Isolation and characterization of an AGAMOUS homologue from cocoa

NARCIS (Netherlands)

Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

2006-01-01

We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

Institute of Scientific and Technical Information of China (English)

Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

2014-01-01

Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

Nance-Horan syndrome: a contiguous gene syndrome involving deletion of the amelogenin gene? A case report and molecular analysis.

Science.gov (United States)

Franco, E; Hodgson, S; Lench, N; Roberts, G J

1995-03-01

A case of Nance-Horan syndrome in a male is presented, with some features of the condition in his carrier mother and her mother. It is proposed that Nance-Horan syndrome might be a contiguous gene syndrome mapping to chromosome Xp21.2-p22.3. The proband had congenital cataract microphthalmia and dental abnormalities including screwdriver shaped incisors and evidence of enamel pitting hypoplasia. The region Xp21.2-p22.3 also contains the tooth enamel protein gene, amelogenin (AMGX). Using molecular genetic techniques, we have shown that there is no evidence that the AMGX gene is deleted in this case of the Nance-Horan syndrome.

Kallmann syndrome and ichthyosis: a case of contiguous gene deletion syndrome

Directory of Open Access Journals (Sweden)

Irene Berges-Raso

2017-09-01

Full Text Available Kallmann syndrome is a genetically heterogeneous form of hypogonadotropic hypogonadism caused by gonadotropin-releasing hormone deficiency and characterized by anosmia or hyposmia due to hypoplasia of the olfactory bulbs; osteoporosis and metabolic syndrome can develop due to longstanding untreated hypogonadism. Kallmann syndrome affects 1 in 10 000 men and 1 in 50 000 women. Defects in 17 genes, including KAL1, have been implicated. Kallmann syndrome can be associated with X-linked ichthyosis, a skin disorder characterized by early onset dark, dry, irregular scales affecting the limb and trunk, caused by a defect of the steroid sulfatase gene (STS. Both KAL1 and STS are located in the Xp22.3 region; therefore, deletions in this region cause a contiguous gene syndrome. We report the case of a 32-year-old man with ichthyosis referred for evaluation of excessive height (2.07 m and weight (BMI: 29.6 kg/m2, microgenitalia and absence of secondary sex characteristics. We diagnosed Kallmann syndrome with ichthyosis due to a deletion in Xp22.3, a rare phenomenon.

TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

OpenAIRE

Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

1994-01-01

The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

International Nuclear Information System (INIS)

Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

1990-01-01

Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

The role of the leukemia-associated ETO homologue repressors in hematopoiesis

OpenAIRE

Olsson, André

2006-01-01

The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

Science.gov (United States)

Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

2011-11-01

Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

Are mice pigmentary genes throwing light on humans?

Directory of Open Access Journals (Sweden)

Bose S

1993-01-01

Full Text Available In this article the rapid advances made in the molecular genetics of inherited disorders of hypo and hyperpigmentation during the past three years are reviewed. The main focus is on studies in mice as compared to homologues in humans. The main hypomelanotic diseases included are, piebaldism (white spotting due to mutations of c-KIT, PDGF and MGF genes; vitiligo (microphathalmia mice mutations of c-Kit and c-fms genes; Waardenburg syndrome (splotch locus mutations of mice PAX-3 or human Hup-2 genes; albinism (mutations of tyrosinase genes, Menkes disease (Mottled mouse, premature graying (mutations in light/brown locus/gp75/ TRP-1; Griscelli disease (mutations in TRP-1 and steel; Prader-willi and Angelman syndromes, tyrosinase-positive oculocutaneous albinism and hypomelanosis of lto (mutations of pink-eyed dilution gene/mapping to human chromosomes 15 q 11.2 - q12; and human platelet storage pool deficiency diseases due to defects in pallidin, an erythrocyte membrane protein (pallid mouse / mapping to 4.2 pallidin gene. The genetic characterization of hypermelanosis includes, neurofibromatosis 1 (Café-au-lait spots and McCune-Albright Syndrome. Rapid evolving knowledge about pigmentary genes will increase further the knowledge about these hypo and hyperpigmentary disorders.

A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

NARCIS (Netherlands)

Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

2004-01-01

Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

Calpain-5 gene variants are associated with diastolic blood pressure and cholesterol levels

Directory of Open Access Journals (Sweden)

Morón Francisco J

2007-01-01

Full Text Available Abstract Background Genes implicated in common complex disorders such as obesity, type 2 diabetes mellitus (T2DM or cardiovascular diseases are not disease specific, since clinically related disorders also share genetic components. Cysteine protease Calpain 10 (CAPN10 has been associated with T2DM, hypertension, hypercholesterolemia, increased body mass index (BMI and polycystic ovary syndrome (PCOS, a reproductive disorder of women in which isunlin resistance seems to play a pathogenic role. The calpain 5 gene (CAPN5 encodes a protein homologue of CAPN10. CAPN5 has been previously associated with PCOS by our group. In this new study, we have analysed the association of four CAPN5 gene variants(rs948976A>G, rs4945140G>A, rs2233546C>T and rs2233549G>A with several cardiovascular risk factors related to metabolic syndrome in general population. Methods Anthropometric measurements, blood pressure, insulin, glucose and lipid profiles were determined in 606 individuals randomly chosen from a cross-sectional population-based epidemiological survey in the province of Segovia in Central Spain (Castille, recruited to investigate the prevalence of anthropometric and physiological parameters related to obesity and other components of the metabolic syndrome. Genotypes at the four polymorphic loci in CAPN5 gene were detected by polymerase chain reaction (PCR. Results Genotype association analysis was significant for BMI (p ≤ 0.041, diastolic blood pressure (p = 0.015 and HDL-cholesterol levels (p = 0.025. Different CAPN5 haplotypes were also associated with diastolic blood pressure (DBP (0.0005 ≤ p ≤ 0.006 and total cholesterol levels (0.001 ≤ p ≤ 0.029. In addition, the AACA haplotype, over-represented in obese individuals, is also more frequent in individuals with metabolic syndrome defined by ATPIII criteria (p = 0.029. Conclusion As its homologue CAPN10, CAPN5 seems to influence traits related to increased risk for cardiovascular diseases. Our

Mismatch repair genes in Lynch syndrome: a review

Directory of Open Access Journals (Sweden)

Felipe Cavalcanti Carneiro da Silva

Full Text Available Lynch syndrome represents 1-7% of all cases of colorectal cancer and is an autosomal-dominant inherited cancer predisposition syndrome caused by germline mutations in deoxyribonucleic acid (DNA mismatch repair genes. Since the discovery of the major human genes with DNA mismatch repair function, mutations in five of them have been correlated with susceptibility to Lynch syndrome: mutS homolog 2 (MSH2; mutL homolog 1 (MLH1; mutS homolog 6 (MSH6; postmeiotic segregation increased 2 (PMS2; and postmeiotic segregation increased 1 (PMS1. It has been proposed that one additional mismatch repair gene, mutL homolog 3 (MLH3, also plays a role in Lynch syndrome predisposition, but the clinical significance of mutations in this gene is less clear. According to the InSiGHT database (International Society for Gastrointestinal Hereditary Tumors, approximately 500 different LS-associated mismatch repair gene mutations are known, primarily involving MLH1 (50% and MSH2 (40%, while others account for 10%. Much progress has been made in understanding the molecular basis of Lynch Syndrome. Molecular characterization will be the most accurate way of defining Lynch syndrome and will provide predictive information of greater accuracy regarding the risks of colon and extracolonic cancer and enable optimal cancer surveillance regimens.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

Directory of Open Access Journals (Sweden)

Moore Landon L

2008-02-01

Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

Science.gov (United States)

La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

2012-11-30

Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

Bartter's and Gitelman's syndromes: from gene to clinic

OpenAIRE

Naesens, Maarten; STEELS, Paul; Verberckmoes, René; Vanrenterghem, Yves; Kuypers, Dirk

2004-01-01

Bartter's and Gitelman's syndromes are characterized by hypokalemia, normal to low blood pressure and hypochloremic metabolic alkalosis. Recently, investigators have been able to demonstrate mutations of six genes encoding several renal tubular transporters and ion channels that can be held responsible for Bartter's and Gitelman's syndromes. Neonatal Bartter's syndrome is caused by mutations of NKCC2 or ROMK, classic Bartter's syndrome by mutations of ClC-Kb, Bartter's syndrome associated wit...

ABCD syndrome is caused by a homozygous mutation in the EDNRB gene.

Science.gov (United States)

Verheij, Joke B G M; Kunze, Jürgen; Osinga, Jan; van Essen, Anthonie J; Hofstra, Robert M W

2002-03-15

ABCD syndrome is an autosomal recessive syndrome characterized by albinism, black lock, cell migration disorder of the neurocytes of the gut (Hirschsprung disease [HSCR]), and deafness. This phenotype clearly overlaps with the features of the Shah-Waardenburg syndrome, comprising sensorineural deafness; hypopigmentation of skin, hair, and irides; and HSCR. Therefore, we screened DNA of the index patient of the ABCD syndrome family for mutations in the endothelin B receptor (EDNRB) gene, a gene known to be involved in Shah-Waardenburg syndrome. A homozygous nonsense mutation in exon 3 (R201X) of the EDNRB gene was found. We therefore suggest that ABCD syndrome is not a separate entity, but an expression of Shah-Waardenburg syndrome.

Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

2015-10-01

To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

Pathological assessment of mismatch repair gene variants in Lynch syndrome

DEFF Research Database (Denmark)

Rasmussen, Lene Juel; Heinen, Christopher D; Royer-Pokora, Brigitte

2012-01-01

Lynch syndrome (LS) is caused by germline mutations in DNA mismatch repair (MMR) genes and is the most prevalent hereditary colorectal cancer syndrome. A significant proportion of variants identified in MMR and other common cancer susceptibility genes are missense or noncoding changes whose...

A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

NARCIS (Netherlands)

Spassieva, S; Hille, J

Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

Eye Development Genes and Known Syndromes

Science.gov (United States)

Slavotinek, Anne M.

2011-01-01

Anophthalmia and microphthalmia (A/M) are significant eye defects because they can have profound effects on visual acuity. A/M is associated with non-ocular abnormalities in an estimated 33–95% of cases and around 25% of patients have an underlying genetic syndrome that is diagnosable. Syndrome recognition is important for targeted molecular genetic testing, prognosis and for counseling regarding recurrence risks. This review provides clinical and molecular information for several of the commonest syndromes associated with A/M: Anophthalmia-Esophageal-Genital syndrome, caused by SOX2 mutations, Anophthalmia and pituitary abnormalities caused by OTX2 mutations, Matthew-Wood syndrome caused by STRA6 mutations, Oculocardiafaciodental syndrome and Lenz microphthalmia caused by BCOR mutations, Microphthalmia Linear Skin pigmentation syndrome caused by HCCS mutations, Anophthalmia, pituitary abnormalities, polysyndactyly caused by BMP4 mutations and Waardenburg anophthalmia caused by mutations in SMOC1. In addition, we briefly discuss the ocular and extraocular phenotypes associated with several other important eye developmental genes, including GDF6, VSX2, RAX, SHH, SIX6 and PAX6. PMID:22005280

Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

International Nuclear Information System (INIS)

Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

2005-01-01

Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

Genes and Syndromic Hearing Loss.

Science.gov (United States)

Keats, Bronya J. B.

2002-01-01

This article provides a description of the human genome and patterns of inheritance and discusses genes that are associated with some of the syndromes for which hearing loss is a common finding, including: Waardenburg, Stickler, Jervell and Lange-Neilsen, Usher, Alport, mitochondrial encephalomyopathy, and sensorineural hearing loss. (Contains…

Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

International Nuclear Information System (INIS)

Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

2007-01-01

RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

Distinct gene expression profiles in ovarian cancer linked to Lynch syndrome

DEFF Research Database (Denmark)

Jönsson, Jenny-Maria; Bartuma, Katarina; Dominguez-Valentin, Mev

2014-01-01

Ovarian cancer linked to Lynch syndrome represents a rare subset that typically presents at young age as early-stage tumors with an overrepresentation of endometrioid and clear cell histologies. We investigated the molecular profiles of Lynch syndrome-associated and sporadic ovarian cancer...... with the aim to identify key discriminators and central tumorigenic mechanisms in hereditary ovarian cancer. Global gene expression profiling using whole-genome c-DNA-mediated Annealing, Selection, extension, and Ligation was applied to 48 histopathologically matched Lynch syndrome-associated and sporadic...... ovarian cancers. Lynch syndrome-associated and sporadic ovarian cancers differed by 349 significantly deregulated genes, including PTPRH, BIRC3, SHH and TNFRSF6B. The genes involved were predominantly linked to cell growth, proliferation, and cell-to-cell signaling and interaction. When stratified...

Novel Myopia Genes and Pathways Identified From Syndromic Forms of Myopia

Science.gov (United States)

Loughman, James; Wildsoet, Christine F.; Williams, Cathy; Guggenheim, Jeremy A.

2018-01-01

Purpose To test the hypothesis that genes known to cause clinical syndromes featuring myopia also harbor polymorphisms contributing to nonsyndromic refractive errors. Methods Clinical phenotypes and syndromes that have refractive errors as a recognized feature were identified using the Online Mendelian Inheritance in Man (OMIM) database. One hundred fifty-four unique causative genes were identified, of which 119 were specifically linked with myopia and 114 represented syndromic myopia (i.e., myopia and at least one other clinical feature). Myopia was the only refractive error listed for 98 genes and hyperopia and the only refractive error noted for 28 genes, with the remaining 28 genes linked to phenotypes with multiple forms of refractive error. Pathway analysis was carried out to find biological processes overrepresented within these sets of genes. Genetic variants located within 50 kb of the 119 myopia-related genes were evaluated for involvement in refractive error by analysis of summary statistics from genome-wide association studies (GWAS) conducted by the CREAM Consortium and 23andMe, using both single-marker and gene-based tests. Results Pathway analysis identified several biological processes already implicated in refractive error development through prior GWAS analyses and animal studies, including extracellular matrix remodeling, focal adhesion, and axon guidance, supporting the research hypothesis. Novel pathways also implicated in myopia development included mannosylation, glycosylation, lens development, gliogenesis, and Schwann cell differentiation. Hyperopia was found to be linked to a different pattern of biological processes, mostly related to organogenesis. Comparison with GWAS findings further confirmed that syndromic myopia genes were enriched for genetic variants that influence refractive errors in the general population. Gene-based analyses implicated 21 novel candidate myopia genes (ADAMTS18, ADAMTS2, ADAMTSL4, AGK, ALDH18A1, ASXL1, COL4A1

Amniotic fluid RNA gene expression profiling provides insights into the phenotype of Turner syndrome.

Science.gov (United States)

Massingham, Lauren J; Johnson, Kirby L; Scholl, Thomas M; Slonim, Donna K; Wick, Heather C; Bianchi, Diana W

2014-09-01

Turner syndrome is a sex chromosome aneuploidy with characteristic malformations. Amniotic fluid, a complex biological material, could contribute to the understanding of Turner syndrome pathogenesis. In this pilot study, global gene expression analysis of cell-free RNA in amniotic fluid supernatant was utilized to identify specific genes/organ systems that may play a role in Turner syndrome pathophysiology. Cell-free RNA from amniotic fluid of five mid-trimester Turner syndrome fetuses and five euploid female fetuses matched for gestational age was extracted, amplified, and hybridized onto Affymetrix(®) U133 Plus 2.0 arrays. Significantly differentially regulated genes were identified using paired t tests. Biological interpretation was performed using Ingenuity Pathway Analysis and BioGPS gene expression atlas. There were 470 statistically significantly differentially expressed genes identified. They were widely distributed across the genome. XIST was significantly down-regulated (p Turner syndrome transcriptome from other aneuploidies we previously studied. Manual curation of the differentially expressed gene list identified genes of possible pathologic significance, including NFATC3, IGFBP5, and LDLR. Transcriptomic differences in the amniotic fluid of Turner syndrome fetuses are due to genome-wide dysregulation. The hematologic/immune system differences may play a role in early-onset autoimmune dysfunction. Other genes identified with possible pathologic significance are associated with cardiac and skeletal systems, which are known to be affected in females with Turner syndrome. The discovery-driven approach described here may be useful in elucidating novel mechanisms of disease in Turner syndrome.

A novel homozygous variant in the SMOC1 gene underlying Waardenburg anophthalmia syndrome.

Science.gov (United States)

Ullah, Asmat; Umair, Muhammad; Ahmad, Farooq; Muhammad, Dost; Basit, Sulman; Ahmad, Wasim

2017-01-01

Waardenburg anophthalmia syndrome (WAS), also known as ophthalmo-acromelic syndrome or anophthalmia-syndactyly, is a rare congenital disorder that segregates in an autosomal recessive pattern. Clinical features of the syndrome include malformation of the eyes and the skeleton. Mostly, WAS is caused by mutations in the SMOC-1 gene. The present report describes a large consanguineous family of Pakistani origin segregating Waardenburg anophthalmia syndrome in an autosomal recessive pattern. Genotyping followed by Sanger sequencing was performed to search for a candidate gene. SNP genotyping using AffymetrixGeneChip Human Mapping 250K Nsp array established a single homozygous region among affected members on chromosome 14q23.1-q24.3 harboring the SMOC1 gene. Sequencing of the gene revealed a novel homozygous missense mutation (c.812G>A; p.Cys271Tyr) in the family. This is the first report of Waardenburg anophthalmia syndrome caused by a SMOC1 variant in a Pakistani population. The mutation identified in the present investigation extends the body of evidence implicating the gene SMOC-1 in causing WAS.

Diverse growth hormone receptor gene mutations in Laron syndrome.

Science.gov (United States)

Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

1993-01-01

To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

[RIT1: a novel gene associated with Noonan syndrome].

Science.gov (United States)

Arroyo-Carrera, I; Solo de Zaldivar-Tristancho, M; Martin-Fernandez, R; Vera-Torres, M; Gonzalez de Buitrago-Amigo, J F; Botet-Rodriguez, J

2016-10-16

Noonan syndrome is the most frequent of the congenital group of malformation syndromes caused by germline mutations that encode components of the RAS/MAPK pathway, termed RASopathies, one of the most frequent congenital genetic disorders in the clinical practice. Recently RIT1 mutations have been reported in patients with Noonan syndrome. A 7 years-old girl with a clinical diagnosis of Noonan syndrome, and with a hypertrophic cardiomyopathy included in her clinical manifestations, where a de novo heterozygous, probably pathogenic, novel mutation in RIT1, c.295T>C (p.Phe99Leu), has been identified. RIT1 shares homology with other RAS proteins and the expression of mutant alleles demonstrates a gain-of-function effect supporting a causative role in Noonan syndrome pathogenesis. Data suggest that the frequency of RIT1 mutations can be estimated as 3-5% in Noonan syndrome patients. These cases compared with Noonan patients harboring mutations in other genes are characterized by high frequency of prenatal abnormalities and hypertrophic cardiomyopathy, and lower frequencies of short stature and pectus abnormalities. We emphasize the importance of the novel identified genes in order to be included in the diagnostic panels.

[Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

Science.gov (United States)

Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

2017-10-02

Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

Peeling skin syndrome associated with novel variant in FLG2 gene.

Science.gov (United States)

Alfares, Ahmed; Al-Khenaizan, Sultan; Al Mutairi, Fuad

2017-12-01

Peeling skin syndrome is a rare genodermatosis characterized by variably pruritic superficial generalized peeling of the skin with several genes involved until now little is known about the association between FLG2 and peeling skin syndrome. We describe multiple family members from a consanguineous Saudi family with peeling skin syndrome. Next Generation Sequencing identifies a cosegregating novel variant in FLG2 c.632C>G (p.Ser211*) as a likely etiology in this family. Here, we reported on the clinical manifestation of homozygous loss of function variant in FLG2 as a disease-causing gene for peeling skin syndrome and expand the dermatology findings. © 2017 Wiley Periodicals, Inc.

Do the MTHFR gene polymorphism and Down syndrome pregnancy ...

African Journals Online (AJOL)

Background: Down syndrome, the most common trisomy 21 arises from abnormal chromosomal segregation. The etiology includes genetic and acquired factors. The main genetic factor that is well appreciated for onset of Down syndrome pregnancy is MTHFR gene polymorphism. But till date, no final conclusion has arrived ...

Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

Science.gov (United States)

Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

2017-01-01

Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

Noonan syndrome-causing genes: Molecular update and an assessment of the mutation rate

Directory of Open Access Journals (Sweden)

Ihssane El Bouchikhi

2016-12-01

Full Text Available Noonan syndrome is a common autosomal dominant disorder characterized by short stature, congenital heart disease and facial dysmorphia with an incidence of 1/1000 to 2500 live births. Up to now, several genes have been proven to be involved in the disturbance of the transduction signal through the RAS-MAP Kinase pathway and the manifestation of Noonan syndrome. The first gene described was PTPN11, followed by SOS1, RAF1, KRAS, BRAF, NRAS, MAP2K1, and RIT1, and recently SOS2, LZTR1, and A2ML1, among others. Progressively, the physiopathology and molecular etiology of most signs of Noonan syndrome have been demonstrated, and inheritance patterns as well as genetic counseling have been established. In this review, we summarize the data concerning clinical features frequently observed in Noonan syndrome, and then, we describe the molecular etiology as well as the physiopathology of most Noonan syndrome-causing genes. In the second part of this review, we assess the mutational rate of Noonan syndrome-causing genes reported up to now in most screening studies. This review should give clinicians as well as geneticists a full view of the molecular aspects of Noonan syndrome and the authentic prevalence of the mutational events of its causing-genes. It will also facilitate laying the groundwork for future molecular diagnosis research, and the development of novel treatment strategies.

[Wolfram syndrome: clinical features, molecular genetics of WFS1 gene].

Science.gov (United States)

Tanabe, Katsuya; Matsunaga, Kimie; Hatanaka, Masayuki; Akiyama, Masaru; Tanizawa, Yukio

2015-02-01

Wolfram syndrome(WFS: OMIM 222300) is a rare recessive neuro-endocrine degenerative disorder, known as DIDMOAD(Diabetes Insipidus, early-onset Diabetes Mellitus, Optic Atrophy and Deafness) syndrome. Most affected individuals carry recessive mutations in the Wolfram syndrome 1 gene(WFS1). The WFS1 protein is an endoplasmic reticulum(ER) embedded protein, which functions in ER calcium homeostasis and unfolded protein responses. Dysregulation of these cellular processes results in the development of ER stress, leading to apoptosis. In addition, abundantly present WFS1 protein in insulin secretory granules plays a role in the intra-granular acidification. However, the phenotypic pleiomorphism and molecular complexity of this disease limit the understanding of WFS. Here we review clinical features, molecular mechanisms and mutations of WFS1 gene that relate to this syndrome.

Thyroid peroxidase: evidence for disease gene exclusion in Pendred's syndrome.

Science.gov (United States)

Gausden, E; Armour, J A; Coyle, B; Coffey, R; Hochberg, Z; Pembrey, M; Britton, K E; Grossman, A; Reardon, W; Trembath, R

1996-04-01

Pendred's syndrome is an association between congenital neurosensory deafness and goitre with abnormal discharge of iodide following perchlorate challenge, indicating a defect of iodide organification. Although Pendred's syndrome may cause up to 7.5% of all cases of congenital deafness, the molecular basis of the association between the hearing loss and the thyroid organification defect remains unknown. We chose to investigate the role of the thyroid peroxidase (TPO) gene as the genetic defect in Pendred's syndrome. A highly informative variable number tandem repeat (VNTR), located 1.5 kb downstream of exon 10 of the TPO gene, was used to search for genetic linkage in multiple sibships affected by Pendred's syndrome. Seven kindreds were recruited from the UK, each with at least two affected members. We have also examined a large inbred Israeli family with two affected offspring and five unaffected children. Individuals were assigned affected status based on the characteristic clinical features of Pendred's syndrome, namely the presence of congenital sensorineural hearing loss and the appearance in early life of a goitre. Additionally, at least one affected member from each sibship had a characteristic positive perchlorate discharge test (Morgans & Trotter, 1958). PCR amplification of genomic DNA at the TPO VNTR allowed assignment of genotypes to each individual and the calculation of a two-point LOD score. In six of the nine sibships analysed we found obligatory recombination between TPO and Pendred's syndrome. Non-complementation observed in affected parents with an affected offspring excluded TPO in an affected sibship with genotype sharing and supports a hypothesis of genetic homogeneity for Pendred's syndrome. In two sibships, mutation of the TPO gene as the cause of Pendred's syndrome could not be excluded. These data suggest that defects at the thyroid peroxidase locus on chromosome 2 are not the major cause of Pendred's syndrome.

Gene screening in a Chinese family with Marfan syndrome

Directory of Open Access Journals (Sweden)

Wen-Jiao Xia

2016-05-01

Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

International Nuclear Information System (INIS)

Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

2003-01-01

Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies

Science.gov (United States)

1996-09-01

Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo

Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

Science.gov (United States)

Trolle, Christian; Mortensen, Kristian H; Pedersen, Lisbeth N; Berglund, Agnethe; Jensen, Henrik K; Andersen, Niels H; Gravholt, Claus H

2013-01-01

QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc) over time and relate the findings to the Turner syndrome phenotype. Adult women with Turner syndrome (n = 88) were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%), and adjusted for influence of heart rate by Bazett's (bQTc) and Hodges's formula (hQTc). The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms) compared to controls (390.4 ± 17.8 ms) was prolonged (pTurner syndrome karyotypes (418.2 ± 24.8 vs. 407.6 ± 25.5 ms; p = 0.055). In women with Turner syndrome and a bQTc >432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2) and one in a minor Long QT syndrome gene (KCNE2). There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women. NCT00624949. https://register.clinicaltrials.gov/prs/app/action/SelectProtocol/sid/S0001FLI/selectaction/View/ts/3/uid/U000099E.

Sjogren Syndrome-Gene Therapy and its Prospective

Directory of Open Access Journals (Sweden)

R Rahpeyma

2003-02-01

Full Text Available Sjogren syndrome is one of the autoimmune diseases which is characterized by lymphocytic infiltration to exocrine glands and causes keratoconjunctivitis sicca and xerostomia. Today, a large population, with a majority of women over 40, suffer from this disease and have several complications regarding oral health and reduced life quality such as severe dental caries, painful eyes, olfactory and gustatory deficiency, speech, mastication and swallowing discomforts. Unfortunately, these patients do not respond to the conventional therapies. Nowadays in medical world, which its target is basic therapy and not symptomatic one, several gene therapy approaches, have gained importance in treatment of this apparently incurable diseases. Due to the facts that this disease is the second prevelant autoimmune disease, after rheumatoid arthritis, and the conventional therapies of the disease are all relative and symptomatic, researchers have insisted on the basic and causative therapy through gene transfer more than before. In the Present article, through reviewing 58 references containing recent scientific and investigatory findings it has been tried, to consider the pathogenesis and conventional therapies of this syndrome. Another purpose of this study was to investigate several and potentially very effective gene transfer systems and different theraputic genes (mainly membrane water channels, ione transporter molecules, transcription factors, antifungal proteins and free radical scavengers.

Investigation of Monnose-Binding Lectin gene Polymorphism in Patients with Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome

Directory of Open Access Journals (Sweden)

Sevil Toka

2012-09-01

Full Text Available Objective: Monnose-Binding lectin (MBL appears to play an important role in the immune system. The genetic polymorphisms in the MBL2 gene can result in a reduction of serum levels, leading to a predisposition to recurrent infection. The aim of this study is to investigate the influence of a polymorphism in codon 54 of the MBL2 gene on the susceptibility to Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome (EM, SJS and SJS/TEN overlap syndrome. Material and Methods: Our study included 64 patients who were clinically and/or histopathologically diagnosed with EM, SJS, and SJS/TEN overlap syndrome and 66 healthy control subjects who were genotyped for the MBL2 gene codon 54 polymorphism using the PCR-RFLP method. For all statistical analyses, the level of significance was set at p<0.05. Results: The prevalence of the B allele was 18% in the EM, SJS and SJS/TEN patient groups and 13% in the control group. No significant differences in allele frequencies of any polymorphism were observed between the patient and control groups, although the B allele was more frequent in the patient groups (p=0.328.Conclusion: Our results provide no evidence of a relationship between MBL2 gene codon 54 polymorphism and the susceptibility to EM, SJS and SJS/TEN overlap syndrome. However, these findings should be confirmed in studies with a larger sample size.

Isolation of a cotton NADP(H oxidase homologue induced by drought stress

Directory of Open Access Journals (Sweden)

NEPOMUCENO ALEXANDRE LIMA

2000-01-01

Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

Identification of the gene for Nance-Horan syndrome (NHS).

Science.gov (United States)

Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J

2004-10-01

The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.

Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

Directory of Open Access Journals (Sweden)

Goldman Gustavo H

2010-01-01

Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

Diagnostic test for prenatal identification of Down's syndrome and mental retardation and gene therapy therefor

Science.gov (United States)

Smith, Desmond J.; Rubin, Edward M.

2000-01-01

A a diagnostic test useful for prenatal identification of Down syndrome and mental retardation. A method for gene therapy for correction and treatment of Down syndrome. DYRK gene involved in the ability to learn. A method for diagnosing Down's syndrome and mental retardation and an assay therefor. A pharmaceutical composition for treatment of Down's syndrome mental retardation.

Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

Directory of Open Access Journals (Sweden)

Christian Trolle

Full Text Available QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc over time and relate the findings to the Turner syndrome phenotype.Adult women with Turner syndrome (n = 88 were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%, and adjusted for influence of heart rate by Bazett's (bQTc and Hodges's formula (hQTc. The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms. Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done.The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms compared to controls (390.4 ± 17.8 ms was prolonged (p432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2 and one in a minor Long QT syndrome gene (KCNE2.There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women.NCT00624949. https://register.clinicaltrials.gov/prs/app/action/SelectProtocol/sid/S0001FLI/selectaction/View/ts/3/uid/U000099E.

Numerous BAF complex genes are mutated in Coffin-Siris syndrome.

Science.gov (United States)

Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

2014-09-01

Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.

GDNF gene is associated with tourette syndrome in a family study.

Science.gov (United States)

Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

2015-07-01

Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

GDNF Gene Is Associated With Tourette Syndrome in a Family Study

Science.gov (United States)

Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

2016-01-01

Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

Pleiotropic genes for metabolic syndrome and inflammation

DEFF Research Database (Denmark)

Kraja, Aldi T; Chasman, Daniel I; North, Kari E

2014-01-01

Metabolic syndrome (MetS) has become a health and financial burden worldwide. The MetS definition captures clustering of risk factors that predict higher risk for diabetes mellitus and cardiovascular disease. Our study hypothesis is that additional to genes influencing individual MetS risk factor...

Epilepsy in Rett syndrome, and CDKL5- and FOXG1-gene-related encephalopathies.

Science.gov (United States)

Guerrini, Renzo; Parrini, Elena

2012-12-01

Rett syndrome is an X-linked neurodevelopmental disorder that manifests in early childhood with developmental stagnation, and loss of spoken language and hand use, with the development of distinctive hand stereotypies, severe cognitive impairment, and autistic features. About 60% of patients have epilepsy. Seizure onset before the age of 3 years is unlikely, and onset after age 20 is rare. Diagnosis of Rett syndrome is based on key clinical elements that identify "typical" Rett syndrome but also "variant" or "atypical" forms. Diagnostic criteria have been modified only slightly over time, even after discovering that MECP2 gene alterations are present in >90% of patients with typical Rett syndrome but only in 50-70% of atypical cases. Over the last several years, intragenic or genomic alterations of the CDKL5 and FOXG1 genes have been associated with severe cognitive impairment, early onset epilepsy and, often, dyskinetic movement disorders, which have variably been defined as Rett variants. It is now clearly emerging that epilepsy has distinctive characteristics in typical Rett syndrome and in the different syndromes caused by CDKL5 and FOXG1 gene alterations. The progressive parting of CDKL5- and FOXG1-gene-related encephalopathies from the core Rett syndrome is reflected by the effort to produce clearer diagnostic criteria for typical and atypical Rett syndrome. Efforts to characterize the molecular pathology underlying these developmental encephalopathies are pointing to abnormalities of telencephalic development, neuronal morphogenesis, maturation and maintenance, and dendritic arborization. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.

Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

Science.gov (United States)

Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

2017-01-01

Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

Marfan syndrome gene search intensifies following identification of basic defect

Energy Technology Data Exchange (ETDEWEB)

Randall, T.

1990-10-03

Somewhere, quite possible along chromosomes 8 and/or 15, the gene(s) for Marfan syndrome will be found. The search is intensifying following a report that faulty scaffolding in the body's connective tissue appears to be the long sought after defect behind the syndrome, and inherited disorder that has caused the premature death of young, healthy-looking individuals. Finding that something in the living masonry of the human body has proven to be a 30-year inquisition of nearly two dozen molecules that has engaged investigators worldwide. Historically, researchers have searched for a structural flaw in one of the collagen molecules to explain the cause of Marfan Syndrome. Using monoclonal antibodies, researchers have implicated microfibrils, the extracellular filaments that provide a matrix for the deposit of elastin during embryonic development.

A patient with Werner syndrome and adiponectin gene mutation.

Science.gov (United States)

Hashimoto, Naotake; Hatanaka, Sachiko; Yokote, Koutaro; Kurosawa, Hiroko; Yoshida, Tomohiko; Iwai, Rie; Takahashi, Hidenori; Yoshida, Katsuya; Horie, Atsuya; Sakurai, Kenichi; Yagui, Kazuo; Saito, Yasushi; Yoshida, Shouji

2007-01-01

Werner syndrome is a premature aging disease characterized by genomic instability and increased cancer risk. Here, we report a 45-year-old diabetic man as the first Werner syndrome patient found to have an adiponectin gene mutation. Showing graying and loss of hair, skin atrophy, and juvenile cataract, he was diagnosed with Werner syndrome type 4 by molecular analysis. His serum adiponectin concentration was low. In the globular domain of the adiponectin gene, I164T in exon 3 was detected. When we examined effects of pioglitazone (15 mg/day) on serum adiponectin multimer and monomer concentrations using selective assays, the patient's relative percentage increased in adiponectin concentration was almost same as that in the 18 diabetic patients without an adiponectin mutation, but the absolute adiponectin concentration was half of those seen in diabetic patients treated with the same pioglitazone dose who had no adiponectin mutation. The response suggested that pioglitazone treatment might help to prevent future Werner syndrome-related acceleration of atherosclerosis. Present and further clinical relevant to atherosclerosis in this patient should be imformative concerning the pathogenesis and treatment of atherosclerosis in the presence of hypoadiponectinemia and insulin resistance.

Novel mutations in the USH1C gene in Usher syndrome patients.

Science.gov (United States)

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

2010-12-31

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

Genetic basis of prune belly syndrome: screening for HNF1β gene.

Science.gov (United States)

Granberg, Candace F; Harrison, Steven M; Dajusta, Daniel; Zhang, Shaohua; Hajarnis, Sachin; Igarashi, Peter; Baker, Linda A

2012-01-01

Although the cause of prune belly syndrome is unknown, familial evidence suggests a genetic component. Recently 2 nonfamilial cases of prune belly syndrome with chromosome 17q12 deletions encompassing the HNF1β gene have made this a candidate gene for prune belly syndrome. To date, there has been no large-scale screening of patients with prune belly syndrome for HNF1β mutations. We assessed the role of HNF1β in prune belly syndrome by screening for genomic mutations with functional characterization of any detected mutations. We studied patients with prune belly syndrome who were prospectively enrolled in our Pediatric Genitourinary DNA Repository since 2001. DNA from patient samples was amplified by polymerase chain reaction, sequenced for coding and splice regions of the HNF1β gene, and compared to control databases. We performed functional assay testing of the ability of mutant HNF1β to activate a luciferase construct with an HNF1β DNA binding site. From 32 prune belly syndrome probands (30 males, 2 females) HNF1β sequencing detected a missense mutation (V61G) in 1 child with prune belly syndrome. Absent in control databases, V61G was previously reported in 2 patients without prune belly syndrome who had congenital genitourinary anomalies. Functional testing showed similar luciferase activity compared to wild-type HNF1β, suggesting the V61G substitution does not disturb HNF1β function. One genomic HNF1β mutation was detected in 3% of patients with prune belly syndrome but found to be functionally normal. Thus, functionally significant HNF1β mutations are uncommon in prune belly syndrome, despite case reports of HNF1β deletions. Further genetic study is necessary, as identification of the genetic basis of prune belly syndrome may ultimately lead to prevention and improved treatments for this rare but severe syndrome. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Prader-Willi Syndrome and Schaaf-Yang Syndrome: Neurodevelopmental Diseases Intersecting at the MAGEL2 Gene

Directory of Open Access Journals (Sweden)

Michael D. Fountain

2016-01-01

Full Text Available Prader-Willi syndrome (PWS is a neurodevelopmental disorder characterized by neonatal hypotonia, developmental delay/intellectual disability, and characteristic feeding behaviors with failure to thrive during infancy; followed by hyperphagia and excessive weight gain later in childhood. Individuals with PWS also manifest complex behavioral phenotypes. Approximately 25% meet criteria for autism spectrum disorder (ASD. PWS is caused by the absence of paternally expressed, maternally silenced genes at chromosome 15q11-q13. MAGEL2 is one of five protein-coding genes in the PWS-critical domain. Truncating point mutations of the paternal allele of MAGEL2 cause Schaaf-Yang syndrome, which has significant phenotypic overlap with PWS, but is also clinically distinct; based on the presence of joint contractures, and a particularly high prevalence of autism spectrum disorder (up to 75% of affected individuals. The clinical and molecular overlap between PWS and Schaaf-Yang syndrome, but also their distinguishing features provide insight into the pathogenetic mechanisms underlying both disorders.

