of [PSI^(+)] and sup45 mutations increased with the overexpression of GLN3 and MOT3 that encode Q/N-rich transcription factors. An analysis of the effects of their expression on the transcription of the release factors genes revealed an increase in SUP35 transcription in both cases. Since SUP35 overexpression is known to be toxic in [PSI^(+)] strains, these genes apparently enhance [PSI^(+)] toxicity via the regulation of SUP35 transcription.
Prion Propagation in Cells Expressing PrP Glycosylation Mutants ▿
Salamat, Muhammad K.; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert
2011-01-01
Infection by prions involves conversion of a host-encoded cell surface protein (PrPC) to a disease-related isoform (PrPSc). PrPC carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrPC glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrPSc and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrPSc, while PrPC with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrPC, were able to form infectious PrPSc. Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection. PMID:21248032
Campeau, Jody L; Wu, Gengshu; Bell, John R; Rasmussen, Jay; Sim, Valerie L
2013-01-01
Prion diseases are infectious neurodegenerative diseases associated with the accumulation of protease-resistant prion protein, neuronal loss, spongiform change and astrogliosis. In the mouse model, the loss of dendritic spines is one of the earliest pathological changes observed in vivo, occurring 4-5 weeks after the first detection of protease-resistant prion protein in the brain. While there are cell culture models of prion infection, most do not recapitulate the neuropathology seen in vivo. Only the recently developed prion organotypic slice culture assay has been reported to undergo neuronal loss and the development of some aspects of prion pathology, namely small vacuolar degeneration and tubulovesicular bodies. Given the rapid replication of prions in this system, with protease-resistant prion protein detectable by 21 days, we investigated whether the dendritic spine loss and altered dendritic morphology seen in prion disease might also develop within the lifetime of this culture system. Indeed, six weeks after first detection of protease-resistant prion protein in tga20 mouse cerebellar slice cultures infected with RML prion strain, we found a statistically significant loss of Purkinje cell dendritic spines and altered dendritic morphology in infected cultures, analogous to that seen in vivo. In addition, we found a transient but statistically significant increase in Purkinje cell dendritic spine density during infection, at the time when protease-resistant prion protein was first detectable in culture. Our findings support the use of this slice culture system as one which recapitulates prion disease pathology and one which may facilitate study of the earliest stages of prion disease pathogenesis.
Jansen, Casper; Parchi, Piero; Capellari, Sabina; Vermeij, Ad J.; Corrado, Patrizia; Baas, Frank; Strammiello, Rosaria; van Gool, Willem A.; van Swieten, John C.; Rozemuller, Annemieke J. M.
2010-01-01
Stop codon mutations in the gene encoding the prion protein (PRNP) are very rare and have thus far only been described in two patients with prion protein cerebral amyloid angiopathy (PrP-CAA). In this report, we describe the clinical, histopathological and pathological prion protein (PrPSc)
The synergistic effect between coal macerals during hydropyrolysis
Energy Technology Data Exchange (ETDEWEB)
Sun, Q.; Li, W.; Chen, H.; Li, B. [CAS, Taiyuan (China)
2007-01-15
Using TGA technology, the volatile matter yields during hydropyrolysis of Chinese Shenmu coal and its derived high purity macerals under different heating rates and pressures were investigated. The {Delta}W, calculated by the difference between the volatile matter yield of parent coal and that of macerals, is used to evaluate the synergistic effect of macerals during hydropyrolysis. The results showed that with increasing pressure and decreasing heating rate, the Delta W increases. At temperature of 500{sup o}C and pressure of 3 MPa, the difference of volatile matter yield between parent coal and vitrinite reaches the maximum and the {Delta} W also occurs the highest value of 14.1%, suggesting the existence of the synergistic effect between macerals during hydropyrolysis. Based on the structural characteristics of macerals and the basic knowledge of hydropyrolysis, the possible explanation for the synergism are proposed.
Directory of Open Access Journals (Sweden)
Hany A Omar
2016-11-01
Full Text Available Background: Sorafenib (Nexavar® is an FDA-approved systemic therapy for advanced hepatocellular carcinoma (HCC. However, the low efficacy and adverse effects at high doses limit the clinical application of sorafenib and strongly recommend its combination with other agents aiming at ameliorating its drawbacks. OSU-2S, a PKCδ activator, was selected as a potential candidate anticancer agent to be combined with sorafenib to promote the anti-cancer activity through synergistic interaction. Methods: The antitumor effects of sorafenib, OSU-2S and their combination were assessed by MTT assay, caspase activation, Western blotting, migration/invasion assays in four different HCC cell lines. The synergistic interactions were determined by Calcusyn analysis. PKCδ knockdown was used to elucidate the role of PKCδ activation as a mechanism for the synergy. The knockdown/over-expression of p53 was used to explain the differential sensitivity of HCC cell lines to sorafenib and/or OSU-2S. Results: OSU-2S synergistically enhanced the anti-proliferative effects of sorafenib in the four used HCC cell lines with combination indices < 1. This effect was accompanied by parallel increases in caspase 3/7 activity, PARP cleavage, PKCδ activation and HCC cell migration/invasion. In addition, PKCδ knockdown abolished the synergy between sorafenib and OSU-2S. Furthermore, p53 restoration in Hep3B cells through the over-expression rendered them more sensitive to both agents while p53 knockdown from HepG2 cells increased their resistance to both agents. Conclusions: OSU-2S augments the anti-proliferative effect of sorafenib in HCC cell lines, in part, through the activation of PKCδ. The p53 status in HCC cells predicts their sensitivity towards both sorafenib and OSU-2S. The proposed combination represents a therapeutically relevant approach that can lead to a new HCC therapeutic protocol.
Directory of Open Access Journals (Sweden)
Hanae Takatsuki, PhD
2016-10-01
Full Text Available Human prion diseases are neurodegenerative disorders caused by abnormally folded prion proteins in the central nervous system. These proteins can be detected using the quaking-induced conversion assay. Compared with other bioassays, this assay is extremely sensitive and was used in the present study to determine prion distribution in sporadic Creutzfeldt-Jakob disease patients at autopsy. Although infectivity of the sporadic form is thought to be restricted within the central nervous system, results showed that prion-seeding activities reach 106/g from a 50% seeding dose in non-neuronal tissues, suggesting that prion-seeding activity exists in non-neural organs, and we suggested that non-neural tissues of 106/g SD50 did not exist the infectivity.
The anti-tumor effect of ACNU and x-irradiation on mouse glioma
International Nuclear Information System (INIS)
Nakagawa, Hidemitsu; Hori, Masaharu; Hasegawa, Hiroshi; Mogami, Heitaro; Hayakawa, Toru.
1979-01-01
Anti-tumor activities of 1-(4-amino-2-methyl-5-pyrimidinyl)methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) and x-irradiation on methylcholanthrene induced glioma in C 57 BL mice were studied in vitro and in vivo. In vitro experiments using cultured glioma cells (MGB cells), the synchronization of cell cycle was done by excess addition of thymidine, and the anti-tumor cell effect were investigated by mean of determinations of DNA synthesis, mitotic index and the number of the living cells following the treatments. As the results, it appeared obvious that ACNU was most effective on MGB cells in S phase and x-irradiation in M phase. As to the combined therapy of ACNU and x-irradiation, the anti-tumor effect was most remarkable when the cells were treated by x-irradiation in the G 2 , M phase, which were hervested by addition of ACNU 44 hours before irradiation. However simultaneous treatment of ACNU and x-irradiation on the cells in G 1 phase was not so remarkable. In vivo experiments the anti-tumor effect of ACNU and x-irradiation on subcutaneously or intracranially transplanted glioma in mice was investigated. Either ACNU 10 mg/kg or local x-irradiation 1240 rads showed inhibitory effect on the tumor growth and prolonged the survival time of the tumor bearing mice. The combination therapy was more effective than ACNU or x-irradiation alone, particularly combination therapy of ACNU and repeated small doses irradiation of x-ray was remarkably effective. Evidence obtained indicated that the combination therapy of ACNU and x-irradiation have synergistic anti-tumor effect on experimental mouse glioma. (author)
Energy Technology Data Exchange (ETDEWEB)
Mylonaki, Effie; Manika, Katerina [Pulmonary Department, “G.Papanikolaou” General Hospital, Aristotle University of Thessaloniki (Greece); Zarogoulidis, Paul, E-mail: pzarog@hotmail.com [Pulmonary Department, “G.Papanikolaou” General Hospital, Aristotle University of Thessaloniki (Greece); Domvri, Kalliopi; Voutsas, Vasilis; Zarogoulidis, Kostas [Pulmonary Department, “G.Papanikolaou” General Hospital, Aristotle University of Thessaloniki (Greece); Mourelatos, Dionysios [Biology and Genetics, Medical School, Aristotle University of Thessaloniki (Greece)
2012-12-15
Highlights: ► SCEs in vivo, a possible predictor of tumor chemoresponse. ► In vivo exposure to combined treatment, applying the SCE assay. ► Aminophylline enhances DNA instability induced by chemotherapy in vivo. ► In vivo synergistic effect of Aminophylline with the chemotherapeutic agents. - Abstract: Background: The anti-cancer and cytogenetic effects of aminophylline (AM) have been demonstrated in several clinical trials. The aim of the present study was to investigate the in vivo cytogenetic effects of AM in newly diagnosed patients with small cell (SCLC) and non-small cell lung cancer (NSCLC), receiving chemotherapy for the first time. Methods: Sister chromatid exchanges (SCEs) and proliferation rate index (PRI) were evaluated in peripheral blood lymphocyte cultures from six patients with SCLC and six patients with NSCLC after the in vitro addition of AM and after the in vivo administration of AM in patients receiving chemotherapy. Results: The in vitro addition of AM significantly increased SCEs only in SCLC patients (p < 0.001). The in vivo administration of AM after chemotherapy increased SCEs in both cancer types (SCLC: p < 0.001, NSCLC: p = 0.003) and this increase was synergistic, the rates of SCEs in the presence of AM were higher than the expected SCE values if the increases above background for chemotherapy and AM were independent and additive (SCLC: p < 0.001, NSCLC: p = 0.008). Although in both groups of patients cell division delays were observed after the combined chemotherapy plus in vivo AM treatment, the correlation between the magnitude of the SCE response and the PRI depression was not statistically significant (p > 0.05). Conclusions: These observations suggest that AM enhances the results of concurrently administered chemotherapy by synergistically increasing its cytogenetic effects in patients with lung cancer.
The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation
Directory of Open Access Journals (Sweden)
Shi Fushan
2012-07-01
Full Text Available Abstract Background Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role in the pathogenesis of prion diseases. Although interleukin (IL-1β release by prion-induced microglia has been widely reported, the mechanism by which primed microglia become activated and secrete IL-1β in prion diseases has not yet been elucidated. In this study, we investigated the role of the NACHT, LRR and PYD domains-containing protein (NALP3 inflammasome in IL-1β release from lipopolysaccharide (LPS-primed microglia after exposure to a synthetic neurotoxic prion fragment (PrP106-126. Methods The inflammasome components NALP3 and apoptosis-associated speck-like protein (ASC were knocked down by gene silencing. IL-1β production was assessed using ELISA. The mRNA expression of NALP3, ASC, and pro-inflammatory factors was measured by quantitative PCR. Western blot analysis was used to detect the protein level of NALP3, ASC, caspase-1 and nuclear factor-κB. Results We found that that PrP106-126-induced IL-1β release depends on NALP3 inflammasome activation, that inflammasome activation is required for the synthesis of pro-inflammatory and chemotactic factors by PrP106-126-activated microglia, that inhibition of NF-κB activation abrogated PrP106-126-induced NALP3 upregulation, and that potassium efflux and production of reactive oxygen species were implicated in PrP106-126-induced NALP3 inflammasome activation in microglia. Conclusions We conclude that the NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation. To our knowledge, this is the first time that strong evidence for the involvement of NALP3 inflammasome in prion-associated inflammation has been found.
Sod1 deficiency reduces incubation time in mouse models of prion disease.
Directory of Open Access Journals (Sweden)
Shaheen Akhtar
Full Text Available Prion infections, causing neurodegenerative conditions such as Creutzfeldt-Jakob disease and kuru in humans, scrapie in sheep and BSE in cattle are characterised by prolonged and variable incubation periods that are faithfully reproduced in mouse models. Incubation time is partly determined by genetic factors including polymorphisms in the prion protein gene. Quantitative trait loci studies in mice and human genome-wide association studies have confirmed that multiple genes are involved. Candidate gene approaches have also been used and identified App, Il1-r1 and Sod1 as affecting incubation times. In this study we looked for an association between App, Il1-r1 and Sod1 representative SNPs and prion disease incubation time in the Northport heterogeneous stock of mice inoculated with the Chandler/RML prion strain. No association was seen with App, however, significant associations were seen with Il1-r1 (P = 0.02 and Sod1 (P<0.0001 suggesting that polymorphisms at these loci contribute to the natural variation observed in incubation time. Furthermore, following challenge with Chandler/RML, ME7 and MRC2 prion strains, Sod1 deficient mice showed highly significant reductions in incubation time of 20, 13 and 24%, respectively. No differences were detected in Sod1 expression or activity. Our data confirm the protective role of endogenous Sod1 in prion disease.
Takatsuki, Hanae; Fuse, Takayuki; Nakagaki, Takehiro; Mori, Tsuyoshi; Mihara, Ban; Takao, Masaki; Iwasaki, Yasushi; Yoshida, Mari; Murayama, Shigeo; Atarashi, Ryuichiro; Nishida, Noriyuki; Satoh, Katsuya
2016-10-01
Human prion diseases are neurodegenerative disorders caused by abnormally folded prion proteins in the central nervous system. These proteins can be detected using the quaking-induced conversion assay. Compared with other bioassays, this assay is extremely sensitive and was used in the present study to determine prion distribution in sporadic Creutzfeldt-Jakob disease patients at autopsy. Although infectivity of the sporadic form is thought to be restricted within the central nervous system, results showed that prion-seeding activities reach 10 6 /g from a 50% seeding dose in non-neuronal tissues, suggesting that prion-seeding activity exists in non-neural organs, and we suggested that non-neural tissues of 10 6 /g SD50 did not exist the infectivity. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Johnson, Christopher J.; McKenzie, Debbie; Pedersen, Joel A.; Aiken, Judd M.
