
Sample records for syndrome gene homologue

  1. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  2. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles


    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  3. The murine homologue of HIRA, a DiGeorge syndrome candidate gene, is expressed in embryonic structures affected in human CATCH22 patients

    NARCIS (Netherlands)

    L.G. Wilming (Laurens); C.A. Snoeren; A.L. Rijswijk (Angelique); C. Meijers (Carel); F.G. Grosveld (Frank)


    textabstractA wide spectrum of birth defects is caused by deletions of the DiGeorge syndrome chromosomal region at 22q11. Characteristic features include cranio-facial, cardiac and thymic malformations, which are thought to arise form disturbances in the interactions

  4. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte


    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  5. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE


    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M


    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  6. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A


    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  7. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue (United States)

    Shao, Chung-Ping; Hor, Lien-I


    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  8. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved


    Apte, Manasi S.; Meller, Victoria H.


    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  9. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair


    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  10. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver


    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  11. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger


    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  12. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex


    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  13. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne


    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  14. An X-linked homologue of the autosomal inprinted gene ZNF127 escapes X inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Longstreet, M.; Nicholls, R.D.; Willard, H.F. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others


    The ZNF127 gene has been shown to be subject to parental imprinting in both humans and the mouse and maps to within the Prader-Willi/Angelman Syndrome critical region on chromosome 15. We have cloned two X-linked related loci, one of which, ZNFXp is a transcribed gene while the other, ZNFXq, is an untranscribed pseudogene. ZNFXp is 83.6% identical to ZNFXq and 65.4% identical to ZNF127 over 1.4 kb of open reading frame they share in common, Like ZNF127, the predicted protein sequence of ZNFXp contains a C{sub 3}HC{sub 4} zinc finger domain and C{sub 3}H zinc finger-like motifs. Whereas ZNF127 has three C{sub 3}H motifs, ZNFXp has four. A strong CpG island is located within 1 kb 5{prime} of the predicted amino terminus of ZNFXp. Expression of ZNFXp has been detected from mouse/human somatic cell hybrids containing either an active (n=2) or an inactive (n=4) chromosome, and thus escapes X inactivation. Probes made from the 3{prime} UTR of ZNFXp detect a number of related loci in both human and murine DNA, none of which is the ZNF127 locus on chromosome 15. None of the detectable murine bands shows dosage differences between males and females as would be expected for X-linked loci. This raises the possibility that ZNFXp inserted into the human X chromosome after its divergence from a common ancestor with the murine X. We have mapped ZNFXp to Xp11.4 by Southern blotting and PCR of hybrid DNAs and by fluorescence in situ hybridization (FISH). ZNFXq maps within the X Inactivation Center (XIC) region on Xq13.2, approximately 300 kb distal to the XIST gene. We find it intriguing, and perhaps significant, that two members of this gene family are subject to epigenetic regulation -- one autosomal imprinting, and the other escape from X inactivation. These results could imply an evolutionary and mechanistic relationship between these two processes.

  15. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii. (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H


    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.


    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  17. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger


    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  18. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato. (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A


    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  19. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes. (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos


    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  20. Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker. (United States)

    Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F


    The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  1. Candidate gene association studies in syndromic and non-syndromic cleft lip and palate

    Energy Technology Data Exchange (ETDEWEB)

    Daack-Hirsch, S.; Basart, A.; Frischmeyer, P. [Univ. of Iowa, IA (United States)] [and others


    Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP found in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.

  2. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100 (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.


    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  3. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.


    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.


    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  4. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu


    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  5. Activation of pur Gene Expression by a Homologue of the Bacillus subtilis PurR repressor:

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Martinussen, Jan


    R encoded repressor from Bacillus subtilis. The wildtype purR gene complements the purine auxotrophy of a purR::Iss1mutant, and it was shown that the purR::Iss1 mutation lowers transcription from the purine regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression....... We have identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences...... in the promoter regions of the PurR regulated genes in B. subtilis, and identified a perfectly matching PurBox in the purA promoter region, and slightly degenerate PurBox like sequences in the promoter regions for the pur operon and the purR gene....

  6. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung


    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  7. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth


    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  8. Genes and Syndromic Hearing Loss. (United States)

    Keats, Bronya J. B.


    This article provides a description of the human genome and patterns of inheritance and discusses genes that are associated with some of the syndromes for which hearing loss is a common finding, including: Waardenburg, Stickler, Jervell and Lange-Neilsen, Usher, Alport, mitochondrial encephalomyopathy, and sensorineural hearing loss. (Contains…

  9. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo


    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  10. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi


    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  11. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus


    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  12. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L


    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  13. Exclusion of RAI2 as the causative gene for Nance-Horan syndrome. (United States)

    Walpole, S M; Ronce, N; Grayson, C; Dessay, B; Yates, J R; Trump, D; Toutain, A


    Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, microphthalmia and/or microcornea, unusual dental morphology, dysmorphic facial features, and developmental delay in some cases. Recent linkage studies have mapped the NHS disease gene to a 3.5-cM interval on Xp22.2 between DXS1053 and DXS443. We previously identified a human homologue of a mouse retinoic-acid-induced gene (RAI2) within the NHS critical flanking interval and have tested the gene as a candidate for Nance-Horan syndrome in nine NHS-affected families. Direct sequencing of the RAI2 gene and predicted promoter region has revealed no mutations in the families screened; RAI2 is therefore unlikely to be associated with NHS.

  14. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes. (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J


    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  15. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.


    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  16. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus. (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  17. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  18. An indigoidine biosynthetic gene cluster from Streptomyces chromofuscus ATCC 49982 contains an unusual IndB homologue. (United States)

    Yu, Dayu; Xu, Fuchao; Valiente, Jonathan; Wang, Siyuan; Zhan, Jixun


    A putative indigoidine biosynthetic gene cluster was located in the genome of Streptomyces chromofuscus ATCC 49982. The silent 9.4-kb gene cluster consists of five open reading frames, named orf1, Sc-indC, Sc-indA, Sc-indB, and orf2, respectively. Sc-IndC was functionally characterized as an indigoidine synthase through heterologous expression of the enzyme in both Streptomyces coelicolor CH999 and Escherichia coli BAP1. The yield of indigoidine in E. coli BAP1 reached 2.78 g/l under the optimized conditions. The predicted protein product of Sc-indB is unusual and much larger than any other reported IndB-like protein. The N-terminal portion of this enzyme resembles IdgB and the C-terminal portion is a hypothetical protein. Sc-IndA and/or Sc-IndB were co-expressed with Sc-IndC in E. coli BAP1, which demonstrated the involvement of Sc-IndB, but not Sc-IndA, in the biosynthetic pathway of indigoidine. The yield of indigoidine was dramatically increased by 41.4 % (3.93 g/l) when Sc-IndB was co-expressed with Sc-IndC in E. coli BAP1. Indigoidine is more stable at low temperatures.

  19. Hyper-radiation sensitivity of murine scid mutation and mapping of the human homologue HYRC1 gene

    International Nuclear Information System (INIS)

    Komatsu, Kenshi; Ohta, Tohru; Niikawa, Norio; Okumura, Yutaka; Kubota, Nobuo.


    The murine severe combined immunodeficient mutation (scid) is characterized by a lack of both B and T cells, due to a defect in lymphoid variable-(diversity)-joining(V(D)J) rearrangement. Scid cells are highly sensitive to both radiation-induced killing and chromosomal aberrations. Present experiments also demonstrated the high sensitivity of scid cells to killing, because of a deficient repair of double strand breaks(DSB). Scid cells can repair only 60% of radiation-induced DSB for 3 hours, while normal cells repair 85% of the DSB. Significantly reduced Do and n values were obtained from survival curves of scid cells and were similar to ataxia-telangiectasia(AT) cells (a unique human disease conferring whole body radiosensitivity). However, the kinetics of DNA synthesis after irradiation were different between the two cell types. In contrast with the radioresistant DNA synthesis of AT cells, DNA synthesis of scid cells was markedly inhibited after irradiation. The existence of different mutations was also supported by evidence of complementation in somatic cell hybrids between scid cells and AT cells. Using these hybrid cells, fragments of human chromosome 8 were introduced into scid cells HPRT mutant via X-irradiation and somatic cell fusion. The resulting hybrid clones contained human DNA fragment(s) which complemented the hyper-radiosensitivity of the scid cells. Alu-PCR products from these hybrids were used for chromosome painting using the technique of chromosome in situ suppression hybridization, allowing assignment of the human HYRC1 (hyper-radiosensitivity of murine scid mutation, complementing 1) gene, a candidate for a V(D)J recombinant gene, to human chromosome 8q11. (author)

  20. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  1. Pleiotropic genes for metabolic syndrome and inflammation

    DEFF Research Database (Denmark)

    Kraja, Aldi T; Chasman, Daniel I; North, Kari E


    Metabolic syndrome (MetS) has become a health and financial burden worldwide. The MetS definition captures clustering of risk factors that predict higher risk for diabetes mellitus and cardiovascular disease. Our study hypothesis is that additional to genes influencing individual MetS risk factor...

  2. Eye Development Genes and Known Syndromes (United States)

    Slavotinek, Anne M.


    Anophthalmia and microphthalmia (A/M) are significant eye defects because they can have profound effects on visual acuity. A/M is associated with non-ocular abnormalities in an estimated 33–95% of cases and around 25% of patients have an underlying genetic syndrome that is diagnosable. Syndrome recognition is important for targeted molecular genetic testing, prognosis and for counseling regarding recurrence risks. This review provides clinical and molecular information for several of the commonest syndromes associated with A/M: Anophthalmia-Esophageal-Genital syndrome, caused by SOX2 mutations, Anophthalmia and pituitary abnormalities caused by OTX2 mutations, Matthew-Wood syndrome caused by STRA6 mutations, Oculocardiafaciodental syndrome and Lenz microphthalmia caused by BCOR mutations, Microphthalmia Linear Skin pigmentation syndrome caused by HCCS mutations, Anophthalmia, pituitary abnormalities, polysyndactyly caused by BMP4 mutations and Waardenburg anophthalmia caused by mutations in SMOC1. In addition, we briefly discuss the ocular and extraocular phenotypes associated with several other important eye developmental genes, including GDF6, VSX2, RAX, SHH, SIX6 and PAX6. PMID:22005280

  3. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim


    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  4. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development. (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron


    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  5. The light gene of Drosophila melanogaster encodes a homologue of VPS41, a yeast gene involved in cellular-protein trafficking. (United States)

    Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M


    Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.

  6. Bartter's and Gitelman's syndromes: from gene to clinic


    Naesens, Maarten; STEELS, Paul; Verberckmoes, René; Vanrenterghem, Yves; Kuypers, Dirk


    Bartter's and Gitelman's syndromes are characterized by hypokalemia, normal to low blood pressure and hypochloremic metabolic alkalosis. Recently, investigators have been able to demonstrate mutations of six genes encoding several renal tubular transporters and ion channels that can be held responsible for Bartter's and Gitelman's syndromes. Neonatal Bartter's syndrome is caused by mutations of NKCC2 or ROMK, classic Bartter's syndrome by mutations of ClC-Kb, Bartter's syndrome associated wit...

  7. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, V.


    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  8. Pathological assessment of mismatch repair gene variants in Lynch syndrome

    DEFF Research Database (Denmark)

    Rasmussen, Lene Juel; Heinen, Christopher D; Royer-Pokora, Brigitte


    Lynch syndrome (LS) is caused by germline mutations in DNA mismatch repair (MMR) genes and is the most prevalent hereditary colorectal cancer syndrome. A significant proportion of variants identified in MMR and other common cancer susceptibility genes are missense or noncoding changes whose...

  9. Blood Gene Expression Predicts Bronchiolitis Obliterans Syndrome

    Directory of Open Access Journals (Sweden)

    Richard Danger


    Full Text Available Bronchiolitis obliterans syndrome (BOS, the main manifestation of chronic lung allograft dysfunction, leads to poor long-term survival after lung transplantation. Identifying predictors of BOS is essential to prevent the progression of dysfunction before irreversible damage occurs. By using a large set of 107 samples from lung recipients, we performed microarray gene expression profiling of whole blood to identify early biomarkers of BOS, including samples from 49 patients with stable function for at least 3 years, 32 samples collected at least 6 months before BOS diagnosis (prediction group, and 26 samples at or after BOS diagnosis (diagnosis group. An independent set from 25 lung recipients was used for validation by quantitative PCR (13 stables, 11 in the prediction group, and 8 in the diagnosis group. We identified 50 transcripts differentially expressed between stable and BOS recipients. Three genes, namely POU class 2 associating factor 1 (POU2AF1, T-cell leukemia/lymphoma protein 1A (TCL1A, and B cell lymphocyte kinase, were validated as predictive biomarkers of BOS more than 6 months before diagnosis, with areas under the curve of 0.83, 0.77, and 0.78 respectively. These genes allow stratification based on BOS risk (log-rank test p < 0.01 and are not associated with time posttransplantation. This is the first published large-scale gene expression analysis of blood after lung transplantation. The three-gene blood signature could provide clinicians with new tools to improve follow-up and adapt treatment of patients likely to develop BOS.

  10. Translocation breakpoint at 7q31 associated with tics: further evidence for IMMP2L as a candidate gene for Tourette syndrome. (United States)

    Patel, Chirag; Cooper-Charles, Lisa; McMullan, Dominic J; Walker, Judith M; Davison, Val; Morton, Jenny


    Gilles de la Tourette syndrome is a complex neuropsychiatric disorder with a strong genetic basis. We identified a male patient with Tourette syndrome-like tics and an apparently balanced de novo translocation [46,XY,t(2;7)(p24.2;q31)]. Further analysis using array comparative genomic hybridisation (CGH) revealed a cryptic deletion at 7q31.1-7q31.2. Breakpoints disrupting this region have been reported in one isolated and one familial case of Tourette syndrome. In our case, IMMP2L, a gene coding for a human homologue of the yeast inner mitochondrial membrane peptidase subunit 2, was disrupted by the breakpoint on 7q31.1, with deletion of exons 1-3 of the gene. The IMMP2L gene has previously been proposed as a candidate gene for Tourette syndrome, and our case provides further evidence of its possible role in the pathogenesis. The deleted region (7q31.1-7q31.2) of 7.2 Mb of genomic DNA also encompasses numerous genes, including FOXP2, associated with verbal dyspraxia, and the CFTR gene.

  11. Do the MTHFR gene polymorphism and Down syndrome pregnancy ...

    African Journals Online (AJOL)

    Background: Down syndrome, the most common trisomy 21 arises from abnormal chromosomal segregation. The etiology includes genetic and acquired factors. The main genetic factor that is well appreciated for onset of Down syndrome pregnancy is MTHFR gene polymorphism. But till date, no final conclusion has arrived ...

  12. Genes and Disease: Prader-Willi Syndrome (United States)

    ... MD): National Center for Biotechnology Information (US); 1998-. Genes and Disease [Internet]. Show details National Center for ... 45K) PDF version of this title (3.8M) Gene sequence Genome view see gene locations Entrez Gene ...

  13. The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.


    Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

  14. Mismatch repair genes in Lynch syndrome: a review

    Directory of Open Access Journals (Sweden)

    Felipe Cavalcanti Carneiro da Silva

    Full Text Available Lynch syndrome represents 1-7% of all cases of colorectal cancer and is an autosomal-dominant inherited cancer predisposition syndrome caused by germline mutations in deoxyribonucleic acid (DNA mismatch repair genes. Since the discovery of the major human genes with DNA mismatch repair function, mutations in five of them have been correlated with susceptibility to Lynch syndrome: mutS homolog 2 (MSH2; mutL homolog 1 (MLH1; mutS homolog 6 (MSH6; postmeiotic segregation increased 2 (PMS2; and postmeiotic segregation increased 1 (PMS1. It has been proposed that one additional mismatch repair gene, mutL homolog 3 (MLH3, also plays a role in Lynch syndrome predisposition, but the clinical significance of mutations in this gene is less clear. According to the InSiGHT database (International Society for Gastrointestinal Hereditary Tumors, approximately 500 different LS-associated mismatch repair gene mutations are known, primarily involving MLH1 (50% and MSH2 (40%, while others account for 10%. Much progress has been made in understanding the molecular basis of Lynch Syndrome. Molecular characterization will be the most accurate way of defining Lynch syndrome and will provide predictive information of greater accuracy regarding the risks of colon and extracolonic cancer and enable optimal cancer surveillance regimens.

  15. Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism

    Directory of Open Access Journals (Sweden)

    Lavender Yuen-Nam Fan


    Full Text Available The data presented in this article are related to the review article entitled ‘Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis’ (Saavedra-Garcia et al., 2017 [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

  16. Dataset of the human homologues and orthologues of lipid-metabolic genes identified as DAF-16 targets their roles in lipid and energy metabolism. (United States)

    Fan, Lavender Yuen-Nam; Saavedra-García, Paula; Lam, Eric Wing-Fai


    The data presented in this article are related to the review article entitled 'Unravelling the role of fatty acid metabolism in cancer through the FOXO3-FOXM1 axis' (Saavedra-Garcia et al., 2017) [24]. Here, we have matched the DAF-16/FOXO3 downstream genes with their respective human orthologues and reviewed the roles of these targeted genes in FA metabolism. The list of genes listed in this article are precisely selected from literature reviews based on their functions in mammalian FA metabolism. The nematode Caenorhabditis elegans gene orthologues of the genes are obtained from WormBase, the online biological database of C. elegans. This dataset has not been uploaded to a public repository yet.

  17. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  18. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.


    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  19. Nance-Horan syndrome: a contiguous gene syndrome involving deletion of the amelogenin gene? A case report and molecular analysis. (United States)

    Franco, E; Hodgson, S; Lench, N; Roberts, G J


    A case of Nance-Horan syndrome in a male is presented, with some features of the condition in his carrier mother and her mother. It is proposed that Nance-Horan syndrome might be a contiguous gene syndrome mapping to chromosome Xp21.2-p22.3. The proband had congenital cataract microphthalmia and dental abnormalities including screwdriver shaped incisors and evidence of enamel pitting hypoplasia. The region Xp21.2-p22.3 also contains the tooth enamel protein gene, amelogenin (AMGX). Using molecular genetic techniques, we have shown that there is no evidence that the AMGX gene is deleted in this case of the Nance-Horan syndrome.

  20. Mating type gene homologues and putative sex pheromone-sensing pathway in arbuscular mycorrhizal fungi, a presumably asexual plant root symbiont.

    Directory of Open Access Journals (Sweden)

    Sébastien Halary

    Full Text Available The fungal kingdom displays a fascinating diversity of sex-determination systems. Recent advances in genomics provide insights into the molecular mechanisms of sex, mating type determination, and evolution of sexual reproduction in many fungal species in both ancient and modern phylogenetic lineages. All major fungal groups have evolved sexual differentiation and recombination pathways. However, sexuality is unknown in arbuscular mycorrhizal fungi (AMF of the phylum Glomeromycota, an ecologically vital group of obligate plant root symbionts. AMF are commonly considered an ancient asexual lineage dating back to the Ordovician, approximately 460 M years ago. In this study, we used genomic and transcriptomic surveys of several AMF species to demonstrate the presence of conserved putative sex pheromone-sensing mitogen-activated protein (MAP kinases, comparable to those described in Ascomycota and Basidiomycota. We also find genes for high mobility group (HMG transcription factors, homologous to SexM and SexP genes in the Mucorales. The SexM genes show a remarkable sequence diversity among multiple copies in the genome, while only a single SexP sequence was detected in some isolates of Rhizophagus irregularis. In the Mucorales and Microsporidia, the sexM gene is flanked by genes for a triosephosphate transporter (TPT and a RNA helicase, but we find no evidence for synteny in the vicinity of the Sex locus in AMF. Nonetheless, our results, together with previous observations on meiotic machinery, suggest that AMF could undergo a complete sexual reproduction cycle.

  1. [Wolfram syndrome: clinical features, molecular genetics of WFS1 gene]. (United States)

    Tanabe, Katsuya; Matsunaga, Kimie; Hatanaka, Masayuki; Akiyama, Masaru; Tanizawa, Yukio


    Wolfram syndrome(WFS: OMIM 222300) is a rare recessive neuro-endocrine degenerative disorder, known as DIDMOAD(Diabetes Insipidus, early-onset Diabetes Mellitus, Optic Atrophy and Deafness) syndrome. Most affected individuals carry recessive mutations in the Wolfram syndrome 1 gene(WFS1). The WFS1 protein is an endoplasmic reticulum(ER) embedded protein, which functions in ER calcium homeostasis and unfolded protein responses. Dysregulation of these cellular processes results in the development of ER stress, leading to apoptosis. In addition, abundantly present WFS1 protein in insulin secretory granules plays a role in the intra-granular acidification. However, the phenotypic pleiomorphism and molecular complexity of this disease limit the understanding of WFS. Here we review clinical features, molecular mechanisms and mutations of WFS1 gene that relate to this syndrome.


    We recently described a general method that can improve microarray analysis of toxicant-exposed cells that uses the intrinsic power of transcriptional coupling and toxicant concentration-expression response data. In this analysis, we characterized changes in global gene expressio...

  3. Thyroid peroxidase: evidence for disease gene exclusion in Pendred's syndrome. (United States)

    Gausden, E; Armour, J A; Coyle, B; Coffey, R; Hochberg, Z; Pembrey, M; Britton, K E; Grossman, A; Reardon, W; Trembath, R


    Pendred's syndrome is an association between congenital neurosensory deafness and goitre with abnormal discharge of iodide following perchlorate challenge, indicating a defect of iodide organification. Although Pendred's syndrome may cause up to 7.5% of all cases of congenital deafness, the molecular basis of the association between the hearing loss and the thyroid organification defect remains unknown. We chose to investigate the role of the thyroid peroxidase (TPO) gene as the genetic defect in Pendred's syndrome. A highly informative variable number tandem repeat (VNTR), located 1.5 kb downstream of exon 10 of the TPO gene, was used to search for genetic linkage in multiple sibships affected by Pendred's syndrome. Seven kindreds were recruited from the UK, each with at least two affected members. We have also examined a large inbred Israeli family with two affected offspring and five unaffected children. Individuals were assigned affected status based on the characteristic clinical features of Pendred's syndrome, namely the presence of congenital sensorineural hearing loss and the appearance in early life of a goitre. Additionally, at least one affected member from each sibship had a characteristic positive perchlorate discharge test (Morgans & Trotter, 1958). PCR amplification of genomic DNA at the TPO VNTR allowed assignment of genotypes to each individual and the calculation of a two-point LOD score. In six of the nine sibships analysed we found obligatory recombination between TPO and Pendred's syndrome. Non-complementation observed in affected parents with an affected offspring excluded TPO in an affected sibship with genotype sharing and supports a hypothesis of genetic homogeneity for Pendred's syndrome. In two sibships, mutation of the TPO gene as the cause of Pendred's syndrome could not be excluded. These data suggest that defects at the thyroid peroxidase locus on chromosome 2 are not the major cause of Pendred's syndrome.

  4. Combination of Hypomorphic Mutations of the Drosophila Homologues of Aryl Hydrocarbon Receptor and Nucleosome Assembly Protein Family Genes Disrupts Morphogenesis, Memory and Detoxification


    Kuzin, Boris A.; Nikitina, Ekaterina A.; Cherezov, Roman O.; Vorontsova, Julia E.; Slezinger, Mikhail S.; Zatsepina, Olga G.; Simonova, Olga B.; Enikolopov, Grigori N.; Savvateeva-Popova, Elena V.


    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response...

  5. Gene dosage effects of the imprinted delta-like homologue 1 (dlk1/pref1 in development: implications for the evolution of imprinting.

    Directory of Open Access Journals (Sweden)

    Simao Teixeira da Rocha


    Full Text Available Genomic imprinting is a normal process that causes genes to be expressed according to parental origin. The selective advantage conferred by imprinting is not understood but is hypothesised to act on dosage-critical genes. Here, we report a unique model in which the consequences of a single, double, and triple dosage of the imprinted Dlk1/Pref1, normally repressed on the maternally inherited chromosome, can be assessed in the growing embryo. BAC-transgenic mice were generated that over-express Dlk1 from endogenous regulators at all sites of embryonic activity. Triple dosage causes lethality associated with major organ abnormalities. Embryos expressing a double dose of Dlk1, recapitulating loss of imprinting, are growth enhanced but fail to thrive in early life, despite the early growth advantage. Thus, any benefit conferred by increased embryonic size is offset by postnatal lethality. We propose a negative correlation between gene dosage and survival that fixes an upper limit on growth promotion by Dlk1, and we hypothesize that trade-off between growth and lethality might have driven imprinting at this locus.

  6. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification. (United States)

    Kuzin, Boris A; Nikitina, Ekaterina A; Cherezov, Roman O; Vorontsova, Julia E; Slezinger, Mikhail S; Zatsepina, Olga G; Simonova, Olga B; Enikolopov, Grigori N; Savvateeva-Popova, Elena V


    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  7. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Directory of Open Access Journals (Sweden)

    Boris A Kuzin

    Full Text Available Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  8. Diagnostic test for prenatal identification of Down's syndrome and mental retardation and gene therapy therefor (United States)

    Smith, Desmond J.; Rubin, Edward M.


    A a diagnostic test useful for prenatal identification of Down syndrome and mental retardation. A method for gene therapy for correction and treatment of Down syndrome. DYRK gene involved in the ability to learn. A method for diagnosing Down's syndrome and mental retardation and an assay therefor. A pharmaceutical composition for treatment of Down's syndrome mental retardation.

  9. [RIT1: a novel gene associated with Noonan syndrome]. (United States)

    Arroyo-Carrera, I; Solo de Zaldivar-Tristancho, M; Martin-Fernandez, R; Vera-Torres, M; Gonzalez de Buitrago-Amigo, J F; Botet-Rodriguez, J


    Noonan syndrome is the most frequent of the congenital group of malformation syndromes caused by germline mutations that encode components of the RAS/MAPK pathway, termed RASopathies, one of the most frequent congenital genetic disorders in the clinical practice. Recently RIT1 mutations have been reported in patients with Noonan syndrome. A 7 years-old girl with a clinical diagnosis of Noonan syndrome, and with a hypertrophic cardiomyopathy included in her clinical manifestations, where a de novo heterozygous, probably pathogenic, novel mutation in RIT1, c.295T>C (p.Phe99Leu), has been identified. RIT1 shares homology with other RAS proteins and the expression of mutant alleles demonstrates a gain-of-function effect supporting a causative role in Noonan syndrome pathogenesis. Data suggest that the frequency of RIT1 mutations can be estimated as 3-5% in Noonan syndrome patients. These cases compared with Noonan patients harboring mutations in other genes are characterized by high frequency of prenatal abnormalities and hypertrophic cardiomyopathy, and lower frequencies of short stature and pectus abnormalities. We emphasize the importance of the novel identified genes in order to be included in the diagnostic panels.

  10. Marfan syndrome gene search intensifies following identification of basic defect

    Energy Technology Data Exchange (ETDEWEB)

    Randall, T.


    Somewhere, quite possible along chromosomes 8 and/or 15, the gene(s) for Marfan syndrome will be found. The search is intensifying following a report that faulty scaffolding in the body's connective tissue appears to be the long sought after defect behind the syndrome, and inherited disorder that has caused the premature death of young, healthy-looking individuals. Finding that something in the living masonry of the human body has proven to be a 30-year inquisition of nearly two dozen molecules that has engaged investigators worldwide. Historically, researchers have searched for a structural flaw in one of the collagen molecules to explain the cause of Marfan Syndrome. Using monoclonal antibodies, researchers have implicated microfibrils, the extracellular filaments that provide a matrix for the deposit of elastin during embryonic development.

  11. A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats. (United States)

    Boshra, Hani; Truong, Thang; Nfon, Charles; Bowden, Timothy R; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A; Kara, Pravesh; Mather, Arshad; Wallace, David B; Babiuk, Shawn


    Sheep and goat pox continue to be important livestock diseases that pose a major threat to the livestock industry in many regions in Africa and Asia. Currently, several live attenuated vaccines are available and used in endemic countries to control these diseases. One of these is a partially attenuated strain of lumpy skin disease virus (LSDV), KS-1, which provides cross-protection against both sheep pox and goat pox. However, when used in highly stressed dairy cattle to protect against lumpy skin disease (LSD) the vaccine can cause clinical disease. In order to develop safer vaccines effective against all three diseases, a pathogenic strain of LSDV (Warmbaths [WB], South Africa) was attenuated by removing a putative virulence factor gene (IL-10-like) using gene knockout (KO) technology. This construct (LSDV WB005KO) was then evaluated as a vaccine for sheep and goats against virulent capripoxvirus challenge. Sheep and goats were vaccinated with the construct and the animals were observed for 21days. The vaccine appeared to be safe, and did not cause disease, although it induced minor inflammation at the injection site similar to that caused by other attenuated sheep and goat pox vaccines. In addition, no virus replication was detected in blood, oral or nasal swabs using real-time PCR following vaccination and low levels of neutralising antibodies were detected in both sheep and goats. Leukocytes isolated from vaccinated animals following vaccination elicited capripoxvirus-specific IFN-γ secretion, suggesting that immunity was also T-cell mediated. Following challenge with virulent capripoxvirus, vaccinated sheep and goats were found to be completely protected and exhibited no clinical disease. Furthermore, real-time PCR of blood samples at various time points suggested that viremia was absent in both groups of vaccinated animals, as opposed to capripoxvirus-related clinical disease and viremia observed in the unvaccinated animals. These findings suggest that this

  12. nuvA, an Aspergillus nidulans gene involved in DNA repair and recombination, is a homologue of Saccharomyces cerevisiae RAD18 and Neurospora crassa uvs-2. (United States)

    Iwanejko, L; Cotton, C; Jones, G; Tomsett, B; Strike, P


    A 40 kb genomic clone and 2.3 kb EcoRI subclone that rescued the DNA repair and recombination defects of the Aspergillus nidulans nuvA11 mutant were isolated and the subclone sequenced. The subclone hybridized to a cosmid in a chromosome-specific library confirming the assignment of nuvA to linkage group IV and indicating its closeness to bimD. Amplification by PCR clarified the relative positions of nuvA and bimD. A region identified within the subclone, encoding a C3HC4 zinc finger motif, was used as a probe to retrieve a cDNA clone. Sequencing of this clone showed that the nuvA gene has an ORF of 1329 bp with two introns of 51 bp and 60 bp. Expression of nuvA appears to be extremely low. The putative NUVA polypeptide has two zinc finger motifs, a molecular mass of 48906 Da and has 39% identity with the Neurospora crassa uvs-2 and 25% identity with the Saccharomyces cerevisiae RAD18 translation products. Although mutations in nuvA, uvs-2 and RAD18 produce similar phenotypes, only the nuvA11 mutation affects meiotic recombination. A role for nuvA in both DNA repair and genetic recombination is proposed.

  13. Kallmann syndrome and ichthyosis: a case of contiguous gene deletion syndrome

    Directory of Open Access Journals (Sweden)

    Irene Berges-Raso


    Full Text Available Kallmann syndrome is a genetically heterogeneous form of hypogonadotropic hypogonadism caused by gonadotropin-releasing hormone deficiency and characterized by anosmia or hyposmia due to hypoplasia of the olfactory bulbs; osteoporosis and metabolic syndrome can develop due to longstanding untreated hypogonadism. Kallmann syndrome affects 1 in 10 000 men and 1 in 50 000 women. Defects in 17 genes, including KAL1, have been implicated. Kallmann syndrome can be associated with X-linked ichthyosis, a skin disorder characterized by early onset dark, dry, irregular scales affecting the limb and trunk, caused by a defect of the steroid sulfatase gene (STS. Both KAL1 and STS are located in the Xp22.3 region; therefore, deletions in this region cause a contiguous gene syndrome. We report the case of a 32-year-old man with ichthyosis referred for evaluation of excessive height (2.07 m and weight (BMI: 29.6 kg/m2, microgenitalia and absence of secondary sex characteristics. We diagnosed Kallmann syndrome with ichthyosis due to a deletion in Xp22.3, a rare phenomenon.

  14. Identification of the gene for Nance-Horan syndrome (NHS). (United States)

    Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J


    The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.

  15. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Emond Mary


    Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

  16. Diverse growth hormone receptor gene mutations in Laron syndrome. (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U


    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  17. Gene mapping of the Usher syndromes. (United States)

    Kimberling, W; Smith, R J


    USH is an autosomal recessive group of diseases characterized by auditory impairment and visual loss owing to RP. Two common types of USH are known, types I and II. USH type I is characterized by a congenital severe to profound hearing impairment, absent vestibular function, and a progressive pigmentary retinopathy. Persons with type I do not find hearing aids useful, have delayed motor development, and experience progressive night blindness and peripheral visual loss, which usually begins in their second decade. USH type II is characterized by a congenital moderate to severe hearing loss with a down-sloping audiogram, normal vestibular function, and a progressive pigmentary retinopathy. Persons with USH2 find hearing aids beneficial, have normal psychomotor development, and experience progressive night blindness and peripheral visual loss, which usually begins in their third decade. Vestibular dysfunction is the best distinguishing hallmark to differentiate USH type I from type II. One USH type II gene (called USH2) has been assigned to chromosome 1q. One USH type I gene has been tentatively assigned to chromosome 14q. There are other USH genes that have not yet been localized.

  18. A patient with Werner syndrome and adiponectin gene mutation. (United States)

    Hashimoto, Naotake; Hatanaka, Sachiko; Yokote, Koutaro; Kurosawa, Hiroko; Yoshida, Tomohiko; Iwai, Rie; Takahashi, Hidenori; Yoshida, Katsuya; Horie, Atsuya; Sakurai, Kenichi; Yagui, Kazuo; Saito, Yasushi; Yoshida, Shouji


    Werner syndrome is a premature aging disease characterized by genomic instability and increased cancer risk. Here, we report a 45-year-old diabetic man as the first Werner syndrome patient found to have an adiponectin gene mutation. Showing graying and loss of hair, skin atrophy, and juvenile cataract, he was diagnosed with Werner syndrome type 4 by molecular analysis. His serum adiponectin concentration was low. In the globular domain of the adiponectin gene, I164T in exon 3 was detected. When we examined effects of pioglitazone (15 mg/day) on serum adiponectin multimer and monomer concentrations using selective assays, the patient's relative percentage increased in adiponectin concentration was almost same as that in the 18 diabetic patients without an adiponectin mutation, but the absolute adiponectin concentration was half of those seen in diabetic patients treated with the same pioglitazone dose who had no adiponectin mutation. The response suggested that pioglitazone treatment might help to prevent future Werner syndrome-related acceleration of atherosclerosis. Present and further clinical relevant to atherosclerosis in this patient should be imformative concerning the pathogenesis and treatment of atherosclerosis in the presence of hypoadiponectinemia and insulin resistance.

  19. Syndromes associated with Homo sapiens pol II regulatory genes. (United States)

    Bina, M; Demmon, S; Pares-Matos, E I


    The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.

  20. Variant of Rett syndrome and CDKL5 gene

    DEFF Research Database (Denmark)

    Pini, Giorgio; Bigoni, Stefania; Engerström, Ingegerd Witt


    UNLABELLED: Rett syndrome (RTT) is a severe neurodevelopmental disorder affecting almost exclusively females. The Hanefeld variant, or early-onset seizure variant, has been associated with mutations in CDKL5 gene. AIMS: In recent years more than 60 patients with mutations in the CDKL5 gene have...... been described in the literature, but the cardiorespiratory phenotype has not been reported. Our aim is to describe clinical and autonomic features of these girls. METHODS: 10 girls with CDKL5 mutations and a diagnosis of Hanefeld variant have been evaluated on axiological and clinical aspects. In all...

  1. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia


    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  2. What's in a Gene? Pseudoexfoliation Syndrome and Pigment Dispersion Syndrome in the Same Patient. (United States)

    Pokrovskaya, Olya; O'Brien, Colm


    Pseudoexfoliation syndrome (PXS) and pigment dispersion syndrome (PDS) are two of the commonest disorders to produce secondary open-angle glaucoma through trabecular meshwork blockage. Each is a defined clinical entity, and while genetics likely play a significant role in the pathogenesis of both, the specific genes involved appear to be distinct. There is surprisingly little published in the literature regarding the coexistence of PDS and PXS in the same patient. We present the intriguing case of a patient who developed PDS in one eye and PXS in the other. This unusual case acts as a platform for an interesting discussion of the genomics of PXS and PDS.

  3. What's in a Gene Pseudoexfoliation Syndrome and Pigment Dispersion Syndrome in the Same Patient

    Directory of Open Access Journals (Sweden)

    Olya Pokrovskaya


    Full Text Available Pseudoexfoliation syndrome (PXS and pigment dispersion syndrome (PDS are two of the commonest disorders to produce secondary open-angle glaucoma through trabecular meshwork blockage. Each is a defined clinical entity, and while genetics likely play a significant role in the pathogenesis of both, the specific genes involved appear to be distinct. There is surprisingly little published in the literature regarding the coexistence of PDS and PXS in the same patient. We present the intriguing case of a patient who developed PDS in one eye and PXS in the other. This unusual case acts as a platform for an interesting discussion of the genomics of PXS and PDS.


    Directory of Open Access Journals (Sweden)

    Zh.P. Sharnova


    Full Text Available To investigate the role of the reninangiotensin system genes polymorphisms in develop and progression of nephrotic syndrom (NS in children we determined the genotypes of angiotensin converting enzyme (ACE, angiotensinogen (AGT and angiotensin ii receptor (ATII-R of 1 type in 80 russian children with ns including and 15 children with chronic renal failure (CRF. Genotype frequencies did not differ between patients with ns and controls (n = 165. The distribution of ace, AGT and ATII-R 1 type genotypes was similar among ns sub groups, such as focal segmental glomerulosclerosis (FSGS (n = 18, steroid-sensitive nephrotic syndrome (n = 32, nephrotic syndrome with hypertension and hemoturia (n = 22 and with control group. When ns subjects with CRF (n = 15 were compared with control, the prevalence of ace DD genotype was significantly higher (47% VS 21%; χ2 = 4,44; p < 0,05. Our results indicate that the DD genotype ace may be a factor of risk for the dеvеlopment of progressive renal impairment in the children with nephrotic syndrome. The analysis of treatment's effect with inhibitor of ace in groups patients with steroid resistant NS (SRNS demonstrated decreasing of renoprotective effect of this drugs in patients with id and dd genotypes com? Pared with ii genotype: the degree of blood pressure, proteinuria and the rate of glomerular filtration decrease was significantly lower (55,46 ± 9,25 VS 92,74 ± 25; р < 0,05 in these patients.Key words: nephrotic syndrom, chronic renal failure, polymorphism of genes, renin-angiotensin system.

  5. Sjogren Syndrome-Gene Therapy and its Prospective

    Directory of Open Access Journals (Sweden)

    R Rahpeyma


    Full Text Available Sjogren syndrome is one of the autoimmune diseases which is characterized by lymphocytic infiltration to exocrine glands and causes keratoconjunctivitis sicca and xerostomia. Today, a large population, with a majority of women over 40, suffer from this disease and have several complications regarding oral health and reduced life quality such as severe dental caries, painful eyes, olfactory and gustatory deficiency, speech, mastication and swallowing discomforts. Unfortunately, these patients do not respond to the conventional therapies. Nowadays in medical world, which its target is basic therapy and not symptomatic one, several gene therapy approaches, have gained importance in treatment of this apparently incurable diseases. Due to the facts that this disease is the second prevelant autoimmune disease, after rheumatoid arthritis, and the conventional therapies of the disease are all relative and symptomatic, researchers have insisted on the basic and causative therapy through gene transfer more than before. In the Present article, through reviewing 58 references containing recent scientific and investigatory findings it has been tried, to consider the pathogenesis and conventional therapies of this syndrome. Another purpose of this study was to investigate several and potentially very effective gene transfer systems and different theraputic genes (mainly membrane water channels, ione transporter molecules, transcription factors, antifungal proteins and free radical scavengers.

  6. RAI1 gene mutations: mechanisms of Smith–Magenis Syndrome

    Directory of Open Access Journals (Sweden)

    Falco M


    Full Text Available Mariateresa Falco,1,* Sonia Amabile,1,* Fabio Acquaviva2 1Department of Molecular Medicine and Medical Biotechnology, University of Naples “Federico II”, Naples, Italy; 2Department of Translational Medical Sciences (DISMET, Section of Pediatric Clinical Genetics, University of Naples “Federico II”, Naples, Italy *These authors contributed equally to this work Abstract: Smith–Magenis syndrome (SMS; OMIM #182290 is a complex genetic disorder characterized by distinctive physical features, developmental delay, cognitive impairment, and a typical behavioral phenotype. SMS is caused by interstitial 17p11.2 deletions, encompassing multiple genes and including the retinoic acid-induced 1 gene (RAI1, or by mutations in RAI1 itself. About 10% of all the SMS patients, in fact, carry an RAI1 mutation responsible for the phenotype. RAI1 (OMIM *607642 is a dosage-sensitive gene expressed in many tissues and highly conserved among species. Over the years, several studies have demonstrated that RAI1 (or its homologs in animal models acts as a transcriptional factor implicated in embryonic neurodevelopment, neuronal differentiation, cell growth and cell cycle regulation, bone and skeletal development, lipid and glucose metabolisms, behavioral functions, and circadian activity. Patients with RAI1 pathogenic variants show some phenotypic differences when compared to those carrying the typical deletion. They usually have lower incidence of hypotonia and less cognitive impairment than those with 17p11.2 deletions but more frequently show the behavioral characteristics of the syndrome and overeating issues. These differences reflect the primary pathogenetic role of RAI1 without the pathogenetic contribution of the other genes included in the typical 17p11.2 deletion. The better comprehension of physiological roles of RAI1, its molecular co-workers and interactors, and its contribution in determining the typical SMS phenotype will certainly open a new path

  7. Marfan Syndrome and Related Disorders: 25 Years of Gene Discovery. (United States)

    Verstraeten, Aline; Alaerts, Maaike; Van Laer, Lut; Loeys, Bart


    Marfan syndrome (MFS) is a rare, autosomal-dominant, multisystem disorder, presenting with skeletal, ocular, skin, and cardiovascular symptoms. Significant clinical overlap with other systemic connective tissue diseases, including Loeys-Dietz syndrome (LDS), Shprintzen-Goldberg syndrome (SGS), and the MASS phenotype, has been documented. In MFS and LDS, the cardiovascular manifestations account for the major cause of patient morbidity and mortality, rendering them the main target for therapeutic intervention. Over the past decades, gene identification studies confidently linked the aforementioned syndromes, as well as nonsyndromic aneurysmal disease, to genetic defects in proteins related to the transforming growth factor (TGF)-β pathway, greatly expanding our knowledge on the disease mechanisms and providing us with novel therapeutic targets. As a result, the focus of the developing pharmacological treatment strategies is shifting from hemodynamic stress management to TGF-β antagonism. In this review, we discuss the insights that have been gained in the molecular biology of MFS and related disorders over the past 25 years. © 2016 WILEY PERIODICALS, INC.

  8. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri


    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  9. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome. (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali


    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  10. Atypical haemolytic uraemic syndrome associated with a hybrid complement gene.

    Directory of Open Access Journals (Sweden)

    Julian P Venables


    Full Text Available BACKGROUND: Sequence analysis of the regulators of complement activation (RCA cluster of genes at chromosome position 1q32 shows evidence of several large genomic duplications. These duplications have resulted in a high degree of sequence identity between the gene for factor H (CFH and the genes for the five factor H-related proteins (CFHL1-5; aliases CFHR1-5. CFH mutations have been described in association with atypical haemolytic uraemic syndrome (aHUS. The majority of the mutations are missense changes that cluster in the C-terminal region and impair the ability of factor H to regulate surface-bound C3b. Some have arisen as a result of gene conversion between CFH and CFHL1. In this study we tested the hypothesis that nonallelic homologous recombination between low-copy repeats in the RCA cluster could result in the formation of a hybrid CFH/CFHL1 gene that predisposes to the development of aHUS. METHODS AND FINDINGS: In a family with many cases of aHUS that segregate with the RCA cluster we used cDNA analysis, gene sequencing, and Southern blotting to show that affected individuals carry a heterozygous CFH/CFHL1 hybrid gene in which exons 1-21 are derived from CFH and exons 22/23 from CFHL1. This hybrid encodes a protein product identical to a functionally significant CFH mutant (c.3572C>T, S1191L and c.3590T>C, V1197A that has been previously described in association with aHUS. CONCLUSIONS: CFH mutation screening is recommended in all aHUS patients prior to renal transplantation because of the high risk of disease recurrence post-transplant in those known to have a CFH mutation. Because of our finding it will be necessary to implement additional screening strategies that will detect a hybrid CFH/CFHL1 gene.