A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

Directory of Open Access Journals (Sweden)

Emond Mary

2007-09-01

Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

Science.gov (United States)

Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

2015-03-01

NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

IMPACT OF ANGIOTENSIN-CONVERTING ENZYME GENE POLYMORPHISM ON THE DEVELOPMENT OF INSULIN RESISTANCE SYNDROME

Directory of Open Access Journals (Sweden)

G. E. Roitberg

2013-01-01

Full Text Available Objective: to analyze the distribution of components of insulin resistance (IR syndrome and to study the frequency of their combinations in relation to the genotypes and allelic variants of the angiotensin-converting enzyme (ACE gene.Subjects and methods. A group of clinically healthy patients (50 women and 42 men with different genotypes of the ACE gene was examined.The distribution of IR syndrome components and the frequency of their combinations were analyzed in relation to the genotypes and allelicvariants of the ACE gene.Results. A group of D allele carriers compared to A allele ones showed a pronounced tendency for the frequency of IR to reduce due to thehigher proportion of patients with complete IR syndrome. This observation becomes statistically significant in the assessment of homozygous variants of the ACE gene. At the same time dyslipidemia and hypertension in the presence of IR significantly more frequently occurred in patients with the DD genotype than in those with genotype II.Conclusion. There was a marked predominance of the manifestations of IR syndrome with a complete set of components in the DD genotypicgroup, which confirms the significant strong association between ACE gene polymorphism and IR syndrome.

Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly

NARCIS (Netherlands)

Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm

2017-01-01

Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS

Genetic and Dyanmic Analysis of Murine Peak Bone Density

Science.gov (United States)

1997-10-01

These homologous segments have provided important clues to mapping human genes associated with a number of diseases including Waardenburg syndrome (14...Newton, V., Wellesley, D., Harris, R., and Read, A. P. Assignment of the locus for Waardenburg syndrome type 1 to human chromosone 2q37 and possible...and Strachan, T. Waardenburg’s syndrome patients have mutations in the human homologue of the Pax-3 paired box gene, Nature. 355: 635-636, 1992

Association of arginine vasopressin receptor 1a gene polymorphisms with hepatorenal syndrome

International Nuclear Information System (INIS)

Wang, C.; Luo, X.; Ye, J.; Liu, S.; Miu, L.; Bao, J.; Wang, F.; Yu, Z.

2017-01-01

To assess the association of arginine vasopressin receptor 1a gene single nucleotide polymorphisms with type I hepatorenal syndrome. Methods: The case-control study was conducted at the Hangzhou City Xixi Hospital, Hangzhou, China, from January 2012 to June 2014, and comprised patients with type I hepatorenal syndrome and individuals with cirrhosis who acted as the control group. Arginine vasopressin receptor 1a gene rs113481894 locus single nucleotide polymorphisms were analysed by high-resolution melting methods. Statistical analysis was performed using SPSS 17. Results: Of the 60 participants, 28(46.7%) were in the hepatorenal syndrome group and 32(53.3%) were controls. The mean age was 42.21+-11.30years in the hepatorenal syndrome group and 43.69+-12.60 in the control group (p=0.64). Mean total bilirubin, albumin and prothrombin activity levels were 154.76+-51.58, 49.30+-24.67 and 33.42+-3.69 in the hepatorenal syndrome group compared to 181.26+-64.46, 41.78+-17.52 and 32.98+-4.81 among controls (p=0.09, p=0.18 and p=0.70). Statistically significant differences were found in the distributions of arginine vasopressin receptor 1a gene rs113481894 locus T allele between type I hepatorenal syndrome patients and the control group (odds ratio= 2.230; p= 0.040). Conclusion: T allele located at arginine vasopressin receptor 1a receptor promoter rs113481894 locus may be associated with the pathogenesis of type I hepatorenal syndrome. (author)

Monolayer structures of alkyl aldehydes: Odd-membered homologues

International Nuclear Information System (INIS)

Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

2011-01-01

Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy

OpenAIRE

Williams, David S.

2007-01-01

Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects...

A novel small deletion in the NHS gene associated with Nance-Horan syndrome.

Science.gov (United States)

Li, Huajin; Yang, Lizhu; Sun, Zixi; Yuan, Zhisheng; Wu, Shijing; Sui, Ruifang

2018-02-05

Nance-Horan syndrome is a rare X-linked recessive inherited disease with clinical features including severe bilateral congenital cataracts, characteristic facial and dental abnormalities. Data from Chinese Nance-Horan syndrome patients are limited. We assessed the clinical manifestations of a Chinese Nance-Horan syndrome pedigree and identified the genetic defect. Genetic analysis showed that 3 affected males carried a novel small deletion in NHS gene, c.263_266delCGTC (p.Ala89TrpfsTer106), and 2 female carriers were heterozygous for the same variant. All 3 affected males presented with typical Nance-Horan syndrome features. One female carrier displayed lens opacities centered on the posterior Y-suture in both eyes, as well as mild dental abnormalities. We recorded the clinical features of a Chinese Nance-Horan syndrome family and broadened the spectrum of mutations in the NHS gene.

Intracranial arteries in individuals with the elastin gene hemideletion of Williams syndrome.

Science.gov (United States)

Wint, D P; Butman, J A; Masdeu, J C; Meyer-Lindenberg, A; Mervis, C B; Sarpal, D; Morris, C A; Berman, K F

2014-01-01

Williams syndrome, a rare genetic disorder with a striking neurobehavioral profile characterized by extreme sociability and impaired visuospatial construction abilities, is caused by a hemideletion that includes the elastin gene, resulting in frequent supravavular aortic stenosis and other stenotic arterial lesions. Strokes have been reported in Williams syndrome. Although the extracranial carotid artery has been studied in a sample of patients with Williams syndrome, proximal intracranial arteries have not. Using MRA, we studied the intracranial vessels in 27 participants: 14 patients with Williams syndrome (age range, 18-44 years; mean age, 27.3 ± 9.1; 43% women) and 13 healthy control participants with similar age and sex distribution (age range, 22-52 years; mean age, 33.4 ± 7.6; 46% women). All participants with Williams syndrome had hemideletions of the elastin gene. Blinded to group allocation or to any other clinical data, a neuroradiologist determined the presence of intracranial vascular changes in the 2 groups. The Williams syndrome group and the healthy control group had similar patency of the proximal intracranial arteries, including the internal carotid and vertebral arteries; basilar artery; and stem and proximal branches of the anterior cerebral artery, MCA, and posterior cerebral arteries. The postcommunicating segment of the anterior cerebral artery was longer in the Williams syndrome group. Despite the elastin haploinsufficiency, the proximal intracranial arteries in Williams syndrome preserve normal patency.

(GPR98) gene in an Iranian family with Usher syndrome type II

Indian Academy of Sciences (India)

2014-12-04

Dec 4, 2014 ... Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran 1985713834, Iran. [Kahrizi K. ... Usher syndrome (USH) is an autosomal recessive disease .... missense variants on the protein structures, pathogen severity .... genes to a Spanish Usher syndrome type 2 cohort.

Isolated and combined dystonia syndromes - an update on new genes and their phenotypes.

Science.gov (United States)

Balint, B; Bhatia, K P

2015-04-01

Recent consensus on the definition, phenomenology and classification of dystonia centres around phenomenology and guides our diagnostic approach for the heterogeneous group of dystonias. Current terminology classifies conditions where dystonia is the sole motor feature (apart from tremor) as 'isolated dystonia', while 'combined dystonia' refers to dystonias with other accompanying movement disorders. This review highlights recent advances in the genetics of some isolated and combined dystonic syndromes. Some genes, such as ANO3, GNAL and CIZ1, have been discovered for isolated dystonia, but they are probably not a common cause of classic cervical dystonia. Conversely, the phenotype associated with TUBB4A mutations expanded from that of isolated dystonia to a syndrome of hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC syndrome). Similarly, ATP1A3 mutations cause a wide phenotypic spectrum ranging from rapid-onset dystonia-parkinsonism to alternating hemiplegia of childhood. Other entities entailing dystonia-parkinsonism include dopamine transporter deficiency syndrome (SLC63 mutations); dopa-responsive dystonias; young-onset parkinsonism (PARKIN, PINK1 and DJ-1 mutations); PRKRA mutations; and X-linked TAF1 mutations, which rarely can also manifest in women. Clinical and genetic heterogeneity also characterizes myoclonus-dystonia, which includes not only the classical phenotype associated with epsilon-sarcoglycan mutations but rarely also presentation of ANO3 gene mutations, TITF1 gene mutations typically underlying benign hereditary chorea, and some dopamine synthesis pathway conditions due to GCH1 and TH mutations. Thus, new genes are being recognized for isolated dystonia, and the phenotype of known genes is broadening and now involves different combined dystonia syndromes. © 2015 EAN.

A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome).

Science.gov (United States)

Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji

2008-04-01

Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

Correlation of gene expression with bladder capacity in interstitial cystitis/bladder pain syndrome.

Science.gov (United States)

Colaco, Marc; Koslov, David S; Keys, Tristan; Evans, Robert J; Badlani, Gopal H; Andersson, Karl-Erik; Walker, Stephen J

2014-10-01

Interstitial cystitis and bladder pain syndrome are terms used to describe a heterogeneous chronic pelvic and bladder pain disorder. Despite its significant prevalence, our understanding of disease etiology is poor. We molecularly characterized interstitial cystitis/bladder pain syndrome and determined whether there are clinical factors that correlate with gene expression. Bladder biopsies from female subjects with interstitial cystitis/bladder pain syndrome and female controls without signs of the disease were collected and divided into those with normal and low anesthetized bladder capacity, respectively. Samples then underwent RNA extraction and microarray assay. Data generated by these assays were analyzed using Omics Explorer (Qlucore, Lund, Sweden), GeneSifter® Analysis Edition 4.0 and Ingenuity® Pathway Analysis to determine similarity among samples within and between groups, and measure differentially expressed transcripts unique to each phenotype. A total of 16 subjects were included in study. Principal component analysis and unsupervised hierarchical clustering showed clear separation between gene expression in tissues from subjects with low compared to normal bladder capacity. Gene expression in tissue from patients with interstitial cystitis/bladder pain syndrome who had normal bladder capacity did not significantly differ from that in controls without interstitial cystitis/bladder pain syndrome. Pairwise analysis revealed that pathways related to inflammatory and immune response were most involved. Microarray analysis provides insight into the potential pathological condition underlying interstitial cystitis/bladder pain syndrome. This pilot study shows that patients with this disorder who have low compared to normal bladder capacity have significantly different molecular characteristics, which may reflect a difference in disease pathophysiology. Copyright © 2014 American Urological Association Education and Research, Inc. Published by Elsevier Inc

Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

Science.gov (United States)

Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

2013-09-15

Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

Pendred syndrome (goitre and sensorineural hearing loss) maps to chromosome 7 in the region containing the nonsyndromic deafness gene DFNB4.

Science.gov (United States)

Coyle, B; Coffey, R; Armour, J A; Gausden, E; Hochberg, Z; Grossman, A; Britton, K; Pembrey, M; Reardon, W; Trembath, R

1996-04-01

Inherited causes account for about 50% of individuals presenting with childhood (prelingual) hearing loss, of which 70% are due to mutation in numerous single genes which impair auditory function alone (non-syndromic). The remainder are associated with other developmental anomalies termed syndromic deafness. Genes responsible for syndromic forms of hearing loss include the COL4A5 gene in Alport syndrome and the PAX3 and MITF genes in Waardenburg syndrome. Pendred syndrome is an autosomal recessive disorder associated with developmental abnormalities of the cochlea, sensorineural hearing loss and diffuse thyroid enlargement (goitre). Pendred syndrome is the most common syndromal form of deafness, yet the primary defect remains unknown. We have established a panel of 12 families with two or more affected individuals and used them to search for the location of the Pendred gene by linkage analysis. We excluded localization to four previously mapped nonsyndromic deafness loci but obtained conclusive evidence for linkage of the Pendred syndrome gene to microsatellite markers on chromosome 7q31 (D7S495 Zmax 7.32, Qmax = 0). This region contains a gene, DFNBL, for autosomal recessive non-syndromic sensorineural hearing loss. Multipoint analysis indicates that DFNB4 and Pendred syndrome co-localize to the same 5.5 centiMorgan (cM) interval flanked by D7S501 and D7S523. These data raise the possibility that Pendred syndrome is either allelic with DFNB4 or may represent an inherited contiguous gene disorder, not clinically manifest in the heterozygote.

Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome.

Science.gov (United States)

Aller, Elena; Jaijo, Teresa; Beneyto, Magdalena; Nájera, Carmen; Morera, Constantino; Pérez-Garrigues, Herminio; Ayuso, Carmen; Millán, Jose

2007-09-01

The Usher syndrome (USH) is an autosomal recessive hereditary disorder characterized by the association of sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. The USH1G gene, encoding SANS, has been found to cause both Usher syndrome type I and atypical Usher syndrome. 109 Spanish unrelated patients suffering from Usher syndrome type I, type II, type III and unclassified Usher syndrome were screened for mutations in this gene, but only eight different changes without a clear pathogenic effect have been detected. Based on these results as well as previous studies in other populations where mutational analysis of this gene has been carried out, one can conclude that USH1G has a minor involvement in Usher syndrome pathogenesis.

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

Science.gov (United States)

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

Variant of Rett syndrome and CDKL5 gene

DEFF Research Database (Denmark)

Pini, Giorgio; Bigoni, Stefania; Engerström, Ingegerd Witt

2012-01-01

UNLABELLED: Rett syndrome (RTT) is a severe neurodevelopmental disorder affecting almost exclusively females. The Hanefeld variant, or early-onset seizure variant, has been associated with mutations in CDKL5 gene. AIMS: In recent years more than 60 patients with mutations in the CDKL5 gene have...... been described in the literature, but the cardiorespiratory phenotype has not been reported. Our aim is to describe clinical and autonomic features of these girls. METHODS: 10 girls with CDKL5 mutations and a diagnosis of Hanefeld variant have been evaluated on axiological and clinical aspects. In all...

Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

DEFF Research Database (Denmark)

Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

2013-01-01

Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

Left-sided congenital heart lesions in mosaic Turner syndrome.

Science.gov (United States)

Bouayed Abdelmoula, Nouha; Abdelmoula, Balkiss; Smaoui, Walid; Trabelsi, Imen; Louati, Rim; Aloulou, Samir; Aloulou, Wafa; Abid, Fatma; Kammoun, Senda; Trigui, Khaled; Bedoui, Olfa; Denguir, Hichem; Mallek, Souad; Ben Aziza, Mustapha; Dammak, Jamila; Kaabi, Oldez; Abdellaoui, Nawel; Turki, Fatma; Kaabi, Asma; Kamoun, Wafa; Jabeur, Jihen; Ltaif, Wided; Chaker, Kays; Fourati, Haytham; M'rabet, Samir; Ben Ameur, Hedi; Gouia, Naourez; Mhiri, Mohamed Nabil; Rebai, Tarek

2018-04-01

In the era of the diseasomes and interactome networks, linking genetics with phenotypic traits in Turner syndrome should be studied thoroughly. As a part of this stratagem, mosaicism of both X and Y chromosome which is a common finding in TS and an evaluation of congenital heart diseases in the different situations of mosaic TS types, can be helpful in the identification of disturbed sex chromosomes, genes and signaling pathway actors. Here we report the case of a mosaic TS associated to four left-sided CHD, including BAV, COA, aortic aneurysms and dissections at an early age. The mosaicism included two cell lines, well-defined at the cytogenetic and molecular levels: a cell line which is monosomic for Xp and Xq genes (45,X) and another which is trisomic for pseudoautosomal genes that are present on the X and Y chromosomes and escape X inactivation: 45,X[8]/46,X,idic(Y)(pter→q11.2::q11.2→pter)[42]. This case generates two hypotheses about the contribution of genes linked to the sex chromosomes and the signaling pathways involving these genes, in left-sided heart diseases. The first hypothesis suggests the interaction between X chromosome and autosomal genes or loci of aortic development, possibly dose-dependent, and which could be in the framework of TGF-β-SMAD signaling pathways. The second implies that left-sided congenital heart lesions involve sex chromosomes loci. The reduced dosage of X chromosome gene(s), escaping X inactivation during development, contributes to this type of CHD. Regarding our case, these X chromosome genes may have homologues at the Y chromosome, but the process of inactivation of the centromeres of the isodicentric Y spreads to the concerned Y chromosome genes. Therefore, this case emerges as an invitation to consider the mosaics of Turner syndrome and to study their phenotypes in correlation with their genotypes to discover the underlying developmental and genetic mechanisms, especially the ones related to sex chromosomes.

Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

Science.gov (United States)

Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

2012-01-01

Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

An X-linked homologue of the autosomal inprinted gene ZNF127 escapes X inactivation

Energy Technology Data Exchange (ETDEWEB)

Longstreet, M.; Nicholls, R.D.; Willard, H.F. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others

1994-09-01

The ZNF127 gene has been shown to be subject to parental imprinting in both humans and the mouse and maps to within the Prader-Willi/Angelman Syndrome critical region on chromosome 15. We have cloned two X-linked related loci, one of which, ZNFXp is a transcribed gene while the other, ZNFXq, is an untranscribed pseudogene. ZNFXp is 83.6% identical to ZNFXq and 65.4% identical to ZNF127 over 1.4 kb of open reading frame they share in common, Like ZNF127, the predicted protein sequence of ZNFXp contains a C{sub 3}HC{sub 4} zinc finger domain and C{sub 3}H zinc finger-like motifs. Whereas ZNF127 has three C{sub 3}H motifs, ZNFXp has four. A strong CpG island is located within 1 kb 5{prime} of the predicted amino terminus of ZNFXp. Expression of ZNFXp has been detected from mouse/human somatic cell hybrids containing either an active (n=2) or an inactive (n=4) chromosome, and thus escapes X inactivation. Probes made from the 3{prime} UTR of ZNFXp detect a number of related loci in both human and murine DNA, none of which is the ZNF127 locus on chromosome 15. None of the detectable murine bands shows dosage differences between males and females as would be expected for X-linked loci. This raises the possibility that ZNFXp inserted into the human X chromosome after its divergence from a common ancestor with the murine X. We have mapped ZNFXp to Xp11.4 by Southern blotting and PCR of hybrid DNAs and by fluorescence in situ hybridization (FISH). ZNFXq maps within the X Inactivation Center (XIC) region on Xq13.2, approximately 300 kb distal to the XIST gene. We find it intriguing, and perhaps significant, that two members of this gene family are subject to epigenetic regulation -- one autosomal imprinting, and the other escape from X inactivation. These results could imply an evolutionary and mechanistic relationship between these two processes.

Syndromic Craniosynostosis Can Define New Candidate Genes for Suture Development or Result from the Non-specifc Effects of Pleiotropic Genes: Rasopathies and Chromatinopathies as Examples

Directory of Open Access Journals (Sweden)

Marcella Zollino

2017-10-01

Full Text Available Craniosynostosis is a heterogeneous condition caused by the premature fusion of cranial sutures, occurring mostly as an isolated anomaly. Pathogenesis of non-syndromic forms of craniosynostosis is largely unknown. In about 15–30% of cases craniosynostosis occurs in association with other physical anomalies and it is referred to as syndromic craniosynostosis. Syndromic forms of craniosynostosis arise from mutations in genes belonging to the Fibroblast Growth Factor Receptor (FGFR family and the interconnected molecular pathways in most cases. However it can occur in association with other gene variants and with a variety of chromosome abnormalities as well, usually in association with intellectual disability (ID and additional physical anomalies. Evaluating the molecular properties of the genes undergoing intragenic mutations or copy number variations (CNVs along with prevalence of craniosynostosis in different conditions and animal models if available, we made an attempt to define two distinct groups of unusual syndromic craniosynostosis, which can reflect direct effects of emerging new candidate genes with roles in suture homeostasis or a non-specific phenotypic manifestation of pleiotropic genes, respectively. RASopathies and 9p23p22.3 deletions are reviewed as examples of conditions in the first group. In particular, we found that craniosynostosis is a relatively common component manifestation of cardio-facio-cutaneous (CFC syndrome. Chromatinopathies and neurocristopathies are presented as examples of conditions in the second group. We observed that craniosynostosis is uncommon on average in these conditions. It was randomly associated with Kabuki, Koolen-de Vries/KANSL1 haploinsufficiency and Mowat–Wilson syndromes and in KAT6B-related disorders. As an exception, trigonocephaly in Bohring-Opitz syndrome reflects specific molecular properties of the chromatin modifier ASXL1 gene. Surveillance for craniosynostosis in syndromic forms of

Neonatal Marfan syndrome caused by an exon 25 mutation of the fibrillin-1 gene.

Science.gov (United States)

Elçioglu, N H; Akalin, F; Elçioglu, M; Comeglio, P; Child, A H

2004-01-01

Neonatal Marfan syndrome caused by an exon 25 mutation of the Fibrillin-1 gene: We describe a male infant with severe arachnodactyly, hypermobility of the fingers, flexion contractures of elbows, wrists, hips, and knees, microretrognathia, crumpled ears, rockerbottom feet, loose redundant skin, and lens dislocations. Cardiac valve insufficiency and aortic dilatation resulted in cardiac failure, decompensated with digitalisation and death occurred at the age of 4 months. This case represents the severe end of the clinical spectrum of Marfan syndrome, namely neonatal Marfan syndrome. Molecular diagnostic analyses confirmed a de novo exon 25 mutation in the FBN1 gene.

A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

Science.gov (United States)

Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

2012-12-01

Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients.

Science.gov (United States)

Jansen, Anne M L; Geilenkirchen, Marije A; van Wezel, Tom; Jagmohan-Changur, Shantie C; Ruano, Dina; van der Klift, Heleen M; van den Akker, Brendy E W M; Laros, Jeroen F J; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G W; Gómez-García, Encarna B; Tops, Carli M J; Vasen, Hans F; Devilee, Peter; Hes, Frederik J; Morreau, Hans; Wijnen, Juul T

2016-01-01

Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes.

Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

Energy Technology Data Exchange (ETDEWEB)

Garcia, V.

2001-12-15

The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

Mitchell-Riley Syndrome: A Novel Mutation in RFX6 Gene

Directory of Open Access Journals (Sweden)

Marta Zegre Amorim

2015-01-01

Full Text Available A novel RFX6 homozygous missense mutation was identified in an infant with Mitchell-Riley syndrome. The most common features of Mitchell-Riley syndrome were present, including severe neonatal diabetes associated with annular pancreas, intestinal malrotation, gallbladder agenesis, cholestatic disease, chronic diarrhea, and severe intrauterine growth restriction. Perijejunal tissue similar to pancreatic tissue was found in the submucosa, a finding that has not been previously reported in this syndrome. This case associating RFX6 mutation with structural and functional pancreatic abnormalities reinforces the RFX6 gene role in pancreas development and β-cell function, adding information to the existent mutation databases.

Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

Directory of Open Access Journals (Sweden)

Knüchel Ruth

2008-05-01

Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

Severe neonatal marfan syndrome resulting from a De Novo 3-bp insertion into the fibrillin gene on chromosome 15

Energy Technology Data Exchange (ETDEWEB)

Milewicz, D.M.; Duvic, M. (Univ. of Texas Medical School, Houston, TX (United States))

1994-03-01

Severe neonatal Marfan syndrome has features of the Marfan syndrome and congenital contractural arachnodactyly present at birth, along with unique features such as loose, redundant skin and pulmonary emphysema. Since the Marfan syndrome and congenital contractural arachnodactyly are due to mutations in different genes, it has been uncertain whether neonatal Marfan syndrome is due to mutations in the fibrillin gene on chromosome 15 or in another gene. The authors studied an infant with severe neonatal Marfan syndrome. Dermal fibroblasts were metabolically labeled and found to secrete fibrillin inefficiently when compared with control cells. Reverse transcription and amplification of the proband's fibroblast RNA was used to identify a 3-bp insertion between nucleotides 480-481 or 481-482 of the fibrillin cDNA. The insertion maintains the reading frame of the protein and inserts a cysteine between amino acids 160 and 161 in an epidermal growth-factor-like motif of fibrillin. This 3-bp insertion was not found in the fibrillin gene in 70 unrelated, unaffected individuals and 11 unrelated individuals with the Maran syndrome. The authors conclude that neonatal Marfan syndrome is the result of mutations in the fibrillin gene on chromosome 15 and is part of the Marfan syndrome spectrum. 32 refs., 3 figs.

Linkage of Usher syndrome type I gene (USH1B) to the long arm of chromosome 11.

Science.gov (United States)

Kimberling, W J; Möller, C G; Davenport, S; Priluck, I A; Beighton, P H; Greenberg, J; Reardon, W; Weston, M D; Kenyon, J B; Grunkemeyer, J A

1992-12-01

Usher syndrome is the most commonly recognized cause of combined visual and hearing loss in technologically developed countries. There are several different types and all are inherited in an autosomal recessive manner. There may be as many as five different genes responsible for at least two closely related phenotypes. The nature of the gene defects is unknown, and positional cloning strategies are being employed to identify the genes. This is a report of the localization of one gene for Usher syndrome type I to chromosome 11q, probably distal to marker D11S527. Another USH1 gene had been previously localized to chromosome 14q, and this second localization establishes the existence of a new and independent locus for Usher syndrome.

Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

Directory of Open Access Journals (Sweden)

Adriano Senatore

Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

RENIN ANGIOTENSIN SYSTEM GENE POLYMORPHISMS IN CHILDREN WITH NEPHROTIC SYNDROM

Directory of Open Access Journals (Sweden)

Zh.P. Sharnova

2006-01-01

Full Text Available To investigate the role of the reninangiotensin system genes polymorphisms in develop and progression of nephrotic syndrom (NS in children we determined the genotypes of angiotensin converting enzyme (ACE, angiotensinogen (AGT and angiotensin ii receptor (ATII-R of 1 type in 80 russian children with ns including and 15 children with chronic renal failure (CRF. Genotype frequencies did not differ between patients with ns and controls (n = 165. The distribution of ace, AGT and ATII-R 1 type genotypes was similar among ns sub groups, such as focal segmental glomerulosclerosis (FSGS (n = 18, steroid-sensitive nephrotic syndrome (n = 32, nephrotic syndrome with hypertension and hemoturia (n = 22 and with control group. When ns subjects with CRF (n = 15 were compared with control, the prevalence of ace DD genotype was significantly higher (47% VS 21%; χ2 = 4,44; p < 0,05. Our results indicate that the DD genotype ace may be a factor of risk for the dеvеlopment of progressive renal impairment in the children with nephrotic syndrome. The analysis of treatment's effect with inhibitor of ace in groups patients with steroid resistant NS (SRNS demonstrated decreasing of renoprotective effect of this drugs in patients with id and dd genotypes com? Pared with ii genotype: the degree of blood pressure, proteinuria and the rate of glomerular filtration decrease was significantly lower (55,46 ± 9,25 VS 92,74 ± 25; р < 0,05 in these patients.Key words: nephrotic syndrom, chronic renal failure, polymorphism of genes, renin-angiotensin system.

What's in a Gene? Pseudoexfoliation Syndrome and Pigment Dispersion Syndrome in the Same Patient.

Science.gov (United States)

Pokrovskaya, Olya; O'Brien, Colm

2016-01-01

Pseudoexfoliation syndrome (PXS) and pigment dispersion syndrome (PDS) are two of the commonest disorders to produce secondary open-angle glaucoma through trabecular meshwork blockage. Each is a defined clinical entity, and while genetics likely play a significant role in the pathogenesis of both, the specific genes involved appear to be distinct. There is surprisingly little published in the literature regarding the coexistence of PDS and PXS in the same patient. We present the intriguing case of a patient who developed PDS in one eye and PXS in the other. This unusual case acts as a platform for an interesting discussion of the genomics of PXS and PDS.

What's in a Gene Pseudoexfoliation Syndrome and Pigment Dispersion Syndrome in the Same Patient

Directory of Open Access Journals (Sweden)

Olya Pokrovskaya

2016-01-01

Full Text Available Pseudoexfoliation syndrome (PXS and pigment dispersion syndrome (PDS are two of the commonest disorders to produce secondary open-angle glaucoma through trabecular meshwork blockage. Each is a defined clinical entity, and while genetics likely play a significant role in the pathogenesis of both, the specific genes involved appear to be distinct. There is surprisingly little published in the literature regarding the coexistence of PDS and PXS in the same patient. We present the intriguing case of a patient who developed PDS in one eye and PXS in the other. This unusual case acts as a platform for an interesting discussion of the genomics of PXS and PDS.

Candidate genes and pathogenesis investigation for sepsis-related acute respiratory distress syndrome based on gene expression profile.

Science.gov (United States)

Wang, Min; Yan, Jingjun; He, Xingxing; Zhong, Qiang; Zhan, Chengye; Li, Shusheng

2016-04-18

Acute respiratory distress syndrome (ARDS) is a potentially devastating form of acute inflammatory lung injury as well as a major cause of acute respiratory failure. Although researchers have made significant progresses in elucidating the pathophysiology of this complex syndrome over the years, the absence of a universal detail disease mechanism up until now has led to a series of practical problems for a definitive treatment. This study aimed to predict some genes or pathways associated with sepsis-related ARDS based on a public microarray dataset and to further explore the molecular mechanism of ARDS. A total of 122 up-regulated DEGs and 91 down-regulated differentially expressed genes (DEGs) were obtained. The up- and down-regulated DEGs were mainly involved in functions like mitotic cell cycle and pathway like cell cycle. Protein-protein interaction network of ARDS analysis revealed 20 hub genes including cyclin B1 (CCNB1), cyclin B2 (CCNB2) and topoisomerase II alpha (TOP2A). A total of seven transcription factors including forkhead box protein M1 (FOXM1) and 30 target genes were revealed in the transcription factor-target gene regulation network. Furthermore, co-cited genes including CCNB2-CCNB1 were revealed in literature mining for the relations ARDS related genes. Pathways like mitotic cell cycle were closed related with the development of ARDS. Genes including CCNB1, CCNB2 and TOP2A, as well as transcription factors like FOXM1 might be used as the novel gene therapy targets for sepsis related ARDS.

Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

Science.gov (United States)

Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

2008-01-01

The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

Characterization of MORE AXILLARY GROWTH genes in Populus.

Directory of Open Access Journals (Sweden)

Olaf Czarnecki

Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.

Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

Science.gov (United States)

Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

2015-09-01

Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many

RAI1 gene mutations: mechanisms of Smith–Magenis Syndrome

Directory of Open Access Journals (Sweden)

Falco M

2017-11-01

Full Text Available Mariateresa Falco,1,* Sonia Amabile,1,* Fabio Acquaviva2 1Department of Molecular Medicine and Medical Biotechnology, University of Naples “Federico II”, Naples, Italy; 2Department of Translational Medical Sciences (DISMET, Section of Pediatric Clinical Genetics, University of Naples “Federico II”, Naples, Italy *These authors contributed equally to this work Abstract: Smith–Magenis syndrome (SMS; OMIM #182290 is a complex genetic disorder characterized by distinctive physical features, developmental delay, cognitive impairment, and a typical behavioral phenotype. SMS is caused by interstitial 17p11.2 deletions, encompassing multiple genes and including the retinoic acid-induced 1 gene (RAI1, or by mutations in RAI1 itself. About 10% of all the SMS patients, in fact, carry an RAI1 mutation responsible for the phenotype. RAI1 (OMIM *607642 is a dosage-sensitive gene expressed in many tissues and highly conserved among species. Over the years, several studies have demonstrated that RAI1 (or its homologs in animal models acts as a transcriptional factor implicated in embryonic neurodevelopment, neuronal differentiation, cell growth and cell cycle regulation, bone and skeletal development, lipid and glucose metabolisms, behavioral functions, and circadian activity. Patients with RAI1 pathogenic variants show some phenotypic differences when compared to those carrying the typical deletion. They usually have lower incidence of hypotonia and less cognitive impairment than those with 17p11.2 deletions but more frequently show the behavioral characteristics of the syndrome and overeating issues. These differences reflect the primary pathogenetic role of RAI1 without the pathogenetic contribution of the other genes included in the typical 17p11.2 deletion. The better comprehension of physiological roles of RAI1, its molecular co-workers and interactors, and its contribution in determining the typical SMS phenotype will certainly open a new path

Study on the correlation between KCNJ11 gene polymorphism and metabolic syndrome in the elderly.

Science.gov (United States)

Jiang, Fan; Liu, Ning; Chen, Xiao Zhuang; Han, Kun Yuan; Zhu, Cai Zhong

2017-09-01

The aim of the study was to examine the correlation between KCNJ11 gene polymorphism and metabolic syndrome in elderly patients. From January 2014 to January 2015, 54 elderly patients with metabolic syndrome were enrolled in this study as the observation group. During the same period, 46 healthy elderly individuals were enrolled in this study as the control group. KCNJ11 gene polymorphism (rs28502) was analyzed using polymerase chain reaction-restriction fragment length polymorphism. The expression levels of mRNA in different genotypes were detected using FQ-PCR. ELISA was used to evaluate the KCNJ11 protein expression in different genotypes. KCNJ11 gene polymorphism and metabolic syndrome was studied by measuring the blood pressure levels in patients with different genotypes. Three genotypes of KCNJ11 gene in rs28502 were CC, CT and TT. The CC, CT and TT genotype frequencies in healthy population were 8.5, 9.2 and 82.2%, respectively, while the genotype frequencies in patients with metabolic syndrome were 42.4, 49.8 and 7.8%, respectively. There were significant differences between groups (P≤0.05). However, the genotype frequencies of C/T in healthy individuals and metabolic syndrome patients were 35.3 and 38.3%, respectively. There were no significant differences between groups (P>0.05). FQ-PCR results showed that the KCNJ11 mRNA expression levels in the control and observation groups had no significant differences (P>0.05). However, the results obtained from ELISA analysis revealed that KCNJ11 protein expression level in the observation group was significantly higher than that in the control group (Pmetabolic syndrome in the elderly. Elderly patients with the CC and TT genotypes are more likely to develop metabolic syndrome.

Syndromes associated with Homo sapiens pol II regulatory genes.

Science.gov (United States)

Bina, M; Demmon, S; Pares-Matos, E I

2000-01-01

The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.

Analysis of Polymorphism of Angiotensin System Genes (ACE, AGTR1, and AGT) and Gene ITGB3 in Patients with Arterial Hypertension in Combination with Metabolic Syndrome.

Science.gov (United States)

Zotova, T Yu; Kubanova, A P; Azova, M M; Aissa, A Ait; Gigani, O O; Frolov, V A

2016-07-01

Changes in the frequencies of genotypes and mutant alleles of ACE, AGTR1, AGT, and ITGB3 genes were analyzed in patients with arterial hypertension coupled with metabolic syndrome (N=15) and compared with population data and corresponding parameters in patients with isolated hypertension (N=15). Increased frequency of genotype ID of ACE gene (hypertension predictor) was confirmed for both groups. In case of isolated hypertension, M235M genotype (gene AGT) was more frequent, in case of hypertension combined with metabolic syndrome, the frequency of genotypes A1166C and C1166C of the gene AGTR1 was higher in comparison with population data. Comparison of mutant allele frequencies in the two groups showed that at the 90% significance level allele T of the AGT gene was more frequent in hypertension coupled with metabolic syndrome (OR=1.26) and genotype A1166A of the AGTR1 gene was more frequent in the group with isolated hypertension.

Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

Directory of Open Access Journals (Sweden)

Colovati Mileny ES

2012-01-01

Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

A novel small deletion in the NHS gene associated with Nance-Horan syndrome

OpenAIRE

Li, Huajin; Yang, Lizhu; Sun, Zixi; Yuan, Zhisheng; Wu, Shijing; Sui, Ruifang

2018-01-01

Nance-Horan syndrome is a rare X-linked recessive inherited disease with clinical features including severe bilateral congenital cataracts, characteristic facial and dental abnormalities. Data from Chinese Nance-Horan syndrome patients are limited. We assessed the clinical manifestations of a Chinese Nance-Horan syndrome pedigree and identified the genetic defect. Genetic analysis showed that 3 affected males carried a novel small deletion in NHS gene, c.263_266delCGTC (p.Ala89TrpfsTer106), a...

Cytochrome C oxydase deficiency: SURF1 gene investigation in patients with Leigh syndrome.

Science.gov (United States)

Maalej, Marwa; Kammoun, Thouraya; Alila-Fersi, Olfa; Kharrat, Marwa; Ammar, Marwa; Felhi, Rahma; Mkaouar-Rebai, Emna; Keskes, Leila; Hachicha, Mongia; Fakhfakh, Faiza

2018-03-18

Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is the MT[HYPHEN]ATP6 and SURF1 gene screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions by clinical and bioinformatics analyses. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analyses to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A > C/c. c.751 + 16G > A). In silico analyses of theses intronic variations showed that it could alters splicing processes as well as SURF1 protein translation. Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is MT-ATP6 and SURF1 genes screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in

Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation.