2011-01-01
Ingestion of prion-contaminated materials is postulated to be a primary route of prion disease transmission. Binding of prions to soil (micro)particles dramatically enhances peroral disease transmission relative to unbound prions, and it was hypothesized that micrometer-sized particles present in other consumed materials may affect prion disease transmission via the oral route of exposure. Small, insoluble particles are present in many substances, including soil, human foods, pharmaceuticals, and animal feeds. It is known that meat and bone meal (MBM), a feed additive believed responsible for the spread of bovine spongiform encephalopathy (BSE), contains particles smaller than 20 μm and that the pathogenic prion protein binds to MBM. The potentiation of disease transmission via the oral route by exposure to MBM or three micrometer-sized mineral feed additives was determined. Data showed that when the disease agent was bound to any of the tested materials, the penetrance of disease was increased compared to unbound prions. Our data suggest that in feed or other prion-contaminated substances consumed by animals or, potentially, humans, the addition of MBM or the presence of microparticles could heighten risks of prion disease acquisition.
The first report of prion-related protein gene (PRNT) polymorphisms in goat.
Kim, Yong-Chan; Jeong, Byung-Hoon
2017-06-01
Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.
Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases
Emwas, Abdul-Hamid M.; Al-Talla, Zeyad; Guo, Xianrong; Al-Ghamdi, Suliman; Al-Masri, Harbi Tomah
2013-01-01
Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.
Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases
Emwas, Abdul-Hamid M.
2013-02-24
Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.
Desale, Swapnil S; Raja, Srikumar M; Kim, Jong Oh; Mohapatra, Bhopal; Soni, Kruti S; Luan, Haitao; Williams, Stetson H; Bielecki, Timothy A; Feng, Dan; Storck, Matthew; Band, Vimla; Cohen, Samuel M; Band, Hamid; Bronich, Tatiana K
2015-06-28
ErbB2-driven breast cancers constitute 20-25% of the cases diagnosed within the USA. The humanized anti-ErbB2 monoclonal antibody, Trastuzumab (Herceptin™; Genentech), with chemotherapy is the current standard of treatment. Novel agents and strategies continue to be explored, given the challenges posed by Trastuzumab-resistance development in most patients. The HSP90 inhibitor, 17-allylaminodemethoxygeldanamycin (17-AAG), which induces ErbB2 degradation and attenuates downstream oncogenic signaling, is one such agent that showed significant promise in early phase I and II clinical trials. Its low water solubility, potential toxicities and undesirable side effects observed in patients, partly due to the Cremophor-based formulation, have been discouraging factors in the advancement of this promising drug into clinical use. Encapsulation of 17-AAG into polymeric nanoparticle formulations, particularly in synergistic combination with conventional chemotherapeutics, represents an alternative approach to overcome these problems. Herein, we report an efficient co-encapsulation of 17-AAG and doxorubicin, a clinically well-established and effective modality in breast cancer treatment, into biodegradable and biocompatible polypeptide-based nanogels. Dual drug-loaded nanogels displayed potent cytotoxicity in a breast cancer cell panel and exerted selective synergistic anticancer activity against ErbB2-overexpressing breast cancer cell lines. Analysis of ErbB2 degradation confirmed efficient 17-AAG release from nanogels with activity comparable to free 17-AAG. Furthermore, nanogels containing both 17-AAG and doxorubicin exhibited superior antitumor efficacy in vivo in an ErbB2-driven xenograft model compared to the combination of free drugs. These studies demonstrate that polypeptide-based nanogels can serve as novel nanocarriers for encapsulating 17-AAG along with other chemotherapeutics, providing an opportunity to overcome solubility issues and thereby exploit its full
Propagation of Mammalian Prions in Yeast
National Research Council Canada - National Science Library
Harris, David A
2006-01-01
...: the budding yeast Saccharomyces cerevisiae. This unicellular organism offers a number of potential advantages for the study of prion biology, including rapid generation time, ease of culturing, and facile genetics...
Prion protein degradation by lichens of the genus Cladonia
Bennett, James P.; Rodriguez, Cynthia M.; Johnson, Christopher J.
2012-01-01
It has recently been discovered that lichens contain a serine protease capable of degrading the pathogenic prion protein, the etiological agent of prion diseases such as sheep scrapie and cervid chronic wasting disease. Limited methods are available to degrade or inactivate prion disease agents, especially in the environment, and lichens or their serine protease could prove important for management of these diseases. Scant information is available regarding the presence or absence of the protease responsible for degrading prion protein (PrP) in lichen species and, in this study, we tested the hypothesis that PrP degradation activity in lichens is phylogenetically-based by testing 44 species of Cladonia lichens, a genus for which a significant portion of the phylogeny is well established. We categorized PrP degradation activity among the 44 species (high, moderate, low or none) and found that activity in Cladonia species did not correspond with phylogenetic position of the species. Degradation of PrP did correspond, however, with three classical taxonomic characters within the genus: species with brown apothecia, no usnic acid, and the presence of a cortex. Of the 44 species studied, 18 (41%) had either high or moderate PrP degradation activity, suggesting the protease may be frequent in this genus of lichens.
Prion disease resembling frontotemporal dementia and parkinsonism linked to chromosome 17
Directory of Open Access Journals (Sweden)
Nitrini Ricardo
2001-01-01
Full Text Available OBJECTIVE: To compare the clinical features of a familial prion disease with those of frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17. BACKGROUND: Prion diseases are not usually considered in the differential diagnosis of FTDP-17, since familial Creutzfeldt-Jakob disease (CJD, the most common inherited prion disease, often manifests as a rapidly progressive dementia. Conversely, FTDP-17 usually has an insidious onset in the fifth decade, with abnormal behavior and parkinsonian features. METHOD: We present the clinical features of 12 patients from a family with CJD associated with a point mutation at codon 183 of the prion protein gene. RESULTS: The mean age at onset was 44.0 ± 3.7; the duration of the symptoms until death ranged from two to nine years. Behavioral disturbances were the predominant presenting symptoms. Nine patients were first seen by psychiatrists. Eight patients manifested parkinsonian signs. CONCLUSION: These clinical features bear a considerable resemblance to those described in FTDP-17.
Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Igel-Egalon, Angelique; Barbereau, Clément; Chapuis, Jérôme; Ciric, Danica; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel
2017-01-02
Mapping out regions of PrP influencing prion conversion remains a challenging issue complicated by the lack of prion structure. The portion of PrP associated with infectivity contains the α-helical domain of the correctly folded protein and turns into a β-sheet-rich insoluble core in prions. Deletions performed so far inside this segment essentially prevented the conversion. Recently we found that deletion of the last C-terminal residues of the helix H2 was fully compatible with prion conversion in the RK13-ovPrP cell culture model, using 3 different infecting strains. This was in agreement with preservation of the overall PrP C structure even after removal of up to one-third of this helix. Prions with internal deletion were infectious for cells and mice expressing the wild-type PrP and they retained prion strain-specific characteristics. We thus identified a piece of the prion domain that is neither necessary for the conformational transition of PrP C nor for the formation of a stable prion structure.
Directory of Open Access Journals (Sweden)
Wu X
2017-03-01
Full Text Available Xiaozhe Wu,1 Zhan Li,1 Xiaolu Li,2,3 Yaomei Tian,1 Yingzi Fan,1 Chaoheng Yu,1 Bailing Zhou,1 Yi Liu,4 Rong Xiang,5 Li Yang1 1State Key Laboratory of Biotherapy/Collaborative Innovation Center of Biotherapy, West China Hospital, Sichuan University, 2International Center for Translational Chinese Medicine, Sichuan Academy of Chinese Medicine Sciences, Chengdu, 3Department of Plastic and Burn Surgery, Affiliated Hospital of Southwest Medical University, Luzhou, 4Department of Microbial Examination, Sichuan Center for Disease Control and Prevention, Chengdu, 5Nankai University School of Medicine, Tianjin, People’s Republic of China Abstract: Antibiotic-resistant bacteria present a great threat to public health. In this study, the synergistic effects of antimicrobial peptides (AMPs and antibiotics on several multidrug-resistant bacterial strains were studied, and their synergistic effects on azithromycin (AZT-resistance genes were analyzed to determine the relationships between antimicrobial resistance and these synergistic effects. A checkerboard method was used to evaluate the synergistic effects of AMPs (DP7 and CLS001 and several antibiotics (gentamicin, vancomycin [VAN], AZT, and amoxicillin on clinical bacterial strains (Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, and Escherichia coli. The AZT-resistance genes (ermA, ermB, ermC, mefA, and msrA were identified in the resistant strains using quantitative polymerase chain reaction. For all the clinical isolates tested that were resistant to different antibiotics, DP7 had high antimicrobial activity (≤32 mg/L. When DP7 was combined with VAN or AZT, the effect was most frequently synergistic. When we studied the resistance genes of the AZT-resistant isolates, the synergistic effect of DP7–AZT occurred most frequently in highly resistant strains or strains carrying more than two AZT-resistance genes. A transmission electron microscopic analysis of the S. aureus
Meade-White, K.; Race, B.; Trifilo, M.; Bossers, A.; Favara, C.; Lacasse, R.; Miller, M.; Williams, E.; Oldstone, M.; Race, R.; Chesebro, B.
2007-01-01
Prion protein (PrP) is a required factor for susceptibility to transmissible spongiform encephalopathy or prion diseases. In transgenic mice, expression of prion protein (PrP) from another species often confers susceptibility to prion disease from that donor species. For example, expression of deer
Synergistic effects in radiation-induced particle ejection from solid surfaces
International Nuclear Information System (INIS)
Itoh, Noriaki
1990-01-01
A description is given on radiation-induced particle ejection from solid surfaces, emphasizing synergistic effects arising from multi-species particle irradiation and from irradiation under complex environments. First, it is pointed out that synergisms can be treated by introducing the effects of material modification on radiation-induced particle ejection. As examples of the effects of surface modification on the sputtering induced by elastic encounters, sputtering of alloys and chemical sputtering of graphite are briefly discussed. Then the particle ejection induced by electronic encounters is explained emphasizing the difference in the behaviors from materials to materials. The possible synergistic effects of electronic and elastic encounters are also described. Lastly, we point out the importance of understanding the elementary processes of material-particle interaction and of developing computer codes describing material behaviors under irradiation. (author)
Genetics Home Reference: prion disease
... which have overlapping signs and symptoms, include familial Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), and fatal ... Sc . Sporadic forms of prion disease include sporadic Creutzfeldt-Jakob disease (sCJD), sporadic fatal insomnia (sFI), and variably protease- ...
Infectivity-associated PrP(Sc) and disease duration-associated PrP(Sc) of mouse BSE prions.
Miyazawa, Kohtaro; Okada, Hiroyuki; Masujin, Kentaro; Iwamaru, Yoshifumi; Yokoyama, Takashi
2015-01-01
Disease-related prion protein (PrP(Sc)), which is a structural isoform of the host-encoded cellular prion protein, is thought to be a causative agent of transmissible spongiform encephalopathies. However, the specific role of PrP(Sc) in prion pathogenesis and its relationship to infectivity remain controversial. A time-course study of prion-affected mice was conducted, which showed that the prion infectivity was not simply proportional to the amount of PrP(Sc) in the brain. Centrifugation (20,000 ×g) of the brain homogenate showed that most of the PrP(Sc) was precipitated into the pellet, and the supernatant contained only a slight amount of PrP(Sc). Interestingly, mice inoculated with the obtained supernatant showed incubation periods that were approximately 15 d longer than those of mice inoculated with the crude homogenate even though both inocula contained almost the same infectivity. Our results suggest that a small population of fine PrP(Sc) may be responsible for prion infectivity and that large, aggregated PrP(Sc) may contribute to determining prion disease duration.
Prions: Potential Threat to Mankind and Dental Implications
Directory of Open Access Journals (Sweden)
Ajay R Bhoosreddy
2010-01-01
Full Text Available Prion diseases are fatal, infectious, neurodegenerative disorders with special implications for infection control in the health care system. The causative agent is highly resistant to routine disinfection and sterilization processes and has been transmitted during health care interactions. Thus, it is important to use evidence gained through research and case reports to minimize risk of infection. There is no data suggesting that prions are transmitted easily during dental sittings but there remains a rare risk of such transmission if appropriate infection measures are not adhered to.
Directory of Open Access Journals (Sweden)
Lewis Victoria
2012-04-01
Full Text Available Abstract Background Prion disease transmission and pathogenesis are linked to misfolded, typically protease resistant (PrPres conformers of the normal cellular prion protein (PrPC, with the former posited to be the principal constituent of the infectious 'prion'. Unexplained discrepancies observed between detectable PrPres and infectivity levels exemplify the complexity in deciphering the exact biophysical nature of prions and those host cell factors, if any, which contribute to transmission efficiency. In order to improve our understanding of these important issues, this study utilized a bioassay validated cell culture model of prion infection to investigate discordance between PrPres levels and infectivity titres at a subcellular resolution. Findings Subcellular fractions enriched in lipid rafts or endoplasmic reticulum/mitochondrial marker proteins were equally highly efficient at prion transmission, despite lipid raft fractions containing up to eight times the levels of detectable PrPres. Brain homogenate infectivity was not differentially enhanced by subcellular fraction-specific co-factors, and proteinase K pre-treatment of selected fractions modestly, but equally reduced infectivity. Only lipid raft associated infectivity was enhanced by sonication. Conclusions This study authenticates a subcellular disparity in PrPres and infectivity levels, and eliminates simultaneous divergence of prion strains as the explanation for this phenomenon. On balance, the results align best with the concept that transmission efficiency is influenced more by intrinsic characteristics of the infectious prion, rather than cellular microenvironment conditions or absolute PrPres levels.
Almberg, Emily S.; Cross, Paul C.; Johnson, Christopher J.; Heisey, Dennis M.; Richards, Bryan J.