  11. ABCD syndrome is caused by a homozygous mutation in the EDNRB gene. (United States)

    Verheij, Joke B G M; Kunze, Jürgen; Osinga, Jan; van Essen, Anthonie J; Hofstra, Robert M W


    ABCD syndrome is an autosomal recessive syndrome characterized by albinism, black lock, cell migration disorder of the neurocytes of the gut (Hirschsprung disease [HSCR]), and deafness. This phenotype clearly overlaps with the features of the Shah-Waardenburg syndrome, comprising sensorineural deafness; hypopigmentation of skin, hair, and irides; and HSCR. Therefore, we screened DNA of the index patient of the ABCD syndrome family for mutations in the endothelin B receptor (EDNRB) gene, a gene known to be involved in Shah-Waardenburg syndrome. A homozygous nonsense mutation in exon 3 (R201X) of the EDNRB gene was found. We therefore suggest that ABCD syndrome is not a separate entity, but an expression of Shah-Waardenburg syndrome.

  12. Amniotic fluid RNA gene expression profiling provides insights into the phenotype of Turner syndrome. (United States)

    Massingham, Lauren J; Johnson, Kirby L; Scholl, Thomas M; Slonim, Donna K; Wick, Heather C; Bianchi, Diana W


    Turner syndrome is a sex chromosome aneuploidy with characteristic malformations. Amniotic fluid, a complex biological material, could contribute to the understanding of Turner syndrome pathogenesis. In this pilot study, global gene expression analysis of cell-free RNA in amniotic fluid supernatant was utilized to identify specific genes/organ systems that may play a role in Turner syndrome pathophysiology. Cell-free RNA from amniotic fluid of five mid-trimester Turner syndrome fetuses and five euploid female fetuses matched for gestational age was extracted, amplified, and hybridized onto Affymetrix(®) U133 Plus 2.0 arrays. Significantly differentially regulated genes were identified using paired t tests. Biological interpretation was performed using Ingenuity Pathway Analysis and BioGPS gene expression atlas. There were 470 statistically significantly differentially expressed genes identified. They were widely distributed across the genome. XIST was significantly down-regulated (p Turner syndrome transcriptome from other aneuploidies we previously studied. Manual curation of the differentially expressed gene list identified genes of possible pathologic significance, including NFATC3, IGFBP5, and LDLR. Transcriptomic differences in the amniotic fluid of Turner syndrome fetuses are due to genome-wide dysregulation. The hematologic/immune system differences may play a role in early-onset autoimmune dysfunction. Other genes identified with possible pathologic significance are associated with cardiac and skeletal systems, which are known to be affected in females with Turner syndrome. The discovery-driven approach described here may be useful in elucidating novel mechanisms of disease in Turner syndrome.

  13. Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients. (United States)

    Jansen, Anne M L; Geilenkirchen, Marije A; van Wezel, Tom; Jagmohan-Changur, Shantie C; Ruano, Dina; van der Klift, Heleen M; van den Akker, Brendy E W M; Laros, Jeroen F J; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G W; Gómez-García, Encarna B; Tops, Carli M J; Vasen, Hans F; Devilee, Peter; Hes, Frederik J; Morreau, Hans; Wijnen, Juul T


    Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes.

  14. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome (United States)

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun


    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  15. Peeling skin syndrome associated with novel variant in FLG2 gene. (United States)

    Alfares, Ahmed; Al-Khenaizan, Sultan; Al Mutairi, Fuad


    Peeling skin syndrome is a rare genodermatosis characterized by variably pruritic superficial generalized peeling of the skin with several genes involved until now little is known about the association between FLG2 and peeling skin syndrome. We describe multiple family members from a consanguineous Saudi family with peeling skin syndrome. Next Generation Sequencing identifies a cosegregating novel variant in FLG2 c.632C>G (p.Ser211*) as a likely etiology in this family. Here, we reported on the clinical manifestation of homozygous loss of function variant in FLG2 as a disease-causing gene for peeling skin syndrome and expand the dermatology findings. © 2017 Wiley Periodicals, Inc.

  16. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  17. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.


    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  18. Syndromes and Disorders Associated with Omphalocele (III: Single Gene Disorders, Neural Tube Defects, Diaphragmatic Defects and Others

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen


    Full Text Available Omphalocele can be associated with single gene disorders, neural tube defects, diaphragmatic defects, fetal valproate syndrome, and syndromes of unknown etiology. This article provides a comprehensive review of omphalocele-related disorders: otopalatodigital syndrome type II; Melnick–Needles syndrome; Rieger syndrome; neural tube defects; Meckel syndrome; Shprintzen–Goldberg omphalocele syndrome; lethal omphalocele-cleft palate syndrome; cerebro-costo-mandibular syndrome; fetal valproate syndrome; Marshall–Smith syndrome; fibrochondrogenesis; hydrolethalus syndrome; Fryns syndrome; omphalocele, diaphragmatic defects, radial anomalies and various internal malformations; diaphragmatic defects, limb deficiencies and ossification defects of skull; Donnai–Barrow syndrome; CHARGE syndrome; Goltz syndrome; Carpenter syndrome; Toriello–Carey syndrome; familial omphalocele; Cornelia de Lange syndrome; C syndrome; Elejalde syndrome; Malpuech syndrome; cervical ribs, Sprengel anomaly, anal atresia and urethral obstruction; hydrocephalus with associated malformations; Kennerknecht syndrome; lymphedema, atrial septal defect and facial changes; and craniosynostosis- mental retardation syndrome of Lin and Gettig. Perinatal identification of omphalocele should alert one to the possibility of omphalocele-related disorders and familial inheritance and prompt a thorough genetic counseling for these disorders.

  19. New recurrent deletions in the PPARgamma and TP53 genes are associated with childhood myelodysplastic syndrome

    DEFF Research Database (Denmark)

    Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T


    Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were...

  20. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy]. (United States)

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y


    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  1. Investigation of Monnose-Binding Lectin gene Polymorphism in Patients with Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome

    Directory of Open Access Journals (Sweden)

    Sevil Toka


    Full Text Available Objective: Monnose-Binding lectin (MBL appears to play an important role in the immune system. The genetic polymorphisms in the MBL2 gene can result in a reduction of serum levels, leading to a predisposition to recurrent infection. The aim of this study is to investigate the influence of a polymorphism in codon 54 of the MBL2 gene on the susceptibility to Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome (EM, SJS and SJS/TEN overlap syndrome. Material and Methods: Our study included 64 patients who were clinically and/or histopathologically diagnosed with EM, SJS, and SJS/TEN overlap syndrome and 66 healthy control subjects who were genotyped for the MBL2 gene codon 54 polymorphism using the PCR-RFLP method. For all statistical analyses, the level of significance was set at p<0.05. Results: The prevalence of the B allele was 18% in the EM, SJS and SJS/TEN patient groups and 13% in the control group. No significant differences in allele frequencies of any polymorphism were observed between the patient and control groups, although the B allele was more frequent in the patient groups (p=0.328.Conclusion: Our results provide no evidence of a relationship between MBL2 gene codon 54 polymorphism and the susceptibility to EM, SJS and SJS/TEN overlap syndrome. However, these findings should be confirmed in studies with a larger sample size.

  2. Genetic basis of prune belly syndrome: screening for HNF1β gene. (United States)

    Granberg, Candace F; Harrison, Steven M; Dajusta, Daniel; Zhang, Shaohua; Hajarnis, Sachin; Igarashi, Peter; Baker, Linda A


    Although the cause of prune belly syndrome is unknown, familial evidence suggests a genetic component. Recently 2 nonfamilial cases of prune belly syndrome with chromosome 17q12 deletions encompassing the HNF1β gene have made this a candidate gene for prune belly syndrome. To date, there has been no large-scale screening of patients with prune belly syndrome for HNF1β mutations. We assessed the role of HNF1β in prune belly syndrome by screening for genomic mutations with functional characterization of any detected mutations. We studied patients with prune belly syndrome who were prospectively enrolled in our Pediatric Genitourinary DNA Repository since 2001. DNA from patient samples was amplified by polymerase chain reaction, sequenced for coding and splice regions of the HNF1β gene, and compared to control databases. We performed functional assay testing of the ability of mutant HNF1β to activate a luciferase construct with an HNF1β DNA binding site. From 32 prune belly syndrome probands (30 males, 2 females) HNF1β sequencing detected a missense mutation (V61G) in 1 child with prune belly syndrome. Absent in control databases, V61G was previously reported in 2 patients without prune belly syndrome who had congenital genitourinary anomalies. Functional testing showed similar luciferase activity compared to wild-type HNF1β, suggesting the V61G substitution does not disturb HNF1β function. One genomic HNF1β mutation was detected in 3% of patients with prune belly syndrome but found to be functionally normal. Thus, functionally significant HNF1β mutations are uncommon in prune belly syndrome, despite case reports of HNF1β deletions. Further genetic study is necessary, as identification of the genetic basis of prune belly syndrome may ultimately lead to prevention and improved treatments for this rare but severe syndrome. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  3. Sarcomeric gene mutations in sudden infant death syndrome (SIDS). (United States)

    Brion, Maria; Allegue, Catarina; Santori, Montserrat; Gil, Rocio; Blanco-Verea, Alejandro; Haas, Cordula; Bartsch, Christine; Poster, Simone; Madea, Burkhard; Campuzano, Oscar; Brugada, Ramon; Carracedo, Angel


    In developed countries, sudden infant death syndrome (SIDS) represents the most prevalent cause of death in children between 1 month and 1 year of age. SIDS is a diagnosis of exclusion, a negative autopsy which requires the absence of structural organ disease. Although investigators have confirmed that a significant percentage of SIDS cases are actually channelopathies, no data have been made available as to whether other sudden cardiac death-associated diseases, such as hypertrophic cardiomyopathy (HCM), could be responsible for some cases of SIDS. The presence of a genetic mutation in the sarcomeric protein usually affects the force of contraction of the myocyte, whose weakness is compensated with progressive hypertrophy and disarray. However, it is unclear whether in the most incipient forms, that is, first years of life, the lack of these phenotypes still confers a risk of arrhythmogenesis. The main goal of the present study is to wonder whether genetic defects in the sarcomeric proteins, previously associated with HCM, could be responsible for SIDS. We have analysed 286 SIDS cases for the most common genes implicated in HCM in adults. A total of 680 mutations localised in 16 genes were analysed by semi-automated matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDITOF-MS) using the Sequenom MassARRAY(®) System. Ten subjects with completely normal hearts showed mutated alleles at nine of the genetic variants analysed, and one additional novel mutation was detected by conventional sequencing. Therefore, a genetic mutation associated with HCM may cause sudden cardiac death in the absence of an identifiable phenotype. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  4. Takotsubo syndrome and estrogen receptor genes: partners in crime? (United States)

    Pizzino, Gabriele; Bitto, Alessandra; Crea, Pasquale; Khandheria, Bijoy; Vriz, Olga; Carerj, Scipione; Squadrito, Francesco; Minisini, Rosalba; Citro, Rodolfo; Cusmà-Piccione, Maurizio; Madaffari, Antonio; Andò, Giuseppe; Altavilla, Domenica; Zito, Concetta


    We aimed to analyze genetic polymorphism of estrogen receptor (ESR) 1 and ESR2 in a series of postmenopausal women with Takotsubo syndrome (TS). In total, 81 consecutive white women were prospectively enrolled: 22 with TS (TS group; mean age 71.2 ± 9.8 years), 22 with acute myocardial infarction (MI group; mean age 73.2 ± 8 years), and 37 asymptomatic healthy controls (CTRL group; mean age 69 ± 4.2 years). Genotyping of ESR1 -397C>T (rs2234693) and -351A>G (rs9340799) and ESR2 -1839G>T (rs 1271572) and 1082G>A (rs1256049) genetic variants was performed. We estimated the odds ratio (OR) between the genotype of each examined locus with the occurrence of TS or MI. The risk of experiencing TS was higher for those study participants carrying the T allele at the rs2234693 locus of the ESR1 gene [OR: 2.0, 95% confidence interval (CI): 0.973-4.11, P = 0.04, TS vs. MI + CTRL; OR: 2.79, 95% CI: 1.17-6.64, P = 0.016, TS vs. MI alone]. Women carrying a T allele at the rs1271572 locus of the ESR2 gene demonstrated an even higher risk (OR: 3.23, 95% CI: 1.55-6.73, P = 0.0019, TS vs. MI + CTRL; OR: 9.13, 95% CI: 2.78-29.9, P = 0.0001, TS vs. MI alone). The study reports preliminary findings suggesting a possible link between ESR polymorphisms and the occurrence of TS. Larger studies are needed to confirm our results.

  5. (GPR98) gene in an Iranian family with Usher syndrome type II

    Indian Academy of Sciences (India)


    Dec 4, 2014 ... Genetics Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran 1985713834, Iran. [Kahrizi K. ... Usher syndrome (USH) is an autosomal recessive disease .... missense variants on the protein structures, pathogen severity .... genes to a Spanish Usher syndrome type 2 cohort.

  6. Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly

    NARCIS (Netherlands)

    Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm


    Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS

  7. Epilepsy in Rett syndrome, and CDKL5- and FOXG1-gene-related encephalopathies. (United States)

    Guerrini, Renzo; Parrini, Elena


    Rett syndrome is an X-linked neurodevelopmental disorder that manifests in early childhood with developmental stagnation, and loss of spoken language and hand use, with the development of distinctive hand stereotypies, severe cognitive impairment, and autistic features. About 60% of patients have epilepsy. Seizure onset before the age of 3 years is unlikely, and onset after age 20 is rare. Diagnosis of Rett syndrome is based on key clinical elements that identify "typical" Rett syndrome but also "variant" or "atypical" forms. Diagnostic criteria have been modified only slightly over time, even after discovering that MECP2 gene alterations are present in >90% of patients with typical Rett syndrome but only in 50-70% of atypical cases. Over the last several years, intragenic or genomic alterations of the CDKL5 and FOXG1 genes have been associated with severe cognitive impairment, early onset epilepsy and, often, dyskinetic movement disorders, which have variably been defined as Rett variants. It is now clearly emerging that epilepsy has distinctive characteristics in typical Rett syndrome and in the different syndromes caused by CDKL5 and FOXG1 gene alterations. The progressive parting of CDKL5- and FOXG1-gene-related encephalopathies from the core Rett syndrome is reflected by the effort to produce clearer diagnostic criteria for typical and atypical Rett syndrome. Efforts to characterize the molecular pathology underlying these developmental encephalopathies are pointing to abnormalities of telencephalic development, neuronal morphogenesis, maturation and maintenance, and dendritic arborization. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.

  8. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den


    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  9. Noonan syndrome-causing genes: Molecular update and an assessment of the mutation rate

    Directory of Open Access Journals (Sweden)

    Ihssane El Bouchikhi


    Full Text Available Noonan syndrome is a common autosomal dominant disorder characterized by short stature, congenital heart disease and facial dysmorphia with an incidence of 1/1000 to 2500 live births. Up to now, several genes have been proven to be involved in the disturbance of the transduction signal through the RAS-MAP Kinase pathway and the manifestation of Noonan syndrome. The first gene described was PTPN11, followed by SOS1, RAF1, KRAS, BRAF, NRAS, MAP2K1, and RIT1, and recently SOS2, LZTR1, and A2ML1, among others. Progressively, the physiopathology and molecular etiology of most signs of Noonan syndrome have been demonstrated, and inheritance patterns as well as genetic counseling have been established. In this review, we summarize the data concerning clinical features frequently observed in Noonan syndrome, and then, we describe the molecular etiology as well as the physiopathology of most Noonan syndrome-causing genes. In the second part of this review, we assess the mutational rate of Noonan syndrome-causing genes reported up to now in most screening studies. This review should give clinicians as well as geneticists a full view of the molecular aspects of Noonan syndrome and the authentic prevalence of the mutational events of its causing-genes. It will also facilitate laying the groundwork for future molecular diagnosis research, and the development of novel treatment strategies.

  10. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas


    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  11. Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy


    Williams, David S.


    Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects...

  12. Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations. (United States)

    Trolle, Christian; Mortensen, Kristian H; Pedersen, Lisbeth N; Berglund, Agnethe; Jensen, Henrik K; Andersen, Niels H; Gravholt, Claus H


    QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc) over time and relate the findings to the Turner syndrome phenotype. Adult women with Turner syndrome (n = 88) were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%), and adjusted for influence of heart rate by Bazett's (bQTc) and Hodges's formula (hQTc). The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms) compared to controls (390.4 ± 17.8 ms) was prolonged (pTurner syndrome karyotypes (418.2 ± 24.8 vs. 407.6 ± 25.5 ms; p = 0.055). In women with Turner syndrome and a bQTc >432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2) and one in a minor Long QT syndrome gene (KCNE2). There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women. NCT00624949.

  13. The role of the leukemia-associated ETO homologue repressors in hematopoiesis


    Olsson, André


    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  14. Neonatal Marfan syndrome caused by an exon 25 mutation of the fibrillin-1 gene. (United States)

    Elçioglu, N H; Akalin, F; Elçioglu, M; Comeglio, P; Child, A H


    Neonatal Marfan syndrome caused by an exon 25 mutation of the Fibrillin-1 gene: We describe a male infant with severe arachnodactyly, hypermobility of the fingers, flexion contractures of elbows, wrists, hips, and knees, microretrognathia, crumpled ears, rockerbottom feet, loose redundant skin, and lens dislocations. Cardiac valve insufficiency and aortic dilatation resulted in cardiac failure, decompensated with digitalisation and death occurred at the age of 4 months. This case represents the severe end of the clinical spectrum of Marfan syndrome, namely neonatal Marfan syndrome. Molecular diagnostic analyses confirmed a de novo exon 25 mutation in the FBN1 gene.

  15. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome). (United States)

    Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji


    Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

  16. A novel small deletion in the NHS gene associated with Nance-Horan syndrome. (United States)

    Li, Huajin; Yang, Lizhu; Sun, Zixi; Yuan, Zhisheng; Wu, Shijing; Sui, Ruifang


    Nance-Horan syndrome is a rare X-linked recessive inherited disease with clinical features including severe bilateral congenital cataracts, characteristic facial and dental abnormalities. Data from Chinese Nance-Horan syndrome patients are limited. We assessed the clinical manifestations of a Chinese Nance-Horan syndrome pedigree and identified the genetic defect. Genetic analysis showed that 3 affected males carried a novel small deletion in NHS gene, c.263_266delCGTC (p.Ala89TrpfsTer106), and 2 female carriers were heterozygous for the same variant. All 3 affected males presented with typical Nance-Horan syndrome features. One female carrier displayed lens opacities centered on the posterior Y-suture in both eyes, as well as mild dental abnormalities. We recorded the clinical features of a Chinese Nance-Horan syndrome family and broadened the spectrum of mutations in the NHS gene.

  17. Severe visual impairment and retinal changes in a boy with a deletion of the gene for Nance-Horan syndrome. (United States)

    Mathys, R; Deconinck, H; Keymolen, K; Jansen, A; Van Esch, H


    We present the ophthalmologic findings in a boy with a deletion of Xp22 comprising the gene for Nance-Horan syndrome. Different mechanisms underlying the visual impairment in Nance-Horan syndrome are discussed.

  18. Síndrome de Diógenes Diogenes syndrome

    Directory of Open Access Journals (Sweden)

    Bárbara Perdigão Stumpf


    Full Text Available A síndrome de Diógenes (SD caracteriza-se por descuido extremo com a higiene pessoal, negligência com o asseio da própria moradia, isolamento social, suspeição e comportamento paranoico, sendo frequente a ocorrência de colecionismo. A incidência anual é de 5/10.000 entre aqueles acima de 60 anos, e pelo menos a metade é portadora de demência ou algum outro transtorno psiquiátrico. As principais hipóteses etiológicas são: (1 a condição representaria o "estágio final" de um transtorno de personalidade; (2 a síndrome seria uma manifestação de demência do lobo frontal; (3 a SD seria o estágio final do subtipo hoarding do TOC; (4 a SD seria uma via final comum a diferentes transtornos psiquiátricos, especialmente aqueles associados ao colecionismo; (5 a síndrome seria precipitada por estressores biológicos, psicológicos e sociais, associados com a idade, em indivíduos com traços de personalidade predisponentes. É conhecido que existem apenas relatos de casos envolvendo tratamentos específicos para a SD, particularmente a risperidona. Por se tratar de condição grave, com elevada mortalidade por problemas clínicos, estudos se fazem necessários para determinar as melhores estratégias de abordagem desses pacientes. Os autores descrevem o caso de uma paciente com SD e fazem uma breve revisão da literatura.Diogenes syndrome (DSis characterized by extreme self-neglect, domestic squalor, social withdrawal, suspiciousness and paranoid behaviour and is often accompanied by excessive hoarding. The annual incidence is five per ten thousand of the population aged over 60, at least half of whom will have dementia or some other form of mental illness. The main etiological hypotheses are: (1 the condition represents the "end-stage" of a personality disorder; (2 the syndrome is a manifestation of a frontal-lobe dementia; (3 DS may be an end stage of the hoarding subtype of OCD; (4 DS may be a final common pathway of different

  19. Distinct gene expression profiles in ovarian cancer linked to Lynch syndrome

    DEFF Research Database (Denmark)

    Jönsson, Jenny-Maria; Bartuma, Katarina; Dominguez-Valentin, Mev


    Ovarian cancer linked to Lynch syndrome represents a rare subset that typically presents at young age as early-stage tumors with an overrepresentation of endometrioid and clear cell histologies. We investigated the molecular profiles of Lynch syndrome-associated and sporadic ovarian cancer...... with the aim to identify key discriminators and central tumorigenic mechanisms in hereditary ovarian cancer. Global gene expression profiling using whole-genome c-DNA-mediated Annealing, Selection, extension, and Ligation was applied to 48 histopathologically matched Lynch syndrome-associated and sporadic...... ovarian cancers. Lynch syndrome-associated and sporadic ovarian cancers differed by 349 significantly deregulated genes, including PTPRH, BIRC3, SHH and TNFRSF6B. The genes involved were predominantly linked to cell growth, proliferation, and cell-to-cell signaling and interaction. When stratified...

  20. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.


    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  1. A novel homozygous variant in the SMOC1 gene underlying Waardenburg anophthalmia syndrome. (United States)

    Ullah, Asmat; Umair, Muhammad; Ahmad, Farooq; Muhammad, Dost; Basit, Sulman; Ahmad, Wasim


    Waardenburg anophthalmia syndrome (WAS), also known as ophthalmo-acromelic syndrome or anophthalmia-syndactyly, is a rare congenital disorder that segregates in an autosomal recessive pattern. Clinical features of the syndrome include malformation of the eyes and the skeleton. Mostly, WAS is caused by mutations in the SMOC-1 gene. The present report describes a large consanguineous family of Pakistani origin segregating Waardenburg anophthalmia syndrome in an autosomal recessive pattern. Genotyping followed by Sanger sequencing was performed to search for a candidate gene. SNP genotyping using AffymetrixGeneChip Human Mapping 250K Nsp array established a single homozygous region among affected members on chromosome 14q23.1-q24.3 harboring the SMOC1 gene. Sequencing of the gene revealed a novel homozygous missense mutation (c.812G>A; p.Cys271Tyr) in the family. This is the first report of Waardenburg anophthalmia syndrome caused by a SMOC1 variant in a Pakistani population. The mutation identified in the present investigation extends the body of evidence implicating the gene SMOC-1 in causing WAS.

  2. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene. (United States)

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco


    Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

  3. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    Directory of Open Access Journals (Sweden)

    Colovati Mileny ES


    Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

  4. Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

    Directory of Open Access Journals (Sweden)

    Christian Trolle

    Full Text Available QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc over time and relate the findings to the Turner syndrome phenotype.Adult women with Turner syndrome (n = 88 were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%, and adjusted for influence of heart rate by Bazett's (bQTc and Hodges's formula (hQTc. The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms. Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done.The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms compared to controls (390.4 ± 17.8 ms was prolonged (p432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2 and one in a minor Long QT syndrome gene (KCNE2.There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women.NCT00624949.

  5. Intracranial arteries in individuals with the elastin gene hemideletion of Williams syndrome. (United States)

    Wint, D P; Butman, J A; Masdeu, J C; Meyer-Lindenberg, A; Mervis, C B; Sarpal, D; Morris, C A; Berman, K F


    Williams syndrome, a rare genetic disorder with a striking neurobehavioral profile characterized by extreme sociability and impaired visuospatial construction abilities, is caused by a hemideletion that includes the elastin gene, resulting in frequent supravavular aortic stenosis and other stenotic arterial lesions. Strokes have been reported in Williams syndrome. Although the extracranial carotid artery has been studied in a sample of patients with Williams syndrome, proximal intracranial arteries have not. Using MRA, we studied the intracranial vessels in 27 participants: 14 patients with Williams syndrome (age range, 18-44 years; mean age, 27.3 ± 9.1; 43% women) and 13 healthy control participants with similar age and sex distribution (age range, 22-52 years; mean age, 33.4 ± 7.6; 46% women). All participants with Williams syndrome had hemideletions of the elastin gene. Blinded to group allocation or to any other clinical data, a neuroradiologist determined the presence of intracranial vascular changes in the 2 groups. The Williams syndrome group and the healthy control group had similar patency of the proximal intracranial arteries, including the internal carotid and vertebral arteries; basilar artery; and stem and proximal branches of the anterior cerebral artery, MCA, and posterior cerebral arteries. The postcommunicating segment of the anterior cerebral artery was longer in the Williams syndrome group. Despite the elastin haploinsufficiency, the proximal intracranial arteries in Williams syndrome preserve normal patency.

  6. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast


    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.


    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...


    Directory of Open Access Journals (Sweden)

    G. E. Roitberg


    Full Text Available Objective: to analyze the distribution of components of insulin resistance (IR syndrome and to study the frequency of their combinations in relation to the genotypes and allelic variants of the angiotensin-converting enzyme (ACE gene.Subjects and methods. A group of clinically healthy patients (50 women and 42 men with different genotypes of the ACE gene was examined.The distribution of IR syndrome components and the frequency of their combinations were analyzed in relation to the genotypes and allelicvariants of the ACE gene.Results. A group of D allele carriers compared to A allele ones showed a pronounced tendency for the frequency of IR to reduce due to thehigher proportion of patients with complete IR syndrome. This observation becomes statistically significant in the assessment of homozygous variants of the ACE gene. At the same time dyslipidemia and hypertension in the presence of IR significantly more frequently occurred in patients with the DD genotype than in those with genotype II.Conclusion. There was a marked predominance of the manifestations of IR syndrome with a complete set of components in the DD genotypicgroup, which confirms the significant strong association between ACE gene polymorphism and IR syndrome.

  8. Do the MTHFR gene polymorphism and Down syndrome pregnancy ...

    African Journals Online (AJOL)

    Srinivasan Muthuswamy


    Sep 28, 2015 ... syndrome pregnancy association stands true? A case–control study of Indian population and meta-analysis. Srinivasan Muthuswamy ... Various clinical as well as experimental evidences have linked DNA hypomethylation to ...

  9. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype. (United States)

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora


    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  10. Screening of the USH1G gene among Spanish patients with Usher syndrome. Lack of mutations and evidence of a minor role in the pathogenesis of the syndrome. (United States)

    Aller, Elena; Jaijo, Teresa; Beneyto, Magdalena; Nájera, Carmen; Morera, Constantino; Pérez-Garrigues, Herminio; Ayuso, Carmen; Millán, Jose


    The Usher syndrome (USH) is an autosomal recessive hereditary disorder characterized by the association of sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. The USH1G gene, encoding SANS, has been found to cause both Usher syndrome type I and atypical Usher syndrome. 109 Spanish unrelated patients suffering from Usher syndrome type I, type II, type III and unclassified Usher syndrome were screened for mutations in this gene, but only eight different changes without a clear pathogenic effect have been detected. Based on these results as well as previous studies in other populations where mutational analysis of this gene has been carried out, one can conclude that USH1G has a minor involvement in Usher syndrome pathogenesis.

  11. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV. (United States)

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng


    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. [MVK gene abnormality and new approach to treatment of hyper IgD syndrome and periodic fever syndrome]. (United States)

    Naruto, Takuya


    Hyper IgD and periodic fever syndrome (HIDS; OMIM 260920) is one of the hereditary autoinflammatory syndromes characterized by recurrent episodes of fever and inflammation.. HIDS is an autosomal recessive disorder characterized by recurrent fever attacks in early childhood. HIDS caused by mevalonate kinase (MK) mutations, also that is the gene of mevalonic aciduria (OMIM 251170). During febrile episodes, urinary mevalonate concentrations were found to be significantly elevated in patients. Diagnosis of HIDS was retrieving gene or measurement of the enzyme activity in peripheral blood lymphocyte in general. This of HIDS is an activity decline of MK, and a complete deficiency of MK becomes a mevalonic aciduria with a nervous symptom. The relation between the fever and inflammation of mevalonate or isoprenoid products are uncertain. The therapy attempt with statins, which is inhibited the next enzyme after HMG-CoA reductase, or inhibit the proinflammatory cytokines.

  13. A novel small deletion in the NHS gene associated with Nance-Horan syndrome


    Li, Huajin; Yang, Lizhu; Sun, Zixi; Yuan, Zhisheng; Wu, Shijing; Sui, Ruifang


    Nance-Horan syndrome is a rare X-linked recessive inherited disease with clinical features including severe bilateral congenital cataracts, characteristic facial and dental abnormalities. Data from Chinese Nance-Horan syndrome patients are limited. We assessed the clinical manifestations of a Chinese Nance-Horan syndrome pedigree and identified the genetic defect. Genetic analysis showed that 3 affected males carried a novel small deletion in NHS gene, c.263_266delCGTC (p.Ala89TrpfsTer106), a...

  14. Mitchell-Riley Syndrome: A Novel Mutation in RFX6 Gene

    Directory of Open Access Journals (Sweden)

    Marta Zegre Amorim


    Full Text Available A novel RFX6 homozygous missense mutation was identified in an infant with Mitchell-Riley syndrome. The most common features of Mitchell-Riley syndrome were present, including severe neonatal diabetes associated with annular pancreas, intestinal malrotation, gallbladder agenesis, cholestatic disease, chronic diarrhea, and severe intrauterine growth restriction. Perijejunal tissue similar to pancreatic tissue was found in the submucosa, a finding that has not been previously reported in this syndrome. This case associating RFX6 mutation with structural and functional pancreatic abnormalities reinforces the RFX6 gene role in pancreas development and β-cell function, adding information to the existent mutation databases.

  15. Novel Myopia Genes and Pathways Identified From Syndromic Forms of Myopia (United States)

    Loughman, James; Wildsoet, Christine F.; Williams, Cathy; Guggenheim, Jeremy A.


    Purpose To test the hypothesis that genes known to cause clinical syndromes featuring myopia also harbor polymorphisms contributing to nonsyndromic refractive errors. Methods Clinical phenotypes and syndromes that have refractive errors as a recognized feature were identified using the Online Mendelian Inheritance in Man (OMIM) database. One hundred fifty-four unique causative genes were identified, of which 119 were specifically linked with myopia and 114 represented syndromic myopia (i.e., myopia and at least one other clinical feature). Myopia was the only refractive error listed for 98 genes and hyperopia and the only refractive error noted for 28 genes, with the remaining 28 genes linked to phenotypes with multiple forms of refractive error. Pathway analysis was carried out to find biological processes overrepresented within these sets of genes. Genetic variants located within 50 kb of the 119 myopia-related genes were evaluated for involvement in refractive error by analysis of summary statistics from genome-wide association studies (GWAS) conducted by the CREAM Consortium and 23andMe, using both single-marker and gene-based tests. Results Pathway analysis identified several biological processes already implicated in refractive error development through prior GWAS analyses and animal studies, including extracellular matrix remodeling, focal adhesion, and axon guidance, supporting the research hypothesis. Novel pathways also implicated in myopia development included mannosylation, glycosylation, lens development, gliogenesis, and Schwann cell differentiation. Hyperopia was found to be linked to a different pattern of biological processes, mostly related to organogenesis. Comparison with GWAS findings further confirmed that syndromic myopia genes were enriched for genetic variants that influence refractive errors in the general population. Gene-based analyses implicated 21 novel candidate myopia genes (ADAMTS18, ADAMTS2, ADAMTSL4, AGK, ALDH18A1, ASXL1, COL4A1

  16. A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome. (United States)

    Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah


    Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.

  17. Study on the correlation between KCNJ11 gene polymorphism and metabolic syndrome in the elderly. (United States)

    Jiang, Fan; Liu, Ning; Chen, Xiao Zhuang; Han, Kun Yuan; Zhu, Cai Zhong


    The aim of the study was to examine the correlation between KCNJ11 gene polymorphism and metabolic syndrome in elderly patients. From January 2014 to January 2015, 54 elderly patients with metabolic syndrome were enrolled in this study as the observation group. During the same period, 46 healthy elderly individuals were enrolled in this study as the control group. KCNJ11 gene polymorphism (rs28502) was analyzed using polymerase chain reaction-restriction fragment length polymorphism. The expression levels of mRNA in different genotypes were detected using FQ-PCR. ELISA was used to evaluate the KCNJ11 protein expression in different genotypes. KCNJ11 gene polymorphism and metabolic syndrome was studied by measuring the blood pressure levels in patients with different genotypes. Three genotypes of KCNJ11 gene in rs28502 were CC, CT and TT. The CC, CT and TT genotype frequencies in healthy population were 8.5, 9.2 and 82.2%, respectively, while the genotype frequencies in patients with metabolic syndrome were 42.4, 49.8 and 7.8%, respectively. There were significant differences between groups (P≤0.05). However, the genotype frequencies of C/T in healthy individuals and metabolic syndrome patients were 35.3 and 38.3%, respectively. There were no significant differences between groups (P>0.05). FQ-PCR results showed that the KCNJ11 mRNA expression levels in the control and observation groups had no significant differences (P>0.05). However, the results obtained from ELISA analysis revealed that KCNJ11 protein expression level in the observation group was significantly higher than that in the control group (Pmetabolic syndrome in the elderly. Elderly patients with the CC and TT genotypes are more likely to develop metabolic syndrome.

  18. Mutation screening of USH3 gene (clarin-1) in Spanish patients with Usher syndrome: low prevalence and phenotypic variability. (United States)

    Aller, E; Jaijo, T; Oltra, S; Alió, J; Galán, F; Nájera, C; Beneyto, M; Millán, J M


    Usher syndrome type III is an autosomal recessive disorder clinically characterized by the association of retinitis pigmentosa (RP), variable presence of vestibular dysfunction and progressive hearing loss, being the progression of the hearing impairment the critical parameter classically used to distinguish this form from Usher syndrome type I and Usher syndrome type II. Usher syndrome type III clinical subtype is the rarest form of Usher syndrome in Spain, accounting only for 6% of all Usher syndrome Spanish cases. The gene responsible for Usher syndrome type III is named clarin-1 and it is thought to be involved in hair cell and photoreceptor cell synapses. Here, we report a screening for mutations in clarin-1 gene among our series of Usher syndrome Spanish patients. Clarin-1 has been found to be responsible for the disease in only two families: the first one is a previously reported family homozygous for Y63X mutation and the second one, described here, is homozygous for C40G. This accounts for 1.7% of Usher syndrome Spanish families. It is noticeable that, whereas C40G family is clinically compatible with Usher syndrome type III due to the progression of the hearing loss, Y63X family could be diagnosed as Usher syndrome type I because the hearing impairment is profound and stable. Thus, we consider that the progression of hearing loss is not the definitive key parameter to distinguish Usher syndrome type III from Usher syndrome type I and Usher syndrome type II.

  19. Candidate genes and pathogenesis investigation for sepsis-related acute respiratory distress syndrome based on gene expression profile. (United States)

    Wang, Min; Yan, Jingjun; He, Xingxing; Zhong, Qiang; Zhan, Chengye; Li, Shusheng


    Acute respiratory distress syndrome (ARDS) is a potentially devastating form of acute inflammatory lung injury as well as a major cause of acute respiratory failure. Although researchers have made significant progresses in elucidating the pathophysiology of this complex syndrome over the years, the absence of a universal detail disease mechanism up until now has led to a series of practical problems for a definitive treatment. This study aimed to predict some genes or pathways associated with sepsis-related ARDS based on a public microarray dataset and to further explore the molecular mechanism of ARDS. A total of 122 up-regulated DEGs and 91 down-regulated differentially expressed genes (DEGs) were obtained. The up- and down-regulated DEGs were mainly involved in functions like mitotic cell cycle and pathway like cell cycle. Protein-protein interaction network of ARDS analysis revealed 20 hub genes including cyclin B1 (CCNB1), cyclin B2 (CCNB2) and topoisomerase II alpha (TOP2A). A total of seven transcription factors including forkhead box protein M1 (FOXM1) and 30 target genes were revealed in the transcription factor-target gene regulation network. Furthermore, co-cited genes including CCNB2-CCNB1 were revealed in literature mining for the relations ARDS related genes. Pathways like mitotic cell cycle were closed related with the development of ARDS. Genes including CCNB1, CCNB2 and TOP2A, as well as transcription factors like FOXM1 might be used as the novel gene therapy targets for sepsis related ARDS.

  20. P63 gene mutations and human developmental syndromes.

    NARCIS (Netherlands)

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van


    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  1. Prospects for Gene Therapy in the Fragile X Syndrome (United States)

    Rattazzi, Mario C.; LaFauci, Giuseppe; Brown, W. Ted


    Gene therapy is unarguably the definitive way to treat, and possibly cure, genetic diseases. A straightforward concept in theory, in practice it has proven difficult to realize, even when directed to easily accessed somatic cell systems. Gene therapy for diseases in which the central nervous system (CNS) is the target organ presents even greater…

  2. Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

    African Journals Online (AJOL)

    Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...

  3. Novel mutations in the USH1C gene in Usher syndrome patients. (United States)

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María


    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  4. Ghrelin Gene Variants Influence on Metabolic Syndrome Components in Aged Spanish Population


    Mora, Mireia; Adam, Victoria; Palomera, Elisabet; Blesa, Sebastian; Díaz, Gonzalo; Buquet, Xavier; Serra-Prat, Mateu; Martín-Escudero, Juan Carlos; Palanca, Ana; Chaves, Javier Felipe; Puig-Domingo, Manuel


    BACKGROUND: The role of genetic variations within the ghrelin gene on cardiometabolic profile and nutritional status is still not clear in humans, particularly in elderly people. OBJECTIVES: We investigated six SNPs of the ghrelin gene and their relationship with metabolic syndrome (MS) components. SUBJECTS AND METHODS: 824 subjects (413 men/411 women, age 77.31±5.04) participating in the Mataró aging study (n = 310) and the Hortega study (n = 514) were analyzed. Anthropometric variables, ghr...

  5. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa


    García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J.; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M.


    Purpose The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. Methods The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was...

  6. Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study


    Le Quesne Stabej, Polona; Saihan, Zubin; Rangesh, Nell; Steele-Stallard, Heather B; Ambrose, John; Coffey, Alison; Emmerson, Jenny; Haralambous, Elene; Hughes, Yasmin; Steel, Karen P; Luxon, Linda M; Webster, Andrew R; Bitner-Glindzicz, Maria


    Background Usher syndrome (USH) is an autosomal recessive disorder comprising retinitis pigmentosa, hearing loss and, in some cases, vestibular dysfunction. It is clinically and genetically heterogeneous with three distinctive clinical types (I?III) and nine Usher genes identified. This study is a comprehensive clinical and genetic analysis of 172 Usher patients and evaluates the contribution of digenic inheritance. Methods The genes MYO7A, USH1C, CDH23, PCDH15, USH1G, USH2A, GPR98, WHRN, CLR...

  7. Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome. (United States)

    Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna


    Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many

  8. Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I (United States)

    Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.


    Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

  9. A Novel Fibrillin-1 Gene Mutation Leading to Marfan Syndrome in a Korean Girl. (United States)

    Nam, Hyo-Kyoung; Nam, Myung-Hyun; Ha, Kee-Soo; Rhie, Young-Jun; Lee, Kee-Hyoung


    Marfan syndrome is an autosomal dominant genetic disorder caused by a connective tissue defect. A nine-year-old girl was referred to our pediatric endocrinology clinic for tall stature. Physical examination revealed a lens dislocation with strabismus, high palate, positive wrist and thumb signs, joint hypermobility, and pes planus. Transthoracic echocardiography revealed dilatation of the aortic root. She was diagnosed with Marfan syndrome based on the revised Ghent diagnostic criteria. Molecular investigation identified a heterozygous c.2810G >A variation in the FBN1 gene in the patient, but not in her parents. To our knowledge, this sequence variant has been reported as a polymorphism (rs113602180), but it is the first report identifying it as the genetic cause of Marfan syndrome. We hypothesize that this de novo novel missense FBN1 mutation disrupts fibrillin-1 function and is probably involved in the development of Marfan syndrome in this patient. © 2017 by the Association of Clinical Scientists, Inc.

  10. Prader-Willi Syndrome and Schaaf-Yang Syndrome: Neurodevelopmental Diseases Intersecting at the MAGEL2 Gene

    Directory of Open Access Journals (Sweden)

    Michael D. Fountain


    Full Text Available Prader-Willi syndrome (PWS is a neurodevelopmental disorder characterized by neonatal hypotonia, developmental delay/intellectual disability, and characteristic feeding behaviors with failure to thrive during infancy; followed by hyperphagia and excessive weight gain later in childhood. Individuals with PWS also manifest complex behavioral phenotypes. Approximately 25% meet criteria for autism spectrum disorder (ASD. PWS is caused by the absence of paternally expressed, maternally silenced genes at chromosome 15q11-q13. MAGEL2 is one of five protein-coding genes in the PWS-critical domain. Truncating point mutations of the paternal allele of MAGEL2 cause Schaaf-Yang syndrome, which has significant phenotypic overlap with PWS, but is also clinically distinct; based on the presence of joint contractures, and a particularly high prevalence of autism spectrum disorder (up to 75% of affected individuals. The clinical and molecular overlap between PWS and Schaaf-Yang syndrome, but also their distinguishing features provide insight into the pathogenetic mechanisms underlying both disorders.

  11. Catecholamine-related gene expression in blood correlates with tic severity in tourette syndrome

    NARCIS (Netherlands)

    Gunther, Joan; Tian, Yingfang; Stamova, Boryana; Lit, Lisa; Corbett, Blythe; Ander, Brad; Zhan, Xinhua; Jickling, Glen; Bos-Veneman, Netty; Liu, Da; Hoekstra, Pieter; Sharp, Frank


    Tourette syndrome (TS) is a heritable disorder characterized by tics that are decreased in some patients by treatment with alpha adrenergic agonists and dopamine receptor blockers. Thus, this study examines the relationship between catecholamine gene expression in blood and tic severity. TS

  12. Gene variants of unknown clinical significance in Lynch syndrome. An introduction for clinicians

    NARCIS (Netherlands)

    Sijmons, Rolf H.; Greenblatt, Marc S.; Genuardi, Maurizio

    Clinicians referring patients for genetic testing for Lynch syndrome will sooner or later receive results for DNA Mismatch Repair (MMR) genes reporting DNA changes that are unclear from a clinical point of view. These changes are referred to as variants of unknown, or unclear, clinical significance

  13. Development of lymphoma in Autoimmune Lymphoproliferative Syndrome (ALPS) and its relationship to Fas gene mutations

    NARCIS (Netherlands)

    Poppema, Sibrand; Maggio, Ewerton; van den Berg, Anke

    Autoimmune Lymphoproliferative Syndrome (ALPS) is generally the result of a mutation in genes associated with apoptosis, like Fas, Fas ligand, Casp 8 and Casp 10. As a result, the normal homeostasis of T- and B-lymphocytes is disturbed and a proliferation of polyclonal T lymphocytes occurs. This

  14. Gene, Brain, and Behavior Relationships in Fragile X Syndrome: Evidence from Neuroimaging Studies (United States)

    Lightbody, Amy A.; Reiss, Allan L.


    Fragile X syndrome (FraX) remains the most common inherited cause of intellectual disability and provides a valuable model for studying gene-brain-behavior relationships. Over the past 15 years, structural and functional magnetic resonance imaging studies have emerged with the goal of better understanding the neural pathways contributing to the…

  15. Fanconi syndrome (United States)

    De Toni-Fanconi syndrome ... Fanconi syndrome can be caused by faulty genes, or it may result later in life due to kidney damage. Sometimes the cause of Fanconi syndrome is unknown. Common causes of Fanconi syndrome in ...

  16. Association of arginine vasopressin receptor 1a gene polymorphisms with hepatorenal syndrome

    International Nuclear Information System (INIS)

    Wang, C.; Luo, X.; Ye, J.; Liu, S.; Miu, L.; Bao, J.; Wang, F.; Yu, Z.