Science.gov (United States)

Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong

2016-10-01

Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

International Nuclear Information System (INIS)

Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

2006-01-01

The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

Marfan Syndrome and Related Disorders: 25 Years of Gene Discovery.

Science.gov (United States)

Verstraeten, Aline; Alaerts, Maaike; Van Laer, Lut; Loeys, Bart

2016-06-01

Marfan syndrome (MFS) is a rare, autosomal-dominant, multisystem disorder, presenting with skeletal, ocular, skin, and cardiovascular symptoms. Significant clinical overlap with other systemic connective tissue diseases, including Loeys-Dietz syndrome (LDS), Shprintzen-Goldberg syndrome (SGS), and the MASS phenotype, has been documented. In MFS and LDS, the cardiovascular manifestations account for the major cause of patient morbidity and mortality, rendering them the main target for therapeutic intervention. Over the past decades, gene identification studies confidently linked the aforementioned syndromes, as well as nonsyndromic aneurysmal disease, to genetic defects in proteins related to the transforming growth factor (TGF)-β pathway, greatly expanding our knowledge on the disease mechanisms and providing us with novel therapeutic targets. As a result, the focus of the developing pharmacological treatment strategies is shifting from hemodynamic stress management to TGF-β antagonism. In this review, we discuss the insights that have been gained in the molecular biology of MFS and related disorders over the past 25 years. © 2016 WILEY PERIODICALS, INC.

β-Secretases, Alzheimer’s Disease, and Down Syndrome

Directory of Open Access Journals (Sweden)

Robin L. Webb

2012-01-01

Full Text Available Individuals with Down Syndrome (DS, or trisomy 21, develop Alzheimer’s disease (AD pathology by approximately 40 years of age. Chromosome 21 harbors several genes implicated in AD, including the amyloid precursor protein and one homologue of the β-site APP cleaving enzyme, BACE2. Processing of the amyloid precursor protein by β-secretase (BACE is the rate-limiting step in the production of the pathogenic Aβ peptide. Increased amounts of APP in the DS brain result in increased amounts of Aβ and extracellular plaque formation beginning early in life. BACE dysregulation potentially represents an overlapping biological mechanism with sporadic AD and a common therapeutic target. As the lifespan for those with DS continues to increase, age-related concerns such as obesity, depression, and AD are of growing concern. The ability to prevent or delay the progression of neurodegenerative diseases will promote healthy aging and improve quality of life for those with DS.

Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

DEFF Research Database (Denmark)

Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos

2016-01-01

Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2...... Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large...... deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder...

WS1 gene mutation analysis of Wolfram syndrome in a Chinese patient and a systematic review of literatures.

Science.gov (United States)

Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin

2010-10-01

Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.

The murine homologue of HIRA, a DiGeorge syndrome candidate gene, is expressed in embryonic structures affected in human CATCH22 patients

NARCIS (Netherlands)

L.G. Wilming (Laurens); C.A. Snoeren; A.L. Rijswijk (Angelique); C. Meijers (Carel); F.G. Grosveld (Frank)

1997-01-01

textabstractA wide spectrum of birth defects is caused by deletions of the DiGeorge syndrome chromosomal region at 22q11. Characteristic features include cranio-facial, cardiac and thymic malformations, which are thought to arise form disturbances in the interactions

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

Energy Technology Data Exchange (ETDEWEB)

Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F. (Harvard Medical School, Boston, MA (USA))

1988-08-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

International Nuclear Information System (INIS)

Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F.

1988-01-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid β precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS

[MVK gene abnormality and new approach to treatment of hyper IgD syndrome and periodic fever syndrome].

Science.gov (United States)

Naruto, Takuya

2007-04-01

Hyper IgD and periodic fever syndrome (HIDS; OMIM 260920) is one of the hereditary autoinflammatory syndromes characterized by recurrent episodes of fever and inflammation.. HIDS is an autosomal recessive disorder characterized by recurrent fever attacks in early childhood. HIDS caused by mevalonate kinase (MK) mutations, also that is the gene of mevalonic aciduria (OMIM 251170). During febrile episodes, urinary mevalonate concentrations were found to be significantly elevated in patients. Diagnosis of HIDS was retrieving gene or measurement of the enzyme activity in peripheral blood lymphocyte in general. This of HIDS is an activity decline of MK, and a complete deficiency of MK becomes a mevalonic aciduria with a nervous symptom. The relation between the fever and inflammation of mevalonate or isoprenoid products are uncertain. The therapy attempt with statins, which is inhibited the next enzyme after HMG-CoA reductase, or inhibit the proinflammatory cytokines.

A unique mosaic Turner syndrome patient with androgen receptor gene derived marker chromosome.

Science.gov (United States)

Kalkan, Rasime; Özdağ, Nermin; Bundak, Rüveyde; Çirakoğlu, Ayşe; Serakinci, Nedime

2016-01-01

Patients with Turner syndrome are generally characterized by having short stature with no secondary sexual characteristics. Some abnormalities, such as webbed neck, renal malformations (>50%) and cardiac defects (10%) are less common. The intelligence of these patients is considered normal. Non-mosaic monosomy X is observed in approximately 45% of postnatal patients with Turner syndrome and the rest of the patients have structural abnormalities or mosaicism involving 46,X,i(Xq), 45,X/46,XX, 45,X and other variants. The phenotype of 45,X/46,X,+mar individuals varies by the genetic continent and degree of the mosaicism. The gene content of the marker chromosome is the most important when correlating the phenotype with the genotype. Here we present an 11-year-old female who was referred for evaluation of her short stature and learning disabilities. Conventional cytogenetic investigation showed a mosaic 45,X/46,X,+mar karyotype. Fluorescence in situ hybridization showed that the marker chromosome originated from the X chromosome within the androgen receptor (AR) and X-inactive specific transcript (XIST) genes. Therefore, it is possible that aberrant activation of the marker chromosome, compromising the AR and XIST genes, may modify the Turner syndrome phenotype.

A Next Generation Sequencing custom gene panel as first line diagnostic tool for atypical cases of syndromic obesity: Application in a case of Alström syndrome.

Science.gov (United States)

Maltese, Paolo E; Iarossi, Giancarlo; Ziccardi, Lucia; Colombo, Leonardo; Buzzonetti, Luca; Crinò, Antonino; Tezzele, Silvia; Bertelli, Matteo

2018-02-01

Obesity phenotype can be manifested as an isolated trait or accompanied by multisystem disorders as part of a syndromic picture. In both situations, same molecular pathways may be involved to different degrees. This evidence is stronger in syndromic obesity, in which phenotypes of different syndromes may overlap. In these cases, genetic testing can unequivocally provide a final diagnosis. Here we describe a patient who met the diagnostic criteria for Alström syndrome only during adolescence. Genetic testing was requested at 25 years of age for a final confirmation of the diagnosis. The genetic diagnosis of Alström syndrome was obtained through a Next Generation Sequencing genetic test approach using a custom-designed gene panel of 47 genes associated with syndromic and non-syndromic obesity. Genetic analysis revealed a novel homozygous frameshift variant p.(Arg1550Lysfs*10) on exon 8 of the ALMS1 gene. This case shows the need for a revision of the diagnostic criteria guidelines, as a consequence of the recent advent of massive parallel sequencing technology. Indications for genetic testing reported in these currently accepted diagnostic criteria for Alström syndrome, were drafted when sequencing was expensive and time consuming. Nowadays, Next Generation Sequencing testing could be considered as first line diagnostic tool not only for Alström syndrome but, more generally, for all those atypical or not clearly distinguishable cases of syndromic obesity, thus avoiding delayed diagnosis and treatments. Early diagnosis permits a better follow-up and pre-symptomatic interventions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

International Nuclear Information System (INIS)

Back, Susan J.; Andronikou, Savvas; Kilborn, Tracy; Kaplan, Bernard S.; Darge, Kassa

2015-01-01

Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

Energy Technology Data Exchange (ETDEWEB)

Back, Susan J. [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Andronikou, Savvas [University of the Witwatersrand, Radiology Department, Faculty of Health Sciences, Johannesburg (South Africa); Kilborn, Tracy [University of Cape Town, Red Cross War Memorial Children' s Hospital, Cape Town (South Africa); Kaplan, Bernard S. [The Children' s Hospital of Philadelphia, Division of Nephrology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States); Darge, Kassa [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States)

2015-03-01

Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

Science.gov (United States)

Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

2007-07-01

Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

KANSL1 gene disruption associated with the full clinical spectrum of 17q21.31 microdeletion syndrome

OpenAIRE

Moreno-Igoa, María; Hernández-Charro, Blanca; Bengoa-Alonso, Amaya; Pérez-Juana-del-Casal, Aranzazu; Romero-Ibarra, Carlos; Nieva-Echebarria, Beatriz; Ramos-Arroyo, María Antonia

2015-01-01

Background Chromosome 17q21.31 microdeletion syndrome is a multisystem genomic disorder caused by a recurrent 600-kb-long deletion, or haploinsufficiency of the chromatin modifier gene KANSL1, which maps to that region. Patients with KANSL1 intragenic mutations have been reported to display the major clinical features of 17q21.31 microdeletion syndrome. However, they did not exhibit the full clinical spectrum of this disorder, which might indicate that an additional gene or genes, located in ...

Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

International Nuclear Information System (INIS)

Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

2004-01-01

To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

Sterol regulatory element binding protein-1 (SREBP1) gene expression is similarly increased in polycystic ovary syndrome and endometrial cancer.

Science.gov (United States)

Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William

2017-05-01

Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory element

The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

Energy Technology Data Exchange (ETDEWEB)

McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

1997-12-15

Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

LENUS (Irish Health Repository)

Thornton, Roibeard F

2010-04-23

Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.

The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

Directory of Open Access Journals (Sweden)

Kagawa Todd F

2010-04-01

Full Text Available Abstract Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota.

Novel variant in the TP63 gene associated to ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome.

Science.gov (United States)

Gonzalez, Francisco; Loidi, Lourdes; Abalo-Lojo, Jose M

2017-01-01

Ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome is a disorder resulting from anomalous embryonic development of ectodermal tissues. There is evidence that AEC syndrome is caused by mutations in the TP63 gene, which encodes the p63 protein. This is an important regulatory protein involved in epidermal proliferation and differentiation. Genome sequencing was performed in DNA from peripheral blood leukocytes of a newborn with AEC syndrome and her parents. Variants were searched in all coding exons and intron-exon boundaries of the TP63 gene. A heterozygous missense variant (NM_003722.4:c.1063G>C (p.Asp355His) was found in the newborn patient. No variants were found in either of the parents. We identified a previously unreported variant in TP63 gene which seems to be involved in the somatic malformations found in the AEC syndrome. The absence of this variant in both parents suggests that the variant appeared de novo.

[Severe type A insulin resistance syndrome due to a mutation in the insulin receptor gene].

Science.gov (United States)

Ros, P; Colino-Alcol, E; Grasso, V; Barbetti, F; Argente, J

2015-01-01

Insulin resistance syndromes without lipodystrophy are an infrequent and heterogeneous group of disorders with variable clinical phenotypes, associated with hyperglycemia and hyperinsulinemia. The three conditions related to mutations in the insulin receptor gene are leprechaunism or Donohue syndrome, Rabson-Mendenhall syndrome, and Type A syndrome. A case is presented on a patient diagnosed with type A insulin resistance, defined by the triad of extreme insulin resistance, acanthosis nigricans, and hyperandrogenism, carrying a heterozygous mutation in exon 19 of the insulin receptor gene coding for its tyrosine kinase domain that is crucial for the catalytic activity of the receptor. The molecular basis of the syndrome is reviewed, focusing on the structure-function relationships of the insulin receptor, knowing that the criteria for survival are linked to residual insulin receptor function. It is also pointed out that, although type A insulin resistance appears to represent a somewhat less severe condition, these patients have a high morbidity and their treatment is still unsatisfactory. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Three cases with L1 syndrome and two novel mutations in the L1CAM gene.

Science.gov (United States)

Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco

2015-11-01

Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

Science.gov (United States)

Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

2017-08-10

To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

NARCIS (Netherlands)

Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

2006-01-01

Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

Roles of the sister chromatid cohesion apparatus in gene expression, development, and human syndromes

Science.gov (United States)

Dorsett, Dale

2006-01-01

The sister chromatid cohesion apparatus mediates physical pairing of duplicated chromosomes. This pairing is essential for appropriate distribution of chromosomes into the daughter cells upon cell division. Recent evidence shows that the cohesion apparatus, which is a significant structural component of chromosomes during interphase, also affects gene expression and development. The Cornelia de Lange (CdLS) and Roberts/SC phocomelia (RBS/SC) genetic syndromes in humans are caused by mutations affecting components of the cohesion apparatus. Studies in Drosophila suggest that effects on gene expression are most likely responsible for developmental alterations in CdLS. Effects on chromatid cohesion are apparent in RBS/SC syndrome, but data from yeast and Drosophila point to the likelihood that changes in expression of genes located in heterochromatin could contribute to the developmental deficits. PMID:16819604

Brugada syndrome with a novel missense mutation in SCN5A gene: A case report from Bangladesh

Directory of Open Access Journals (Sweden)

Md. Zahidus Sayeed

2014-01-01

Full Text Available Brugada syndrome is an inherited cardiac arrhythmia that follows autosomal dominant transmission and can cause sudden death. We report a case of Brugada syndrome in a 55-year-old male patient presented with recurrent palpitation, atypical chest pain and presyncope. ECG changes were consistent with type 1 Brugada. Gene analysis revealed a novel missense mutation in SCN5A gene with a genetic variation of D785N and a nucleotide change at 2353G-A. One of his children also had the same mutation. To our knowledge this is the first genetically proved case of Brugada syndrome in Bangladesh.

Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

Science.gov (United States)

Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

2017-01-01

Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Identification and characterization of a novel serine-threonine kinase gene from the Xp22 region.

Science.gov (United States)

Montini, E; Andolfi, G; Caruso, A; Buchner, G; Walpole, S M; Mariani, M; Consalez, G; Trump, D; Ballabio, A; Franco, B

1998-08-01

Eukaryotic protein kinases are part of a large and expanding family of proteins. Through our transcriptional mapping effort in the Xp22 region, we have isolated and sequenced the full-length transcript of STK9, a novel cDNA highly homologous to serine-threonine kinases. A number of human genetic disorders have been mapped to the region where STK9 has been localized including Nance-Horan (NH) syndrome, oral-facial-digital syndrome type 1 (OFD1), and a novel locus for nonsyndromic sensorineural deafness (DFN6). To evaluate the possible involvement of STK9 in any of the above-mentioned disorders, a 2416-bp full-length cDNA was assembled. The entire genomic structure of the gene, which is composed of 20 coding exons, was determined. Northern analysis revealed a transcript larger than 9.5 kb in several tissues including brain, lung, and kidney. The mouse homologue (Stk9) was identified and mapped in the mouse in the region syntenic to human Xp. This location is compatible with the location of the Xcat mutant, which shows congenital cataracts very similar to those observed in NH patients. Sequence homologies, expression pattern, and mapping information in both human and mouse make STK9 a candidate gene for the above-mentioned disorders. Copyright 1998 Academic Press.

Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

International Nuclear Information System (INIS)

Essouissi, Imen

2006-01-01

Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II.

Science.gov (United States)

Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan

2014-06-01

Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

International Nuclear Information System (INIS)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-01-01

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

Energy Technology Data Exchange (ETDEWEB)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-09-18

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly.

Science.gov (United States)

Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm

2017-10-01

Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.

The gene for the Ellis-van Creveld syndrome is located on chromosome 4p16

Energy Technology Data Exchange (ETDEWEB)

Polymeropoulos, M.H.; Ide, S.E. [National Institute of Health, Bethesda, MD (United States); Wright, M. [Univ. of Newcastle Upon Tyne (United Kingdom)] [and others

1996-07-01

Ellis-van Creveld syndrome (EVC) is an autosomal recessive disorder characterized by disproportionate dwarfism, polydactyly, and congenital heart disease. This rare disorder is found with increased frequency among the Old Order Amish community in Lancaster County, Pennsylvania. We have used linkage analysis to localize the gene responsible for the EVC phenotype in nine interrelated Amish pedigrees and three unrelated families from Mexico, Ecuador, and Brazil. We now report the linkage for the Ellisvan Creveld syndrome gene to markers on the distal short arm of human chromosome 4, with Z{sub max} = 6.91 at {theta} = 0.02 for marker HOX7, in a region proximal to the FGFR3 gene responsible for the achondroplasia phenotype. 17 refs., 2 figs., 1 tab.

New recurrent deletions in the PPARgamma and TP53 genes are associated with childhood myelodysplastic syndrome

DEFF Research Database (Denmark)

Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T

2009-01-01

Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were...

Otitis Media in a New Mouse Model for CHARGE Syndrome with a Deletion in the Chd7 Gene

Science.gov (United States)

Tian, Cong; Yu, Heping; Yang, Bin; Han, Fengchan; Zheng, Ye; Bartels, Cynthia F.; Schelling, Deborah; Arnold, James E.; Scacheri, Peter C.; Zheng, Qing Yin

2012-01-01

Otitis media is a middle ear disease common in children under three years old. Otitis media can occur in normal individuals with no other symptoms or syndromes, but it is often seen in individuals clinically diagnosed with genetic diseases such as CHARGE syndrome, a complex genetic disease caused by mutation in the Chd7 gene and characterized by multiple birth defects. Although otitis media is common in human CHARGE syndrome patients, it has not been reported in mouse models of CHARGE syndrome. In this study, we report a mouse model with a spontaneous deletion mutation in the Chd7 gene and with chronic otitis media of early onset age accompanied by hearing loss. These mice also exhibit morphological alteration in the Eustachian tubes, dysregulation of epithelial proliferation, and decreased density of middle ear cilia. Gene expression profiling revealed up-regulation of Muc5ac, Muc5b and Tgf-β1 transcripts, the products of which are involved in mucin production and TGF pathway regulation. This is the first mouse model of CHARGE syndrome reported to show otitis media with effusion and it will be valuable for studying the etiology of otitis media and other symptoms in CHARGE syndrome. PMID:22539951

Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I).

OpenAIRE

Hoth, C F; Milunsky, A; Lipsky, N; Sheffer, R; Clarren, S K; Baldwin, C T

1993-01-01

Waardenburg syndrome type I (WS-I) is an autosomal dominant disorder characterized by sensorineural hearing loss, dystopia canthorum, pigmentary disturbances, and other developmental defects. Klein-Waardenburg syndrome (WS-III) is a disorder with many of the same characteristics as WS-I and includes musculoskeletal abnormalities. We have recently reported the identification and characterization of one of the first gene defects, in the human PAX3 gene, which causes WS-I. PAX3 is a DNA-binding ...

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

Directory of Open Access Journals (Sweden)

Maryam Taghdiri

2017-08-01

Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

Science.gov (United States)

Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

2017-01-01

Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

Isolation and characterization of CXC receptor genes in a range of elasmobranchs.

Science.gov (United States)

Goostrey, Anna; Jones, Gareth; Secombes, Christopher J

2005-01-01

The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.

Inhibitors of Histone Deacetylases Are Weak Activators of the FMR1 Gene in Fragile X Syndrome Cell Lines

Directory of Open Access Journals (Sweden)

Alexander A. Dolskiy

2017-01-01

Full Text Available Fragile X syndrome is the most common cause of inherited intellectual disability in humans. It is a result of CGG repeat expansion in the 5′ untranslated region (5′ UTR of the FMR1 gene. This gene encodes the FMRP protein that is involved in neuronal development. Repeat expansion leads to heterochromatinization of the promoter, gene silencing, and the subsequent absence of FMRP. To date, there is no specific therapy for the syndrome. All treatments in clinic practice provide symptomatic therapy. The development of drug therapy for Fragile X syndrome treatment is connected with the search for inhibitors of enzymes that are responsible for heterochromatinization. Here, we report a weak transcriptional activity of the FMR1 gene and the absence of FMRP protein after Fragile X syndrome cell lines treatment with two FDA approved inhibitors of histone deacetylases, romidepsin and vorinostat. We demonstrate that romidepsin, an inhibitor of class I histone deacetylases, does not activate FMR1 expression in patient cell cultures, whereas vorinostat, an inhibitor of classes I and II histone deacetylases, activates a low level of FMR1 expression in some patient cell lines.

Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome.

Science.gov (United States)

Essawi, Mona L; Ismail, Manal F; Afifi, Hanan H; Kobesiy, Maha M; El Kotoury, Ahmed; Barakat, Maged M

2013-11-01

Noonan syndrome (NS) is inherited as an autosomal dominant disorder with dysmorphic facies, short stature, and cardiac defects, which can be caused by missense mutations in the protein tyrosine phosphatase nonreceptor type 11 (PTPN11) gene, which encodes src homology region 2 domain containing tyrosine phosphatase-2 (SHP-2), a protein tyrosine phosphatase that acts in signal transduction downstream to growth factors and cytokines. The current study aimed to study the molecular characterization of the PTPN11 gene among Egyptian patients with Noonan syndrome. Eleven exons of the PTPN11 gene were amplified and screened by single stranded conformational polymorphism (SSCP). DNA samples showing band shift in SSCP were subjected to sequencing. Mutational analysis of the PTPN11 gene revealed T→C transition at position 854 in exon 8, predicting Phe285Ser substitution within PTP domain of SHP-2 protein, in one NS patient and -21C→T polymorphism in intron 7 in four other cases. Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS. Copyright © 2012. Published by Elsevier B.V.

The actin homologue MreB organizes the bacterial cell membrane

NARCIS (Netherlands)

Strahl, H.; Burmann, F.; Hamoen, L.W.

2014-01-01

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

Clinical aspects of Usher syndrome and the USH2A gene in a cohort of 433 patients.

Science.gov (United States)

Blanco-Kelly, Fiona; Jaijo, Teresa; Aller, Elena; Avila-Fernandez, Almudena; López-Molina, María Isabel; Giménez, Ascensión; García-Sandoval, Blanca; Millán, José M; Ayuso, Carmen

2015-02-01

A new statistical approach is needed to describe the clinical differences between type I and type II Usher syndrome and between the 2 most frequent mutations in the USH2A gene. To describe the primary phenotypic characteristics and differences between type I and type II Usher syndrome and to establish a phenotype-genotype correlation for the 2 most frequent mutations in the USH2A gene. Cross-sectional study at a genetics department, in which clinical evaluations were performed for 433 patients (297 unrelated families) who were classified as having type I, II, III, atypical, or unclassified Usher syndrome according to their clinical history, pedigree data, results from ophthalmological studies, and audiological, neurophysiological, and vestibular test results. Molecular studies were performed for 304 patients (256 unrelated families). The Mann-Whitney U test or the χ2 test was used for calculating the differences between mean values for the analyzed parameters. Age at diagnosis; age at onset of night blindness, visual field loss, visual acuity loss, and cataracts; and severity and age at diagnosis of hearing loss. The comparison between patients with type I Usher syndrome and those with type II Usher syndrome revealed P Usher syndrome and between the 2 most frequent mutations in the USH2A gene. Detailed genotype-phenotype correlations, as presented in our study, allow for a better correlation of clinical signs with a known genotype and can improve the clinical management, genetic counseling, and risk assessment of patients with Usher syndrome because an estimated prognosis of their disease can be made.

Blood Gene Expression Predicts Bronchiolitis Obliterans Syndrome

Directory of Open Access Journals (Sweden)

Richard Danger

2018-01-01

Full Text Available Bronchiolitis obliterans syndrome (BOS, the main manifestation of chronic lung allograft dysfunction, leads to poor long-term survival after lung transplantation. Identifying predictors of BOS is essential to prevent the progression of dysfunction before irreversible damage occurs. By using a large set of 107 samples from lung recipients, we performed microarray gene expression profiling of whole blood to identify early biomarkers of BOS, including samples from 49 patients with stable function for at least 3 years, 32 samples collected at least 6 months before BOS diagnosis (prediction group, and 26 samples at or after BOS diagnosis (diagnosis group. An independent set from 25 lung recipients was used for validation by quantitative PCR (13 stables, 11 in the prediction group, and 8 in the diagnosis group. We identified 50 transcripts differentially expressed between stable and BOS recipients. Three genes, namely POU class 2 associating factor 1 (POU2AF1, T-cell leukemia/lymphoma protein 1A (TCL1A, and B cell lymphocyte kinase, were validated as predictive biomarkers of BOS more than 6 months before diagnosis, with areas under the curve of 0.83, 0.77, and 0.78 respectively. These genes allow stratification based on BOS risk (log-rank test p < 0.01 and are not associated with time posttransplantation. This is the first published large-scale gene expression analysis of blood after lung transplantation. The three-gene blood signature could provide clinicians with new tools to improve follow-up and adapt treatment of patients likely to develop BOS.

A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

Directory of Open Access Journals (Sweden)

Hewitt Jane E

2010-11-01

Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness.

Science.gov (United States)

Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak

2016-02-01

Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

Science.gov (United States)

Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

2002-12-01

The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

POLYMORPHISMS OF ENDOTHELIAL NITRIC OXIDE SYNTHASE GENE AS PREDICTORS OF WOLFF-PARKINSON-WHITE SYNDROME

Directory of Open Access Journals (Sweden)

G. V. Matyushin

2017-01-01

Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

Science.gov (United States)

Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

2014-03-15

Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

Ghrelin Gene Variants Influence on Metabolic Syndrome Components in Aged Spanish Population

OpenAIRE

Mora, Mireia; Adam, Victoria; Palomera, Elisabet; Blesa, Sebastian; Díaz, Gonzalo; Buquet, Xavier; Serra-Prat, Mateu; Martín-Escudero, Juan Carlos; Palanca, Ana; Chaves, Javier Felipe; Puig-Domingo, Manuel

2015-01-01

BACKGROUND: The role of genetic variations within the ghrelin gene on cardiometabolic profile and nutritional status is still not clear in humans, particularly in elderly people. OBJECTIVES: We investigated six SNPs of the ghrelin gene and their relationship with metabolic syndrome (MS) components. SUBJECTS AND METHODS: 824 subjects (413 men/411 women, age 77.31±5.04) participating in the Mataró aging study (n = 310) and the Hortega study (n = 514) were analyzed. Anthropometric variables, ghr...

Syndromes and Disorders Associated with Omphalocele (III: Single Gene Disorders, Neural Tube Defects, Diaphragmatic Defects and Others

Directory of Open Access Journals (Sweden)

Chih-Ping Chen

2007-06-01

Full Text Available Omphalocele can be associated with single gene disorders, neural tube defects, diaphragmatic defects, fetal valproate syndrome, and syndromes of unknown etiology. This article provides a comprehensive review of omphalocele-related disorders: otopalatodigital syndrome type II; Melnick–Needles syndrome; Rieger syndrome; neural tube defects; Meckel syndrome; Shprintzen–Goldberg omphalocele syndrome; lethal omphalocele-cleft palate syndrome; cerebro-costo-mandibular syndrome; fetal valproate syndrome; Marshall–Smith syndrome; fibrochondrogenesis; hydrolethalus syndrome; Fryns syndrome; omphalocele, diaphragmatic defects, radial anomalies and various internal malformations; diaphragmatic defects, limb deficiencies and ossification defects of skull; Donnai–Barrow syndrome; CHARGE syndrome; Goltz syndrome; Carpenter syndrome; Toriello–Carey syndrome; familial omphalocele; Cornelia de Lange syndrome; C syndrome; Elejalde syndrome; Malpuech syndrome; cervical ribs, Sprengel anomaly, anal atresia and urethral obstruction; hydrocephalus with associated malformations; Kennerknecht syndrome; lymphedema, atrial septal defect and facial changes; and craniosynostosis- mental retardation syndrome of Lin and Gettig. Perinatal identification of omphalocele should alert one to the possibility of omphalocele-related disorders and familial inheritance and prompt a thorough genetic counseling for these disorders.

Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

2012-01-01

PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

Potential hot spot for de novo mutations in PTCH1 gene in Gorlin syndrome patients: a case report of twins from Croatia.

Science.gov (United States)

Musani, Vesna; Ozretić, Petar; Trnski, Diana; Sabol, Maja; Poduje, Sanja; Tošić, Mateja; Šitum, Mirna; Levanat, Sonja

2018-02-28

We describe a case of twins with sporadic Gorlin syndrome. Both twins had common Gorlin syndrome features including calcification of the falx cerebri, multiple jaw keratocysts, and multiple basal cell carcinomas, but with different expressivity. One brother also had benign testicular mesothelioma. We propose this tumor type as a possible new feature of Gorlin syndrome. Gorlin syndrome is a rare autosomal dominant disorder characterized by both developmental abnormalities and cancer predisposition, with variable expression of various developmental abnormalities and different types of tumors. The syndrome is primarily caused by mutations in the Patched 1 (PTCH1) gene, although rare mutations of Patched 2 (PTCH2) or Suppressor of Fused (SUFU) genes have also been found. Neither founder mutations nor hot spot locations have been described for PTCH1 in Gorlin syndrome patients. Although de novo mutations of the PTCH1 gene occur in almost 50% of Gorlin syndrome cases, there are a few recurrent mutations. Our twin patients were carriers of a de novo mutation in the PTCH1 gene, c.3364_3365delAT (p.Met1122ValfsX22). This is, to our knowledge, the first Gorlin syndrome-causing mutation that has been reported four independent times in distant geographical locations. Therefore, we propose the location of the described mutation as a potential hot spot for mutations in PTCH1.

Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy

Science.gov (United States)

Williams, David S.

2009-01-01

Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects, retinal phenotypes are relatively mild and have been difficult to characterize. The retinal functions of the Usher proteins are still largely unknown. Protein binding studies have suggested many interactions among the proteins, and a model of interaction among all the proteins in the photoreceptor synapse has been proposed. However this model is not supported by localization data from some laboratories, or the indication of any synaptic phenotype in mutant mice. An earlier suggestion, based on patient pathologies, of Usher protein function in the photoreceptor cilium continues to gain support from immunolocalization and mutant mouse studies, which are consistent with Usher protein interaction in the photoreceptor ciliary/periciliary region. So far, the most characterized Usher protein is myosin VIIa. It is present in the apical RPE and photoreceptor ciliary/periciliary region, where it is required for organelle transport and clearance of opsin from the connecting cilium, respectively. Usher syndrome is amenable to gene replacement therapy, but also has some specific challenges. Progress in this treatment approach has been achieved by correction of mutant phenotypes in Myo7a-null mouse retinas, following lentiviral delivery of MYO7A. PMID:17936325

Nephrogenic diabetes insipidus in a patient with L1 syndrome: a new report of a contiguous gene deletion syndrome including L1CAM and AVPR2.

Science.gov (United States)

Knops, Noël B B; Bos, Krista K; Kerstjens, Mieke; van Dael, Karin; Vos, Yvonne J

2008-07-15

We report on an infant boy with congenital hydrocephalus due to L1 syndrome and polyuria due to diabetes insipidus. We initially believed his excessive urine loss was from central diabetes insipidus and that the cerebral malformation caused a secondary insufficient pituitary vasopressin release. However, he failed to respond to treatment with a vasopressin analogue, which pointed to nephrogenic diabetes insipidus (NDI). L1 syndrome and X-linked NDI are distinct clinical disorders caused by mutations in the L1CAM and AVPR2 genes, respectively, located in adjacent positions in Xq28. In this boy we found a deletion of 61,577 basepairs encompassing the entire L1CAM and AVPR2 genes and extending into intron 7 of the ARHGAP4 gene. To our knowledge this is the first description of a patient with a deletion of these three genes. He is the second patient to be described with L1 syndrome and NDI. During follow-up he manifested complications from the hydrocephalus and NDI including global developmental delay and growth failure with low IGF-1 and hypothyroidism. 2008 Wiley-Liss, Inc.

The urokinase receptor and its structural homologue C4.4A in human cancer

DEFF Research Database (Denmark)

Jacobsen, B; Ploug, M

2008-01-01

The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

Science.gov (United States)

Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

2015-08-01

To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

Marfan syndrome masked by Down syndrome?

NARCIS (Netherlands)

Vis, J.C.; Engelen, K. van; Timmermans, J.; Hamel, B.C.J.; Mulder, B.J.

2009-01-01

Down syndrome is the most common chromosomal abnormality. A simultaneous occurrence with Marfan syndrome is extremely rare. We present a case of a 28-year-old female with Down syndrome and a mutation in the fibrillin-1 gene. The patient showed strikingly few manifestations of Marfan syndrome.

The ZNF75 zinc finger gene subfamily: Isolation and mapping of the four members in humans and great apes

Energy Technology Data Exchange (ETDEWEB)

Villa, A.; Strina, D.; Frattini, A. [Consiglio Nazionale delle Ricerche, Milan (Italy)] [and others

1996-07-15

We have previously reported the characterization of the human ZNF75 gene located on Xq26, which has only limited homology (less than 65%) to other ZF genes in the databases. Here, we describe three human zinc finger genes with 86 to 95% homology to ZNF75 at the nucleotide level, which represent all the members of the human ZNF75 subfamily. One of these, ZNF75B, is a pseudogene mapped to chromosome 12q13. The other two, ZNF75A and ZNF75C, maintain on ORF in the sequenced region, and at least the latter is expressed in the U937 cell line. They were mapped to chromosomes 16 and 11, respectively. All these genes are conserved in chimpanzees, gorillas, and orangutans. The ZNF75B homologue is a pseudogene in all three great apes, and in chimpanzee it is located on chromosome 10 (phylogenetic XII), at p13 (corresponding to the human 12q13). The chimpanzee homologue of ZNF75 is also located on the Xq26 chromosome, in the same region, as detected by in situ hybridization. As expected, nucleotide changes were clearly more abundant between human and organutan than between human and chimpanzee or gorilla homologues. Members of the same class were more similar to each other than to the other homologues within the same species. This suggests that the duplication and/or retrotranscription events occurred in a common ancestor long before great ape speciation. This, together with the existance of at least two genes in cows and horses, suggests a relatively high conservation of this gene family. 20 refs., 5 figs., 1 tab.

Cholesterol Transporters ABCA1 and ABCG1 Gene Expression in Peripheral Blood Mononuclear Cells in Patients with Metabolic Syndrome

Directory of Open Access Journals (Sweden)

Zahra Tavoosi

2015-01-01

Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.

UMD-USHbases: a comprehensive set of databases to record and analyse pathogenic mutations and unclassified variants in seven Usher syndrome causing genes.

Science.gov (United States)

Baux, David; Faugère, Valérie; Larrieu, Lise; Le Guédard-Méreuze, Sandie; Hamroun, Dalil; Béroud, Christophe; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

2008-08-01

Using the Universal Mutation Database (UMD) software, we have constructed "UMD-USHbases", a set of relational databases of nucleotide variations for seven genes involved in Usher syndrome (MYO7A, CDH23, PCDH15, USH1C, USH1G, USH3A and USH2A). Mutations in the Usher syndrome type I causing genes are also recorded in non-syndromic hearing loss cases and mutations in USH2A in non-syndromic retinitis pigmentosa. Usher syndrome provides a particular challenge for molecular diagnostics because of the clinical and molecular heterogeneity. As many mutations are missense changes, and all the genes also contain apparently non-pathogenic polymorphisms, well-curated databases are crucial for accurate interpretation of pathogenicity. Tools are provided to assess the pathogenicity of mutations, including conservation of amino acids and analysis of splice-sites. Reference amino acid alignments are provided. Apparently non-pathogenic variants in patients with Usher syndrome, at both the nucleotide and amino acid level, are included. The UMD-USHbases currently contain more than 2,830 entries including disease causing mutations, unclassified variants or non-pathogenic polymorphisms identified in over 938 patients. In addition to data collected from 89 publications, 15 novel mutations identified in our laboratory are recorded in MYO7A (6), CDH23 (8), or PCDH15 (1) genes. Information is given on the relative involvement of the seven genes, the number and distribution of variants in each gene. UMD-USHbases give access to a software package that provides specific routines and optimized multicriteria research and sorting tools. These databases should assist clinicians and geneticists seeking information about mutations responsible for Usher syndrome.

Mutation spectrum of genes associated with steroid-resistant nephrotic syndrome in Chinese children.

Science.gov (United States)

Wang, Ying; Dang, Xiqiang; He, Qingnan; Zhen, Yan; He, Xiaoxie; Yi, Zhuwen; Zhu, Kuichun

2017-08-20

Approximately 20% of children with idiopathic nephrotic syndrome do not respond to steroid therapy. More than 30 genes have been identified as disease-causing genes for the steroid-resistant nephrotic syndrome (SRNS). Few reports were from the Chinese population. The coding regions of genes commonly associated with SRNS were analyzed to characterize the gene mutation spectrum in children with SRNS in central China. The first phase study involved 38 children with five genes (NPHS1, NPHS2, PLCE1, WT1, and TRPC6) by Sanger sequencing. The second phase study involved 33 children with 17 genes by next generation DNA sequencing (NGS. 22 new patients, and 11 patients from first phase study but without positive findings). Overall deleterious or putatively deleterious gene variants were identified in 19 patients (31.7%), including four NPHS1 variants among five patients and three PLCE1 variants among four other patients. Variants in COL4A3, COL4A4, or COL4A5 were found in six patients. Eight novel variants were identified, including two in NPHS1, two in PLCE1, one in NPHS2, LAMB2, COL4A3, and COL4A4, respectively. 55.6% of the children with variants failed to respond to immunosuppressive agent therapy, while the resistance rate in children without variants was 44.4%. Our results show that screening for deleterious variants in some common genes in children clinically suspected with SRNS might be helpful for disease diagnosis as well as prediction of treatment efficacy and prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

DEFF Research Database (Denmark)

Koch, Birgit; Nybroe, Ole

2006-01-01

A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.