2011-01-01
Chronic wasting disease (CWD) is a fatal disease of deer, elk, and moose transmitted through direct, animal-to-animal contact, and indirectly, via environmental contamination. Considerable attention has been paid to modeling direct transmission, but despite the fact that CWD prions can remain infectious in the environment for years, relatively little information exists about the potential effects of indirect transmission on CWD dynamics. In the present study, we use simulation models to demonstrate how indirect transmission and the duration of environmental prion persistence may affect epidemics of CWD and populations of North American deer. Existing data from Colorado, Wyoming, and Wisconsin's CWD epidemics were used to define plausible short-term outcomes and associated parameter spaces. Resulting long-term outcomes range from relatively low disease prevalence and limited host-population decline to host-population collapse and extinction. Our models suggest that disease prevalence and the severity of population decline is driven by the duration that prions remain infectious in the environment. Despite relatively low epidemic growth rates, the basic reproductive number, R0, may be much larger than expected under the direct-transmission paradigm because the infectious period can vastly exceed the host's life span. High prion persistence is expected to lead to an increasing environmental pool of prions during the early phases (i.e. approximately during the first 50 years) of the epidemic. As a consequence, over this period of time, disease dynamics will become more heavily influenced by indirect transmission, which may explain some of the observed regional differences in age and sex-specific disease patterns. This suggests management interventions, such as culling or vaccination, will become increasingly less effective as CWD epidemics progress.
Detection of type 1 prion protein in variant Creutzfeldt-Jakob disease
Yull, H.M.; Ritchie, D.L.; Langeveld, J.P.M.; Zijderveld, van F.G.; Bruce, M.E.; Ironside, J.W.; Head, M.W.
2006-01-01
Molecular typing of the abnormal form of the prion protein (PrPSc) has come to be regarded as a powerful tool in the investigation of the prion diseases. All evidence thus far presented indicates a single PrPSc molecular type in variant Creutzfeldt-Jakob disease (termed type 2B), presumably
Differential effects of divalent cations on elk prion protein fibril formation and stability
Misfolding of the normally folded prion protein of mammals (PrPC) into infectious fibrils causes a variety of different diseases, from scrapie in sheep to bovine spongiform encephalopathy in cattle to chronic wasting disease (CWD) in deer and elk. The misfolded form of PrPC, termed PrPSc, or in this...
Grisin, Tiphany; Bories, Christian; Bombardi, Martina; Loiseau, Philippe M; Rouffiac, Valérie; Solgadi, Audrey; Mallet, Jean-Maurice; Ponchel, Gilles; Bouchemal, Kawthar
2017-05-01
The aim of this work is to design new chitosan conjugates able to self-organize in aqueous solution in the form of micrometer-size platelets. When mixed with amphotericin B deoxycholate (AmB-DOC), micro-platelets act as a drug booster allowing further improvement in AmB-DOC anti-Candida albicans activity. Micro-platelets were obtained by mixing oleoyl chitosan and α-cyclodextrin in water. The formulation is specifically-engineered for mucosal application by dispersing chitosan micro-platelets into thermosensitive pluronic ® F127 20 wt% hydrogel. The formulation completely cured C. albicans vaginal infection in mice and had a superior activity in comparison with AmB-DOC without addition of chitosan micro-platelets. In vitro studies showed that the platelets significantly enhance AmB-DOC antifungal activity since the IC 50 and the MIC 90 decrease 4.5 and 4.8-times. Calculation of fractional inhibitory concentration index (FICI = 0.198) showed that chitosan micro-platelets act in a synergistic way with AmB-DOC against C. albicans. No synergy is found between spherical nanoparticles composed poly(isobutylcyanoacrylate)/chitosan and AmB-DOC. These results demonstrate for the first time the ability of flattened chitosan micro-platelets to have synergistic activity with AmB-DOC against C. albicans candidiasis and highlight the importance of rheological and mucoadhesive behaviors of hydrogels in the efficacy of the treatment.
Phosphatidylinositol-glycan-phospholipase D is involved in neurodegeneration in prion disease.
Directory of Open Access Journals (Sweden)
Jae-Kwang Jin
Full Text Available PrPSc is formed from a normal glycosylphosphatidylinositol (GPI-anchored prion protein (PrPC by a posttranslational modification. Most GPI-anchored proteins have been shown to be cleaved by GPI phospholipases. Recently, GPI-phospholipase D (GPI-PLD was shown to be a strictly specific enzyme for GPI anchors. To investigate the involvement of GPI-PLD in the processes of neurodegeneration in prion diseases, we examined the mRNA and protein expression levels of GPI-PLD in the brains of a prion animal model (scrapie, and in both the brains and cerebrospinal fluids (CSF of sporadic and familial Creutzfeldt-Jakob disease (CJD patients. We found that compared with controls, the expression of GPI-PLD was dramatically down-regulated in the brains of scrapie-infected mice, especially in the caveolin-enriched membrane fractions. Interestingly, the observed decrease in GPI-PLD expression levels began at the same time that PrPSc began to accumulate in the infected brains and this decrease was also observed in both the brain and CSF of CJD patients; however, no differences in expression were observed in either the brains or CSF specimens from Alzheimer's disease patients. Taken together, these results suggest that the down-regulation of GPI-PLD protein may be involved in prion propagation in the brains of prion diseases.
Pathogenic prion protein is degraded by a manganese oxide mineral found in soils
Russo, F.; Johnson, C.J.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.
2009-01-01
Prions, the aetiological agents of transmissible spongiform encephalopathies, exhibit extreme resistance to degradation. Soil can retain prion infectivity in the environment for years. Reactive soil components may, however, contribute to the inactivation of prions in soil. Members of the birnessite family of manganese oxides (MnO2) rank among the strongest natural oxidants in soils. Here, we report the abiotic degradation of pathogenic prion protein (PrPTSE) by a synthetic analogue of naturally occurring birnessite minerals. Aqueous MnO2 suspensions degraded the PrPTSE as evidenced by decreased immunoreactivity and diminished ability to seed protein misfolding cyclic amplification reactions. Birnessite-mediated PrPTSE degradation increased as a solution's pH decreased, consistent with the pH-dependence of the redox potential of MnO2. Exposure to 5.6 mg MnO2 ml-1 (PrPTSE:MnO2=1 : 110) decreased PrPTSE levels by ???4 orders of magnitude. Manganese oxides may contribute to prion degradation in soil environments rich in these minerals. ?? 2009 SGM.
Humic substances interfere with detection of pathogenic prion protein
Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.
2014-01-01
Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.
Haldiman, T.; Kim, C.; Cohen, Y.; Chen, W.; Blevins, J.; Qing, L.; Cohen, M.L.; Langeveld, J.P.M.; Telling, G.C.; Kong, Q.; Safar, J.G.
2013-01-01
The unique phenotypic characteristics of mammalian prions are thought to be encoded in the conformation of pathogenic prion proteins (PrPSc). The molecular mechanism responsible for the adaptation, mutation, and evolution of prions observed in cloned cells and upon crossing the species barrier
PrP Knockout Cells Expressing Transmembrane PrP Resist Prion Infection.
Marshall, Karen E; Hughson, Andrew; Vascellari, Sarah; Priola, Suzette A; Sakudo, Akikazu; Onodera, Takashi; Baron, Gerald S
2017-01-15
Glycosylphosphatidylinositol (GPI) anchoring of the prion protein (PrP C ) influences PrP C misfolding into the disease-associated isoform, PrP res , as well as prion propagation and infectivity. GPI proteins are found in cholesterol- and sphingolipid-rich membrane regions called rafts. Exchanging the GPI anchor for a nonraft transmembrane sequence redirects PrP C away from rafts. Previous studies showed that nonraft transmembrane PrP C variants resist conversion to PrP res when transfected into scrapie-infected N2a neuroblastoma cells, likely due to segregation of transmembrane PrP C and GPI-anchored PrP res in distinct membrane environments. Thus, it remained unclear whether transmembrane PrP C might convert to PrP res if seeded by an exogenous source of PrP res not associated with host cell rafts and without the potential influence of endogenous expression of GPI-anchored PrP C To further explore these questions, constructs containing either a C-terminal wild-type GPI anchor signal sequence or a nonraft transmembrane sequence containing a flexible linker were expressed in a cell line derived from PrP knockout hippocampal neurons, NpL2. NpL2 cells have physiological similarities to primary neurons, representing a novel and advantageous model for studying transmissible spongiform encephalopathy (TSE) infection. Cells were infected with inocula from multiple prion strains and in different biochemical states (i.e., membrane bound as in brain microsomes from wild-type mice or purified GPI-anchorless amyloid fibrils). Only GPI-anchored PrP C supported persistent PrP res propagation. Our data provide strong evidence that in cell culture GPI anchor-directed membrane association of PrP C is required for persistent PrP res propagation, implicating raft microdomains as a location for conversion. Mechanisms of prion propagation, and what makes them transmissible, are poorly understood. Glycosylphosphatidylinositol (GPI) membrane anchoring of the prion protein (PrP C
Ji, Xiaonan; Shen, Yanli; Sun, Hao; Gao, Xiangdong
2016-08-01
Human hepatocellular carcinoma (HCC) has a high rate of tumor recurrence and metastasis, resulting in shortened survival time. The function of alpha-fetoprotein (AFP) as a regulatory factor in the growth of HCC cells has been well defined. The aim of this study was to investigate the use of a novel AFP-specific single-chain variable fragment that blocked AFP and inhibited HCC cell growth. The results indicated that the anti-AFP single-chain variable fragment (scFv) induced growth inhibition of AFP-expressing HCC cell lines in vitro through induction of G1 cell cycle arrest and apoptosis. The mechanism of apoptosis probably involved with blocking AFP internalization and regulation of the PTEN/PI3K/Akt signaling network. Moreover, the anti-AFP-scFv also effectively sensitized the HepG2 cells to paclitaxel (PTX) at a lower concentration. The combination effect of PTX and anti-AFP-scFv displayed a synergistic effect on HepG2 cells both in vitro and in vivo. Our results demonstrated that targeting AFP by specific antibodies has potential immunotherapeutic efficacy in human HCC.
Directory of Open Access Journals (Sweden)
Gabriele Giachin
Full Text Available Humic substances (HS are the largest constituent of soil organic matter and are considered as a key component of the terrestrial ecosystem. HS may facilitate the transport of organic and inorganic molecules, as well as the sorption interactions with environmentally relevant proteins such as prions. Prions enter the environment through shedding from live hosts, facilitating a sustained incidence of animal prion diseases such as Chronic Wasting Disease and scrapie in cervid and ovine populations, respectively. Changes in prion structure upon environmental exposure may be significant as they can affect prion infectivity and disease pathology. Despite its relevance, the mechanisms of prion interaction with HS are still not completely understood. The goal of this work is to advance a structural-level picture of the encapsulation of recombinant, non-infectious, prion protein (PrP into different natural HS. We observed that PrP precipitation upon addition of HS is mainly driven by a mechanism of "salting-out" whereby PrP molecules are rapidly removed from the solution and aggregate in insoluble adducts with humic molecules. Importantly, this process does not alter the protein folding since insoluble PrP retains its α-helical content when in complex with HS. The observed ability of HS to promote PrP insolubilization without altering its secondary structure may have potential relevance in the context of "prion ecology". These results suggest that soil organic matter interacts with prions possibly without altering the protein structures. This may facilitate prions preservation from biotic and abiotic degradation leading to their accumulation in the environment.
Synergistic effect of mixed neutron and gamma irradiation in bipolar operational amplifier OP07
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu, E-mail: liuyan@nint.ac.cn [State Key Laboratory of Intense Pulsed Irradiation Simulation and Effect, Northwest Institute of Nuclear Technology, P.O.Box 69-10, Xi’an 710024 (China); School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China); Wei, Chen; Shanchao, Yang; Xiaoming, Jin [State Key Laboratory of Intense Pulsed Irradiation Simulation and Effect, Northwest Institute of Nuclear Technology, P.O.Box 69-10, Xi’an 710024 (China); Chaohui, He [School of Nuclear Science and Technology, Xi’an Jiaotong University, Xi’an 710049 (China)
2016-09-21
This paper presents the synergistic effects in bipolar operational amplifier OP07. The radiation effects are studied by neutron beam, gamma ray, and mixed neutron/gamma ray environments. The characterateristics of the synergistic effects are studied through comparison of different experiment results. The results show that the bipolar operational amplifier OP07 exhibited significant synergistic effects in the mixed neutron and gamma irradiation. The bipolar transistor is identified as the most radiation sensitive unit of the operational amplifier. In this paper, a series of simulations are performed on bipolar transistors in different radiation environments. In the theoretical simulation, the geometric model and calculations based on the Medici toolkit are built to study the radiation effects in bipolar components. The effect of mixed neutron and gamma irradiation is simulated based on the understanding of the underlying mechanisms of radiation effects in bipolar transistors. The simulated results agree well with the experimental data. The results of the experiments and simulation indicate that the radiation effects in the bipolar devices subjected to mixed neutron and gamma environments is not a simple combination of total ionizing dose (TID) effects and displacement damage. The data suggests that the TID effect could enhance the displacement damage. The synergistic effect should not be neglected in complex radiation environments.
Synergistic effects in threshold models on networks
Juul, Jonas S.; Porter, Mason A.
2018-01-01
Network structure can have a significant impact on the propagation of diseases, memes, and information on social networks. Different types of spreading processes (and other dynamical processes) are affected by network architecture in different ways, and it is important to develop tractable models of spreading processes on networks to explore such issues. In this paper, we incorporate the idea of synergy into a two-state ("active" or "passive") threshold model of social influence on networks. Our model's update rule is deterministic, and the influence of each meme-carrying (i.e., active) neighbor can—depending on a parameter—either be enhanced or inhibited by an amount that depends on the number of active neighbors of a node. Such a synergistic system models social behavior in which the willingness to adopt either accelerates or saturates in a way that depends on the number of neighbors who have adopted that behavior. We illustrate that our model's synergy parameter has a crucial effect on system dynamics, as it determines whether degree-k nodes are possible or impossible to activate. We simulate synergistic meme spreading on both random-graph models and networks constructed from empirical data. Using a heterogeneous mean-field approximation, which we derive under the assumption that a network is locally tree-like, we are able to determine which synergy-parameter values allow degree-k nodes to be activated for many networks and for a broad family of synergistic models.
Prion protein protects mice from lethal infection with influenza A viruses.