    To assess the association of arginine vasopressin receptor 1a gene single nucleotide polymorphisms with type I hepatorenal syndrome. Methods: The case-control study was conducted at the Hangzhou City Xixi Hospital, Hangzhou, China, from January 2012 to June 2014, and comprised patients with type I hepatorenal syndrome and individuals with cirrhosis who acted as the control group. Arginine vasopressin receptor 1a gene rs113481894 locus single nucleotide polymorphisms were analysed by high-resolution melting methods. Statistical analysis was performed using SPSS 17. Results: Of the 60 participants, 28(46.7%) were in the hepatorenal syndrome group and 32(53.3%) were controls. The mean age was 42.21+-11.30years in the hepatorenal syndrome group and 43.69+-12.60 in the control group (p=0.64). Mean total bilirubin, albumin and prothrombin activity levels were 154.76+-51.58, 49.30+-24.67 and 33.42+-3.69 in the hepatorenal syndrome group compared to 181.26+-64.46, 41.78+-17.52 and 32.98+-4.81 among controls (p=0.09, p=0.18 and p=0.70). Statistically significant differences were found in the distributions of arginine vasopressin receptor 1a gene rs113481894 locus T allele between type I hepatorenal syndrome patients and the control group (odds ratio= 2.230; p= 0.040). Conclusion: T allele located at arginine vasopressin receptor 1a receptor promoter rs113481894 locus may be associated with the pathogenesis of type I hepatorenal syndrome. (author)

  17. Correlation of gene expression with bladder capacity in interstitial cystitis/bladder pain syndrome. (United States)

    Colaco, Marc; Koslov, David S; Keys, Tristan; Evans, Robert J; Badlani, Gopal H; Andersson, Karl-Erik; Walker, Stephen J


    Interstitial cystitis and bladder pain syndrome are terms used to describe a heterogeneous chronic pelvic and bladder pain disorder. Despite its significant prevalence, our understanding of disease etiology is poor. We molecularly characterized interstitial cystitis/bladder pain syndrome and determined whether there are clinical factors that correlate with gene expression. Bladder biopsies from female subjects with interstitial cystitis/bladder pain syndrome and female controls without signs of the disease were collected and divided into those with normal and low anesthetized bladder capacity, respectively. Samples then underwent RNA extraction and microarray assay. Data generated by these assays were analyzed using Omics Explorer (Qlucore, Lund, Sweden), GeneSifter® Analysis Edition 4.0 and Ingenuity® Pathway Analysis to determine similarity among samples within and between groups, and measure differentially expressed transcripts unique to each phenotype. A total of 16 subjects were included in study. Principal component analysis and unsupervised hierarchical clustering showed clear separation between gene expression in tissues from subjects with low compared to normal bladder capacity. Gene expression in tissue from patients with interstitial cystitis/bladder pain syndrome who had normal bladder capacity did not significantly differ from that in controls without interstitial cystitis/bladder pain syndrome. Pairwise analysis revealed that pathways related to inflammatory and immune response were most involved. Microarray analysis provides insight into the potential pathological condition underlying interstitial cystitis/bladder pain syndrome. This pilot study shows that patients with this disorder who have low compared to normal bladder capacity have significantly different molecular characteristics, which may reflect a difference in disease pathophysiology. Copyright © 2014 American Urological Association Education and Research, Inc. Published by Elsevier Inc

  18. Finding new genes for non-syndromic hearing loss through an in silico prioritization study.

    Directory of Open Access Journals (Sweden)

    Matteo Accetturo

    Full Text Available At present, 51 genes are already known to be responsible for Non-Syndromic hereditary Hearing Loss (NSHL, but the knowledge of 121 NSHL-linked chromosomal regions brings to the hypothesis that a number of disease genes have still to be uncovered. To help scientists to find new NSHL genes, we built a gene-scoring system, integrating Gene Ontology, NCBI Gene and Map Viewer databases, which prioritizes the candidate genes according to their probability to cause NSHL. We defined a set of candidates and measured their functional similarity with respect to the disease gene set, computing a score ( S S M avg that relies on the assumption that functionally related genes might contribute to the same (disease phenotype. A Kolmogorov-Smirnov test, comparing the pair-wise distribution on the disease gene set with the distribution on the remaining human genes, provided a statistical assessment of this assumption. We found at a p-value 0.99. The twenty top-scored genes were finally examined to evaluate their possible involvement in NSHL. We found that half of them are known to be expressed in human inner ear or cochlea and are mainly involved in remodeling and organization of actin formation and maintenance of the cilia and the endocochlear potential. These findings strongly indicate that our metric was able to suggest excellent NSHL candidates to be screened in patients and controls for causative mutations.

  19. Isolated and combined dystonia syndromes - an update on new genes and their phenotypes. (United States)

    Balint, B; Bhatia, K P


    Recent consensus on the definition, phenomenology and classification of dystonia centres around phenomenology and guides our diagnostic approach for the heterogeneous group of dystonias. Current terminology classifies conditions where dystonia is the sole motor feature (apart from tremor) as 'isolated dystonia', while 'combined dystonia' refers to dystonias with other accompanying movement disorders. This review highlights recent advances in the genetics of some isolated and combined dystonic syndromes. Some genes, such as ANO3, GNAL and CIZ1, have been discovered for isolated dystonia, but they are probably not a common cause of classic cervical dystonia. Conversely, the phenotype associated with TUBB4A mutations expanded from that of isolated dystonia to a syndrome of hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC syndrome). Similarly, ATP1A3 mutations cause a wide phenotypic spectrum ranging from rapid-onset dystonia-parkinsonism to alternating hemiplegia of childhood. Other entities entailing dystonia-parkinsonism include dopamine transporter deficiency syndrome (SLC63 mutations); dopa-responsive dystonias; young-onset parkinsonism (PARKIN, PINK1 and DJ-1 mutations); PRKRA mutations; and X-linked TAF1 mutations, which rarely can also manifest in women. Clinical and genetic heterogeneity also characterizes myoclonus-dystonia, which includes not only the classical phenotype associated with epsilon-sarcoglycan mutations but rarely also presentation of ANO3 gene mutations, TITF1 gene mutations typically underlying benign hereditary chorea, and some dopamine synthesis pathway conditions due to GCH1 and TH mutations. Thus, new genes are being recognized for isolated dystonia, and the phenotype of known genes is broadening and now involves different combined dystonia syndromes. © 2015 EAN.

  20. GDNF gene is associated with tourette syndrome in a family study. (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo


    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  1. GDNF Gene Is Associated With Tourette Syndrome in a Family Study (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo


    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  2. KANSL1 gene disruption associated with the full clinical spectrum of 17q21.31 microdeletion syndrome


    Moreno-Igoa, María; Hernández-Charro, Blanca; Bengoa-Alonso, Amaya; Pérez-Juana-del-Casal, Aranzazu; Romero-Ibarra, Carlos; Nieva-Echebarria, Beatriz; Ramos-Arroyo, María Antonia


    Background Chromosome 17q21.31 microdeletion syndrome is a multisystem genomic disorder caused by a recurrent 600-kb-long deletion, or haploinsufficiency of the chromatin modifier gene KANSL1, which maps to that region. Patients with KANSL1 intragenic mutations have been reported to display the major clinical features of 17q21.31 microdeletion syndrome. However, they did not exhibit the full clinical spectrum of this disorder, which might indicate that an additional gene or genes, located in ...

  3. Is the Prosthetic Homologue Necessary for Embodiment? (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael


    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  4. Roles of the sister chromatid cohesion apparatus in gene expression, development, and human syndromes (United States)

    Dorsett, Dale


    The sister chromatid cohesion apparatus mediates physical pairing of duplicated chromosomes. This pairing is essential for appropriate distribution of chromosomes into the daughter cells upon cell division. Recent evidence shows that the cohesion apparatus, which is a significant structural component of chromosomes during interphase, also affects gene expression and development. The Cornelia de Lange (CdLS) and Roberts/SC phocomelia (RBS/SC) genetic syndromes in humans are caused by mutations affecting components of the cohesion apparatus. Studies in Drosophila suggest that effects on gene expression are most likely responsible for developmental alterations in CdLS. Effects on chromatid cohesion are apparent in RBS/SC syndrome, but data from yeast and Drosophila point to the likelihood that changes in expression of genes located in heterochromatin could contribute to the developmental deficits. PMID:16819604

  5. The gene for the Ellis-van Creveld syndrome is located on chromosome 4p16

    Energy Technology Data Exchange (ETDEWEB)

    Polymeropoulos, M.H.; Ide, S.E. [National Institute of Health, Bethesda, MD (United States); Wright, M. [Univ. of Newcastle Upon Tyne (United Kingdom)] [and others


    Ellis-van Creveld syndrome (EVC) is an autosomal recessive disorder characterized by disproportionate dwarfism, polydactyly, and congenital heart disease. This rare disorder is found with increased frequency among the Old Order Amish community in Lancaster County, Pennsylvania. We have used linkage analysis to localize the gene responsible for the EVC phenotype in nine interrelated Amish pedigrees and three unrelated families from Mexico, Ecuador, and Brazil. We now report the linkage for the Ellisvan Creveld syndrome gene to markers on the distal short arm of human chromosome 4, with Z{sub max} = 6.91 at {theta} = 0.02 for marker HOX7, in a region proximal to the FGFR3 gene responsible for the achondroplasia phenotype. 17 refs., 2 figs., 1 tab.

  6. [Severe type A insulin resistance syndrome due to a mutation in the insulin receptor gene]. (United States)

    Ros, P; Colino-Alcol, E; Grasso, V; Barbetti, F; Argente, J


    Insulin resistance syndromes without lipodystrophy are an infrequent and heterogeneous group of disorders with variable clinical phenotypes, associated with hyperglycemia and hyperinsulinemia. The three conditions related to mutations in the insulin receptor gene are leprechaunism or Donohue syndrome, Rabson-Mendenhall syndrome, and Type A syndrome. A case is presented on a patient diagnosed with type A insulin resistance, defined by the triad of extreme insulin resistance, acanthosis nigricans, and hyperandrogenism, carrying a heterozygous mutation in exon 19 of the insulin receptor gene coding for its tyrosine kinase domain that is crucial for the catalytic activity of the receptor. The molecular basis of the syndrome is reviewed, focusing on the structure-function relationships of the insulin receptor, knowing that the criteria for survival are linked to residual insulin receptor function. It is also pointed out that, although type A insulin resistance appears to represent a somewhat less severe condition, these patients have a high morbidity and their treatment is still unsatisfactory. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  7. Three cases with L1 syndrome and two novel mutations in the L1CAM gene. (United States)

    Marín, Rosario; Ley-Martos, Miriam; Gutiérrez, Gema; Rodríguez-Sánchez, Felicidad; Arroyo, Diego; Mora-López, Francisco


    Mutations in the L1CAM gene have been identified in the following various X-linked neurological disorders: congenital hydrocephalus; mental retardation, aphasia, shuffling gait, and adducted thumbs (MASA) syndrome; spastic paraplegia; and agenesis of the corpus callosum. These conditions are currently considered different phenotypes of a single entity known as L1 syndrome. We present three families with L1 syndrome. Sequencing of the L1CAM gene allowed the identification of the following mutations involved: a known splicing mutation (c.3531-12G>A) and two novel ones: a missense mutation (c.1754A>C; p.Asp585Ala) and a nonsense mutation (c.3478C>T; p.Gln1160Stop). The number of affected males and carrier females identified in a relatively small population suggests that L1 syndrome may be under-diagnosed. L1 syndrome should be considered in the differential diagnosis of intellectual disability or mental retardation in children, especially when other signs such as hydrocephalus or adducted thumbs are present.

  8. Analysis of Polymorphism of Angiotensin System Genes (ACE, AGTR1, and AGT) and Gene ITGB3 in Patients with Arterial Hypertension in Combination with Metabolic Syndrome. (United States)

    Zotova, T Yu; Kubanova, A P; Azova, M M; Aissa, A Ait; Gigani, O O; Frolov, V A


    Changes in the frequencies of genotypes and mutant alleles of ACE, AGTR1, AGT, and ITGB3 genes were analyzed in patients with arterial hypertension coupled with metabolic syndrome (N=15) and compared with population data and corresponding parameters in patients with isolated hypertension (N=15). Increased frequency of genotype ID of ACE gene (hypertension predictor) was confirmed for both groups. In case of isolated hypertension, M235M genotype (gene AGT) was more frequent, in case of hypertension combined with metabolic syndrome, the frequency of genotypes A1166C and C1166C of the gene AGTR1 was higher in comparison with population data. Comparison of mutant allele frequencies in the two groups showed that at the 90% significance level allele T of the AGT gene was more frequent in hypertension coupled with metabolic syndrome (OR=1.26) and genotype A1166A of the AGTR1 gene was more frequent in the group with isolated hypertension.

  9. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev


    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  10. Numerous BAF complex genes are mutated in Coffin-Siris syndrome. (United States)

    Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi


    Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.

  11. Defect in IgV gene somatic hypermutation in common variable immuno-deficiency syndrome. (United States)

    Levy, Y; Gupta, N; Le Deist, F; Garcia, C; Fischer, A; Weill, J C; Reynaud, C A


    Common Variable Immuno-Deficiency (CVID) is the most common symptomatic primary antibody-deficiency syndrome, but the basic immunologic defects underlying this syndrome are not well defined. We report here that among eight patients studied (six CVID and two hypogammaglobulinemic patients with recurrent infections), there is in two CVID patients a dramatic reduction in Ig V gene somatic hypermutation with 40-75% of IgG transcripts totally devoid of mutations in the circulating memory B cell compartment. Functional assays of the T cell compartment point to an intrinsic B cell defect in the process of antibody affinity maturation in these two cases.

  12. Long QT interval in Turner syndrome: a high prevalence of LQTS gene mutations

    DEFF Research Database (Denmark)

    Trolle, Christian

    Objective: QT interval prolongation of unknown aetiology is common in Turner syndrome (TS). This study set out to explore the presence of known pathogenic long QT (LQT) mutations in TS and to examine the corrected QT interval (QTc) over time and relate the findings to the TS phenotype. Methods......QTc). The prevalence of mutations in genes related to Long QT syndrome (LQTS) was determined in females with TS and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. Results: The mean hQTc in females with TS (414.0±25.5 ms...

  13. Genetic Alterations within the DENND1A Gene in Patients with Polycystic Ovary Syndrome (PCOS)

    DEFF Research Database (Denmark)

    Eriksen, Mette B; Nielsen, Michael F B; Brusgaard, Klaus


    sequencing. SNP genotyping was tested by allelic discrimination in real-time PCR in the additional patients and controls. Sequencing of the DENND1A gene identified eight SNPs; seven were not known to be associated with any diseases. One missense SNP was detected (rs189947178, A/C), potentially altering......Polycystic ovary syndrome (PCOS), the most common endocrine disease among premenopausal women, is caused by both genes and environment. We and others previously reported association between single nucleotide polymorphisms (SNPs) in the DENND1A gene and PCOS. We therefore sequenced the DENND1A gene...... and FG-score or PCOS diagnosis, this could be a false positive finding. In conclusion, sequence analysis of the DENND1A gene of patients with PCOS did not identify alterations that alone could be responsible for the PCOS pathogenesis, but a missense SNP (rs189947178) was identified in one patient...

  14. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports. (United States)

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi


    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  15. Severe neonatal marfan syndrome resulting from a De Novo 3-bp insertion into the fibrillin gene on chromosome 15

    Energy Technology Data Exchange (ETDEWEB)

    Milewicz, D.M.; Duvic, M. (Univ. of Texas Medical School, Houston, TX (United States))


    Severe neonatal Marfan syndrome has features of the Marfan syndrome and congenital contractural arachnodactyly present at birth, along with unique features such as loose, redundant skin and pulmonary emphysema. Since the Marfan syndrome and congenital contractural arachnodactyly are due to mutations in different genes, it has been uncertain whether neonatal Marfan syndrome is due to mutations in the fibrillin gene on chromosome 15 or in another gene. The authors studied an infant with severe neonatal Marfan syndrome. Dermal fibroblasts were metabolically labeled and found to secrete fibrillin inefficiently when compared with control cells. Reverse transcription and amplification of the proband's fibroblast RNA was used to identify a 3-bp insertion between nucleotides 480-481 or 481-482 of the fibrillin cDNA. The insertion maintains the reading frame of the protein and inserts a cysteine between amino acids 160 and 161 in an epidermal growth-factor-like motif of fibrillin. This 3-bp insertion was not found in the fibrillin gene in 70 unrelated, unaffected individuals and 11 unrelated individuals with the Maran syndrome. The authors conclude that neonatal Marfan syndrome is the result of mutations in the fibrillin gene on chromosome 15 and is part of the Marfan syndrome spectrum. 32 refs., 3 figs.

  16. Assessment of a 44 gene classifier for the evaluation of chronic fatigue syndrome from peripheral blood mononuclear cell gene expression.

    Directory of Open Access Journals (Sweden)

    Daniel Frampton

    Full Text Available Chronic fatigue syndrome (CFS is a clinically defined illness estimated to affect millions of people worldwide causing significant morbidity and an annual cost of billions of dollars. Currently there are no laboratory-based diagnostic methods for CFS. However, differences in gene expression profiles between CFS patients and healthy persons have been reported in the literature. Using mRNA relative quantities for 44 previously identified reporter genes taken from a large dataset comprising both CFS patients and healthy volunteers, we derived a gene profile scoring metric to accurately classify CFS and healthy samples. This metric out-performed any of the reporter genes used individually as a classifier of CFS.To determine whether the reporter genes were robust across populations, we applied this metric to classify a separate blind dataset of mRNA relative quantities from a new population of CFS patients and healthy persons with limited success. Although the metric was able to successfully classify roughly two-thirds of both CFS and healthy samples correctly, the level of misclassification was high. We conclude many of the previously identified reporter genes are study-specific and thus cannot be used as a broad CFS diagnostic.

  17. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.


    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  18. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.


    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  19. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome]. (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen


    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  20. Cytochrome C oxydase deficiency: SURF1 gene investigation in patients with Leigh syndrome. (United States)

    Maalej, Marwa; Kammoun, Thouraya; Alila-Fersi, Olfa; Kharrat, Marwa; Ammar, Marwa; Felhi, Rahma; Mkaouar-Rebai, Emna; Keskes, Leila; Hachicha, Mongia; Fakhfakh, Faiza


    Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is the MT[HYPHEN]ATP6 and SURF1 gene screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions by clinical and bioinformatics analyses. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analyses to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A > C/c. c.751 + 16G > A). In silico analyses of theses intronic variations showed that it could alters splicing processes as well as SURF1 protein translation. Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is MT-ATP6 and SURF1 genes screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in

  1. Syndromic Craniosynostosis Can Define New Candidate Genes for Suture Development or Result from the Non-specifc Effects of Pleiotropic Genes: Rasopathies and Chromatinopathies as Examples

    Directory of Open Access Journals (Sweden)

    Marcella Zollino


    Full Text Available Craniosynostosis is a heterogeneous condition caused by the premature fusion of cranial sutures, occurring mostly as an isolated anomaly. Pathogenesis of non-syndromic forms of craniosynostosis is largely unknown. In about 15–30% of cases craniosynostosis occurs in association with other physical anomalies and it is referred to as syndromic craniosynostosis. Syndromic forms of craniosynostosis arise from mutations in genes belonging to the Fibroblast Growth Factor Receptor (FGFR family and the interconnected molecular pathways in most cases. However it can occur in association with other gene variants and with a variety of chromosome abnormalities as well, usually in association with intellectual disability (ID and additional physical anomalies. Evaluating the molecular properties of the genes undergoing intragenic mutations or copy number variations (CNVs along with prevalence of craniosynostosis in different conditions and animal models if available, we made an attempt to define two distinct groups of unusual syndromic craniosynostosis, which can reflect direct effects of emerging new candidate genes with roles in suture homeostasis or a non-specific phenotypic manifestation of pleiotropic genes, respectively. RASopathies and 9p23p22.3 deletions are reviewed as examples of conditions in the first group. In particular, we found that craniosynostosis is a relatively common component manifestation of cardio-facio-cutaneous (CFC syndrome. Chromatinopathies and neurocristopathies are presented as examples of conditions in the second group. We observed that craniosynostosis is uncommon on average in these conditions. It was randomly associated with Kabuki, Koolen-de Vries/KANSL1 haploinsufficiency and Mowat–Wilson syndromes and in KAT6B-related disorders. As an exception, trigonocephaly in Bohring-Opitz syndrome reflects specific molecular properties of the chromatin modifier ASXL1 gene. Surveillance for craniosynostosis in syndromic forms of

  2. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu


    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  3. Genetic screens to identify pathogenic gene variants in the common cancer predisposition Lynch syndrome

    DEFF Research Database (Denmark)

    Drost, Mark; Lützen, Anne; van Hees, Sandrine


    In many individuals suspected of the common cancer predisposition Lynch syndrome, variants of unclear significance (VUS), rather than an obviously pathogenic mutations, are identified in one of the DNA mismatch repair (MMR) genes. The uncertainty of whether such VUS inactivate MMR, and therefore...... function. When a residue identified as mutated in an individual suspected of Lynch syndrome is listed as critical in such a reverse diagnosis catalog, there is a high probability that the corresponding human VUS is pathogenic. To investigate the applicability of this approach, we have generated....... Nearly half of these critical residues match with VUS previously identified in individuals suspected of Lynch syndrome. This aids in the assignment of pathogenicity to these human VUS and validates the approach described here as a diagnostic tool. In a wider perspective, this work provides a model...

  4. Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis. (United States)

    Bonnet, Crystel; Grati, M'hamed; Marlin, Sandrine; Levilliers, Jacqueline; Hardelin, Jean-Pierre; Parodi, Marine; Niasme-Grare, Magali; Zelenika, Diana; Délépine, Marc; Feldmann, Delphine; Jonard, Laurence; El-Amraoui, Aziz; Weil, Dominique; Delobel, Bruno; Vincent, Christophe; Dollfus, Hélène; Eliot, Marie-Madeleine; David, Albert; Calais, Catherine; Vigneron, Jacqueline; Montaut-Verient, Bettina; Bonneau, Dominique; Dubin, Jacques; Thauvin, Christel; Duvillard, Alain; Francannet, Christine; Mom, Thierry; Lacombe, Didier; Duriez, Françoise; Drouin-Garraud, Valérie; Thuillier-Obstoy, Marie-Françoise; Sigaudy, Sabine; Frances, Anne-Marie; Collignon, Patrick; Challe, Georges; Couderc, Rémy; Lathrop, Mark; Sahel, José-Alain; Weissenbach, Jean; Petit, Christine; Denoyelle, Françoise


    Usher syndrome (USH) combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3). Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3). Biallelic mutations were detected in 39 patients (72%) and monoallelic mutations in an additional 10 patients (18.5%). In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%), and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48%) were novel. Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.

  5. WS1 gene mutation analysis of Wolfram syndrome in a Chinese patient and a systematic review of literatures. (United States)

    Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin


    Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.


    Directory of Open Access Journals (Sweden)

    G. V. Matyushin


    Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

  7. Risk stratification in myelodysplastic syndromes: is there a role for gene expression profiling? (United States)

    Zeidan, Amer M; Prebet, Thomas; Saad Aldin, Ehab; Gore, Steven David


    Evaluation of: Pellagatti A, Benner A, Mills KI et al. Identification of gene expression-based prognostic markers in the hematopoietic stem cells of patients with myelodysplastic syndromes. J. Clin. Oncol. 31(28), 3557-3564 (2013). Patients with myelodysplastic syndromes (MDS) exhibit wide heterogeneity in clinical outcomes making accurate risk-stratification an integral part of the risk-adaptive management paradigm. Current prognostic schemes for MDS rely on clinicopathological parameters. Despite the increasing knowledge of the genetic landscape of MDS and the prognostic impact of many newly discovered molecular aberrations, none to date has been incorporated formally into the major risk models. Efforts are ongoing to use data generated from genome-wide high-throughput techniques to improve the 'individualized' outcome prediction for patients. We here discuss an important paper in which gene expression profiling (GEP) technology was applied to marrow CD34(+) cells from 125 MDS patients to generate and validate a standardized GEP-based prognostic signature.

  8. Bartter syndrome in two sisters with a novel mutation of the CLCNKB gene, one with deafness. (United States)

    Robitaille, Pierre; Merouani, Aicha; He, Ning; Pei, York


    This article describes two sisters with type III Bartter syndrome (BS) due to a novel missense variant of the CLCNKB gene. The phenotypic expression of the disease was very different in these two siblings. In one sister, the disease followed a very severe course, especially in the neonatal period and as a toddler. Both the classic symptoms and the biochemical features of the syndrome were striking. In addition, she presented with sensorineural deafness, a complication yet unreported in this subtype of BS In contrast, the least affected sister was symptom free and the biochemical features of the disease although present remained discrete throughout the prolonged follow-up. It is suggested that such a difference in the phenotypic expression of the disease is possibly secondary to the modifier effect of a gene and/or results from environmental factor(s).

  9. Wolfram syndrome 1 gene negatively regulates ER stress signaling in rodent and human cells. (United States)

    Fonseca, Sonya G; Ishigaki, Shinsuke; Oslowski, Christine M; Lu, Simin; Lipson, Kathryn L; Ghosh, Rajarshi; Hayashi, Emiko; Ishihara, Hisamitsu; Oka, Yoshitomo; Permutt, M Alan; Urano, Fumihiko


    Wolfram syndrome is an autosomal-recessive disorder characterized by insulin-dependent diabetes mellitus, caused by nonautoimmune loss of beta cells, and neurological dysfunctions. We have previously shown that mutations in the Wolfram syndrome 1 (WFS1) gene cause Wolfram syndrome and that WFS1 has a protective function against ER stress. However, it remained to be determined how WFS1 mitigates ER stress. Here we have shown in rodent and human cell lines that WFS1 negatively regulates a key transcription factor involved in ER stress signaling, activating transcription factor 6alpha (ATF6alpha), through the ubiquitin-proteasome pathway. WFS1 suppressed expression of ATF6alpha target genes and repressed ATF6alpha-mediated activation of the ER stress response element (ERSE) promoter. Moreover, WFS1 stabilized the E3 ubiquitin ligase HRD1, brought ATF6alpha to the proteasome, and enhanced its ubiquitination and proteasome-mediated degradation, leading to suppression of ER stress signaling. Consistent with these data, beta cells from WFS1-deficient mice and lymphocytes from patients with Wolfram syndrome exhibited dysregulated ER stress signaling through upregulation of ATF6alpha and downregulation of HRD1. These results reveal a role for WFS1 in the negative regulation of ER stress signaling and in the pathogenesis of diseases involving chronic, unresolvable ER stress, such as pancreatic beta cell death in diabetes.

  10. c.376G>A mutation in WFS1 gene causes Wolfram syndrome without deafness. (United States)

    Safarpour Lima, Behnam; Ghaedi, Hamid; Daftarian, Narsis; Ahmadieh, Hamid; Jamshidi, Javad; Khorrami, Mehdi; Noroozi, Rezvan; Sohrabifar, Nasim; Assarzadegan, Farhad; Hesami, Omid; Taghavi, Shaghayegh; Ahmadifard, Azadeh; Atakhorrami, Minoo; Rahimi-Aliabadi, Simin; Shahmohammadibeni, Neda; Alehabib, Elham; Andarva, Monavvar; Darvish, Hossein; Emamalizadeh, Babak


    Wolfram syndrome is one of the rare autosomal recessive, progressive, neurodegenerative disorders, characterized by diabetes mellitus and optic atrophy. Several other features are observed in patients including deafness, ataxia, and peripheral neuropathy. A gene called WFS1 is identified on chromosome 4p, responsible for Wolfram syndrome. We investigated a family consisted of parents and 8 children, which 5 of them have been diagnosed for Wolfram syndrome. WFS1 gene in all family members was sequenced for causative mutations. A mutation (c.376G>A, p.A126T) was found in all affected members in homozygous state and in both parents in heterozygous state. The bioinformatics analysis showed the deleterious effects of this nucleotide change on the structure and function of the protein product. As all of the patients in the family showed the homozygote mutation, and parents were both heterozygote, this mutation is probably the cause of the disease. We identified this mutation in homozygous state for the first time as Wolfram syndrome causation. We also showed that this mutation probably doesn't cause deafness in affected individuals. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. A Next Generation Sequencing custom gene panel as first line diagnostic tool for atypical cases of syndromic obesity: Application in a case of Alström syndrome. (United States)

    Maltese, Paolo E; Iarossi, Giancarlo; Ziccardi, Lucia; Colombo, Leonardo; Buzzonetti, Luca; Crinò, Antonino; Tezzele, Silvia; Bertelli, Matteo


    Obesity phenotype can be manifested as an isolated trait or accompanied by multisystem disorders as part of a syndromic picture. In both situations, same molecular pathways may be involved to different degrees. This evidence is stronger in syndromic obesity, in which phenotypes of different syndromes may overlap. In these cases, genetic testing can unequivocally provide a final diagnosis. Here we describe a patient who met the diagnostic criteria for Alström syndrome only during adolescence. Genetic testing was requested at 25 years of age for a final confirmation of the diagnosis. The genetic diagnosis of Alström syndrome was obtained through a Next Generation Sequencing genetic test approach using a custom-designed gene panel of 47 genes associated with syndromic and non-syndromic obesity. Genetic analysis revealed a novel homozygous frameshift variant p.(Arg1550Lysfs*10) on exon 8 of the ALMS1 gene. This case shows the need for a revision of the diagnostic criteria guidelines, as a consequence of the recent advent of massive parallel sequencing technology. Indications for genetic testing reported in these currently accepted diagnostic criteria for Alström syndrome, were drafted when sequencing was expensive and time consuming. Nowadays, Next Generation Sequencing testing could be considered as first line diagnostic tool not only for Alström syndrome but, more generally, for all those atypical or not clearly distinguishable cases of syndromic obesity, thus avoiding delayed diagnosis and treatments. Early diagnosis permits a better follow-up and pre-symptomatic interventions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene

    NARCIS (Netherlands)

    Eisenkraft, A.; Pode-Shakked, B.; Goldstein, N.; Shpirer, Z.; Bokhoven, H. van; Anikster, Y.


    Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish

  13. Acral peeling skin syndrome associated with a novel CSTA gene mutation. (United States)

    Muttardi, K; Nitoiu, D; Kelsell, D P; O'Toole, E A; Batta, K


    Acral peeling skin syndrome (APSS) is a rare autosomal recessive condition, characterized by asymptomatic peeling of the skin of the hands and feet, often linked to mutations in the gene TGM5. However, more recently recessive loss of function mutations in CSTA, encoding cystatin A, have been linked with APSS and exfoliative ichthyosis. We describe the clinical features in two sisters with APSS, associated with a novel large homozygous deletion encompassing exon 1 of CSTA. © 2015 British Association of Dermatologists.

  14. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II]. (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen


    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  15. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands. (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B


    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  16. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin


    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  17. Gene Therapy for the Retinal Degeneration of Usher Syndrome Caused by Mutations in MYO7A. (United States)

    Lopes, Vanda S; Williams, David S


    Usher syndrome is a deaf-blindness disorder. One of the subtypes, Usher 1B, is caused by loss of function of the gene encoding the unconventional myosin, MYO7A. A variety of different viral-based delivery approaches have been tested for retinal gene therapy to prevent the blindness of Usher 1B, and a clinical trial based on one of these approaches has begun. This review evaluates the different approaches. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  18. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

    DEFF Research Database (Denmark)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos


    Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2...... Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large...... deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder...

  19. Comprehensive screening of the USH2A gene in Usher syndrome type II and non-syndromic recessive retinitis pigmentosa. (United States)

    Seyedahmadi, Babak Jian; Rivolta, Carlo; Keene, Julia A; Berson, Eliot L; Dryja, Thaddeus P


    A screen of the entire coding region of the USH2A gene in 129 unrelated patients with Usher syndrome type II (USH2) and in 146 unrelated patients with non-syndromic autosomal recessive retinitis pigmentosa (ARRP) uncovered 54 different sequence variations, including 18 likely pathogenic mutations (13 frameshift, three nonsense, and two missense), 12 changes of uncertain pathogenicity (11 missense changes and one in-frame deletion), and 24 non-pathogenic rare variants or polymorphisms. Of the 18 likely pathogenic mutations, nine were novel. Among the USH2 patients, 50 (39%) had one or two likely pathogenic mutations. The most common mutant allele in USH2 patients was E767fs, which was found in 29 patients, including one homozygote. Among the ARRP patients, we found 17 (12%) with one or two likely pathogenic mutations. The most common mutant allele in ARRP patients was C759F and it was found in 10 patients. The C759F allele was also found in two USH2 patients; in neither of them was a change in the other allele found. The second most common mutant allele in both patient groups was L1447fs (found in 6/50 USH2 patients and 6/17 ARRP patients). Of the 50+17=67 patients with identified USH2A mutations, only one mutation in one allele was found in 41+12=53 (79%); the reason for the high proportion of patients with only one identified mutation is obscure. Our results indicate that USH2A mutations are found in about 7% of all cases of RP in North America, a frequency similar to the RPGR gene (8%) and the rhodopsin gene (10%).

  20. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome]. (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun


    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  1. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    Directory of Open Access Journals (Sweden)

    Jose Miguel Moreno-Ortiz


    Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  2. Xp21 contiguous gene syndromes: Deletion quantitation with bivariate flow karyotyping allows mapping of patient breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    McCabe, E.R.B.; Towbin, J.A. (Baylor College of Medicine, Houston, TX (United States)); Engh, G. van den; Trask, B.J. (Lawrence Livermore National Lab., CA (United States))


    Bivariate flow karyotyping was used to estimate the deletion sizes for a series of patients with Xp21 contiguous gene syndromes. The deletion estimates were used to develop an approximate scale for the genomic map in Xp21. The bivariate flow karyotype results were compared with clinical and molecular genetic information on the extent of the patients' deletions, and these various types of data were consistent. The resulting map spans >15 Mb, from the telomeric interval between DXS41 (99-6) and DXS68 (1-4) to a position centromeric to the ornithine transcarbamylase locus. The deletion sizing was considered to be accurate to [plus minus]1 Mb. The map provides information on the relative localization of genes and markers within this region. For example, the map suggests that the adrenal hypoplasia congenita and glycerol kinase genes are physically close to each other, are within 1-2 Mb of the telomeric end of the Duchenne muscular dystrophy (DMD) gene, and are nearer to the DMD locus than to the more distal marker DXS28 (C7). Information of this type is useful in developing genomic strategies for positional cloning in Xp21. These investigations demonstrate that the DNA from patients with Xp21 contiguous gene syndromes can be valuable reagents, not only for ordering loci and markers but also for providing an approximate scale to the map of the Xp21 region surrounding DMD. 44 refs., 3 figs.

  3. Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome. (United States)

    Essawi, Mona L; Ismail, Manal F; Afifi, Hanan H; Kobesiy, Maha M; El Kotoury, Ahmed; Barakat, Maged M


    Noonan syndrome (NS) is inherited as an autosomal dominant disorder with dysmorphic facies, short stature, and cardiac defects, which can be caused by missense mutations in the protein tyrosine phosphatase nonreceptor type 11 (PTPN11) gene, which encodes src homology region 2 domain containing tyrosine phosphatase-2 (SHP-2), a protein tyrosine phosphatase that acts in signal transduction downstream to growth factors and cytokines. The current study aimed to study the molecular characterization of the PTPN11 gene among Egyptian patients with Noonan syndrome. Eleven exons of the PTPN11 gene were amplified and screened by single stranded conformational polymorphism (SSCP). DNA samples showing band shift in SSCP were subjected to sequencing. Mutational analysis of the PTPN11 gene revealed T→C transition at position 854 in exon 8, predicting Phe285Ser substitution within PTP domain of SHP-2 protein, in one NS patient and -21C→T polymorphism in intron 7 in four other cases. Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS. Copyright © 2012. Published by Elsevier B.V.

  4. Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study. (United States)

    Le Quesne Stabej, Polona; Saihan, Zubin; Rangesh, Nell; Steele-Stallard, Heather B; Ambrose, John; Coffey, Alison; Emmerson, Jenny; Haralambous, Elene; Hughes, Yasmin; Steel, Karen P; Luxon, Linda M; Webster, Andrew R; Bitner-Glindzicz, Maria


    Usher syndrome (USH) is an autosomal recessive disorder comprising retinitis pigmentosa, hearing loss and, in some cases, vestibular dysfunction. It is clinically and genetically heterogeneous with three distinctive clinical types (I-III) and nine Usher genes identified. This study is a comprehensive clinical and genetic analysis of 172 Usher patients and evaluates the contribution of digenic inheritance. The genes MYO7A, USH1C, CDH23, PCDH15, USH1G, USH2A, GPR98, WHRN, CLRN1 and the candidate gene SLC4A7 were sequenced in 172 UK Usher patients, regardless of clinical type. No subject had definite mutations (nonsense, frameshift or consensus splice site mutations) in two different USH genes. Novel missense variants were classified UV1-4 (unclassified variant): UV4 is 'probably pathogenic', based on control frequency A being the most common USH1 mutation in the cohort). USH2A was responsible for 79.3% of USH2 families and GPR98 for only 6.6%. No mutations were found in USH1G, WHRN or SLC4A7. One or two pathogenic/likely pathogenic variants were identified in 86% of cases. No convincing cases of digenic inheritance were found. It is concluded that digenic inheritance does not make a significant contribution to Usher syndrome; the observation of multiple variants in different genes is likely to reflect polymorphic variation, rather than digenic effects.

  5. A unique mosaic Turner syndrome patient with androgen receptor gene derived marker chromosome. (United States)

    Kalkan, Rasime; Özdağ, Nermin; Bundak, Rüveyde; Çirakoğlu, Ayşe; Serakinci, Nedime


    Patients with Turner syndrome are generally characterized by having short stature with no secondary sexual characteristics. Some abnormalities, such as webbed neck, renal malformations (>50%) and cardiac defects (10%) are less common. The intelligence of these patients is considered normal. Non-mosaic monosomy X is observed in approximately 45% of postnatal patients with Turner syndrome and the rest of the patients have structural abnormalities or mosaicism involving 46,X,i(Xq), 45,X/46,XX, 45,X and other variants. The phenotype of 45,X/46,X,+mar individuals varies by the genetic continent and degree of the mosaicism. The gene content of the marker chromosome is the most important when correlating the phenotype with the genotype. Here we present an 11-year-old female who was referred for evaluation of her short stature and learning disabilities. Conventional cytogenetic investigation showed a mosaic 45,X/46,X,+mar karyotype. Fluorescence in situ hybridization showed that the marker chromosome originated from the X chromosome within the androgen receptor (AR) and X-inactive specific transcript (XIST) genes. Therefore, it is possible that aberrant activation of the marker chromosome, compromising the AR and XIST genes, may modify the Turner syndrome phenotype.

  6. Mutation spectrum of genes associated with steroid-resistant nephrotic syndrome in Chinese children. (United States)

    Wang, Ying; Dang, Xiqiang; He, Qingnan; Zhen, Yan; He, Xiaoxie; Yi, Zhuwen; Zhu, Kuichun


    Approximately 20% of children with idiopathic nephrotic syndrome do not respond to steroid therapy. More than 30 genes have been identified as disease-causing genes for the steroid-resistant nephrotic syndrome (SRNS). Few reports were from the Chinese population. The coding regions of genes commonly associated with SRNS were analyzed to characterize the gene mutation spectrum in children with SRNS in central China. The first phase study involved 38 children with five genes (NPHS1, NPHS2, PLCE1, WT1, and TRPC6) by Sanger sequencing. The second phase study involved 33 children with 17 genes by next generation DNA sequencing (NGS. 22 new patients, and 11 patients from first phase study but without positive findings). Overall deleterious or putatively deleterious gene variants were identified in 19 patients (31.7%), including four NPHS1 variants among five patients and three PLCE1 variants among four other patients. Variants in COL4A3, COL4A4, or COL4A5 were found in six patients. Eight novel variants were identified, including two in NPHS1, two in PLCE1, one in NPHS2, LAMB2, COL4A3, and COL4A4, respectively. 55.6% of the children with variants failed to respond to immunosuppressive agent therapy, while the resistance rate in children without variants was 44.4%. Our results show that screening for deleterious variants in some common genes in children clinically suspected with SRNS might be helpful for disease diagnosis as well as prediction of treatment efficacy and prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Síndrome de Diógenes Diogenes syndrome


    Bárbara Perdigão Stumpf; Fábio Lopes Rocha


    A síndrome de Diógenes (SD) caracteriza-se por descuido extremo com a higiene pessoal, negligência com o asseio da própria moradia, isolamento social, suspeição e comportamento paranoico, sendo frequente a ocorrência de colecionismo. A incidência anual é de 5/10.000 entre aqueles acima de 60 anos, e pelo menos a metade é portadora de demência ou algum outro transtorno psiquiátrico. As principais hipóteses etiológicas são: (1) a condição representaria o "estágio final" de um transtorno de pers...

  8. Expression profile of immune response genes in patients with Severe Acute Respiratory Syndrome

    Directory of Open Access Journals (Sweden)

    Tai Dessmon


    Full Text Available Abstract Background Severe acute respiratory syndrome (SARS emerged in later February 2003, as a new epidemic form of life-threatening infection caused by a novel coronavirus. However, the immune-pathogenesis of SARS is poorly understood. To understand the host response to this pathogen, we investigated the gene expression profiles of peripheral blood mononuclear cells (PBMCs derived from SARS patients, and compared with healthy controls. Results The number of differentially expressed genes was found to be 186 under stringent filtering criteria of microarray data analysis. Several genes were highly up-regulated in patients with SARS, such as, the genes coding for Lactoferrin, S100A9 and Lipocalin 2. The real-time PCR method verified the results of the gene array analysis and showed that those genes that were up-regulated as determined by microarray analysis were also found to be comparatively up-regulated by real-time PCR analysis. Conclusions This differential gene expression profiling of PBMCs from patients with SARS strongly suggests that the response of SARS affected patients seems to be mainly an innate inflammatory response, rather than a specific immune response against a viral infection, as we observed a complete lack of cytokine genes usually triggered during a viral infection. Our study shows for the first time how the immune system responds to the SARS infection, and opens new possibilities for designing new diagnostics and treatments for this new life-threatening disease.

  9. Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy (United States)

    Williams, David S.


    Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects, retinal phenotypes are relatively mild and have been difficult to characterize. The retinal functions of the Usher proteins are still largely unknown. Protein binding studies have suggested many interactions among the proteins, and a model of interaction among all the proteins in the photoreceptor synapse has been proposed. However this model is not supported by localization data from some laboratories, or the indication of any synaptic phenotype in mutant mice. An earlier suggestion, based on patient pathologies, of Usher protein function in the photoreceptor cilium continues to gain support from immunolocalization and mutant mouse studies, which are consistent with Usher protein interaction in the photoreceptor ciliary/periciliary region. So far, the most characterized Usher protein is myosin VIIa. It is present in the apical RPE and photoreceptor ciliary/periciliary region, where it is required for organelle transport and clearance of opsin from the connecting cilium, respectively. Usher syndrome is amenable to gene replacement therapy, but also has some specific challenges. Progress in this treatment approach has been achieved by correction of mutant phenotypes in Myo7a-null mouse retinas, following lentiviral delivery of MYO7A. PMID:17936325

  10. Linkage of Usher syndrome type I gene (USH1B) to the long arm of chromosome 11. (United States)

    Kimberling, W J; Möller, C G; Davenport, S; Priluck, I A; Beighton, P H; Greenberg, J; Reardon, W; Weston, M D; Kenyon, J B; Grunkemeyer, J A


    Usher syndrome is the most commonly recognized cause of combined visual and hearing loss in technologically developed countries. There are several different types and all are inherited in an autosomal recessive manner. There may be as many as five different genes responsible for at least two closely related phenotypes. The nature of the gene defects is unknown, and positional cloning strategies are being employed to identify the genes. This is a report of the localization of one gene for Usher syndrome type I to chromosome 11q, probably distal to marker D11S527. Another USH1 gene had been previously localized to chromosome 14q, and this second localization establishes the existence of a new and independent locus for Usher syndrome.

  11. Brugada syndrome with a novel missense mutation in SCN5A gene: A case report from Bangladesh

    Directory of Open Access Journals (Sweden)

    Md. Zahidus Sayeed


    Full Text Available Brugada syndrome is an inherited cardiac arrhythmia that follows autosomal dominant transmission and can cause sudden death. We report a case of Brugada syndrome in a 55-year-old male patient presented with recurrent palpitation, atypical chest pain and presyncope. ECG changes were consistent with type 1 Brugada. Gene analysis revealed a novel missense mutation in SCN5A gene with a genetic variation of D785N and a nucleotide change at 2353G-A. One of his children also had the same mutation. To our knowledge this is the first genetically proved case of Brugada syndrome in Bangladesh.

  12. Connected Gene Communities Underlie Transcriptional Changes in Cornelia de Lange Syndrome. (United States)

    Boudaoud, Imène; Fournier, Éric; Baguette, Audrey; Vallée, Maxime; Lamaze, Fabien C; Droit, Arnaud; Bilodeau, Steve


    Cornelia de Lange syndrome (CdLS) is a complex multisystem developmental disorder caused by mutations in cohesin subunits and regulators. While its precise molecular mechanisms are not well defined, they point toward a global deregulation of the transcriptional gene expression program. Cohesin is associated with the boundaries of chromosome domains and with enhancer and promoter regions connecting the three-dimensional genome organization with transcriptional regulation. Here, we show that connected gene communities, structures emerging from the interactions of noncoding regulatory elements and genes in the three-dimensional chromosomal space, provide a molecular explanation for the pathoetiology of CdLS associated with mutations in the cohesin-loading factor NIPBL and the cohesin subunit SMC1A NIPBL and cohesin are important constituents of connected gene communities that are centrally positioned at noncoding regulatory elements. Accordingly, genes deregulated in CdLS are positioned within reach of NIPBL- and cohesin-occupied regions through promoter-promoter interactions. Our findings suggest a dynamic model where NIPBL loads cohesin to connect genes in communities, offering an explanation for the gene expression deregulation in the CdLS. Copyright © 2017 by the Genetics Society of America.