Science.gov (United States)

Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah

2016-05-01

Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.

Gitelman or Bartter type 3 syndrome? A case of distal convoluted tubulopathy caused by CLCNKB gene mutation.

Science.gov (United States)

Cruz, António José; Castro, Alexandra

2013-01-22

A 32-year-old woman with no significant medical history was sent to our consultation due to hypokalaemia (syndrome (GS) came negative. CLCNKB gene mutation analysis present in both GS and Bartter (BS) type 3 syndromes was positive. The patient is now being treated with potassium and magnesium oral supplements, ramipril and spironolactone with stable near-normal potassium and magnesium levels. This article presents the case of a patient with hypokalaemia caused by CLCNKB gene mutation hard to categorise as GS or BS type 3.

CAGE-defined promoter regions of the genes implicated in Rett Syndrome

DEFF Research Database (Denmark)

Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

2014-01-01

BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I

Science.gov (United States)

Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.

2008-01-01

Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

Cognitive-behavioral phenotypes of Williams syndrome are associated with genetic variation in the GTF2I gene, in a healthy population.

Science.gov (United States)

Crespi, Bernard J; Hurd, Peter L

2014-11-28

Individuals with Williams syndrome, a neurogenetic condition caused by deletion of a set of genes at chromosomal location 7q11.23, exhibit a remarkable suite of traits including hypersociality with high, nonselective friendliness and low social anxiety, expressive language relatively well-developed but under-developed social-communication skills overall, and reduced visual-spatial abilities. Deletions and duplications of the Williams-syndrome region have also been associated with autism, and with schizophrenia, two disorders centrally involving social cognition. Several lines of evidence have linked the gene GTF2I (General Transcription Factor IIi) with the social phenotypes of Williams syndrome, but a role for this gene in sociality within healthy populations has yet to be investigated. We genotyped a large set of healthy individuals for two single-nucleotide polymorphisms in the GTF2I gene that have recently been significantly associated with autism, and thus apparently exhibit functional effects on autism-related social phenotypes. GTF2I genotypes for these SNPs showed highly significant association with low social anxiety combined with reduced social-communication abilities, which represents a metric of the Williams-syndrome cognitive profile as described from previous studies. These findings implicate the GTF2I gene in the neurogenetic basis of social communication and social anxiety, both in Williams syndrome and among individuals in healthy populations.

[Association analysis of SNP-63 and indel-19 variant in the calpain-10 gene with polycystic ovary syndrome in women of reproductive age].

Science.gov (United States)

Flores-Martínez, Silvia Esperanza; Castro-Martínez, Anna Gabriela; López-Quintero, Andrés; García-Zapién, Alejandra Guadalupe; Torres-Rodríguez, Ruth Noemí; Sánchez-Corona, José

2015-01-01

Polycystic ovary syndrome is a complex and heterogeneous disease involving both reproductive and metabolic problems. It has been suggested a genetic predisposition in the etiology of this syndrome. The identification of calpain-10 gene (CAPN10) as the first candidate gene for type 2 diabetes mellitus, has focused the interest in investigating their possible relation with the polycystic ovary syndrome, because this syndrome is associated with hyperinsulinemia and insulin resistance, two metabolic abnormalities associated with type 2 diabetes mellitus. To investigate if there is association between the SNP-63 and the variant indel-19 of the CAPN10 gene and polycystic ovary syndrome in women of reproductive age. This study included 101 women (55 with polycystic ovary syndrome and 46 without polycystic ovary syndrome). The genetic variant indel-19 was identified by electrophoresis of the amplified fragments by PCR, and the SNP-63 by PCR-RFLP. The allele and genotype frequencies of the two variants do not differ significatly between women with polycystic ovary syndrome and control women group. The haplotype 21 (defined by the insertion allele of indel-19 variant and C allele of SNP-63) was found with higher frequency in both study groups, being more frequent in the polycystic ovary syndrome patients group, however, this difference was not statistically significant (p = 0.8353). The results suggest that SNP-63 and indel-19 variant of the CAPN10 gene do not represent a risk factor for polycystic ovary syndrome in our patients group. Copyright © 2015. Published by Masson Doyma México S.A.

Severe visual impairment and retinal changes in a boy with a deletion of the gene for Nance-Horan syndrome.

Science.gov (United States)

Mathys, R; Deconinck, H; Keymolen, K; Jansen, A; Van Esch, H

2007-01-01

We present the ophthalmologic findings in a boy with a deletion of Xp22 comprising the gene for Nance-Horan syndrome. Different mechanisms underlying the visual impairment in Nance-Horan syndrome are discussed.

Mutation screening of USH3 gene (clarin-1) in Spanish patients with Usher syndrome: low prevalence and phenotypic variability.

Science.gov (United States)

Aller, E; Jaijo, T; Oltra, S; Alió, J; Galán, F; Nájera, C; Beneyto, M; Millán, J M

2004-12-01

Usher syndrome type III is an autosomal recessive disorder clinically characterized by the association of retinitis pigmentosa (RP), variable presence of vestibular dysfunction and progressive hearing loss, being the progression of the hearing impairment the critical parameter classically used to distinguish this form from Usher syndrome type I and Usher syndrome type II. Usher syndrome type III clinical subtype is the rarest form of Usher syndrome in Spain, accounting only for 6% of all Usher syndrome Spanish cases. The gene responsible for Usher syndrome type III is named clarin-1 and it is thought to be involved in hair cell and photoreceptor cell synapses. Here, we report a screening for mutations in clarin-1 gene among our series of Usher syndrome Spanish patients. Clarin-1 has been found to be responsible for the disease in only two families: the first one is a previously reported family homozygous for Y63X mutation and the second one, described here, is homozygous for C40G. This accounts for 1.7% of Usher syndrome Spanish families. It is noticeable that, whereas C40G family is clinically compatible with Usher syndrome type III due to the progression of the hearing loss, Y63X family could be diagnosed as Usher syndrome type I because the hearing impairment is profound and stable. Thus, we consider that the progression of hearing loss is not the definitive key parameter to distinguish Usher syndrome type III from Usher syndrome type I and Usher syndrome type II.

A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

Science.gov (United States)

Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

2017-01-01

Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Connected Gene Communities Underlie Transcriptional Changes in Cornelia de Lange Syndrome.

Science.gov (United States)

Boudaoud, Imène; Fournier, Éric; Baguette, Audrey; Vallée, Maxime; Lamaze, Fabien C; Droit, Arnaud; Bilodeau, Steve

2017-09-01

Cornelia de Lange syndrome (CdLS) is a complex multisystem developmental disorder caused by mutations in cohesin subunits and regulators. While its precise molecular mechanisms are not well defined, they point toward a global deregulation of the transcriptional gene expression program. Cohesin is associated with the boundaries of chromosome domains and with enhancer and promoter regions connecting the three-dimensional genome organization with transcriptional regulation. Here, we show that connected gene communities, structures emerging from the interactions of noncoding regulatory elements and genes in the three-dimensional chromosomal space, provide a molecular explanation for the pathoetiology of CdLS associated with mutations in the cohesin-loading factor NIPBL and the cohesin subunit SMC1A NIPBL and cohesin are important constituents of connected gene communities that are centrally positioned at noncoding regulatory elements. Accordingly, genes deregulated in CdLS are positioned within reach of NIPBL- and cohesin-occupied regions through promoter-promoter interactions. Our findings suggest a dynamic model where NIPBL loads cohesin to connect genes in communities, offering an explanation for the gene expression deregulation in the CdLS. Copyright © 2017 by the Genetics Society of America.

Catecholamine-related gene expression in blood correlates with tic severity in tourette syndrome

NARCIS (Netherlands)

Gunther, Joan; Tian, Yingfang; Stamova, Boryana; Lit, Lisa; Corbett, Blythe; Ander, Brad; Zhan, Xinhua; Jickling, Glen; Bos-Veneman, Netty; Liu, Da; Hoekstra, Pieter; Sharp, Frank

2012-01-01

Tourette syndrome (TS) is a heritable disorder characterized by tics that are decreased in some patients by treatment with alpha adrenergic agonists and dopamine receptor blockers. Thus, this study examines the relationship between catecholamine gene expression in blood and tic severity. TS

Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family.

Science.gov (United States)

Ying, Yan-Qin; Wei, Hong; Cao, Li-Zhi; Lu, Juan-Juan; Luo, Xiao-Ping

2007-08-01

Laron syndrome is an autosomal recessive disorder caused by defects of growth hormone receptor (GHR) gene. It is characterized by severe postnatal growth retardation and characteristic facial features as well as high circulating levels of growth hormone (GH) and low levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3). This report described the clinical features and GHR gene mutations in 2 siblings with Laron syndrome in a Chinese family. Their heights and weights were in the normal range at birth, but the growth was retarded after birth. When they presented to the clinic, the heights of the boy (8 years old) and his sister (11 years old) were 80.0 cm (-8.2 SDS) and 96.6 cm (-6.8 SDS) respectively. They had typical appearance features of Laron syndrome such as short stature and obesity, with protruding forehead, saddle nose, large eyes, sparse and thin silky hair and high-pitched voice. They had higher basal serum GH levels and lower serum levels of IGF-I, IGFBP-3 and growth hormone binding protein (GHBP) than normal controls. The peak serum GH level after colonidine and insulin stimulations in the boy was over 350 ng/mL. After one-year rhGH treatment, the boy's height increased from 80.0 cm to 83.3 cm. The gene mutation analysis revealed that two patients had same homozygous mutation of S65H (TCA -->CCA) in exon 4, which is a novel gene mutation. It was concluded that a definite diagnosis of Laron syndrome can be made based on characteristic appearance features and serum levels of GH, IGF-I, IGFBP-3 and GHBP. The S65H mutation might be the cause of Laron syndrome in the two patients.

Evidence for the intense exchange of MazG in marine cyanophages by horizontal gene transfer.

Directory of Open Access Journals (Sweden)

Michael J Bryan

Full Text Available BACKGROUND: S-PM2 is a phage capable of infecting strains of unicellular cyanobacteria belonging to the genus Synechococcus. S-PM2, like other myoviruses infecting marine cyanobacteria, encodes a number of bacterial-like genes. Amongst these genes is one encoding a MazG homologue that is hypothesized to be involved in the adaption of the infected host for production of progeny phage. METHODOLOGY/PRINCIPAL FINDINGS: This study focuses on establishing the occurrence of mazG homologues in other cyanophages isolated from different oceanic locations. Degenerate PCR primers were designed using the mazG gene of S-PM2. The mazG gene was found to be widely distributed and highly conserved among Synechococcus myoviruses and podoviruses from diverse oceanic provinces. CONCLUSIONS/SIGNIFICANCE: This study provides evidence of a globally connected cyanophage gene pool, the cyanophage mazG gene having a small effective population size indicative of rapid lateral gene transfer despite being present in a substantial fraction of cyanophage. The Prochlorococcus and Synechococcus phage mazG genes do not cluster with the host mazG gene, suggesting that their primary hosts are not the source of the mazG gene.

Wolfram syndrome 1 gene negatively regulates ER stress signaling in rodent and human cells.

Science.gov (United States)

Fonseca, Sonya G; Ishigaki, Shinsuke; Oslowski, Christine M; Lu, Simin; Lipson, Kathryn L; Ghosh, Rajarshi; Hayashi, Emiko; Ishihara, Hisamitsu; Oka, Yoshitomo; Permutt, M Alan; Urano, Fumihiko

2010-03-01

Wolfram syndrome is an autosomal-recessive disorder characterized by insulin-dependent diabetes mellitus, caused by nonautoimmune loss of beta cells, and neurological dysfunctions. We have previously shown that mutations in the Wolfram syndrome 1 (WFS1) gene cause Wolfram syndrome and that WFS1 has a protective function against ER stress. However, it remained to be determined how WFS1 mitigates ER stress. Here we have shown in rodent and human cell lines that WFS1 negatively regulates a key transcription factor involved in ER stress signaling, activating transcription factor 6alpha (ATF6alpha), through the ubiquitin-proteasome pathway. WFS1 suppressed expression of ATF6alpha target genes and repressed ATF6alpha-mediated activation of the ER stress response element (ERSE) promoter. Moreover, WFS1 stabilized the E3 ubiquitin ligase HRD1, brought ATF6alpha to the proteasome, and enhanced its ubiquitination and proteasome-mediated degradation, leading to suppression of ER stress signaling. Consistent with these data, beta cells from WFS1-deficient mice and lymphocytes from patients with Wolfram syndrome exhibited dysregulated ER stress signaling through upregulation of ATF6alpha and downregulation of HRD1. These results reveal a role for WFS1 in the negative regulation of ER stress signaling and in the pathogenesis of diseases involving chronic, unresolvable ER stress, such as pancreatic beta cell death in diabetes.

Fanconi syndrome

Science.gov (United States)

De Toni-Fanconi syndrome ... Fanconi syndrome can be caused by faulty genes, or it may result later in life due to kidney damage. Sometimes the cause of Fanconi syndrome is unknown. Common causes of Fanconi syndrome in ...

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Science.gov (United States)

Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

2015-01-01

"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

Association Study between Ghrelin Gene Polymorphism and Metabolic Syndrome in a Han Chinese Population.

Science.gov (United States)

You, Yueyue; Yu, Yaqin; Wu, Yanhua; Rao, Wenwang; Zhang, Yangyu; Liu, Yingyu; Yang, Guang; Fu, Yingli; Shi, Jieping; Kou, Changgui

2017-01-01

Ghrelin, in humans, is a hormone secreted from the stomach with an orexigenic effect, which is good for digestion and absorption, as well as regulating physical growth, metabolism, and energy balance. It is also involved in the development of metabolic syndrome (MetS) and type 2 diabetes mellitus (T2DM). This study assessed the association between single nucleotide variants of the GHRL gene and the risk of metabolic syndrome in a Han Chinese population. A case-control study was performed on 3780 Han Chinese comprising 1813 MetS cases and 1967 controls. Three missense polymorphisms in GHRL (rs26802, rs10490816, and rs696217) were selected, and the association between these polymorphisms and the risk of MetS was investigated. Metabolic syndrome was defined according to the criteria of the International Diabetes Federation (IDF). Using Pearson's 2 test, we found that there were no significant differences in genotype distributions and allele frequencies between cases and controls (all p > 0.05). There were also no significant differences in haplotype distributions between MetS cases and healthy controls. Furthermore, we confirmed that rs26802 of the GHRL gene is associated with body mass index (BMI), waist circumference, systolic blood pressure (SBP), and fasting glucose; rs10490816 is associated with triglycerides (TG) and total cholesterol (TC); while rs696217 is associated with hip circumference and fasting glucose. We concluded that mutations in the GHRL gene did not confer risk for MetS in our study population. Therefore, functional analysis and replication studies in other populations are needed to further investigate the exact role of the GHRL gene in MetS.

Association between Two Resistin Gene Polymorphisms and Metabolic Syndrome in Jilin, Northeast China: A Case-Control Study

Directory of Open Access Journals (Sweden)

Yingli Fu

2017-01-01

Full Text Available Metabolic syndrome (MetS is a significant health care problem worldwide and is characterized by increased fasting glucose and obesity. Resistin is a protein hormone produced both by adipocytes and immunocompetent cells, including those residing in adipose tissue, and is believed to modulate glucose tolerance and insulin action. This study examined the association of resistin gene polymorphisms, rs1862513 and rs3745368, and related haplotypes with the development of metabolic syndrome in a Han Chinese population. This case-control study was performed on 3792 subjects, including 1771 MetS cases and 2021 healthy controls from the Jilin province of China. Metabolic syndrome was defined according to the criteria of the International Diabetes Federation (IDF. Logistic regression analysis was used to estimate the relationship between gene polymorphism and MetS. Our results showed that there were no significant associations between MetS and the genotype distributions in four kinds of inheritance models, allele frequencies, and related haplotypes of resistin gene polymorphisms rs1862513 and rs3745368 (all p values > 0.05. Based on our study findings, we concluded that mutations in resistin genes are not associated with the presence of MetS in a Han Chinese population from Jilin province in China.

Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

DEFF Research Database (Denmark)

Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

2011-01-01

The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

Directory of Open Access Journals (Sweden)

Chia-Sui Hung

2007-01-01

Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse)

OpenAIRE

Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.

1997-01-01

Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/...

Gene variants of unknown clinical significance in Lynch syndrome. An introduction for clinicians

NARCIS (Netherlands)

Sijmons, Rolf H.; Greenblatt, Marc S.; Genuardi, Maurizio

Clinicians referring patients for genetic testing for Lynch syndrome will sooner or later receive results for DNA Mismatch Repair (MMR) genes reporting DNA changes that are unclear from a clinical point of view. These changes are referred to as variants of unknown, or unclear, clinical significance

Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

Directory of Open Access Journals (Sweden)

Jose Miguel Moreno-Ortiz

2016-01-01

Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

Risk stratification in myelodysplastic syndromes: is there a role for gene expression profiling?

Science.gov (United States)

Zeidan, Amer M; Prebet, Thomas; Saad Aldin, Ehab; Gore, Steven David

2014-04-01

Evaluation of: Pellagatti A, Benner A, Mills KI et al. Identification of gene expression-based prognostic markers in the hematopoietic stem cells of patients with myelodysplastic syndromes. J. Clin. Oncol. 31(28), 3557-3564 (2013). Patients with myelodysplastic syndromes (MDS) exhibit wide heterogeneity in clinical outcomes making accurate risk-stratification an integral part of the risk-adaptive management paradigm. Current prognostic schemes for MDS rely on clinicopathological parameters. Despite the increasing knowledge of the genetic landscape of MDS and the prognostic impact of many newly discovered molecular aberrations, none to date has been incorporated formally into the major risk models. Efforts are ongoing to use data generated from genome-wide high-throughput techniques to improve the 'individualized' outcome prediction for patients. We here discuss an important paper in which gene expression profiling (GEP) technology was applied to marrow CD34(+) cells from 125 MDS patients to generate and validate a standardized GEP-based prognostic signature.

Triple-A syndrome with prominent ophthalmic features and a novel mutation in the AAAS gene: a case report

Directory of Open Access Journals (Sweden)

Stuart Caroline

2004-06-01

Full Text Available Abstract Background Triple-A syndrome (Allgrove syndrome is an autosomal recessive disorder characterized by adrenal insufficiency, alacrima, achalasia, and – occasionally – autonomic instability. Mutations have been found in the AAAS gene on 12q13. Case presentation We present the case of a 12 year-old boy with classic systemic features of triple-A syndrome and several prominent ophthalmic features, including: accommodative spasm, dry eye, superficial punctate keratopathy, and pupillary hypersensitivity to dilute pilocarpine. MRI showed small lacrimal glands bilaterally. DNA sequencing of PCR-amplified fragments from the 16 exons of the AAAS gene revealed compound heterozygosity for a new, out-of-frame 5-bp deletion in exon 15, c1368-1372delGCTCA, and a previously-described nonsense mutation in exon 9, c938C>T, R286X. Conclusions In addition to known ophthalmic manifestations, triple-A syndrome can present with accommodative dysregulation and ocular signs of autonomic dysfunction.

In silico analysis of cacao (Theobroma cacao L.) genes that involved in pathogen and disease responses

Science.gov (United States)

Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah

2017-02-01

Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.

Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

International Nuclear Information System (INIS)

Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

2012-01-01

A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

Energy Technology Data Exchange (ETDEWEB)

Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

2012-08-31

A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

A Case of Brown-Vialetto-Van Laere Syndrome Due To a Novel Mutation in Gene

Directory of Open Access Journals (Sweden)

Venkatraman Thulasi BA

2017-08-01

Full Text Available Brown-Vialetto-Van Laere syndrome is a rare disorder characterized by motor, sensory, and cranial neuronopathies, associated with mutations in SLC52A2 and SLC52A3 genes that code for human riboflavin transporters RFVT2 and RFVT3, respectively. The authors describe the clinical course of a 6-year-old girl with Brown-Vialetto-Van Laere syndrome and a novel homozygous mutation c.1156T>C in the SLC52A3 gene, who presented at the age of 2.5 years with progressive brain stem dysfunction including ptosis, facial weakness, hearing loss, dysphagia, anarthria with bilateral vocal cord paralysis, and ataxic gait. She subsequently developed respiratory failure requiring tracheostomy and worsening dysphagia necessitating a gastrostomy. Following riboflavin supplementation, resolution of facial diplegia and ataxia, improvements in ptosis, and bulbar function including vocalization and respiration were noted. However, her sensorineural hearing loss remained unchanged. Similar to other cases of Brown-Vialetto-Van Laere syndrome, our patient responded favorably to early riboflavin supplementation with significant but not complete neurologic recovery.

Defect in IgV gene somatic hypermutation in common variable immuno-deficiency syndrome.

Science.gov (United States)

Levy, Y; Gupta, N; Le Deist, F; Garcia, C; Fischer, A; Weill, J C; Reynaud, C A

1998-10-27

Common Variable Immuno-Deficiency (CVID) is the most common symptomatic primary antibody-deficiency syndrome, but the basic immunologic defects underlying this syndrome are not well defined. We report here that among eight patients studied (six CVID and two hypogammaglobulinemic patients with recurrent infections), there is in two CVID patients a dramatic reduction in Ig V gene somatic hypermutation with 40-75% of IgG transcripts totally devoid of mutations in the circulating memory B cell compartment. Functional assays of the T cell compartment point to an intrinsic B cell defect in the process of antibody affinity maturation in these two cases.

A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report.

Science.gov (United States)

Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua

2018-03-17

Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.

Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene

NARCIS (Netherlands)

Eisenkraft, A.; Pode-Shakked, B.; Goldstein, N.; Shpirer, Z.; Bokhoven, H. van; Anikster, Y.

2015-01-01

Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish

Wolfram syndrome 1 and Wolfram syndrome 2.

Science.gov (United States)

Rigoli, Luciana; Di Bella, Chiara

2012-08-01

Wolfram syndrome 1 (WS1) is an autosomal recessive disorder characterized by diabetes insipidus, diabetes mellitus, optic atrophy, and deafness (DI DM OA D syndrome) associated with other variable clinical manifestations. The causative gene for WS1 (WFS1) encoding wolframin maps to chromosome 4p16.1. Wolframin has an important function in maintaining the homeostasis of the endoplasmic reticulum (ER) in pancreatic β cells. Recently, another causative gene, CISD2, has been identified in patients with a type of Wolfram syndrome (WS2) resulting in early optic atrophy, diabetes mellitus, deafness, decreased lifespan, but not diabetes insipidus. The CISD2-encoded protein ERIS (endoplasmic reticulum intermembrane small protein) also localizes to ER, but does not interact directly with wolframin. ERIS maps to chromosome 4q22. Numerous studies have shown an interesting similarity between WFS1 and CISD2 genes. Experimental studies demonstrated that the Cisd2 knockout (Cisd2) mouse shows premature aging and typical symptoms of Wolfram syndrome. These researches provide interesting insight into the relation of neurodegenerative diseases, mitochondrial disorders, and autophagy and are useful for the pathophysiological understanding of both Wolfram syndrome and mitochondrial-mediated premature aging. The knowledge of WS1 and WS2 pathogenesis, and of the interactions between WFS1 and CISD2 genes, is useful for accurate diagnostic classification and for diagnosis of presymptomatic individuals.

Gene, Brain, and Behavior Relationships in Fragile X Syndrome: Evidence from Neuroimaging Studies

Science.gov (United States)

Lightbody, Amy A.; Reiss, Allan L.

2009-01-01

Fragile X syndrome (FraX) remains the most common inherited cause of intellectual disability and provides a valuable model for studying gene-brain-behavior relationships. Over the past 15 years, structural and functional magnetic resonance imaging studies have emerged with the goal of better understanding the neural pathways contributing to the…

Cloning and characterization of maize ZmSPK1, a homologue to ...

African Journals Online (AJOL)

hope&shola

2006-03-15

Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

2015-03-01

Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

Loeys-Dietz Syndrome

Science.gov (United States)

... to the signs and symptoms of Loeys-Dietz syndrome. Marfan syndrome is different from Loeys-Dietz syndrome in that the gene mutation which causes Marfan syndrome is in fibrillin-1 (FBN-1), a protein ...

Genes, language, and the nature of scientific explanations: the case of Williams syndrome.

Science.gov (United States)

Musolino, Julien; Landau, Barbara

2012-01-01

In this article, we discuss two experiments of nature and their implications for the sciences of the mind. The first, Williams syndrome, bears on one of cognitive science's holy grails: the possibility of unravelling the causal chain between genes and cognition. We sketch the outline of a general framework to study the relationship between genes and cognition, focusing as our case study on the development of language in individuals with Williams syndrome. Our approach emphasizes the role of three key ingredients: the need to specify a clear level of analysis, the need to provide a theoretical account of the relevant cognitive structure at that level, and the importance of the (typical) developmental process itself. The promise offered by the case of Williams syndrome has also given rise to two strongly conflicting theoretical approaches-modularity and neuroconstructivism-themselves offshoots of a perennial debate between nativism and empiricism. We apply our framework to explore the tension created by these two conflicting perspectives. To this end, we discuss a second experiment of nature, which allows us to compare the two competing perspectives in what comes close to a controlled experimental setting. From this comparison, we conclude that the "meaningful debate assumption", a widespread assumption suggesting that neuroconstructivism and modularity address the same questions and represent genuine theoretical alternatives, rests on a fallacy.

Marfan Syndrome

Science.gov (United States)

Marfan syndrome is a disorder that affects connective tissue. Connective tissues are proteins that support skin, bones, blood vessels, ... A problem with the fibrillin gene causes Marfan syndrome. Marfan syndrome can be mild to severe, and ...

Role of folate-homocysteine pathway gene polymorphisms and nutritional cofactors in Down syndrome: A triad study.

Science.gov (United States)

Sukla, K K; Jaiswal, S K; Rai, A K; Mishra, O P; Gupta, V; Kumar, A; Raman, R

2015-08-01

Do gene-gene and gene-environment interactions in folate-homocysteine (Hcy) pathway have a predisposing role for Down syndrome (DS)? The study provides evidence that in addition to advanced age, maternal genotype, micronutrient deficiency and elevated Hcy levels, individually and in combination, are risk factors for Down syndrome. Polymorphisms in certain folate-Hcy-pathway genes (especially the T allele of MTHFR C677T), elevated Hcy and poor folate levels in mothers during pregnancy have been shown to be risk factors for Down syndrome in certain Asian populations (including the eastern region of India), while the same SNPs are not a risk factor in European populations. This conflicting situation alludes to differential gene-environment (nutrition) interactions in different populations which needs to be explored. Between 2008 and 2012, 151 Down syndrome triads and 200 age-matched controls (Control mothers n = 186) were included in the study. Seven polymorphisms in six genes of folate-Hcy metabolic pathway, along with Hcy, cysteine (Cys), vitamin B12 (vit-B12) and folate levels, were analysed and compared among the case and control groups. Genotyping was performed by the PCR-RFLP technique. Levels of homocysteine and cysteine were measured by HPLC while vitamin B12 and folate were estimated by chemiluminescence. We demonstrate that polymorphisms in the folate-Hcy pathway genes in mothers collectively constitute a genotypic risk for DS which is effectively modified by interactions among genes and by the environment affecting folate, Hcy and vitamin B12 levels. The study also supports the idea that these maternal risk factors provide an adaptive advantage during pregnancy supporting live birth of the DS child. Our inability to obtain genotype and nutritional assessments of unaffected siblings of the DS children was an important limitation of the study. Also, its confinement to a specific geographic region (the eastern part) of India, and relatively small sample size

Mediterranean dietary pattern and VEGF +405 G/C gene polymorphisms in patients with metabolic syndrome: An aspect of gene-nutrient interaction.

Science.gov (United States)

Hajiluian, Ghazaleh; Abbasalizad Farhangi, Mahdieh; Jahangiry, Leila

2017-01-01

To evaluate the relationship between Mediterranean dietary pattern, anthropometric and metabolic biomarkers and vascular endothelial growth factor (VEGF) +405 G/C gene polymorphism in patient with metabolic syndrome (Mets). In this study 150 patients with Mets and 50 healthy subjects were enrolled. Dietary intakes were evaluated with a semi-quantitative food-frequency questionnaire (FFQ) and Mediterranean dietary quality index (Med-DQI) was assessed. Anthropometric assessments and blood pressure measurement were performed. Biochemical assays including fasting serum glucose (FSG), matrix metalloproteinase-3 (MMP-3), liver enzymes and lipid profiles were also assessed. Polymorphism of +405 G/C VEGF gene was determined utilizing polymerase chain reaction-restriction fragments length polymorphism (PCR-RFLP) method. Serum high density lipoprotein-cholesterol (HDL-C) was significantly lower and low density lipoprotein cholesterol (LDL-C), triglyceride (TG), total cholesterol (TC) concentrations and FSG were significantly higher in metabolic syndrome patients compared with control group (P consumption of "cholesterol" had significantly upper serum TG; also high consumption of "fish" and "vegetables-fruits" was associated with a significantly lower serum LDL concentrations. In metabolic syndrome patients with CC genotype, mean score of "saturated fatty acid" subgroup was significantly higher compared with other genotypes; whereas, in healthy individuals, mean score of "fruit-vegetable" subgroup in individuals of CC and GG genotype was significantly higher (P<0.05). Our findings indicated a significant relationship between Mediterranean dietary quality index and both anthropometric and metabolic risk factors. We also indicated a higher "saturated fatty acid" intake in CC genotype among metabolic syndrome patients.

[From gene to disease; genetic causes of hearing loss and visual impairment sometimes accompanied by vestibular problems (Usher syndrome)].

Science.gov (United States)

Pennings, R J E; Kremer, H; Deutman, A F; Kimberling, W J; Cremers, C W R J

2002-12-07

Usher syndrome is an autosomal recessively inherited disease, characterised by sensorineural hearing loss, tapetoretinal degeneration and in some cases vestibular problems. Based on the clinical heterogeneity, the disease can be classified into three clinical types (I, II and III), which have their own genetic subtypes (Usher 1A-Usher IG, Usher 2A-Usher 2C and Usher 3). The majority of the Usher type I cases are caused by mutations in the MYO7A gene (Usher 1B) while mutations in the USH2A gene (Usher 2A) are the cause of most cases of type II. Usher syndrome type III, caused by mutations in the USH3 gene, is frequently seen only in Finland.

Rubinstein-Taybi Syndrome and Epigenetic Alterations.

Science.gov (United States)

Korzus, Edward

2017-01-01

Rubinstein-Taybi syndrome (RSTS) is a rare genetic disorder in humans characterized by growth and psychomotor delay, abnormal gross anatomy, and mild to severe mental retardation (Rubinstein and Taybi, Am J Dis Child 105:588-608, 1963, Hennekam et al., Am J Med Genet Suppl 6:56-64, 1990). RSTS is caused by de novo mutations in epigenetics-associated genes, including the cAMP response element-binding protein (CREBBP), the gene-encoding protein referred to as CBP, and the EP300 gene, which encodes the p300 protein, a CBP homologue. Recent studies of the epigenetic mechanisms underlying cognitive functions in mice provide direct evidence for the involvement of nuclear factors (e.g., CBP) in the control of higher cognitive functions. In fact, a role for CBP in higher cognitive function is suggested by the finding that RSTS is caused by heterozygous mutations at the CBP locus (Petrij et al., Nature 376:348-351, 1995). CBP was demonstrated to possess an intrinsic histone acetyltransferase activity (Ogryzko et al., Cell 87:953-959, 1996) that is required for CREB-mediated gene expression (Korzus et al., Science 279:703-707, 1998). The intrinsic protein acetyltransferase activity in CBP might directly destabilize promoter-bound nucleosomes, facilitating the activation of transcription. Due to the complexity of developmental abnormalities and the possible genetic compensation associated with this congenital disorder, however, it is difficult to establish a direct role for CBP in cognitive function in the adult brain. Although aspects of the clinical presentation in RSTS cases have been extensively studied, a spectrum of symptoms found in RSTS patients can be accessed only after birth, and, thus, prenatal genetic tests for this extremely rare genetic disorder are seldom considered. Even though there has been intensive research on the genetic and epigenetic function of the CREBBP gene in rodents, the etiology of this devastating congenital human disorder is largely unknown.

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Directory of Open Access Journals (Sweden)

Petar Petrov

Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

DEFF Research Database (Denmark)

van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

2017-01-01

, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

A Novel Fibrillin-1 Gene Mutation Leading to Marfan Syndrome in a Korean Girl.

Science.gov (United States)

Nam, Hyo-Kyoung; Nam, Myung-Hyun; Ha, Kee-Soo; Rhie, Young-Jun; Lee, Kee-Hyoung

2017-03-01

Marfan syndrome is an autosomal dominant genetic disorder caused by a connective tissue defect. A nine-year-old girl was referred to our pediatric endocrinology clinic for tall stature. Physical examination revealed a lens dislocation with strabismus, high palate, positive wrist and thumb signs, joint hypermobility, and pes planus. Transthoracic echocardiography revealed dilatation of the aortic root. She was diagnosed with Marfan syndrome based on the revised Ghent diagnostic criteria. Molecular investigation identified a heterozygous c.2810G >A variation in the FBN1 gene in the patient, but not in her parents. To our knowledge, this sequence variant has been reported as a polymorphism (rs113602180), but it is the first report identifying it as the genetic cause of Marfan syndrome. We hypothesize that this de novo novel missense FBN1 mutation disrupts fibrillin-1 function and is probably involved in the development of Marfan syndrome in this patient. © 2017 by the Association of Clinical Scientists, Inc.

Long QT interval in Turner syndrome: a high prevalence of LQTS gene mutations

DEFF Research Database (Denmark)

Trolle, Christian

Objective: QT interval prolongation of unknown aetiology is common in Turner syndrome (TS). This study set out to explore the presence of known pathogenic long QT (LQT) mutations in TS and to examine the corrected QT interval (QTc) over time and relate the findings to the TS phenotype. Methods......QTc). The prevalence of mutations in genes related to Long QT syndrome (LQTS) was determined in females with TS and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. Results: The mean hQTc in females with TS (414.0±25.5 ms...

Common mutations identified in the MLH1 gene in familial Lynch syndrome

Directory of Open Access Journals (Sweden)

Jisha Elias

2017-12-01

In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

Doublesex: a conserved downstream gene controlled by diverse ...

Indian Academy of Sciences (India)

The Drosophila doublesex (dsx) gene at the bottom of the sex-determination cascade is the best characterized candidate so far, and is conserved from worms (mab3 of Caenorhabditis elegans) to mammals (Dmrt-1). Studies of dsx homologues from insect species belonging to different orders position them at the bottom of ...

Williams syndrome

Science.gov (United States)

Williams-Beuren syndrome ... Williams syndrome is caused by not having a copy of several genes. It may be passed down in families. ... history of the condition. However, people with Williams syndrome have a 50% chance of passing the disorder ...

Novel mutations in cyclin-dependent kinase-like 5 (CDKL5) gene in Indian cases of Rett syndrome.

Science.gov (United States)

Das, Dhanjit Kumar; Mehta, Bhakti; Menon, Shyla R; Raha, Sarbani; Udani, Vrajesh

2013-03-01

Rett syndrome is a severe neurodevelopmental disorder, almost exclusively affecting females and characterized by a wide spectrum of clinical manifestations. Both the classic and atypical forms of Rett syndrome are primarily due to mutations in the methyl-CpG-binding protein 2 (MECP2) gene. Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with atypical Rett syndrome, X-linked infantile spasms sharing common features of generally early-onset seizures and mental retardation. CDKL5 is known as serine/threonine protein kinase 9 (STK9) and is mapped to the Xp22 region. It has a conserved serine/threonine kinase domain within its amino terminus and a large C-terminal region. Disease-causing mutations are distributed in both the amino terminal domain and in the large C-terminal domain. We have screened the CDKL5 gene in 44 patients with atypical Rett syndrome who had tested negative for MECP2 gene mutations and have identified 6 sequence variants, out of which three were novel and three known mutations. Two of these novel mutations p.V966I and p.A1011V were missense and p.H589H a silent mutation. Other known mutations identified were p.V999M, p.Q791P and p.T734A. Sequence homology for all the mutations revealed that the two mutations (p.Q791P and p.T734A) were conserved across species. This indicated the importance of these residues in structure and function of the protein. The damaging effects of these mutations were analysed in silico using PolyPhen-2 online software. The PolyPhen-2 scores of p.Q791P and p.T734A were 0.998 and 0.48, revealing that these mutations could be deleterious and might have potential functional effect. All other mutations had a low score suggesting that they might not alter the activity of CDKL5. We have also analysed the position of the mutations in the CDKL5 protein and found that all the mutations were present in the C-terminal domain of the protein. The C-terminal domain is required for

Severe early onset retinitis pigmentosa in a Moroccan patient with Heimler syndrome due to novel homozygous mutation of PEX1 gene.