Directory of Open Access Journals (Sweden)
Junji Chida
2018-05-01
Full Text Available The cellular prion protein, designated PrPC, is a membrane glycoprotein expressed abundantly in brains and to a lesser extent in other tissues. Conformational conversion of PrPC into the amyloidogenic isoform is a key pathogenic event in prion diseases. However, the physiological functions of PrPC remain largely unknown, particularly in non-neuronal tissues. Here, we show that PrPC is expressed in lung epithelial cells, including alveolar type 1 and 2 cells and bronchiolar Clara cells. Compared with wild-type (WT mice, PrPC-null mice (Prnp0/0 were highly susceptible to influenza A viruses (IAVs, with higher mortality. Infected Prnp0/0 lungs were severely injured, with higher inflammation and higher apoptosis of epithelial cells, and contained higher reactive oxygen species (ROS than control WT lungs. Treatment with a ROS scavenger or an inhibitor of xanthine oxidase (XO, a major ROS-generating enzyme in IAV-infected lungs, rescued Prnp0/0 mice from the lethal infection with IAV. Moreover, Prnp0/0 mice transgenic for PrP with a deletion of the Cu-binding octapeptide repeat (OR region, Tg(PrPΔOR/Prnp0/0 mice, were also highly susceptible to IAV infection. These results indicate that PrPC has a protective role against lethal infection with IAVs through the Cu-binding OR region by reducing ROS in infected lungs. Cu content and the activity of anti-oxidant enzyme Cu/Zn-dependent superoxide dismutase, SOD1, were lower in Prnp0/0 and Tg(PrPΔOR/Prnp0/0 lungs than in WT lungs. It is thus conceivable that PrPC functions to maintain Cu content and regulate SOD1 through the OR region in lungs, thereby reducing ROS in IAV-infected lungs and eventually protecting them from lethal infection with IAVs. Our current results highlight the role of PrPC in protection against IAV infection, and suggest that PrPC might be a novel target molecule for anti-influenza therapeutics.
Accumulation and dissemination of prion protein in experimental sheep scrapie in the natural host
Directory of Open Access Journals (Sweden)
Warner Richard
2009-02-01
Full Text Available Abstract Background In order to study the sites of uptake and mechanisms of dissemination of scrapie prions in the natural host under controlled conditions, lambs aged 14 days and homozygous for the VRQ allele of the PrP gene were infected by the oral route. Infection occurred in all lambs with a remarkably short and highly consistent incubation period of approximately 6 months. Challenge of lambs at approximately eight months of age resulted in disease in all animals, but with more variable incubation periods averaging significantly longer than those challenged at 14 days. This model provides an excellent system in which to study the disease in the natural host by virtue of the relatively short incubation period and close resemblance to natural infection. Results Multiple sites of prion uptake were identified, of which the most important was the Peyer's patch of the distal ileum. Neuroinvasion was detected initially in the enteric nervous system prior to infection of the central nervous system. At end stage disease prion accumulation was widespread throughout the entire neuraxis, but vacuolar pathology was absent in most animals that developed disease at 6–7 months of age. Conclusion Initial spread of detectable PrP was consistent with drainage in afferent lymph to dependent lymph nodes. Subsequent accumulation of prions in lymphoid tissue not associated with the gut is consistent with haematogenous spread. In addition to macrophages and follicular dendritic cells, prion containing cells consistent with afferent lymph dendritic cells were identified and are suggested as a likely vehicle for carriage of prions from initial site of uptake to the lymphoreticular system, and as potential carriers of prion protein in blood. It is apparent that spongiform change, the characteristic lesion of scrapie and other prion diseases, is not responsible for the clinical signs in sheep, but may develop in an age dependent manner.
Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from normal cellular prion protein to pathogenic misfolded conformation. This conversion has been used for in vitro assays including serial protein misfolding amplification...
Involvement of Endogenous Retroviruses in Prion Diseases
Directory of Open Access Journals (Sweden)
Yong-Sun Kim
2013-08-01
Full Text Available For millions of years, vertebrates have been continuously exposed to infection by retroviruses. Ancient retroviral infection of germline cells resulted in the formation and accumulation of inherited retrovirus sequences in host genomes. These inherited retroviruses are referred to as endogenous retroviruses (ERVs, and recent estimates have revealed that a significant portion of animal genomes is made up of ERVs. Although various host factors have suppressed ERV activation, both positive and negative functions have been reported for some ERVs in normal and abnormal physiological conditions, such as in disease states. Similar to other complex diseases, ERV activation has been observed in prion diseases, and this review will discuss the potential involvement of ERVs in prion diseases.
Prion diseases of the brain; Prionenerkrankung des Gehirns
Energy Technology Data Exchange (ETDEWEB)
Lutz, Kira; Urbach, Horst [Universitaetsklinik Freiburg (Germany). Klinik fuer Neuroradiologie
2015-09-15
The prion diseases of the brain, especially Creutzfeldt-Jakob disease, are rare fatal neurodegenerative disorders. A definitive CJD diagnosis is currently only possible by a brain biopsy or post mortem autopsy. The diagnosis of Creutzfeldt-Jakob disease is based on clinical signs, pathognomonic EEG, on typical MRI findings and the examination of the cerebrospinal fluid. Using the MRI the diagnosis Creutzfeldt-Jakob disease can be confirmed or excluded with high certainty. The MRI examination should contain diffusion-weighted and FLAIR imaging sequences. This review article provides an overview of the prion diseases of the brain with the corresponding imaging findings.
2010-07-07
... Prion as a Pest under FIFRA and Amendment of EPA's Regulatory Definition of Pests to Include Prion....e., proteinaceous infectious particle) a ``pest'' under the Federal Insecticide, Fungicide, and... is adding prion to the list of pests in EPA's regulations. This amendment, together with the formal...
Didonna, Alessandro; Vaccari, Lisa; Bek, Alpan; Legname, Giuseppe
2011-03-16
Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrP(Sc)) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrP(C), into nascent PrP(Sc). The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level.
2011-01-01
Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrPSc) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrPC, into nascent PrPSc. The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level. PMID:22778865
Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent
Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...
Determining the relative susceptibility of four prion protein genotypes to atypical scrapie
Atypical scrapie is a sheep prion (PrPSc) disease whose epidemiology is consistent with a sporadic origin and is associated with specific polymorphisms of the normal cellular prion protein (PrPC). We describe a mass spectrometry-based method of detecting and quantifying the polymorphisms of sheep P...
Contrast-induced nephrotoxicity: possible synergistic effect of stress hyperglycemia.
LENUS (Irish Health Repository)
O'Donnell, David H
2010-07-01
Oxidative stress on the renal tubules has been implicated as a mechanism of injury in both stress hyperglycemia and contrast-induced nephrotoxicity. The purpose of this study was to determine whether the combination of these effects has a synergistic effect on accentuating renal tubular apoptosis and therefore increasing the risk of contrast-induced nephrotoxicity.
Prion-seeding activity in cerebrospinal fluid of deer with chronic wasting disease.
Directory of Open Access Journals (Sweden)
Nicholas J Haley
Full Text Available Transmissible spongiform encephalopathies (TSEs, or prion diseases, are a uniformly fatal family of neurodegenerative diseases in mammals that includes chronic wasting disease (CWD of cervids. The early and ante-mortem identification of TSE-infected individuals using conventional western blotting or immunohistochemistry (IHC has proven difficult, as the levels of infectious prions in readily obtainable samples, including blood and bodily fluids, are typically beyond the limits of detection. The development of amplification-based seeding assays has been instrumental in the detection of low levels of infectious prions in clinical samples. In the present study, we evaluated the cerebrospinal fluid (CSF of CWD-exposed (n=44 and naïve (n=4 deer (n=48 total for CWD prions (PrP(d using two amplification assays: serial protein misfolding cyclic amplification with polytetrafluoroethylene beads (sPMCAb and real-time quaking induced conversion (RT-QuIC employing a truncated Syrian hamster recombinant protein substrate. Samples were evaluated blindly in parallel with appropriate positive and negative controls. Results from amplification assays were compared to one another and to obex immunohistochemistry, and were correlated to available clinical histories including CWD inoculum source (e.g. saliva, blood, genotype, survival period, and duration of clinical signs. We found that both sPMCAb and RT-QuIC were capable of amplifying CWD prions from cervid CSF, and results correlated well with one another. Prion seeding activity in either assay was observed in approximately 50% of deer with PrP(d detected by IHC in the obex region of the brain. Important predictors of amplification included duration of clinical signs and time of first tonsil biopsy positive results, and ultimately the levels of PrP(d identified in the obex by IHC. Based on our findings, we expect that both sPMCAb and RT-QuIC may prove to be useful detection assays for the detection of prions in
The number and transmission of [PSI] prion seeds (Propagons in the yeast Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Lee J Byrne
Full Text Available Yeast (Saccharomyces cerevisiae prions are efficiently propagated and the on-going generation and transmission of prion seeds (propagons to daughter cells during cell division ensures a high degree of mitotic stability. The reversible inhibition of the molecular chaperone Hsp104p by guanidine hydrochloride (GdnHCl results in cell division-dependent elimination of yeast prions due to a block in propagon generation and the subsequent dilution out of propagons by cell division.Analysing the kinetics of the GdnHCl-induced elimination of the yeast [PSI+] prion has allowed us to develop novel statistical models that aid our understanding of prion propagation in yeast cells. Here we describe the application of a new stochastic model that allows us to estimate more accurately the mean number of propagons in a [PSI+] cell. To achieve this accuracy we also experimentally determine key cell reproduction parameters and show that the presence of the [PSI+] prion has no impact on these key processes. Additionally, we experimentally determine the proportion of propagons transmitted to a daughter cell and show this reflects the relative cell volume of mother and daughter cells at cell division.While propagon generation is an ATP-driven process, the partition of propagons to daughter cells occurs by passive transfer via the distribution of cytoplasm. Furthermore, our new estimates of n(0, the number of propagons per cell (500-1000, are some five times higher than our previous estimates and this has important implications for our understanding of the inheritance of the [PSI+] and the spontaneous formation of prion-free cells.
Prion protein inhibits microtubule assembly by inducing tubulin oligomerization
International Nuclear Information System (INIS)
Nieznanski, Krzysztof; Podlubnaya, Zoya A.; Nieznanska, Hanna
2006-01-01
A growing body of evidence points to an association of prion protein (PrP) with microtubular cytoskeleton. Recently, direct binding of PrP to tubulin has also been found. In this work, using standard light scattering measurements, sedimentation experiments, and electron microscopy, we show for First time the effect of a direct interaction between these proteins on tubulin polymerization. We demonstrate that full-length recombinant PrP induces a rapid increase in the turbidity of tubulin diluted below the critical concentration for microtubule assembly. This effect requires magnesium ions and is weakened by NaCl. Moreover, the PrP-induced light scattering structures of tubulin are cold-stable. In preparations of diluted tubulin incubated with PrP, electron microscopy revealed the presence of ∼50 nm disc-shaped structures not reported so far. These unique tubulin oligomers may form large aggregates. The effect of PrP is more pronounced under the conditions promoting microtubule formation. In these tubulin samples, PrP induces formation of the above oligomers associated with short protofilaments and sheets of protofilaments into aggregates. Noticeably, this is accompanied by a significant reduction of the number and length of microtubules. Hence, we postulate that prion protein may act as an inhibitor of microtubule assembly by inducing formation of stable tubulin oligomers
The Good, the Bad, and the Ugly of Dendritic Cells during Prion Disease
Mabbott, Neil Andrew; Bradford, Barry Matthew
2015-01-01
Prions are a unique group of proteinaceous pathogens which cause neurodegenerative disease and can be transmitted by a variety of exposure routes. After peripheral exposure, the accumulation and replication of prions within secondary lymphoid organs are obligatory for their efficient spread from the periphery to the brain where they ultimately cause neurodegeneration and death. Mononuclear phagocytes (MNP) are a heterogeneous population of dendritic cells (DC) and macrophages. These cells are abundant throughout the body and display a diverse range of roles based on their anatomical locations. For example, some MNP are strategically situated to provide a first line of defence against pathogens by phagocytosing and destroying them. Conventional DC are potent antigen presenting cells and migrate via the lymphatics to the draining lymphoid tissue where they present the antigens to lymphocytes. The diverse roles of MNP are also reflected in various ways in which they interact with prions and in doing so impact on disease pathogenesis. Indeed, some studies suggest that prions exploit conventional DC to infect the host. Here we review our current understanding of the influence of MNP in the pathogenesis of the acquired prion diseases with particular emphasis on the role of conventional DC. PMID:26697507
Directory of Open Access Journals (Sweden)
Xian Zhou
2016-07-01
Full Text Available Traditional Chinese medicine is an important part of primary health care in Asian countries that has utilised complex herbal formulations (consisting 2 or more medicinal herbs for treating diseases over thousands of years. There seems to be a general assumption that the synergistic therapeutic effects of Chinese herbal medicine derive from the complex interactions between the multiple bioactive components within the herbs and/or herbal formulations. However, evidence to support these synergistic effects remains weak and controversial due to several reasons, including the very complex nature of Chinese herbal medicine, misconceptions about synergy, methodological challenges to study design. In this review, we clarify the definition of synergy, identify common errors in synergy research and describe current methodological approaches to test for synergistic interaction. We discuss the strengthen and weakness of these models in the context of Chinese herbal medicine and summarise the current status of synergy research in CHM. Despite the availability of some scientific data to support the synergistic effects of multi-herbal and/or herb-drug combinations, the level of evidence remains low and the clinical relevancy of most of these findings is undetermined. There remain significant challenges in the development of suitable methods for synergistic studies of complex herbal combinations.
Oxidation reduces the fibrillation but not the neurotoxicity of the prion peptide PrP106-126
DEFF Research Database (Denmark)
Bergstrøm, Linda Alice; Chabry, J.; Bastholm, L.
2007-01-01
There is increasing evidence that soluble oligomers of misfolded protein may play a role in the pathogenesis of protein misfolding diseases including the transmissible spongiform encephalopathies (TSE) where the protein involved is the prion protein, PrP. The effect of oxidation on fibrillation...... tendency and neurotoxicity of different molecular variants of the prion peptide PrP106-126 was investigated. It was found that methionine oxidation significantly reduced amyloid fibril formation and proteinase K resistance, but it did not reduce (but rather increase slightly) the neurotoxicity...
Directory of Open Access Journals (Sweden)
Chae Kim
Full Text Available The mammalian prions replicate by converting cellular prion protein (PrP(C into pathogenic conformational isoform (PrP(Sc. Variations in prions, which cause different disease phenotypes, are referred to as strains. The mechanism of high-fidelity replication of prion strains in the absence of nucleic acid remains unsolved. We investigated the impact of different conformational characteristics of PrP(Sc on conversion of PrP(C in vitro using PrP(Sc seeds from the most frequent human prion disease worldwide, the Creutzfeldt-Jakob disease (sCJD. The conversion potency of a broad spectrum of distinct sCJD prions was governed by the level, conformation, and stability of small oligomers of the protease-sensitive (s PrP(Sc. The smallest most potent prions present in sCJD brains were composed only of∼20 monomers of PrP(Sc. The tight correlation between conversion potency of small oligomers of human sPrP(Sc observed in vitro and duration of the disease suggests that sPrP(Sc conformers are an important determinant of prion strain characteristics that control the progression rate of the disease.