  13. Deletions at the SOX10 gene locus cause Waardenburg syndrome types 2 and 4. (United States)

    Bondurand, Nadege; Dastot-Le Moal, Florence; Stanchina, Laure; Collot, Nathalie; Baral, Viviane; Marlin, Sandrine; Attie-Bitach, Tania; Giurgea, Irina; Skopinski, Laurent; Reardon, William; Toutain, Annick; Sarda, Pierre; Echaieb, Anis; Lackmy-Port-Lis, Marilyn; Touraine, Renaud; Amiel, Jeanne; Goossens, Michel; Pingault, Veronique


    Waardenburg syndrome (WS) is an auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair and skin. Depending on additional symptoms, WS is classified into four subtypes, WS1-WS4. Absence of additional features characterizes WS2. The association of facial dysmorphic features defines WS1 and WS3, whereas the association with Hirschsprung disease (aganglionic megacolon) characterizes WS4, also called "Waardenburg-Hirschsprung disease." Mutations within the genes MITF and SNAI2 have been identified in WS2, whereas mutations of EDN3, EDNRB, and SOX10 have been observed in patients with WS4. However, not all cases are explained at the molecular level, which raises the possibility that other genes are involved or that some mutations within the known genes are not detected by commonly used genotyping methods. We used a combination of semiquantitative fluorescent multiplex polymerase chain reaction and fluorescent in situ hybridization to search for SOX10 heterozygous deletions. We describe the first characterization of SOX10 deletions in patients presenting with WS4. We also found SOX10 deletions in WS2 cases, making SOX10 a new gene of WS2. Interestingly, neurological phenotypes reminiscent of that observed in WS4 (PCWH syndrome [peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung disease]) were observed in some WS2-affected patients with SOX10 deletions. This study further characterizes the molecular complexity and the close relationship that links the different subtypes of WS.

  14. Pitt-Hopkins syndrome: report of a case with a TCF4 gene mutation

    Directory of Open Access Journals (Sweden)

    Orsini Alessandro


    Full Text Available Abstract Aims We will discuss the clinical and genetic diagnosis of a child with severe psychomotor delay, who at 3 years of age presented with paroxysms of hyperpnea-apnea and seizures unrelated to breathing anomalies. Methods The child underwent genetic (karyotype, FISH telomeres and neuroradiological (cranial CT and MRI tests, which proved to be normal. He came under our clinical observation at 3 years and 5 months of age. Due to severe psychomotor delay and facial dysmorphisms we completed the genetic investigations based on his clinical feature and analysis of the available literature. Results The presence of severe mental retardation associated with anomalous breathing pattern may suggest the Joubert and Rett syndrome, however these were excluded on the basis of clinical and genetic examination. Angelman syndrome, suspected for facial dysmorphisms and absent language, was also excluded because of the presence of a normal pattern of methylation at SNRPN locus. Another possible diagnosis was the Pitt-Hopkins Syndrome (PHS, characterized by severe mental retardation, breathing anomalies (paroxisms of hyperpnea-apnea, dysmorphisms and sometimes epilepsy. Haploinsufficiency of TCF4 gene located at 18q21.2 region has been recently identified as causative of this syndrome. In our patient the research of TCF4 mutation by the Institute of Human Genetics, University Hospital Erlangen (Germany, showed a de novo mutation. Conclusions The diagnosis of Pitt-Hopkins syndrome, an underdiagnosed cause of mental retardation, was based on clinical and genetic findings. Searching for TCF4 mutations is highly recommended when others overlapping syndromes was excluded. At our knowledge our patient is the first italian case of PHS diagnosed at molecular level.

  15. Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome. (United States)

    Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K


    Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

  16. Analysis of gene expression profile microarray data in complex regional pain syndrome. (United States)

    Tan, Wulin; Song, Yiyan; Mo, Chengqiang; Jiang, Shuangjian; Wang, Zhongxing


    The aim of the present study was to predict key genes and proteins associated with complex regional pain syndrome (CRPS) using bioinformatics analysis. The gene expression profiling microarray data, GSE47603, which included peripheral blood samples from 4 patients with CRPS and 5 healthy controls, was obtained from the Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) in CRPS patients compared with healthy controls were identified using the GEO2R online tool. Functional enrichment analysis was then performed using The Database for Annotation Visualization and Integrated Discovery online tool. Protein‑protein interaction (PPI) network analysis was subsequently performed using Search Tool for the Retrieval of Interaction Genes database and analyzed with Cytoscape software. A total of 257 DEGs were identified, including 243 upregulated genes and 14 downregulated ones. Genes in the human leukocyte antigen (HLA) family were most significantly differentially expressed. Enrichment analysis demonstrated that signaling pathways, including immune response, cell motion, adhesion and angiogenesis were associated with CRPS. PPI network analysis revealed that key genes, including early region 1A binding protein p300 (EP300), CREB‑binding protein (CREBBP), signal transducer and activator of transcription (STAT)3, STAT5A and integrin α M were associated with CRPS. The results suggest that the immune response may therefore serve an important role in CRPS development. In addition, genes in the HLA family, such as HLA‑DQB1 and HLA‑DRB1, may present potential biomarkers for the diagnosis of CRPS. Furthermore, EP300, its paralog CREBBP, and the STAT family genes, STAT3 and STAT5 may be important in the development of CRPS.

  17. Novel variant in the TP63 gene associated to ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome. (United States)

    Gonzalez, Francisco; Loidi, Lourdes; Abalo-Lojo, Jose M


    Ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome is a disorder resulting from anomalous embryonic development of ectodermal tissues. There is evidence that AEC syndrome is caused by mutations in the TP63 gene, which encodes the p63 protein. This is an important regulatory protein involved in epidermal proliferation and differentiation. Genome sequencing was performed in DNA from peripheral blood leukocytes of a newborn with AEC syndrome and her parents. Variants were searched in all coding exons and intron-exon boundaries of the TP63 gene. A heterozygous missense variant (NM_003722.4:c.1063G>C (p.Asp355His) was found in the newborn patient. No variants were found in either of the parents. We identified a previously unreported variant in TP63 gene which seems to be involved in the somatic malformations found in the AEC syndrome. The absence of this variant in both parents suggests that the variant appeared de novo.

  18. Characterization of ORF89 - A latency-related gene of white spot syndrome virus

    International Nuclear Information System (INIS)

    Hossain, M.S.; Khadijah, Siti; Kwang, Jimmy


    Open reading frame 89 (ORF89) is one of the three genes that are believed to be involved in the latent infection of white spot syndrome virus (WSSV). Here, we report the structure and functional characterization of ORF89. cDNA sequencing, 5' RLM-RACE, and 3' RLM-RACE showed that ORF89 gene is transcribed into an unspliced mRNA of 4436 nucleotides, which is predicted to encode a protein of 1437 amino acids. ORF89 expressed an approximately 165-kDa protein in Sf9 cells that localized in the nucleus. Amino acids 678-683 were found to be essential for nuclear localization. Cotransfection assays demonstrated that ORF89 protein repressed its own promoter as well as those of a protein kinase and the thymidine-thymidylate kinase genes of WSSV. SYBR Green real-time PCR indicated that the repression occurred at the transcriptional level

  19. Gene Therapy Restores Balance and Auditory Functions in a Mouse Model of Usher Syndrome. (United States)

    Isgrig, Kevin; Shteamer, Jack W; Belyantseva, Inna A; Drummond, Meghan C; Fitzgerald, Tracy S; Vijayakumar, Sarath; Jones, Sherri M; Griffith, Andrew J; Friedman, Thomas B; Cunningham, Lisa L; Chien, Wade W


    Dizziness and hearing loss are among the most common disabilities. Many forms of hereditary balance and hearing disorders are caused by abnormal development of stereocilia, mechanosensory organelles on the apical surface of hair cells in the inner ear. The deaf whirler mouse, a model of human Usher syndrome (manifested by hearing loss, dizziness, and blindness), has a recessive mutation in the whirlin gene, which renders hair cell stereocilia short and dysfunctional. In this study, wild-type whirlin cDNA was delivered to the inner ears of neonatal whirler mice using adeno-associated virus serotype 2/8 (AAV8-whirlin) by injection into the posterior semicircular canal. Unilateral whirlin gene therapy injection was able to restore balance function as well as improve hearing in whirler mice for at least 4 months. Our data indicate that gene therapy is likely to become a treatment option for hereditary disorders of balance and hearing. Copyright © 2017. Published by Elsevier Inc.

  20. Association Study between Ghrelin Gene Polymorphism and Metabolic Syndrome in a Han Chinese Population. (United States)

    You, Yueyue; Yu, Yaqin; Wu, Yanhua; Rao, Wenwang; Zhang, Yangyu; Liu, Yingyu; Yang, Guang; Fu, Yingli; Shi, Jieping; Kou, Changgui


    Ghrelin, in humans, is a hormone secreted from the stomach with an orexigenic effect, which is good for digestion and absorption, as well as regulating physical growth, metabolism, and energy balance. It is also involved in the development of metabolic syndrome (MetS) and type 2 diabetes mellitus (T2DM). This study assessed the association between single nucleotide variants of the GHRL gene and the risk of metabolic syndrome in a Han Chinese population. A case-control study was performed on 3780 Han Chinese comprising 1813 MetS cases and 1967 controls. Three missense polymorphisms in GHRL (rs26802, rs10490816, and rs696217) were selected, and the association between these polymorphisms and the risk of MetS was investigated. Metabolic syndrome was defined according to the criteria of the International Diabetes Federation (IDF). Using Pearson's 2 test, we found that there were no significant differences in genotype distributions and allele frequencies between cases and controls (all p > 0.05). There were also no significant differences in haplotype distributions between MetS cases and healthy controls. Furthermore, we confirmed that rs26802 of the GHRL gene is associated with body mass index (BMI), waist circumference, systolic blood pressure (SBP), and fasting glucose; rs10490816 is associated with triglycerides (TG) and total cholesterol (TC); while rs696217 is associated with hip circumference and fasting glucose. We concluded that mutations in the GHRL gene did not confer risk for MetS in our study population. Therefore, functional analysis and replication studies in other populations are needed to further investigate the exact role of the GHRL gene in MetS.

  1. Genes, language, and the nature of scientific explanations: the case of Williams syndrome. (United States)

    Musolino, Julien; Landau, Barbara


    In this article, we discuss two experiments of nature and their implications for the sciences of the mind. The first, Williams syndrome, bears on one of cognitive science's holy grails: the possibility of unravelling the causal chain between genes and cognition. We sketch the outline of a general framework to study the relationship between genes and cognition, focusing as our case study on the development of language in individuals with Williams syndrome. Our approach emphasizes the role of three key ingredients: the need to specify a clear level of analysis, the need to provide a theoretical account of the relevant cognitive structure at that level, and the importance of the (typical) developmental process itself. The promise offered by the case of Williams syndrome has also given rise to two strongly conflicting theoretical approaches-modularity and neuroconstructivism-themselves offshoots of a perennial debate between nativism and empiricism. We apply our framework to explore the tension created by these two conflicting perspectives. To this end, we discuss a second experiment of nature, which allows us to compare the two competing perspectives in what comes close to a controlled experimental setting. From this comparison, we conclude that the "meaningful debate assumption", a widespread assumption suggesting that neuroconstructivism and modularity address the same questions and represent genuine theoretical alternatives, rests on a fallacy.

  2. A Case of Brown-Vialetto-Van Laere Syndrome Due To a Novel Mutation in Gene

    Directory of Open Access Journals (Sweden)

    Venkatraman Thulasi BA


    Full Text Available Brown-Vialetto-Van Laere syndrome is a rare disorder characterized by motor, sensory, and cranial neuronopathies, associated with mutations in SLC52A2 and SLC52A3 genes that code for human riboflavin transporters RFVT2 and RFVT3, respectively. The authors describe the clinical course of a 6-year-old girl with Brown-Vialetto-Van Laere syndrome and a novel homozygous mutation c.1156T>C in the SLC52A3 gene, who presented at the age of 2.5 years with progressive brain stem dysfunction including ptosis, facial weakness, hearing loss, dysphagia, anarthria with bilateral vocal cord paralysis, and ataxic gait. She subsequently developed respiratory failure requiring tracheostomy and worsening dysphagia necessitating a gastrostomy. Following riboflavin supplementation, resolution of facial diplegia and ataxia, improvements in ptosis, and bulbar function including vocalization and respiration were noted. However, her sensorineural hearing loss remained unchanged. Similar to other cases of Brown-Vialetto-Van Laere syndrome, our patient responded favorably to early riboflavin supplementation with significant but not complete neurologic recovery.

  3. Hearing impairment caused by mutations in two different genes responsible for nonsyndromic and syndromic hearing loss within a single family. (United States)

    Niepokój, Katarzyna; Rygiel, Agnieszka M; Jurczak, Piotr; Kujko, Aleksandra A; Śniegórska, Dominika; Sawicka, Justyna; Grabarczyk, Alicja; Bal, Jerzy; Wertheim-Tysarowska, Katarzyna


    Usher syndrome is rare genetic disorder impairing two human senses, hearing and vision, with the characteristic late onset of vision loss. This syndrome is divided into three types. In all cases, the vision loss is postlingual, while loss of hearing is usually prelingual. The vestibular functions may also be disturbed in Usher type 1 and sometimes in type 3. Vestibular areflexia is helpful in making a proper diagnosis of the syndrome, but, often, the syndrome is misdiagnosed as a nonsyndromic hearing loss. Here, we present a Polish family with hearing loss, which was clinically classified as nonsyndromic. After excluding mutations in the DFNB1 locus, we implemented the next-generation sequencing method and revealed that hearing loss was syndromic and mutations in the USH2A gene indicate Usher syndrome. This research highlights the importance of molecular analysis in establishing a clinical diagnosis of congenital hearing loss.

  4. Marfan Syndrome (United States)

    Marfan syndrome is a disorder that affects connective tissue. Connective tissues are proteins that support skin, bones, blood vessels, ... A problem with the fibrillin gene causes Marfan syndrome. Marfan syndrome can be mild to severe, and ...

  5. Williams syndrome (United States)

    Williams-Beuren syndrome ... Williams syndrome is caused by not having a copy of several genes. It may be passed down in families. ... history of the condition. However, people with Williams syndrome have a 50% chance of passing the disorder ...

  6. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.


    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  7. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de


    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  8. Symptoms of Attention-Deficit/Hyperactivity Disorder in Down Syndrome: Effects of the Dopamine Receptor D4 Gene (United States)

    Mason, Gina Marie; Spanó, Goffredina; Edgin, Jamie


    This study examined individual differences in ADHD symptoms and executive function (EF) in children with Down syndrome (DS) in relation to the dopamine receptor D4 (DRD4) gene, a gene often linked to ADHD in people without DS. Participants included 68 individuals with DS (7-21 years), assessed through laboratory tasks, caregiver reports, and…

  9. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis]. (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B


    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  10. Polyunsaturated fatty acid regulation of gene transcription: a molecular mechanism to improve the metabolic syndrome. (United States)

    Clarke, S D


    This review addresses the hypothesis that polyunsaturated fatty acids (PUFA), particularly those of the (n-3) family, play pivotal roles as "fuel partitioners" in that they direct fatty acids away from triglyceride storage and toward oxidation, and that they enhance glucose flux to glycogen. In doing this, PUFA may protect against the adverse symptoms of the metabolic syndrome and reduce the risk of heart disease. PUFA exert their beneficial effects by up-regulating the expression of genes encoding proteins involved in fatty acid oxidation while simultaneously down-regulating genes encoding proteins of lipid synthesis. PUFA govern oxidative gene expression by activating the transcription factor peroxisome proliferator-activated receptor alpha. PUFA suppress lipogenic gene expression by reducing the nuclear abundance and DNA-binding affinity of transcription factors responsible for imparting insulin and carbohydrate control to lipogenic and glycolytic genes. In particular, PUFA suppress the nuclear abundance and expression of sterol regulatory element binding protein-1 and reduce the DNA-binding activities of nuclear factor Y, Sp1 and possibly hepatic nuclear factor-4. Collectively, the studies discussed suggest that the fuel "repartitioning" and gene expression actions of PUFA should be considered among criteria used in defining the dietary needs of (n-6) and (n-3) and in establishing the dietary ratio of (n-6) to (n-3) needed for optimum health benefit.

  11. MYO7A and USH2A gene sequence variants in Italian patients with Usher syndrome. (United States)

    Sodi, Andrea; Mariottini, Alessandro; Passerini, Ilaria; Murro, Vittoria; Tachyla, Iryna; Bianchi, Benedetta; Menchini, Ugo; Torricelli, Francesca


    To analyze the spectrum of sequence variants in the MYO7A and USH2A genes in a group of Italian patients affected by Usher syndrome (USH). Thirty-six Italian patients with a diagnosis of USH were recruited. They received a standard ophthalmologic examination, visual field testing, optical coherence tomography (OCT) scan, and electrophysiological tests. Fluorescein angiography and fundus autofluorescence imaging were performed in selected cases. All the patients underwent an audiologic examination for the 0.25-8,000 Hz frequencies. Vestibular function was evaluated with specific tests. DNA samples were analyzed for sequence variants of the MYO7A gene (for USH1) and the USH2A gene (for USH2) with direct sequencing techniques. A few patients were analyzed for both genes. In the MYO7A gene, ten missense variants were found; three patients were compound heterozygous, and two were homozygous. Thirty-four USH2A gene variants were detected, including eight missense variants, nine nonsense variants, six splicing variants, and 11 duplications/deletions; 19 patients were compound heterozygous, and three were homozygous. Four MYO7A and 17 USH2A variants have already been described in the literature. Among the novel mutations there are four USH2A large deletions, detected with multiplex ligation dependent probe amplification (MLPA) technology. Two potentially pathogenic variants were found in 27 patients (75%). Affected patients showed variable clinical pictures without a clear genotype-phenotype correlation. Ten variants in the MYO7A gene and 34 variants in the USH2A gene were detected in Italian patients with USH at a high detection rate. A selective analysis of these genes may be valuable for molecular analysis, combining diagnostic efficiency with little time wastage and less resource consumption.

  12. Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis

    Directory of Open Access Journals (Sweden)

    Lacombe Didier


    Full Text Available Abstract Background Usher syndrome (USH combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3. Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. Methods We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3. Results Biallelic mutations were detected in 39 patients (72% and monoallelic mutations in an additional 10 patients (18.5%. In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%, and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48% were novel. Conclusions Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.

  13. Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination. (United States)

    Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin


    Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

  14. Genetic testing of the FBN1 gene in Chinese patients with Marfan/Marfan-like syndrome. (United States)

    Yang, Hang; Luo, Mingyao; Chen, Qianlong; Fu, Yuanyuan; Zhang, Jing; Qian, Xiangyang; Sun, Xiaogang; Fan, Yuxin; Zhou, Zhou; Chang, Qian


    Marfan syndrome (MFS) is an autosomal dominant connective tissue disorder typically involving the ocular, skeletal and cardiovascular systems, and aortic aneurysms/dissection mainly contributes to its mortality. Here, we performed genetic testing of the FBN1 gene in 39 Chinese probands with Marfan/Marfan-like syndrome and their related family members by Sanger sequencing. In total, 29 pathogenic/likely pathogenic FBN1 mutations, including 17 novel ones, were identified. In addition, most MFS patients with aortic disease (62%) had a truncating or splicing mutation. These results expand the FBN1 mutation spectrum and enrich our knowledge of genotype-phenotype correlations. Genetic testing for MFS and its related aortic diseases is increasingly important for early intervention and treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I. (United States)

    Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J


    PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  16. Common sequence variants in the LOXL1 gene in pigment dispersion syndrome and pigmentary glaucoma. (United States)

    Giardina, Emiliano; Oddone, Francesco; Lepre, Tiziana; Centofanti, Marco; Peconi, Cristina; Tanga, Lucia; Quaranta, Luciano; Frezzotti, Paolo; Novelli, Giuseppe; Manni, Gianluca


    Single nucleotide polymorphisms (SNPs) within the LOXL1 gene are associated with pseudoesfoliation syndrome and pseudoesfoliation glaucoma. The aim of our study is to investigate a potential involvement of LOXL1 gene in the pathogenesis of pigment dispersion syndrome (PDS) and pigmentary glaucoma (PG). A cohort of Caucasian origin of 84 unrelated and clinically well-characterised patients with PDS/PG and 200 control subjects were included in the study. Genomic DNA from whole blood was extracted and the coding and regulatory regions of LOXL1 gene were risequenced in both patients and controls to identify unknown sequence variations. Genotype and haplotype analysis were performed with UNPHASED software. The expression levels of LOXL1 were determined on c-DNA from peripheral blood lymphocytes by quantitative real-time RT-PCR. A significant allele association was detected for SNP rs2304722 within the fifth intron of LOXL1 (Odds ratio (OR = 2.43, p-value = 3,05e-2). Haplotype analysis revealed the existence of risk and protective haplotypes associated with PG-PDS (OR = 3.35; p-value = 1.00e-5 and OR = 3.35; p-value = 1.00e-4, respectively). Expression analysis suggests that associated haplotypes can regulate the expression level LOXL1. Haplotypes of LOXL1 are associated with PG-PDS independently from rs1048661, leading to a differential expression of the transcript.

  17. Unusual presentation of Kallmannn syndrome with contiguous gene deletion in three siblings of a family

    Directory of Open Access Journals (Sweden)

    Sri Venkat Madhu


    Full Text Available We report the case of 3 brothers aged 34, 24, and 22 years, unmarried, who presented to our endocrinology clinic with absence of secondary sexual characters. There was no such history in other siblings, but their maternal uncle had similar complaints. On examination, all 3 had pre-pubertal appearance, voice, and genitalia along with anosmia and bimanual synkinesia. Cryptorchidism was noticed in 2 while third person had small hypoplastic testes. It was also noted that all 3 patients had icthyosis mainly involving trunk, back, and limbs. The hormonal assays were consistent with isolated hypogonadotrophic hypogonadism. IQ testing revealed mental retardation in the 2 patients. Ultrasound showed ectopic right kidney in one patient, atrophic right kidney in the second patient while the third patient had normal kidneys. MRI brain of all the patients showed poorly visualized olfactory tract and bulb. Kallmann syndrome (KS was diagnosed based on hormonal evaluation and MRI results. Of the four types of KS: Synkinesia, renal anomaly, and X-linked pedigree pattern in our patients pointed towards X-linked type 1 KS as the possible cause. But, icthyosis and mental retardation are not usual presentation of type 1 KS. They are usually seen as a result of contiguous gene deletion of KAL1, steroid sulfatase (STS, and mental retardation (MRX gene on X chromosome. Hence, the possible gene defect in our cases is inherited defect in contiguous gene deletion. The contiguous gene deletion as the cause of KS in 3 patients of same family is very rare and worth reporting. Also, the significance of phenotype-genotypic association in Kallmann syndrome is discussed

  18. Same MSH2 Gene Mutation But Variable Phenotypes in 2 Families With Lynch Syndrome: Two Case Reports and Review of Genotype-Phenotype Correlation. (United States)

    Liccardo, Raffaella; De Rosa, Marina; Duraturo, Francesca


    Lynch syndrome is an autosomal dominant syndrome that can be subdivided into Lynch syndrome I, or site-specific colonic cancer, and Lynch syndrome II, or extracolonic cancers, particularly carcinomas of the stomach, endometrium, biliary and pancreatic systems, and urinary tract. Lynch syndrome is associated with point mutations and large rearrangements in DNA MisMatch Repair ( MMR ) genes. This syndrome shows a variable phenotypic expression in people who carry pathogenetic mutations. So far, a correlation in genotype-phenotype has not been definitely established. In this study, we describe 2 Lynch syndrome cases presenting with the same genotype but different phenotypes and discuss possible reasons for this.

  19. Nevoid basal cell carcinoma syndrome (United States)

    NBCC syndrome; Gorlin-Goltz syndrome; Basal cell nevus syndrome; BCNS; Basal cell cancer - nevoid basal cell carcinoma syndrome ... Nevoid basal cell carcinoma nevus syndrome is a rare genetic ... syndrome is known as PTCH ("patched"). The gene is passed down ...

  20. Nucleocapsid gene analysis from an imported case of Middle East respiratory syndrome coronavirus, Malaysia

    Directory of Open Access Journals (Sweden)

    Nor-Aziyah Mat-Rahim


    Full Text Available Objective: To describe the complete nucleocapsid (N gene region of Middle East respiratory syndrome coronavirus (MERS-CoV from imported case in Malaysia and the relations with human- and camel-derived MERS-CoV. Methods: Combination of throat and nasal swab specimens was subjected to viral RNA extraction. For screening, the extracted RNA was subjected to real-time RT-PCR targeting upstream of E gene, open reading frame 1b and open reading frame 1a. For confirmation, the RNA was subjected to RT-PCR targeting partial part of the RNA-dependent RNA polymerase and nucleocapsid, followed by amplification of complete N gene region. Nucleotide sequencing of the first Malaysian case of MERS-CoV was performed following the confirmation with real-time RT-PCR detection. Results: Initial analysis of partial RNA-dependent RNA polymerase and N gene revealed that the nucleotides had high similarity to Jeddah_1_2013 strain. Analysis of complete N gene region (1 242 nucleotides from the case showed high similarity and yet distinct to the nucleotide sequences of camel-derived MERS-CoV. Conclusions: From the finding, there are possibilities that the patient acquired the infection from zoonotic transmission from dromedary camels.

  1. ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenchao; Wang, Hui; Zhang, Wei [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Lv, Ruijuan [Department of Emergency, Qilu Hospital of Shandong University, Jinan (China); Wang, Zhihao [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Geriatrics, Qilu Hospital of Shandong University, Jinan (China); Shang, Yuanyuan; Zhang, Yun; Zhong, Ming [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Chen, Yuguo; Tang, Mengxiong, E-mail: [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Emergency, Qilu Hospital of Shandong University, Jinan (China)


    Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients.

  2. Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development. (United States)

    Miller, Nichol L G; Wevrick, Rachel; Mellon, Pamela L


    Prader-Willi syndrome (PWS) is a complex genetic disorder characterized by hyperphagia, obesity and hypogonadotrophic hypogonadism, all highly suggestive of hypothalamic dysfunction. The NDN gene, encoding the MAGE family protein, necdin, maps to the PWS chromosome region and is highly expressed in mature hypothalamic neurons. Adult mice lacking necdin have reduced numbers of gonadotropin-releasing hormone (GnRH) neurons, but the mechanism for this reduction is unknown. Herein, we show that, although necdin is not expressed in an immature, migratory GnRH neuronal cell line (GN11), high levels are present in a mature GnRH neuronal cell line (GT1-7). Furthermore, overexpression of necdin activates GnRH transcription through cis elements bound by the homeodomain repressor Msx that are located in the enhancer and promoter of the GnRH gene, and knock-down of necdin expression reduces GnRH gene expression. In fact, overexpression of Necdin relieves Msx repression of GnRH transcription through these elements and necdin co-immunoprecipitates with Msx from GnRH neuronal cells, indicating that necdin may activate GnRH gene expression by preventing repression of GnRH gene expression by Msx. Finally, necdin is necessary for generation of the full complement of GnRH neurons during mouse development and extension of GnRH axons to the median eminence. Together, these results indicate that lack of necdin during development likely contributes to the hypogonadotrophic hypogonadal phenotype in individuals with PWS.

  3. Necdin, a Prader–Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development (United States)

    Miller, Nichol L.G.; Wevrick, Rachel; Mellon, Pamela L.


    Prader–Willi syndrome (PWS) is a complex genetic disorder characterized by hyperphagia, obesity and hypogonadotrophic hypogonadism, all highly suggestive of hypothalamic dysfunction. The NDN gene, encoding the MAGE family protein, necdin, maps to the PWS chromosome region and is highly expressed in mature hypothalamic neurons. Adult mice lacking necdin have reduced numbers of gonadotropin-releasing hormone (GnRH) neurons, but the mechanism for this reduction is unknown. Herein, we show that, although necdin is not expressed in an immature, migratory GnRH neuronal cell line (GN11), high levels are present in a mature GnRH neuronal cell line (GT1-7). Furthermore, overexpression of necdin activates GnRH transcription through cis elements bound by the homeodomain repressor Msx that are located in the enhancer and promoter of the GnRH gene, and knock-down of necdin expression reduces GnRH gene expression. In fact, overexpression of Necdin relieves Msx repression of GnRH transcription through these elements and necdin co-immunoprecipitates with Msx from GnRH neuronal cells, indicating that necdin may activate GnRH gene expression by preventing repression of GnRH gene expression by Msx. Finally, necdin is necessary for generation of the full complement of GnRH neurons during mouse development and extension of GnRH axons to the median eminence. Together, these results indicate that lack of necdin during development likely contributes to the hypogonadotrophic hypogonadal phenotype in individuals with PWS. PMID:18930956

  4. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi


    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  5. Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3. (United States)

    Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M


    Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

  6. Neurogenetics and gene therapy for reward deficiency syndrome: are we going to the Promised Land? (United States)

    Blum, Kenneth; Thanos, Peter K; Badgaiyan, Rajendra D; Febo, Marcelo; Oscar-Berman, Marlene; Fratantonio, James; Demotrovics, Zsolt; Gold, Mark S


    Addiction is a substantial health issue with limited treatment options approved by the FDA and as such currently available. The advent of neuroimaging techniques that link neurochemical and neurogenetic mechanisms to the reward circuitry brain function provides a framework for potential genomic-based therapies. Through candidate and genome-wide association studies approaches, many gene polymorphisms and clusters have been implicated in drug, food and behavioral dependence linked by the common rubric reward deficiency syndrome (RDS). The results of selective studies that include the role of epigenetics, noncoding micro RNAs in RDS behaviors especially drug abuse involving alcohol, opioids, cocaine, nicotine, pain and feeding are reviewed in this article. New targets for addiction treatment and relapse prevention, treatment alternatives such as gene therapy in animal models, and pharmacogenomics and nutrigenomics methods to manipulate transcription and gene expression are explored. The recognition of the clinical benefit of early genetic testing to determine addiction risk stratification and dopaminergic agonistic, rather than antagonistic therapies are potentially the genomic-based wave of the future. In addition, further development, especially in gene transfer work and viral vector identification, could make gene therapy for RDS a possibility in the future.

  7. Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

    Directory of Open Access Journals (Sweden)

    Marianna P.R. Porto


    Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

  8. ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

    International Nuclear Information System (INIS)

    Zhang, Wenchao; Wang, Hui; Zhang, Wei; Lv, Ruijuan; Wang, Zhihao; Shang, Yuanyuan; Zhang, Yun; Zhong, Ming; Chen, Yuguo; Tang, Mengxiong


    Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients

  9. Sterol regulatory element binding protein-1 (SREBP1) gene expression is similarly increased in polycystic ovary syndrome and endometrial cancer. (United States)

    Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William


    Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory element

  10. Differential allelic expression of a fibrillin gene (FBNI) in patients with Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Hewett, D.; Lynch, J.; Sykes, B. [Univ. of Oxford (United Kingdom); Firth, H. [Churchill Hospital, Oxford (United Kingdom); Child, A. [St. George`s Hospital Medical School, London (United Kingdom)


    Marfan syndrome is a connective-tissue disorder affecting cardiovascular, skeletal, and ocular systems. The major Marfan locus has been identified as the FBN1 gene on chromosome 15; this codes for the extracellular-matrix protein fibrillin, a 350-kD constituent of the 8-10-nm elastin-associated microfibrils. The authors identified five MFS patients who were heterozygous for an RsaI restriction-site dimorphism in the 3{prime} UTR of the FBN1 gene. This expressed variation was used to distinguish the mRNA output from each of the two FBN1 alleles in fibroblast cultures from these five patients. Three of the patients were shown to produce <5% of the normal level of FBN1 transcripts from one of their alleles. This null-allele phenotype was not observed in 10 nonmarfanoid fibroblast cell lines. 26 refs., 4 figs.

  11. VPA alleviates neurological deficits and restores gene expression in a mouse model of Rett syndrome.

    Directory of Open Access Journals (Sweden)

    Weixiang Guo

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that occurs once in every 10,000-15,000 live female births. Despite intensive research, no effective cure is yet available. Valproic acid (VPA has been used widely to treat mood disorder, epilepsy, and a growing number of other disorders. In limited clinical studies, VPA has also been used to control seizure in RTT patients with promising albeit somewhat unclear efficacy. In this study we tested the effect of VPA on the neurological symptoms of RTT and discovered that short-term VPA treatment during the symptomatic period could reduce neurological symptoms in RTT mice. We found that VPA restores the expression of a subset of genes in RTT mouse brains, and these genes clustered in neurological disease and developmental disorder networks. Our data suggest that VPA could be used as a drug to alleviate RTT symptoms.

  12. 657del5 mutation of the NBS1 gene in myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    Bunjevacki Vera


    Full Text Available Myelodysplastic syndromes (MDS are clonal hematologic stem cell disorders with an as yet unknown molecular pathology. Genetic instability has been proposed as a cause of MDS. Mutations in the NBS1 gene, whose product nibrin (p95 is involved in DNA damage repair and cell-cycle control, might be associated with an elevated predisposition to the development of MDS. The aim of the study was to examine truncating 5 bp deletion (657del5, the most frequent NBS1 gene mutation in Slavic populations, in MDS patients. Among 71 MDS patients, we found one case that was heterozygous for the NBS1 657del5 mutation. To the best of our knowledge, this is the first report of a NBS1 mutation in MDS. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  13. Recombinase Activating Gene 1 Deficiencies Without Omenn Syndrome May Also Present With Eosinophilia and Bone Marrow Fibrosis


    Ulusoy, Ezgi; Karaca, Neslihan Edeer; Azarsiz, Elif; Berdeli, Afig; Aksu, Guzide; Kutukculer, Necil


    Background Severe combined immunodeficiency (SCID) syndromes are a heterogenous group of diseases characterized by impairment in both cellular and humoral immunity with a range of genetic disorders. Complete recombinase activating gene (RAG) deficiency is associated with classical T-B-NK+ SCID which is the most common phenotype of Turkish SCID patients. There is a broad spectrum of hypomorfic RAG mutations including Omenn syndrome, leaky or atypical SCID with expansion of ?? T cells, autoimmu...

  14. Concomitant mutation and epimutation of the MLH1 gene in a Lynch syndrome family. (United States)

    Cini, Giulia; Carnevali, Ileana; Quaia, Michele; Chiaravalli, Anna Maria; Sala, Paola; Giacomini, Elisa; Maestro, Roberta; Tibiletti, Maria Grazia; Viel, Alessandra


    Lynch syndrome (LS) is an inherited predisposition cancer syndrome, typically caused by germline mutations in the mismatch repair genes MLH1, MSH2, MSH6 and PMS2. In the last years, a role for epimutations of the same genes has also been reported. MLH1 promoter methylation is a well known mechanism of somatic inactivation in tumors, and more recently, several cases of constitutional methylation have been identified. In four subjects affected by multiple tumors and belonging to a suspected LS family, we detected a novel secondary MLH1 gene epimutation. The methylation of MLH1 promoter was always linked in cis with a 997 bp-deletion (c.-168_c.116+713del), that removed exon 1 and partially involved the promoter of the same gene. Differently from cases with constitutional primary MLH1 inactivation, this secondary methylation was allele-specific and CpGs of the residual promoter region were totally methylated, leading to complete allele silencing. In the colon tumor of the proband, MLH1 and PMS2 expression was completely lost as a consequence of a pathogenic somatic point mutation (MLH1 c.199G>A, p.Gly67Arg) that also abrogated local methylation by destroying a CpG site. The evidences obtained highlight how MLH1 mutations and epimutations can reciprocally influence each other and suggest that an altered structure of the MLH1 locus results in epigenetic alteration. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  15. Investigation of the Matrix Metalloproteinase-2 Gene in Patients with Non-Syndromic Mitral Valve Prolapse

    Directory of Open Access Journals (Sweden)

    Maëlle Perrocheau


    Full Text Available Non-syndromic mitral valve prolapse (MVP is a common degenerative valvulopathy, predisposing to arrhythmia and sudden death. The etiology of MVP is suspected to be under genetic control, as supported by familial cases and its manifestation in genetic syndrome (e.g., Marfan syndrome. One candidate etiological mechanism is a perturbation of the extracellular matrix (ECM remodeling of the valve. To test this hypothesis, we assessed the role of genetic variants in the matrix metalloproteinase 2 gene (MMP2 known to regulate the ECM turnover by direct degradation of proteins and for which transgenic mice develop MVP. Direct sequencing of exons of MMP2 in 47 unrelated patients and segregation analyses in families did not reveal any causative mutation. We studied eight common single nucleotide polymorphisms (TagSNPs, which summarize the genetic information at the MMP2 locus. The association study in two case controls sets (NCases = 1073 and NControls = 1635 provided suggestive evidence for the association of rs1556888 located downstream MMP2 with the risk of MVP, especially in patients with the fibroelastic defiency form. Our study does not support the contribution of MMP2 rare variation in the etiology to MVP in humans, though further genetic and molecular investigation is required to confirm our current suggestive association of one common variant.

  16. De novo dominant mutation of SOX10 gene in a Chinese family with Waardenburg syndrome type II. (United States)

    Chen, Kaitian; Zong, Ling; Liu, Min; Zhan, Yuan; Wu, Xuan; Zou, Wenting; Jiang, Hongyan


    Waardenburg syndrome is a rare genetic disorder, inherited as an autosomal dominant trait. The condition is characterized by sensorineural hearing loss and pigment disturbances of the hair, skin, and iris. The de novo mutation in the SOX10 gene, responsible for Waardenburg syndrome type II, is rarely seen. The present study aimed to identify the genetic causes of Waardenburg syndrome type II in a Chinese family. Clinical and molecular evaluations were conducted in a Chinese family with Waardenburg syndrome type II. A novel SOX10 heterozygous c.259-260delCT mutation was identified. Heterozygosity was not observed in the parents and sister of the proband, indicating that the mutation has arisen de novo. The novel frameshift mutation, located in exon 3 of the SOX10 gene, disrupted normal amino acid coding from Leu87, leading to premature termination at nucleotide 396 (TGA). The high mobility group domain of SOX10 was inferred to be partially impaired. The novel heterozygous c.259-260delCT mutation in the SOX10 gene was considered to be the cause of Waardenburg syndrome in the proband. The clinical and genetic characterization of this family would help elucidate the genetic heterogeneity of SOX10 in Waardenburg syndrome type II. Moreover, the de novo pattern expanded the mutation data of SOX10. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. Otitis Media in a New Mouse Model for CHARGE Syndrome with a Deletion in the Chd7 Gene (United States)

    Tian, Cong; Yu, Heping; Yang, Bin; Han, Fengchan; Zheng, Ye; Bartels, Cynthia F.; Schelling, Deborah; Arnold, James E.; Scacheri, Peter C.; Zheng, Qing Yin


    Otitis media is a middle ear disease common in children under three years old. Otitis media can occur in normal individuals with no other symptoms or syndromes, but it is often seen in individuals clinically diagnosed with genetic diseases such as CHARGE syndrome, a complex genetic disease caused by mutation in the Chd7 gene and characterized by multiple birth defects. Although otitis media is common in human CHARGE syndrome patients, it has not been reported in mouse models of CHARGE syndrome. In this study, we report a mouse model with a spontaneous deletion mutation in the Chd7 gene and with chronic otitis media of early onset age accompanied by hearing loss. These mice also exhibit morphological alteration in the Eustachian tubes, dysregulation of epithelial proliferation, and decreased density of middle ear cilia. Gene expression profiling revealed up-regulation of Muc5ac, Muc5b and Tgf-β1 transcripts, the products of which are involved in mucin production and TGF pathway regulation. This is the first mouse model of CHARGE syndrome reported to show otitis media with effusion and it will be valuable for studying the etiology of otitis media and other symptoms in CHARGE syndrome. PMID:22539951

  18. Genetic mapping of the gene for Usher syndrome: Linkage analysis in a large Samaritan kindred

    Energy Technology Data Exchange (ETDEWEB)

    Bonne-Tamir, B.; Korostishevsky, M.; Kalinsky, H.; Seroussi, E.; Beker, R.; Weiss, S. (Sackler Faculty of Medicine, Ramat-Aviv (Israel)); Godel, V. (Ichilov Hospital, Tel-Aviv (Israel))


    Usher syndrome is a group of autosomal recessive disorders associated with congenital sensorineural deafness and progressive visual loss due to retinitis pigmentosa. Sixteen members of the small inbred Samaritan isolate with autosomal recessive deafness from 59 individuals including parents and affected and nonaffected sibs were typed for markers on chromosomes 1q and 11q for which linkage has recently been established for Usher syndrome types II and I. Statistically significant linkage was observed with four markers on 11q (D11S533, D11S527, OMP, and INT2) with a maximum six-point location score of 11.61 at the D11S533 locus. Analysis of haplotypes supports the notion that the mutation arose only once in an ancestral chromosome carrying a specific haplotype. The availability of markers closely linked to the disease locus allows indirect genotype analysis and identifies all carriers of the gene within the community. Furthermore, the detection of complete linkage disequilibrium between the D11S533 marker and the Usher gene suggests that these loci are either identical or adjacent and narrows the critical region to which physical mapping efforts are currently directed. 35 refs., 2 figs., 6 tabs.

  19. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias


    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  20. Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Chia-Sui Hung


    Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

  1. Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly. (United States)

    Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm


    Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.

  2. Spectrum of mismatch repair gene mutations and clinical presentation of Hispanic individuals with Lynch syndrome. (United States)

    Sunga, Annette Y; Ricker, Charité; Espenschied, Carin R; Castillo, Danielle; Melas, Marilena; Herzog, Josef; Bannon, Sarah; Cruz-Correa, Marcia; Lynch, Patrick; Solomon, Ilana; Gruber, Stephen B; Weitzel, Jeffrey N


    Lynch syndrome (LS), the most common hereditary colorectal cancer syndrome, is caused by mismatch repair (MMR) gene mutations. However, data about MMR mutations in Hispanics are limited. This study aims to describe the spectrum of MMR mutations in Hispanics with LS and explore ancestral origins. This case series involved an IRB-approved retrospective chart review of self-identified Hispanic patients (n = 397) seen for genetic cancer risk assessment at four collaborating academic institutions in California, Texas, and Puerto Rico who were evaluated by MMR genotyping and/or tumor analysis. A literature review was conducted for all mutations identified. Of those who underwent clinical genetic testing (n = 176), 71 had MMR gene mutations. Nine mutations were observed more than once. One third (3/9) of recurrent mutations and two additional mutations (seen only once) were previously reported in Spain, confirming the influence of Spanish ancestry on MMR mutations in Hispanic populations. The recurrent mutations identified (n = 9) included both previously reported mutations as well as unique mutations not in the literature. This is the largest report of Hispanic MMR mutations in North America; however, a larger sample and haplotype analyses are needed to better understand recurrent MMR mutations in Hispanic populations. Copyright © 2017. Published by Elsevier Inc.

  3. Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees. (United States)

    Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi


    Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

  4. Genetic mapping of the gene for Usher syndrome: linkage analysis in a large Samaritan kindred. (United States)

    Bonné-Tamir, B; Korostishevsky, M; Kalinsky, H; Seroussi, E; Beker, R; Weiss, S; Godel, V


    Usher syndrome is a group of autosomal recessive disorders associated with congenital sensorineural deafness and progressive visual loss due to retinitis pigmentosa. Sixteen members of the small inbred Samaritan isolate with autosomal recessive deafness were studied in 10 related sibships. DNA samples from 59 individuals including parents and affected and nonaffected sibs were typed for markers on chromosomes 1q and 11q for which linkage has recently been established for Usher syndrome types II and I. Statistically significant linkage was observed with four markers on 11q (D11S533, D11S527, OMP, and INT2) with a maximum six-point location score of 11.61 at the D11S533 locus. Analysis of haplotypes supports the notion that the mutation arose only once in an ancestral chromosome carrying a specific haplotype. The availability of markers closely linked to the disease locus allows indirect genotype analysis and identifies all carriers of the gene within the community. Furthermore, the detection of complete linkage disequilibrium between the D11S533 marker and the Usher gene suggests that these loci are either identical or adjacent and narrows the critical region to which physical mapping efforts are currently directed.