Science.gov (United States)

Ratbi, Ilham; Jaouad, Imane Cherkaoui; Elorch, Hamza; Al-Sheqaih, Nada; Elalloussi, Mustapha; Lyahyai, Jaber; Berraho, Amina; Newman, William G; Sefiani, Abdelaziz

2016-10-01

Heimler syndrome (HS) is a rare recessive disorder characterized by sensorineural hearing loss (SNHL), amelogenesis imperfecta, nail abnormalities, and occasional or late-onset retinal pigmentation. It is the mildest form known to date of peroxisome biogenesis disorder caused by hypomorphic mutations of PEX1 and PEX6 genes. We report on a second Moroccan family with Heimler syndrome with early onset, severe visual impairment and important phenotypic overlap with Usher syndrome. The patient carried a novel homozygous missense variant c.3140T > C (p.Leu1047Pro) of PEX1 gene. As standard biochemical screening of blood for evidence of a peroxisomal disorder did not provide a diagnosis in the individuals with HS, patients with SNHL and retinal pigmentation should have mutation analysis of PEX1 and PEX6 genes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Behaviour of the homologues of Rf and Db in complexing media

International Nuclear Information System (INIS)

Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

1999-01-01

In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

Science.gov (United States)

García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

2011-08-01

Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

Blau syndrome-associated mutations in exon 4 of the caspase activating recruitment domain 15 (CARD 15) gene are not found in ethnic Danes with sarcoidosis

DEFF Research Database (Denmark)

Milman, Nils; Nielsen, Finn Cilius; Hviid, Thomas Vauvert F

2007-01-01

BACKGROUND: Distinct mutations of the caspase activating recruitment domain 15 (CARD15) gene (also known as nucleotide-binding oligomerisation domain protein 2) on chromosome 16q are associated with the chronic granulomatous disease called Blau syndrome. Sarcoidosis is a systemic granulomatous...... disease, which has features in common with Blau syndrome. AIM: The aim of this study was to evaluate whether ethnic Danes with sarcoidosis have CARD15 mutations associated with Blau syndrome. METHODS: Analysis of exon 4 of the CARD15 gene containing mutations associated with Blau syndrome was performed...

The actin homologue MreB organizes the bacterial cell membrane

OpenAIRE

Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

2014-01-01

The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

Science.gov (United States)

Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

2005-01-01

A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

Identification, characterization, and function analysis of the Cactus gene from Litopenaeus vannamei.

Directory of Open Access Journals (Sweden)

Chaozheng Li

Full Text Available The nuclear factor-kappa B (NF-κB pathways play important roles in innate immune responses. IκB is the main cytoplasmic inhibitor of NF-κB. In this study, we identified the LvCactus gene from Litopenaeus vannamei, which is the first cloned IκB homologue in subphylum Crustacea. LvCactus contains six predicted ankyrin repeats, which show similarities to those of Cactus proteins from insects. LvCactus localizes in cytoplasm and interacts with LvDorsal, an L. vannamei homologue to Drosophila melanogaster Dorsal belonging to class II NF-κB family, to prevent its nuclear translocation. Contrary to that of LvDorsal, over-expression of LvCactus down-regulates the activities of shrimp antimicrobial peptides promoters, suggesting LvCactus is an inhibitor of LvDorsal. The promoter of LvCactus was predicted to contain five putative NF-κB binding motifs, among which four were proved to be bound by LvDorsal by chromatin immunoprecipitation assays. Dual-luciferase reporter assays also showed that transcription of LvCactus was promoted by LvDorsal but inhibited by LvCactus itself, indicating a feedback regulatory pathway between LvCactus and LvDorsal. Expression of LvCactus was up-regulated after Lipopolysaccharides, poly (I:C, Vibrio parahaemolyticus, and Staphylococcus aureus injections, suggesting an activation response of LvCactus to bacterial and immune stimulant challenges. Differently, the LvCactus expression levels obviously decreased during white spot syndrome virus (WSSV infection, indicating the feedback regulatory pathway of LvCactus/LvDorsal could be modified by WSSV.

Symptoms of Attention-Deficit/Hyperactivity Disorder in Down Syndrome: Effects of the Dopamine Receptor D4 Gene

Science.gov (United States)

Mason, Gina Marie; Spanó, Goffredina; Edgin, Jamie

2015-01-01

This study examined individual differences in ADHD symptoms and executive function (EF) in children with Down syndrome (DS) in relation to the dopamine receptor D4 (DRD4) gene, a gene often linked to ADHD in people without DS. Participants included 68 individuals with DS (7-21 years), assessed through laboratory tasks, caregiver reports, and…

Kearns-Sayre syndrome with facial and white matter extensive involvement: a (mitochondrial and nuclear gene related? neurocristopathy?

Directory of Open Access Journals (Sweden)

Agostino Berio

2017-12-01

Full Text Available The Authors report on a patient with Kearns-Sayre syndrome, large mtDNA deletion (7/kb, facial abnormalities and severe central nervous system (CNS white matter radiological features, commonly attributed to spongy alterations. The common origin from neural crest cell (NCC of facial structures (cartilagineous, osseous, vascular and of the peripheral nervous system and of peripheral glia and partially of the CNS white matter are underlined and the facial and glial abnormalities are attributed to the abnormal reproduction/migration of NCC. In this view, the CNS spongy alterations in KSS may be not only a dystrophic process (leukodystrophy but also a dysplastic condition (leukodysplasia. The Authors hypothesize that the symptoms may be related to mtDNA mutations associated to NCC nuclear gene abnormality. SOX 10 gene may be a nuclear candidate gene, as reported in some case of Waardenburg IV syndrome.

An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

Science.gov (United States)

Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

2010-01-01

Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

Apa-I polymorphism in VDR gene is related to metabolic syndrome in polycystic ovary syndrome: a cross-sectional study.

Science.gov (United States)

Santos, Betânia Rodrigues; Lecke, Sheila Bunecker; Spritzer, Poli Mara

2018-04-18

Polycystic ovary syndrome (PCOS) is a common endocrine disorder determined by polygenic traits as well as environmental factors. Lower vitamin D levels have been detected in PCOS women and related to hormone and metabolic disturbances. Vitamin D acts in tissues through the vitamin D receptor (VDR). VDR gene variants have been associated with worse metabolic profile in the general population. We investigated the genotype and haplotype distribution of the Bsm-I (rs1544410), Apa-I (rs7975232), and Taq-I (rs731236) VDR gene polymorphisms in PCOS and non-hirsute women from southern Brazil. We further investigated the associations of these gene variants and their haplotypes with PCOS, vitamin D levels, and metabolic abnormalities, including the metabolic syndrome (MetS). A group of 191 women with PCOS (Rotterdam criteria) and 100 non-hirsute controls with regular ovulatory cycles were genotyped for all polymorphisms by real-time PCR, with allelic discrimination assays. MetS and the cutoffs for its isolated components were defined in accordance with the Joint Scientific Statement. Women with PCOS were younger and had significantly higher BMI and total testosterone levels than controls (p Apa-I entailed higher risk of MetS in PCOS (OR: 2.133; 95% CI 1.020-4.464, p = 0.042), and was associated with higher systolic blood pressure (p = 0.009), total cholesterol (p = 0.040), and LDL-cholesterol (p = 0.038) in both PCOS and control groups (two-way ANOVA). The frequencies of VDR haplotypes were similar in PCOS and control women. The present results suggest that the Apa-I variant in VDR gene may be associated with MetS in southern Brazilian women with PCOS, and with blood pressure, total cholesterol, and LDL-c in women with and without PCOS.

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

International Nuclear Information System (INIS)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

2005-01-01

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

International Nuclear Information System (INIS)

Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

2005-01-01

We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

Molecular characterization of a fungal gene paralogue of the penicillin penDE gene of Penicillium chrysogenum

Science.gov (United States)

2009-01-01

Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became

Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

DEFF Research Database (Denmark)

Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

2009-01-01

hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

Prenatal diagnosis of the fragile X syndrome : loss of mutation owing to a double recombinant or gene conversion event at the FMR1 locus

NARCIS (Netherlands)

Losekoot, M; Hoogendoorn, E; Olmer, R; Jansen, CCAM; Oosterwijk, JC; vandenOuweland, AMW; Halley, DJJ; Warren, ST; Willemsen, R; Oostra, BA; Bakker, E

1997-01-01

The fragile X syndrome, an X linked mental retardation syndrome, is caused by an expanded CGG repeat in the first exon of the FMR1 gene. In patients with an expanded repeat the FMR1 promoter is methylated and, consequently, the gene is silenced and no FMR1 protein (FMRP) is produced, thus leading to

Transcriptome study of storage protein genes of field-grown barley in response to inorganic nitrogen fertilizers

DEFF Research Database (Denmark)

Hansen, Michael; Bowra, Steve; Lange, Mette

2010-01-01

The storage proteins of barley, in terms of both amino acid profile and quantity, are traits strongly influenced by the amount of nitrogen applied. Given this, we performed a developmental expression analysis of the genes from barley grains grown under field conditions to further our understanding...... profile under different N regimes. Reviewing the expression of the storage protein homologues within the families revealed markedly different temporal profiles; for example, some alleles were expressed very early in development. Furthermore, the differential temporal expression of the homologues suggested...

Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study.

Science.gov (United States)

Le Quesne Stabej, Polona; Saihan, Zubin; Rangesh, Nell; Steele-Stallard, Heather B; Ambrose, John; Coffey, Alison; Emmerson, Jenny; Haralambous, Elene; Hughes, Yasmin; Steel, Karen P; Luxon, Linda M; Webster, Andrew R; Bitner-Glindzicz, Maria

2012-01-01

Usher syndrome (USH) is an autosomal recessive disorder comprising retinitis pigmentosa, hearing loss and, in some cases, vestibular dysfunction. It is clinically and genetically heterogeneous with three distinctive clinical types (I-III) and nine Usher genes identified. This study is a comprehensive clinical and genetic analysis of 172 Usher patients and evaluates the contribution of digenic inheritance. The genes MYO7A, USH1C, CDH23, PCDH15, USH1G, USH2A, GPR98, WHRN, CLRN1 and the candidate gene SLC4A7 were sequenced in 172 UK Usher patients, regardless of clinical type. No subject had definite mutations (nonsense, frameshift or consensus splice site mutations) in two different USH genes. Novel missense variants were classified UV1-4 (unclassified variant): UV4 is 'probably pathogenic', based on control frequency A being the most common USH1 mutation in the cohort). USH2A was responsible for 79.3% of USH2 families and GPR98 for only 6.6%. No mutations were found in USH1G, WHRN or SLC4A7. One or two pathogenic/likely pathogenic variants were identified in 86% of cases. No convincing cases of digenic inheritance were found. It is concluded that digenic inheritance does not make a significant contribution to Usher syndrome; the observation of multiple variants in different genes is likely to reflect polymorphic variation, rather than digenic effects.

Uncoupling proteins, dietary fat and the metabolic syndrome

Directory of Open Access Journals (Sweden)

Warden Craig H

2006-09-01

Full Text Available Abstract There has been intense interest in defining the functions of UCP2 and UCP3 during the nine years since the cloning of these UCP1 homologues. Current data suggest that both UCP2 and UCP3 proteins share some features with UCP1, such as the ability to reduce mitochondrial membrane potential, but they also have distinctly different physiological roles. Human genetic studies consistently demonstrate the effect of UCP2 alleles on type-2 diabetes. Less clear is whether UCP2 alleles influence body weight or body mass index (BMI with many studies showing a positive effect while others do not. There is strong evidence that both UCP2 and UCP3 protect against mitochondrial oxidative damage by reducing the production of reactive oxygen species. The evidence that UCP2 protein is a negative regulator of insulin secretion by pancreatic β-cells is also strong: increased UCP2 decreases glucose stimulated insulin secretion ultimately leading to β-cell dysfunction. UCP2 is also neuroprotective, reducing oxidative stress in neurons. UCP3 may also transport fatty acids out of mitochondria thereby protecting the mitochondria from fatty acid anions or peroxides. Current data suggest that UCP2 plays a role in the metabolic syndrome through down-regulation of insulin secretion and development of type-2 diabetes. However, UCP2 may protect against atherosclerosis through reduction of oxidative stress and both UCP2 and UCP3 may protect against obesity. Thus, these UCP1 homologues may both contribute to and protect from the markers of the metabolic syndrome.

Cell cycle–related genes as modifiers of age of onset of colorectal cancer in Lynch syndrome: a large-scale study in non-Hispanic white patients

Science.gov (United States)

Chen, Jinyun; Pande, Mala

2013-01-01

Heterogeneity in age of onset of colorectal cancer in individuals with mutations in DNA mismatch repair genes (Lynch syndrome) suggests the influence of other lifestyle and genetic modifiers. We hypothesized that genes regulating the cell cycle influence the observed heterogeneity as cell cycle–related genes respond to DNA damage by arresting the cell cycle to provide time for repair and induce transcription of genes that facilitate repair. We examined the association of 1456 single nucleotide polymorphisms (SNPs) in 128 cell cycle–related genes and 31 DNA repair–related genes in 485 non-Hispanic white participants with Lynch syndrome to determine whether there are SNPs associated with age of onset of colorectal cancer. Genotyping was performed on an Illumina GoldenGate platform, and data were analyzed using Kaplan–Meier survival analysis, Cox regression analysis and classification and regression tree (CART) methods. Ten SNPs were independently significant in a multivariable Cox proportional hazards regression model after correcting for multiple comparisons (P Lynch syndrome. PMID:23125224

Cell cycle-related genes as modifiers of age of onset of colorectal cancer in Lynch syndrome: a large-scale study in non-Hispanic white patients.

Science.gov (United States)

Chen, Jinyun; Pande, Mala; Huang, Yu-Jing; Wei, Chongjuan; Amos, Christopher I; Talseth-Palmer, Bente A; Meldrum, Cliff J; Chen, Wei V; Gorlov, Ivan P; Lynch, Patrick M; Scott, Rodney J; Frazier, Marsha L

2013-02-01

Heterogeneity in age of onset of colorectal cancer in individuals with mutations in DNA mismatch repair genes (Lynch syndrome) suggests the influence of other lifestyle and genetic modifiers. We hypothesized that genes regulating the cell cycle influence the observed heterogeneity as cell cycle-related genes respond to DNA damage by arresting the cell cycle to provide time for repair and induce transcription of genes that facilitate repair. We examined the association of 1456 single nucleotide polymorphisms (SNPs) in 128 cell cycle-related genes and 31 DNA repair-related genes in 485 non-Hispanic white participants with Lynch syndrome to determine whether there are SNPs associated with age of onset of colorectal cancer. Genotyping was performed on an Illumina GoldenGate platform, and data were analyzed using Kaplan-Meier survival analysis, Cox regression analysis and classification and regression tree (CART) methods. Ten SNPs were independently significant in a multivariable Cox proportional hazards regression model after correcting for multiple comparisons (P Lynch syndrome.

Mixed Bartter-Gitelman syndrome: an inbred family with a heterogeneous phenotype expression of a novel variant in the CLCNKB gene.

Science.gov (United States)

Al-Shibli, Amar; Yusuf, Madinah; Abounajab, Issam; Willems, Patrick J

2014-01-01

Patients with renal diseases associated with salt-losing tubulopathies categorized as Gitelman and classic form of Bartter syndrome have undergone genetic screening for possible mutation capture in two different genes: SLC12A3 and CLCNKB. Clinical symptoms of these two diseases may overlap. Bartter syndrome and Gitelman syndrome are autosomal recessive salt-losing tubulopathies with hypokalemia, metabolic alkalosis, hyperreninemia, hyperplasia of the juxtaglomerular apparatus, hyperaldosteronism, and, in some patients, hypomagnesemia. Here we describe four patients from an inbred family with a novel missense variant in the CLCNKB gene. All of patients are asymptomatic; yet they have the typical metabolic abnormality of salt losing tubulopathies. One of those patients had hypomagnesaemia while others not. Clinical and laboratory data of all patients was described. All 4 patients have a homozygous c.490G > T missense variant in exon 5 of the CLCNKB gene. This variant alters a glycine into a cysteine on amino acid position 164 of the resulting protein (p.Gly164Cys). The c.490G > T variant is a novel variant not previously described in other patients nor controls. Polyphen analysis predicts the variation to be possibly damaging. Analysis of SLC12A3 was normal. Here in we are describing a novel homozygous c.490G > T missense variation was identified in exon 5 of the CLCNKB gene was identified in an Emirati patients with a mild manifestation of Bartter - Gitelman syndrome.

Genetic screens to identify pathogenic gene variants in the common cancer predisposition Lynch syndrome

DEFF Research Database (Denmark)

Drost, Mark; Lützen, Anne; van Hees, Sandrine

2013-01-01

In many individuals suspected of the common cancer predisposition Lynch syndrome, variants of unclear significance (VUS), rather than an obviously pathogenic mutations, are identified in one of the DNA mismatch repair (MMR) genes. The uncertainty of whether such VUS inactivate MMR, and therefore...... function. When a residue identified as mutated in an individual suspected of Lynch syndrome is listed as critical in such a reverse diagnosis catalog, there is a high probability that the corresponding human VUS is pathogenic. To investigate the applicability of this approach, we have generated....... Nearly half of these critical residues match with VUS previously identified in individuals suspected of Lynch syndrome. This aids in the assignment of pathogenicity to these human VUS and validates the approach described here as a diagnostic tool. In a wider perspective, this work provides a model...

Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

International Nuclear Information System (INIS)

Singh, S.; Yamashita, A.; Gouaux, E.

2007-01-01

Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

Energy Technology Data Exchange (ETDEWEB)

Singh,S.; Yamashita, A.; Gouaux, E.

2007-01-01

Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

Atypical haemolytic uraemic syndrome associated with a hybrid complement gene.

Directory of Open Access Journals (Sweden)

Julian P Venables

2006-10-01

Full Text Available BACKGROUND: Sequence analysis of the regulators of complement activation (RCA cluster of genes at chromosome position 1q32 shows evidence of several large genomic duplications. These duplications have resulted in a high degree of sequence identity between the gene for factor H (CFH and the genes for the five factor H-related proteins (CFHL1-5; aliases CFHR1-5. CFH mutations have been described in association with atypical haemolytic uraemic syndrome (aHUS. The majority of the mutations are missense changes that cluster in the C-terminal region and impair the ability of factor H to regulate surface-bound C3b. Some have arisen as a result of gene conversion between CFH and CFHL1. In this study we tested the hypothesis that nonallelic homologous recombination between low-copy repeats in the RCA cluster could result in the formation of a hybrid CFH/CFHL1 gene that predisposes to the development of aHUS. METHODS AND FINDINGS: In a family with many cases of aHUS that segregate with the RCA cluster we used cDNA analysis, gene sequencing, and Southern blotting to show that affected individuals carry a heterozygous CFH/CFHL1 hybrid gene in which exons 1-21 are derived from CFH and exons 22/23 from CFHL1. This hybrid encodes a protein product identical to a functionally significant CFH mutant (c.3572C>T, S1191L and c.3590T>C, V1197A that has been previously described in association with aHUS. CONCLUSIONS: CFH mutation screening is recommended in all aHUS patients prior to renal transplantation because of the high risk of disease recurrence post-transplant in those known to have a CFH mutation. Because of our finding it will be necessary to implement additional screening strategies that will detect a hybrid CFH/CFHL1 gene.

Acral peeling skin syndrome associated with a novel CSTA gene mutation.

Science.gov (United States)

Muttardi, K; Nitoiu, D; Kelsell, D P; O'Toole, E A; Batta, K

2016-06-01

Acral peeling skin syndrome (APSS) is a rare autosomal recessive condition, characterized by asymptomatic peeling of the skin of the hands and feet, often linked to mutations in the gene TGM5. However, more recently recessive loss of function mutations in CSTA, encoding cystatin A, have been linked with APSS and exfoliative ichthyosis. We describe the clinical features in two sisters with APSS, associated with a novel large homozygous deletion encompassing exon 1 of CSTA. © 2015 British Association of Dermatologists.

Structural studies on a non-toxic homologue of type II RIPs from ...

Indian Academy of Sciences (India)

Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

Recombinase Activating Gene 1 Deficiencies Without Omenn Syndrome May Also Present With Eosinophilia and Bone Marrow Fibrosis

OpenAIRE

Ulusoy, Ezgi; Karaca, Neslihan Edeer; Azarsiz, Elif; Berdeli, Afig; Aksu, Guzide; Kutukculer, Necil

2016-01-01

Background Severe combined immunodeficiency (SCID) syndromes are a heterogenous group of diseases characterized by impairment in both cellular and humoral immunity with a range of genetic disorders. Complete recombinase activating gene (RAG) deficiency is associated with classical T-B-NK+ SCID which is the most common phenotype of Turkish SCID patients. There is a broad spectrum of hypomorfic RAG mutations including Omenn syndrome, leaky or atypical SCID with expansion of ?? T cells, autoimmu...

ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

Science.gov (United States)

Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

2011-01-01

We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

Alport Syndrome: De Novo Mutation in the COL4A5 Gene Converting Glycine 1205 to Valine

Directory of Open Access Journals (Sweden)

Pilar Antón-Martín

2012-01-01

Full Text Available Background Alport syndrome is a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family. It is a genetically heterogeneous disease with different mutations and forms of inheritance that presents with renal affection, hearing loss and eye defects. Several new mutations related to X-linked forms have been previously determined. Methods We report the case of a 12 years old male and his family diagnosed with Alport syndrome after genetic analysis was performed. Result Anew mutation determining a nucleotide change C.3614G > T (p. Gly1205Val in hemizygosis in the COL4A5 gene was found. This molecular defect has not been previously described. Conclusion Molecular biology has helped us to comprehend the mechanisms of pathophysiology in Alport syndrome. Genetic analysis provides the only conclusive diagnosis of the disorder at the moment. Our contribution with a new mutation further supports the need of more sophisticated molecular methods to increase the mutation detection rates with lower costs and less time.

Bartter syndrome in two sisters with a novel mutation of the CLCNKB gene, one with deafness.

Science.gov (United States)

Robitaille, Pierre; Merouani, Aicha; He, Ning; Pei, York

2011-09-01

This article describes two sisters with type III Bartter syndrome (BS) due to a novel missense variant of the CLCNKB gene. The phenotypic expression of the disease was very different in these two siblings. In one sister, the disease followed a very severe course, especially in the neonatal period and as a toddler. Both the classic symptoms and the biochemical features of the syndrome were striking. In addition, she presented with sensorineural deafness, a complication yet unreported in this subtype of BS In contrast, the least affected sister was symptom free and the biochemical features of the disease although present remained discrete throughout the prolonged follow-up. It is suggested that such a difference in the phenotypic expression of the disease is possibly secondary to the modifier effect of a gene and/or results from environmental factor(s).

Orphan Hereditary Syndromes in the Practice of Pediatric Endocrinologist

Directory of Open Access Journals (Sweden)

M.O. Ryznychuk

2015-05-01

Above-mentioned syndromes are caused by different gene mutations, namely Perlman syndrome — by homozygous or heterozygous mutation in DIS3L2 gene on the chromosome 2q37, Proteus syndrome — mutation in AKT1 gene on chromosome 14q32.3, Sotos syndrome 1 is caused by heterozygous mutation in NSD1 gene in the 5q35 region, Sotos syndrome 2 — by heterozygous mutation in NFIX gene on chromosome 19p13.3. Berardinelli syndrome, which is divided into four types, has four different mutations, namely: type 1 is caused by mutations in AGPAT2 gene in locus 9q34, type 2 — in BSCα2gene in locus 11q13, type 3 — by mutations in CAV1 gene (locus 7q31, type 4 — by mutation in PTRF gene located on the chromosome 17.

Bardet-Biedl syndrome and Usher syndrome.

Science.gov (United States)

Koenig, Rainer

2003-01-01

Bardet-Biedl syndrome (BBS) and Usher syndrome (USH) are the most prevalent syndromic forms of retinitis pigmentosa (RP), together they make up almost a quarter of the patients with RP. BBS is defined by the association of retinopathy, obesity, hypogonadism, renal dysfunction, postaxial polydactyly and mental retardation. This clinically complex syndrome is genetically heterogeneous with linkage to more than 6 loci, and 4 genes have been cloned so far. Recent molecular data present evidence that, in some instances, the clinical manifestation of BBS requires recessive mutations in 1 of the 6 BBS loci plus one or two additional mutations in a second BBS locus (tri- or tetra-allelic inheritance). USH is characterized by the combination of congenital or early-onset sensorineural deafness, RP, and variable degrees of vestibular dysfunction. Each of the three clinical types is genetically heterogeneous: 7 loci have been mapped for type 1, three loci for type 2, and two loci for type 3. Currently, 6 USH genes (MYO7A, USH1C, CDH23, PCDH15, USH2A, USH3) have been identified. Pathogenetically, mutations of the USH1 genes seem to result in defects of auditory and retinal sensory cells, the USH 2 phenotype is caused by defects of extracellular matrix or cell surface receptor proteins, and USH3 may be due to synaptic disturbances. The considerable contribution of syndromic forms of RP requires interdisciplinary approaches to the clinical and diagnostic management of RP patients.

A Biotin Biosynthesis Gene Restricted to Helicobacter

Science.gov (United States)

Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

2016-01-01

In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

Nevoid basal cell carcinoma syndrome

Science.gov (United States)

NBCC syndrome; Gorlin-Goltz syndrome; Basal cell nevus syndrome; BCNS; Basal cell cancer - nevoid basal cell carcinoma syndrome ... Nevoid basal cell carcinoma nevus syndrome is a rare genetic ... syndrome is known as PTCH ("patched"). The gene is passed down ...

Mutation update for the CSB/ERCC6 and CSA/ERCC8 genes involved in Cockayne syndrome.

Science.gov (United States)

Laugel, V; Dalloz, C; Durand, M; Sauvanaud, F; Kristensen, U; Vincent, M C; Pasquier, L; Odent, S; Cormier-Daire, V; Gener, B; Tobias, E S; Tolmie, J L; Martin-Coignard, D; Drouin-Garraud, V; Heron, D; Journel, H; Raffo, E; Vigneron, J; Lyonnet, S; Murday, V; Gubser-Mercati, D; Funalot, B; Brueton, L; Sanchez Del Pozo, J; Muñoz, E; Gennery, A R; Salih, M; Noruzinia, M; Prescott, K; Ramos, L; Stark, Z; Fieggen, K; Chabrol, B; Sarda, P; Edery, P; Bloch-Zupan, A; Fawcett, H; Pham, D; Egly, J M; Lehmann, A R; Sarasin, A; Dollfus, H

2010-02-01

Cockayne syndrome is an autosomal recessive multisystem disorder characterized principally by neurological and sensory impairment, cachectic dwarfism, and photosensitivity. This rare disease is linked to mutations in the CSB/ERCC6 and CSA/ERCC8 genes encoding proteins involved in the transcription-coupled DNA repair pathway. The clinical spectrum of Cockayne syndrome encompasses a wide range of severity from severe prenatal forms to mild and late-onset presentations. We have reviewed the 45 published mutations in CSA and CSB to date and we report 43 new mutations in these genes together with the corresponding clinical data. Among the 84 reported kindreds, 52 (62%) have mutations in the CSB gene. Many types of mutations are scattered along the whole coding sequence of both genes, but clusters of missense mutations can be recognized and highlight the role of particular motifs in the proteins. Genotype-phenotype correlation hypotheses are considered with regard to these new molecular and clinical data. Additional cases of molecular prenatal diagnosis are reported and the strategy for prenatal testing is discussed. Two web-based locus-specific databases have been created to list all identified variants and to allow the inclusion of future reports (www.umd.be/CSA/ and www.umd.be/CSB/). (c) 2009 Wiley-Liss, Inc.

Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study

OpenAIRE

Le Quesne Stabej, Polona; Saihan, Zubin; Rangesh, Nell; Steele-Stallard, Heather B; Ambrose, John; Coffey, Alison; Emmerson, Jenny; Haralambous, Elene; Hughes, Yasmin; Steel, Karen P; Luxon, Linda M; Webster, Andrew R; Bitner-Glindzicz, Maria

2011-01-01

Background Usher syndrome (USH) is an autosomal recessive disorder comprising retinitis pigmentosa, hearing loss and, in some cases, vestibular dysfunction. It is clinically and genetically heterogeneous with three distinctive clinical types (I?III) and nine Usher genes identified. This study is a comprehensive clinical and genetic analysis of 172 Usher patients and evaluates the contribution of digenic inheritance. Methods The genes MYO7A, USH1C, CDH23, PCDH15, USH1G, USH2A, GPR98, WHRN, CLR...

Development of lymphoma in Autoimmune Lymphoproliferative Syndrome (ALPS) and its relationship to Fas gene mutations

NARCIS (Netherlands)

Poppema, Sibrand; Maggio, Ewerton; van den Berg, Anke

Autoimmune Lymphoproliferative Syndrome (ALPS) is generally the result of a mutation in genes associated with apoptosis, like Fas, Fas ligand, Casp 8 and Casp 10. As a result, the normal homeostasis of T- and B-lymphocytes is disturbed and a proliferation of polyclonal T lymphocytes occurs. This

De novo mutations in ARID1B associated with both syndromic and non-syndromic short stature.

Science.gov (United States)

Yu, Yongguo; Yao, RuEn; Wang, Lili; Fan, Yanjie; Huang, Xiaodong; Hirschhorn, Joel; Dauber, Andrew; Shen, Yiping

2015-09-16

Human height is a complex trait with a strong genetic basis. Recently, a significant association between rare copy number variations (CNVs) and short stature has been identified, and candidate genes in these rare CNVs are being explored. This study aims to evaluate the association between mutations in ARID1B gene and short stature, both the syndromic and non-syndromic form. Based on a case-control study of whole genome chromosome microarray analysis (CMA), three overlapping CNVs were identified in patients with developmental disorders who exhibited short stature. ARID1B, a causal gene for Coffin Siris syndrome, is the only gene encompassed by all three CNVs. A following retrospective genotype-phenotype analysis based on a literature review confirmed that short stature is a frequent feature in those Coffin-Siris syndrome patients with ARID1B mutations. Mutation screening of ARID1B coding regions was further conducted in a cohort of 48 non-syndromic short stature patients,andfour novel missense variants including two de novo mutations were found. These results suggest that haploinsufficient mutations of ARID1B are associated with syndromic short stature including Coffin-Siris syndrome and intellectual disability, while rare missense variants in ARID1B are associated with non-syndromic short stature. This study supports the notion that mutations in genes related to syndromic short stature may exert milder effect and contribute to short stature in the general population.

A novel mutation in the succinate dehydrogenase subunit D gene in siblings with the hereditary paraganglioma–pheochromocytoma syndrome

Directory of Open Access Journals (Sweden)

Chaithra Prasad

2014-10-01

Full Text Available Germline mutations in the succinate dehydrogenase complex subunit D gene are now known to be associated with hereditary paraganglioma–pheochromocytoma syndromes. Since the initial succinate dehydrogenase complex subunit D gene mutation was identified about a decade ago, more than 131 unique variants have been reported. We report the case of two siblings presenting with multiple paragangliomas and pheochromocytomas; they were both found to carry a mutation in the succinate dehydrogenase complex subunit D gene involving a substitution of thymine to guanine at nucleotide 236 in exon 3. This particular mutation of the succinate dehydrogenase complex subunit D gene has only been reported in one previous patient in Japan; this is, therefore, the first report of this pathogenic mutation in siblings and the first report of this mutation in North America. With continued screening of more individuals, we will be able to create a robust mutation database that can help us understand disease patterns associated with particular variants and may be a starting point in the development of new therapies for familial paraganglioma syndromes.

Characterization of a rare variant (c.2635-2A>G) of the MSH2 gene in a family with Lynch syndrome.

Science.gov (United States)

Cariola, Filomena; Disciglio, Vittoria; Valentini, Anna M; Lotesoriere, Claudio; Fasano, Candida; Forte, Giovanna; Russo, Luciana; Di Carlo, Antonio; Guglielmi, Floranna; Manghisi, Andrea; Lolli, Ivan; Caruso, Maria L; Simone, Cristiano

2018-04-01

Lynch syndrome is caused by germline mutations in one of the mismatch repair genes ( MLH1, MSH2, MSH6, and PMS2) or in the EPCAM gene. Lynch syndrome is defined on the basis of clinical, pathological, and genetic findings. Accordingly, the identification of predisposing genes allows for accurate risk assessment and tailored screening protocols. Here, we report a family case with three family members manifesting the Lynch syndrome phenotype, all of which harbor the rare variant c.2635-2A>G affecting the splice site consensus sequence of intron 15 of the MSH2 gene. This mutation was previously described only in one family with Lynch syndrome, in which mismatch repair protein expression in tumor tissues was not assessed. In this study, we report for the first time the molecular characterization of the MSH2 c.2635-2A>G variant through in silico prediction analysis, microsatellite instability, and mismatch repair protein expression experiments on tumor tissues of Lynch syndrome patients. The potential effect of the splice site variant was revealed by three splicing prediction bioinformatics tools, which suggested the generation of a new cryptic splicing site. The potential pathogenic role of this variant was also revealed by the presence of microsatellite instability and the absence of MSH2/MSH6 heterodimer protein expression in the tumor cells of cancer tissues of the affected family members. We provide compelling evidence in favor of the pathogenic role of the MSH2 variant c.2635-2A>G, which could induce an alteration of the canonical splice site and consequently an aberrant form of the protein product (MSH2).

Genomic profiling in Down syndrome acute lymphoblastic leukemia identifies histone gene deletions associated with altered methylation profiles

Science.gov (United States)

Loudin, Michael G.; Wang, Jinhua; Leung, Hon-Chiu Eastwood; Gurusiddappa, Sivashankarappa; Meyer, Julia; Condos, Gregory; Morrison, Debra; Tsimelzon, Anna; Devidas, Meenakshi; Heerema, Nyla A.; Carroll, Andrew J.; Plon, Sharon E.; Hunger, Stephen P.; Basso, Giuseppe; Pession, Andrea; Bhojwani, Deepa; Carroll, William L.; Rabin, Karen R.

2014-01-01

Patients with Down syndrome (DS) and acute lymphoblastic leukemia (ALL) have distinct clinical and biological features. Whereas most DS-ALL cases lack the sentinel cytogenetic lesions that guide risk assignment in childhood ALL, JAK2 mutations and CRLF2 overexpression are highly enriched. To further characterize the unique biology of DS-ALL, we performed genome-wide profiling of 58 DS-ALL and 68 non-Down syndrome (NDS) ALL cases by DNA copy number, loss of heterozygosity, gene expression, and methylation analyses. We report a novel deletion within the 6p22 histone gene cluster as significantly more frequent in DS-ALL, occurring in 11 DS (22%) and only two NDS cases (3.1%) (Fisher’s exact p = 0.002). Homozygous deletions yielded significantly lower histone expression levels, and were associated with higher methylation levels, distinct spatial localization of methylated promoters, and enrichment of highly methylated genes for specific pathways and transcription factor binding motifs. Gene expression profiling demonstrated heterogeneity of DS-ALL cases overall, with supervised analysis defining a 45-transcript signature associated with CRLF2 overexpression. Further characterization of pathways associated with histone deletions may identify opportunities for novel targeted interventions. PMID:21647151

Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

DEFF Research Database (Denmark)

Riess, O; Weber, B; Nørremølle, Anne

1992-01-01

as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

Science.gov (United States)

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

2012-01-01

PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

The study of mutability of RYS2 gene in diploid yeast Saccharomyces

International Nuclear Information System (INIS)

Chernov, Yu.O.; Gordenin, D.A.; Soldatov, S.P.; Glazer, V.M.

1985-01-01

More than 3000 spontaneous X-ray and ultraviolet-radiation induced mutants have been obtained by LYSD gene in haploid and diploid yeast Saccharcomyces. Mutants were selected using Chattu et cet. method. Comparison of mutant frequency in haploidy and diploidy and analysis of pho 1 marker closely related with LYS2 gene allow to conclude that the main mechanism causing spontaneous and induced mutants in diploidy is mutation of LYS2 gene in one of homologues and the following mitotic homozygotization of originating mutation

[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

Science.gov (United States)

Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

2018-02-10

OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

Directory of Open Access Journals (Sweden)

Shuai Wang

Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

Process and genes for expression and overexpression of active [FeFe] hydrogenases

Science.gov (United States)

Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L

2014-09-16

A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.

The orthologue of Sjögren's syndrome nuclear autoantigen 1 (SSNA1 in Trypanosoma brucei is an immunogenic self-assembling molecule.