Variably Protease-Sensitive Prionopathy: A New Sporadic Disease of the Prion Protein
Zou, Wen-Quan; Puoti, Gianfranco; Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Shimoji, Miyuki; Langeveld, Jan P. M.; Castellani, Rudy; Notari, Silvio; Crain, Barbara; Schmidt, Robert E.; Geschwind, Michael; DeArmond, Stephen J.; Cairns, Nigel J.; Dickson, Dennis; Honig, Lawrence; Torres, Juan Maria; Mastrianni, James; Capellari, Sabina; Giaccone, Giorgio; Belay, Ermias D.; Schonberger, Lawrence B.; Cohen, Mark; Perry, George; Kong, Qingzhong; Parchi, Piero; Tagliavini, Fabrizio; Gambetti, Pierluigi
2011-01-01
Objective The objective of the study is to report 2 new genotypic forms of protease-sensitive prionopathy (PSPr), a novel prion disease described in 2008, in 11 subjects all homozygous for valine at codon 129 of the prion protein (PrP) gene (129VV). The 2 new PSPr forms affect individuals who are either homozygous for methionine (129MM) or heterozygous for methionine/valine (129MV). Methods Fifteen affected subjects with 129MM, 129MV, and 129VV underwent comparative evaluation at the National Prion Disease Pathology Surveillance Center for clinical, histopathologic, immunohistochemical, genotypical, and PrP characteristics. Results Disease duration (between 22 and 45 months) was significantly different in the 129VV and 129MV subjects. Most other phenotypic features along with the PrP electrophoretic profile were similar but distinguishable in the 3 129 genotypes. A major difference laid in the sensitivity to protease digestion of the disease-associated PrP, which was high in 129VV but much lower, or altogether lacking, in 129MV and 129MM. This difference prompted the substitution of the original designation with “variably protease-sensitive prionopathy” (VPSPr). None of the subjects had mutations in the PrP gene coding region. Interpretation Because all 3 129 genotypes are involved, and are associated with distinguishable phenotypes, VPSPr becomes the second sporadic prion protein disease with this feature after Creutzfeldt-Jakob disease, originally reported in 1920. However, the characteristics of the abnormal prion protein suggest that VPSPr is different from typical prion diseases, and perhaps more akin to subtypes of Gerstmann-Sträussler-Scheinker disease. PMID:20695009
Signal Transduction by a Fungal NOD-Like Receptor Based on Propagation of a Prion Amyloid Fold
Daskalov, A.; Habenstein, B.; Martinez, D.; Debets, A.J.M.; Sabate, R.; Loquet, A.; Saupe, S.J.
2015-01-01
In the fungus Podospora anserina, the [Het-s] prion induces programmed cell death by activating the HET-S pore-forming protein. The HET-s ß-solenoid prion fold serves as a template for converting the HET-S prion-forming domain into the same fold. This conversion, in turn, activates the HET-S
Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; Vries, de R.; Smits, M.
1997-01-01
Prion diseases are natural transmissible neurodegenerative disorders in humans and animals. They are characterized by the accumulation of a protease-resistant scrapie-associated prion protein (PrPSc) of the host-encoded cellular prion protein (PrPC) mainly in the central nervous system.
Bajpai, Vivek K; Yoon, Jung In; Bhardwaj, Monika; Kang, Sun Chul
2014-08-01
To examine the individual and synergistic anti-listerial effect of nisin and leaf essential oil of Metasequoia glyptostroboides (M. glyptostroboides) against one of the leading foodborne pathogens Listeria monocytogenes (L. monocytogenes) ATCC 19116 in milk samples. The whole (8%), low (1%) and skim (no fat content) milk samples were inoculated with L. monocytogenes ATCC 19116 along with leaf essential oil of M. glyptostroboides or nisin alone as well in combinations. In this study, the leaf essential oil at the concentrations of 2% and 5% revealed strong anti-listerial effect against L. monocytogenes ATCC 19116 in all categories of milk samples. Nisin at the concentrations of 250 and 500 IU/mL displayed a strong inhibitory effect against ATCC 19116 as compared to the control group. Additionally, synergistic combinations of leaf essential oil (1%) and nisin (62.5, 125, 250 and 500 IU/mL) also had a remarkable anti-listerial synergism in all the tested milk samples including whole, low and skim milk after 14 days. As a major finding, the leaf essential oil of M. glyptostroboides might be a useful candidate for using in food industry to control the growth of foodborne pathogenic bacteria as confirmed by its potent anti-listerial synergistic effect with nisin against L. monocytogenes ATCC 19116 in different milk samples. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Relationship between magnetism and prion protein
Directory of Open Access Journals (Sweden)
F. Balzano
2010-01-01
Full Text Available The mechanism of conversion of the normal prion protein (PrPC into aggregates of its pathological conformer (PrPSc reamins unclear. The aim of this study was to evaluate the effects induced by exposure of biological samples containing PrPSC to a magnetic field induced prominent molecular changes of samples indicated by the IR spectra located in the region that contains contribution primarily from absorption of amides. This finding suggests the existence of a strong correlation between magnetism and PrPsc and supports a new hypothesis that explains the conversion of normal PrPc to abnormal isoform PrPsc.
Previous investigations aimed at determining whether the mammalian prion protein actually facilitates tangible molecular aspects of either a discrete or pleiotropic functional niche have been debated, especially given the apparent absence of overt behavioral or physiological phenotypes associated wi...
RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. Y. Prosekov
2016-01-01
Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
Synergistic effect of aqueous extract of Telfaria occidentalis on the ...
African Journals Online (AJOL)
Synergistic effect of aqueous extract of Telfaria occidentalis on the biological activities of ... Department of Pharmaceutical Chemistry, Faculty of Pharmacy, University of Ibadan. 2. ... development of resistance to most of the earlier drugs.
Directory of Open Access Journals (Sweden)
Nicholas J. Haley
2017-08-01
Full Text Available Since chronic wasting disease (CWD was first identified nearly 50 years ago in a captive mule deer herd in the Rocky Mountains of the United States, it has slowly spread across North America through the natural and anthropogenic movement of cervids and their carcasses. As the endemic areas have expanded, so has the need for rapid, sensitive, and cost effective diagnostic tests—especially those which take advantage of samples collected antemortem. Over the past two decades, strategies have evolved from the recognition of microscopic spongiform pathology and associated immunohistochemical staining of the misfolded prion protein to enzyme-linked immunoassays capable of detecting the abnormal prion conformer in postmortem samples. In a history that parallels the diagnosis of more conventional infectious agents, both qualitative and real-time amplification assays have recently been developed to detect minute quantities of misfolded prions in a range of biological and environmental samples. With these more sensitive and semi-quantitative approaches has come a greater understanding of the pathogenesis and epidemiology of this disease in the native host. Because the molecular pathogenesis of prion protein misfolding is broadly analogous to the misfolding of other pathogenic proteins, including Aβ and α-synuclein, efforts are currently underway to apply these in vitro amplification techniques towards the diagnosis of Alzheimer’s disease, Parkinson’s disease, and other proteinopathies. Chronic wasting disease—once a rare disease of Colorado mule deer—now represents one of the most prevalent prion diseases, and should serve as a model for the continued development and implementation of novel diagnostic strategies for protein misfolding disorders in the natural host.
Detection of prions in the faeces of sheep naturally infected with classical scrapie
Directory of Open Access Journals (Sweden)
Terry Linda A
2011-05-01
Full Text Available Abstract Classical scrapie is a naturally transmitted prion disease of sheep and goats. Contaminated environments may contribute to the spread of disease and evidence from animal models has implicated urine, blood, saliva, placenta and faeces as possible sources of the infection. Here we sought to determine whether sheep naturally infected with classical scrapie shed prions in their faeces. We used serial protein misfolding cyclic amplification (sPMCA along with two extraction methods to examine faeces from sheep during both the clinical and preclinical phases of the disease and showed amplification of PrPSc in 7 of 15 and 14 of 14 sheep respectively. However PrPSc was not amplified from the faeces of 25 sheep not exposed to scrapie. These data represent the first demonstration of prion shedding in faeces from a naturally infected host and thus a likely source of prion contamination in the environment.
Metabolic patterns in prion diseases: an FDG PET voxel-based analysis
Energy Technology Data Exchange (ETDEWEB)
Prieto, Elena; Dominguez-Prado, Ines; Jesus Ribelles, Maria; Arbizu, Javier [Clinica Universidad de Navarra, Nuclear Medicine Department, Pamplona (Spain); Riverol, Mario; Ortega-Cubero, Sara; Rosario Luquin, Maria; Castro, Purificacion de [Clinica Universidad de Navarra, Neurology Department, Pamplona (Spain)
2015-09-15
Clinical diagnosis of human prion diseases can be challenging since symptoms are common to other disorders associated with rapidly progressive dementia. In this context, {sup 18}F-fluorodeoxyglucose (FDG) positron emission tomography (PET) might be a useful complementary tool. The aim of this study was to determine the metabolic pattern in human prion diseases, particularly sporadic Creutzfeldt-Jakob disease (sCJD), the new variant of Creutzfeldt-Jakob disease (vCJD) and fatal familial insomnia (FFI). We retrospectively studied 17 patients with a definitive, probable or possible prion disease who underwent FDG PET in our institution. Of these patients, 12 were diagnosed as sCJD (9 definitive, 2 probable and 1 possible), 1 was diagnosed as definitive vCJD and 4 were diagnosed as definitive FFI. The hypometabolic pattern of each individual and comparisons across the groups of subjects (control subjects, sCJD and FFI) were evaluated using a voxel-based analysis. The sCJD group exhibited a pattern of hypometabolism that affected both subcortical (bilateral caudate, thalamus) and cortical (frontal cortex) structures, while the FFI group only presented a slight hypometabolism in the thalamus. Individual analysis demonstrated a considerable variability of metabolic patterns among patients, with the thalamus and basal ganglia the most frequently affected areas, combined in some cases with frontal and temporal hypometabolism. Patients with a prion disease exhibit a characteristic pattern of brain metabolism presentation in FDG PET imaging. Consequently, in patients with rapidly progressive cognitive impairment, the detection of these patterns in the FDG PET study could orient the diagnosis to a prion disease. (orig.)
Metabolic patterns in prion diseases: an FDG PET voxel-based analysis
International Nuclear Information System (INIS)
Prieto, Elena; Dominguez-Prado, Ines; Jesus Ribelles, Maria; Arbizu, Javier; Riverol, Mario; Ortega-Cubero, Sara; Rosario Luquin, Maria; Castro, Purificacion de
2015-01-01
Clinical diagnosis of human prion diseases can be challenging since symptoms are common to other disorders associated with rapidly progressive dementia. In this context, 18 F-fluorodeoxyglucose (FDG) positron emission tomography (PET) might be a useful complementary tool. The aim of this study was to determine the metabolic pattern in human prion diseases, particularly sporadic Creutzfeldt-Jakob disease (sCJD), the new variant of Creutzfeldt-Jakob disease (vCJD) and fatal familial insomnia (FFI). We retrospectively studied 17 patients with a definitive, probable or possible prion disease who underwent FDG PET in our institution. Of these patients, 12 were diagnosed as sCJD (9 definitive, 2 probable and 1 possible), 1 was diagnosed as definitive vCJD and 4 were diagnosed as definitive FFI. The hypometabolic pattern of each individual and comparisons across the groups of subjects (control subjects, sCJD and FFI) were evaluated using a voxel-based analysis. The sCJD group exhibited a pattern of hypometabolism that affected both subcortical (bilateral caudate, thalamus) and cortical (frontal cortex) structures, while the FFI group only presented a slight hypometabolism in the thalamus. Individual analysis demonstrated a considerable variability of metabolic patterns among patients, with the thalamus and basal ganglia the most frequently affected areas, combined in some cases with frontal and temporal hypometabolism. Patients with a prion disease exhibit a characteristic pattern of brain metabolism presentation in FDG PET imaging. Consequently, in patients with rapidly progressive cognitive impairment, the detection of these patterns in the FDG PET study could orient the diagnosis to a prion disease. (orig.)
The structural core of prion disease
Boshuizen, R.S.
2010-01-01
Transmissible spongiform encephalopathies (TSEs) or prion diseases are serious neurological ailments, in which the brain tissue deteriorates by progressive loss of brain cells which results in the loss of a wide variety of brain functions, including memory, speech and locomotion. Similar conditions
Khan, M. Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R.; Pai, Emil F.; Chakrabartty, Avijit
2010-01-01
Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrPSc). Exposure to PrPSc from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer–octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease. PMID:21041683
Khan, M Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R; Pai, Emil F; Chakrabartty, Avijit
2010-11-16
Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrP(Sc)). Exposure to PrP(Sc) from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer-octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease.
Huyben, David; Boqvist, Sofia; Passoth, Volkmar; Renström, Lena; Allard Bengtsson, Ulrika; Andréoletti, Olivier; Kiessling, Anders; Lundh, Torbjörn; Vågsholm, Ivar
2018-02-08
Yeasts can be used to convert organic food wastes to protein-rich animal feed in order to recapture nutrients. However, the reuse of animal-derived waste poses a risk for the transmission of infectious prions that can cause neurodegeneration and fatality in humans and animals. The aim of this study was to investigate the ability of yeasts to reduce prion activity during the biotransformation of waste substrates-thereby becoming a biosafety hurdle in such a circular food system. During pre-screening, 30 yeast isolates were spiked with Classical Scrapie prions and incubated for 72 h in casein substrate, as a waste substitute. Based on reduced Scrapie seeding activity, waste biotransformation and protease activities, intact cells and cell extracts of 10 yeasts were further tested. Prion analysis showed that five yeast species reduced Scrapie seeding activity by approximately 1 log10 or 90%. Cryptococcus laurentii showed the most potential to reduce prion activity since both intact and extracted cells reduced Scrapie by 1 log10 and achieved the highest protease activity. These results show that select forms of yeast can act as a prion hurdle during the biotransformation of waste. However, the limited ability of yeasts to reduce prion activity warrants caution as a sole barrier to transmission as higher log reductions are needed before using waste-cultured yeast in circular food systems.