  5. Nelson`s syndrome associated with a somatic frame shift mutation in the glucocorticoid recepter gene

    Energy Technology Data Exchange (ETDEWEB)

    Karl, M.; Stratakis, C.A.; Chrousos, G.P.; Katz, D.A.; Ali, I.U.; Oldfield, E.H. [National Inst. of Neurological Disorders and Stroke, Bethesda, MD (United States)] [and others


    Nelson`s syndrome is the appearance and/or progression of ACTH-secreting pituitary macroadenomas in patients who had previously undergone bilateral adrenalectomy for Cushing`s disease. Extremely high plasma ACTH levels and aggressive neoplastic growth might be explained by the lack of appropriate glucocorticoid negative feedback due to defective glucocorticoid signal transduction. To study the glucocorticoid receptor (GR) gene in Nelson`s syndrome, DNA was extracted from pituitary adenomas and leukocytes of four patients with this condition and amplified by PCR for direct sequence analysis. In one of the tumors, a heterozygous mutation, consisting of an insertion of a thymine between complementary DNA nucleotides 1188 and 1189, was found in exon 2. This frame-shift mutation led to premature termination at amino acid residue 366 of the world-type coding sequence, excluding the expression of a functioning receptor protein from the defective allele. The mutation was not detected in the sequence of the GR gene in the patient`s leukocyte DNA, indicating a somatic origin. By lowering the receptor number in tumorous cells, this defect might have caused local resistance to negative glucocorticoid feedback similar to that caused by the presence of a null allele in a kindred with the generalized glucocorticoid resistance syndrome. P53 protein accumulation, previously reported in 60% of corticotropinomas, could not be detected in any of the four pituitary tumors examined by immunohistochemistry. We suggest that a somatic GR defect might have played a pathophysiological role in the tumorigenesis of the corticotropinoma bearing this mutation. 35 refs., 3 figs., 1 tab.

  6. Cholesterol Transporters ABCA1 and ABCG1 Gene Expression in Peripheral Blood Mononuclear Cells in Patients with Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Zahra Tavoosi


    Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.

  7. MASA syndrome is caused by mutations in the neural cell adhesion gene, L1CAM

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, C.E.; Wang, Y.; Schroer, R.J.; Stevenson, R.E. [Greenwood Genetic Center, SC (United States)


    The MASA syndrome is a recessive X-linked disorder characterized by Mental retardation, Adducted thumbs, Shuffling gait and Aphasia. Recently we found that MASA in one family was likely caused by a point mutation in exon 6 of the L1CAM gene. This gene has also been shown to be involved in X-linked hydrocephalus (HSAS). We have screened 60 patients with either sporadic HSAS or MASA as well as two additional families with MASA. For the screening, we initially utilized 3 cDNA probes for the L1CAM gene. In one of the MASA families, K8310, two affected males were found to have an altered BglII band. The band was present in their carrier mother but not in their normal brothers. This band was detected by the entire cDNA probe as well as the cDNA probe for 3{prime} end of the gene. Analysis of the L1CAM sequence indicated the altered BglII site is distal to the exon 28 but proximal to the punative poly A signal site. It is hypothesized that this point mutation alters the stability of the L1CAM mRNA. This is being tested using cell lines established from the two affected males.

  8. Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene. (United States)

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore


    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.

  9. MSX ₁ gene variant and non-syndromic clefting: association or rejection? (United States)

    Reddy, Naveen Admala; Gopinath, Adusumilli; Reddy, Jayaprakash Thirumala; Devanna, Raghu; Saravanan, Pichai; Rohra, Mayur G


    Non-syndromic cleft lip/palate (NSCL/P) is a congenital anomaly with significant medical, psychological and social ramifications. There is sufficient evidence to hypothesize that locus for this condition can be identified by candidate genes. The aim of this study is to amplify the chosen region (799 G >T) of MSX 1 gene, investigate the degree of association and perform a mutation research from Raichur cleft lip and palate patient sample. Case history and clinical examination of the patient were recorded to rule. Written consent was obtained from patients and controls for in vivo study. STUDY WAS DESIGNED IN FOUR STEPS AS FOLLOWS: a. Collection of a blood sample; b. Genomic deoxyribonucleic acid (DNA) extraction; c. Polymerase chain reaction (PCR); d. Restriction fragment length polymorphism (RFLP). Blood samples were collected from 50 subjects having NSCL/P and 50 controls. Genomic DNA was extracted, PCR and RFLP was performed for digestion products that were evaluated. Chi-square test with P value at 95% confidence intervals. The results showed a positive correlation between MSX 1 799 G >T gene variant and NSCL/P patients in Raichur patients. From a genetically diverse etiology MSX 1 799 G >T gene variant may be a good screening marker for NSCL/P in Raichur patients.

  10. Insulin gene polymorphisms in type 1 diabetes, Addison's disease and the polyglandular autoimmune syndrome type II

    Directory of Open Access Journals (Sweden)

    Hahner Stefanie


    Full Text Available Abstract Background Polymorphisms within the insulin gene can influence insulin expression in the pancreas and especially in the thymus, where self-antigens are processed, shaping the T cell repertoire into selftolerance, a process that protects from β-cell autoimmunity. Methods We investigated the role of the -2221Msp(C/T and -23HphI(A/T polymorphisms within the insulin gene in patients with a monoglandular autoimmune endocrine disease [patients with isolated type 1 diabetes (T1D, n = 317, Addison's disease (AD, n = 107 or Hashimoto's thyroiditis (HT, n = 61], those with a polyglandular autoimmune syndrome type II (combination of T1D and/or AD with HT or GD, n = 62 as well as in healthy controls (HC, n = 275. Results T1D patients carried significantly more often the homozygous genotype "CC" -2221Msp(C/T and "AA" -23HphI(A/T polymorphisms than the HC (78.5% vs. 66.2%, p = 0.0027 and 75.4% vs. 52.4%, p = 3.7 × 10-8, respectively. The distribution of insulin gene polymorphisms did not show significant differences between patients with AD, HT, or APS-II and HC. Conclusion We demonstrate that the allele "C" of the -2221Msp(C/T and "A" -23HphI(A/T insulin gene polymorphisms confer susceptibility to T1D but not to isolated AD, HT or as a part of the APS-II.

  11. Safe and Effective Gene Therapy for Murine Wiskott-Aldrich Syndrome Using an Insulated Lentiviral Vector

    Directory of Open Access Journals (Sweden)

    Swati Singh


    Full Text Available Wiskott-Aldrich syndrome (WAS is a life-threatening immunodeficiency caused by mutations within the WAS gene. Viral gene therapy to restore WAS protein (WASp expression in hematopoietic cells of patients with WAS has the potential to improve outcomes relative to the current standard of care, allogeneic bone marrow transplantation. However, the development of viral vectors that are both safe and effective has been problematic. While use of viral transcriptional promoters may increase the risk of insertional mutagenesis, cellular promoters may not achieve WASp expression levels necessary for optimal therapeutic effect. Here we evaluate a self-inactivating (SIN lentiviral vector combining a chromatin insulator upstream of a viral MND (MPSV LTR, NCR deleted, dl587 PBS promoter driving WASp expression. Used as a gene therapeutic in Was−/− mice, this vector resulted in stable WASp+ cells in all hematopoietic lineages and rescue of T and B cell defects with a low number of viral integrations per cell, without evidence of insertional mutagenesis in serial bone marrow transplants. In a gene transfer experiment in non-human primates, the insulated MND promoter (driving GFP expression demonstrated long-term polyclonal engraftment of GFP+ cells. These observations demonstrate that the insulated MND promoter safely and efficiently reconstitutes clinically effective WASp expression and should be considered for future WAS therapy.

  12. Gene expression in response to exercise in patients with chronic fatigue syndrome: a pilot study.

    Directory of Open Access Journals (Sweden)

    Andrew Keech


    Full Text Available Chronic fatigue syndrome (CFS is a debilitating disorder of unknown pathogenesis, characterised by fatigue, which is exacerbated after minimal exercise. We examined the effect of a single bout of aerobic exercise on leucocyte mRNA expression of genes putatively linked to exaggerated afferent signalling as an under-pinning of the fatigue state. A carefully-characterised sample of patients with CFS (N = 10 and healthy matched control participants (N = 12 were included. Participant ratings of fatigue and other symptoms, as well as blood samples, were obtained at baseline, and five other time-points up to 72 hours after 25 minutes of moderate-intensity cycling exercise. Leucocyte mRNA of 19 metabolite-sensing, adrenergic, immune and neurotransmission genes was examined using quantitative polymerase chain reaction. Patients with CFS reported substantial fatigue, functional impairment and poor sleep at baseline (all p < 0.02, and exercise immediately induced worsened patients’ fatigue (effect size, ES = 1.17. There were no significant changes in gene expression after exercise and patients did not differ from control participants at any time point. Higher levels of expression of ficolin (FCN1 and a purinergic receptor (P2RX4 in patients with CFS were found when all time points were combined. Patients with CFS did not show significant exercise-induced changes in leucocyte mRNA of 19 metabolite-sensing, adrenergic, immune and neurotransmission genes despite a prominent exacerbation of fatigue.

  13. Catecholamine-related gene expression in blood correlates with tic severity in tourette syndrome. (United States)

    Gunther, Joan; Tian, Yingfang; Stamova, Boryana; Lit, Lisa; Corbett, Blythe; Ander, Brad; Zhan, Xinhua; Jickling, Glen; Bos-Veneman, Netty; Liu, Da; Hoekstra, Pieter; Sharp, Frank


    Tourette syndrome (TS) is a heritable disorder characterized by tics that are decreased in some patients by treatment with alpha adrenergic agonists and dopamine receptor blockers. Thus, this study examines the relationship between catecholamine gene expression in blood and tic severity. TS diagnosis was confirmed using Diagnostic and Statistical Manual of Mental Disorders (DSM)-IV criteria and tic severity measured using the Yale Global Tic Severity Scale (YGTSS) for 26 un-medicated subjects with TS. Whole blood was collected and Ribonucleic acid (RNA) processed on Affymetrix Human Exon 1.0 ST arrays. An Analysis of Covariance (ANCOVA) identified 3627 genes correlated with tic severity (pdisorders, Attention Deficit Hyperactivity Disorder (ADHD), and Obsessive-Compulsive Disorder (OCD). Correlation of gene expression in peripheral blood with tic severity may allow inferences about catecholamine pathway dysfunction in TS subjects. Findings built on previous work suggest that at least some genes expressed peripherally are relevant for central nervous system (CNS) pathology in the brain of individuals with TS. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  14. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome]. (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan


    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  15. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen


    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  16. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)



    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  17. Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome. (United States)

    Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed


    Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

  18. Gitelman or Bartter type 3 syndrome? A case of distal convoluted tubulopathy caused by CLCNKB gene mutation. (United States)

    Cruz, António José; Castro, Alexandra


    A 32-year-old woman with no significant medical history was sent to our consultation due to hypokalaemia (syndrome (GS) came negative. CLCNKB gene mutation analysis present in both GS and Bartter (BS) type 3 syndromes was positive. The patient is now being treated with potassium and magnesium oral supplements, ramipril and spironolactone with stable near-normal potassium and magnesium levels. This article presents the case of a patient with hypokalaemia caused by CLCNKB gene mutation hard to categorise as GS or BS type 3.

  19. Prenatal diagnosis of the fragile X syndrome : loss of mutation owing to a double recombinant or gene conversion event at the FMR1 locus

    NARCIS (Netherlands)

    Losekoot, M; Hoogendoorn, E; Olmer, R; Jansen, CCAM; Oosterwijk, JC; vandenOuweland, AMW; Halley, DJJ; Warren, ST; Willemsen, R; Oostra, BA; Bakker, E


    The fragile X syndrome, an X linked mental retardation syndrome, is caused by an expanded CGG repeat in the first exon of the FMR1 gene. In patients with an expanded repeat the FMR1 promoter is methylated and, consequently, the gene is silenced and no FMR1 protein (FMRP) is produced, thus leading to

  20. Nephrogenic diabetes insipidus in a patient with L1 syndrome: a new report of a contiguous gene deletion syndrome including L1CAM and AVPR2. (United States)

    Knops, Noël B B; Bos, Krista K; Kerstjens, Mieke; van Dael, Karin; Vos, Yvonne J


    We report on an infant boy with congenital hydrocephalus due to L1 syndrome and polyuria due to diabetes insipidus. We initially believed his excessive urine loss was from central diabetes insipidus and that the cerebral malformation caused a secondary insufficient pituitary vasopressin release. However, he failed to respond to treatment with a vasopressin analogue, which pointed to nephrogenic diabetes insipidus (NDI). L1 syndrome and X-linked NDI are distinct clinical disorders caused by mutations in the L1CAM and AVPR2 genes, respectively, located in adjacent positions in Xq28. In this boy we found a deletion of 61,577 basepairs encompassing the entire L1CAM and AVPR2 genes and extending into intron 7 of the ARHGAP4 gene. To our knowledge this is the first description of a patient with a deletion of these three genes. He is the second patient to be described with L1 syndrome and NDI. During follow-up he manifested complications from the hydrocephalus and NDI including global developmental delay and growth failure with low IGF-1 and hypothyroidism. 2008 Wiley-Liss, Inc.

  1. Pendred syndrome (goitre and sensorineural hearing loss) maps to chromosome 7 in the region containing the nonsyndromic deafness gene DFNB4. (United States)

    Coyle, B; Coffey, R; Armour, J A; Gausden, E; Hochberg, Z; Grossman, A; Britton, K; Pembrey, M; Reardon, W; Trembath, R


    Inherited causes account for about 50% of individuals presenting with childhood (prelingual) hearing loss, of which 70% are due to mutation in numerous single genes which impair auditory function alone (non-syndromic). The remainder are associated with other developmental anomalies termed syndromic deafness. Genes responsible for syndromic forms of hearing loss include the COL4A5 gene in Alport syndrome and the PAX3 and MITF genes in Waardenburg syndrome. Pendred syndrome is an autosomal recessive disorder associated with developmental abnormalities of the cochlea, sensorineural hearing loss and diffuse thyroid enlargement (goitre). Pendred syndrome is the most common syndromal form of deafness, yet the primary defect remains unknown. We have established a panel of 12 families with two or more affected individuals and used them to search for the location of the Pendred gene by linkage analysis. We excluded localization to four previously mapped nonsyndromic deafness loci but obtained conclusive evidence for linkage of the Pendred syndrome gene to microsatellite markers on chromosome 7q31 (D7S495 Zmax 7.32, Qmax = 0). This region contains a gene, DFNBL, for autosomal recessive non-syndromic sensorineural hearing loss. Multipoint analysis indicates that DFNB4 and Pendred syndrome co-localize to the same 5.5 centiMorgan (cM) interval flanked by D7S501 and D7S523. These data raise the possibility that Pendred syndrome is either allelic with DFNB4 or may represent an inherited contiguous gene disorder, not clinically manifest in the heterozygote.

  2. A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report. (United States)

    Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua


    Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.

  3. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  4. 15 years of research on Oral-Facial-Digital syndromes: from 1 to 16 causal genes (United States)

    Bruel, Ange-Line; Franco, Brunella; Duffourd, Yannis; Thevenon, Julien; Jego, Laurence; Lopez, Estelle; Deleuze, Jean-François; Doummar, Diane; Giles, Rachel H.; Johnson, Colin A.; Huynen, Martijn A.; Chevrier, Véronique; Burglen, Lydie; Morleo, Manuela; Desguerres, Isabelle; Pierquin, Geneviève; Doray, Bérénice; Gilbert-Dussardier, Brigitte; Reversade, Bruno; Steichen-Gersdorf, Elisabeth; Baumann, Clarisse; Panigrahi, Inusha; Fargeot-Espaliat, Anne; Dieux, Anne; David, Albert; Goldenberg, Alice; Bongers, Ernie; Gaillard, Dominique; Argente, Jesús; Aral, Bernard; Gigot, Nadège; St-Onge, Judith; Birnbaum, Daniel; Phadke, Shubha R.; Cormier-Daire, Valérie; Eguether, Thibaut; Pazour, Gregory J.; Herranz-Pérez, Vicente; Lee, Jaclyn S.; Pasquier, Laurent; Loget, Philippe; Saunier, Sophie; Mégarbané, André; Rosnet, Olivier; Leroux, Michel R.; Wallingford, John B.; Blacque, Oliver E.; Nachury, Maxence V.; Attie-Bitach, Tania; Rivière, Jean-Baptiste; Faivre, Laurence; Thauvin-Robinet, Christel


    Oral-facial-digital syndromes (OFDS) gather rare genetic disorders characterized by facial, oral and digital abnormalities associated with a wide range of additional features (polycystic kidney disease, cerebral malformations and several others) to delineate a growing list of OFD subtypes. The most frequent, OFD type I, is caused by a heterozygous mutation in the OFD1 gene encoding a centrosomal protein. The wide clinical heterogeneity of OFDS suggests the involvement of other ciliary genes. For 15 years, we have aimed to identify the molecular bases of OFDS. This effort has been greatly helped by the recent development of whole exome sequencing (WES). Here, we present all our published and unpublished results for WES in 24 OFDS cases. We identified causal variants in five new genes (C2CD3, TMEM107, INTU, KIAA0753, IFT57) and related the clinical spectrum of four genes in other ciliopathies (C5orf42, TMEM138, TMEM231, WDPCP) to OFDS. Mutations were also detected in two genes previously implicated in OFDS. Functional studies revealed the involvement of centriole elongation, transition zone and intraflagellar transport defects in OFDS, thus characterizing three ciliary protein modules: the complex KIAA0753-FOPNL-OFD1, a regulator of centriole elongation; the MKS module, a major component of the transition zone; and the CPLANE complex necessary for IFT-A assembly. OFDS now appear to be a distinct subgroup of ciliopathies with wide heterogeneity, which makes the initial classification obsolete. A clinical classification restricted to the three frequent/well-delineated subtypes could be proposed, and for patients who do not fit one of these 3 main subtypes, a further classification could be based on the genotype. PMID:28289185

  5. Adiponectin gene polymorphism is selectively associated with the concomitant presence of metabolic syndrome and essential hypertension.

    Directory of Open Access Journals (Sweden)

    Hsin-Bang Leu

    Full Text Available OBJECTIVE: Cardiovascular risk increases with the presence of both metabolic syndrome (MetS and hypertension (HTN. Although the adiponectin (ADIPOQ gene has been reported to be involved in MetS, its association with HTN remained undetermined. This study aimed to investigate the association of ADIPOQ gene with the phenotypes of HTN and MetS. METHODS: A total of 962 participants from 302 families from the Taiwan young-onset hypertension genetic study were enrolled. Plasma adiponectin were measured, and association analysis was conducted by using GEE regression-based method. Another study, of 1448 unrelated participants, was conducted to replicate the association between ADIPOQ gene and variable phenotypes of MetS with or without HTN. RESULTS: Among 962 subjects from family samples, the lowest plasma adiponectin value was observed in MetS with HTN component (9.3±0.47 µg/ml compared with hypertensives (13.4±0.74 µg /ml or MetS without HTN (11.9±0.60 µg/ml, P<0.05. The SNP rs1501299 (G276T in ADIPOQ gene was found associated with the presence of HTN in MetS (odds ratio for GG+GT vs. TT = 2.46; 95% CI: 1.14-5.3, p = 0.02, but not rs2241766 (T45G. No association of ADIPOQ gene with HTN alone or MetS without HTN was observed. The significant association of the SNP rs1501299 (G276T with the phenotype of presence of HTN in MetS was confirmed (odds ratio for GG+GT vs. TT = 2.15; 95% CI: 1.1-4.3 in the replication study. CONCLUSIONS: ADIPOQ genetic variants were selectively and specifically associated with the concomitant presence of MetS and HTN, suggesting potential genetic linkage between MetS and HTN.

  6. Genetic alterations within the DENND1A gene in patients with polycystic ovary syndrome (PCOS.

    Directory of Open Access Journals (Sweden)

    Mette B Eriksen

    Full Text Available Polycystic ovary syndrome (PCOS, the most common endocrine disease among premenopausal women, is caused by both genes and environment. We and others previously reported association between single nucleotide polymorphisms (SNPs in the DENND1A gene and PCOS. We therefore sequenced the DENND1A gene in white patients with PCOS to identify possible alterations that may be implicated in the PCOS pathogenesis. Patients were referred with PCOS and/or hirsutism between 1998 and 2011 (n = 261. PCOS was diagnosed according to the Rotterdam criteria (n = 165. Sequence analysis was performed in 10 patients with PCOS. Additional patients (n = 251 and healthy female controls (n = 248 were included for SNP genotyping. Patients underwent clinical examination including Ferriman-Gallwey score (FG-score, biochemical analyses and transvaginal ultrasound. Mutation analysis was carried out by bidirectional sequencing. SNP genotyping was tested by allelic discrimination in real-time PCR in the additional patients and controls. Sequencing of the DENND1A gene identified eight SNPs; seven were not known to be associated with any diseases. One missense SNP was detected (rs189947178, A/C, potentially altering the structural conformation of the DENND1A protein. SNP genotyping of rs189947178 showed significantly more carriers among patients with PCOS and moderate hirsutism compared to controls. However, due to small sample size and lack of multiple regression analysis supporting an association between rs189947178 and FG-score or PCOS diagnosis, this could be a false positive finding. In conclusion, sequence analysis of the DENND1A gene of patients with PCOS did not identify alterations that alone could be responsible for the PCOS pathogenesis, but a missense SNP (rs189947178 was identified in one patient and significantly more carriers of rs189947178 were found among patients with PCOS and moderate hirsutism vs. controls. Additional studies with independent cohort are needed

  7. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H


    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  8. Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome previously diagnosed as Seckel syndrome: report of a novel mutation of the PCNT gene. (United States)

    Piane, Maria; Della Monica, Matteo; Piatelli, Gianluca; Lulli, Patrizia; Lonardo, Fortunato; Chessa, Luciana; Scarano, Gioacchino


    We report on a 3-year-old boy with prenatal onset of proportionate dwarfism, postnatal severe microcephaly, high forehead with receded hairline, sparse scalp hair, beaked nose, mild retrognathia and hypotonia diagnosed at birth as Seckel syndrome. At age 3 years, he became paralyzed due to a cerebrovascular malformation. Based on the clinical and radiological features showing evidence of skeletal dysplasia, the diagnosis was revised to Majewski osteodysplastic primordial dwarfism type II (MOPD II) syndrome. Western blot analysis of the patient's lymphoblastoid cell line lysate showed the absence of the protein pericentrin. Subsequent molecular analysis identified a novel homozygous single base insertion (c.1527_1528insA) in exon 10 of the PCNT gene, which leads to a frameshift (Treo510fs) and to premature protein truncation. PCNT mutations must be considered diagnostic of MOPD II syndrome. A possible role of pericentrin in the development of cerebral vessels is suggested. Copyright 2009 Wiley-Liss, Inc.

  9. Methylenetetrahydrofolate reductase C677T gene polymorphism in Turkish patients with polycystic ovary syndrome. (United States)

    Karadeniz, Muammer; Erdogan, Mehmet; Zengi, Ayhan; Eroglu, Zuhal; Tamsel, Sadik; Olukman, Murat; Saygili, Fusun; Yilmaz, Candeger


    Higher Levels of Hcy are associated with several clinical conditions, among them non-insulin-dependent diabetes mellitus, endometrial dysplasia and hypertension with insulin resistance, and polycystic ovary syndrome. The purpose of this study was to investigate the serum homocystein levels and other metabolic parameters in relationship with the MTHFR C677T gene polymorphism in patients with PCOS. Our study included 86 young women with PCOS constituting the study group and 70 healthy women constituting the control group. Homocystein levels, metabolic, and hormonal parameters were measured, and genetic analysis of the MTHFR C677T gene polymorphism was performed in all the subjects. A statistically significant difference was observed in mean homocystein levels between patients with PCOS when compared to the control group. The MTHFR 677 CC genotypes had significantly higher proportions in the control group compared to the PCOS patients (χ(2) = 21.381, P homocystein levels were higher than normal subjects in patients with PCOS and that the MTHFR C677T gene polymorphism does not influence homocystein levels of patients with PCOS.

  10. Interferons in Sjögren’s syndrome: genes, mechanisms, and effects

    Directory of Open Access Journals (Sweden)

    He eLi


    Full Text Available Sjögren’s syndrome (SS is a common, progressive autoimmune exocrinopathy distinguished by dry eyes and mouth and affects ~0.7% of European population. Overexpression of transcripts induced by interferons (IFN, termed as an ‘IFN signature’, has been found in SS patients. Four microarray studies have been published in SS that identified dysregulated genes within type I IFN signaling in either salivary glands or peripheral blood of SS patients. The mechanism of this type I IFN activation is still obscure, but several possible explanations have been proposed, including virus infection-initiated and immune-complex-initiated type I IFN production by plasmacytoid dendritic cells (pDCs. Genetic predisposition to increased type I IFN signaling is supported by candidate gene studies showing evidence for association of variants within IFN-related genes. Once activated, IFN signaling may contribute to numerous aspects of SS pathophysiology, including lymphocyte infiltration into exocrine glands, autoantibody production, and glandular cell apoptosis. Thus, dysregulation of IFN pathways is an important feature that can be potentially used as a serum biomarker for diagnosis and targeting of new treatments in this complex autoimmune disease.

  11. A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome (United States)

    Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco


    Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968

  12. Growth hormone receptor gene mutations in two Italian patients with Laron Syndrome. (United States)

    Fassone, L; Corneli, G; Bellone, S; Camacho-Hübner, C; Aimaretti, G; Cappa, M; Ubertini, G; Bona, G


    Laron Syndrome (LS) represents a condition characterized by GH insensitivity caused by molecular defects in the GH receptor (GHR) gene or in the post-receptor signalling pathway. We report the molecular characterization of two unrelated Italian girls from Sicily diagnosed with LS. The DNA sequencing of the GHR gene revealed the presence of different nonsense mutations, occurring in the same background haplotype. The molecular defects occurred in the extracellular domain of the GHR leading to a premature termination signal and to a truncated non-functional receptor. In one patient, a homozygous G to T transversion, in exon 6, led to the mutation GAA to TAA at codon 180 (E180X), while in the second patient a homozygous C to T transition in exon 7 was detected, causing the CGA to TAA substitution at codon 217 (R217X). Both probands presented the polymorphisms Gly168Gly and Ile544Leu in a homozygous state in exons 6 and 10, respectively. The E180X represents a novel defect of the GHR gene, while the R217X mutation has been previously reported in several patients from different ethnic backgrounds but all from countries located in the Mediterranean and Middle Eastern region.

  13. Nonalcoholic fatty liver in patients with Laron syndrome and GH gene deletion - preliminary report. (United States)

    Laron, Zvi; Ginsberg, Shira; Webb, Muriel


    There is little information on the relationship between growth hormone/insulin-like growth factor-I (GH/IGF-I) deficiency or IGF-I treatment on nonalcoholic fatty liver disease (NAFLD) a disorder linked to obesity and insulin resistance. To find out whether the markedly obese patients with Laron syndrome (LS) and GH gene deletion have fatty livers. We studied 11 untreated adult patients with LS (5M, 6F), five girls with LS treated by IGF-I and five adult patients with GH gene deletion (3M, 3F), four previously treated by hGH in childhood. Fatty liver was quantitatively evaluated by ultrasonography using a phase array US system (HITACHI 6500, Japan). Body adiposity was determined by DEXA, and insulin resistance was estimated by HOMA-IR using the fasting serum glucose and insulin values. Six out of 11 adult patients with LS, two out of the five IGF-I treated girls with LS and three out of five adult hGH gene deletion patients were found to have NAFLD (nonalcoholic fatty liver disease). NAFLD is a frequent complication in untreated and treated congenital IGF-I deficiency. No correlation between NAFLD and age, sex, degree of obesity, blood lipids, or degree of insulin resistance was observed.

  14. Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in Hui Chinese Women.

    Directory of Open Access Journals (Sweden)

    Lingxia Ha

    Full Text Available Polycystic ovary syndrome (PCOS is one of the most common endocrine-metabolic disorders. Evidence of familial aggregation analysis and different clinical traits among different regions and ethnicities indicated that the pathogenesis of PCOS is associated with multiple genetic and environmental factors. Our previous research had identified three susceptibility loci (rs2479106, DENND1A; rs13405728, LHCGR; rs13429458, THADA for PCOS in Han Chinese women. The overall aim of this study was to investigate the relationship between three susceptibility gene polymorphisms and PCOS in Hui ethnic women.151 patients with PCOS (case group and 99 healthy women (control group were recruited from the Reproductive Medicine Center of the General Hospital of Ningxia Medical University. Clinical data and serum hormone characteristics of case and control groups were collected and analyzed. The three susceptibility single-nucleotide polymorphisms have been replicated in both case and control groups. Gene polymorphisms were detected by direct sequencing after polymerase chain reaction.The Body Mass Index, LH, LH/FSH ratio and total testosterone were significantly elevated in PCOS patients compared to control group (P0.05.The present study suggested that the SNP rs13405728 in the LHCGR gene was associated with PCOS in Hui ethnic women, and its TT genotype characterized with higher level of TT, TG and LDL.

  15. Genotyping Rs2274625 Marker in NPHS2 Gene Associated with Nephrotic Syndrome in Isfahan Population

    Directory of Open Access Journals (Sweden)

    L Esmaili Chamgordani


    Full Text Available Introduction: Nephrotic syndrome (NS is a genetic disease belonging to a heterogeneous group of glomerular disorders, which mainly occurs within the children. Linkage analysis using single nucleotide polymorphisms (SNP is used as an indirect method in molecular diagnosis of the disease. A large number of SNP markers have been introduced in NPHS2gene in the available electronic databases. Method: In the present study, the genotype and informative status of rs2274625 marker in NPHS2 genewas investigated in 120 unrelated healthy individuals using Tetra-primer ARMS PCR technique and newly designed primers. Allelic frequency and presence of Hardy Weinberg Equilibrium (HWE was estimated using GenePop website. Furthermore, PowerMarker software was utilized in order to compute the index of polymorphism information content (PIC. Results: The study results indicated allele frequency of 97% and 3% for C and T alleles, respectively, in regard with rs2274625 marker within Isfahan population. Moreover, the PIC for the rs2274625 marker was 0.5%, and HWE revealed the equilibruim of the study population in regard with the related marker. Conclusion: As the study findings indicated, rs2274625 could be introduced as an SNP marker in the linkage analysis in order to molecularly trace NPHS2 gene mutations in molecular NS diagnosis in Isfahan population as a representative sample of the Iranian population.

  16. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN


    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  17. NUCB2 gene polymorphism and its relationship with nesfatin-1 levels in polycystic ovary syndrome. (United States)

    Taskin, Mine Islimye; Eser, Betul; Adali, Ertan; Kara, Hayrettin; Cuce, Coskun; Hismiogulları, Adnan Adil


    Nesfatin-1, encoded by the nucleobindin-2 (NUCB2) gene, is an anorexigenic protein related to energy metabolism, obesity, and insulin resistance. The aim of this study was to evaluate NUCB2 gene polymorphism (rs757081) and its association with serum levels of nesfatin-1 in obese and non-obese women with polycystic ovary syndrome (PCOS). In the study population, we analyzed 60 patients with PCOS and 26 age-matched healthy women as controls. The patients with PCOS were divided into two groups based on body mass index (BMI): obese group (n = 28) or non-obese group (n = 32). NUCB2 was genotyped using the polymerase chain reaction-restriction (PCR) technique. Serum nesfatin-1 level was measured by enzyme-linked immunosorbent assay (ELISA). Nesfatin-1 levels in the obese PCOS group were significantly lower than those in the non-obese PCOS and control groups (p  0.05), whereas nesfatin-1 levels in the CC and CG genotypes were lower than those in the GG genotype. Nesfatin-1 decreases in PCOS, especially in obese women, and is negatively correlated with cardiometabolic risk factors. Although genotype disturbances of NUCB2 were similar among the groups, CC and CG genotypes accompanied lower nesfatin-1 levels. C allele of NUCB2 gene polymorphism and nesfatin-1 may play a role in the pathophysiology of PCOS.

  18. New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome. (United States)

    Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa


    The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome. (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza


    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  20. MELAS syndrome associated with a new mitochondrial tRNA-Val gene mutation (m.1616A>G). (United States)

    Toyoshima, Yuka; Tanaka, Yuji; Satomi, Kazuo


    We describe the case of a 40-year-old-man with mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, with cardiomyopathy and severe heart failure. He had a mitochondrial transfer RNA (tRNA) mutation (m.1616A>G) of the (tRNA-Val) gene, and it was not found in MELAS syndrome ever before. The presence of this newly observed tRNA-Val mutation (m.1616A>G) may induce multiple respiratory chain enzyme deficiencies and contribute to MELAS syndrome symptoms that are associated with mitochondrial DNA (mtDNA) mutations. We report that the pathognomonic symptom in MELAS syndrome caused by this newly observed mtDNA mutation may be rapid progression of cardiomyopathy and severe heart failure. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  1. A novel syndrome of autosomal-dominant hyperinsulinemic hypoglycemia linked to a mutation in the human insulin receptor gene

    DEFF Research Database (Denmark)

    Højlund, Kurt; Hansen, Torben; Lajer, Maria


    a missense mutation (Arg1174Gln) in the tyrosine kinase domain of the insulin receptor gene that cosegregated with the disease phenotype (logarithm of odds [LOD] score 3.21). In conclusion, we report a novel syndrome of autosomal-dominant hyperinsulinemic hypoglycemia. The findings demonstrate...

  2. When silence is noise: infantile-onset Barth syndrome caused by a synonymous substitution affecting TAZ gene transcription

    NARCIS (Netherlands)

    Ferri, L.; Dionisi-Vici, C.; Taurisano, R.; Vaz, F. M.; Guerrini, R.; Morrone, A.


    Barth syndrome (BTHS) is an X-linked inborn error of metabolism which affects males. The main manifestations are cardiomyopathy, myopathy, hypotonia, growth delay, intermittent neutropenia and 3-methylglutaconic aciduria. Diagnosis is confirmed by mutational analysis of the TAZ gene and biochemical

  3. The long-term outcome of boys with partial androgen insensitivity syndrome and a mutation in the androgen receptor gene

    NARCIS (Netherlands)

    Lucas-Herald, A.; S. Bertelloni (Silvano); A. Juul (Anders); J. Bryce (Jillian); Jiang, J.; M. Rodie (Martina); R. Sinnott (Richard); Boroujerdi, M.; Lindhardt Johansen, M.; O. Hiort (Olaf); P-M. Holterhus (Paul-Martin); M.L. Cools (Martine); Guaragna-Filho, G.; Guerra-Junior, G.; N. Weintrob (Naomi); S.E. Hannema (Sabine); S.L.S. Drop (Stenvert); T. Guran (Tulay); F. Darendeliler (Feyza); A. Nordenström (Anna); I.A. Hughes (Ieuan A.); Acerini, C.; Tadokoro-Cuccaro, R.; S.F. Ahmed (Faisal)


    textabstractBackground: In boys with suspected partial androgen insensitivity syndrome (PAIS), systematic evidence that supports the long-term prognostic value of identifying a mutation in the androgen receptor gene (AR) is lacking. Objective: To assess the clinical characteristics and long-term

  4. Mutations in the VLGR1 gene implicate G-protein signaling in the pathogenesis of Usher syndrome type II.

    NARCIS (Netherlands)

    Weston, M.D.; Luijendijk, M.W.J.; Humphrey, K.D.; Moller, C.G.; Kimberling, W.J.


    Usher syndrome type II (USH2) is a genetically heterogeneous autosomal recessive disorder with at least three genetic subtypes (USH2A, USH2B, and USH2C) and is classified phenotypically as congenital hearing loss and progressive retinitis pigmentosa. The VLGR1 (MASS1) gene in the 5q14.3-q21.1 USH2C

  5. Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing impairment, diabetes mellitus, and psychiatric disease

    NARCIS (Netherlands)

    Cryns, K; Sivakumaran, TA; Van den Ouweland, JMW; Pennings, RJE; Cremers, CWRJ; Flothmann, K; Young, TL; Smith, RJH; Lesperance, MM; Van Camp, G


    WFS1 is a novel gene and encodes an 890 amino-acid glycoprotein (wolframin), predominantly localized in the endoplasmic reticulum. Mutations in WFS1 underlie autosomal recessive Wolfram syndrome and autosomal dominant low frequency sensorineural hearing impairment (LFSNHI) DFNA6/14. In addition,

  6. Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing impairment, diabetes mellitus, and psychiatric disease.

    NARCIS (Netherlands)

    Cryns, K.; Sivakumaran, T.A.; Ouweland, J.M.W. van den; Pennings, R.J.E.; Cremers, C.W.R.J.; Flothmann, K.; Young, T.L.; Smith, R.J.H.; Lesperance, M.M.; Camp, G. van


    WFS1 is a novel gene and encodes an 890 amino-acid glycoprotein (wolframin), predominantly localized in the endoplasmic reticulum. Mutations in WFS1 underlie autosomal recessive Wolfram syndrome and autosomal dominant low frequency sensorineural hearing impairment (LFSNHI) DFNA6/14. In addition,

  7. Inhibitors of Histone Deacetylases Are Weak Activators of the FMR1 Gene in Fragile X Syndrome Cell Lines

    Directory of Open Access Journals (Sweden)

    Alexander A. Dolskiy


    Full Text Available Fragile X syndrome is the most common cause of inherited intellectual disability in humans. It is a result of CGG repeat expansion in the 5′ untranslated region (5′ UTR of the FMR1 gene. This gene encodes the FMRP protein that is involved in neuronal development. Repeat expansion leads to heterochromatinization of the promoter, gene silencing, and the subsequent absence of FMRP. To date, there is no specific therapy for the syndrome. All treatments in clinic practice provide symptomatic therapy. The development of drug therapy for Fragile X syndrome treatment is connected with the search for inhibitors of enzymes that are responsible for heterochromatinization. Here, we report a weak transcriptional activity of the FMR1 gene and the absence of FMRP protein after Fragile X syndrome cell lines treatment with two FDA approved inhibitors of histone deacetylases, romidepsin and vorinostat. We demonstrate that romidepsin, an inhibitor of class I histone deacetylases, does not activate FMR1 expression in patient cell cultures, whereas vorinostat, an inhibitor of classes I and II histone deacetylases, activates a low level of FMR1 expression in some patient cell lines.

  8. The fragile X syndrome: Isolation of the FMR-1 gene and characterization of the fragile X mutation

    NARCIS (Netherlands)

    B.A. Oostra (Ben); A. Verkerk


    markdownabstractConclusion Rapid progress has been made in the analysis of the fragile X syndrome during 1991. Different groups have discovered that fragile X chromosomes are preferentially methylated. In these X chromosomes an insertion has been found in the methylated region. The FMR-1 gene,

  9. Clinical aspects of Usher syndrome and the USH2A gene in a cohort of 433 patients. (United States)

    Blanco-Kelly, Fiona; Jaijo, Teresa; Aller, Elena; Avila-Fernandez, Almudena; López-Molina, María Isabel; Giménez, Ascensión; García-Sandoval, Blanca; Millán, José M; Ayuso, Carmen


    A new statistical approach is needed to describe the clinical differences between type I and type II Usher syndrome and between the 2 most frequent mutations in the USH2A gene. To describe the primary phenotypic characteristics and differences between type I and type II Usher syndrome and to establish a phenotype-genotype correlation for the 2 most frequent mutations in the USH2A gene. Cross-sectional study at a genetics department, in which clinical evaluations were performed for 433 patients (297 unrelated families) who were classified as having type I, II, III, atypical, or unclassified Usher syndrome according to their clinical history, pedigree data, results from ophthalmological studies, and audiological, neurophysiological, and vestibular test results. Molecular studies were performed for 304 patients (256 unrelated families). The Mann-Whitney U test or the χ2 test was used for calculating the differences between mean values for the analyzed parameters. Age at diagnosis; age at onset of night blindness, visual field loss, visual acuity loss, and cataracts; and severity and age at diagnosis of hearing loss. The comparison between patients with type I Usher syndrome and those with type II Usher syndrome revealed P Usher syndrome and between the 2 most frequent mutations in the USH2A gene. Detailed genotype-phenotype correlations, as presented in our study, allow for a better correlation of clinical signs with a known genotype and can improve the clinical management, genetic counseling, and risk assessment of patients with Usher syndrome because an estimated prognosis of their disease can be made.

  10. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome. (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran


    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  11. Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy

    Directory of Open Access Journals (Sweden)

    Matthew M Wielgosz

    Full Text Available We have developed a producer cell line that generates lentiviral vector particles of high titer. The vector encodes the Wiskott-Aldrich syndrome (WAS protein. An insulator element has been added to the long terminal repeats of the integrated vector to limit proto-oncogene activation. The vector provides high-level, stable expression of WAS protein in transduced murine and human hematopoietic cells. We have also developed a monoclonal antibody specific for intracellular WAS protein. This antibody has been used to monitor expression in blood and bone marrow cells after transfer into lineage negative bone marrow cells from WAS mice and in a WAS negative human B-cell line. Persistent expression of the transgene has been observed in transduced murine cells 12–20 weeks following transplantation. The producer cell line and the specific monoclonal antibody will facilitate the development of a clinical protocol for gene transfer into WAS protein deficient stem cells.

  12. Disrupted auto-regulation of the spliceosomal gene SNRPB causes cerebro–costo–mandibular syndrome (United States)

    Lynch, Danielle C.; Revil, Timothée; Schwartzentruber, Jeremy; Bhoj, Elizabeth J.; Innes, A. Micheil; Lamont, Ryan E.; Lemire, Edmond G.; Chodirker, Bernard N.; Taylor, Juliet P.; Zackai, Elaine H.; McLeod, D. Ross; Kirk, Edwin P.; Hoover-Fong, Julie; Fleming, Leah; Savarirayan, Ravi; Boycott, Kym; MacKenzie, Alex; Brudno, Michael; Bulman, Dennis; Dyment, David; Majewski, Jacek; Jerome-Majewska, Loydie A.; Parboosingh, Jillian S.; Bernier, Francois P.


    Elucidating the function of highly conserved regulatory sequences is a significant challenge in genomics today. Certain intragenic highly conserved elements have been associated with regulating levels of core components of the spliceosome and alternative splicing of downstream genes. Here we identify mutations in one such element, a regulatory alternative exon of SNRPB as the cause of cerebro–costo–mandibular syndrome. This exon contains a premature termination codon that triggers nonsense-mediated mRNA decay when included in the transcript. These mutations cause increased inclusion of the alternative exon and decreased overall expression of SNRPB. We provide evidence for the functional importance of this conserved intragenic element in the regulation of alternative splicing and development, and suggest that the evolution of such a regulatory mechanism has contributed to the complexity of mammalian development. PMID:25047197

  13. Disrupted auto-regulation of the spliceosomal gene SNRPB causes cerebro-costo-mandibular syndrome. (United States)

    Lynch, Danielle C; Revil, Timothée; Schwartzentruber, Jeremy; Bhoj, Elizabeth J; Innes, A Micheil; Lamont, Ryan E; Lemire, Edmond G; Chodirker, Bernard N; Taylor, Juliet P; Zackai, Elaine H; McLeod, D Ross; Kirk, Edwin P; Hoover-Fong, Julie; Fleming, Leah; Savarirayan, Ravi; Majewski, Jacek; Jerome-Majewska, Loydie A; Parboosingh, Jillian S; Bernier, Francois P


    Elucidating the function of highly conserved regulatory sequences is a significant challenge in genomics today. Certain intragenic highly conserved elements have been associated with regulating levels of core components of the spliceosome and alternative splicing of downstream genes. Here we identify mutations in one such element, a regulatory alternative exon of SNRPB as the cause of cerebro-costo-mandibular syndrome. This exon contains a premature termination codon that triggers nonsense-mediated mRNA decay when included in the transcript. These mutations cause increased inclusion of the alternative exon and decreased overall expression of SNRPB. We provide evidence for the functional importance of this conserved intragenic element in the regulation of alternative splicing and development, and suggest that the evolution of such a regulatory mechanism has contributed to the complexity of mammalian development.

  14. Analysis of unstable DNA sequence in FRM1 gene in Polish families with fragile X syndrome

    International Nuclear Information System (INIS)

    Milewski, Michal; Bal, Jerzy; Obersztyn, Ewa; Bocian, Ewa; Mazurczak, Tadeusz; Zygulska, Marta; Horst, Juergen; Deelen, Wout H.; Halley, Dicky J.J.