Directory of Open Access Journals (Sweden)

Helen P Price

Full Text Available Primary Sjögren's Syndrome (PSS is a highly prevalent autoimmune disease, typically manifesting as lymphocytic infiltration of the exocrine glands leading to chronically impaired lacrimal and salivary secretion. Sjögren's Syndrome nuclear autoantigen 1 (SSNA1 or NA14 is a major specific target for autoantibodies in PSS but the precise function and clinical relevance of this protein are largely unknown. Orthologues of the gene are absent from many of the commonly used model organisms but are present in Chlamyodomonas reinhardtii (in which it has been termed DIP13 and most protozoa. We report the functional characterisation of the orthologue of SSNA1 in the kinetoplastid parasite, Trypanosoma brucei. Both TbDIP13 and human SSNA1 are small coiled-coil proteins which are predicted to be remote homologues of the actin-binding protein tropomyosin. We use comparative proteomic methods to identify potential interacting partners of TbDIP13. We also show evidence that TbDIP13 is able to self-assemble into fibril-like structures both in vitro and in vivo, a property which may contribute to its immunogenicity. Endogenous TbDIP13 partially co-localises with acetylated α-tubulin in the insect procyclic stage of the parasite. However, deletion of the DIP13 gene in cultured bloodstream and procyclic stages of T. brucei has little effect on parasite growth or morphology, indicating either a degree of functional redundancy or a function in an alternative stage of the parasite life cycle.

Genetics Home Reference: Costello syndrome

Science.gov (United States)

... other genetic conditions, cardiofaciocutaneous syndrome (CFC syndrome) and Noonan syndrome . In affected infants, it can be difficult to ... These individuals may actually have CFC syndrome or Noonan syndrome , which are caused by mutations in related genes. ...

Assessment of a 44 gene classifier for the evaluation of chronic fatigue syndrome from peripheral blood mononuclear cell gene expression.

Directory of Open Access Journals (Sweden)

Daniel Frampton

Full Text Available Chronic fatigue syndrome (CFS is a clinically defined illness estimated to affect millions of people worldwide causing significant morbidity and an annual cost of billions of dollars. Currently there are no laboratory-based diagnostic methods for CFS. However, differences in gene expression profiles between CFS patients and healthy persons have been reported in the literature. Using mRNA relative quantities for 44 previously identified reporter genes taken from a large dataset comprising both CFS patients and healthy volunteers, we derived a gene profile scoring metric to accurately classify CFS and healthy samples. This metric out-performed any of the reporter genes used individually as a classifier of CFS.To determine whether the reporter genes were robust across populations, we applied this metric to classify a separate blind dataset of mRNA relative quantities from a new population of CFS patients and healthy persons with limited success. Although the metric was able to successfully classify roughly two-thirds of both CFS and healthy samples correctly, the level of misclassification was high. We conclude many of the previously identified reporter genes are study-specific and thus cannot be used as a broad CFS diagnostic.

Causes of Cancer Death Among First-Degree Relatives in Japanese Families with Lynch Syndrome.

Science.gov (United States)

Tanakaya, Kohji; Yamaguchi, Tatsuro; Ishikawa, Hideki; Hinoi, Takao; Furukawa, Yoichi; Hirata, Keiji; Saida, Yoshihisa; Shimokawa, Mototsugu; Arai, Masami; Matsubara, Nagahide; Tomita, Naohiro; Tamura, Kazuo; Sugano, Kokichi; Ishioka, Chikashi; Yoshida, Teruhiko; Ishida, Hideyuki; Watanabe, Toshiaki; Sugihara, Kenichi

2016-04-01

To elucidate the causes of cancer death in Japanese families with Lynch syndrome (LS). The distributions of cancer deaths in 485 individuals from 67 families with LS (35, 30, and two families with MutL homologue 1 (MLH1), MSH2, and MSH6 gene mutations, respectively), obtained from the Registry of the Japanese Society for Cancer of the Colon and Rectum were analyzed. Among 98 cancer deaths of first-degree relatives of unknown mutation status, 53%, 19%, 13% (among females), 7% (among females) and 5% were due to colorectal, gastric, uterine, ovarian, and hepatobiliary cancer, respectively. The proportion of deaths from extra-colonic cancer was significantly higher in families with MSH2 mutation than in those with MLH1 mutation (p=0.003). In addition to colonic and uterine cancer, management and surveillance targeting gastric, ovarian and hepatobiliary cancer are considered important for Japanese families with LS. Extra-colonic cancer in families with MSH2 mutation might require for more intensive surveillance. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The light gene of Drosophila melanogaster encodes a homologue of VPS41, a yeast gene involved in cellular-protein trafficking.

Science.gov (United States)

Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M

1998-04-01

Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.

5p13 microduplication syndrome: a new case and better clinical definition of the syndrome.

Science.gov (United States)

Novara, Francesca; Alfei, Enrico; D'Arrigo, Stefano; Pantaleoni, Chiara; Beri, Silvana; Achille, Valentina; Sciacca, Francesca L; Giorda, Roberto; Zuffardi, Orsetta; Ciccone, Roberto

2013-01-01

Chromosome 5p13 duplication syndrome (OMIM #613174), a contiguous gene syndrome involving duplication of several genes on chromosome 5p13 including NIPBL (OMIM 608667), has been described in rare patients with developmental delay and learning disability, behavioral problems and peculiar facial dysmorphisms. 5p13 duplications described so far present with variable sizes, from 0.25 to 13.6 Mb, and contain a variable number of genes. Here we report another patient with 5p13 duplication syndrome including NIPBL gene only. Proband's phenotype overlapped that reported in patients with 5p13 microduplication syndrome and especially that of subjects with smaller duplications. Moreover, we better define genotype-phenotype relationship associated with this duplication and confirmed that NIPBL was likely the major dosage sensitive gene for the 5p13 microduplication phenotype. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Co-existence of Blau syndrome and NAID? Diagnostic challenges associated with presence of multiple pathogenic variants in NOD2 gene: a case report.

Science.gov (United States)

Dziedzic, Magdalena; Marjańska, Agata; Bąbol-Pokora, Katarzyna; Urbańczyk, Anna; Grześk, Elżbieta; Młynarski, Wojciech; Kołtan, Sylwia

2017-07-27

Pediatric autoinflammatory diseases are rare and still poorly understood conditions resulting from defective genetic control of innate immune system, inter alia from anomalies of NOD2 gene. The product of this gene is Nod2 protein, taking part in maintenance of immune homeostasis. Clinical form of resultant autoinflammatory condition depends on NOD2 genotype; usually patients with NOD2 defects present with Blau syndrome, NOD2-associated autoinflammatory disease (NAID) or Crohn's disease. We present the case of a 7-year-old girl with co-existing symptoms of two rare diseases, Blau syndrome and NAID. Overlapping manifestations of two syndromes raised a significant diagnostic challenge, until next-generation molecular test (NGS) identified presence of three pathogenic variants of NOD2 gene: P268S, IVS8 +158 , 1007 fs, and established the ultimate diagnosis. Presence of multiple genetical abnormalities resulted in an ambiguous clinical presentation with overlapping symptoms of Blau syndrome and NAID. Final diagnosis of autoinflammatory disease opened new therapeutic possibilities, including the use of biological treatments.

MELAS syndrome associated with a new mitochondrial tRNA-Val gene mutation (m.1616A>G).

Science.gov (United States)

Toyoshima, Yuka; Tanaka, Yuji; Satomi, Kazuo

2017-09-11

We describe the case of a 40-year-old-man with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, with cardiomyopathy and severe heart failure. He had a mitochondrial transfer RNA (tRNA) mutation (m.1616A>G) of the (tRNA-Val) gene, and it was not found in MELAS syndrome ever before. The presence of this newly observed tRNA-Val mutation (m.1616A>G) may induce multiple respiratory chain enzyme deficiencies and contribute to MELAS syndrome symptoms that are associated with mitochondrial DNA (mtDNA) mutations. We report that the pathognomonic symptom in MELAS syndrome caused by this newly observed mtDNA mutation may be rapid progression of cardiomyopathy and severe heart failure. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Comprehensive screening of the USH2A gene in Usher syndrome type II and non-syndromic recessive retinitis pigmentosa.

Science.gov (United States)

Seyedahmadi, Babak Jian; Rivolta, Carlo; Keene, Julia A; Berson, Eliot L; Dryja, Thaddeus P

2004-08-01

A screen of the entire coding region of the USH2A gene in 129 unrelated patients with Usher syndrome type II (USH2) and in 146 unrelated patients with non-syndromic autosomal recessive retinitis pigmentosa (ARRP) uncovered 54 different sequence variations, including 18 likely pathogenic mutations (13 frameshift, three nonsense, and two missense), 12 changes of uncertain pathogenicity (11 missense changes and one in-frame deletion), and 24 non-pathogenic rare variants or polymorphisms. Of the 18 likely pathogenic mutations, nine were novel. Among the USH2 patients, 50 (39%) had one or two likely pathogenic mutations. The most common mutant allele in USH2 patients was E767fs, which was found in 29 patients, including one homozygote. Among the ARRP patients, we found 17 (12%) with one or two likely pathogenic mutations. The most common mutant allele in ARRP patients was C759F and it was found in 10 patients. The C759F allele was also found in two USH2 patients; in neither of them was a change in the other allele found. The second most common mutant allele in both patient groups was L1447fs (found in 6/50 USH2 patients and 6/17 ARRP patients). Of the 50+17=67 patients with identified USH2A mutations, only one mutation in one allele was found in 41+12=53 (79%); the reason for the high proportion of patients with only one identified mutation is obscure. Our results indicate that USH2A mutations are found in about 7% of all cases of RP in North America, a frequency similar to the RPGR gene (8%) and the rhodopsin gene (10%).

A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression

Science.gov (United States)

Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel

2014-01-01

Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene

Concomitant mutation and epimutation of the MLH1 gene in a Lynch syndrome family.

Science.gov (United States)

Cini, Giulia; Carnevali, Ileana; Quaia, Michele; Chiaravalli, Anna Maria; Sala, Paola; Giacomini, Elisa; Maestro, Roberta; Tibiletti, Maria Grazia; Viel, Alessandra

2015-04-01

Lynch syndrome (LS) is an inherited predisposition cancer syndrome, typically caused by germline mutations in the mismatch repair genes MLH1, MSH2, MSH6 and PMS2. In the last years, a role for epimutations of the same genes has also been reported. MLH1 promoter methylation is a well known mechanism of somatic inactivation in tumors, and more recently, several cases of constitutional methylation have been identified. In four subjects affected by multiple tumors and belonging to a suspected LS family, we detected a novel secondary MLH1 gene epimutation. The methylation of MLH1 promoter was always linked in cis with a 997 bp-deletion (c.-168_c.116+713del), that removed exon 1 and partially involved the promoter of the same gene. Differently from cases with constitutional primary MLH1 inactivation, this secondary methylation was allele-specific and CpGs of the residual promoter region were totally methylated, leading to complete allele silencing. In the colon tumor of the proband, MLH1 and PMS2 expression was completely lost as a consequence of a pathogenic somatic point mutation (MLH1 c.199G>A, p.Gly67Arg) that also abrogated local methylation by destroying a CpG site. The evidences obtained highlight how MLH1 mutations and epimutations can reciprocally influence each other and suggest that an altered structure of the MLH1 locus results in epigenetic alteration. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Deletions at the SOX10 gene locus cause Waardenburg syndrome types 2 and 4.

Science.gov (United States)

Bondurand, Nadege; Dastot-Le Moal, Florence; Stanchina, Laure; Collot, Nathalie; Baral, Viviane; Marlin, Sandrine; Attie-Bitach, Tania; Giurgea, Irina; Skopinski, Laurent; Reardon, William; Toutain, Annick; Sarda, Pierre; Echaieb, Anis; Lackmy-Port-Lis, Marilyn; Touraine, Renaud; Amiel, Jeanne; Goossens, Michel; Pingault, Veronique

2007-12-01

Waardenburg syndrome (WS) is an auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair and skin. Depending on additional symptoms, WS is classified into four subtypes, WS1-WS4. Absence of additional features characterizes WS2. The association of facial dysmorphic features defines WS1 and WS3, whereas the association with Hirschsprung disease (aganglionic megacolon) characterizes WS4, also called "Waardenburg-Hirschsprung disease." Mutations within the genes MITF and SNAI2 have been identified in WS2, whereas mutations of EDN3, EDNRB, and SOX10 have been observed in patients with WS4. However, not all cases are explained at the molecular level, which raises the possibility that other genes are involved or that some mutations within the known genes are not detected by commonly used genotyping methods. We used a combination of semiquantitative fluorescent multiplex polymerase chain reaction and fluorescent in situ hybridization to search for SOX10 heterozygous deletions. We describe the first characterization of SOX10 deletions in patients presenting with WS4. We also found SOX10 deletions in WS2 cases, making SOX10 a new gene of WS2. Interestingly, neurological phenotypes reminiscent of that observed in WS4 (PCWH syndrome [peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung disease]) were observed in some WS2-affected patients with SOX10 deletions. This study further characterizes the molecular complexity and the close relationship that links the different subtypes of WS.

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse)

Science.gov (United States)

Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.

1997-01-01

Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans. PMID:9371826

A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse).

Science.gov (United States)

Zhou, Y; Xu, B C; Maheshwari, H G; He, L; Reed, M; Lozykowski, M; Okada, S; Cataldo, L; Coschigamo, K; Wagner, T E; Baumann, G; Kopchick, J J

1997-11-25

Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans.

Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

International Nuclear Information System (INIS)

Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

1997-01-01

Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

Xp21 contiguous gene syndromes: Deletion quantitation with bivariate flow karyotyping allows mapping of patient breakpoints

Energy Technology Data Exchange (ETDEWEB)

McCabe, E.R.B.; Towbin, J.A. (Baylor College of Medicine, Houston, TX (United States)); Engh, G. van den; Trask, B.J. (Lawrence Livermore National Lab., CA (United States))

1992-12-01

Bivariate flow karyotyping was used to estimate the deletion sizes for a series of patients with Xp21 contiguous gene syndromes. The deletion estimates were used to develop an approximate scale for the genomic map in Xp21. The bivariate flow karyotype results were compared with clinical and molecular genetic information on the extent of the patients' deletions, and these various types of data were consistent. The resulting map spans >15 Mb, from the telomeric interval between DXS41 (99-6) and DXS68 (1-4) to a position centromeric to the ornithine transcarbamylase locus. The deletion sizing was considered to be accurate to [plus minus]1 Mb. The map provides information on the relative localization of genes and markers within this region. For example, the map suggests that the adrenal hypoplasia congenita and glycerol kinase genes are physically close to each other, are within 1-2 Mb of the telomeric end of the Duchenne muscular dystrophy (DMD) gene, and are nearer to the DMD locus than to the more distal marker DXS28 (C7). Information of this type is useful in developing genomic strategies for positional cloning in Xp21. These investigations demonstrate that the DNA from patients with Xp21 contiguous gene syndromes can be valuable reagents, not only for ordering loci and markers but also for providing an approximate scale to the map of the Xp21 region surrounding DMD. 44 refs., 3 figs.

Intragenic deletions affecting two alternative transcripts of the IMMP2L gene in patients with Tourette syndrome

Science.gov (United States)

Bertelsen, Birgitte; Melchior, Linea; Jensen, Lars R; Groth, Camilla; Glenthøj, Birte; Rizzo, Renata; Debes, Nanette Mol; Skov, Liselotte; Brøndum-Nielsen, Karen; Paschou, Peristera; Silahtaroglu, Asli; Tümer, Zeynep

2014-01-01

Tourette syndrome is a neurodevelopmental disorder characterized by multiple motor and vocal tics, and the disorder is often accompanied by comorbidities such as attention-deficit hyperactivity-disorder and obsessive compulsive disorder. Tourette syndrome has a complex etiology, but the underlying environmental and genetic factors are largely unknown. IMMP2L (inner mitochondrial membrane peptidase, subunit 2) located on chromosome 7q31 is one of the genes suggested as a susceptibility factor in disease pathogenesis. Through screening of a Danish cohort comprising 188 unrelated Tourette syndrome patients for copy number variations, we identified seven patients with intragenic IMMP2L deletions (3.7%), and this frequency was significantly higher (P=0.0447) compared with a Danish control cohort (0.9%). Four of the seven deletions identified did not include any known exons of IMMP2L, but were within intron 3. These deletions were found to affect a shorter IMMP2L mRNA species with two alternative 5′-exons (one including the ATG start codon). We showed that both transcripts (long and short) were expressed in several brain regions, with a particularly high expression in cerebellum and hippocampus. The current findings give further evidence for the role of IMMP2L as a susceptibility factor in Tourette syndrome and suggest that intronic changes in disease susceptibility genes should be investigated further for presence of alternatively spliced exons. PMID:24549057

New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

Science.gov (United States)

Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

2006-09-01

Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

DEFF Research Database (Denmark)

Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

2006-01-01

A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

A novel mutation of the adrenocorticotropin receptor (ACTH-R) gene in a family with the syndrome of isolated glucocorticoid deficiency, but no ACTH-R abnormalities in two families with the triple A syndrome

Energy Technology Data Exchange (ETDEWEB)

Tsigos, C.; Arai, K.; Latronico, A.C. [National Inst. of Child Health and Human Development, Bethesda, MD (United States)]|[Temple Univ. School of Medicine, Philadelphia, PA (United States)]|[Children`s Hospital of New Jersey, Newark, NJ (United States)] [and others

1995-07-01

Isolated glucocorticoid deficiency (IGD) is an autosomal recessive disorder characterized by primary adrenocortical insufficiency, usually without mineralocorticoid deficiency. Occasionally, the disorder is associated with alacrima and achalasia of the esophagus (triple A syndrome), suggesting potential heterogeneity in its etiology. Mutations in the ACTH receptor gene have been reported in several families with IGD. We have amplified and directly sequenced the entire intronless ACTH receptor gene in 1 other family with IGD and 2 famlies with triple A syndrome. The proband with IGD was a homozygote for an A {r_arrow}G substitution, changing tyrosine 254 to cysteine in the third extracellular loop of the receptor protein, probably interfering with ligand binding. Both of her parents were heterozygotes for this mutation, which was not detected in 100 normal alleles. No mutations were identified in the entire coding area of the ACTH receptor in the 2 families with triple A syndrome, supporting the idea of a developmental or postreceptor defect in this syndrome. 19 refs., 1 fig.

MSX ₁ gene variant and non-syndromic clefting: association or rejection?

Science.gov (United States)

Reddy, Naveen Admala; Gopinath, Adusumilli; Reddy, Jayaprakash Thirumala; Devanna, Raghu; Saravanan, Pichai; Rohra, Mayur G

2014-01-01

Non-syndromic cleft lip/palate (NSCL/P) is a congenital anomaly with significant medical, psychological and social ramifications. There is sufficient evidence to hypothesize that locus for this condition can be identified by candidate genes. The aim of this study is to amplify the chosen region (799 G >T) of MSX 1 gene, investigate the degree of association and perform a mutation research from Raichur cleft lip and palate patient sample. Case history and clinical examination of the patient were recorded to rule. Written consent was obtained from patients and controls for in vivo study. STUDY WAS DESIGNED IN FOUR STEPS AS FOLLOWS: a. Collection of a blood sample; b. Genomic deoxyribonucleic acid (DNA) extraction; c. Polymerase chain reaction (PCR); d. Restriction fragment length polymorphism (RFLP). Blood samples were collected from 50 subjects having NSCL/P and 50 controls. Genomic DNA was extracted, PCR and RFLP was performed for digestion products that were evaluated. Chi-square test with P value at 95% confidence intervals. The results showed a positive correlation between MSX 1 799 G >T gene variant and NSCL/P patients in Raichur patients. From a genetically diverse etiology MSX 1 799 G >T gene variant may be a good screening marker for NSCL/P in Raichur patients.

Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa

OpenAIRE

García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J.; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M.

2014-01-01

Purpose The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. Methods The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was...

Genetics Home Reference: Marfan syndrome

Science.gov (United States)

... Share: Email Facebook Twitter Home Health Conditions Marfan syndrome Marfan syndrome Printable PDF Open All Close All Enable Javascript ... Marfan syndrome KidsHealth from Nemours Foundation MalaCards: marfan syndrome Orphanet: Marfan syndrome Your Genes Your Health from Cold Spring ...

A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

NARCIS (Netherlands)

Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

2012-01-01

De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

Metabolic syndrome, diabetes and atherosclerosis: Influence of gene-environment interaction

Energy Technology Data Exchange (ETDEWEB)

Andreassi, Maria Grazia, E-mail: andreas@ifc.cnr.it [CNR Institute of Clinical Physiology, G. Pasquinucci Hospital, Via Aurelia Sud, Massa (Italy)

2009-07-10

Despite remarkable progress in diagnosis and understanding of risk factors, cardiovascular disease (CVD) remains still the leading cause of morbidity and mortality in the world's developed countries. The metabolic syndrome, a cluster of risk factors (visceral obesity, insulin resistance, dyslipidaemia, and hypertension), is increasingly being recognized as a new risk factor for type 2 diabetes and atherosclerotic cardiovascular disease. Nevertheless, there is wide variation in both the occurrence of disease and age of onset, even in individuals who display very similar risk profiles. There is now compelling evidence that a complex interplay between genetic determinants and environmental factors (still largely unknown) is the reason for this large inter-individual variation in disease susceptibility. The purpose of the present review is to describe the current status of our knowledge concerning the gene-environment interactions potentially implicated in the pathogenesis of metabolic syndrome, diabetes and cardiovascular disease. It focuses predominantly on studies of genes (peroxisome proliferator-activated receptor-gamma, alcohol dehydrogenase type 1C, apolipoprotein E, glutathione S-transferases T1 and M1) that are known to be modified by dietary and lifestyle habits (fat diet, intake of alcohol and smoking habit). It also describes the limited current understanding of the role of genetic variants of xenobiotic metabolizing enzymes and their interactions with environmental toxicants. Additional studies are needed in order to clarify whether inter-individual differences in detoxification of environmental toxicants may have an essential role in the development of CVD and contribute to the emerging field of 'environmental cardiology'. Such knowledge may be particularly relevant for improving cardiovascular risk stratification and conceiving the development of 'personalized intervention program'.

Metabolic syndrome, diabetes and atherosclerosis: Influence of gene-environment interaction

International Nuclear Information System (INIS)

Andreassi, Maria Grazia

2009-01-01

Despite remarkable progress in diagnosis and understanding of risk factors, cardiovascular disease (CVD) remains still the leading cause of morbidity and mortality in the world's developed countries. The metabolic syndrome, a cluster of risk factors (visceral obesity, insulin resistance, dyslipidaemia, and hypertension), is increasingly being recognized as a new risk factor for type 2 diabetes and atherosclerotic cardiovascular disease. Nevertheless, there is wide variation in both the occurrence of disease and age of onset, even in individuals who display very similar risk profiles. There is now compelling evidence that a complex interplay between genetic determinants and environmental factors (still largely unknown) is the reason for this large inter-individual variation in disease susceptibility. The purpose of the present review is to describe the current status of our knowledge concerning the gene-environment interactions potentially implicated in the pathogenesis of metabolic syndrome, diabetes and cardiovascular disease. It focuses predominantly on studies of genes (peroxisome proliferator-activated receptor-gamma, alcohol dehydrogenase type 1C, apolipoprotein E, glutathione S-transferases T1 and M1) that are known to be modified by dietary and lifestyle habits (fat diet, intake of alcohol and smoking habit). It also describes the limited current understanding of the role of genetic variants of xenobiotic metabolizing enzymes and their interactions with environmental toxicants. Additional studies are needed in order to clarify whether inter-individual differences in detoxification of environmental toxicants may have an essential role in the development of CVD and contribute to the emerging field of 'environmental cardiology'. Such knowledge may be particularly relevant for improving cardiovascular risk stratification and conceiving the development of 'personalized intervention program'.

Pitt-Hopkins syndrome: report of a case with a TCF4 gene mutation

Directory of Open Access Journals (Sweden)

Orsini Alessandro

2010-02-01

Full Text Available Abstract Aims We will discuss the clinical and genetic diagnosis of a child with severe psychomotor delay, who at 3 years of age presented with paroxysms of hyperpnea-apnea and seizures unrelated to breathing anomalies. Methods The child underwent genetic (karyotype, FISH telomeres and neuroradiological (cranial CT and MRI tests, which proved to be normal. He came under our clinical observation at 3 years and 5 months of age. Due to severe psychomotor delay and facial dysmorphisms we completed the genetic investigations based on his clinical feature and analysis of the available literature. Results The presence of severe mental retardation associated with anomalous breathing pattern may suggest the Joubert and Rett syndrome, however these were excluded on the basis of clinical and genetic examination. Angelman syndrome, suspected for facial dysmorphisms and absent language, was also excluded because of the presence of a normal pattern of methylation at SNRPN locus. Another possible diagnosis was the Pitt-Hopkins Syndrome (PHS, characterized by severe mental retardation, breathing anomalies (paroxisms of hyperpnea-apnea, dysmorphisms and sometimes epilepsy. Haploinsufficiency of TCF4 gene located at 18q21.2 region has been recently identified as causative of this syndrome. In our patient the research of TCF4 mutation by the Institute of Human Genetics, University Hospital Erlangen (Germany, showed a de novo mutation. Conclusions The diagnosis of Pitt-Hopkins syndrome, an underdiagnosed cause of mental retardation, was based on clinical and genetic findings. Searching for TCF4 mutations is highly recommended when others overlapping syndromes was excluded. At our knowledge our patient is the first italian case of PHS diagnosed at molecular level.

1p13.2 deletion displays clinical features overlapping Noonan syndrome, likely related to NRAS gene haploinsufficiency

Directory of Open Access Journals (Sweden)

Natália Duarte Linhares

Full Text Available Abstract Deletion-induced hemizygosity may unmask deleterious autosomal recessive variants and be a cause of the phenotypic variability observed in microdeletion syndromes. We performed complete exome sequencing (WES analysis to examine this possibility in a patient with 1p13.2 microdeletion. Since the patient displayed clinical features suggestive of Noonan Syndrome (NS, we also used WES to rule out the presence of pathogenic variants in any of the genes associated with the different types of NS. We concluded that the clinical findings could be attributed solely to the 1p13.2 haploinsufficiency. Retrospective analysis of other nine reported patients with 1p13.2 microdeletions showed that six of them also presented some characteristics of NS. In all these cases, the deleted segment included the NRAS gene. Gain-of-function mutations of NRAS gene are causally related to NS type 6. Thus, it is conceivable that NRAS haploinsufficiency and gain-of-function mutations may have similar clinical consequences. The same phenomenon has been described for two other genes belonging to the Ras/MAPK pathway: MAP2K2 and SHOC2. In conclusion, we here report genotype-phenotype correlations in patients with chromosome 1p13.2 microdeletions and we propose that NRAS may be a critical gene for the NS characteristics in the patients.

A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

Science.gov (United States)

Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

2013-03-01

Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome.

Analysis of gene expression profile microarray data in complex regional pain syndrome.

Science.gov (United States)

Tan, Wulin; Song, Yiyan; Mo, Chengqiang; Jiang, Shuangjian; Wang, Zhongxing

2017-09-01

The aim of the present study was to predict key genes and proteins associated with complex regional pain syndrome (CRPS) using bioinformatics analysis. The gene expression profiling microarray data, GSE47603, which included peripheral blood samples from 4 patients with CRPS and 5 healthy controls, was obtained from the Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) in CRPS patients compared with healthy controls were identified using the GEO2R online tool. Functional enrichment analysis was then performed using The Database for Annotation Visualization and Integrated Discovery online tool. Protein‑protein interaction (PPI) network analysis was subsequently performed using Search Tool for the Retrieval of Interaction Genes database and analyzed with Cytoscape software. A total of 257 DEGs were identified, including 243 upregulated genes and 14 downregulated ones. Genes in the human leukocyte antigen (HLA) family were most significantly differentially expressed. Enrichment analysis demonstrated that signaling pathways, including immune response, cell motion, adhesion and angiogenesis were associated with CRPS. PPI network analysis revealed that key genes, including early region 1A binding protein p300 (EP300), CREB‑binding protein (CREBBP), signal transducer and activator of transcription (STAT)3, STAT5A and integrin α M were associated with CRPS. The results suggest that the immune response may therefore serve an important role in CRPS development. In addition, genes in the HLA family, such as HLA‑DQB1 and HLA‑DRB1, may present potential biomarkers for the diagnosis of CRPS. Furthermore, EP300, its paralog CREBBP, and the STAT family genes, STAT3 and STAT5 may be important in the development of CRPS.

[Mutational frequencies in usherin(USH2A gene) in 26 Colombian individuals with Usher syndrome type II].

Science.gov (United States)

López, Greizy; Gelvez, Nancy Yaneth; Tamayo, Martalucía

2011-03-01

Usher syndrome is a disorder characterized by progressive retinitis pigmentosa, prelingual sensory hearing loss and vestibular dysfunction. It is the most frequent cause of deaf-blindness in humans. Three clinical types and twelve genetic subtypes have been characterized. Type II is the most common, and among these cases, nearly 80% have mutations in the USH2A gene. The aim of the study was to establish the mutational frequencies for the short isoform of USH2A gene in Usher syndrome type II. Twenty-six Colombian individuals with Usher syndrome type II were included. SSCP analysis for 20 exons of the short isoform was performed and abnormal patterns were sequenced. Sequencing of exon 13 of the USH2A gene was performed for all the individuals because the most frequent mutation is located in this exon. The most frequent mutation was c.2299delG, identified in the 27% (n=8) of the sample. The second mutation, p.R334W, showed a frequency of 15%. A new variant identified in the 5’UTR region, g.129G>T, was present in 1 individual (4%). Four polymorphisms were identified; one of them is a new deletion in exon 20, first reported in this study. Mutations in the usherin short isoform were identified in 38% of a sample of 26 USH2 cases. Molecular diagnosis was established in 7 of the 26.

Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

Science.gov (United States)

Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

2007-07-01

Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.

Science.gov (United States)

Ponti, G; Ponz de Leon, M; Maffei, S; Pedroni, M; Losi, L; Di Gregorio, C; Gismondi, V; Scarselli, A; Benatti, P; Roncari, B; Seidenari, S; Pellacani, G; Varotti, C; Prete, E; Varesco, L; Roncucci, L

2005-11-01

Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.Peculiar dermatologic manifestations are present in several heritable gastrointestinal disorders. Muir-Torre syndrome (MTS) is a genodermatosis whose peculiar feature is the presence of sebaceous gland tumors associated with visceral malignancies. We describe one patient in whom multiple sebaceous gland tumors were associated with early onset colon and thyroid cancers and attenuated polyposis coli. Her family history was positive for colonic adenomas. She had a daughter presenting with yellow papules in the forehead region developed in the late infancy. Skin and visceral neoplasms were tested for microsatellite instability and immunohistochemical status of mismatch repair (MMR), APC and MYH proteins. The proband colon and skin tumors were microsatellite stable and showed normal expression of MMR proteins. Cytoplasmic expression of MYH protein was revealed in colonic cancer cells. Compound heterozygosity due to biallelic mutations in MYH, R168H and 379delC, was identified in the proband. The 11-year-old daughter was carrier of the monoallelic constitutional mutation 379delC in the MYH gene; in the sister, the R168H MYH gene mutation was detected. This report presents an interesting case of association between MYH-associated polyposis and sebaceous gland tumors. These findings suggest that patients with MTS phenotype that include colonic polyposis should be screened for MYH gene mutations.

Juvenile Leigh syndrome, optic atrophy, ataxia, dystonia, and epilepsy due to T14487C mutation in the mtDNA-ND6 gene: a mitochondrial syndrome presenting from birth to adolescence.

Science.gov (United States)

Leshinsky-Silver, Esther; Shuvalov, Ruslan; Inbar, Shani; Cohen, Sarit; Lev, Dorit; Lerman-Sagie, Tally

2011-04-01

An increasing number of reports describe mutations in mitochondrial DNA coding regions, especially in mitochondrial DNA- encoded nicotinamide adenine dinucleotide dehydrogenase subunit genes of the respiratory chain complex I, as causing early-onset Leigh syndrome. The authors report the molecular findings in a 24-year-old patient with juvenile-onset Leigh syndrome presenting with optic atrophy, ataxia dystonia, and epilepsy. A brain magnetic resonance imaging revealed bilateral basal ganglia and thalamic hypointensities, and a magnetic resonance spectroscopy revealed an increased lactate peak. The authors identified a T14487C change causing M63V substitution in the mitochondrial ND6 gene. The mutation was heteroplasmic in muscle and blood samples, with different mutation loads, and was absent in the patient's mother's urine and blood samples. They suggest that the T14487C mtDNA mutation should be analyzed in Leigh syndrome, presenting with optic atrophy, ataxia, dystonia, and epilepsy, regardless of age.

Genetic Alterations within the DENND1A Gene in Patients with Polycystic Ovary Syndrome (PCOS)

DEFF Research Database (Denmark)

Eriksen, Mette B; Nielsen, Michael F B; Brusgaard, Klaus

2013-01-01

sequencing. SNP genotyping was tested by allelic discrimination in real-time PCR in the additional patients and controls. Sequencing of the DENND1A gene identified eight SNPs; seven were not known to be associated with any diseases. One missense SNP was detected (rs189947178, A/C), potentially altering......Polycystic ovary syndrome (PCOS), the most common endocrine disease among premenopausal women, is caused by both genes and environment. We and others previously reported association between single nucleotide polymorphisms (SNPs) in the DENND1A gene and PCOS. We therefore sequenced the DENND1A gene...... and FG-score or PCOS diagnosis, this could be a false positive finding. In conclusion, sequence analysis of the DENND1A gene of patients with PCOS did not identify alterations that alone could be responsible for the PCOS pathogenesis, but a missense SNP (rs189947178) was identified in one patient...

Same MSH2 Gene Mutation But Variable Phenotypes in 2 Families With Lynch Syndrome: Two Case Reports and Review of Genotype-Phenotype Correlation.

Science.gov (United States)

Liccardo, Raffaella; De Rosa, Marina; Duraturo, Francesca

2018-01-01

Lynch syndrome is an autosomal dominant syndrome that can be subdivided into Lynch syndrome I, or site-specific colonic cancer, and Lynch syndrome II, or extracolonic cancers, particularly carcinomas of the stomach, endometrium, biliary and pancreatic systems, and urinary tract. Lynch syndrome is associated with point mutations and large rearrangements in DNA MisMatch Repair ( MMR ) genes. This syndrome shows a variable phenotypic expression in people who carry pathogenetic mutations. So far, a correlation in genotype-phenotype has not been definitely established. In this study, we describe 2 Lynch syndrome cases presenting with the same genotype but different phenotypes and discuss possible reasons for this.

Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

Science.gov (United States)

Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

2017-09-01

Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

Unusual presentation of Kallmannn syndrome with contiguous gene deletion in three siblings of a family

Directory of Open Access Journals (Sweden)

Sri Venkat Madhu

2012-01-01

Full Text Available We report the case of 3 brothers aged 34, 24, and 22 years, unmarried, who presented to our endocrinology clinic with absence of secondary sexual characters. There was no such history in other siblings, but their maternal uncle had similar complaints. On examination, all 3 had pre-pubertal appearance, voice, and genitalia along with anosmia and bimanual synkinesia. Cryptorchidism was noticed in 2 while third person had small hypoplastic testes. It was also noted that all 3 patients had icthyosis mainly involving trunk, back, and limbs. The hormonal assays were consistent with isolated hypogonadotrophic hypogonadism. IQ testing revealed mental retardation in the 2 patients. Ultrasound showed ectopic right kidney in one patient, atrophic right kidney in the second patient while the third patient had normal kidneys. MRI brain of all the patients showed poorly visualized olfactory tract and bulb. Kallmann syndrome (KS was diagnosed based on hormonal evaluation and MRI results. Of the four types of KS: Synkinesia, renal anomaly, and X-linked pedigree pattern in our patients pointed towards X-linked type 1 KS as the possible cause. But, icthyosis and mental retardation are not usual presentation of type 1 KS. They are usually seen as a result of contiguous gene deletion of KAL1, steroid sulfatase (STS, and mental retardation (MRX gene on X chromosome. Hence, the possible gene defect in our cases is inherited defect in contiguous gene deletion. The contiguous gene deletion as the cause of KS in 3 patients of same family is very rare and worth reporting. Also, the significance of phenotype-genotypic association in Kallmann syndrome is discussed

Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

Science.gov (United States)

Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

2012-10-18

Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

657del5 mutation of the NBS1 gene in myelodysplastic syndrome

Directory of Open Access Journals (Sweden)

Bunjevacki Vera

2014-01-01

Full Text Available Myelodysplastic syndromes (MDS are clonal hematologic stem cell disorders with an as yet unknown molecular pathology. Genetic instability has been proposed as a cause of MDS. Mutations in the NBS1 gene, whose product nibrin (p95 is involved in DNA damage repair and cell-cycle control, might be associated with an elevated predisposition to the development of MDS. The aim of the study was to examine truncating 5 bp deletion (657del5, the most frequent NBS1 gene mutation in Slavic populations, in MDS patients. Among 71 MDS patients, we found one case that was heterozygous for the NBS1 657del5 mutation. To the best of our knowledge, this is the first report of a NBS1 mutation in MDS. [Projekat Ministarstva nauke Republike Srbije, br. 175091

Disruption of the Arabidopsis CGI-58 homologue produces Chanarin–Dorfman-like lipid droplet accumulation in plants

OpenAIRE

James, Christopher N.; Horn, Patrick J.; Case, Charlene R.; Gidda, Satinder K.; Zhang, Daiyuan; Mullen, Robert T.; Dyer, John M.; Anderson, Richard G. W.; Chapman, Kent D.