Wang, Jing; Li, Yun; Sun, Wei; Liu, Jing; Chen, Wenming
2018-03-22
This study aimed to investigate synergistic effects of recombinant mutant human tumor necrosis factor-related apoptosis-inducing ligand (rmhTRAIL) and heat-shock protein 90 (HSP90) inhibitor (geldanamycin derivative 17 -allylamino- 17-demethoxy -geldanamycin, 17-AAG) on the proliferation and apoptosis of multiple myeloma (MM) cells. MTT assays evaluated inhibitory effects of rmhTRAIL and 17-AAG in different concentrations and treatment durations on the proliferation of RPMI8226 and U266 cells. The half maximal inhibitory concentration was calculated using OriginPro7.5. Synergistic effects of rmhTRAIL and 17-AAG on apoptosis of MM cells were detected using flow cytometry at 24 and 48 h post-treatment. To evaluate synergistic effects of rmhTRAIL and 17-AAG, the Q-value was calculated using King's formula. rmhTRAIL exhibited significant inhibitory effects on the proliferation of RPMI8226 cells in a dose- and time-dependent manner (>50%), whereas U266 cells were not sensitive to rmhTRAIL (80%). Significant synergistic effects of rmhTRAIL and 17-AAG on the proliferation of RPMI8226 cells were revealed (Q-value > 1.15), whereas synergistic effects were not evident on the proliferation of U266 cells (Q-value effects on apoptosis of RPMI8226 and U266 cells (Q-value > 1.15). The combined application of rmhTRAIL and 17-AAG revealed favorable synergistic effects in the treatment of MM.
Directory of Open Access Journals (Sweden)
Gourdain Pauline
2012-01-01
Full Text Available Abstract Background The cellular prion protein (PrPc is a host-encoded glycoprotein whose transconformation into PrP scrapie (PrPSc initiates prion diseases. The role of PrPc in health is still obscure, but many candidate functions have been attributed to the protein, both in the immune and the nervous systems. Recent data show that experimental autoimmune encephalomyelitis (EAE is worsened in mice lacking PrPc. Disease exacerbation has been attributed to T cells that would differentiate into more aggressive effectors when deprived of PrPc. However, alternative interpretations such as reduced resistance of neurons to autoimmune insult and exacerbated gliosis leading to neuronal deficits were not considered. Method To better discriminate the contribution of immune cells versus neural cells, reciprocal bone marrow chimeras with differential expression of PrPc in the lymphoid or in the central nervous system (CNS were generated. Mice were subsequently challenged with MOG35-55 peptide and clinical disease as well as histopathology were compared in both groups. Furthermore, to test directly the T cell hypothesis, we compared the encephalitogenicity of adoptively transferred PrPc-deficient versus PrPc-sufficient, anti-MOG T cells. Results First, EAE exacerbation in PrPc-deficient mice was confirmed. Irradiation exacerbated EAE in all the chimeras and controls, but disease was more severe in mice with a PrPc-deleted CNS and a normal immune system than in the reciprocal construction. Moreover, there was no indication that anti-MOG responses were different in PrPc-sufficient and PrPc-deficient mice. Paradoxically, PrPc-deficient anti-MOG 2D2 T cells were less pathogenic than PrPc-expressing 2D2 T cells. Conclusions In view of the present data, it can be concluded that the origin of EAE exacerbation in PrPc-ablated mice resides in the absence of the prion protein in the CNS. Furthermore, the absence of PrPc on both neural and immune cells does not
Energy Technology Data Exchange (ETDEWEB)
Scarpelli, M; Perlman, S; Liu, G [University of Wisconsin-Madison, Madison, WI (United States); Simoncic, U [Jozef Stefan Institute, Ljubljana (Slovenia); Jeraj, R [University of Wisconsin-Madison, Madison, WI (United States); Jozef Stefan Institute, Ljubljana (Slovenia)
2016-06-15
Purpose: Novel treatment strategies for metastatic cancer patients involve synergistically combining treatments with the hope of improving outcomes. This study investigated changes in tumor proliferative and vascular characteristics derived from dynamic [F-18]FLT PET during antiangiogenic treatment with the goal of identifying synergistic treatment opportunities. Methods: Patients with various solid cancers underwent continuous three-week cycles of anti-angiogenic treatment with intermittent dosing (two-weeks-on/one-week-off). Patients received up to six dynamic FLT PET/CT scans (days 0, 14, and 21 of cycle 1 (C1) and cycle 3 (C3)). Tumor proliferative (Kflt, net uptake rate) and vascular parameters (K1 blood-to-tissue transfer; Vb, vascular fraction) were calculated using a two-tissue compartment four-rate parameter kinetic model. Relative changes in these parameters, from day 0 to 14 (TxResp) and day 14 to 21 (offTxResp), were calculated. Significant differences were tested using Wilcoxon signed-rank test and significant correlations were tested using Spearman correlation. Results: Thirty patients were evaluable for C1 offTxResp with median values for Kflt, K1, and Vb of +30%, +35% and +30%, respectively. The fractions of patients with positive C1 offTxResp were: 21/30 for Ki, 24/30 for K1, 21/30 for Vb, and 12/30 had positive offTxResp for all three kinetic parameters. The offTxResp in C3 was not significantly different from C1 for any of the kinetic parameters. Significant correlations were found between TxResp and offTxResp in C1 for Kflt (ρ=-0.52, p=0.014), K1 (ρ=−0.61, p=0.003) and Vb (ρ=−0.80, p<0.001). Similar correlations were found for Kflt (ρ=-1, p=0.017) and K1 (ρ=−1, p=0.017) for the five patients evaluable in C3. Conclusion: Dynamic FLT PET showed evidence of distinct vascular and proliferative increases during off treatment weeks that could potentially be targeted with synergistic therapy. Early changes in kinetic parameters were
Scrapie prion liposomes and rods exhibit target sizes of 55,000 Da
International Nuclear Information System (INIS)
Bellinger-Kawahara, C.G.; Kempner, E.; Groth, D.; Gabizon, R.; Prusiner, S.B.
1988-01-01
Scrapie is a degenerative neurologic disease in sheep and goats which can be experimentally transmitted to laboratory rodents. Considerable evidence suggests that the scrapie agent is composed largely, if not entirely, of an abnormal isoform of the prion protein (PrPSc). Inactivation of scrapie prions by ionizing radiation exhibited single-hit kinetics and gave a target size of 55,000 +/- 9000 mol wt. The inactivation profile was independent of the form of the prion. Scrapie agent infectivity in brain homogenates, microsomal fractions, detergent-extracted microsomes, purified amyloid rods, and liposomes exhibited the same inactivation profile. Our data are consistent with the hypothesis that the infectious particle causing scrapie contains approximately 2 PrPSc molecules
Human prion diseases in the United States.
Directory of Open Access Journals (Sweden)
Robert C Holman
Full Text Available BACKGROUND: Prion diseases are a family of rare, progressive, neurodegenerative disorders that affect humans and animals. The most common form of human prion disease, Creutzfeldt-Jakob disease (CJD, occurs worldwide. Variant CJD (vCJD, a recently emerged human prion disease, is a zoonotic foodborne disorder that occurs almost exclusively in countries with outbreaks of bovine spongiform encephalopathy. This study describes the occurrence and epidemiology of CJD and vCJD in the United States. METHODOLOGY/PRINCIPAL FINDINGS: Analysis of CJD and vCJD deaths using death certificates of US residents for 1979-2006, and those identified through other surveillance mechanisms during 1996-2008. Since CJD is invariably fatal and illness duration is usually less than one year, the CJD incidence is estimated as the death rate. During 1979 through 2006, an estimated 6,917 deaths with CJD as a cause of death were reported in the United States, an annual average of approximately 247 deaths (range 172-304 deaths. The average annual age-adjusted incidence for CJD was 0.97 per 1,000,000 persons. Most (61.8% of the CJD deaths occurred among persons >or=65 years of age for an average annual incidence of 4.8 per 1,000,000 persons in this population. Most deaths were among whites (94.6%; the age-adjusted incidence for whites was 2.7 times higher than that for blacks (1.04 and 0.40, respectively. Three patients who died since 2004 were reported with vCJD; epidemiologic evidence indicated that their infection was acquired outside of the United States. CONCLUSION/SIGNIFICANCE: Surveillance continues to show an annual CJD incidence rate of about 1 case per 1,000,000 persons and marked differences in CJD rates by age and race in the United States. Ongoing surveillance remains important for monitoring the stability of the CJD incidence rates, and detecting occurrences of vCJD and possibly other novel prion diseases in the United States.
Donaldson, David S.; Else, Kathryn J.
2015-01-01
ABSTRACT Prion diseases are infectious neurodegenerative disorders characterized by accumulations of abnormally folded cellular prion protein in affected tissues. Many natural prion diseases are acquired orally, and following exposure, the early replication of some prion isolates upon follicular dendritic cells (FDC) within gut-associated lymphoid tissues (GALT) is important for the efficient spread of disease to the brain (neuroinvasion). Prion detection within large intestinal GALT biopsy specimens has been used to estimate human and animal disease prevalence. However, the relative contributions of the small and large intestinal GALT to oral prion pathogenesis were unknown. To address this issue, we created mice that specifically lacked FDC-containing GALT only in the small intestine. Our data show that oral prion disease susceptibility was dramatically reduced in mice lacking small intestinal GALT. Although these mice had FDC-containing GALT throughout their large intestines, these tissues were not early sites of prion accumulation or neuroinvasion. We also determined whether pathology specifically within the large intestine might influence prion pathogenesis. Congruent infection with the nematode parasite Trichuris muris in the large intestine around the time of oral prion exposure did not affect disease pathogenesis. Together, these data demonstrate that the small intestinal GALT are the major early sites of prion accumulation and neuroinvasion after oral exposure. This has important implications for our understanding of the factors that influence the risk of infection and the preclinical diagnosis of disease. IMPORTANCE Many natural prion diseases are acquired orally. After exposure, the accumulation of some prion diseases in the gut-associated lymphoid tissues (GALT) is important for efficient spread of disease to the brain. However, the relative contributions of GALT in the small and large intestines to oral prion pathogenesis were unknown. We show that the
Donaldson, David S; Else, Kathryn J; Mabbott, Neil A
2015-09-01
Prion diseases are infectious neurodegenerative disorders characterized by accumulations of abnormally folded cellular prion protein in affected tissues. Many natural prion diseases are acquired orally, and following exposure, the early replication of some prion isolates upon follicular dendritic cells (FDC) within gut-associated lymphoid tissues (GALT) is important for the efficient spread of disease to the brain (neuroinvasion). Prion detection within large intestinal GALT biopsy specimens has been used to estimate human and animal disease prevalence. However, the relative contributions of the small and large intestinal GALT to oral prion pathogenesis were unknown. To address this issue, we created mice that specifically lacked FDC-containing GALT only in the small intestine. Our data show that oral prion disease susceptibility was dramatically reduced in mice lacking small intestinal GALT. Although these mice had FDC-containing GALT throughout their large intestines, these tissues were not early sites of prion accumulation or neuroinvasion. We also determined whether pathology specifically within the large intestine might influence prion pathogenesis. Congruent infection with the nematode parasite Trichuris muris in the large intestine around the time of oral prion exposure did not affect disease pathogenesis. Together, these data demonstrate that the small intestinal GALT are the major early sites of prion accumulation and neuroinvasion after oral exposure. This has important implications for our understanding of the factors that influence the risk of infection and the preclinical diagnosis of disease. Many natural prion diseases are acquired orally. After exposure, the accumulation of some prion diseases in the gut-associated lymphoid tissues (GALT) is important for efficient spread of disease to the brain. However, the relative contributions of GALT in the small and large intestines to oral prion pathogenesis were unknown. We show that the small intestinal
Directory of Open Access Journals (Sweden)
Diego La Mendola
2014-05-01
Full Text Available Prion disorders are a group of fatal neurodegenerative conditions of mammals. The key molecular event in the pathogenesis of such diseases is the conformational conversion of prion protein, PrPC, into a misfolded form rich in β-sheet structure, PrPSc, but the detailed mechanistic aspects of prion protein conversion remain enigmatic. There is uncertainty on the precise physiological function of PrPC in healthy individuals. Several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ mainly through a domain composed by four to five repeats of eight amino acids. In addition to mammals, PrP homologues have also been identified in birds, reptiles, amphibians and fish. The globular domain of protein is retained in the different species, suggesting that the protein carries out an essential common function. However, the comparison of amino acid sequences indicates that prion protein has evolved differently in each vertebrate class. The primary sequences are strongly conserved in each group, but these exhibit a low similarity with those of mammals. The N-terminal domain of different prions shows tandem amino acid repeats with an increasing amount of histidine residues going from amphibians to mammals. The difference in the sequence affects the number of copper binding sites, the affinity and the coordination environment of metal ions, suggesting that the involvement of prion in metal homeostasis may be a specific characteristic of mammalian prion protein. In this review, we describe the similarities and the differences in the metal binding of different species’ prion protein, as revealed by studies carried out on the entire protein and related peptide fragments.
Directory of Open Access Journals (Sweden)
Angélique Igel-Egalon
2017-09-01
Full Text Available Mammalian prions, the pathogens that cause transmissible spongiform encephalopathies, propagate by self-perpetuating the structural information stored in the abnormally folded, aggregated conformer (PrPSc of the host-encoded prion protein (PrPC. To date, no structural model related to prion assembly organization satisfactorily describes how strain-specified structural information is encoded and by which mechanism this information is transferred to PrPC. To achieve progress on this issue, we correlated the PrPSc quaternary structural transition from three distinct prion strains during unfolding and refolding with their templating activity. We reveal the existence of a mesoscopic organization in PrPSc through the packing of a highly stable oligomeric elementary subunit (suPrP, in which the strain structural determinant (SSD is encoded. Once kinetically trapped, this elementary subunit reversibly loses all replicative information. We demonstrate that acquisition of the templating interface and infectivity requires structural rearrangement of suPrP, in concert with its condensation. The existence of such an elementary brick scales down the SSD support to a small oligomer and provide a basis of reflexion for prion templating process and propagation.
Subtype and regional regulation of prion biomarkers in sporadic Creutzfeldt-Jakob disease.