    The unstable DNA sequence in the FMR1 gene was analyzed in 85 individuals from Polish families with fragile X syndrome in order to characterize mutations responsible for the disease in Poland. In all affected individuals classified on the basis of clinical features and expression of the fragile site at X(q27.3) a large expansion of the unstable sequence (full mutation) was detected. About 5% (2 of 43) of individuals with full mutation did not express the fragile site. Among normal alleles, ranging in size from 20 to 41 CGC repeats, allele with 29 repeats was the most frequent (37%). Transmission of premutated and fully mutated alleles to the offspring was always associated with size increase. No change in repeat number was found when normal alleles were transmitted. (author). 19 refs., 4 figs, 1 tab

  15. Searching for Tourette’s syndrome gene. Part 1. Heterogeneity of clinical phenotypes

    Directory of Open Access Journals (Sweden)

    Anna Kowalska


    Full Text Available The French neuropsychiatrist Georges Gilles de la Tourette described in 1885 the “Maladie des Tics” which later was named after him, as Gilles de la Tourette syndrome (GTS. Gilles de la Tourette syndrome is a neurodevelopmental disorder characterized by simple and complex motor and vocal tics with multiple neuropsychiatric comorbidities. GTS is often concurrent with obsessive-compulsive disorder (OCD and attention deficit hyperactivity disorder (ADHD. There are several clinical GTS subtypes: GTS only, GTS OCD, and GTS OCD ADHD. Additional clinical aspects of the disorder include occurrence of anger episodes, anxiety and mood disorders, and learning and sleeping disturbances. The genetics of GTS is complex and remains unclear. So far, no causative candidate genes have been identified. However, segregation studies in families and twins with GTS provide strong evidence for the existence of a genetic background associated with a multifactorial mode of inheritance. Progress in studies on genome variability among patients with GTS is necessary to improve pharmacotherapeutic strategies of the disorder.

  16. Sequence variants of the DFNB31 gene among Usher syndrome patients of diverse origin (United States)

    Aller, Elena; Jaijo, Teresa; van Wijk, Erwin; Ebermann, Inga; Kersten, Ferry; García-García, Gema; Voesenek, Krysta; Aparisi, María José; Hoefsloot, Lies; Cremers, Cor; Díaz-Llopis, Manuel; Pennings, Ronald; Bolz, Hanno J.; Kremer, Hannie; Millán, José M.


    Purpose It has been demonstrated that mutations in deafness, autosomal recessive 31 (DFNB31), the gene encoding whirlin, is responsible for nonsyndromic hearing loss (NSHL; DFNB31) and Usher syndrome type II (USH2D). We screened DFNB31 in a large cohort of patients with different clinical subtypes of Usher syndrome (USH) to determine the prevalence of DFNB31 mutations among USH patients. Methods DFNB31 was screened in 149 USH2, 29 USH1, six atypical USH, and 11 unclassified USH patients from diverse ethnic backgrounds. Mutation detection was performed by direct sequencing of all coding exons. Results We identified 38 different variants among 195 patients. Most variants were clearly polymorphic, but at least two out of the 15 nonsynonymous variants (p.R350W and p.R882S) are predicted to impair whirlin structure and function, suggesting eventual pathogenicity. No putatively pathogenic mutation was found in the second allele of patients with these mutations. Conclusions DFNB31 is not a major cause of USH. PMID:20352026

  17. Mutations in the evolutionarily highly conserved KEOPS complex genes cause nephrotic syndrome with microcephaly (United States)

    Braun, Daniela A.; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A.; Schanze, Denny; Ashraf, Shazia; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I. Chiara; Sanchez-Ferras, Oraly; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E.; Pabst, Werner L.; Warejko, Jillian; Daga, Ankana; LeBerre, Tamara Basta; Matejas, Verena; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T.; Gipson, Patrick E.; Hsu, Chyong-Hsin; Kari, Jameela A.; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okasha; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth; Rump, Patrick; Schnur, Rhonda E.; Shiihara, Takashi; Sinha, Manish; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A.; Tsai, Wen-Hui; Tsai, Jeng-Daw; Vester, Udo; Viskochil, David H.; Vatanavicharn, Nithiwat; Waxler, Jessica L.; Wolf, Matthias T.F.; Wong, Sik-Nin; Poduri, Annapurna; Truglio, Gessica; Mane, Shrikant; Lifton, Richard P.; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Calleweart, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm


    Galloway-Mowat syndrome (GAMOS) is a severe autosomal-recessive disease characterized by the combination of early-onset steroid-resistant nephrotic syndrome (SRNS) and microcephaly with brain anomalies. To date, mutations of WDR73 are the only known monogenic cause of GAMOS and in most affected individuals the molecular diagnosis remains elusive. We here identify recessive mutations of OSGEP, TP53RK, TPRKB, or LAGE3, encoding the 4 subunits of the KEOPS complex in 33 individuals of 30 families with GAMOS. CRISPR/Cas9 knockout in zebrafish and mice recapitulates the human phenotype of microcephaly and results in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibits cell proliferation, which human mutations fail to rescue, and knockdown of either gene activates DNA damage response signaling and induces apoptosis. OSGEP and TP53RK molecularly interact and co-localize with the actin-regulating ARP2/3 complex. Furthermore, knockdown of OSGEP and TP53RK induces defects of the actin cytoskeleton and reduces migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identify 4 novel monogenic causes of GAMOS, describe the first link between KEOPS function and human disease, and delineate potential pathogenic mechanisms. PMID:28805828

  18. [Mutation screening of MITF gene in patients with Waardenburg syndrome type 2]. (United States)

    Chen, Jing; Yang, Shu-Zhi; Liu, Jun; Han, Bing; Wang, Guo-Jian; Zhang, Xin; Kang, Dong-Yang; Dai, Pu; Young, Wie-Yen; Yuan, Hui-Jun


    Warrgenburg syndrome type 2 (WS2) is the most common autosomal dominantly-inherited syndrome with hearing loss. MITF (microphthalmia associated transcription factor)is a basic-helix-loop-helix-luecine zipper (bHLHZip) factor which regulates expression of tyrosinase, and is involved in melanocyte differentiation. Mutations in MITF associated with WS2 have been identified in some but not all affected families. Here, we report a three-generation Chinese family with a point mutation in the MITF gene causing WS2. The proband exhibits congenital severe sensorineural hearing loss, heterochromia iridis and facial freckles. One of family members manifests sensorineural deafness, and the other patients show premature greying or/and freckles. This mutation, heterozygous deletion c.639delA, creates a stop codon in exon 7 and is predicted to result in a truncated protein lacking normal interaction with its target DNA motif. This mutation is a novel mutation and the third case identified in exon 7 of MITF in WS2. Though there is only one base pair distance between this novel mutation and the other two documented cases and similar amino acids change, significant difference is seen in clinical phenotype, which suggests genetic background may play an important role.

  19. The Tourette International Collaborative Genetics (TIC Genetics) study, finding the genes causing Tourette syndrome

    DEFF Research Database (Denmark)

    Dietrich, Andrea; Fernandez, Thomas V; King, Robert A


    Tourette syndrome (TS) is a neuropsychiatric disorder characterized by recurrent motor and vocal tics, often accompanied by obsessive-compulsive disorder and/or attention-deficit/hyperactivity disorder. While the evidence for a genetic contribution is strong, its exact nature has yet to be clarif......Tourette syndrome (TS) is a neuropsychiatric disorder characterized by recurrent motor and vocal tics, often accompanied by obsessive-compulsive disorder and/or attention-deficit/hyperactivity disorder. While the evidence for a genetic contribution is strong, its exact nature has yet......, it is clear that large patient cohorts and open-access repositories will be essential to further advance the field. To that end, the large multicenter Tourette International Collaborative Genetics (TIC Genetics) study was established. The goal of the TIC Genetics study is to undertake a comprehensive gene...... discovery effort, focusing both on familial genetic variants with large effects within multiply affected pedigrees and on de novo mutations ascertained through the analysis of apparently simplex parent-child trios with non-familial tics. The clinical data and biomaterials (DNA, transformed cell lines, RNA...

  20. Metabolic syndrome, diabetes and atherosclerosis: Influence of gene-environment interaction

    International Nuclear Information System (INIS)

    Andreassi, Maria Grazia


    Despite remarkable progress in diagnosis and understanding of risk factors, cardiovascular disease (CVD) remains still the leading cause of morbidity and mortality in the world's developed countries. The metabolic syndrome, a cluster of risk factors (visceral obesity, insulin resistance, dyslipidaemia, and hypertension), is increasingly being recognized as a new risk factor for type 2 diabetes and atherosclerotic cardiovascular disease. Nevertheless, there is wide variation in both the occurrence of disease and age of onset, even in individuals who display very similar risk profiles. There is now compelling evidence that a complex interplay between genetic determinants and environmental factors (still largely unknown) is the reason for this large inter-individual variation in disease susceptibility. The purpose of the present review is to describe the current status of our knowledge concerning the gene-environment interactions potentially implicated in the pathogenesis of metabolic syndrome, diabetes and cardiovascular disease. It focuses predominantly on studies of genes (peroxisome proliferator-activated receptor-gamma, alcohol dehydrogenase type 1C, apolipoprotein E, glutathione S-transferases T1 and M1) that are known to be modified by dietary and lifestyle habits (fat diet, intake of alcohol and smoking habit). It also describes the limited current understanding of the role of genetic variants of xenobiotic metabolizing enzymes and their interactions with environmental toxicants. Additional studies are needed in order to clarify whether inter-individual differences in detoxification of environmental toxicants may have an essential role in the development of CVD and contribute to the emerging field of 'environmental cardiology'. Such knowledge may be particularly relevant for improving cardiovascular risk stratification and conceiving the development of 'personalized intervention program'.

  1. Metabolic syndrome, diabetes and atherosclerosis: Influence of gene-environment interaction

    Energy Technology Data Exchange (ETDEWEB)

    Andreassi, Maria Grazia, E-mail: [CNR Institute of Clinical Physiology, G. Pasquinucci Hospital, Via Aurelia Sud, Massa (Italy)


    Despite remarkable progress in diagnosis and understanding of risk factors, cardiovascular disease (CVD) remains still the leading cause of morbidity and mortality in the world's developed countries. The metabolic syndrome, a cluster of risk factors (visceral obesity, insulin resistance, dyslipidaemia, and hypertension), is increasingly being recognized as a new risk factor for type 2 diabetes and atherosclerotic cardiovascular disease. Nevertheless, there is wide variation in both the occurrence of disease and age of onset, even in individuals who display very similar risk profiles. There is now compelling evidence that a complex interplay between genetic determinants and environmental factors (still largely unknown) is the reason for this large inter-individual variation in disease susceptibility. The purpose of the present review is to describe the current status of our knowledge concerning the gene-environment interactions potentially implicated in the pathogenesis of metabolic syndrome, diabetes and cardiovascular disease. It focuses predominantly on studies of genes (peroxisome proliferator-activated receptor-gamma, alcohol dehydrogenase type 1C, apolipoprotein E, glutathione S-transferases T1 and M1) that are known to be modified by dietary and lifestyle habits (fat diet, intake of alcohol and smoking habit). It also describes the limited current understanding of the role of genetic variants of xenobiotic metabolizing enzymes and their interactions with environmental toxicants. Additional studies are needed in order to clarify whether inter-individual differences in detoxification of environmental toxicants may have an essential role in the development of CVD and contribute to the emerging field of 'environmental cardiology'. Such knowledge may be particularly relevant for improving cardiovascular risk stratification and conceiving the development of 'personalized intervention program'.

  2. Recent Trends in WRN Gene Mutation Patterns in Individuals with Werner Syndrome. (United States)

    Yamaga, Masaya; Takemoto, Minoru; Takada-Watanabe, Aki; Koizumi, Naoko; Kitamoto, Takumi; Sakamoto, Kenichi; Ishikawa, Takahiro; Koshizaka, Masaya; Maezawa, Yoshiro; Yokote, Koutaro


    To determine recent trends in mutation patterns in the WRN gene, which cause Werner syndrome (WS), a rare, inheritable progeroid syndrome in Japan. Retrospective cohort. Longitudinal survey of WS and literature search for case reports. Individuals whose genetic testing their facilities had requested between 2009 and October 2016 (N = 67). A nationwide epidemiological study was conducted from 2009 to 2011 to improve understanding of the pathology of WS and develop therapeutic guidelines. Since 2009, Chiba University Hospital consecutively evaluated the WRN gene in 67 individuals throughout Japan who had requested genetic testing. A literature search was also conducted for case reports on Japanese WS reported since 1997. A definitive diagnosis of WS was confirmed genetically in 50 of 67 participants. Through the literature search, 16 individuals diagnosed genetically with WS were identified. Of these 66 individuals with WS, 42 were homozygous for a WRN mutation, and 21 were compound heterozygotes. One novel mutant allele was identified in an individual with the compound heterozygous genotype. The proportion of compound heterozygotes (31.8%) was significantly greater than reported previously (14.2%), indicating that the incidence of consanguineous marriage of parents has decreased. The increased frequency of individuals with WS with the compound heterozygous genotype is a recent trend in Japan. A long-term follow-up study on WRN homozygotes and compound heterozygotes will allow the relationship between WRN genotype and clinical severity of WS to be evaluated in the future. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

  3. Clinical characteristics and STK11 gene mutations in Chinese children with Peutz-Jeghers syndrome. (United States)

    Huang, Zhiheng; Miao, Shijian; Wang, Lin; Zhang, Ping; Wu, Bingbing; Wu, Jie; Huang, Ying


    Peutz-Jeghers syndrome (PJS) is a rare autosomal dominant inherited disease characterized by gastrointestinal hamartomatous polyps and mucocutaneous melanin spots. Germline mutation of the serine/threonine kinase 11 (STK11) gene are responsible for PJS. In this study, we investigated the clinical characteristics and molecular basis of the disease in Chinese children with PJS. Thirteen children diagnosed with PJS in our hospital were enrolled in this study from 2011 to 2015, and their clinical data on polyp characteristics, intussusceptions events, family histories, etc. were described. Genomic DNA was extracted from whole-blood samples from each subject, and the entire coding sequence of the STK11 gene was amplified by polymerase chain reaction and analyzed by direct sequencing. The median age at the onset of symptoms was 2 years and 4 months. To date, these children have undergone 40 endoscopy screenings, 17 laparotomies and 9 intussusceptions. Polyps were found in the stomach, duodenum, small bowel, colon and rectum, with large polyps found in 7 children. Mutations were found in eleven children, including seven novel mutations (c.481het_dupA, c.943_944het_delCCinsG, c.397het_delG, c.862 + 1G > G/A, c.348_349het_delGT, and c.803_804het_delGGinsC and c.121_139de l19insTT) and four previously reported mutations (c.658C > C/T, c.890G > G/A, c.1062 C > C/G, and c.290 + 1G > G/A). One PJS patient did not have any STK11 mutations. The polyps caused significant clinical consequences in children with PJS, and mutations of the STK11 gene are generally the cause of PJS in Chinese children. This study expands the spectrum of known STK11 gene mutations.

  4. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi. (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain


    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  5. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus. (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee


    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Loeys-Dietz Syndrome (United States)

    ... to the signs and symptoms of Loeys-Dietz syndrome. Marfan syndrome is different from Loeys-Dietz syndrome in that the gene mutation which causes Marfan syndrome is in fibrillin-1 (FBN-1), a protein ...

  7. Are mice pigmentary genes throwing light on humans?

    Directory of Open Access Journals (Sweden)

    Bose S


    Full Text Available In this article the rapid advances made in the molecular genetics of inherited disorders of hypo and hyperpigmentation during the past three years are reviewed. The main focus is on studies in mice as compared to homologues in humans. The main hypomelanotic diseases included are, piebaldism (white spotting due to mutations of c-KIT, PDGF and MGF genes; vitiligo (microphathalmia mice mutations of c-Kit and c-fms genes; Waardenburg syndrome (splotch locus mutations of mice PAX-3 or human Hup-2 genes; albinism (mutations of tyrosinase genes, Menkes disease (Mottled mouse, premature graying (mutations in light/brown locus/gp75/ TRP-1; Griscelli disease (mutations in TRP-1 and steel; Prader-willi and Angelman syndromes, tyrosinase-positive oculocutaneous albinism and hypomelanosis of lto (mutations of pink-eyed dilution gene/mapping to human chromosomes 15 q 11.2 - q12; and human platelet storage pool deficiency diseases due to defects in pallidin, an erythrocyte membrane protein (pallid mouse / mapping to 4.2 pallidin gene. The genetic characterization of hypermelanosis includes, neurofibromatosis 1 (Café-au-lait spots and McCune-Albright Syndrome. Rapid evolving knowledge about pigmentary genes will increase further the knowledge about these hypo and hyperpigmentary disorders.

  8. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse)


    Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.


    Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/...

  9. Mutation analysis of the SHOC2 gene in Noonan-like syndrome and in hematologic malignancies

    NARCIS (Netherlands)

    Komatsuzaki, Shoko; Aoki, Yoko; Niihori, Tetsuya; Okamoto, Nobuhiko; Hennekam, Raoul C. M.; Hopman, Saskia; Ohashi, Hirofumi; Mizuno, Seiji; Watanabe, Yoriko; Kamasaki, Hotaka; Kondo, Ikuko; Moriyama, Nobuko; Kurosawa, Kenji; Kawame, Hiroshi; Okuyama, Ryuhei; Imaizumi, Masue; Rikiishi, Takeshi; Tsuchiya, Shigeru; Kure, Shigeo; Matsubara, Yoichi


    Noonan syndrome is an autosomal dominant disease characterized by dysmorphic features, webbed neck, cardiac anomalies, short stature and cryptorchidism. It shows phenotypic overlap with Costello syndrome and cardio-facio-cutaneous (CFC) syndrome. Noonan syndrome and related disorders are caused by

  10. A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome. (United States)

    Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane


    Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  11. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M


    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  12. Kearns-Sayre syndrome with facial and white matter extensive involvement: a (mitochondrial and nuclear gene related? neurocristopathy?

    Directory of Open Access Journals (Sweden)

    Agostino Berio


    Full Text Available The Authors report on a patient with Kearns-Sayre syndrome, large mtDNA deletion (7/kb, facial abnormalities and severe central nervous system (CNS white matter radiological features, commonly attributed to spongy alterations. The common origin from neural crest cell (NCC of facial structures (cartilagineous, osseous, vascular and of the peripheral nervous system and of peripheral glia and partially of the CNS white matter are underlined and the facial and glial abnormalities are attributed to the abnormal reproduction/migration of NCC. In this view, the CNS spongy alterations in KSS may be not only a dystrophic process (leukodystrophy but also a dysplastic condition (leukodysplasia. The Authors hypothesize that the symptoms may be related to mtDNA mutations associated to NCC nuclear gene abnormality. SOX 10 gene may be a nuclear candidate gene, as reported in some case of Waardenburg IV syndrome.

  13. [From gene to disease; genetic causes of hearing loss and visual impairment sometimes accompanied by vestibular problems (Usher syndrome)]. (United States)

    Pennings, R J E; Kremer, H; Deutman, A F; Kimberling, W J; Cremers, C W R J


    Usher syndrome is an autosomal recessively inherited disease, characterised by sensorineural hearing loss, tapetoretinal degeneration and in some cases vestibular problems. Based on the clinical heterogeneity, the disease can be classified into three clinical types (I, II and III), which have their own genetic subtypes (Usher 1A-Usher IG, Usher 2A-Usher 2C and Usher 3). The majority of the Usher type I cases are caused by mutations in the MYO7A gene (Usher 1B) while mutations in the USH2A gene (Usher 2A) are the cause of most cases of type II. Usher syndrome type III, caused by mutations in the USH3 gene, is frequently seen only in Finland.

  14. Genetics Home Reference: Costello syndrome (United States)

    ... other genetic conditions, cardiofaciocutaneous syndrome (CFC syndrome) and Noonan syndrome . In affected infants, it can be difficult to ... These individuals may actually have CFC syndrome or Noonan syndrome , which are caused by mutations in related genes. ...

  15. Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

    International Nuclear Information System (INIS)

    Back, Susan J.; Andronikou, Savvas; Kilborn, Tracy; Kaplan, Bernard S.; Darge, Kassa


    Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

  16. Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Back, Susan J. [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Andronikou, Savvas [University of the Witwatersrand, Radiology Department, Faculty of Health Sciences, Johannesburg (South Africa); Kilborn, Tracy [University of Cape Town, Red Cross War Memorial Children' s Hospital, Cape Town (South Africa); Kaplan, Bernard S. [The Children' s Hospital of Philadelphia, Division of Nephrology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States); Darge, Kassa [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States)


    Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

  17. Blau syndrome-associated mutations in exon 4 of the caspase activating recruitment domain 15 (CARD 15) gene are not found in ethnic Danes with sarcoidosis

    DEFF Research Database (Denmark)

    Milman, Nils; Nielsen, Finn Cilius; Hviid, Thomas Vauvert F


    BACKGROUND: Distinct mutations of the caspase activating recruitment domain 15 (CARD15) gene (also known as nucleotide-binding oligomerisation domain protein 2) on chromosome 16q are associated with the chronic granulomatous disease called Blau syndrome. Sarcoidosis is a systemic granulomatous...... disease, which has features in common with Blau syndrome. AIM: The aim of this study was to evaluate whether ethnic Danes with sarcoidosis have CARD15 mutations associated with Blau syndrome. METHODS: Analysis of exon 4 of the CARD15 gene containing mutations associated with Blau syndrome was performed...

  18. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome. (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh


    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome. (United States)

    Abdi, Samia; Bahloul, Amel; Behlouli, Asma; Hardelin, Jean-Pierre; Makrelouf, Mohamed; Boudjelida, Kamel; Louha, Malek; Cheknene, Ahmed; Belouni, Rachid; Rous, Yahia; Merad, Zahida; Selmane, Djamel; Hasbelaoui, Mokhtar; Bonnet, Crystel; Zenati, Akila; Petit, Christine


    Usher syndrome (USH) is an autosomal recessive disorder characterized by a dual sensory impairment affecting hearing and vision. USH is clinically and genetically heterogeneous. Ten different causal genes have been reported. We studied the molecular bases of the disease in 18 unrelated Algerian patients by targeted-exome sequencing, and identified the causal biallelic mutations in all of them: 16 patients carried the mutations at the homozygous state and 2 at the compound heterozygous state. Nine of the 17 different mutations detected in MYO7A (1 of 5 mutations), CDH23 (4 of 7 mutations), PCDH15 (1 mutation), USH1C (1 mutation), USH1G (1 mutation), and USH2A (1 of 2 mutations), had not been previously reported. The deleterious consequences of a missense mutation of CDH23 (p.Asp1501Asn) and the in-frame single codon deletion in USH1G (p.Ala397del) on the corresponding proteins were predicted from the solved 3D-structures of extracellular cadherin (EC) domains of cadherin-23 and the sterile alpha motif (SAM) domain of USH1G/sans, respectively. In addition, we were able to show that the USH1G mutation is likely to affect the binding interface between the SAM domain and USH1C/harmonin. This should spur the use of 3D-structures, not only of isolated protein domains, but also of protein-protein interaction interfaces, to predict the functional impact of mutations detected in the USH genes.

  20. High incidence of large deletions in the PMS2 gene in Spanish Lynch syndrome families. (United States)

    Brea-Fernández, A J; Cameselle-Teijeiro, J M; Alenda, C; Fernández-Rozadilla, C; Cubiella, J; Clofent, J; Reñé, J M; Anido, U; Milá, M; Balaguer, F; Castells, A; Castellvi-Bel, S; Jover, R; Carracedo, A; Ruiz-Ponte, C


    Lynch syndrome (LS) is caused by germline mutations in one of the four mismatch repair (MMR) genes. Defects in this pathway lead to microsatellite instability (MSI) in DNA tumors, which constitutes the molecular hallmark of this disease. Selection of patients for genetic testing in LS is usually based on fulfillment of diagnostic clinical criteria (i.e. Amsterdam criteria or the revised Bethesda guidelines). However, following these criteria PMS2 mutations have probably been underestimated as their penetrances appear to be lower than those of the other MMR genes. The use of universal MMR study-based strategies, using MSI testing and immunohistochemical (IHC) staining, is being one proposed alternative. Besides, germline mutation detection in PMS2 is complicated by the presence of highly homologous pseudogenes. Nevertheless, specific amplification of PMS2 by long-range polymerase chain reaction (PCR) and the improvement of the analysis of large deletions/duplications by multiplex ligation-dependent probe amplification (MLPA) overcome this difficulty. By using both approaches, we analyzed 19 PMS2-suspected carriers who have been selected by clinical or universal strategies and found five large deletions and one frameshift mutation in PMS2 in six patients (31%). Owing to the high incidence of large deletions found in our cohort, we recommend MLPA analysis as the first-line method for searching germline mutations in PMS2. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Identification of fibrillin 1 gene mutations in patients with bicuspid aortic valve (BAV) without Marfan syndrome (United States)


    Background Bicuspid aortic valve (BAV) is the most frequent congenital heart disease with frequent involvement in thoracic aortic dilatation, aneurysm and dissection. Although BAV and Marfan syndrome (MFS) share some clinical features, and some MFS patients with BAV display mutations in FBN1, the gene encoding fibrillin-1, the genetic background of isolated BAV is poorly defined. Methods Ten consecutive BAV patients [8 men, age range 24–42 years] without MFS were clinically characterized. BAV phenotype and function, together with evaluation of aortic morphology, were comprehensively assessed by Doppler echocardiography. Direct sequencing of each FBN1 exon with flanking intron sequences was performed on eight patients. Results We detected three FBN1 mutations in two patients (aged 24 and 25 years) displaying aortic root aneurysm ≥50 mm and moderate aortic regurgitation. In particular, one patient had two mutations (p.Arg2726Trp and p.Arg636Gly) one of which has been previously associated with variable Marfanoid phenotypes. The other patient showed a pArg529Gln substitution reported to be associated with an incomplete MFS phenotype. Conclusions The present findings enlarge the clinical spectrum of isolated BAV to include patients with BAV without MFS who have involvement of FBN1 gene. These results underscore the importance of accurate phenotyping of BAV aortopathy and of clinical characterization of BAV patients, including investigation of systemic connective tissue manifestations and genetic testing. PMID:24564502

  2. Variant of Rett syndrome and CDKL5 gene: clinical and autonomic description of 10 cases. (United States)

    Pini, Giorgio; Bigoni, Stefania; Engerström, Ingegerd Witt; Calabrese, Olga; Felloni, Beatrice; Scusa, Maria Flora; Di Marco, Pietro; Borelli, Paolo; Bonuccelli, Ubaldo; Julu, Peter O O; Nielsen, Jytte Bieber; Morin, Bodil; Hansen, Stig; Gobbi, Giuseppe; Visconti, Paola; Pintaudi, Maria; Edvige, Veneselli; Romanelli, Anna; Bianchi, Fabrizio; Casarano, Manuela; Battini, Roberta; Cioni, Giovanni; Ariani, Francesca; Renieri, Alessandra; Benincasa, Alberto; Delamont, Robert S; Zappella, Michele


    Rett syndrome (RTT) is a severe neurodevelopmental disorder affecting almost exclusively females. The Hanefeld variant, or early-onset seizure variant, has been associated with mutations in CDKL5 gene. In recent years more than 60 patients with mutations in the CDKL5 gene have been described in the literature, but the cardiorespiratory phenotype has not been reported. Our aim is to describe clinical and autonomic features of these girls. 10 girls with CDKL5 mutations and a diagnosis of Hanefeld variant have been evaluated on axiological and clinical aspects. In all subjects an evaluation of the autonomic system was performed using the Neuroscope. Common features were gaze avoidance, repetitive head movements and hand stereotypies. The autonomic evaluation disclosed eight cases with the Forceful breather cardiorespiratory phenotype and two cases with the Apneustic breather phenotype. The clinical picture remains within the RTT spectrum but some symptoms are more pronounced in addition to the very early onset of seizures. The cardiorespiratory phenotype was dominated by Forceful breathers, while Feeble breathers were not found, differently from the general Rett population, suggesting a specific behavioral and cardiorespiratory phenotype of the RTT the Hanefeld variant. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  3. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Junyu Zhang

    Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  4. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa. (United States)

    García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M


    The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.

  5. Cataract as a phenotypic marker for a mutation in WFS1, the Wolfram syndrome gene. (United States)

    Titah, Salah Mohamed Cherif; Meunier, Isabelle; Blanchet, Catherine; Lopez, Severine; Rondouin, Gerard; Lenaers, Guy; Amati-Bonneau, Patrizia; Reynier, Pascal; Paquis-Flucklinger, Veronique; Hamel, Christian P


    Wolfram syndrome (WS) or diabetes insipidus, diabetes mellitus, optic atrophy, and deafness (DIDMOAD) (OMIM 222300) is an inherited neurodegenerative disease characterized by diabetes mellitus and optic atrophy as the 2 major criteria, followed later in life by deafness, diabetes insipidus, and various signs of neurologic impairment. The presence of a cataract has been variably mentioned in WS. Two members of a family had thorough ophthalmic examination and their DNA was screened for mutations in mitochondrial DNA, WFS1, OPA1, and OPA3 genes. We report a patient who first had surgery for bilateral cataract at age 5 and who subsequently presented typical signs of WS, i.e., diabetes mellitus, optic atrophy with reduced visual acuity at 20/400 on both eyes at age 22, and mild deafness. The patient was found to be a compound heterozygote for 2 truncating mutations in WFS1, the major WS gene. She carried the previously reported c.1231_1233 delCT and a novel c.2431_2465dup35 mutation. She also was heterozygote for a novel OPA1 sequence variant, c.929A>G in exon 9, whose pathogenicity remains uncertain. The patient's mother was a heterozygous carrier of the c.2431_2465dup35 mutation. She did not have diabetes mellitus or optic atrophy but had bilateral polar cataract. She did not carry the OPA1 sequence variant. Cataract could be a marker for the WFS1 heterozygosity in this family, namely the c.2431_2465dup35 mutation.

  6. Screening non-classical 21-hydroxylase gene deficiency from patients diagnosed as polycystic ovary syndrome by gene assay

    Directory of Open Access Journals (Sweden)

    Jie HU


    Full Text Available Objective  To screen non-classical 21-hydroxylase deficiency (NC-21OHD from patients diagnosed as polycystic ovary syndrome (PCOS by gene assay. Methods  Ninety-eight patients with PCOS were enrolled according to 2003 Rotterdam criteria from Department of Endocrinology, Tangdu Hospital of Fourth Military Medical University, and they were divided into three groups according to the modified Ferriman-Gallway (mF-G score as follows: group A with score 0-2; group B with score 3-5, and group C with score ≥6. Meanwhile, 30 healthy subjects from the Medical Center of the Hospital were recruited as control group. Peripheral blood of all subjects were collected for extracting DNA, the CYP21A2 gene were amplified by 5 pairs of specific primers, and then the PCR products were sequenced by Shanghai Sangon Co. The subjects would accept test for serum cortisol and adrenocorticotropic hormone (ACTH at 8:00am if their CYP21A2 was proved to be abnormal. Results  Thirty subjects of control group had no any defects in CYP21A2, but 5 of 98 patients with PCOS were proved to be deficient in CYP21A2, and the genotypes were V281L/920-921insT (P1, V281L/I230M (P2, V281L/Normal (P3, P4, P5, respectively, and all of them were heterozygous mutations. The incidences of NC-21OHD in group C and B were 28.6% and 3.3%, respectively. Genotype P1 had been identified to belong to NC-21OHD, which was consistent with its clinical phenotype. All genotypes P3, P4 and P5 belonged to carriers. But for P2, since I230M hadn't been reported in literature, the patient with V281L/I230M couldn't be classified now. Serum biochemical results showed that only in P1 the cortisol was close to the normal lower level, and ACTH was close to the normal upper limit of the reported level in the literature, and the remainders were all normal. Conclusions  Although PCOS and NC-21OHD are very similar in clinical manifestations, they are different completely in the pathogenesis and treatment. So it

  7. Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family. (United States)

    Ying, Yan-Qin; Wei, Hong; Cao, Li-Zhi; Lu, Juan-Juan; Luo, Xiao-Ping


    Laron syndrome is an autosomal recessive disorder caused by defects of growth hormone receptor (GHR) gene. It is characterized by severe postnatal growth retardation and characteristic facial features as well as high circulating levels of growth hormone (GH) and low levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3). This report described the clinical features and GHR gene mutations in 2 siblings with Laron syndrome in a Chinese family. Their heights and weights were in the normal range at birth, but the growth was retarded after birth. When they presented to the clinic, the heights of the boy (8 years old) and his sister (11 years old) were 80.0 cm (-8.2 SDS) and 96.6 cm (-6.8 SDS) respectively. They had typical appearance features of Laron syndrome such as short stature and obesity, with protruding forehead, saddle nose, large eyes, sparse and thin silky hair and high-pitched voice. They had higher basal serum GH levels and lower serum levels of IGF-I, IGFBP-3 and growth hormone binding protein (GHBP) than normal controls. The peak serum GH level after colonidine and insulin stimulations in the boy was over 350 ng/mL. After one-year rhGH treatment, the boy's height increased from 80.0 cm to 83.3 cm. The gene mutation analysis revealed that two patients had same homozygous mutation of S65H (TCA -->CCA) in exon 4, which is a novel gene mutation. It was concluded that a definite diagnosis of Laron syndrome can be made based on characteristic appearance features and serum levels of GH, IGF-I, IGFBP-3 and GHBP. The S65H mutation might be the cause of Laron syndrome in the two patients.

  8. A novel heterozygous germline deletion in MSH2 gene in a five generation Chinese family with Lynch syndrome


    Wu, Bin; Ji, Wuyang; Liang, Shengran; Ling, Chao; You, Yan; Xu, Lai; Zhong, Min-Er; Xiao, Yi; Qiu, Hui-Zhong; Lu, Jun-Yang; Banerjee, Santasree


    Lynch syndrome (LS) is one of the most common familial forms of colorectal cancer predisposing syndrome with an autosomal dominant mode of inheritance. LS is caused by the germline mutations in DNA mismatch repair (MMR) genes including MSH2, MLH1, MSH6 and PMS2. Clinically, LS is characterized by high incidence of early-onset colorectal cancer as well as endometrial, small intestinal and urinary tract cancers, usually occur in the third to fourth decade of the life. Here we describe a five ge...

  9. Novel PSTPIP1 gene mutation in a patient with pyogenic arthritis, pyoderma gangrenosum and acne (PAPA) syndrome. (United States)

    Lindwall, Elvira; Singla, Shikha; Davis, William E; Quinet, Robert J


    Pyogenic arthritis, pyoderma gangrenosum, and acne (PAPA) syndrome is a rare autosomal dominant disease that usually presents in childhood with recurrent sterile arthritis. As the child ages into puberty, cutaneous features develop and arthritis subsides. We report the case of a now 25-year-old male patient with PAPA syndrome with the E250K mutation in PSTPIP1. We also present a systematic literature review of other PAPA cases. We conducted a literature search of PubMed using the following search terms: E250K mutation, PSTPIP1, and PAPA. PAPA syndrome is caused by mutations on chromosome 15q affecting the proline-serine-threonine phosphatase-interacting protein 1 (PSTPIP1) gene, also known as CD2-binding protein 1 (CD2BP1). The reported cases of PAPA syndrome currently in the literature involve mutations in A230T and E250Q. One case of a novel E250K mutation has been reported, which presented with a different phenotype to previously described cases of PAPA syndrome. With variation present between disease presentations from case to case, it is possible that the spectrum of PAPA syndrome is wider than currently thought. Further research is needed which may uncover an as-yet undiscovered genetic abnormality linking these interrelated diseases together. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. [Molecular pathogenesis of Waardenburg syndrome type II resulting from SOX10 gene mutation]. (United States)

    Zhang, Hua; Chen, Hongsheng; Feng, Yong; Qian, Minfei; Li, Jiping; Liu, Jun; Zhang, Chun


    To explore the molecular mechanism of Waardenburg syndrome type II (WS2) resulting from SOX10 gene mutation E248fs through in vitro experiment. 293T cells were transiently transfected with wild type (WT) SOX10 and mutant type (MT) E248fs plasmids. The regulatory effect of WT/MT SOX10 on the transcriptional activity of MITF gene and influence of E248fs on WT SOX10 function were determined with a luciferase activity assay. The DNA binding capacity of the WT/MT SOX10 with the promoter of the MITF gene was determined with a biotinylated double-stranded oligonucleotide probe containing the SOX10 binding sequence cattgtc to precipitate MITF and E248fs, respectively. The stability of SOX10 and E248fs were also analyzed. As a loss-of-function mutation, the E248fs mutant failed to transactivate the MITF promoter as compared with the WT SOX10 (P<0.01), which also showed a dominant-negative effect on WT SOX10. The WT SOX10 and E248fs mutant were also able to bind specifically to the cattgtc motif in the MITF promoter, whereas E248fs had degraded faster than WT SOX10. Despite the fact that the E248fs has a dominant-negative effect on SOX10, its reduced stability may down-regulate the transcription of MITF and decrease the synthesis of melanin, which may result in haploinsufficiency of SOX10 protein and cause the milder WS2 phenotype.

  11. The prognostic impact of mutations in spliceosomal genes for myelodysplastic syndrome patients without ring sideroblasts

    International Nuclear Information System (INIS)

    Kang, Min-Gu; Kim, Hye-Ran; Seo, Bo-Young; Lee, Jun Hyung; Choi, Seok-Yong; Kim, Soo-Hyun; Shin, Jong-Hee; Suh, Soon-Pal; Ahn, Jae-Sook; Shin, Myung-Geun


    Mutations in genes that are part of the splicing machinery for myelodysplastic syndromes (MDS), including MDS without ring sideroblasts (RS), have been widely investigated. The effects of these mutations on clinical outcomes have been diverse and contrasting. We examined a cohort of 129 de novo MDS patients, who did not harbor RS, for mutations affecting three spliceosomal genes (SF3B1, U2AF1, and SRSF2). The mutation rates of SF3B1, U2AF1, and SRSF2 were 7.0 %, 7.8 %, and 10.1 %, respectively. Compared with previously reported results, these rates were relatively infrequent. The SRSF2 mutation strongly correlated with old age (P < 0.001), while the mutation status of SF3B1 did not affect overall survival (OS), progression-free survival (PFS), or acute myeloid leukemia (AML) transformation. In contrast, MDS patients with mutations in U2AF1 or SRSF2 exhibited inferior PFS. The U2AF1 mutation was associated with inferior OS in low-risk MDS patients (P = 0.035). The SRSF2 mutation was somewhat associated with AML transformation (P = 0.083). Our findings suggest that the frequencies of the SF3B1, U2AF1, and SRSF2 splicing gene mutations in MDS without RS were relatively low. We also demonstrated that the U2AF1 and SRSF2 mutations were associated with an unfavorable prognostic impact in MDS patients without RS. The online version of this article (doi:10.1186/s12885-015-1493-5) contains supplementary material, which is available to authorized users

  12. Vitamin D receptor gene polymorphisms and risk of polycystic ovary syndrome in South Indian women. (United States)

    Siddamalla, Swapna; Reddy, Tumu Venkat; Govatati, Suresh; Erram, Nagendram; Deenadayal, Mamata; Shivaji, Sisinthy; Bhanoori, Manjula


    Polycystic ovary syndrome (PCOS) is the most common endocrine disorder of reproductive age women. Emerging evidence suggests that Vitamin D Receptor (VDR) might be a causal factor for characteristics associated with PCOS such as obesity and type 2 diabetes. Present study investigated association between VDR gene BsmI A/G (rs1544410), ApaI A/C (rs7975232) and TaqI T/C (rs731236) single nucleotide polymorphisms and PCOS risk in South Indian women. Genotyping of VDR gene SNPs was carried out in PCOS patients (n = 95) and controls (n = 130) by PCR-RFLP method and confirmed by sequencing analysis. Haplotype frequencies for multiple loci and the standardized disequilibrium coefficient (D') for pairwise linkage disequilibrium (LD) were assessed by Haploview software. Results showed significantly increased frequencies of BsmI G/G (p = .0197), ApaI C/C (p = .048), TaqI C/C (p = .044) genotypes and BsmI G (p = .0181), ApaI C (p = .0092), TaqI C (p = .0066) alleles in patients compared to controls. In addition, the frequency of the 'BsmI G, ApaI C, TaqI C' haplotype was also significantly elevated in patients (p = .0087). In conclusion, the VDR gene BsmI A/G ApaI A/C TaqI T/C and haplotype may constitute an inheritable risk factor for PCOS in South Indian women.

  13. Nonsense mutations in the PAX3 gene cause Waardenburg syndrome type I in two Chinese patients. (United States)

    Yang, Shu-Zhi; Cao, Ju-Yang; Zhang, Rui-Ning; Liu, Li-Xian; Liu, Xin; Zhang, Xin; Kang, Dong-Yang; Li, Mei; Han, Dong-Yi; Yuan, Hui-Jun; Yang, Wei-Yan


    Waardenburg syndrome type I (WS1) is an autosomal dominant disorder characterized by sensorineural hearing loss, pigmental abnormalities of the eye, hair and skin, and dystopia canthorum. The gene mainly responsible for WS1 is PAX3 which is involved in melanocytic development and survival. Mutations of PAX3 have been reported in familiar or sporadic patients with WS1 in several populations of the world except Chinese. In order to explore the genetic background of Chinese WS1 patients, a mutation screening of PAX3 gene was carried out in four WS1 pedigrees. A questionnaire survey and comprehensive clinical examination were conducted in four Chinese pedigrees of WS1. Genomic DNA from each patient and their family members was extracted and exons of PAX3 were amplified by PCR. PCR fragments were ethanol-purified and sequenced in both directions on an ABI_Prism 3100 DNA sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit. The sequences were obtained and aligned to the wild type sequence of PAX3 with the GeneTool program. Two nonsense PAX3 mutations have been found in the study population. One is heterozygous for a novel nonsense mutation S209X. The other is heterozygous for a previously reported mutation in European population R223X. Both mutations create stop codons leading to truncation of the PAX3 protein. This is the first demonstration of PAX3 mutations in Chinese WS1 patients and one of the few examples of an identical mutation of PAX3 occurred in different populations.

  14. Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

    Energy Technology Data Exchange (ETDEWEB)

    Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others


    Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC, results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

  15. [Application of MALDI-TOF-MS in gene testing for non-syndromic hearing loss]. (United States)

    Zeng, Yun; Jiang, Dan; Feng, Da-fei; Jin, Dong-dong; Wu, Xiao-hui; Ding, Yan-li; Zou, Jing


    To investigate the feasibility of Matrix-Assisted Laser Desorption-Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS) , according to the genetic test of non-syndromic hearing loss (NSHL), and check using the direct sequencing. Peripheral blood was collected from 454 NSHL patients. DNA samples were extracted and 20 loci of the four common disease-causing genes were analysed by MALDI-TOF-MS, including GJB2 (35delG, 167delT, 176_191del16, 235delC, 299_300delAT ), GJB3 (538C→T, 547G→A), SLC26A4 (281C→T, 589G→A, IVS7-2A→G, 1174A→T, 1226G→A, 1229C→T, IVS15+5G→A, 1975G→C, 2027T→A, 2162C→T, 2168A→G), and mitochondrial 12S rRNA (1494C→T, 1555A→G). Direct sequencing was also used to analyse the aforementioned 20 loci in order to validate the accuracy of MALDI-TOF-MS. Among the 454 patients, 166 cases (36.56%) of disease-causing mutations were detected, which included 69 cases (21.15%) of GJB2 gene mutation, four cases (0.88%) of GJB3 gene mutation, 64 cases (14.10%) of SLC26A4 gene mutation, and three cases (0.66%) of mitochondrial 12S rRNA gene mutation. Moreover, the results obtained from direct sequencing and MALDI-TOF-MS were consistent, and the results showed that the two methods were consistent. The MALDI-TOF-MS detection method was designed based on the hearing loss-related mutation hotspots seen in the Chinese population, and it has a high detection rate for NSHL related mutations. In comparison to the conventional detection methods, MALDI-TOF-MS has the following advantages: more detection sites, greater coverage, accurate, high throughput and low cost. Therefore, this method is capable of satisfying the needs of clinical detection for hearing impairment and it is suitable for large-scale implementation.

  16. Association between Two Resistin Gene Polymorphisms and Metabolic Syndrome in Jilin, Northeast China: A Case-Control Study

    Directory of Open Access Journals (Sweden)

    Yingli Fu


    Full Text Available Metabolic syndrome (MetS is a significant health care problem worldwide and is characterized by increased fasting glucose and obesity. Resistin is a protein hormone produced both by adipocytes and immunocompetent cells, including those residing in adipose tissue, and is believed to modulate glucose tolerance and insulin action. This study examined the association of resistin gene polymorphisms, rs1862513 and rs3745368, and related haplotypes with the development of metabolic syndrome in a Han Chinese population. This case-control study was performed on 3792 subjects, including 1771 MetS cases and 2021 healthy controls from the Jilin province of China. Metabolic syndrome was defined according to the criteria of the International Diabetes Federation (IDF. Logistic regression analysis was used to estimate the relationship between gene polymorphism and MetS. Our results showed that there were no significant associations between MetS and the genotype distributions in four kinds of inheritance models, allele frequencies, and related haplotypes of resistin gene polymorphisms rs1862513 and rs3745368 (all p values > 0.05. Based on our study findings, we concluded that mutations in resistin genes are not associated with the presence of MetS in a Han Chinese population from Jilin province in China.

  17. Identification of 51 novel exons of the Usher syndrome type 2A (USH2A) gene that encode multiple conserved functional domains and that are mutated in patients with Usher syndrome type II.

    NARCIS (Netherlands)

    Wijk, E. van; Pennings, R.J.E.; Brinke, H. te; Claassen, A.M.W.; Yntema, H.G.; Hoefsloot, L.H.; Cremers, F.P.M.; Cremers, C.W.R.J.; Kremer, J.M.J.