2010-01-01

CGI-58 is the defective gene in the human neutral lipid storage disease called Chanarin-Dorfman syndrome. This disorder causes intracellular lipid droplets to accumulate in nonadipose tissues, such as skin and blood cells. Here, disruption of the homologous CGI-58 gene in Arabidopsis thaliana resulted in the accumulation of neutral lipid droplets in mature leaves. Mass spectroscopy of isolated lipid droplets from cgi-58 loss-of-function mutants showed they contain triacylglycerols with common...

Gene Therapy for the Retinal Degeneration of Usher Syndrome Caused by Mutations in MYO7A.

Science.gov (United States)

Lopes, Vanda S; Williams, David S

2015-01-20

Usher syndrome is a deaf-blindness disorder. One of the subtypes, Usher 1B, is caused by loss of function of the gene encoding the unconventional myosin, MYO7A. A variety of different viral-based delivery approaches have been tested for retinal gene therapy to prevent the blindness of Usher 1B, and a clinical trial based on one of these approaches has begun. This review evaluates the different approaches. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

Novel mutations in the long isoform of the USH2A gene in patients with Usher syndrome type II or non-syndromic retinitis pigmentosa.

Science.gov (United States)

McGee, Terri L; Seyedahmadi, Babak Jian; Sweeney, Meredith O; Dryja, Thaddeus P; Berson, Eliot L

2010-07-01

Usher syndrome type II (USH2) is an autosomal recessive disorder characterised by retinitis pigmentosa (RP) and mild to moderate sensorineural hearing loss. Mutations in the USH2A gene are the most common cause of USH2 and are also a cause of some forms of RP without hearing loss (ie, non-syndromic RP). The USH2A gene was initially identified as a transcript comprised of 21 exons but subsequently a longer isoform containing 72 exons was identified. The 51 exons unique to the long isoform of USH2A were screened for mutations among a core set of 108 patients diagnosed with USH2 and 80 patients with non-syndromic RP who were all included in a previously reported screen of the short isoform of USH2A. For several exons, additional patients were screened. In total, 35 deleterious mutations were identified including 17 nonsense mutations, 9 frameshift mutations, 5 splice-site mutations, and 4 small in-frame deletions or insertions. Twenty-seven mutations were novel. In addition, 65 rare missense changes were identified. A method of classifying the deleterious effect of the missense changes was developed using the summed results of four different mutation assessment algorithms, SIFT, pMUT, PolyPhen, and AGVGD. This system classified 8 of the 65 changes as 'likely deleterious' and 9 as 'possibly deleterious'. At least one mutation was identified in 57-63% of USH2 cases and 19-23% of cases of non-syndromic recessive RP (calculated without and including probable/possible deleterious changes) thus supporting that USH2A is the most common known cause of RP in the USA.

Characterization of ORF89 - A latency-related gene of white spot syndrome virus

International Nuclear Information System (INIS)

Hossain, M.S.; Khadijah, Siti; Kwang, Jimmy

2004-01-01

Open reading frame 89 (ORF89) is one of the three genes that are believed to be involved in the latent infection of white spot syndrome virus (WSSV). Here, we report the structure and functional characterization of ORF89. cDNA sequencing, 5' RLM-RACE, and 3' RLM-RACE showed that ORF89 gene is transcribed into an unspliced mRNA of 4436 nucleotides, which is predicted to encode a protein of 1437 amino acids. ORF89 expressed an approximately 165-kDa protein in Sf9 cells that localized in the nucleus. Amino acids 678-683 were found to be essential for nuclear localization. Cotransfection assays demonstrated that ORF89 protein repressed its own promoter as well as those of a protein kinase and the thymidine-thymidylate kinase genes of WSSV. SYBR Green real-time PCR indicated that the repression occurred at the transcriptional level

Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

Science.gov (United States)

Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

2001-10-01

Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

Science.gov (United States)

Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

2006-08-15

Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

When silence is noise: infantile-onset Barth syndrome caused by a synonymous substitution affecting TAZ gene transcription

NARCIS (Netherlands)

Ferri, L.; Dionisi-Vici, C.; Taurisano, R.; Vaz, F. M.; Guerrini, R.; Morrone, A.

2016-01-01

Barth syndrome (BTHS) is an X-linked inborn error of metabolism which affects males. The main manifestations are cardiomyopathy, myopathy, hypotonia, growth delay, intermittent neutropenia and 3-methylglutaconic aciduria. Diagnosis is confirmed by mutational analysis of the TAZ gene and biochemical

Phosphatase and tensin homolog (PTEN) gene mutations and autism: literature review and a case report of a patient with Cowden syndrome, autistic disorder, and epilepsy.

Science.gov (United States)

Conti, Sara; Condò, Maria; Posar, Annio; Mari, Francesca; Resta, Nicoletta; Renieri, Alessandra; Neri, Iria; Patrizi, Annalisa; Parmeggiani, Antonia

2012-03-01

Phosphatase and tensin homolog (PTEN) gene mutations are associated with a spectrum of clinical disorders characterized by skin lesions, macrocephaly, hamartomatous overgrowth of tissues, and an increased risk of cancers. Autism has rarely been described in association with these variable clinical features. At present, 24 patients with phosphatase and tensin homolog gene mutation, autism, macrocephaly, and some clinical findings described in phosphatase and tensin homolog syndromes have been reported in the literature. We describe a 14-year-old boy with autistic disorder, focal epilepsy, severe and progressive macrocephaly, and multiple papular skin lesions and palmoplantar punctate keratoses, characteristic of Cowden syndrome. The boy has a de novo phosphatase and tensin homolog gene mutation. Our patient is the first case described to present a typical Cowden syndrome and autism associated with epilepsy.

Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome previously diagnosed as Seckel syndrome: report of a novel mutation of the PCNT gene.

Science.gov (United States)

Piane, Maria; Della Monica, Matteo; Piatelli, Gianluca; Lulli, Patrizia; Lonardo, Fortunato; Chessa, Luciana; Scarano, Gioacchino

2009-11-01

We report on a 3-year-old boy with prenatal onset of proportionate dwarfism, postnatal severe microcephaly, high forehead with receded hairline, sparse scalp hair, beaked nose, mild retrognathia and hypotonia diagnosed at birth as Seckel syndrome. At age 3 years, he became paralyzed due to a cerebrovascular malformation. Based on the clinical and radiological features showing evidence of skeletal dysplasia, the diagnosis was revised to Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome. Western blot analysis of the patient's lymphoblastoid cell line lysate showed the absence of the protein pericentrin. Subsequent molecular analysis identified a novel homozygous single base insertion (c.1527_1528insA) in exon 10 of the PCNT gene, which leads to a frameshift (Treo510fs) and to premature protein truncation. PCNT mutations must be considered diagnostic of MOPD II syndrome. A possible role of pericentrin in the development of cerebral vessels is suggested. Copyright 2009 Wiley-Liss, Inc.

Catecholamine-related gene expression in blood correlates with tic severity in tourette syndrome.

Science.gov (United States)

Gunther, Joan; Tian, Yingfang; Stamova, Boryana; Lit, Lisa; Corbett, Blythe; Ander, Brad; Zhan, Xinhua; Jickling, Glen; Bos-Veneman, Netty; Liu, Da; Hoekstra, Pieter; Sharp, Frank

2012-12-30

Tourette syndrome (TS) is a heritable disorder characterized by tics that are decreased in some patients by treatment with alpha adrenergic agonists and dopamine receptor blockers. Thus, this study examines the relationship between catecholamine gene expression in blood and tic severity. TS diagnosis was confirmed using Diagnostic and Statistical Manual of Mental Disorders (DSM)-IV criteria and tic severity measured using the Yale Global Tic Severity Scale (YGTSS) for 26 un-medicated subjects with TS. Whole blood was collected and Ribonucleic acid (RNA) processed on Affymetrix Human Exon 1.0 ST arrays. An Analysis of Covariance (ANCOVA) identified 3627 genes correlated with tic severity (pdisorders, Attention Deficit Hyperactivity Disorder (ADHD), and Obsessive-Compulsive Disorder (OCD). Correlation of gene expression in peripheral blood with tic severity may allow inferences about catecholamine pathway dysfunction in TS subjects. Findings built on previous work suggest that at least some genes expressed peripherally are relevant for central nervous system (CNS) pathology in the brain of individuals with TS. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Identification of 51 novel exons of the Usher syndrome type 2A (USH2A) gene that encode multiple conserved functional domains and that are mutated in patients with Usher syndrome type II.

NARCIS (Netherlands)

Wijk, E. van; Pennings, R.J.E.; Brinke, H. te; Claassen, A.M.W.; Yntema, H.G.; Hoefsloot, L.H.; Cremers, F.P.M.; Cremers, C.W.R.J.; Kremer, J.M.J.

2004-01-01

The USH2A gene is mutated in patients with Usher syndrome type IIa, which is the most common subtype of Usher syndrome and is characterized by hearing loss and retinitis pigmentosa. Since mutation analysis by DNA sequencing of exons 1-21 revealed only ~63% of the expected USH2A mutations, we

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

Science.gov (United States)

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

Interferons in Sjögren’s syndrome: genes, mechanisms, and effects

Directory of Open Access Journals (Sweden)

He eLi

2013-09-01

Full Text Available Sjögren’s syndrome (SS is a common, progressive autoimmune exocrinopathy distinguished by dry eyes and mouth and affects ~0.7% of European population. Overexpression of transcripts induced by interferons (IFN, termed as an ‘IFN signature’, has been found in SS patients. Four microarray studies have been published in SS that identified dysregulated genes within type I IFN signaling in either salivary glands or peripheral blood of SS patients. The mechanism of this type I IFN activation is still obscure, but several possible explanations have been proposed, including virus infection-initiated and immune-complex-initiated type I IFN production by plasmacytoid dendritic cells (pDCs. Genetic predisposition to increased type I IFN signaling is supported by candidate gene studies showing evidence for association of variants within IFN-related genes. Once activated, IFN signaling may contribute to numerous aspects of SS pathophysiology, including lymphocyte infiltration into exocrine glands, autoantibody production, and glandular cell apoptosis. Thus, dysregulation of IFN pathways is an important feature that can be potentially used as a serum biomarker for diagnosis and targeting of new treatments in this complex autoimmune disease.

Association study between Van der Woude Syndrome causative gene GRHL3 and nonsyndromic cleft lip with or without cleft palate in a Chinese cohort.

Science.gov (United States)

Wang, Yirui; Sun, Yimin; Huang, Yongqing; Pan, Yongchu; Jia, Zhonglin; Ma, Lijuan; Ma, Lan; Lan, Feifei; Zhou, Yuxi; Shi, Jiayu; Yang, Xiong; Zhang, Lei; Jiang, Hongbing; Jiang, Min; Yin, Aihua; Cheng, Jing; Wang, Lin; Yang, Yinxue; Shi, Bing

2016-08-15

Cleft lip with or without cleft palate (CL/P) is one of the most common birth defects worldwide and is characterized by abnormalities of the orofacial structure. Syndromic CL/P is mainly caused by Mendelian disorders such as Van der Woude Syndrome (VWS). However, >70% of CL/P cases are nonsyndromic, characterized by isolated orofacial cleft without any known syndrome. The etiology of nonsyndromic CL/P (NSCL/P) remains elusive, but it has been suggested that causative genes of syndromic CL/P might also contribute to NSCL/P. As such, the VWS causative gene IRF6 has been extensively studied in NSCL/P. Recently, GRHL3 was identified as another VWS causative gene. Thus, it may be a novel candidate gene for NSCL/P. In the present study, we genotyped 10 tag SNPs covering GRHL3 and performed association analysis with NSCL/P in 504 cases and 455 healthy controls. Our preliminary results identified rs10903078, rs4638975, and a haplotype rs10903078-rs6659209 of GRHL3 that exceeded the significance threshold (p<0.05), though none survived Bonferroni correction for multiple comparisons. As the first study between GRHL3 and NSCL/P, the contribution of this gene to NSCL/P etiology should be interpreted with caution based on existing evidence. Further, the robustness of association between GRHL3 and NSCL/P should be further validated in expanded cohorts. Copyright © 2016. Published by Elsevier B.V.

A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

DEFF Research Database (Denmark)

Becher, Naja; Gjørup, Vibike; Christensen, Rikke

2012-01-01

A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

Science.gov (United States)

Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

2008-02-01

The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

Genetics Home Reference: Rett syndrome

Science.gov (United States)

... Genetic Testing Registry: Rett syndrome Other Diagnosis and Management Resources (4 links) Boston Children's Hospital GeneReview: MECP2-Related Disorders MedlinePlus Encyclopedia: Rett Syndrome RettSyndrome.org: Rett Syndrome Clinics General Information from MedlinePlus (5 links) Diagnostic Tests ...

Finding new genes for non-syndromic hearing loss through an in silico prioritization study.

Directory of Open Access Journals (Sweden)

Matteo Accetturo

Full Text Available At present, 51 genes are already known to be responsible for Non-Syndromic hereditary Hearing Loss (NSHL, but the knowledge of 121 NSHL-linked chromosomal regions brings to the hypothesis that a number of disease genes have still to be uncovered. To help scientists to find new NSHL genes, we built a gene-scoring system, integrating Gene Ontology, NCBI Gene and Map Viewer databases, which prioritizes the candidate genes according to their probability to cause NSHL. We defined a set of candidates and measured their functional similarity with respect to the disease gene set, computing a score ( S S M avg that relies on the assumption that functionally related genes might contribute to the same (disease phenotype. A Kolmogorov-Smirnov test, comparing the pair-wise distribution on the disease gene set with the distribution on the remaining human genes, provided a statistical assessment of this assumption. We found at a p-value 0.99. The twenty top-scored genes were finally examined to evaluate their possible involvement in NSHL. We found that half of them are known to be expressed in human inner ear or cochlea and are mainly involved in remodeling and organization of actin formation and maintenance of the cilia and the endocochlear potential. These findings strongly indicate that our metric was able to suggest excellent NSHL candidates to be screened in patients and controls for causative mutations.

DDC and COBL, flanking the imprinted GRB10 gene on 7p12, are biallelically expressed.

Science.gov (United States)

Hitchins, Megan P; Bentley, Louise; Monk, David; Beechey, Colin; Peters, Jo; Kelsey, Gavin; Ishino, Fumitoshi; Preece, Michael A; Stanier, Philip; Moore, Gudrun E

2002-12-01

Maternal duplication of human 7p11.2-p13 has been associated with Silver-Russell syndrome (SRS) in two familial cases. GRB10 is the only imprinted gene identified within this region to date. GRB10 demonstrates an intricate tissue- and isoform-specific imprinting profile in humans, with paternal expression in fetal brain and maternal expression of one isoform in skeletal muscle. The mouse homolog is maternally transcribed. The GRB10 protein is a potent growth inhibitor and represents a candidate for SRS, which is characterized by pre- and postnatal growth retardation and a spectrum of additional dysmorphic features. Since imprinted genes tend to be grouped in clusters, we investigated the imprinting status of the dopa-decarboxylase gene (DDC) and the Cordon-bleu gene (COBL) which flank GRB10 within the 7p11.2-p13 SRS duplicated region. Although both genes were found to replicate asynchronously, suggestive of imprinting, SNP expression analyses showed that neither gene was imprinted in multiple human fetal tissues. The mouse homologues, Ddc and Cobl, which map to the homologous imprinted region on proximal Chr 11, were also biallelically expressed in mice with uniparental maternal or paternal inheritance of this region. With the intent of using mouse Grb10 as an imprinted control, biallelic expression was consistently observed in fetal, postnatal, and adult brain of these mice, in contrast to the maternal-specific transcription previously demonstrated in brain in inter-specific F1 progeny. This may be a further example of over-expression of maternally derived transcripts in inter-specific mouse crosses. GRB10 remains the only imprinted gene identified within 7p11.2-p13.

Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

Energy Technology Data Exchange (ETDEWEB)

Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others

1994-08-01

Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

Germ-line variants identified by next generation sequencing in a panel of estrogen and cancer associated genes correlate with poor clinical outcome in Lynch syndrome patients.

Science.gov (United States)

Jóri, Balazs; Kamps, Rick; Xanthoulea, Sofia; Delvoux, Bert; Blok, Marinus J; Van de Vijver, Koen K; de Koning, Bart; Oei, Felicia Trups; Tops, Carli M; Speel, Ernst Jm; Kruitwagen, Roy F; Gomez-Garcia, Encarna B; Romano, Andrea

2015-12-01

The risk to develop colorectal and endometrial cancers among subjects testing positive for a pathogenic Lynch syndrome mutation varies, making the risk prediction difficult. Genetic risk modifiers alter the risk conferred by inherited Lynch syndrome mutations, and their identification can improve genetic counseling. We aimed at identifying rare genetic modifiers of the risk of Lynch syndrome endometrial cancer. A family based approach was used to assess the presence of genetic risk modifiers among 35 Lynch syndrome mutation carriers having either a poor clinical phenotype (early age of endometrial cancer diagnosis or multiple cancers) or a neutral clinical phenotype. Putative genetic risk modifiers were identified by Next Generation Sequencing among a panel of 154 genes involved in endometrial physiology and carcinogenesis. A simple pipeline, based on an allele frequency lower than 0.001 and on predicted non-conservative amino-acid substitutions returned 54 variants that were considered putative risk modifiers. The presence of two or more risk modifying variants in women carrying a pathogenic Lynch syndrome mutation was associated with a poor clinical phenotype. A gene-panel is proposed that comprehends genes that can carry variants with putative modifying effects on the risk of Lynch syndrome endometrial cancer. Validation in further studies is warranted before considering the possible use of this tool in genetic counseling.

Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

Science.gov (United States)

Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

2017-08-01

The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene.

Science.gov (United States)

Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair

2015-01-01

Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.

Searching for Tourette’s syndrome gene. Part 1. Heterogeneity of clinical phenotypes

Directory of Open Access Journals (Sweden)

Anna Kowalska

2012-02-01

Full Text Available The French neuropsychiatrist Georges Gilles de la Tourette described in 1885 the “Maladie des Tics” which later was named after him, as Gilles de la Tourette syndrome (GTS. Gilles de la Tourette syndrome is a neurodevelopmental disorder characterized by simple and complex motor and vocal tics with multiple neuropsychiatric comorbidities. GTS is often concurrent with obsessive-compulsive disorder (OCD and attention deficit hyperactivity disorder (ADHD. There are several clinical GTS subtypes: GTS only, GTS OCD, and GTS OCD ADHD. Additional clinical aspects of the disorder include occurrence of anger episodes, anxiety and mood disorders, and learning and sleeping disturbances. The genetics of GTS is complex and remains unclear. So far, no causative candidate genes have been identified. However, segregation studies in families and twins with GTS provide strong evidence for the existence of a genetic background associated with a multifactorial mode of inheritance. Progress in studies on genome variability among patients with GTS is necessary to improve pharmacotherapeutic strategies of the disorder.

Common sequence variants in the LOXL1 gene in pigment dispersion syndrome and pigmentary glaucoma.

Science.gov (United States)

Giardina, Emiliano; Oddone, Francesco; Lepre, Tiziana; Centofanti, Marco; Peconi, Cristina; Tanga, Lucia; Quaranta, Luciano; Frezzotti, Paolo; Novelli, Giuseppe; Manni, Gianluca

2014-04-16

Single nucleotide polymorphisms (SNPs) within the LOXL1 gene are associated with pseudoesfoliation syndrome and pseudoesfoliation glaucoma. The aim of our study is to investigate a potential involvement of LOXL1 gene in the pathogenesis of pigment dispersion syndrome (PDS) and pigmentary glaucoma (PG). A cohort of Caucasian origin of 84 unrelated and clinically well-characterised patients with PDS/PG and 200 control subjects were included in the study. Genomic DNA from whole blood was extracted and the coding and regulatory regions of LOXL1 gene were risequenced in both patients and controls to identify unknown sequence variations. Genotype and haplotype analysis were performed with UNPHASED software. The expression levels of LOXL1 were determined on c-DNA from peripheral blood lymphocytes by quantitative real-time RT-PCR. A significant allele association was detected for SNP rs2304722 within the fifth intron of LOXL1 (Odds ratio (OR = 2.43, p-value = 3,05e-2). Haplotype analysis revealed the existence of risk and protective haplotypes associated with PG-PDS (OR = 3.35; p-value = 1.00e-5 and OR = 3.35; p-value = 1.00e-4, respectively). Expression analysis suggests that associated haplotypes can regulate the expression level LOXL1. Haplotypes of LOXL1 are associated with PG-PDS independently from rs1048661, leading to a differential expression of the transcript.

Evolution and functional analysis of the Pif97 gene of the Pacific oyster Crassostrea gigas

Directory of Open Access Journals (Sweden)

Xiaotong WANG, Xiaorui SONG, Tong WANG, Qihui ZHU, Guoying MIAO, Yuanxin CHEN, Xiaodong FANG, Huayong QUE, Li LI, Guofan ZHANG

2013-02-01

Full Text Available Mollusc shell matrix proteins (SMPs are important functional components embedded in the shell and play a role in shell formation. A SMP (Pif177 was identified previously from the nacreous layer of the Japanese pearl oyster Pinctada fucata, and its cleavage products (named pfPif97 and pfPif80 proteins were found to bind to the chitin framework and induce aragonite crystal formation and orient the c axis. In this study, a homologue of pfPif177 was cloned from the mantle of the Pacific oyster Crassostrea gigas, containing the homologue of pfPif97 only and not pfPif80. This finding hints at the large divergence in gene structure between the two species. This homologue (cgPif97 shares characteristics with pfPif97, and suggests that the biological functions of these two proteins may be similar. The expression pattern of cgPif97 in different tissues and development stages indicates that it may play an important role in shell formation of the adult oyster. The morphology of the inner shell surface was affected by injected siRNA of cgPif97 and the calcite laths of the shell became thinner and narrower when the siRNA dose increased, suggesting that the cgPif97 gene plays an important role in calcite shell formation in C. gigas. In conclusion, we found evidence that the Pif177 gene evolved very fast but still retains a similar function among species [Current Zoology 59 (1: 109–115, 2013].

Beneficial effect of CETP gene polymorphism in combination with a Mediterranean diet influencing lipid metabolism in metabolic syndrome patients: CORDIOPREV study

Science.gov (United States)

The cholesteryl ester transfer protein (CETP) gene has been implicated in high-density lipoprotein (HDL-C) metabolism. However, little is known about the impact of this gene on metabolic syndrome (MetS) patients and its interaction with diet. Here, we evaluate whether the consumption of a Mediterran...

Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome

Directory of Open Access Journals (Sweden)

Tai Dessmon

2005-01-01

Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.

Two fundamentally different classes of microbial genes.

Science.gov (United States)

Wolf, Yuri I; Makarova, Kira S; Lobkovsky, Alexander E; Koonin, Eugene V

2016-11-07

The evolution of bacterial and archaeal genomes is highly dynamic and involves extensive horizontal gene transfer and gene loss 1-4 . Furthermore, many microbial species appear to have open pangenomes, where each newly sequenced genome contains more than 10% ORFans, that is, genes without detectable homologues in other species 5,6 . Here, we report a quantitative analysis of microbial genome evolution by fitting the parameters of a simple, steady-state evolutionary model to the comparative genomic data on the gene content and gene order similarity between archaeal genomes. The results reveal two sharply distinct classes of microbial genes, one of which is characterized by effectively instantaneous gene replacement, and the other consists of genes with finite, distributed replacement rates. These findings imply a conservative estimate of the size of the prokaryotic genomic universe, which appears to consist of at least a billion distinct genes. Furthermore, the same distribution of constraints is shown to govern the evolution of gene complement and gene order, without the need to invoke long-range conservation or the selfish operon concept 7 .

IGF-I generation test in prepubertal children with Noonan syndrome due to mutations in the PTPN11 gene.

Science.gov (United States)

Bertelloni, Silvano; Baroncelli, Giampiero I; Dati, Eleonora; Ghione, Silvia; Baldinotti, Fulvia; Toschi, Benedetta; Simi, Paolo

2013-01-01

Short stature represents one of the main features of children with Noonan syndrome. The reason for impaired growth remains largely unknown. To assess GH and IGF1 secretion in children with Noonan syndrome. 12 prepubertal children with Noonan syndrome due to mutations in the PTPN11 gene [7 males, 6 females; median age, years: 8.6 (range 5.1-13.4)] were studied; 12 prepubertal children with short stature (SS) [7 males, 5 females; median age, years: 8.1 (range 4.8-13.1)] served as the control group. GH secretion after arginine stimulation test; IGF1 generation test by measurement of IGF1 levels before and after recombinant GH (rGH) administration (0.05 mg/kg/day for 4 days). Baseline and stimulated peak values of GH were not significantly different between the two groups. At +120 minutes, GH levels remained significantly higher (p = 0.0121) in comparison with baseline values in children with Noonan syndrome. Baseline IGFI levels in patients and in SS controls were not significantly different, in contrast to values after the rGH generation test [205 ng/mL (interquartiles 138.2-252.5 ng/mL) and 284.5 ng/mL (interquartiles 172-476 ng/mL), respectively; p = 0.0248]. IGF1 values were significantly related to height (baseline: r = 773, p = 0.0320; peak: r = 0.591, p = 0.0428) in children with Noonan syndrome. Blunted increase of IGF1 after the rGH generation test was present in children with Noonan syndrome due to mutations in the PTPN11 gene in comparison with SS children. This finding may be due to partial GH resistance in the former likely related to altered Ras-MAPK signaling pathway.

An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

Directory of Open Access Journals (Sweden)

Wang Haiyang

2002-12-01

Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

A novel mutation in the endothelin B receptor gene in a moroccan family with shah-waardenburg syndrome.

Science.gov (United States)

Doubaj, Yassamine; Pingault, Véronique; Elalaoui, Siham C; Ratbi, Ilham; Azouz, Mohamed; Zerhouni, Hicham; Ettayebi, Fouad; Sefiani, Abdelaziz

2015-02-01

Waardenburg syndrome (WS) is a neurocristopathy disorder combining sensorineural deafness and pigmentary abnormalities. The presence of additional signs defines the 4 subtypes. WS type IV, also called Shah-Waardenburg syndrome (SWS), is characterized by the association with congenital aganglionic megacolon (Hirschsprung disease). To date, 3 causative genes have been related to this congenital disorder. Mutations in the EDNRB and EDN3 genes are responsible for the autosomal recessive form of SWS, whereas SOX10 mutations are inherited in an autosomal dominant manner. We report here the case of a 3-month-old Morrocan girl with WS type IV, born to consanguineous parents. The patient had 3 cousins who died in infancy with the same symptoms. Molecular analysis by Sanger sequencing revealed the presence of a novel homozygous missense mutation c.1133A>G (p.Asn378Ser) in the EDNRB gene. The proband's parents as well as the parents of the deceased cousins are heterozygous carriers of this likely pathogenic mutation. This molecular diagnosis allows us to provide genetic counseling to the family and eventually propose prenatal diagnosis to prevent recurrence of the disease in subsequent pregnancies.

Gene therapy restores auditory and vestibular function in a mouse model of Usher syndrome type 1c.

Science.gov (United States)

Pan, Bifeng; Askew, Charles; Galvin, Alice; Heman-Ackah, Selena; Asai, Yukako; Indzhykulian, Artur A; Jodelka, Francine M; Hastings, Michelle L; Lentz, Jennifer J; Vandenberghe, Luk H; Holt, Jeffrey R; Géléoc, Gwenaëlle S

2017-03-01

Because there are currently no biological treatments for hearing loss, we sought to advance gene therapy approaches to treat genetic deafness. We focused on Usher syndrome, a devastating genetic disorder that causes blindness, balance disorders and profound deafness, and studied a knock-in mouse model, Ush1c c.216G>A, for Usher syndrome type IC (USH1C). As restoration of complex auditory and balance function is likely to require gene delivery systems that target auditory and vestibular sensory cells with high efficiency, we delivered wild-type Ush1c into the inner ear of Ush1c c.216G>A mice using a synthetic adeno-associated viral vector, Anc80L65, shown to transduce 80-90% of sensory hair cells. We demonstrate recovery of gene and protein expression, restoration of sensory cell function, rescue of complex auditory function and recovery of hearing and balance behavior to near wild-type levels. The data represent unprecedented recovery of inner ear function and suggest that biological therapies to treat deafness may be suitable for translation to humans with genetic inner ear disorders.

Genetic Aspects of Preeclampsia and the HELLP Syndrome

Science.gov (United States)

Mortensen, Jan Helge; Nagy, Bálint

2014-01-01

Both preeclampsia and the HELLP syndrome have their origin in the placenta. The aim of this study is to review genetic factors involved in development of preeclampsia and the HELLP syndrome using literature search in PubMed. A familial cohort links chromosomes 2q, 5q, and 13q to preeclampsia. The chromosome 12q is coupled with the HELLP syndrome. The STOX1 gene, the ERAP1 and 2 genes, the syncytin envelope gene, and the −670 Fas receptor polymorphisms are involved in the development of preeclampsia. The ACVR2A gene on chromosome 2q22 is also implicated. The toll-like receptor-4 (TLR-4) and factor V Leiden mutation participate both in development of preeclampsia and the HELLP syndrome. Carriers of the TT and the CC genotype of the MTHFR C677T polymorphism seem to have an increased risk of the HELLP syndrome. The placental levels of VEGF mRNA are reduced both in women with preeclampsia and in women with the HELLP syndrome. The BclI polymorphism is engaged in development of the HELLP syndrome but not in development of severe preeclampsia. The ACE I/D polymorphism affects uteroplacental and umbilical artery blood flows in women with preeclampsia. In women with preeclampsia and the HELLP syndrome several genes in the placenta are deregulated. Preeclampsia and the HELLP syndrome are multiplex genetic diseases. PMID:24991435

Functional analysis of PI-like gene in relation to flower development ...

Indian Academy of Sciences (India)

lying flower development in bamboo, a petal-identity gene was identified as a ... 35S::BoPI fully rescued the defective petal forma- tion in the ... Arabidopsis converted sepals to petals; BoPI-C interacted with BoAP3 on yeast two-hybrid assay, just like the full-length ... PI homologue function in regulating perianth organ forma-.

Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

International Nuclear Information System (INIS)

Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

2009-01-01

Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

Hearing impairment caused by mutations in two different genes responsible for nonsyndromic and syndromic hearing loss within a single family.

Science.gov (United States)

Niepokój, Katarzyna; Rygiel, Agnieszka M; Jurczak, Piotr; Kujko, Aleksandra A; Śniegórska, Dominika; Sawicka, Justyna; Grabarczyk, Alicja; Bal, Jerzy; Wertheim-Tysarowska, Katarzyna

2018-02-01

Usher syndrome is rare genetic disorder impairing two human senses, hearing and vision, with the characteristic late onset of vision loss. This syndrome is divided into three types. In all cases, the vision loss is postlingual, while loss of hearing is usually prelingual. The vestibular functions may also be disturbed in Usher type 1 and sometimes in type 3. Vestibular areflexia is helpful in making a proper diagnosis of the syndrome, but, often, the syndrome is misdiagnosed as a nonsyndromic hearing loss. Here, we present a Polish family with hearing loss, which was clinically classified as nonsyndromic. After excluding mutations in the DFNB1 locus, we implemented the next-generation sequencing method and revealed that hearing loss was syndromic and mutations in the USH2A gene indicate Usher syndrome. This research highlights the importance of molecular analysis in establishing a clinical diagnosis of congenital hearing loss.

The fragile X syndrome: Isolation of the FMR-1 gene and characterization of the fragile X mutation

NARCIS (Netherlands)

B.A. Oostra (Ben); A. Verkerk

1992-01-01

markdownabstractConclusion Rapid progress has been made in the analysis of the fragile X syndrome during 1991. Different groups have discovered that fragile X chromosomes are preferentially methylated. In these X chromosomes an insertion has been found in the methylated region. The FMR-1 gene,

Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis.

Science.gov (United States)

Bonnet, Crystel; Grati, M'hamed; Marlin, Sandrine; Levilliers, Jacqueline; Hardelin, Jean-Pierre; Parodi, Marine; Niasme-Grare, Magali; Zelenika, Diana; Délépine, Marc; Feldmann, Delphine; Jonard, Laurence; El-Amraoui, Aziz; Weil, Dominique; Delobel, Bruno; Vincent, Christophe; Dollfus, Hélène; Eliot, Marie-Madeleine; David, Albert; Calais, Catherine; Vigneron, Jacqueline; Montaut-Verient, Bettina; Bonneau, Dominique; Dubin, Jacques; Thauvin, Christel; Duvillard, Alain; Francannet, Christine; Mom, Thierry; Lacombe, Didier; Duriez, Françoise; Drouin-Garraud, Valérie; Thuillier-Obstoy, Marie-Françoise; Sigaudy, Sabine; Frances, Anne-Marie; Collignon, Patrick; Challe, Georges; Couderc, Rémy; Lathrop, Mark; Sahel, José-Alain; Weissenbach, Jean; Petit, Christine; Denoyelle, Françoise

2011-05-11

Usher syndrome (USH) combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3). Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3). Biallelic mutations were detected in 39 patients (72%) and monoallelic mutations in an additional 10 patients (18.5%). In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%), and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48%) were novel. Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.

Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis

Directory of Open Access Journals (Sweden)

Lacombe Didier

2011-05-01

Full Text Available Abstract Background Usher syndrome (USH combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3. Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. Methods We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3. Results Biallelic mutations were detected in 39 patients (72% and monoallelic mutations in an additional 10 patients (18.5%. In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%, and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48% were novel. Conclusions Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.

Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

Science.gov (United States)

Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

2010-01-01

PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within

LEOPARD-syndrom

DEFF Research Database (Denmark)

Hansen, Lars Kjaersgård; Risby, Kirsten; Bygum, Anette

2009-01-01

We describe a 12-year-old boy with a typical phenotype of the LEOPARD syndrome (LS). The diagnosis was confirmed in the boy and his mother, who both had a mutation in the PTPN11 gene at Thr468Met (c.1403C > T). Several other members of the maternal family are suspected also to have the LEOPARD sy...... syndrome. We discuss the clinical characteristics of LS, the need for follow-up and genetic counselling, and the molecular-genetic background as well as the relationship to the allelic disease Noonan syndrome. Udgivelsesdato: 2009-Jan-26......We describe a 12-year-old boy with a typical phenotype of the LEOPARD syndrome (LS). The diagnosis was confirmed in the boy and his mother, who both had a mutation in the PTPN11 gene at Thr468Met (c.1403C > T). Several other members of the maternal family are suspected also to have the LEOPARD...

Identification of fast-evolving genes in the scleractinian coral Acropora using comparative EST analysis.

Directory of Open Access Journals (Sweden)

Akira Iguchi

Full Text Available To identify fast-evolving genes in reef-building corals, we performed direct comparative sequence analysis with expressed sequence tag (EST datasets from two acroporid species: Acropora palmata from the Caribbean Sea and A. millepora from the Great Barrier Reef in Australia. Comparison of 589 independent sequences from 1,421 A. palmata contigs, with 10,247 A. millepora contigs resulted in the identification of 196 putative homologues. Most of the homologous pairs demonstrated high amino acid similarities (over 90%. Comparisons of putative homologues showing low amino acid similarities (under 90% among the Acropora species to the near complete datasets from two other cnidarians (Hydra magnipapillata and Nematostella vectensis implied that some were non-orthologous. Within 86 homologous pairs, 39 exhibited dN/dS ratios significantly less than 1, suggesting that these genes are under purifying selection associated with functional constraints. Eight independent genes showed dN/dS ratios exceeding 1, while three deviated significantly from 1, suggesting that these genes may play important roles in the adaptive evolution of Acropora. Our results also indicated that CEL-III lectin was under positive selection, consistent with a possible role in immunity or symbiont recognition. Further studies are needed to clarify the possible functions of the genes under positive selection to provide insight into the evolutionary process of corals.

Identification of fast-evolving genes in the scleractinian coral Acropora using comparative EST analysis.

Science.gov (United States)

Iguchi, Akira; Shinzato, Chuya; Forêt, Sylvain; Miller, David J

2011-01-01

To identify fast-evolving genes in reef-building corals, we performed direct comparative sequence analysis with expressed sequence tag (EST) datasets from two acroporid species: Acropora palmata from the Caribbean Sea and A. millepora from the Great Barrier Reef in Australia. Comparison of 589 independent sequences from 1,421 A. palmata contigs, with 10,247 A. millepora contigs resulted in the identification of 196 putative homologues. Most of the homologous pairs demonstrated high amino acid similarities (over 90%). Comparisons of putative homologues showing low amino acid similarities (under 90%) among the Acropora species to the near complete datasets from two other cnidarians (Hydra magnipapillata and Nematostella vectensis) implied that some were non-orthologous. Within 86 homologous pairs, 39 exhibited dN/dS ratios significantly less than 1, suggesting that these genes are under purifying selection associated with functional constraints. Eight independent genes showed dN/dS ratios exceeding 1, while three deviated significantly from 1, suggesting that these genes may play important roles in the adaptive evolution of Acropora. Our results also indicated that CEL-III lectin was under positive selection, consistent with a possible role in immunity or symbiont recognition. Further studies are needed to clarify the possible functions of the genes under positive selection to provide insight into the evolutionary process of corals.