Llorens, Franc; Zafar, Saima; Ansoleaga, Belén; Shafiq, Mohsin; Blanco, Rosi; Carmona, Marga; Grau-Rivera, Oriol; Nos, Carlos; Gelpí, Ellen; Del Río, José Antonio; Zerr, Inga; Ferrer, Isidre
2015-08-01
Creutzfeldt-Jakob disease (CJD) is a rapid progressive neurological disease leading to dementia and death. Prion biomarkers are altered in the cerebrospinal fluid (CSF) of CJD patients, but the pathogenic mechanisms underlying these alterations are still unknown. The present study examined prion biomarker levels in the brain and CSF of sporadic CJD (sCJD) cases and their correlation with neuropathological lesion profiles. The expression levels of 14-3-3, Tau, phospho-Tau and α-synuclein were measured in the CSF and brain of sCJD cases in a subtype- and region-specific manner. In addition, the activity of prion biomarker kinases, the expression levels of CJD hallmarks and the most frequent neuropathological sCJD findings were analysed. Prion biomarkers levels were increased in the CSF of sCJD patients; however, correlations between mRNA, total protein and their phosphorylated forms in brain were different. The observed downregulation of the main Tau kinase, GSK3, in sCJD brain samples may help to explain the differential phospho-Tau/Tau ratios between sCJD and other dementias in the CSF. Importantly, CSF biomarkers levels do not necessarily correlate with sCJD neuropathological findings. Present findings indicate that prion biomarkers levels in sCJD tissues and their release into the CSF are differentially regulated following specific modulated responses, and suggest a functional role for these proteins in sCJD pathogenesis. © 2014 British Neuropathological Society.
Energy Technology Data Exchange (ETDEWEB)
Wang, Chenhui, E-mail: wangchenhui@nint.ac.cn [State Key Laboratory of Intense Pulsed Irradiation Simulation and Effect, Northwest Institute of Nuclear Technology, P.O. Box 69-10, Xi’an 710024 (China); Chen, Wei; Yao, Zhibin; Jin, Xiaoming; Liu, Yan; Yang, Shanchao [State Key Laboratory of Intense Pulsed Irradiation Simulation and Effect, Northwest Institute of Nuclear Technology, P.O. Box 69-10, Xi’an 710024 (China); Wang, Zhikuan [State Key Laboratory of Analog Integrated Circuit, Chongqing 400060 (China)
2016-09-21
A kind of gate-controlled lateral PNP bipolar transistor has been specially designed to do experimental validations and studies on the ionizing/displacement synergistic effects in the lateral PNP bipolar transistor. The individual and mixed irradiation experiments of gamma rays and neutrons are accomplished on the transistors. The common emitter current gain, gate sweep characteristics and sub-threshold sweep characteristics are measured after each exposure. The results indicate that under the sequential irradiation of gamma rays and neutrons, the response of the gate-controlled lateral PNP bipolar transistor does exhibit ionizing/displacement synergistic effects and base current degradation is more severe than the simple artificial sum of those under the individual gamma and neutron irradiation. Enough attention should be paid to this phenomenon in radiation damage evaluation. - Highlights: • A kind of gate-controlled lateral PNP bipolar transistor has been specially designed to facilitate the analysis of ionizing/displacement synergistic effects induced by the mixed irradiation of gamma and neutron. • The difference between ionizing/displacement synergistic effects and the simple sum of TID and displacement effects is analyzed. • The physical mechanisms of synergistic effects are explained.
Insights into the physiological function of cellular prion protein
Directory of Open Access Journals (Sweden)
Martins V.R.
2001-01-01
Full Text Available Prions have been extensively studied since they represent a new class of infectious agents in which a protein, PrPsc (prion scrapie, appears to be the sole component of the infectious particle. They are responsible for transmissible spongiform encephalopathies, which affect both humans and animals. The mechanism of disease propagation is well understood and involves the interaction of PrPsc with its cellular isoform (PrPc and subsequently abnormal structural conversion of the latter. PrPc is a glycoprotein anchored on the cell surface by a glycosylphosphatidylinositol moiety and expressed in most cell types but mainly in neurons. Prion diseases have been associated with the accumulation of the abnormally folded protein and its neurotoxic effects; however, it is not known if PrPc loss of function is an important component. New efforts are addressing this question and trying to characterize the physiological function of PrPc. At least four different mouse strains in which the PrP gene was ablated were generated and the results regarding their phenotype are controversial. Localization of PrPc on the cell membrane makes it a potential candidate for a ligand uptake, cell adhesion and recognition molecule or a membrane signaling molecule. Recent data have shown a potential role for PrPc in the metabolism of copper and moreover that this metal stimulates PrPc endocytosis. Our group has recently demonstrated that PrPc is a high affinity laminin ligand and that this interaction mediates neuronal cell adhesion and neurite extension and maintenance. Moreover, PrPc-caveolin-1 dependent coupling seems to trigger the tyrosine kinase Fyn activation. These data provide the first evidence for PrPc involvement in signal transduction.
Ssb1 chaperone is a [PSI+] prion-curing factor.
Chacinska, A; Szczesniak, B; Kochneva-Pervukhova, N V; Kushnirov, V V; Ter-Avanesyan, M D; Boguta, M
2001-04-01
Yeast SUP7' or SUP11 nonsense suppressors have no phenotypic expression in strains deficient in the isopentenylation of A37 in tRNA. Here we show that such strains spontaneously produce cells with a nonsense suppressor phenotype which is related to the cytoplasmically inherited determinant and manifests all the key features of the [PSI+] prion. A screen of a multicopy yeast genomic library for genes that inactivate the [PSI+]-related suppressor phenotype resulted in the isolation of the SSB1 gene. Moreover, we demonstrate that multicopy plasmid encoding the Ssb1 chaperone cures cells of the [PSI+] prion.
PrPC expression and prion seeding activity in the alimentary tract and lymphoid tissue of deer.
Davenport, Kristen A; Hoover, Clare E; Bian, Jifeng; Telling, Glenn C; Mathiason, Candace K; Hoover, Edward A
2017-01-01
The agent responsible for prion diseases is a misfolded form of a normal protein (PrPC). The prion hypothesis stipulates that PrPC must be present for the disease to manifest. Cervid populations across the world are infected with chronic wasting disease, a horizontally-transmissible prion disease that is likely spread via oral exposure to infectious prions (PrPCWD). Though PrPCWD has been identified in many tissues, there has been little effort to characterize the overall PrPC expression in cervids and its relationship to PrPCWD accumulation. We used immunohistochemistry (IHC), western blot and enzyme-linked immunosorbent assay to describe PrPC expression in naïve white-tailed deer. We used real-time, quaking-induced conversion (RT-QuIC) to detect prion seeding activity in CWD-infected deer. We assessed tissues comprising the alimentary tract, alimentary-associated lymphoid tissue and systemic lymphoid tissue from 5 naïve deer. PrPC was expressed in all tissues, though expression was often very low compared to the level in the CNS. IHC identified specific cell types wherein PrPC expression is very high. To compare the distribution of PrPC to PrPCWD, we examined 5 deer with advanced CWD infection. Using RT-QuIC, we detected prion seeding activity in all 21 tissues. In 3 subclinical deer sacrificed 4 months post-inoculation, we detected PrPCWD consistently in alimentary-associated lymphoid tissue, irregularly in alimentary tract tissues, and not at all in the brain. Contrary to our hypothesis that PrPC levels dictate prion accumulation, PrPC expression was higher in the lower gastrointestinal tissues than in the alimentary-associated lymphoid system and was higher in salivary glands than in the oropharyngeal lymphoid tissue. These data suggest that PrPC expression is not the sole driver of prion accumulation and that alimentary tract tissues accumulate prions before centrifugal spread from the brain occurs.
Directory of Open Access Journals (Sweden)
Aroa Relaño-Ginès
Full Text Available Prion diseases are irreversible progressive neurodegenerative diseases, leading to severe incapacity and death. They are characterized in the brain by prion amyloid deposits, vacuolisation, astrocytosis, neuronal degeneration, and by cognitive, behavioural and physical impairments. There is no treatment for these disorders and stem cell therapy therefore represents an interesting new approach. Gains could not only result from the cell transplantation, but also from the stimulation of endogenous neural stem cells (NSC or by the combination of both approaches. However, the development of such strategies requires a detailed knowledge of the pathology, particularly concerning the status of the adult neurogenesis and endogenous NSC during the development of the disease. During the past decade, several studies have consistently shown that NSC reside in the adult mammalian central nervous system (CNS and that adult neurogenesis occurs throughout the adulthood in the subventricular zone of the lateral ventricle or the Dentate Gyrus of the hippocampus. Adult NSC are believed to constitute a reservoir for neuronal replacement during normal cell turnover or after brain injury. However, the activation of this system does not fully compensate the neuronal loss that occurs during neurodegenerative diseases and could even contribute to the disease progression. We investigated here the status of these cells during the development of prion disorders. We were able to show that NSC accumulate and replicate prions. Importantly, this resulted in the alteration of their neuronal fate which then represents a new pathologic event that might underlie the rapid progression of the disease.
Cross-seeding of prions by aggregated α-synuclein leads to transmissible spongiform encephalopathy.
Directory of Open Access Journals (Sweden)
Elizaveta Katorcha
2017-08-01
Full Text Available Aggregation of misfolded proteins or peptides is a common feature of neurodegenerative diseases including Alzheimer's, Parkinson's, Huntington's, prion and other diseases. Recent years have witnessed a growing number of reports of overlap in neuropathological features that were once thought to be unique to only one neurodegenerative disorder. However, the origin for the overlap remains unclear. One possibility is that diseases with mixed brain pathologies might arise from cross-seeding of one amyloidogenic protein by aggregated states of unrelated proteins. In the current study we examined whether prion replication can be induced by cross-seeding by α-synuclein or Aβ peptide. We found that α-synuclein aggregates formed in cultured cells or in vitro display cross-seeding activity and trigger misfolding of the prion protein (PrPC in serial Protein Misfolding Cyclic Amplification reactions, producing self-replicating PrP states characterized by a short C-terminal proteinase K (PK-resistant region referred to as PrPres. Non-fibrillar α-synuclein or fibrillar Aβ failed to cross-seed misfolding of PrPC. Remarkably, PrPres triggered by aggregated α-synuclein in vitro propagated in animals and, upon serial transmission, produced PrPSc and clinical prion disease characterized by spongiosis and astrocytic gliosis. The current study demonstrates that aggregated α-synuclein is potent in cross-seeding of prion protein misfolding and aggregation in vitro, producing self-replicating states that can lead to transmissible prion diseases upon serial passaging in wild type animals. In summary, the current work documents direct cross-seeding between unrelated amyloidogenic proteins associated with different neurodegenerative diseases. This study suggests that early interaction between unrelated amyloidogenic proteins might underlie the etiology of mixed neurodegenerative proteinopathies.
Directory of Open Access Journals (Sweden)
Shuihua Chen
2015-07-01
Full Text Available Synergistic effect refers to simultaneous actions of separate factors which have a greater total effect than the sum of the individual factor effects. However, there has been a limited knowledge on how synergistic effects occur and individual roles of different drivers are not often considered. Therefore, it becomes quite challenging to manage multiple threatening processes simultaneously in order to mitigate biodiversity loss. In this regard, our hypothesis is, if the traits actually play different roles in the synergistic interaction, conservation efforts could be made more effectively. To understand the synergistic effect and test our hypothesis, we examined the processes associated with the endangerment of critically endangered Chinese Crested Tern (Thalasseus bernsteini, whose total population number was estimated no more than 50. Through monitoring of breeding colonies and investigations into causative factors, combined with other data on human activities, we found that widespread human harvest of seabird eggs and increasing frequency of typhoons are the major factors that threatened the Chinese Crested Tern. Furthermore, 28 percent of breeding failures were due to the synergistic effects in which egg harvest-induced renestings suffered the higher frequent typhoons. In such combined interactions, the egg harvest has clearly served as a proximal factor for the population decline, and the superimposition of enhanced typhoon activity further accelerated the species toward imminent extinction. Our findings suggest that species endangerment, on one hand, should be treated as a synergistic process, while conservation efforts, on the other hand, should focus principally on combatting the threat that triggers synergistic effects.
LRP1 controls biosynthetic and endocytic trafficking of neuronal prion protein
DEFF Research Database (Denmark)
Parkyn, Celia J; Vermeulen, Esmeralda G M; Mootoosamy, Roy C
2008-01-01
The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly and consti......The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly...... required for this process. Moreover, sustained inhibition of LRP1 levels by siRNA leads to the accumulation of PrP(C) in biosynthetic compartments, with a concomitant lowering of surface PrP(C), suggesting that LRP1 expedites the trafficking of PrP(C) to the neuronal surface. PrP(C) and LRP1 can be co......-immunoprecipitated from the endoplasmic reticulum in normal neurons. The N-terminal domain of PrP(C) binds to purified human LRP1 with nanomolar affinity, even in the presence of 1 microM of the LRP-specific chaperone, receptor-associated protein (RAP). Taken together, these data argue that LRP1 controls both the surface...
A prion (PrPSc) is a conformer of a normal cellular prion protein (PrPC). Although they are isosequential, PrPSc is an infectious protein able to convert PrPC into the prion conformation and thereby propagate an infection. PrPC is monomeric while PrPSc is a multimer. PrPSc can adopt more than one co...
Spreading of a prion domain from cell-to-cell by vesicular transport in Caenorhabditis elegans.
Directory of Open Access Journals (Sweden)
Carmen I Nussbaum-Krammer
2013-03-01
Full Text Available Prion proteins can adopt self-propagating alternative conformations that account for the infectious nature of transmissible spongiform encephalopathies (TSEs and the epigenetic inheritance of certain traits in yeast. Recent evidence suggests a similar propagation of misfolded proteins in the spreading of pathology of neurodegenerative diseases including Alzheimer's or Parkinson's disease. Currently there is only a limited number of animal model systems available to study the mechanisms that underlie the cell-to-cell transmission of aggregation-prone proteins. Here, we have established a new metazoan model in Caenorhabditis elegans expressing the prion domain NM of the cytosolic yeast prion protein Sup35, in which aggregation and toxicity are dependent upon the length of oligopeptide repeats in the glutamine/asparagine (Q/N-rich N-terminus. NM forms multiple classes of highly toxic aggregate species and co-localizes to autophagy-related vesicles that transport the prion domain from the site of expression to adjacent tissues. This is associated with a profound cell autonomous and cell non-autonomous disruption of mitochondrial integrity, embryonic and larval arrest, developmental delay, widespread tissue defects, and loss of organismal proteostasis. Our results reveal that the Sup35 prion domain exhibits prion-like properties when expressed in the multicellular organism C. elegans and adapts to different requirements for propagation that involve the autophagy-lysosome pathway to transmit cytosolic aggregation-prone proteins between tissues.