    The USH2A gene is mutated in patients with Usher syndrome type IIa, which is the most common subtype of Usher syndrome and is characterized by hearing loss and retinitis pigmentosa. Since mutation analysis by DNA sequencing of exons 1-21 revealed only ~63% of the expected USH2A mutations, we

  18. Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I).


    Hoth, C F; Milunsky, A; Lipsky, N; Sheffer, R; Clarren, S K; Baldwin, C T


    Waardenburg syndrome type I (WS-I) is an autosomal dominant disorder characterized by sensorineural hearing loss, dystopia canthorum, pigmentary disturbances, and other developmental defects. Klein-Waardenburg syndrome (WS-III) is a disorder with many of the same characteristics as WS-I and includes musculoskeletal abnormalities. We have recently reported the identification and characterization of one of the first gene defects, in the human PAX3 gene, which causes WS-I. PAX3 is a DNA-binding ...

  19. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera. (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross


    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  20. Bloom's syndrome. VI. The disorder in Israel and an estimation of the gene frequency in the Ashkenazim. (United States)

    German, J; Bloom, D; Passarge, E; Fried, K; Goodman, R M; Katzenellenbogen, I; Laron, Z; Legum, C; Levin, S; Wahrman


    An effort was made to identify all individuals with Bloom's syndrome living in Israel between September 1971 and September 1972. Each of the eight individuals located were Jewish and could readily be classified Ashkenazic. The frequency of the Bloom's syndrome gene in Ashkenazim was estimated to be .0042 (minimum), implying a heterozygote frequency greater than 1 in 120. A striking distortion of the sex ratio (M/F = 7.0) may have been due to underascertainment of affected females. One of the affected individuals ascertained during the survey subsequently has died from cancer, which is in keeping with the recognized cancer proneness of this condition. Four of the affected have married, but no conception is known to have occurred, which suggests that sub- or infertility is a feature of the syndrome. PMID:930922

  1. Ghrelin Gene Variants Influence on Metabolic Syndrome Components in Aged Spanish Population. (United States)

    Mora, Mireia; Adam, Victoria; Palomera, Elisabet; Blesa, Sebastian; Díaz, Gonzalo; Buquet, Xavier; Serra-Prat, Mateu; Martín-Escudero, Juan Carlos; Palanca, Ana; Chaves, Javier Felipe; Puig-Domingo, Manuel


    The role of genetic variations within the ghrelin gene on cardiometabolic profile and nutritional status is still not clear in humans, particularly in elderly people. We investigated six SNPs of the ghrelin gene and their relationship with metabolic syndrome (MS) components. 824 subjects (413 men/411 women, age 77.31±5.04) participating in the Mataró aging study (n = 310) and the Hortega study (n = 514) were analyzed. Anthropometric variables, ghrelin, lipids, glucose and blood pressure levels were measured, and distribution of SNPs -994CT (rs26312), -604GA (rs27647), -501AC (rs26802), R51Q (rs34911341), M72L (rs696217) and L90G (rs4684677) of the ghrelin gene evaluated. Genotypes were determined by multiplex PCR and SNaPshot minisequencing. MS (IDF criteria) was found in 54.9%. No association between any of the SNPs and levels of total fasting circulating ghrelin levels was found. C/A-A/A genotype of M72L was associated with increased risk of central obesity according to IDF criteria, while G/A-G/G genotypes of -604GA with reduced risk. A/A genotype of -501AC polymorphism was associated to decreased BMI. In relation to lipid profile, the same genotypes of -604GA were associated with increased total cholesterol and LDL-cholesterol and -501AC with reduced triglycerides. There were no associations with systolic or diastolic blood pressure levels or with hypertension, glucose levels or diabetes and ghrelin polymorphisms. However, G/G genotype of -604GA was associated with glucose >100 mg/dL. Haplotype analysis showed that only one haplotype is associated with increased risk of waist circumference and central obesity. The analysis of subjects by gender showed an important and different association of these polymorphisms regarding MS parameters. Ghrelin gene variants -604GA, -501AC and M72L are associated with certain components of MS, in particular to BMI and lipid profile in elderly Spanish subjects.

  2. Ghrelin Gene Variants Influence on Metabolic Syndrome Components in Aged Spanish Population.

    Directory of Open Access Journals (Sweden)

    Mireia Mora

    Full Text Available The role of genetic variations within the ghrelin gene on cardiometabolic profile and nutritional status is still not clear in humans, particularly in elderly people.We investigated six SNPs of the ghrelin gene and their relationship with metabolic syndrome (MS components.824 subjects (413 men/411 women, age 77.31±5.04 participating in the Mataró aging study (n = 310 and the Hortega study (n = 514 were analyzed. Anthropometric variables, ghrelin, lipids, glucose and blood pressure levels were measured, and distribution of SNPs -994CT (rs26312, -604GA (rs27647, -501AC (rs26802, R51Q (rs34911341, M72L (rs696217 and L90G (rs4684677 of the ghrelin gene evaluated. Genotypes were determined by multiplex PCR and SNaPshot minisequencing. MS (IDF criteria was found in 54.9%.No association between any of the SNPs and levels of total fasting circulating ghrelin levels was found. C/A-A/A genotype of M72L was associated with increased risk of central obesity according to IDF criteria, while G/A-G/G genotypes of -604GA with reduced risk. A/A genotype of -501AC polymorphism was associated to decreased BMI. In relation to lipid profile, the same genotypes of -604GA were associated with increased total cholesterol and LDL-cholesterol and -501AC with reduced triglycerides. There were no associations with systolic or diastolic blood pressure levels or with hypertension, glucose levels or diabetes and ghrelin polymorphisms. However, G/G genotype of -604GA was associated with glucose >100 mg/dL. Haplotype analysis showed that only one haplotype is associated with increased risk of waist circumference and central obesity. The analysis of subjects by gender showed an important and different association of these polymorphisms regarding MS parameters.Ghrelin gene variants -604GA, -501AC and M72L are associated with certain components of MS, in particular to BMI and lipid profile in elderly Spanish subjects.

  3. Computational analysis of TRAPPC9: candidate gene for autosomal recessive non-syndromic mental retardation. (United States)

    Khattak, Naureen Aslam; Mir, Asif


    Mental retardation (MR)/ intellectual disability (ID) is a neuro-developmental disorder characterized by a low intellectual quotient (IQ) and deficits in adaptive behavior related to everyday life tasks such as delayed language acquisition, social skills or self-help skills with onset before age 18. To date, a few genes (PRSS12, CRBN, CC2D1A, GRIK2, TUSC3, TRAPPC9, TECR, ST3GAL3, MED23, MAN1B1, NSUN1) for autosomal-recessive forms of non syndromic MR (NS-ARMR) have been identified and established in various families with ID. The recently reported candidate gene TRAPPC9 was selected for computational analysis to explore its potentially important role in pathology as it is the only gene for ID reported in more than five different familial cases worldwide. YASARA (12.4.1) was utilized to generate three dimensional structures of the candidate gene TRAPPC9. Hybrid structure prediction was employed. Crystal Structure of a Conserved Metalloprotein From Bacillus Cereus (3D19-C) was selected as best suitable template using position-specific iteration-BLAST. Template (3D19-C) parameters were based on E-value, Z-score and resolution and quality score of 0.32, -1.152, 2.30°A and 0.684 respectively. Model reliability showed 93.1% residues placed in the most favored region with 96.684 quality factor, and overall 0.20 G-factor (dihedrals 0.06 and covalent 0.39 respectively). Protein-Protein docking analysis demonstrated that TRAPPC9 showed strong interactions of the amino acid residues S(253), S(251), Y(256), G(243), D(131) with R(105), Q(425), W(226), N(255), S(233), its functional partner 1KBKB. Protein-protein interacting residues could facilitate the exploration of structural and functional outcomes of wild type and mutated TRAPCC9 protein. Actively involved residues can be used to elucidate the binding properties of the protein, and to develop drug therapy for NS-ARMR patients.

  4. Corticotropin-Releasing Hormone Receptor 2 Gene Variants in Irritable Bowel Syndrome.

    Directory of Open Access Journals (Sweden)

    Hazuki Komuro

    Full Text Available Corticotropin-releasing hormone (CRH plays an important role in the pathophysiology of irritable bowel syndrome (IBS and regulates the stress response through two CRH receptors (R1 and R2. Previously, we reported that a CRHR1 gene polymorphism (rs110402, rs242924, and rs7209436 and haplotypes were associated with IBS. However, the association between the CRHR2 gene and IBS was not investigated. We tested the hypothesis that genetic polymorphisms and haplotypes of CRHR2 are associated with IBS pathophysiology and negative emotion in IBS patients.A total of 142 IBS patients and 142 healthy controls participated in this study. Seven single nucleotide polymorphisms (SNPs of the CRHR2 gene (rs4722999, rs3779250, rs2240403, rs2267710, rs2190242, rs2284217, and rs2284220 were genotyped. Subjects' psychological states were evaluated using the Perceived-Stress Scale, the State-Trait Anxiety Inventory, and the Self-Rating Depression Scale.We found that rs4722999 and rs3779250, located in intronic region, were associated with IBS in terms of genotype frequency (rs4722999: P = 0.037; rs3779250: P = 0.017 and that the distribution of the major allele was significantly different between patients and controls. There was a significant group effect (controls vs. IBS, and a CRHR2 genotype effect was observed for three psychological scores, but the interaction was not significant. We found a haplotype of four SNPs (rs4722999, rs3779250, rs2240403, and rs2267710 and two SNPs (rs2284217 and rs2284220 in strong linkage disequilibrium (D' > 0.90. We also found that haplotypes of the CRHR2 gene were significantly different between IBS patients and controls and that they were associated with negative emotion.Our findings support the hypothesis that genetic polymorphisms and haplotypes of CRHR2 are related to IBS. In addition, we found associations between CRHR2 genotypes and haplotypes and negative emotion in IBS patients and controls. Further studies on IBS and the CRH

  5. ABCD syndrome is caused by a homozygous mutation in the EDNRB gene

    NARCIS (Netherlands)

    Verheij, JBGM; Kunze, J; Osinga, J; van Essen, AJ; Hofstra, RMW


    ABCD syndrome is an autosomal recessive syndrome characterized by albinism, black lock, cell migration disorder of the neurocytes of the gut (Hirschsprung disease [HSCR]), and deafness. This phenotype clearly overlaps with the features of the Shah-Waardenburg syndrome, comprising sensorineural

  6. IGF-I generation test in prepubertal children with Noonan syndrome due to mutations in the PTPN11 gene. (United States)

    Bertelloni, Silvano; Baroncelli, Giampiero I; Dati, Eleonora; Ghione, Silvia; Baldinotti, Fulvia; Toschi, Benedetta; Simi, Paolo


    Short stature represents one of the main features of children with Noonan syndrome. The reason for impaired growth remains largely unknown. To assess GH and IGF1 secretion in children with Noonan syndrome. 12 prepubertal children with Noonan syndrome due to mutations in the PTPN11 gene [7 males, 6 females; median age, years: 8.6 (range 5.1-13.4)] were studied; 12 prepubertal children with short stature (SS) [7 males, 5 females; median age, years: 8.1 (range 4.8-13.1)] served as the control group. GH secretion after arginine stimulation test; IGF1 generation test by measurement of IGF1 levels before and after recombinant GH (rGH) administration (0.05 mg/kg/day for 4 days). Baseline and stimulated peak values of GH were not significantly different between the two groups. At +120 minutes, GH levels remained significantly higher (p = 0.0121) in comparison with baseline values in children with Noonan syndrome. Baseline IGFI levels in patients and in SS controls were not significantly different, in contrast to values after the rGH generation test [205 ng/mL (interquartiles 138.2-252.5 ng/mL) and 284.5 ng/mL (interquartiles 172-476 ng/mL), respectively; p = 0.0248]. IGF1 values were significantly related to height (baseline: r = 773, p = 0.0320; peak: r = 0.591, p = 0.0428) in children with Noonan syndrome. Blunted increase of IGF1 after the rGH generation test was present in children with Noonan syndrome due to mutations in the PTPN11 gene in comparison with SS children. This finding may be due to partial GH resistance in the former likely related to altered Ras-MAPK signaling pathway.

  7. Polymorphisms in the LPL and CETP Genes and Haplotype in the ESR1 Gene Are Associated with Metabolic Syndrome in Women from Southwestern Mexico

    Directory of Open Access Journals (Sweden)

    José Ángel Cahua-Pablo


    Full Text Available Metabolic syndrome (MetS is a combination of metabolic disorders associated with an increased risk for cardiovascular disease (CVD. Studies in women reported associations between polymorphisms in ESR1, LPL and CETP genes and MetS. Our aim was to evaluate the association between variants in ESR1, LPL and CETP genes with MetS and its components. Four hundred and eighty women were analyzed, anthropometric features and biochemical profiles were evaluated, and genotyping was performed by real-time PCR. We found an association with elevated glucose levels (odds ratio (OR = 2.9; p = 0.013 in carrying the AA genotype of rs1884051 in the ESR1 gene compared with the GG genotype, and the CC genotype of rs328 in the LPL gene was associated with MetS compared to the CG or GG genotype (OR = 2.8; p = 0.04. Moreover, the GA genotype of rs708272 in the CETP gene is associated with MetS compared to the GG or AA genotype (OR = 1.8; p = 0.006. In addition the ACTCCG haplotype in the ESR1 gene is associated with a decrease in the risk of MetS (OR = 0.02; p < 0.001. In conclusion, our results show the involvement of the variants of ESR1, LPL and CETP genes in metabolic events related to MetS or some of its features.

  8. Novel mutations in the long isoform of the USH2A gene in patients with Usher syndrome type II or non-syndromic retinitis pigmentosa. (United States)

    McGee, Terri L; Seyedahmadi, Babak Jian; Sweeney, Meredith O; Dryja, Thaddeus P; Berson, Eliot L


    Usher syndrome type II (USH2) is an autosomal recessive disorder characterised by retinitis pigmentosa (RP) and mild to moderate sensorineural hearing loss. Mutations in the USH2A gene are the most common cause of USH2 and are also a cause of some forms of RP without hearing loss (ie, non-syndromic RP). The USH2A gene was initially identified as a transcript comprised of 21 exons but subsequently a longer isoform containing 72 exons was identified. The 51 exons unique to the long isoform of USH2A were screened for mutations among a core set of 108 patients diagnosed with USH2 and 80 patients with non-syndromic RP who were all included in a previously reported screen of the short isoform of USH2A. For several exons, additional patients were screened. In total, 35 deleterious mutations were identified including 17 nonsense mutations, 9 frameshift mutations, 5 splice-site mutations, and 4 small in-frame deletions or insertions. Twenty-seven mutations were novel. In addition, 65 rare missense changes were identified. A method of classifying the deleterious effect of the missense changes was developed using the summed results of four different mutation assessment algorithms, SIFT, pMUT, PolyPhen, and AGVGD. This system classified 8 of the 65 changes as 'likely deleterious' and 9 as 'possibly deleterious'. At least one mutation was identified in 57-63% of USH2 cases and 19-23% of cases of non-syndromic recessive RP (calculated without and including probable/possible deleterious changes) thus supporting that USH2A is the most common known cause of RP in the USA.

  9. Novel mutations in cyclin-dependent kinase-like 5 (CDKL5) gene in Indian cases of Rett syndrome. (United States)

    Das, Dhanjit Kumar; Mehta, Bhakti; Menon, Shyla R; Raha, Sarbani; Udani, Vrajesh


    Rett syndrome is a severe neurodevelopmental disorder, almost exclusively affecting females and characterized by a wide spectrum of clinical manifestations. Both the classic and atypical forms of Rett syndrome are primarily due to mutations in the methyl-CpG-binding protein 2 (MECP2) gene. Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been identified in patients with atypical Rett syndrome, X-linked infantile spasms sharing common features of generally early-onset seizures and mental retardation. CDKL5 is known as serine/threonine protein kinase 9 (STK9) and is mapped to the Xp22 region. It has a conserved serine/threonine kinase domain within its amino terminus and a large C-terminal region. Disease-causing mutations are distributed in both the amino terminal domain and in the large C-terminal domain. We have screened the CDKL5 gene in 44 patients with atypical Rett syndrome who had tested negative for MECP2 gene mutations and have identified 6 sequence variants, out of which three were novel and three known mutations. Two of these novel mutations p.V966I and p.A1011V were missense and p.H589H a silent mutation. Other known mutations identified were p.V999M, p.Q791P and p.T734A. Sequence homology for all the mutations revealed that the two mutations (p.Q791P and p.T734A) were conserved across species. This indicated the importance of these residues in structure and function of the protein. The damaging effects of these mutations were analysed in silico using PolyPhen-2 online software. The PolyPhen-2 scores of p.Q791P and p.T734A were 0.998 and 0.48, revealing that these mutations could be deleterious and might have potential functional effect. All other mutations had a low score suggesting that they might not alter the activity of CDKL5. We have also analysed the position of the mutations in the CDKL5 protein and found that all the mutations were present in the C-terminal domain of the protein. The C-terminal domain is required for

  10. Severe manifestation of Bartter syndrome Type IV caused by a novel insertion mutation in the BSND gene. (United States)

    de Pablos, Augusto Luque; García-Nieto, Victor; López-Menchero, Jesús C; Ramos-Trujillo, Elena; González-Acosta, Hilaria; Claverie-Martín, Félix


    Bartter syndrome Type IV is a rare subtype of the Bartter syndromes that leads to both severe renal salt wasting and sensorineural deafness. This autosomal recessive disease is caused by mutations in the gene encoding barttin, BSND, an essential subunit of the ClC-K chloride channels expressed in renal and inner ear epithelia. Patients differ in the severity of renal symptoms, which appears to depend on the modification of channel function by the mutant barttin. To date, only a few BSND mutations have been reported, most of which are missense or nonsense mutations. In this study, we report the identification of the first insertion mutation, p.W102Vfs*7, in the BSND gene of a newborn girl with acute clinical symptoms including early-onset chronic renal failure. The results support previous data indicating that mutations that are predicted to abolish barttin expression are associated with a severe phenotype and early onset renal failure.

  11. A novel mutation in the NOD2 gene associated with Blau syndrome: a Norwegian family with four affected members

    DEFF Research Database (Denmark)

    Milman, N; Ursin, K; Rødevand, E


    BACKGROUND: Blau syndrome is a chronic granulomatous disease with an autosomal dominant trait characterized by the triad granulomatous dermatitis, arthritis, and uveitis. It is caused by mutations in the NOD2 gene, also termed the CARD15 gene. OBJECTIVE: To report a novel mutation in the NOD2 gen...... with an autosomal dominant heritage. Most likely the mutation has arisen de novo in the proband. Genetic counselling and antenatal diagnostics should be available to the involved families....... associated with Blau syndrome. METHODS AND RESULTS: The proband was a 68-year-old ethnic Norwegian male who had uveitis and arthritis since 10 years of age followed by lifelong recurrent arthritis and chronic eye involvement. Genetic analysis showed a heterozygous c.1814 C>A, T605N mutation in NOD2 that has...

  12. Intragenic deletions affecting two alternative transcripts of the IMMP2L gene in patients with Tourette syndrome (United States)

    Bertelsen, Birgitte; Melchior, Linea; Jensen, Lars R; Groth, Camilla; Glenthøj, Birte; Rizzo, Renata; Debes, Nanette Mol; Skov, Liselotte; Brøndum-Nielsen, Karen; Paschou, Peristera; Silahtaroglu, Asli; Tümer, Zeynep


    Tourette syndrome is a neurodevelopmental disorder characterized by multiple motor and vocal tics, and the disorder is often accompanied by comorbidities such as attention-deficit hyperactivity-disorder and obsessive compulsive disorder. Tourette syndrome has a complex etiology, but the underlying environmental and genetic factors are largely unknown. IMMP2L (inner mitochondrial membrane peptidase, subunit 2) located on chromosome 7q31 is one of the genes suggested as a susceptibility factor in disease pathogenesis. Through screening of a Danish cohort comprising 188 unrelated Tourette syndrome patients for copy number variations, we identified seven patients with intragenic IMMP2L deletions (3.7%), and this frequency was significantly higher (P=0.0447) compared with a Danish control cohort (0.9%). Four of the seven deletions identified did not include any known exons of IMMP2L, but were within intron 3. These deletions were found to affect a shorter IMMP2L mRNA species with two alternative 5′-exons (one including the ATG start codon). We showed that both transcripts (long and short) were expressed in several brain regions, with a particularly high expression in cerebellum and hippocampus. The current findings give further evidence for the role of IMMP2L as a susceptibility factor in Tourette syndrome and suggest that intronic changes in disease susceptibility genes should be investigated further for presence of alternatively spliced exons. PMID:24549057

  13. Triple-A syndrome with prominent ophthalmic features and a novel mutation in the AAAS gene: a case report

    Directory of Open Access Journals (Sweden)

    Stuart Caroline


    Full Text Available Abstract Background Triple-A syndrome (Allgrove syndrome is an autosomal recessive disorder characterized by adrenal insufficiency, alacrima, achalasia, and – occasionally – autonomic instability. Mutations have been found in the AAAS gene on 12q13. Case presentation We present the case of a 12 year-old boy with classic systemic features of triple-A syndrome and several prominent ophthalmic features, including: accommodative spasm, dry eye, superficial punctate keratopathy, and pupillary hypersensitivity to dilute pilocarpine. MRI showed small lacrimal glands bilaterally. DNA sequencing of PCR-amplified fragments from the 16 exons of the AAAS gene revealed compound heterozygosity for a new, out-of-frame 5-bp deletion in exon 15, c1368-1372delGCTCA, and a previously-described nonsense mutation in exon 9, c938C>T, R286X. Conclusions In addition to known ophthalmic manifestations, triple-A syndrome can present with accommodative dysregulation and ocular signs of autonomic dysfunction.

  14. [Study on gene differential expressions of substance and energy metabolism in chronic superficial gastritis patients of Pi deficiency syndrome and of pi-wei hygropyrexia syndrome]. (United States)

    Yang, Ze-Min; Chen, Wei-Wen; Wang, Ying-Fang


    To analyze the metabolic levels of energy and substance in chronic superficial gastritis (CSG) patients of Pi deficiency syndrome (PDS) and of Pi-Wei hygropyrexia syndrome (PWHS), including lipid, protein, nucleic acid, carbohydrate, trace element, and energy metabolism, and to study the pathogenesis mechanism of PDS from substance and energy metabolisms. Recruited were 8 CSG patients who visited at First Affiliated Hospital of Guangzhou University of Traditional Chinese Medicine and Guangdong Provincial Hospital of Traditional Chinese Medicine from June 2004 to March 2005, including 4 patients of PDS and 4 of PWHS. Their gastric mucosae were used for experiments of DNA microarray. The dual-channel DNA microarray data were bioinformatically analyzed by BRB ArrayTools and IPA Software. Obtained were fifty-six differentially expressed genes involved in substance and energy metabolisms with the expression fold more than 2, including 11 genes up-regulated and 45 genes down-regulated. Of them, genes correlated to lipid metabolism included CRLS1, LRP11, FUT9, GPCPD1, PIGL, SULT1A4, B3GNT1, ST8SIA4, and ACADVL, mainly involved in the metabolic processes of fatty acid, cholesterol, phospholipids, and glycolipid. Genes correlated to protein metabolism included ASRGL1, AARSD1, EBNA1BP2, PUM2, MRPL52, C120RF65, PSMB8, PSME2, UBA7, RNF11, FBXO44, ZFYVE26, CHMP2A, SSR4, SNX4, RAB3B, RABL2A, GOLGA2, KDELR1, PHPT1, ACPP, PTPRF, CRKL, HDAC7, ADPRHL2, B3GNT1, ST8SIA4, DDOST, and FUT9, mainly involved in the biosynthesis processes of protein, ubiquitination, targeted transport and post-translation modification. Genes correlated to nucleic acid metabolism included DFFB, FLJ35220, TOP2A, SF3A3, CREB3, CRTC2, NR1D2, MED6, GTF2IRD1, C1ORF83, ZNF773, and ZMYND11, mainly involved in DNA replication and repair, transcription regulation. Genes correlated to carbohydrate metabolism included AGL, B3GNT1, FUT9, ST8SIA4, SULT1A4, DDOST, and PIGL, mainly involved in glucogen degradation and

  15. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family. (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy


    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  16. Mutation inactivation of Nijmegen breakage syndrome gene (NBS1 in hepatocellular carcinoma and intrahepatic cholangiocarcinoma.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available Nijmegen breakage syndrome (NBS with NBS1 germ-line mutation is a human autosomal recessive disease characterized by genomic instability and enhanced cancer predisposition. The NBS1 gene codes for a protein, Nbs1(p95/Nibrin, involved in the processing/repair of DNA double-strand breaks. Hepatocellular carcinoma (HCC is a complex and heterogeneous tumor with several genomic alterations. Recent studies have shown that heterozygous NBS1 mice exhibited a higher incidence of HCC than did wild-type mice. The objective of the present study is to assess whether NBS1 mutations play a role in the pathogenesis of human primary liver cancer, including HBV-associated HCC and intrahepatic cholangiocarcinoma (ICC. Eight missense NBS1 mutations were identified in six of 64 (9.4% HCCs and two of 18 (11.1% ICCs, whereas only one synonymous mutation was found in 89 control cases of cirrhosis and chronic hepatitis B. Analysis of the functional consequences of the identified NBS1 mutations in Mre11-binding domain showed loss of nuclear localization of Nbs1 partner Mre11, one of the hallmarks for Nbs1 deficiency, in one HCC and two ICCs with NBS1 mutations. Moreover, seven of the eight tumors with NBS1 mutations had at least one genetic alteration in the TP53 pathway, including TP53 mutation, MDM2 amplification, p14ARF homozygous deletion and promoter methylation, implying a synergistic effect of Nbs1 disruption and p53 inactivation. Our findings provide novel insight on the molecular pathogenesis of primary liver cancer characterized by mutation inactivation of NBS1, a DNA repair associated gene.

  17. Cone structure in patients with usher syndrome type III and mutations in the Clarin 1 gene. (United States)

    Ratnam, Kavitha; Västinsalo, Hanna; Roorda, Austin; Sankila, Eeva-Marja K; Duncan, Jacque L


    To study macular structure and function in patients with Usher syndrome type III (USH3) caused by mutations in the Clarin 1 gene (CLRN1). High-resolution macular images were obtained by adaptive optics scanning laser ophthalmoscopy and spectral domain optical coherence tomography in 3 patients with USH3 and were compared with those of age-similar control subjects. Vision function measures included best-corrected visual acuity, kinetic and static perimetry, and full-field electroretinography. Coding regions of the CLRN1 gene were sequenced. CLRN1 mutations were present in all the patients; a 20-year-old man showed compound heterozygous mutations (p.N48K and p.S188X), and 2 unrelated women aged 25 and 32 years had homozygous mutations (p.N48K). Best-corrected visual acuity ranged from 20/16 to 20/40, with scotomas beginning at 3° eccentricity. The inner segment-outer segment junction or the inner segment ellipsoid band was disrupted within 1° to 4° of the fovea, and the foveal inner and outer segment layers were significantly thinner than normal. Cones near the fovea in patients 1 and 2 showed normal spacing, and the preserved region ended abruptly. Retinal pigment epithelial cells were visible in patient 3 where cones were lost. Cones were observed centrally but not in regions with scotomas, and retinal pigment epithelial cells were visible in regions without cones in patients with CLRN1 mutations. High-resolution measures of retinal structure demonstrate patterns of cone loss associated with CLRN1 mutations. These findings provide insight into the effect of CLRN1 mutations on macular cone structure, which has implications for the development of treatments for USH3. Identifier: NCT00254605.

  18. Multi-exon deletions of the FBN1 gene in Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Schrijver Iris


    Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.

  19. Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome.

    Directory of Open Access Journals (Sweden)

    Samia Abdi

    Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by a dual sensory impairment affecting hearing and vision. USH is clinically and genetically heterogeneous. Ten different causal genes have been reported. We studied the molecular bases of the disease in 18 unrelated Algerian patients by targeted-exome sequencing, and identified the causal biallelic mutations in all of them: 16 patients carried the mutations at the homozygous state and 2 at the compound heterozygous state. Nine of the 17 different mutations detected in MYO7A (1 of 5 mutations, CDH23 (4 of 7 mutations, PCDH15 (1 mutation, USH1C (1 mutation, USH1G (1 mutation, and USH2A (1 of 2 mutations, had not been previously reported. The deleterious consequences of a missense mutation of CDH23 (p.Asp1501Asn and the in-frame single codon deletion in USH1G (p.Ala397del on the corresponding proteins were predicted from the solved 3D-structures of extracellular cadherin (EC domains of cadherin-23 and the sterile alpha motif (SAM domain of USH1G/sans, respectively. In addition, we were able to show that the USH1G mutation is likely to affect the binding interface between the SAM domain and USH1C/harmonin. This should spur the use of 3D-structures, not only of isolated protein domains, but also of protein-protein interaction interfaces, to predict the functional impact of mutations detected in the USH genes.

  20. Cone Structure in Patients With Usher Syndrome Type III and Mutations in the Clarin 1 Gene (United States)

    Ratnam, Kavitha; Västinsalo, Hanna; Roorda, Austin; Sankila, Eeva-Marja K.; Duncan, Jacque L.


    Objective To study macular structure and function in patients with Usher syndrome type III (USH3) caused by mutations in the Clarin 1 gene (CLRN1). Methods High-resolution macular images were obtained by adaptive optics scanning laser ophthalmoscopy and spectral domain optical coherence tomography in 3 patients with USH3 and were compared with those of age-similar control subjects. Vision function measures included best-corrected visual acuity, kinetic and static perimetry, and full-field electroretinography. Coding regions of the CLRN1 gene were sequenced. Results CLRN1 mutations were present in all the patients; a 20-year-old man showed compound heterozygous mutations (p.N48K and p.S188X), and 2 unrelated women aged 25 and 32 years had homozygous mutations (p.N48K). Best-corrected visual acuity ranged from 20/16 to 20/40, with scotomas beginning at 3° eccentricity. The inner segment-outer segment junction or the inner segment ellipsoid band was disrupted within 1° to 4° of the fovea, and the foveal inner and outer segment layers were significantly thinner than normal. Cones near the fovea in patients 1 and 2 showed normal spacing, and the preserved region ended abruptly. Retinal pigment epithelial cells were visible in patient 3 where cones were lost. Conclusions Cones were observed centrally but not in regions with scotomas, and retinal pigment epithelial cells were visible in regions without cones in patients with CLRN1 mutations. High-resolution measures of retinal structure demonstrate patterns of cone loss associated with CLRN1 mutations. Clinical Relevance These findings provide insight into the effect of CLRN1 mutations on macular cone structure, which has implications for the development of treatments for USH3. Trial Registration Identifier: NCT00254605 PMID:22964989

  1. Potential hot spot for de novo mutations in PTCH1 gene in Gorlin syndrome patients: a case report of twins from Croatia. (United States)

    Musani, Vesna; Ozretić, Petar; Trnski, Diana; Sabol, Maja; Poduje, Sanja; Tošić, Mateja; Šitum, Mirna; Levanat, Sonja


    We describe a case of twins with sporadic Gorlin syndrome. Both twins had common Gorlin syndrome features including calcification of the falx cerebri, multiple jaw keratocysts, and multiple basal cell carcinomas, but with different expressivity. One brother also had benign testicular mesothelioma. We propose this tumor type as a possible new feature of Gorlin syndrome. Gorlin syndrome is a rare autosomal dominant disorder characterized by both developmental abnormalities and cancer predisposition, with variable expression of various developmental abnormalities and different types of tumors. The syndrome is primarily caused by mutations in the Patched 1 (PTCH1) gene, although rare mutations of Patched 2 (PTCH2) or Suppressor of Fused (SUFU) genes have also been found. Neither founder mutations nor hot spot locations have been described for PTCH1 in Gorlin syndrome patients. Although de novo mutations of the PTCH1 gene occur in almost 50% of Gorlin syndrome cases, there are a few recurrent mutations. Our twin patients were carriers of a de novo mutation in the PTCH1 gene, c.3364_3365delAT (p.Met1122ValfsX22). This is, to our knowledge, the first Gorlin syndrome-causing mutation that has been reported four independent times in distant geographical locations. Therefore, we propose the location of the described mutation as a potential hot spot for mutations in PTCH1.

  2. Waardenburg Syndrome: description of two novel mutations in the PAX3 gene, one of which incompletely penetrant

    Directory of Open Access Journals (Sweden)

    Eliete Pardono


    Full Text Available We describe two different novel mutations in the PAX3 gene, detected in two families with cases of Waardenburg syndrome type I (WSI. The missense mutation detected in one family involved a single substitution in exon 2 (c.142 G > T and was present both in the affected individual and in his clinically normal father. The mutation found in the second family consisted of a deletion of 13 bases, c.764-776del(TTACCCTGACATT, in exon 5.

  3. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome


    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo


    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  4. The study of the patient and his parents' gene with thyroid hormone resistance syndrome with review of literature

    International Nuclear Information System (INIS)

    Yang Chenwei; Zhang Xi


    Objective: To study the genoty of a family of the thyroid hormone receptor β (TRβ) gene and the clinical representation in a patient with thyroid hormone resistance syndrome (THRS). Methods : The peripheral blood samples of the patient and her parents were collected, then DNA was isolated. PCR and direct sequencing techniques were performed to determine if there were mutations in their THRβ gene. Results: There was a point mutation in exon 3d TRβ of the patient and her father, there was a base inserting in the third exon of the third chromosome. Her mother was normal. Conclusion: THRS is a disease related to thyroid hormone receptor gene mutation. The final diagnosis of this disease depends on gene analysis. (authors)

  5. To Screen Inactivation Mutation of Exon 1 of FSHR Gene in Polycystic Ovarian Syndrome: A South Indian Cohort Study (United States)

    Sekar, Nishu; Yeole, Samiksha; Pradeep, Rashmi; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.


    Polycystic ovary syndrome is an endocrine disorder. Irregular menstrual cycle, acne, facial hair and elevated androgen levels are the most common signs for PCOS. PCOS has an estimated prevalence of 4-12% among reproductive age women, thus making it a forerunner in female infertility. FSHR plays an important role in FSH signaling pathway making it an important gene for PCOS. In this study, we aim to focus on any association between the FSHR gene and PCOS. Our study was to evaluate any polymorphism of exon 1 of FSHR gene associated with PCOS.PCR-RFLP technique was performed on the PCOS samples. Hormonal changes were found in the patients. Exon 1 inactivation mutation of FSHR gene was not observed in the patient sample. A study of this association needs to be done using large sample size.

  6. Heat stress and sudden infant death syndrome--stress gene expression after exposure to moderate heat stress

    DEFF Research Database (Denmark)

    Rohde, Marianne Cathrine; Corydon, Thomas Juhl; Hansen, Jakob


    The aim of the present study was to investigate stress gene expression in cultured primary fibroblasts established from Achilles tendons collected during autopsies from sudden infant death syndrome (SIDS) cases, and age-matched controls (infants dying in a traumatic event). Expression of 4 stress...... responsive genes, HSPA1B, HSPD1, HMOX1, and SOD2, was studied by quantitative reverse transcriptase PCR analysis of RNA purified from cells cultured under standard or various thermal stress conditions. The expression of all 4 genes was highly influenced by thermal stress in both SIDS and control cells. High...... interpersonal variance found in the SIDS group indicated that they represented a more heterogeneous group than controls. The SIDS group responded to thermal stress with a higher expression of the HSPA1B and HSPD1 genes compared to the control group, whereas no significant difference was observed...

  7. Novel mutations in the SOX10 gene in the first two Chinese cases of type IV Waardenburg syndrome. (United States)

    Jiang, Lu; Chen, Hongsheng; Jiang, Wen; Hu, Zhengmao; Mei, Lingyun; Xue, Jingjie; He, Chufeng; Liu, Yalan; Xia, Kun; Feng, Yong


    We analyzed the clinical features and family-related gene mutations for the first two Chinese cases of type IV Waardenburg syndrome (WS4). Two families were analyzed in this study. The analysis included a medical history, clinical analysis, a hearing test and a physical examination. In addition, the EDNRB, EDN3 and SOX10 genes were sequenced in order to identify the pathogenic mutation responsible for the WS4 observed in these patients. The two WS4 cases presented with high phenotypic variability. Two novel heterozygous mutations (c.254G>A and c.698-2A>T) in the SOX10 gene were detected. The mutations identified in the patients were not found in unaffected family members or in 200 unrelated control subjects. This is the first report of WS4 in Chinese patients. In addition, two novel mutations in SOX10 gene have been identified. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  8. Role of folate-homocysteine pathway gene polymorphisms and nutritional cofactors in Down syndrome: A triad study. (United States)

    Sukla, K K; Jaiswal, S K; Rai, A K; Mishra, O P; Gupta, V; Kumar, A; Raman, R


    Do gene-gene and gene-environment interactions in folate-homocysteine (Hcy) pathway have a predisposing role for Down syndrome (DS)? The study provides evidence that in addition to advanced age, maternal genotype, micronutrient deficiency and elevated Hcy levels, individually and in combination, are risk factors for Down syndrome. Polymorphisms in certain folate-Hcy-pathway genes (especially the T allele of MTHFR C677T), elevated Hcy and poor folate levels in mothers during pregnancy have been shown to be risk factors for Down syndrome in certain Asian populations (including the eastern region of India), while the same SNPs are not a risk factor in European populations. This conflicting situation alludes to differential gene-environment (nutrition) interactions in different populations which needs to be explored. Between 2008 and 2012, 151 Down syndrome triads and 200 age-matched controls (Control mothers n = 186) were included in the study. Seven polymorphisms in six genes of folate-Hcy metabolic pathway, along with Hcy, cysteine (Cys), vitamin B12 (vit-B12) and folate levels, were analysed and compared among the case and control groups. Genotyping was performed by the PCR-RFLP technique. Levels of homocysteine and cysteine were measured by HPLC while vitamin B12 and folate were estimated by chemiluminescence. We demonstrate that polymorphisms in the folate-Hcy pathway genes in mothers collectively constitute a genotypic risk for DS which is effectively modified by interactions among genes and by the environment affecting folate, Hcy and vitamin B12 levels. The study also supports the idea that these maternal risk factors provide an adaptive advantage during pregnancy supporting live birth of the DS child. Our inability to obtain genotype and nutritional assessments of unaffected siblings of the DS children was an important limitation of the study. Also, its confinement to a specific geographic region (the eastern part) of India, and relatively small sample size

  9. Ala397Asp mutation of myosin VIIA gene segregating in a Spanish family with type-Ib Usher syndrome. (United States)

    Espinós, C; Millán, J M; Sánchez, F; Beneyto, M; Nájera, C


    In the current study, 12 Spanish families affected by type-I Usher syndrome, that was previously linked to chromosome 11q, were screened for the presence of mutations in the N-terminal coding portion of the motor domain of the myosin VIIA gene by single-strand conformation polymorphism analysis of the first 14 exons. A mutation (Ala397Asp) segregating with the disease was identified, and several polymorphisms were also detected. It is presumed that the other USHIB mutations in these families could be located in the unscreened regions of the gene.

  10. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.


    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  11. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis. (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D


    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  12. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing. (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J


    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. Tietz/Waardenburg type 2A syndrome associated with posterior microphthalmos in two unrelated patients with novel MITF gene mutations. (United States)

    Cortés-González, Vianney; Zenteno, Juan Carlos; Guzmán-Sánchez, Martín; Giordano-Herrera, Verónica; Guadarrama-Vallejo, Dalia; Ruíz-Quintero, Narlly; Villanueva-Mendoza, Cristina


    Tietz syndrome and Waardenburg syndrome type 2A are allelic conditions caused by MITF mutations. Tietz syndrome is inherited in an autosomal dominant pattern and is characterized by congenital deafness and generalized skin, hair, and eye hypopigmentation, while Waardenburg syndrome type 2A typically includes variable degrees of sensorineural hearing loss and patches of de-pigmented skin, hair, and irides. In this paper, we report two unrelated families with MITF mutations. The first family showed an autosomal dominant pattern and variable expressivity. The second patient was isolated. MITF gene analysis in the first family demonstrated a c.648A>C heterozygous mutation in exon 8 c.648A>C; p. (R216S), while in the isolated patient, an apparently de novo heterozygous c.1183_1184insG truncating mutation was demonstrated in exon 10. All patients except one had bilateral reduced ocular anteroposterior axial length and a high hyperopic refractive error corresponding to posterior microphthalmos, features that have not been described as part of the disease. Our results suggest that posterior microphthalmos might be part of the clinical characteristics of Tietz/Waardenburg syndrome type 2A and expand both the clinical and molecular spectrum of the disease. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Waardenburg syndrome type II in a Chinese patient caused by a novel nonsense mutation in the SOX10 gene. (United States)

    Ma, Jing; Zhang, Tie-Song; Lin, Ken; Sun, Hao; Jiang, Hong-Chao; Yang, Yan-Li; Low, Fan; Gao, Ying-Qin; Ruan, Biao


    Waardenburg syndrome is a congenital genetic disorder. It is the most common type of syndromic hearing impairment with highly genetic heterogeneity and proved to be related by 6 genes as follows: PAX3, MITF, SNAI2, EDN3, EDNRB and SOX10. This article aims to identify the genetic causes of a Chinese WS child patient. A Chinese WS child was collected for clinical data collection by questionnaire survey. DNA samples of proband and his parents were extracted from peripheral blood samples. Six candidate genes were sequenced by the Trusight One sequencing panel on the illumina NextSeq 500 platform. A novel nonsense heterozygous mutation was found in the coding region of exon 2 in the SOX10 gene of proband. The novel nonsense heterozygous mutation could cause the replacement of the 55th lysine codon by stop codon (484T > C, C142R) and further more possibly cause terminating the protein translation in advance. However, both proband's parents had no mutation of genes above mentioned. The gene mutation of SOX10 [NM_006941.3 c.163A > T] is a novel nonsense mutation. No record of this mutation has been found in dbSNP, HGMD, 1000 Genomes Project, ClinVar and ESP6500 databases. It meets the condition of PS2 of strong evidence in 2015 ACMG Standards and Guidelines. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. 1p13.2 deletion displays clinical features overlapping Noonan syndrome, likely related to NRAS gene haploinsufficiency

    Directory of Open Access Journals (Sweden)

    Natália Duarte Linhares

    Full Text Available Abstract Deletion-induced hemizygosity may unmask deleterious autosomal recessive variants and be a cause of the phenotypic variability observed in microdeletion syndromes. We performed complete exome sequencing (WES analysis to examine this possibility in a patient with 1p13.2 microdeletion. Since the patient displayed clinical features suggestive of Noonan Syndrome (NS, we also used WES to rule out the presence of pathogenic variants in any of the genes associated with the different types of NS. We concluded that the clinical findings could be attributed solely to the 1p13.2 haploinsufficiency. Retrospective analysis of other nine reported patients with 1p13.2 microdeletions showed that six of them also presented some characteristics of NS. In all these cases, the deleted segment included the NRAS gene. Gain-of-function mutations of NRAS gene are causally related to NS type 6. Thus, it is conceivable that NRAS haploinsufficiency and gain-of-function mutations may have similar clinical consequences. The same phenomenon has been described for two other genes belonging to the Ras/MAPK pathway: MAP2K2 and SHOC2. In conclusion, we here report genotype-phenotype correlations in patients with chromosome 1p13.2 microdeletions and we propose that NRAS may be a critical gene for the NS characteristics in the patients.

  16. Associations between neurodevelopmental genes, neuroanatomy, and ultra high risk symptoms of psychosis in 22q11.2 deletion syndrome. (United States)

    Thompson, Carlie A; Karelis, Jason; Middleton, Frank A; Gentile, Karen; Coman, Ioana L; Radoeva, Petya D; Mehta, Rashi; Fremont, Wanda P; Antshel, Kevin M; Faraone, Stephen V; Kates, Wendy R


    22q11.2 deletion syndrome is a neurogenetic disorder resulting in the deletion of over 40 genes. Up to 40% of individuals with 22q11.2DS develop schizophrenia, though little is known about the underlying mechanisms. We hypothesized that allelic variation in functional polymorphisms in seven genes unique to the deleted region would affect lobar brain volumes, which would predict risk for psychosis in youth with 22q11.2DS. Participants included 56 individuals (30 males) with 22q11.2DS. Anatomic MR images were collected and processed using Freesurfer. Participants were genotyped for 10 SNPs in the COMT, DGCR8, GNB1L, PIK4CA, PRODH, RTN4R, and ZDHHC8 genes. All subjects were assessed for ultra high risk symptoms of psychosis. Allelic variation of the rs701428 SNP of RTN4R was significantly associated with volumetric differences in gray matter of the lingual gyrus and cuneus of the occipital lobe. Moreover, occipital gray matter volumes were robustly associated with ultra high risk symptoms of psychosis in the presence of the G allele of rs701428. Our results suggest that RTN4R, a relatively under-studied gene at the 22q11 locus, constitutes a susceptibility gene for psychosis in individuals with this syndrome through its alteration of the architecture of the brain. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  17. Significant association between polymorphism of the erythropoietin gene promoter and myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    O'Brien Susan


    Full Text Available Abstract Background Myelodysplastic syndrome (MDS may be induced by certain mutagenic environmental or chemotherapeutic toxins; however, the role of susceptibility genes remains unclear. The G/G genotype of the single-nucleotide polymorphism (SNP rs1617640 in the erythropoietin (EPO promoter has been shown to be associated with decreased EPO expression. We examined the association of rs1617640 genotype with MDS. Methods We genotyped the EPO rS1617640 SNP in 189 patients with MDS, 257 with acute myeloid leukemia (AML, 106 with acute lymphoblastic leukemia, 97 with chronic lymphocytic leukemia, 353 with chronic myeloid leukemia, and 95 healthy controls. Results The G/G genotype was significantly more common in MDS patients (47/187; 25.1% than in controls (6/95; 6.3% or in patients with other leukemias (101/813; 12.4% (all P P = 0.03. Time to neutrophils recovery after therapy was significantly longer in MDS patients with the G/G genotype (P = 0.02. Conclusions These findings suggest a strong association between the rs1617640 G/G genotype and MDS. Further studies are warranted to investigate the utility of screening for this marker in individuals exposed to environmental toxins or chemotherapy.