New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

International Nuclear Information System (INIS)

Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Charfeddine, Ilhem; Fakhfakh, Faiza

2008-01-01

The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

A novel mutation in the PAX3 gene causes Waardenburg syndrome type I in an Iranian family.

Science.gov (United States)

Jalilian, Nazanin; Tabatabaiefar, Mohammad Amin; Farhadi, Mohammad; Bahrami, Tayyeb; Noori-Daloii, Mohammad Reza

2015-10-01

Sensorineural hearing impairment (HI) is one of the most frequent congenital defects, with a prevalence of 1 in 500 among neonates. Although there are over 400 syndromes involving HI, most cases of HI are nonsyndromic (70%), 20% of which follow autosomal dominant mode of inheritance. Waardenburg syndrome (WS) ranks first among autosomal dominant syndromic forms of HI. WS is characterized by sensorineural hearing impairment, pigmentation abnormalities of hair and skin and hypoplastic blue eyes or heterochromia iridis. WS is subdivided into four major types, WS1-WS4. WS1 is diagnosed by the presence of dystopia canthorum and PAX3 is the only gene involved. This study aims to determine the pathogenic mutation in a large Iranian pedigree affected with WS1 in order to further confirm the clinical diagnosis. In the present study, a family segregating HI was ascertained in a genetic counseling center. Upon clinical inspection, white forelock, dystopia canthorum, broad high nasal root and synophrys, characteristic of WS1 were evident. In order to clarify the genetic etiology and confirm the clinical data, primers were designed to amplify exons and exon-intron boundaries of the responsible gene, PAX3 with 10 exons, followed by the Sanger DNA sequencing method. Genetic analysis of PAX3 revealed a novel mutation in PAX3 (c.1024_1040 del AGCACGATTCCTTCCAA). Our data provide genotype-phenotype correlation for the mutation in PAX3 and WS1 in the studied family, with implications for genetic counseling, which necessitates detailed clinical inspection of HI patients to distinguish syndromic HI from the more common non-syndromic cases. Our results reveal the value of phenotype-directed genetic analysis and could further expand the spectrum of PAX3 mutations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

Science.gov (United States)

Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

1995-11-01

We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

Science.gov (United States)

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

Directory of Open Access Journals (Sweden)

Marianna P.R. Porto

2010-01-01

Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

A novel heterozygous germline deletion in MSH2 gene in a five generation Chinese family with Lynch syndrome

OpenAIRE

Wu, Bin; Ji, Wuyang; Liang, Shengran; Ling, Chao; You, Yan; Xu, Lai; Zhong, Min-Er; Xiao, Yi; Qiu, Hui-Zhong; Lu, Jun-Yang; Banerjee, Santasree

2017-01-01

Lynch syndrome (LS) is one of the most common familial forms of colorectal cancer predisposing syndrome with an autosomal dominant mode of inheritance. LS is caused by the germline mutations in DNA mismatch repair (MMR) genes including MSH2, MLH1, MSH6 and PMS2. Clinically, LS is characterized by high incidence of early-onset colorectal cancer as well as endometrial, small intestinal and urinary tract cancers, usually occur in the third to fourth decade of the life. Here we describe a five ge...

Bloom's syndrome. VI. The disorder in Israel and an estimation of the gene frequency in the Ashkenazim.

Science.gov (United States)

German, J; Bloom, D; Passarge, E; Fried, K; Goodman, R M; Katzenellenbogen, I; Laron, Z; Legum, C; Levin, S; Wahrman

1977-01-01

An effort was made to identify all individuals with Bloom's syndrome living in Israel between September 1971 and September 1972. Each of the eight individuals located were Jewish and could readily be classified Ashkenazic. The frequency of the Bloom's syndrome gene in Ashkenazim was estimated to be .0042 (minimum), implying a heterozygote frequency greater than 1 in 120. A striking distortion of the sex ratio (M/F = 7.0) may have been due to underascertainment of affected females. One of the affected individuals ascertained during the survey subsequently has died from cancer, which is in keeping with the recognized cancer proneness of this condition. Four of the affected have married, but no conception is known to have occurred, which suggests that sub- or infertility is a feature of the syndrome. PMID:930922

Severe manifestation of Bartter syndrome Type IV caused by a novel insertion mutation in the BSND gene.

Science.gov (United States)

de Pablos, Augusto Luque; García-Nieto, Victor; López-Menchero, Jesús C; Ramos-Trujillo, Elena; González-Acosta, Hilaria; Claverie-Martín, Félix

2014-05-01

Bartter syndrome Type IV is a rare subtype of the Bartter syndromes that leads to both severe renal salt wasting and sensorineural deafness. This autosomal recessive disease is caused by mutations in the gene encoding barttin, BSND, an essential subunit of the ClC-K chloride channels expressed in renal and inner ear epithelia. Patients differ in the severity of renal symptoms, which appears to depend on the modification of channel function by the mutant barttin. To date, only a few BSND mutations have been reported, most of which are missense or nonsense mutations. In this study, we report the identification of the first insertion mutation, p.W102Vfs*7, in the BSND gene of a newborn girl with acute clinical symptoms including early-onset chronic renal failure. The results support previous data indicating that mutations that are predicted to abolish barttin expression are associated with a severe phenotype and early onset renal failure.

Multiple giant cell lesions in patients with Noonan syndrome and cardio-facio-cutaneous syndrome

OpenAIRE

Neumann, Thomas E; Allanson, Judith; Kavamura, Ines; Kerr, Bronwyn; Neri, Giovanni; Noonan, Jacqueline; Cordeddu, Viviana; Gibson, Kate; Tzschach, Andreas; Krüger, Gabriele; Hoeltzenbein, Maria; Goecke, Timm O; Kehl, Hans Gerd; Albrecht, Beate; Luczak, Klaudiusz

2008-01-01

Noonan syndrome (NS) and cardio-facio-cutaneous syndrome (CFCS) are related developmental disorders caused by mutations in genes encoding various components of the RAS-MAPK signaling cascade. NS is associated with mutations in the genes PTPN11, SOS1, RAF1, or KRAS, whereas CFCS can be caused by mutations in BRAF, MEK1, MEK2, or KRAS. the NS phenotype is rarely accompanied by multiple giant cell lesions (MGCL) of the jaw (Noonan-like/MGCL syndrome (NL/MGCLS)). PTPN11 mutations are the only gen...

West syndrome in a patient with Schinzel-Giedion syndrome.

Science.gov (United States)

Miyake, Fuyu; Kuroda, Yukiko; Naruto, Takuya; Ohashi, Ikuko; Takano, Kyoko; Kurosawa, Kenji

2015-06-01

Schinzel-Giedion syndrome is a rare recognizable malformation syndrome defined by characteristic facial features, profound developmental delay, severe growth failure, and multiple congenital anomalies. The causative gene of Schinzel-Giedion syndrome, SETBP1, has been identified, but limited cases have been confirmed by molecular analysis. We present a 9-month-old girl affected by West syndrome with Schinzel-Giedion syndrome. Congenital severe hydronephrosis, typical facial features, and multiple anomalies suggested a clinical diagnosis of Schinzel-Giedion syndrome. Hypsarrhythmia occurred at 7 months of age and was temporarily controlled by adrenocorticotropic hormone (ACTH) therapy during 5 weeks. SETBP1 mutational analysis showed the presence of a recurrent mutation, p.Ile871Thr. The implications in management of Schinzel-Giedion syndrome are discussed. © The Author(s) 2014.

A novel mutation in the NOD2 gene associated with Blau syndrome: a Norwegian family with four affected members

DEFF Research Database (Denmark)

Milman, N; Ursin, K; Rødevand, E

2009-01-01

BACKGROUND: Blau syndrome is a chronic granulomatous disease with an autosomal dominant trait characterized by the triad granulomatous dermatitis, arthritis, and uveitis. It is caused by mutations in the NOD2 gene, also termed the CARD15 gene. OBJECTIVE: To report a novel mutation in the NOD2 gen...... with an autosomal dominant heritage. Most likely the mutation has arisen de novo in the proband. Genetic counselling and antenatal diagnostics should be available to the involved families....... associated with Blau syndrome. METHODS AND RESULTS: The proband was a 68-year-old ethnic Norwegian male who had uveitis and arthritis since 10 years of age followed by lifelong recurrent arthritis and chronic eye involvement. Genetic analysis showed a heterozygous c.1814 C>A, T605N mutation in NOD2 that has...

Atorvastatin inhibits the immediate-early response gene EGR1 and improves the functional profile of CD4+T-lymphocytes in acute coronary syndromes.

Science.gov (United States)

Severino, Anna; Zara, Chiara; Campioni, Mara; Flego, Davide; Angelini, Giulia; Pedicino, Daniela; Giglio, Ada Francesca; Trotta, Francesco; Giubilato, Simona; Pazzano, Vincenzo; Lucci, Claudia; Iaconelli, Antonio; Ruggio, Aureliano; Biasucci, Luigi Marzio; Crea, Filippo; Liuzzo, Giovanna

2017-03-14

Background- Adaptive immune-response is associated with a worse outcome in acute coronary syndromes. Statins have anti-inflammatory activity beyond lowering lipid levels. We investigated the effects of ex-vivo and in-vivo atorvastatin treatment in acute coronary syndromes on CD4+T-cells, and the underlying molecular mechanisms.Approach and results- Blood samples were collected from 50 statin-naïve acute coronary syndrome patients. We assessed CD4+T-cell activation by flow-cytometry, the expression of 84 T-helper transcription-factors and 84 T-cell related genes by RT-qPCR, and protein expression by Western-blot, before and after 24-hours incubation with increasing doses of atorvastatin: 3-10-26 μg/ml (corresponding to blood levels achieved with doses of 10-40-80 mg, respectively). After incubation, we found a significant decrease in interferon-γ-producing CD4+CD28nullT-cells (P = 0.009) and a significant increase in interleukin-10-producing CD4+CD25highT-cells (P 3-fold changes).The in-vivo effects of atorvastatin were analyzed in 10 statin-free acute coronary syndrome patients at baseline, and after 24h and 48h of atorvastatin therapy (80 mg/daily): EGR1-gene expression decreased at 24h (P = 0.01) and 48h (P = 0.005); EGR1-protein levels decreased at 48h (P = 0.03).Conclusions-In acute coronary syndromes, the effects of atorvastatin on immune system might be partially related to the inhibition of the master regulator gene EGR1. Our finding might offer a causal explanation on why statins improve the early outcome in acute coronary syndromes.

Gene p63: In ectrodactyly-ectodermal dysplasia clefting, ankyloblepharon-ectodermal dysplasia, Rapp-Hodgkin syndrome.

Science.gov (United States)

van Straten, Cornelia; Butow, Kurt-W

2013-01-01

An analysis was made of three different syndromes associated with p63 gene mutations, known as ectrodactyly-ectodermal dysplasia-clefting syndrome (EEC), ankyloblepharon-ectodermal dysplasia clefting syndrome (AEC or Hay-Wells) and Rapp-Hodgkin syndrome (RHS). The postoperative complications associated with their cleft reconstructions were also evaluated. Extensive demographic information, in particular of the clinical appearances, associated malformations, and the types and complications of the reconstructive surgical procedures, were recorded of these syndromic cases occurring in a database of 3621 facial cleft deformity patients. The data was analyzed using the Microsoft Excel program. A total of 10 (0.28%) cases of p63 associated syndromes were recorded: EEC (6), RHS (3), and AEC (1). The following clinical cleft appearances were noted - EEC = 6: CLA 1 -right side unilateral (female); CLAP 4 - right side (1) + left side (1) unilateral (male + female); bilateral (2) (males); hPsP 1 (female) (divided in 3 Black, 2 White, 1 Indian); RHS = 3: CLAP 2 (White males); hPsP 1 (White female); AEC = 1: CLAP bilateral (White male). Other features of the syndromes were: skin, hand, foot, tooth, hair and nail involvement, and light sensitivity. Postoperative complications included: (i) stenosis of nasal opening, especially after reconstruction of the bilateral cleft lip and the columella lengthening (2 cases), (ii) premaxilla-prolabium fusion (2 cases), (iii) repeated occurrence of oro-nasal fistula in the hard palate (4 cases), and (iv) dysgnathial development of midfacial structures (3 cases). Three different p63 associated syndromes (EEC, AEC, and RHS) were diagnosed (0.27% of the total facial cleft deformities database). The majority of the cases presented with a bilateral CLAP in males only. A number of females and males had unilateral CLA. The hPsP-cleft was recorded in females only. The associated ectodermal component most probably had a profoundly negative influence

Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

Science.gov (United States)

Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

2015-10-14

The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes

Science.gov (United States)

Haddad, N.M.; Ente, D.; Chouery, E.; Jalkh, N.; Mehawej, C.; Khoueir, Z.; Pingault, V.; Mégarbané, A.

2011-01-01

Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region. PMID:21373256

Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes.

Science.gov (United States)

Haddad, N M; Ente, D; Chouery, E; Jalkh, N; Mehawej, C; Khoueir, Z; Pingault, V; Mégarbané, A

2011-01-01

Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region.

Genetic mapping of the gene for Usher syndrome: Linkage analysis in a large Samaritan kindred

Energy Technology Data Exchange (ETDEWEB)

Bonne-Tamir, B.; Korostishevsky, M.; Kalinsky, H.; Seroussi, E.; Beker, R.; Weiss, S. (Sackler Faculty of Medicine, Ramat-Aviv (Israel)); Godel, V. (Ichilov Hospital, Tel-Aviv (Israel))

1994-03-01

Usher syndrome is a group of autosomal recessive disorders associated with congenital sensorineural deafness and progressive visual loss due to retinitis pigmentosa. Sixteen members of the small inbred Samaritan isolate with autosomal recessive deafness from 59 individuals including parents and affected and nonaffected sibs were typed for markers on chromosomes 1q and 11q for which linkage has recently been established for Usher syndrome types II and I. Statistically significant linkage was observed with four markers on 11q (D11S533, D11S527, OMP, and INT2) with a maximum six-point location score of 11.61 at the D11S533 locus. Analysis of haplotypes supports the notion that the mutation arose only once in an ancestral chromosome carrying a specific haplotype. The availability of markers closely linked to the disease locus allows indirect genotype analysis and identifies all carriers of the gene within the community. Furthermore, the detection of complete linkage disequilibrium between the D11S533 marker and the Usher gene suggests that these loci are either identical or adjacent and narrows the critical region to which physical mapping efforts are currently directed. 35 refs., 2 figs., 6 tabs.

Is the Prosthetic Homologue Necessary for Embodiment?

Science.gov (United States)

Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

2016-01-01

Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing impairment, diabetes mellitus, and psychiatric disease

NARCIS (Netherlands)

Cryns, K; Sivakumaran, TA; Van den Ouweland, JMW; Pennings, RJE; Cremers, CWRJ; Flothmann, K; Young, TL; Smith, RJH; Lesperance, MM; Van Camp, G

2003-01-01

WFS1 is a novel gene and encodes an 890 amino-acid glycoprotein (wolframin), predominantly localized in the endoplasmic reticulum. Mutations in WFS1 underlie autosomal recessive Wolfram syndrome and autosomal dominant low frequency sensorineural hearing impairment (LFSNHI) DFNA6/14. In addition,

Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing impairment, diabetes mellitus, and psychiatric disease.

NARCIS (Netherlands)

Cryns, K.; Sivakumaran, T.A.; Ouweland, J.M.W. van den; Pennings, R.J.E.; Cremers, C.W.R.J.; Flothmann, K.; Young, T.L.; Smith, R.J.H.; Lesperance, M.M.; Camp, G. van

2003-01-01

WFS1 is a novel gene and encodes an 890 amino-acid glycoprotein (wolframin), predominantly localized in the endoplasmic reticulum. Mutations in WFS1 underlie autosomal recessive Wolfram syndrome and autosomal dominant low frequency sensorineural hearing impairment (LFSNHI) DFNA6/14. In addition,

Nelson`s syndrome associated with a somatic frame shift mutation in the glucocorticoid recepter gene

Energy Technology Data Exchange (ETDEWEB)

Karl, M.; Stratakis, C.A.; Chrousos, G.P.; Katz, D.A.; Ali, I.U.; Oldfield, E.H. [National Inst. of Neurological Disorders and Stroke, Bethesda, MD (United States)] [and others

1996-01-01

Nelson`s syndrome is the appearance and/or progression of ACTH-secreting pituitary macroadenomas in patients who had previously undergone bilateral adrenalectomy for Cushing`s disease. Extremely high plasma ACTH levels and aggressive neoplastic growth might be explained by the lack of appropriate glucocorticoid negative feedback due to defective glucocorticoid signal transduction. To study the glucocorticoid receptor (GR) gene in Nelson`s syndrome, DNA was extracted from pituitary adenomas and leukocytes of four patients with this condition and amplified by PCR for direct sequence analysis. In one of the tumors, a heterozygous mutation, consisting of an insertion of a thymine between complementary DNA nucleotides 1188 and 1189, was found in exon 2. This frame-shift mutation led to premature termination at amino acid residue 366 of the world-type coding sequence, excluding the expression of a functioning receptor protein from the defective allele. The mutation was not detected in the sequence of the GR gene in the patient`s leukocyte DNA, indicating a somatic origin. By lowering the receptor number in tumorous cells, this defect might have caused local resistance to negative glucocorticoid feedback similar to that caused by the presence of a null allele in a kindred with the generalized glucocorticoid resistance syndrome. P53 protein accumulation, previously reported in 60% of corticotropinomas, could not be detected in any of the four pituitary tumors examined by immunohistochemistry. We suggest that a somatic GR defect might have played a pathophysiological role in the tumorigenesis of the corticotropinoma bearing this mutation. 35 refs., 3 figs., 1 tab.

Genetic testing of the FBN1 gene in Chinese patients with Marfan/Marfan-like syndrome.

Science.gov (United States)

Yang, Hang; Luo, Mingyao; Chen, Qianlong; Fu, Yuanyuan; Zhang, Jing; Qian, Xiangyang; Sun, Xiaogang; Fan, Yuxin; Zhou, Zhou; Chang, Qian

2016-08-01

Marfan syndrome (MFS) is an autosomal dominant connective tissue disorder typically involving the ocular, skeletal and cardiovascular systems, and aortic aneurysms/dissection mainly contributes to its mortality. Here, we performed genetic testing of the FBN1 gene in 39 Chinese probands with Marfan/Marfan-like syndrome and their related family members by Sanger sequencing. In total, 29 pathogenic/likely pathogenic FBN1 mutations, including 17 novel ones, were identified. In addition, most MFS patients with aortic disease (62%) had a truncating or splicing mutation. These results expand the FBN1 mutation spectrum and enrich our knowledge of genotype-phenotype correlations. Genetic testing for MFS and its related aortic diseases is increasingly important for early intervention and treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

Science.gov (United States)

Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

2017-10-01

In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

Science.gov (United States)

Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

2015-05-01

This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

Science.gov (United States)

Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

2015-08-01

Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

Evidence for gene-environment interaction in a genome wide study of isolated, non-syndromic cleft palate

Science.gov (United States)

Beaty, Terri H.; Ruczinski, Ingo; Murray, Jeffrey C.; Marazita, Mary L.; Munger, Ronald G.; Hetmanski, Jacqueline B.; Murray, Tanda; Redett, Richard J.; Fallin, M. Daniele; Liang, Kung Yee; Wu, Tao; Patel, Poorav J.; Jin, Sheng C.; Zhang, Tian Xiao; Schwender, Holger; Wu-Chou, Yah Huei; Chen, Philip K; Chong, Samuel S; Cheah, Felicia; Yeow, Vincent; Ye, Xiaoqian; Wang, Hong; Huang, Shangzhi; Jabs, Ethylin W.; Shi, Bing; Wilcox, Allen J.; Lie, Rolv T.; Jee, Sun Ha; Christensen, Kaare; Doheny, Kimberley F.; Pugh, Elizabeth W.; Ling, Hua; Scott, Alan F.

2011-01-01

Non-syndromic cleft palate (CP) is a common birth defect with a complex and heterogeneous etiology involving both genetic and environmental risk factors. We conducted a genome wide association study (GWAS) using 550 case-parent trios, ascertained through a CP case collected in an international consortium. Family based association tests of single nucleotide polymorphisms (SNP) and three common maternal exposures (maternal smoking, alcohol consumption and multivitamin supplementation) were used in a combined 2 df test for gene (G) and gene-environment (G×E) interaction simultaneously, plus a separate 1 df test for G×E interaction alone. Conditional logistic regression models were used to estimate effects on risk to exposed and unexposed children. While no SNP achieved genome wide significance when considered alone, markers in several genes attained or approached genome wide significance when G×E interaction was included. Among these, MLLT3 and SMC2 on chromosome 9 showed multiple SNPs resulting in increased risk if the mother consumed alcohol during the peri-conceptual period (3 months prior to conception through the first trimester). TBK1 on chr. 12 and ZNF236 on chr. 18 showed multiple SNPs associated with higher risk of CP in the presence of maternal smoking. Additional evidence of reduced risk due to G×E interaction in the presence of multivitamin supplementation was observed for SNPs in BAALC on chr. 8. These results emphasize the need to consider G×E interaction when searching for genes influencing risk to complex and heterogeneous disorders, such as non-syndromic CP. PMID:21618603

ACE I/D Gene Polymorphism Can't Predict the Steroid Responsiveness in Asian Children with Idiopathic Nephrotic Syndrome: A Meta-Analysis

Science.gov (United States)

Su, Li-Na; Lei, Feng-Ying; Huang, Wei-Fang; Zhao, Yan-Jun

2011-01-01

Background The results from the published studies on the association between angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and the treatment response to steroid in Asian children with idiopathic nephrotic syndrome (INS) is still conflicting. This meta-analysis was performed to evaluate the relation between ACE I/D gene polymorphism and treatment response to steroid in Asian children and to explore whether ACE D allele or DD genotype could become a predictive marker for steroid responsiveness. Methodology/Principal Findings Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2010, and eligible investigations were synthesized using meta-analysis method. Five investigations were identified for the analysis of association between ACE I/D gene polymorphism and steroid-resistant nephrotic syndrome (SRNS) risk in Asian children and seven studies were included to explore the relationship between ACE I/D gene polymorphism and steroid-sensitive nephrotic syndrome (SSNS) susceptibility. Five investigations were recruited to explore the difference of ACE I/D gene distribution between SRNS and SSNS. There was no a markedly association between D allele or DD genotype and SRNS susceptibility or SSNS risk, and the gene distribution differences of ACE between SRNS and SSNS were not statistically significant. II genotype might play a positive role against SRNS onset but not for SSNS (OR = 0.51, P = 0.02; OR = 0.95, P = 0.85; respectively), however, the result for the association of II genotype with SRNS risk was not stable. Conclusions/Significance Our results indicate that D allele or DD homozygous can't become a significant genetic molecular marker to predict the treatment response to steroid in Asian children with INS. PMID:21611163

Recent Trends in WRN Gene Mutation Patterns in Individuals with Werner Syndrome.

Science.gov (United States)

Yamaga, Masaya; Takemoto, Minoru; Takada-Watanabe, Aki; Koizumi, Naoko; Kitamoto, Takumi; Sakamoto, Kenichi; Ishikawa, Takahiro; Koshizaka, Masaya; Maezawa, Yoshiro; Yokote, Koutaro

2017-08-01

To determine recent trends in mutation patterns in the WRN gene, which cause Werner syndrome (WS), a rare, inheritable progeroid syndrome in Japan. Retrospective cohort. Longitudinal survey of WS and literature search for case reports. Individuals whose genetic testing their facilities had requested between 2009 and October 2016 (N = 67). A nationwide epidemiological study was conducted from 2009 to 2011 to improve understanding of the pathology of WS and develop therapeutic guidelines. Since 2009, Chiba University Hospital consecutively evaluated the WRN gene in 67 individuals throughout Japan who had requested genetic testing. A literature search was also conducted for case reports on Japanese WS reported since 1997. A definitive diagnosis of WS was confirmed genetically in 50 of 67 participants. Through the literature search, 16 individuals diagnosed genetically with WS were identified. Of these 66 individuals with WS, 42 were homozygous for a WRN mutation, and 21 were compound heterozygotes. One novel mutant allele was identified in an individual with the compound heterozygous genotype. The proportion of compound heterozygotes (31.8%) was significantly greater than reported previously (14.2%), indicating that the incidence of consanguineous marriage of parents has decreased. The increased frequency of individuals with WS with the compound heterozygous genotype is a recent trend in Japan. A long-term follow-up study on WRN homozygotes and compound heterozygotes will allow the relationship between WRN genotype and clinical severity of WS to be evaluated in the future. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

Molecular epidemiology of Usher syndrome in Italy.

Science.gov (United States)

Vozzi, Diego; Aaspõllu, Anu; Athanasakis, Emmanouil; Berto, Anna; Fabretto, Antonella; Licastro, Danilo; Külm, Maigi; Testa, Francesco; Trevisi, Patrizia; Vahter, Marju; Ziviello, Carmela; Martini, Alessandro; Simonelli, Francesca; Banfi, Sandro; Gasparini, Paolo

2011-01-01

Usher syndrome is an autosomal recessive disorder characterized by hearing and vision loss. Usher syndrome is divided into three clinical subclasses (type 1, type 2, and type 3), which differ in terms of the severity and progression of hearing loss and the presence or absence of vestibular symptoms. Usher syndrome is defined by significant genetic heterogeneity, with at least 12 distinct loci described and 9 genes identified. This study aims to provide a molecular epidemiology report of Usher syndrome in Italy. Molecular data have been obtained on 75 unrelated Italian patients using the most up-to date technology available for the screening of Usher syndrome gene mutations, i.e., the genotyping microarray developed by Asper Biotech (Tartu, Estonia), which simultaneously investigates 612 different marker positions using the well established arrayed primer extension methodology (APEX). Using this method, we found that 12% of cases (9 out of 75) harbored homozygous or compound heterozygous mutations in the gene positions analyzed, whereas 20% (15 out of 75) of the patients were characterized by the presence of only one mutated allele based on the positions analyzed. One patient was found to be compound heterozygous for mutations in two different genes and this represents an example of possible digenic inheritance in Usher syndrome. A total of 66.6% of cases (50 out of 75) were found to be completely negative for the presence of Usher syndrome gene mutations in the detected positions. Mutations detected by the array were confirmed by direct sequencing. These findings highlight the efficacy of the APEX-based genotyping approach in the molecular assessment of Usher patients, suggesting the presence of alleles not yet identified and/or the involvement of additional putative genes that may account for the pathogenesis of Usher syndrome.

Molecular epidemiology of Usher syndrome in Italy

Science.gov (United States)

Vozzi, Diego; Aaspõllu, Anu; Athanasakis, Emmanouil; Berto, Anna; Fabretto, Antonella; Licastro, Danilo; Külm, Maigi; Testa, Francesco; Trevisi, Patrizia; Vahter, Marju; Ziviello, Carmela; Martini, Alessandro; Simonelli, Francesca; Banfi, Sandro

2011-01-01

Purpose Usher syndrome is an autosomal recessive disorder characterized by hearing and vision loss. Usher syndrome is divided into three clinical subclasses (type 1, type 2, and type 3), which differ in terms of the severity and progression of hearing loss and the presence or absence of vestibular symptoms. Usher syndrome is defined by significant genetic heterogeneity, with at least 12 distinct loci described and 9 genes identified. This study aims to provide a molecular epidemiology report of Usher syndrome in Italy. Methods Molecular data have been obtained on 75 unrelated Italian patients using the most up-to date technology available for the screening of Usher syndrome gene mutations, i.e., the genotyping microarray developed by Asper Biotech (Tartu, Estonia), which simultaneously investigates 612 different marker positions using the well established arrayed primer extension methodology (APEX). Results Using this method, we found that 12% of cases (9 out of 75) harbored homozygous or compound heterozygous mutations in the gene positions analyzed, whereas 20% (15 out of 75) of the patients were characterized by the presence of only one mutated allele based on the positions analyzed. One patient was found to be compound heterozygous for mutations in two different genes and this represents an example of possible digenic inheritance in Usher syndrome. A total of 66.6% of cases (50 out of 75) were found to be completely negative for the presence of Usher syndrome gene mutations in the detected positions. Mutations detected by the array were confirmed by direct sequencing. Conclusions These findings highlight the efficacy of the APEX-based genotyping approach in the molecular assessment of Usher patients, suggesting the presence of alleles not yet identified and/or the involvement of additional putative genes that may account for the pathogenesis of Usher syndrome. PMID:21738395

Variation in the fumonisin biosynthetic gene cluster in fumonisin-producing and nonproducing black aspergilli.

Science.gov (United States)

Susca, Antonia; Proctor, Robert H; Butchko, Robert A E; Haidukowski, Miriam; Stea, Gaetano; Logrieco, Antonio; Moretti, Antonio

2014-12-01

The ability to produce fumonisin mycotoxins varies among members of the black aspergilli. Previously, analyses of selected genes in the fumonisin biosynthetic gene (fum) cluster in black aspergilli from California grapes indicated that fumonisin-nonproducing isolates of Aspergillus welwitschiae lack six fum genes, but nonproducing isolates of Aspergillus niger do not. In the current study, analyses of black aspergilli from grapes from the Mediterranean Basin indicate that the genomic context of the fum cluster is the same in isolates of A. niger and A. welwitschiae regardless of fumonisin-production ability and that full-length clusters occur in producing isolates of both species and nonproducing isolates of A. niger. In contrast, the cluster has undergone an eight-gene deletion in fumonisin-nonproducing isolates of A. welwitschiae. Phylogenetic analyses suggest each species consists of a mixed population of fumonisin-producing and nonproducing individuals, and that existence of both production phenotypes may provide a selective advantage to these species. Differences in gene content of fum cluster homologues and phylogenetic relationships of fum genes suggest that the mutation(s) responsible for the nonproduction phenotype differs, and therefore arose independently, in the two species. Partial fum cluster homologues were also identified in genome sequences of four other black Aspergillus species. Gene content of these partial clusters and phylogenetic relationships of fum sequences indicate that non-random partial deletion of the cluster has occurred multiple times among the species. This in turn suggests that an intact cluster and fumonisin production were once more widespread among black aspergilli. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular cloning and characterization of a ToxA-like gene from the maize pathogen Cochliobolus heterostrophus

Science.gov (United States)

ToxA, the first discovered fungal proteinaceous host-selective toxin, was originally identified from the tan spot fungus Pyrenophora tritici-repentis (Ptr). Homologues of the PtrToxA gene have not been identified from any other ascomycetes except the leaf/glume blotch fungus Stagonospora nodorum, w...

Involvement of astrocyte metabolic coupling in Tourette syndrome pathogenesis.

Science.gov (United States)

de Leeuw, Christiaan; Goudriaan, Andrea; Smit, August B; Yu, Dongmei; Mathews, Carol A; Scharf, Jeremiah M; Verheijen, Mark H G; Posthuma, Danielle

2015-11-01

Tourette syndrome is a heritable neurodevelopmental disorder whose pathophysiology remains unknown. Recent genome-wide association studies suggest that it is a polygenic disorder influenced by many genes of small effect. We tested whether these genes cluster in cellular function by applying gene-set analysis using expert curated sets of brain-expressed genes in the current largest available Tourette syndrome genome-wide association data set, involving 1285 cases and 4964 controls. The gene sets included specific synaptic, astrocytic, oligodendrocyte and microglial functions. We report association of Tourette syndrome with a set of genes involved in astrocyte function, specifically in astrocyte carbohydrate metabolism. This association is driven primarily by a subset of 33 genes involved in glycolysis and glutamate metabolism through which astrocytes support synaptic function. Our results indicate for the first time that the process of astrocyte-neuron metabolic coupling may be an important contributor to Tourette syndrome pathogenesis.

A novel syndrome of autosomal-dominant hyperinsulinemic hypoglycemia linked to a mutation in the human insulin receptor gene

DEFF Research Database (Denmark)

Højlund, Kurt; Hansen, Torben; Lajer, Maria

2004-01-01

a missense mutation (Arg1174Gln) in the tyrosine kinase domain of the insulin receptor gene that cosegregated with the disease phenotype (logarithm of odds [LOD] score 3.21). In conclusion, we report a novel syndrome of autosomal-dominant hyperinsulinemic hypoglycemia. The findings demonstrate...

Complementary striped expression patterns of NK homeobox genes during segment formation in the annelid Platynereis.

Science.gov (United States)

Saudemont, Alexandra; Dray, Nicolas; Hudry, Bruno; Le Gouar, Martine; Vervoort, Michel; Balavoine, Guillaume

2008-05-15

NK genes are related pan-metazoan homeobox genes. In the fruitfly, NK genes are clustered and involved in patterning various mesodermal derivatives during embryogenesis. It was therefore suggested that the NK cluster emerged in evolution as an ancestral mesodermal patterning cluster. To test this hypothesis, we cloned and analysed the expression patterns of the homologues of NK cluster genes Msx, NK4, NK3, Lbx, Tlx, NK1 and NK5 in the marine annelid Platynereis dumerilii, a representative of trochozoans, the third great branch of bilaterian animals alongside deuterostomes and ecdysozoans. We found that most of these genes are involved, as they are in the fly, in the specification of distinct mesodermal derivatives, notably subsets of muscle precursors. The expression of the homologue of NK4/tinman in the pulsatile dorsal vessel of Platynereis strongly supports the hypothesis that the vertebrate heart derived from a dorsal vessel relocated to a ventral position by D/V axis inversion in a chordate ancestor. Additionally and more surprisingly, NK4, Lbx, Msx, Tlx and NK1 orthologues are expressed in complementary sets of stripes in the ectoderm and/or mesoderm of forming segments, suggesting an involvement in the segment formation process. A potentially ancient role of the NK cluster genes in segment formation, unsuspected from vertebrate and fruitfly studies so far, now deserves to be investigated in other bilaterian species, especially non-insect arthropods and onychophorans.

The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

Science.gov (United States)

Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

2017-06-01

This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

SKIV2L Mutations Cause Syndromic Diarrhea, or Trichohepatoenteric Syndrome

Science.gov (United States)

Fabre, Alexandre; Charroux, Bernard; Martinez-Vinson, Christine; Roquelaure, Bertrand; Odul, Egritas; Sayar, Ersin; Smith, Hilary; Colomb, Virginie; Andre, Nicolas; Hugot, Jean-Pierre; Goulet, Olivier; Lacoste, Caroline; Sarles, Jacques; Royet, Julien; Levy, Nicolas; Badens, Catherine

2012-01-01

Syndromic diarrhea (or trichohepatoenteric syndrome) is a rare congenital bowel disorder characterized by intractable diarrhea and woolly hair, and it has recently been associated with mutations in TTC37. Although databases report TTC37 as being the human ortholog of Ski3p, one of the yeast Ski-complex cofactors, this lead was not investigated in initial studies. The Ski complex is a multiprotein complex required for exosome-mediated RNA surveillance, including the regulation of normal mRNA and the decay of nonfunctional mRNA. Considering the fact that TTC37 is homologous to Ski3p, we explored a gene encoding another Ski-complex cofactor, SKIV2L, in six individuals presenting with typical syndromic diarrhea without variation in TTC37. We identified mutations in all six individuals. Our results show that mutations in genes encoding cofactors of the human Ski complex cause syndromic diarrhea, establishing a link between defects of the human exosome complex and a Mendelian disease. PMID:22444670

The contribution of GPR98 and DFNB31 genes to a Spanish Usher syndrome type 2 cohort.

Science.gov (United States)

García-García, Gema; Besnard, Thomas; Baux, David; Vaché, Christel; Aller, Elena; Malcolm, Sue; Claustres, Mireille; Millan, Jose M; Roux, Anne-Françoise

2013-01-01

Usher syndrome type 2 (USH2) is an autosomal recessive disease characterized by moderate to severe hearing loss and retinitis pigmentosa. To date, three disease-causing genes have been identified, USH2A, GPR98, and DFNB31, of which USH2A is clearly the major contributor. The aim of this work was to determine the contribution of GPR98 and DFNB31 genes in a Spanish cohort of USH2A negative patients using exhaustive molecular analysis, including sequencing, dosage, and splicing analysis. Linkage analysis was performed to prioritize the gene to study, followed by sequencing of exons and intron-exon boundaries of the selected gene, GPR98 (90 exons) or DFNB31 (12 exons). Functional splicing analyses and comparative genomic hybridization array to detect large rearrangements were performed when appropriate. We confirmed that mutations in GPR98 contribute a significant but minor role to Usher syndrome type 2. In a group of patients referred for molecular diagnosis, 43 had been found to be positive for USH2A mutations, the remaining 19 without USH2A alterations were screened, and seven different mutations were identified in the GPR98 gene in seven patients (five in the homozygous state), of which six were novel. All detected mutations result in a truncated protein; deleterious missense mutations were not found. No pathological mutations were identified in the DFNB31 gene. In Spain, USH2A and GPR98 are responsible for 95.8% and 5.2% of USH2 mutated cases, respectively. DFNB31 plays a minor role in the Spanish population. There was a group of patients in whom no mutation was found. These findings confirm the importance of including at least GPR98 analysis for comprehensive USH2 molecular diagnosis.

[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

Science.gov (United States)

Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

2016-08-01

To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

Science.gov (United States)

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

Science.gov (United States)

Hermes, Fatemah A; Cronan, John E

2013-10-01

The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.