Sepúlveda-Crespo, Daniel; Lorente, Raquel; Leal, Manuel; Gómez, Rafael; De la Mata, Francisco J; Jiménez, José Luis; Muñoz-Fernández, M Ángeles
2014-04-01
Polyanionic carbosilane dendrimers represent opportunities to develop new anti-HIV microbicides. Dendrimers and antiretrovirals (ARVs) acting at different stages of HIV replication have been proposed as compounds to decrease new HIV infections. Thus, we determined the potential use of our G2-STE16 carbosilane dendrimer in combination with other carbosilane dendrimers and ARVs for the use as topical microbicide against HIV-1. We showed that these combinations obtained 100% inhibition and displayed a synergistic profile against different HIV-1 isolates in our model of TZM.bl cells. Our results also showed their potent activity in the presence of an acidic vaginal or seminal fluid environment and did not activate an inflammatory response. This study is the first step toward exploring the use of different anionic carbosilane dendrimers in combination and toward making a safe microbicide. Therefore, our results support further studies on dendrimer/dendrimer or dendrimer/ARV combinations as topical anti-HIV-1 microbicide. This paper describes the first steps toward the use of anionic carbosilane dendrimers in combination with antivirals to address HIV-1, paving the way to further studies on dendrimer/dendrimer or dendrimer/ARV combinations as topical anti-HIV-1 microbicides. © 2014.
Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony
2014-10-01
Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.
Elsherbiny, Nehal M; Younis, Nahla N; Shaheen, Mohamed A; Elseweidy, Mohamed M
2016-09-01
Despite the remarkable anti-tumor activity of doxorubicin (DOX), its clinical application is limited due to multiple organ toxicities. Products with less side effects are therefore highly requested. The current study investigated the anti-cancer activities of vanillin against breast cancer and possible synergistic potentiation of DOX chemotherapeutic effects by vanillin. Vanillin (100mg/kg), DOX (2mg/kg) and their combination were administered i.p. to solid Ehrlich tumor-bearing mice for 21days. MCF-7 human breast cancer cell line was treated with vanillin (1 and 2mM), DOX (100μM) or their combination. Protection against DOX-induced nephrotoxicity was studied in rats that received vanillin (100mg/kg, ip) for 10days with a single dose of DOX (15mg/kg) on day 6. Vanillin exerted anticancer effects comparable to DOX and synergesticlly potentiated DOX anticancer effects both in-vivo and in-vitro. The anticancer potency of vanillin in-vivo was mediated via apoptosis and antioxidant capacity. It also offered an in-vitro growth inhibitory effect and cytotoxicity mediated by apoptosis (increased caspase-9 and Bax:Bcl-2 ratio) along with anti-metasasis effect. Vanillin protected against DOX-induced nephrotoxicity in rats. In conclusion, vanillin can be a potential lead molecule for the development of non-toxic agents for the treatment of breast cancer either alone or combined with DOX. Copyright © 2016. Published by Elsevier GmbH.
Prions: Protein Rebels with a Cause!
Marshall, Karen E.; Serpell, Louise C.
2017-01-01
Traditionally we consider infection to arise from viruses, bacteria and parasites. Prions are infectious proteins without any nucleic acids, and therefore do not represent living things. Despite this, they have the ability to replicate themselves and cause diseases such as mad cow disease (bovine spongiform encepthalopathy) and human…
Synergistic effect of casein glycomacropeptide on sodium caseinate foaming properties.
Morales, R; Martinez, M J; Pilosof, A M R
2017-11-01
Several strategies to improve the interfacial properties and foaming properties of proteins may be developed; among them, the use of mixtures of biopolymers that exhibit synergistic interactions. The aim of the present work was to evaluate the effect of casein glycomacropeptide (CMP) on foaming and surface properties of sodium caseinate (NaCas) and to establish the role of protein interactions in the aqueous phase. To this end particles size, interfacial and foaming properties of CMP, NaCas and NaCas-CMP mixtures at pH 5.5 and 7 were determined. At both pH, the interaction between CMP and NaCas induced a decrease in the aggregation state of NaCas. Single CMP foams showed the highest and NaCas the lowest foam overrun (FO) and the mixture exhibited intermediate values. CMP foam quickly drained. The drainage profile of mixed foams was closer to NaCas foams; at pH 5.5, mixed foams drained even slower than NaCas foam, exhibiting a synergistic performance. Additionally, a strong synergism was observed on the collapse of mixed foams at pH 5.5. Finally, a model to explain the synergistic effect observed on foaming properties in CMP-NaCas mixtures has been proposed; the reduced aggregation state of NaCas in the presence of CMP, made it more efficient for foam stabilization. Copyright © 2017 Elsevier B.V. All rights reserved.
Kim, Soochan; Han, Sinsuk; Lee, Ye Eun; Jung, Woong-Jae; Lee, Hyung Soo; Kim, Yong-Sun; Choi, Eun-Kyoung; Kim, Mi-Yeon
2016-01-01
The cellular prion protein is expressed in almost all tissues, including the central nervous system and lymphoid tissues. To investigate the effects of the prion protein in lymphoid cells and spleen structure formation, we used prion protein-deficient (Prnp(0/0)) Zürich I mice generated by inactivation of the Prnp gene. Prnp(0/0) mice had decreased lymphocytes, in particular, CD4 T cells and lymphoid tissue inducer (LTi) cells. Decreased CD4 T cells resulted from impaired expression of CCL19 and CCL21 in the spleen rather than altered chemokine receptor CCR7 expression. Importantly, some of the white pulp regions in spleens from Prnp(0/0) mice displayed impaired T zone structure as a result of decreased LTi cell numbers and altered expression of the lymphoid tissue-organizing genes lymphotoxin-α and CXCR5, although expression of the lymphatic marker podoplanin and CXCL13 by stromal cells was not affected. In addition, CD3(-)CD4(+)IL-7Rα(+) LTi cells were rarely detected in impaired white pulp in spleens of these mice. These data suggest that the prion protein is required to form the splenic white pulp structure and for development of normal levels of CD4 T and LTi cells. Copyright © 2015. Published by Elsevier GmbH.
Plasminogen stimulates propagation of protease-resistant prion protein in vitro.
Mays, Charles E; Ryou, Chongsuk
2010-12-01
To clarify the role of plasminogen as a cofactor for prion propagation, we conducted functional assays using a cell-free prion protein (PrP) conversion assay termed protein misfolding cyclic amplification (PMCA) and prion-infected cell lines. Here, we report that plasminogen stimulates propagation of the protease-resistant scrapie PrP (PrP(Sc)). Compared to control PMCA conducted without plasminogen, addition of plasminogen in PMCA using wild-type brain material significantly increased PrP conversion, with an EC(50) = ∼56 nM. PrP conversion in PMCA was substantially less efficient with plasminogen-deficient brain material than with wild-type material. The activity stimulating PrP conversion was specific for plasminogen and conserved in its kringle domains. Such activity was abrogated by modification of plasminogen structure and interference of PrP-plasminogen interaction. Kinetic analysis of PrP(Sc) generation demonstrated that the presence of plasminogen in PMCA enhanced the PrP(Sc) production rate to ∼0.97 U/μl/h and reduced turnover time to ∼1 h compared to those (∼0.4 U/μl/h and ∼2.5 h) obtained without supplementation. Furthermore, as observed in PMCA, plasminogen and kringles promoted PrP(Sc) propagation in ScN2a and Elk 21(+) cells. Our results demonstrate that plasminogen functions in stimulating conversion processes and represents the first cellular protein cofactor that enhances the hypothetical mechanism of prion propagation.
Virus Infections on Prion Diseased Mice Exacerbate Inflammatory Microglial Response
Lins, Nara; Mourão, Luiz; Trévia, Nonata; Passos, Aline; Farias, José Augusto; Assunção, Jarila; Bento-Torres, João; Consentino Kronka Sosthenes, Marcia; Diniz, José Antonio Picanço; Vasconcelos, Pedro Fernando da Costa
2016-01-01
We investigated possible interaction between an arbovirus infection and the ME7 induced mice prion disease. C57BL/6, females, 6-week-old, were submitted to a bilateral intrahippocampal injection of ME7 prion strain (ME7) or normal brain homogenate (NBH). After injections, animals were organized into two groups: NBH (n = 26) and ME7 (n = 29). At 15th week after injections (wpi), animals were challenged intranasally with a suspension of Piry arbovirus 0.001% or with NBH. Behavioral changes in ME7 animals appeared in burrowing activity at 14 wpi. Hyperactivity on open field test, errors on rod bridge, and time reduction in inverted screen were detected at 15th, 19th, and 20th wpi respectively. Burrowing was more sensitive to earlier hippocampus dysfunction. However, Piry-infection did not significantly affect the already ongoing burrowing decline in the ME7-treated mice. After behavioral tests, brains were processed for IBA1, protease-resistant form of PrP, and Piry virus antigens. Although virus infection in isolation did not change the number of microglia in CA1, virus infection in prion diseased mice (at 17th wpi) induced changes in number and morphology of microglia in a laminar-dependent way. We suggest that virus infection exacerbates microglial inflammatory response to a greater degree in prion-infected mice, and this is not necessarily correlated with hippocampal-dependent behavioral deficits. PMID:28003864
Prion Disease: Learn the Facts. Avoid Exposure.
Centers for Disease Control (CDC) Podcasts
2011-05-23
This podcast discusses prion diseases and the risk of exposure associated with some common activities. Created: 5/23/2011 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID). Date Released: 5/23/2011.
Iacono, Diego; Ferrari, Sergio; Gelati, Matteo; Zanusso, Gianluigi; Mariotto, Sara; Monaco, Salvatore
2015-01-01
Sporadic Creutzfeldt-Jakob disease (sCJD), the most frequent human prion disorder, is characterized by remarkable phenotypic variability, which is influenced by the conformation of the pathologic prion protein and the methionine/valine polymorphic codon 129 of the prion protein gene. While the etiology of sCJD remains unknown, it has been hypothesized that environmental exposure to prions might occur through conjunctival/mucosal contact, oral ingestion, inhalation, or simultaneous involvement of the olfactory and enteric systems. We studied 21 subjects with definite sCJD to assess neuropathological involvement of the dorsal motor nucleus of the vagus and other medullary nuclei and to evaluate possible associations with codon 129 genotype and prion protein conformation. The present data show that prion protein deposition was detected in medullary nuclei of distinct sCJD subtypes, either valine homozygous or heterozygous at codon 129. These findings suggest that an "environmental exposure" might occur, supporting the hypothesis that external sources of contamination could contribute to sCJD in susceptible hosts. Furthermore, these novel data could shed the light on possible causes of sCJD through a "triple match" hypothesis that identify environmental exposure, host genotype, and direct exposure of specific anatomical regions as possible pathogenetic factors.
The Endoplasmic Reticulum Chaperone GRP78/BiP Modulates Prion Propagation in vitro and in vivo.
Park, Kyung-Won; Eun Kim, Gyoung; Morales, Rodrigo; Moda, Fabio; Moreno-Gonzalez, Ines; Concha-Marambio, Luis; Lee, Amy S; Hetz, Claudio; Soto, Claudio
2017-03-23
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR). GRP78, also called BiP, is a master regulator of the UPR, reducing ER stress levels and apoptosis due to an enhancement of the cellular folding capacity. Here, we studied the role of GRP78 in prion diseases using several in vivo and in vitro approaches. Our results show that a reduction in the expression of this molecular chaperone accelerates prion pathogenesis in vivo. In addition, we observed that prion replication in cell culture was inversely related to the levels of expression of GRP78 and that both proteins interact in the cellular context. Finally, incubation of PrP Sc with recombinant GRP78 led to the dose-dependent reduction of protease-resistant PrP Sc in vitro. Our results uncover a novel role of GRP78 in reducing prion pathogenesis, suggesting that modulating its levels/activity may offer a novel opportunity for designing therapeutic approaches for these diseases. These findings may also have implications for other diseases involving the accumulation of misfolded proteins.
Detection of prions in blood from patients with variant Creutzfeldt-Jakob disease.
Concha-Marambio, Luis; Pritzkow, Sandra; Moda, Fabio; Tagliavini, Fabrizio; Ironside, James W; Schulz, Paul E; Soto, Claudio
2016-12-21
Human prion diseases are infectious and invariably fatal neurodegenerative diseases. They include sporadic Creutzfeldt-Jakob disease (sCJD), the most common form, and variant CJD (vCJD), which is caused by interspecies transmission of prions from cattle infected by bovine spongiform encephalopathy. Development of a biochemical assay for the sensitive, specific, early, and noninvasive detection of prions (PrP Sc ) in the blood of patients affected by prion disease is a top medical priority to increase the safety of the blood supply. vCJD has already been transmitted from human to human by blood transfusion, and the number of asymptomatic carriers of vCJD in the U.K. alone is estimated to be 1 in 2000 people. We used the protein misfolding cyclic amplification (PMCA) technique to analyze blood samples from 14 cases of vCJD and 153 controls, including patients affected by sCJD and other neurodegenerative or neurological disorders as well as healthy subjects. Our results showed that PrP Sc could be detected with 100% sensitivity and specificity in blood samples from vCJD patients. Detection was possible in any of the blood fractions analyzed and could be done with as little as a few microliters of sample volume. The PrP Sc concentration in blood was estimated to be ~0.5 pg/ml. Our findings suggest that PMCA may be useful for premortem noninvasive diagnosis of vCJD and to identify prion contamination of the blood supply. Further studies are needed to fully validate the technology. Copyright © 2016, American Association for the Advancement of Science.
Bergasa-Caceres, Fernando; Rabitz, Herschel A.
2013-06-01
A model of protein folding kinetics is applied to study the effects of macromolecular crowding on protein folding rate and stability. Macromolecular crowding is found to promote a decrease of the entropic cost of folding of proteins that produces an increase of both the stability and the folding rate. The acceleration of the folding rate due to macromolecular crowding is shown to be a topology-dependent effect. The model is applied to the folding dynamics of the murine prion protein (121-231). The differential effect of macromolecular crowding as a function of protein topology suffices to make non-native configurations relatively more accessible.