  18. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients. (United States)

    Riahi, Zied; Bonnet, Crystel; Zainine, Rim; Lahbib, Saida; Bouyacoub, Yosra; Bechraoui, Rym; Marrakchi, Jihène; Hardelin, Jean-Pierre; Louha, Malek; Largueche, Leila; Ben Yahia, Salim; Kheirallah, Moncef; Elmatri, Leila; Besbes, Ghazi; Abdelhak, Sonia; Petit, Christine


    Usher syndrome (USH) is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3) are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys), in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24), and a nonsense mutation, c.52A>T (p.Lys18*). Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  19. Polymorphisms of interleukin-1β and MUC7 genes in burning mouth syndrome. (United States)

    Kim, Moon-Jong; Kim, Jihoon; Chang, Ji-Youn; Kim, Yoon-Young; Kho, Hong-Seop


    The objectives of the present study are to compare polymorphisms of the IL-1β and MUC7 genes between patients with burning mouth syndrome (BMS) and controls and to investigate relationships between these polymorphisms and clinical characteristics in BMS patients. Forty female BMS patients and 40 gender- and age-matched controls were included. Genomic DNA was extracted from saliva samples. Single-nucleotide polymorphisms of IL-1β -511 and +3954 and variation in number of tandem repeat (VNTR) polymorphism of MUC7 were analyzed. Relationships between genotypic polymorphism data and clinical characteristics in BMS patients were also analyzed. There were no significant differences in the genotypes of IL-1β -511 and +3954 and of MUC7 between the groups. There were no significant differences in symptom duration and intensity of BMS patients according to their IL-1β and MUC7 genotypes. The T allele of IL-1β -511 showed associations with psychometry results in BMS patients: paranoid ideation (P = 0.014), Global Severity Index (P = 0.025), and Positive Symptom Total (P = 0.008). The genotypic polymorphisms of IL-1β -511 and +3954, and of MUC7 VNTR, had no direct associations with the development of BMS. However, the T allele of IL-1β -511 may increase the risk of BMS by increasing psychological asthenia. The genotypic polymorphisms of IL-1β -511 may increase the risk for the development of BMS by increasing psychological asthenia.

  20. Whole exome sequencing identifies mutations in Usher syndrome genes in profoundly deaf Tunisian patients.

    Directory of Open Access Journals (Sweden)

    Zied Riahi

    Full Text Available Usher syndrome (USH is an autosomal recessive disorder characterized by combined deafness-blindness. It accounts for about 50% of all hereditary deafness blindness cases. Three clinical subtypes (USH1, USH2, and USH3 are described, of which USH1 is the most severe form, characterized by congenital profound deafness, constant vestibular dysfunction, and a prepubertal onset of retinitis pigmentosa. We performed whole exome sequencing in four unrelated Tunisian patients affected by apparently isolated, congenital profound deafness, with reportedly normal ocular fundus examination. Four biallelic mutations were identified in two USH1 genes: a splice acceptor site mutation, c.2283-1G>T, and a novel missense mutation, c.5434G>A (p.Glu1812Lys, in MYO7A, and two previously unreported mutations in USH1G, i.e. a frameshift mutation, c.1195_1196delAG (p.Leu399Alafs*24, and a nonsense mutation, c.52A>T (p.Lys18*. Another ophthalmological examination including optical coherence tomography actually showed the presence of retinitis pigmentosa in all the patients. Our findings provide evidence that USH is under-diagnosed in Tunisian deaf patients. Yet, early diagnosis of USH is of utmost importance because these patients should undergo cochlear implant surgery in early childhood, in anticipation of the visual loss.

  1. Metabolomics of the Wolfram Syndrome 1 Gene (Wfs1) Deficient Mice. (United States)

    Porosk, Rando; Terasmaa, Anton; Mahlapuu, Riina; Soomets, Ursel; Kilk, Kalle


    Wolfram syndrome 1 is a rare autosomal recessive neurodegenerative disease characterized by diabetes insipidus, diabetes mellitus, optic atrophy, and deafness. Mutations in the WFS1 gene encoding the wolframin glycoprotein can lead to endoplasmic reticulum stress and unfolded protein responses in cells, but the pathophysiology at whole organism level is poorly understood. In this study, several organs (heart, liver, kidneys, and pancreas) and bodily fluids (trunk blood and urine) of 2- and 6-month old Wfs1 knockout (KO), heterozygote (HZ), and wild-type (WT) mice were analyzed by untargeted and targeted metabolomics using liquid chromatography-mass spectrometry. The key findings were significant perturbations in the metabolism of pancreas and heart before the onset of related clinical signs such as glycosuria that precedes hyperglycemia and thus implies a kidney dysfunction before the onset of classical diabetic nephropathy. The glucose use and gluconeogenesis in KO mice are intensified in early stages, but later the energetic needs are mainly covered by lipolysis. Furthermore, in young mice liver and trunk blood hypouricemia, which in time turns to hyperuricemia, was detected. In summary, we show that the metabolism in Wfs1-deficient mice markedly differs from the metabolism of WT mice in many aspects and discuss the future biological and clinical relevance of these observations.

  2. Assignment of an Usher syndrome type III (USH3) gene to chromosome 3q. (United States)

    Sankila, E M; Pakarinen, L; Kääriäinen, H; Aittomäki, K; Karjalainen, S; Sistonen, P; de la Chapelle, A


    Usher syndrome (USH) refers to genetically and clinically heterogeneous autosomal recessive disorders with combined visual and hearing loss. Type I (USH1) is characterized by a congenital, severe to profound hearing loss and absent vestibular function; in type II (USH2) the hearing loss is congenital and moderate to severe, and the vestibular function is normal. Progressive pigmentary retinopathy (PPR) is present in both types. A third type (USH3) differing from USH2 by the progressive nature of its hearing loss has been suggested. USH3 has previously been estimated to comprise 2% of all USH. However, based on clinical criteria, in Finland 42% of USH patients have progressive hearing loss suggesting enrichment of an USH3 gene. We excluded the four previously mapped USH regions as the site of the USH3 disease locus. Systematic search for USH3 by genetic linkage analyses in 10 multiple affected families using polymorphic microsatellite markers revealed significant linkage with markers mapping to chromosome 3q. Pairwise lod scores at zero recombination distance were 7.87 for D3S1308, and 11.29 for D3S1299, incorporating the observed linkage disequilibrium. Conventional multipoint linkage analysis gave a maximum lod score of 9.88 at D3S1299 assigning USH3 to the 5 cM interval between markers D3S1555 and D3S1279 in 3q21-25.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Influence of white spot syndrome virus infection on hepatopancreas gene expression of `Huanghai No. 2' shrimp ( Fenneropenaeus chinensis) (United States)

    Meng, Xianhong; Shi, Xiaoli; Kong, Jie; Luan, Sheng; Luo, Kun; Cao, Baoxiang; Liu, Ning; Lu, Xia; Li, Xupeng; Deng, Kangyu; Cao, Jiawang; Zhang, Yingxue; Zhang, Hengheng


    To elucidate the molecular response of shrimp hepatopancreas to white spot syndrome virus (WSSV) infection, microarray was applied to investigate the differentially expressed genes in the hepatopancreas of `Huanghai No. 2' ( Fenneropenaeus chinensis). A total of 59137 unigenes were designed onto a custom-made 60K Agilent chip. After infection, the gene expression profiles in the hepatopancreas of the shrimp with a lower viral load at early (48-96 h), peak (168-192 h) and late (264-288 h) infection phases were analyzed. Of 18704 differentially expressed genes, 6412 were annotated. In total, 5453 differentially expressed genes (1916 annotated) expressed at all three phases, and most of the annotated were either up- or down-regulated continuously. These genes function diversely in, for example, immune response, cytoskeletal system, signal transduction, stress resistance, protein synthesis and processing, metabolism among others. Some of the immune-related genes, including antilipopolysaccharide factor, Kazal-type proteinase inhibitor, C-type lectin and serine protease encoding genes, were up-regulated after WSSV infection. These genes have been reported to be involved in the anti-WSSV responses. The expression of genes related to the cytoskeletal system, including β-actin and myosin but without tubulin genes, were down-regulated after WSSV infection. Astakine was found for the first time in the WSSV-infected F. chinensis. To further confirm the expression of differentially expressed genes, quantitative real-time PCR was performed to test the expression of eight randomly selected genes and verified the reliability and accuracy of the microarray expression analysis. The data will provide valuable information to understanding the immune mechanism of shrimp's response to WSSV.

  4. [Mutational frequencies in usherin(USH2A gene) in 26 Colombian individuals with Usher syndrome type II]. (United States)

    López, Greizy; Gelvez, Nancy Yaneth; Tamayo, Martalucía


    Usher syndrome is a disorder characterized by progressive retinitis pigmentosa, prelingual sensory hearing loss and vestibular dysfunction. It is the most frequent cause of deaf-blindness in humans. Three clinical types and twelve genetic subtypes have been characterized. Type II is the most common, and among these cases, nearly 80% have mutations in the USH2A gene. The aim of the study was to establish the mutational frequencies for the short isoform of USH2A gene in Usher syndrome type II. Twenty-six Colombian individuals with Usher syndrome type II were included. SSCP analysis for 20 exons of the short isoform was performed and abnormal patterns were sequenced. Sequencing of exon 13 of the USH2A gene was performed for all the individuals because the most frequent mutation is located in this exon. The most frequent mutation was c.2299delG, identified in the 27% (n=8) of the sample. The second mutation, p.R334W, showed a frequency of 15%. A new variant identified in the 5’UTR region, g.129G>T, was present in 1 individual (4%). Four polymorphisms were identified; one of them is a new deletion in exon 20, first reported in this study. Mutations in the usherin short isoform were identified in 38% of a sample of 26 USH2 cases. Molecular diagnosis was established in 7 of the 26.

  5. Growth hormone receptor (GHR) gene polymorphism and scoliosis in Prader-Willi syndrome. (United States)

    Butler, Merlin G; Hossain, Waheeda; Hassan, Maaz; Manzardo, Ann M


    A growth hormone receptor (GHR) gene polymorphism impacts sensitivity to endogenous and exogenous growth hormone (GH) to moderate growth and development. Increased sensitivity may accelerate spinal growth and contribute to scoliosis, particularly in GH-deficient and treated populations such as Prader-Willi syndrome (PWS). Therefore, we examined the relationship between GHR genotype and scoliosis (case and control) in PWS cohorts. We utilized a case-control design in a study of 73 subjects (34M; 39F) with genetically confirmed PWS in 32 individuals previously diagnosed with moderate to severe scoliosis (mean age=16.9±10.2years; age range of 1 to 41years) and 41 adults with no evidence of scoliosis (mean age=30.8±9.7years; age range of 18 to 56years). The GHR gene polymorphism was determined using PCR specific primers to capture the two recognized GHR gene fragment sizes [i.e., full length (fl) or exon 3 deletions (d3)]. Twenty-three (72%) of the 32 case subjects with scoliosis required surgical correction with an approximately equal balance for gender and PWS genetic subtype among cases and 41 control subjects without scoliosis. The GHR d3/d3 genotype was identified in N=2 of 8 (25%) cases with scoliosis and the d3/fl genotype was identified in N=11 of 25 (44%) cases with scoliosis but the distribution difference did not statistically differ. The GHR fl/fl genotype was correlated with a significantly faster rate and heavier weight gain among case subjects. Our examination of demographic and genetic markers associated with scoliosis and surgical repair in PWS found no evidence to support differences in gender, PWS genetic subtype or GHR d3 allele distributions among the case vs control groups. Those with fl/fl alleles were heavier than those with d3/d3 or d3/fl genotypes and warrant further study with a larger sample size and possibly to include other vulnerable populations requiring growth hormone treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Evidence of cardiac involvement in the fetal inflammatory response syndrome: disruption of gene networks programming cardiac development in nonhuman primates. (United States)

    Mitchell, Timothy; MacDonald, James W; Srinouanpranchanh, Sengkeo; Bammler, Theodor K; Merillat, Sean; Boldenow, Erica; Coleman, Michelle; Agnew, Kathy; Baldessari, Audrey; Stencel-Baerenwald, Jennifer E; Tisoncik-Go, Jennifer; Green, Richard R; Gale, Michael J; Rajagopal, Lakshmi; Adams Waldorf, Kristina M


    Most early preterm births are associated with intraamniotic infection and inflammation, which can lead to systemic inflammation in the fetus. The fetal inflammatory response syndrome describes elevations in the fetal interleukin-6 level, which is a marker for inflammation and fetal organ injury. An understanding of the effects of inflammation on fetal cardiac development may lead to insight into the fetal origins of adult cardiovascular disease. The purpose of this study was to determine whether the fetal inflammatory response syndrome is associated with disruptions in gene networks that program fetal cardiac development. We obtained fetal cardiac tissue after necropsy from a well-described pregnant nonhuman primate model (pigtail macaque, Macaca nemestrina) of intrauterine infection (n=5) and controls (n=5). Cases with the fetal inflammatory response syndrome (fetal plasma interleukin-6 >11 pg/mL) were induced by either choriodecidual inoculation of a hypervirulent group B streptococcus strain (n=4) or intraamniotic inoculation of Escherichia coli (n=1). RNA and protein were extracted from fetal hearts and profiled by microarray and Luminex (Millipore, Billerica, MA) for cytokine analysis, respectively. Results were validated by quantitative reverse transcriptase polymerase chain reaction. Statistical and bioinformatics analyses included single gene analysis, gene set analysis, Ingenuity Pathway Analysis (Qiagen, Valencia, CA), and Wilcoxon rank sum. Severe fetal inflammation developed in the context of intraamniotic infection and a disseminated bacterial infection in the fetus. Interleukin-6 and -8 in fetal cardiac tissues were elevated significantly in fetal inflammatory response syndrome cases vs controls (P1.5-fold change, P<.05) in the fetal heart (analysis of variance). Altered expression of select genes was validated by quantitative reverse transcriptase polymerase chain reaction that included several with known functions in cardiac injury, morphogenesis

  7. Apa-I polymorphism in VDR gene is related to metabolic syndrome in polycystic ovary syndrome: a cross-sectional study. (United States)

    Santos, Betânia Rodrigues; Lecke, Sheila Bunecker; Spritzer, Poli Mara


    Polycystic ovary syndrome (PCOS) is a common endocrine disorder determined by polygenic traits as well as environmental factors. Lower vitamin D levels have been detected in PCOS women and related to hormone and metabolic disturbances. Vitamin D acts in tissues through the vitamin D receptor (VDR). VDR gene variants have been associated with worse metabolic profile in the general population. We investigated the genotype and haplotype distribution of the Bsm-I (rs1544410), Apa-I (rs7975232), and Taq-I (rs731236) VDR gene polymorphisms in PCOS and non-hirsute women from southern Brazil. We further investigated the associations of these gene variants and their haplotypes with PCOS, vitamin D levels, and metabolic abnormalities, including the metabolic syndrome (MetS). A group of 191 women with PCOS (Rotterdam criteria) and 100 non-hirsute controls with regular ovulatory cycles were genotyped for all polymorphisms by real-time PCR, with allelic discrimination assays. MetS and the cutoffs for its isolated components were defined in accordance with the Joint Scientific Statement. Women with PCOS were younger and had significantly higher BMI and total testosterone levels than controls (p Apa-I entailed higher risk of MetS in PCOS (OR: 2.133; 95% CI 1.020-4.464, p = 0.042), and was associated with higher systolic blood pressure (p = 0.009), total cholesterol (p = 0.040), and LDL-cholesterol (p = 0.038) in both PCOS and control groups (two-way ANOVA). The frequencies of VDR haplotypes were similar in PCOS and control women. The present results suggest that the Apa-I variant in VDR gene may be associated with MetS in southern Brazilian women with PCOS, and with blood pressure, total cholesterol, and LDL-c in women with and without PCOS.

  8. Mediterranean dietary pattern and VEGF +405 G/C gene polymorphisms in patients with metabolic syndrome: An aspect of gene-nutrient interaction. (United States)

    Hajiluian, Ghazaleh; Abbasalizad Farhangi, Mahdieh; Jahangiry, Leila


    To evaluate the relationship between Mediterranean dietary pattern, anthropometric and metabolic biomarkers and vascular endothelial growth factor (VEGF) +405 G/C gene polymorphism in patient with metabolic syndrome (Mets). In this study 150 patients with Mets and 50 healthy subjects were enrolled. Dietary intakes were evaluated with a semi-quantitative food-frequency questionnaire (FFQ) and Mediterranean dietary quality index (Med-DQI) was assessed. Anthropometric assessments and blood pressure measurement were performed. Biochemical assays including fasting serum glucose (FSG), matrix metalloproteinase-3 (MMP-3), liver enzymes and lipid profiles were also assessed. Polymorphism of +405 G/C VEGF gene was determined utilizing polymerase chain reaction-restriction fragments length polymorphism (PCR-RFLP) method. Serum high density lipoprotein-cholesterol (HDL-C) was significantly lower and low density lipoprotein cholesterol (LDL-C), triglyceride (TG), total cholesterol (TC) concentrations and FSG were significantly higher in metabolic syndrome patients compared with control group (P consumption of "cholesterol" had significantly upper serum TG; also high consumption of "fish" and "vegetables-fruits" was associated with a significantly lower serum LDL concentrations. In metabolic syndrome patients with CC genotype, mean score of "saturated fatty acid" subgroup was significantly higher compared with other genotypes; whereas, in healthy individuals, mean score of "fruit-vegetable" subgroup in individuals of CC and GG genotype was significantly higher (P<0.05). Our findings indicated a significant relationship between Mediterranean dietary quality index and both anthropometric and metabolic risk factors. We also indicated a higher "saturated fatty acid" intake in CC genotype among metabolic syndrome patients.

  9. A novel mutation in the PAX3 gene causes Waardenburg syndrome type I in an Iranian family. (United States)

    Jalilian, Nazanin; Tabatabaiefar, Mohammad Amin; Farhadi, Mohammad; Bahrami, Tayyeb; Noori-Daloii, Mohammad Reza


    Sensorineural hearing impairment (HI) is one of the most frequent congenital defects, with a prevalence of 1 in 500 among neonates. Although there are over 400 syndromes involving HI, most cases of HI are nonsyndromic (70%), 20% of which follow autosomal dominant mode of inheritance. Waardenburg syndrome (WS) ranks first among autosomal dominant syndromic forms of HI. WS is characterized by sensorineural hearing impairment, pigmentation abnormalities of hair and skin and hypoplastic blue eyes or heterochromia iridis. WS is subdivided into four major types, WS1-WS4. WS1 is diagnosed by the presence of dystopia canthorum and PAX3 is the only gene involved. This study aims to determine the pathogenic mutation in a large Iranian pedigree affected with WS1 in order to further confirm the clinical diagnosis. In the present study, a family segregating HI was ascertained in a genetic counseling center. Upon clinical inspection, white forelock, dystopia canthorum, broad high nasal root and synophrys, characteristic of WS1 were evident. In order to clarify the genetic etiology and confirm the clinical data, primers were designed to amplify exons and exon-intron boundaries of the responsible gene, PAX3 with 10 exons, followed by the Sanger DNA sequencing method. Genetic analysis of PAX3 revealed a novel mutation in PAX3 (c.1024_1040 del AGCACGATTCCTTCCAA). Our data provide genotype-phenotype correlation for the mutation in PAX3 and WS1 in the studied family, with implications for genetic counseling, which necessitates detailed clinical inspection of HI patients to distinguish syndromic HI from the more common non-syndromic cases. Our results reveal the value of phenotype-directed genetic analysis and could further expand the spectrum of PAX3 mutations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Two White Spot Syndrome Virus MicroRNAs Target the Dorsal Gene To Promote Virus Infection in Marsupenaeus japonicus Shrimp. (United States)

    Ren, Qian; Huang, Xin; Cui, Yalei; Sun, Jiejie; Wang, Wen; Zhang, Xiaobo


    In eukaryotes, microRNAs (miRNAs) serve as regulators of many biological processes, including virus infection. An miRNA can generally target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs has not yet been extensively explored during virus infection. This study found that the Spaztle (Spz)-Toll-Dorsal-antilipopolysaccharide factor (ALF) signaling pathway plays a very important role in antiviral immunity against invasion of white spot syndrome virus (WSSV) in shrimp ( Marsupenaeus japonicus ). Dorsal , the central gene in the Toll pathway, was targeted by two viral miRNAs (WSSV-miR-N13 and WSSV-miR-N23) during WSSV infection. The regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo , leading to virus infection. Our study contributes novel insights into the viral miRNA-mediated Toll signaling pathway during the virus-host interaction. IMPORTANCE An miRNA can target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs during virus infection has not yet been extensively explored. The results of this study indicated that the shrimp Dorsal gene, the central gene in the Toll pathway, was targeted by two viral miRNAs during infection with white spot syndrome virus. Regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo , leading to virus infection. Our study provides new insight into the viral miRNA-mediated Toll signaling pathway in virus-host interactions. Copyright © 2017 American Society for Microbiology.

  11. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  12. Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation. (United States)

    Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong


    Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

  13. Gene p63: In ectrodactyly-ectodermal dysplasia clefting, ankyloblepharon-ectodermal dysplasia, Rapp-Hodgkin syndrome. (United States)

    van Straten, Cornelia; Butow, Kurt-W


    An analysis was made of three different syndromes associated with p63 gene mutations, known as ectrodactyly-ectodermal dysplasia-clefting syndrome (EEC), ankyloblepharon-ectodermal dysplasia clefting syndrome (AEC or Hay-Wells) and Rapp-Hodgkin syndrome (RHS). The postoperative complications associated with their cleft reconstructions were also evaluated. Extensive demographic information, in particular of the clinical appearances, associated malformations, and the types and complications of the reconstructive surgical procedures, were recorded of these syndromic cases occurring in a database of 3621 facial cleft deformity patients. The data was analyzed using the Microsoft Excel program. A total of 10 (0.28%) cases of p63 associated syndromes were recorded: EEC (6), RHS (3), and AEC (1). The following clinical cleft appearances were noted - EEC = 6: CLA 1 -right side unilateral (female); CLAP 4 - right side (1) + left side (1) unilateral (male + female); bilateral (2) (males); hPsP 1 (female) (divided in 3 Black, 2 White, 1 Indian); RHS = 3: CLAP 2 (White males); hPsP 1 (White female); AEC = 1: CLAP bilateral (White male). Other features of the syndromes were: skin, hand, foot, tooth, hair and nail involvement, and light sensitivity. Postoperative complications included: (i) stenosis of nasal opening, especially after reconstruction of the bilateral cleft lip and the columella lengthening (2 cases), (ii) premaxilla-prolabium fusion (2 cases), (iii) repeated occurrence of oro-nasal fistula in the hard palate (4 cases), and (iv) dysgnathial development of midfacial structures (3 cases). Three different p63 associated syndromes (EEC, AEC, and RHS) were diagnosed (0.27% of the total facial cleft deformities database). The majority of the cases presented with a bilateral CLAP in males only. A number of females and males had unilateral CLA. The hPsP-cleft was recorded in females only. The associated ectodermal component most probably had a profoundly negative influence

  14. Differential gene expression in granulosa cells from polycystic ovary syndrome patients with and without insulin resistance: identification of susceptibility gene sets through network analysis. (United States)

    Kaur, Surleen; Archer, Kellie J; Devi, M Gouri; Kriplani, Alka; Strauss, Jerome F; Singh, Rita


    Polycystic ovary syndrome (PCOS) is a heterogeneous, genetically complex, endocrine disorder of uncertain etiology in women. Our aim was to compare the gene expression profiles in stimulated granulosa cells of PCOS women with and without insulin resistance vs. matched controls. This study included 12 normal ovulatory women (controls), 12 women with PCOS without evidence for insulin resistance (PCOS non-IR), and 16 women with insulin resistance (PCOS-IR) undergoing in vitro fertilization. Granulosa cell gene expression profiling was accomplished using Affymetrix Human Genome-U133 arrays. Differentially expressed genes were classified according to gene ontology using ingenuity pathway analysis tools. Microarray results for selected genes were confirmed by real-time quantitative PCR. A total of 211 genes were differentially expressed in PCOS non-IR and PCOS-IR granulosa cells (fold change≥1.5; P≤0.001) vs. matched controls. Diabetes mellitus and inflammation genes were significantly increased in PCOS-IR patients. Real-time quantitative PCR confirmed higher expression of NCF2 (2.13-fold), TCF7L2 (1.92-fold), and SERPINA1 (5.35-fold). Increased expression of inflammation genes ITGAX (3.68-fold) and TAB2 (1.86-fold) was confirmed in PCOS non-IR. Different cardiometabolic disease genes were differentially expressed in the two groups. Decreased expression of CAV1 (-3.58-fold) in PCOS non-IR and SPARC (-1.88-fold) in PCOS-IR was confirmed. Differential expression of genes involved in TGF-β signaling (IGF2R, increased; and HAS2, decreased), and oxidative stress (TXNIP, increased) was confirmed in both groups. Microarray analysis demonstrated differential expression of genes linked to diabetes mellitus, inflammation, cardiovascular diseases, and infertility in the granulosa cells of PCOS women with and without insulin resistance. Because these dysregulated genes are also involved in oxidative stress, lipid metabolism, and insulin signaling, we hypothesize that these

  15. Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II. (United States)

    Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li


    Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. A novel mutation in the succinate dehydrogenase subunit D gene in siblings with the hereditary paraganglioma–pheochromocytoma syndrome

    Directory of Open Access Journals (Sweden)

    Chaithra Prasad


    Full Text Available Germline mutations in the succinate dehydrogenase complex subunit D gene are now known to be associated with hereditary paraganglioma–pheochromocytoma syndromes. Since the initial succinate dehydrogenase complex subunit D gene mutation was identified about a decade ago, more than 131 unique variants have been reported. We report the case of two siblings presenting with multiple paragangliomas and pheochromocytomas; they were both found to carry a mutation in the succinate dehydrogenase complex subunit D gene involving a substitution of thymine to guanine at nucleotide 236 in exon 3. This particular mutation of the succinate dehydrogenase complex subunit D gene has only been reported in one previous patient in Japan; this is, therefore, the first report of this pathogenic mutation in siblings and the first report of this mutation in North America. With continued screening of more individuals, we will be able to create a robust mutation database that can help us understand disease patterns associated with particular variants and may be a starting point in the development of new therapies for familial paraganglioma syndromes.

  17. Genomic profiling in Down syndrome acute lymphoblastic leukemia identifies histone gene deletions associated with altered methylation profiles (United States)

    Loudin, Michael G.; Wang, Jinhua; Leung, Hon-Chiu Eastwood; Gurusiddappa, Sivashankarappa; Meyer, Julia; Condos, Gregory; Morrison, Debra; Tsimelzon, Anna; Devidas, Meenakshi; Heerema, Nyla A.; Carroll, Andrew J.; Plon, Sharon E.; Hunger, Stephen P.; Basso, Giuseppe; Pession, Andrea; Bhojwani, Deepa; Carroll, William L.; Rabin, Karen R.


    Patients with Down syndrome (DS) and acute lymphoblastic leukemia (ALL) have distinct clinical and biological features. Whereas most DS-ALL cases lack the sentinel cytogenetic lesions that guide risk assignment in childhood ALL, JAK2 mutations and CRLF2 overexpression are highly enriched. To further characterize the unique biology of DS-ALL, we performed genome-wide profiling of 58 DS-ALL and 68 non-Down syndrome (NDS) ALL cases by DNA copy number, loss of heterozygosity, gene expression, and methylation analyses. We report a novel deletion within the 6p22 histone gene cluster as significantly more frequent in DS-ALL, occurring in 11 DS (22%) and only two NDS cases (3.1%) (Fisher’s exact p = 0.002). Homozygous deletions yielded significantly lower histone expression levels, and were associated with higher methylation levels, distinct spatial localization of methylated promoters, and enrichment of highly methylated genes for specific pathways and transcription factor binding motifs. Gene expression profiling demonstrated heterogeneity of DS-ALL cases overall, with supervised analysis defining a 45-transcript signature associated with CRLF2 overexpression. Further characterization of pathways associated with histone deletions may identify opportunities for novel targeted interventions. PMID:21647151

  18. Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations. (United States)

    Ponti, G; Ponz de Leon, M; Maffei, S; Pedroni, M; Losi, L; Di Gregorio, C; Gismondi, V; Scarselli, A; Benatti, P; Roncari, B; Seidenari, S; Pellacani, G; Varotti, C; Prete, E; Varesco, L; Roncucci, L


    Attenuated familial adenomatous polyposis and Muir-Torre syndrome linked to compound biallelic constitutional MYH gene mutations.Peculiar dermatologic manifestations are present in several heritable gastrointestinal disorders. Muir-Torre syndrome (MTS) is a genodermatosis whose peculiar feature is the presence of sebaceous gland tumors associated with visceral malignancies. We describe one patient in whom multiple sebaceous gland tumors were associated with early onset colon and thyroid cancers and attenuated polyposis coli. Her family history was positive for colonic adenomas. She had a daughter presenting with yellow papules in the forehead region developed in the late infancy. Skin and visceral neoplasms were tested for microsatellite instability and immunohistochemical status of mismatch repair (MMR), APC and MYH proteins. The proband colon and skin tumors were microsatellite stable and showed normal expression of MMR proteins. Cytoplasmic expression of MYH protein was revealed in colonic cancer cells. Compound heterozygosity due to biallelic mutations in MYH, R168H and 379delC, was identified in the proband. The 11-year-old daughter was carrier of the monoallelic constitutional mutation 379delC in the MYH gene; in the sister, the R168H MYH gene mutation was detected. This report presents an interesting case of association between MYH-associated polyposis and sebaceous gland tumors. These findings suggest that patients with MTS phenotype that include colonic polyposis should be screened for MYH gene mutations.

  19. Mutation update for the CSB/ERCC6 and CSA/ERCC8 genes involved in Cockayne syndrome. (United States)

    Laugel, V; Dalloz, C; Durand, M; Sauvanaud, F; Kristensen, U; Vincent, M C; Pasquier, L; Odent, S; Cormier-Daire, V; Gener, B; Tobias, E S; Tolmie, J L; Martin-Coignard, D; Drouin-Garraud, V; Heron, D; Journel, H; Raffo, E; Vigneron, J; Lyonnet, S; Murday, V; Gubser-Mercati, D; Funalot, B; Brueton, L; Sanchez Del Pozo, J; Muñoz, E; Gennery, A R; Salih, M; Noruzinia, M; Prescott, K; Ramos, L; Stark, Z; Fieggen, K; Chabrol, B; Sarda, P; Edery, P; Bloch-Zupan, A; Fawcett, H; Pham, D; Egly, J M; Lehmann, A R; Sarasin, A; Dollfus, H


    Cockayne syndrome is an autosomal recessive multisystem disorder characterized principally by neurological and sensory impairment, cachectic dwarfism, and photosensitivity. This rare disease is linked to mutations in the CSB/ERCC6 and CSA/ERCC8 genes encoding proteins involved in the transcription-coupled DNA repair pathway. The clinical spectrum of Cockayne syndrome encompasses a wide range of severity from severe prenatal forms to mild and late-onset presentations. We have reviewed the 45 published mutations in CSA and CSB to date and we report 43 new mutations in these genes together with the corresponding clinical data. Among the 84 reported kindreds, 52 (62%) have mutations in the CSB gene. Many types of mutations are scattered along the whole coding sequence of both genes, but clusters of missense mutations can be recognized and highlight the role of particular motifs in the proteins. Genotype-phenotype correlation hypotheses are considered with regard to these new molecular and clinical data. Additional cases of molecular prenatal diagnosis are reported and the strategy for prenatal testing is discussed. Two web-based locus-specific databases have been created to list all identified variants and to allow the inclusion of future reports ( and (c) 2009 Wiley-Liss, Inc.

  20. Mutations in the G6PC3 gene cause Dursun syndrome. (United States)

    Banka, Siddharth; Newman, William G; Ozgül, R Koksal; Dursun, Ali


    Dursun syndrome is a triad of familial primary pulmonary hypertension, leucopenia, and atrial septal defect. Here we demonstrate that mutations in G6PC3 cause Dursun syndrome. Mutations in G6PC3 are known to also cause severe congenital neutropenia type 4. Identification of the genetic basis of Dursun syndrome expands the pre-existing knowledge about the phenotypic effects of mutations in G6PC3. We propose that Dursun syndrome should now be considered as a subset of severe congenital neutropenia type 4 with pulmonary hypertension as an important clinical feature. Copyright © 2010 Wiley-Liss, Inc.

  1. Cancer spectrum in DNA mismatch repair gene mutation carriers: results from a hospital based Lynch syndrome registry. (United States)

    Pande, Mala; Wei, Chongjuan; Chen, Jinyun; Amos, Christopher I; Lynch, Patrick M; Lu, Karen H; Lucio, Laura A; Boyd-Rogers, Stephanie G; Bannon, Sarah A; Mork, Maureen E; Frazier, Marsha L


    The spectrum of cancers seen in a hospital based Lynch syndrome registry of mismatch repair gene mutation carriers was examined to determine the distribution of cancers and examine excess cancer risk. Overall there were 504 cancers recorded in 368 mutation carriers from 176 families. These included 236 (46.8 %) colorectal and 268 (53.2 %) extracolonic cancers. MLH1 mutation carriers had a higher frequency of colorectal cancers whereas MSH2, MSH6 and PMS2 mutation carriers had more extracolonic cancers although these differences were not statistically significant. Men had fewer extracolonic cancers than colorectal (45.3 vs. 54.7 %), whereas women had more extracolonic than colorectal cancers (59.0 vs. 41.0 %). The mean age at diagnosis overall for extracolonic cancers was older than for colorectal, 49.1 versus 44.8 years (P ≤ 0.001). As expected, the index cancer was colorectal in 58.1 % of patients and among the extracolonic index cancers, endometrial was the most common (13.8 %). A significant number of non-Lynch syndrome index cancers were recorded including breast (n = 5) prostate (n = 3), thyroid (n = 3), cervix (n = 3), melanoma (n = 3), and 1 case each of thymoma, sinus cavity, and adenocarcinoma of the lung. However, standardized incidence ratios calculated to assess excess cancer risk showed that only those cancers known to be associated with Lynch syndrome were significant in our sample. We found that Lynch syndrome patients can often present with cancers that are not considered part of Lynch syndrome. This has clinical relevance both for diagnosis of Lynch syndrome and surveillance for cancers of different sites during follow-up of these patients.

  2. Gene expression profiling in gill tissues of White spot syndrome virus infected black tiger shrimp Penaeus monodon by DNA microarray. (United States)

    Shekhar, M S; Gomathi, A; Gopikrishna, G; Ponniah, A G


    White spot syndrome virus (WSSV) continues to be the most devastating viral pathogen infecting penaeid shrimp the world over. The genome of WSSV has been deciphered and characterized from three geographical isolates and significant progress has been made in developing various molecular diagnostic methods to detect the virus. However, the information on host immune gene response to WSSV pathogenesis is limited. Microarray analysis was carried out as an approach to analyse the gene expression in black tiger shrimp Penaeus monodon in response to WSSV infection. Gill tissues collected from the WSSV infected shrimp at 6, 24, 48 h and moribund stage were analysed for differential gene expression. Shrimp cDNAs of 40,059 unique sequences were considered for designing the microarray chip. The Cy3-labeled cRNA derived from healthy and WSSV-infected shrimp was subjected to hybridization with all the DNA spots in the microarray which revealed 8,633 and 11,147 as up- and down-regulated genes respectively at different time intervals post infection. The altered expression of these numerous genes represented diverse functions such as immune response, osmoregulation, apoptosis, nucleic acid binding, energy and metabolism, signal transduction, stress response and molting. The changes in gene expression profiles observed by microarray analysis provides molecular insights and framework of genes which are up- and down-regulated at different time intervals during WSSV infection in shrimp. The microarray data was validated by Real Time analysis of four differentially expressed genes involved in apoptosis (translationally controlled tumor protein, inhibitor of apoptosis protein, ubiquitin conjugated enzyme E2 and caspase) for gene expression levels. The role of apoptosis related genes in WSSV infected shrimp is discussed herein.

  3. [Association analysis of SNP-63 and indel-19 variant in the calpain-10 gene with polycystic ovary syndrome in women of reproductive age]. (United States)

    Flores-Martínez, Silvia Esperanza; Castro-Martínez, Anna Gabriela; López-Quintero, Andrés; García-Zapién, Alejandra Guadalupe; Torres-Rodríguez, Ruth Noemí; Sánchez-Corona, José


    Polycystic ovary syndrome is a complex and heterogeneous disease involving both reproductive and metabolic problems. It has been suggested a genetic predisposition in the etiology of this syndrome. The identification of calpain-10 gene (CAPN10) as the first candidate gene for type 2 diabetes mellitus, has focused the interest in investigating their possible relation with the polycystic ovary syndrome, because this syndrome is associated with hyperinsulinemia and insulin resistance, two metabolic abnormalities associated with type 2 diabetes mellitus. To investigate if there is association between the SNP-63 and the variant indel-19 of the CAPN10 gene and polycystic ovary syndrome in women of reproductive age. This study included 101 women (55 with polycystic ovary syndrome and 46 without polycystic ovary syndrome). The genetic variant indel-19 was identified by electrophoresis of the amplified fragments by PCR, and the SNP-63 by PCR-RFLP. The allele and genotype frequencies of the two variants do not differ significatly between women with polycystic ovary syndrome and control women group. The haplotype 21 (defined by the insertion allele of indel-19 variant and C allele of SNP-63) was found with higher frequency in both study groups, being more frequent in the polycystic ovary syndrome patients group, however, this difference was not statistically significant (p = 0.8353). The results suggest that SNP-63 and indel-19 variant of the CAPN10 gene do not represent a risk factor for polycystic ovary syndrome in our patients group. Copyright © 2015. Published by Masson Doyma México S.A.

  4. Associations between metabolic syndrome, breast cancer recurrence, and the 21-gene recurrence score assay. (United States)

    Muniz, Jeanette; Kidwell, Kelley M; Henry, N Lynn


    The 21-gene recurrence score (RS) assay is prognostic in estrogen receptor-positive (HR+), HER2-negative, node-negative breast cancer (BC). The interaction between RS and host factors including metabolic syndrome (MS) is unclear. MS conditions such as obesity have been associated with worse BC prognosis. The aim of this study was to identify associations between presence of MS conditions and RS group or breast cancer recurrence. Demographic, pathologic, and treatment data, MS criteria, and menopausal status were abstracted from medical records of women with stage I-II, HR+, HER2-negative BC evaluated with the RS assay at a single institution since 2005. MS was defined as presence of ≥3 of the following within 2 years of diagnosis: body mass index ≥27.7 kg/m(2); hypertension; impaired fasting glucose; HDL <50 mg/dL; hypertriglyceridemia. Of 533 eligible women, 22 % had MS. MS was more common in post- vs premenopausal women (30 vs 9 %; P < 0.0001). There was no significant association between RS group and overall MS status or any individual criterion, controlling for stage, and no association after stratification by menopausal status. Postmenopausal status was associated with higher RS group (P = 0.039), independent of stage. With 4.2-year median follow-up, no association between disease recurrence and MS was identified. Although MS has been associated with worse BC outcomes, we were unable to identify associations between RS group and MS criteria. Identification of prognostic factors other than RS that underlie this higher risk will be important for optimizing breast cancer treatment decision-making in patients with MS.

  5. Association of luteinizing hormone chorionic gonadotropin receptor gene polymorphism (rs2293275) with polycystic ovarian syndrome. (United States)

    Thathapudi, Sujatha; Kodati, Vijayalakshmi; Erukkambattu, Jayashankar; Addepally, Uma; Qurratulain, Hasan


    Polycystic ovaries and irregular menstruation/anovulation are important diagnostic criteria along with hyperandrogenism as per the Androgen Excess Society-2006 criteria for polycystic ovarian syndrome (PCOS). In the etiopathogenesis of PCOS, one of the candidate genes causing ovarian failure is the luteinizing hormone (LH) chorionic gonadotropin hormone receptor (LHCGR). Our aim was to study the association of LHCGR polymorphism (rs2293275) with PCOS in our study population. Genetic case-control study from multiple gynecological centers from Hyderabad, a cosmopolitan city in South India. The study involved 204 women with PCOS and 204 healthy, sex-, and age-matched controls. Anthropometric and biochemical profiles were taken in a well-designed pro forma. Isolation of deoxyribonucleic acid (DNA) and genotype analysis were done for the entire study population using the polymerase chain reaction-restriction fragment length polymorphism method followed by 12% polyacrylamide gel electrophoresis. In this study, we have demonstrated an association between LHCGR (rs2293275) polymorphism and PCOS. The frequency of the G allele was 0.60 in PCOS and 0.49 in controls (odds ratio [OR] 1.531, confidence interval [CI] 1.16-2.01, and p-value=0.0026), which indicates that the G allele is associated with PCOS in our population. The GG genotype conferred a significant risk of developing PCOS (OR 3.36, CI 1.96-5.75, and p-value<0.0001). We found a significant association of the GG allele with body-mass index, waist to hip ratio, insulin resistance, LH, and LH/follicle-stimulating hormone (FSH) ratio in PCOS when compared with controls. The AA allele showed high basal FSH levels. This study suggests that LHCGR (rs2293275) polymorphism is associated with PCOS and could be used as a relevant molecular marker to identify women with the risk of developing PCOS in our population and may provide an understanding about the etiology of PCOS.

  6. New splice site acceptor mutation in AIRE gene in autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Mireia Mora

    Full Text Available Autoimmune polyglandular syndrome type 1 (APS-1, OMIM 240300 is a rare autosomal recessive disorder, characterized by the presence of at least two of three major diseases: hypoparathyroidism, Addison's disease, and chronic mucocutaneous candidiasis. We aim to identify the molecular defects and investigate the clinical and mutational characteristics in an index case and other members of a consanguineous family. We identified a novel homozygous mutation in the splice site acceptor (SSA of intron 5 (c.653-1G>A in two siblings with different clinical outcomes of APS-1. Coding DNA sequencing revealed that this AIRE mutation potentially compromised the recognition of the constitutive SSA of intron 5, splicing upstream onto a nearby cryptic SSA in intron 5. Surprisingly, the use of an alternative SSA entails the uncovering of a cryptic donor splice site in exon 5. This new transcript generates a truncated protein (p.A214fs67X containing the first 213 amino acids and followed by 68 aberrant amino acids. The mutation affects the proper splicing, not only at the acceptor but also at the donor splice site, highlighting the complexity of recognizing suitable splicing sites and the importance of sequencing the intron-exon junctions for a more precise molecular diagnosis and correct genetic counseling. As both siblings were carrying the same mutation but exhibited a different APS-1 onset, and one of the brothers was not clinically diagnosed, our finding highlights the possibility to suspect mutations in the AIRE gene in cases of childhood chronic candidiasis and/or hypoparathyroidism otherwise unexplained, especially when the phenotype is associated with other autoimmune diseases.

  7. SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome. (United States)

    Hanchate, Naresh Kumar; Giacobini, Paolo; Lhuillier, Pierre; Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine


    Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema) mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

  8. SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.

    Directory of Open Access Journals (Sweden)

    Naresh Kumar Hanchate


    Full Text Available Kallmann syndrome (KS associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31 and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H. All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H, which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

  9. A common polymorphism in a Williams syndrome gene predicts amygdala reactivity and extraversion in healthy adults (United States)

    Swartz, Johnna R.; Waller, Rebecca; Bogdan, Ryan; Knodt, Annchen R.; Sabhlok, Aditi; Hyde, Luke W.; Hariri, Ahmad R.


    Background Williams syndrome (WS), a genetic disorder resulting from hemizygous microdeletion of chromosome 7q11.23, has emerged as a model for identifying the genetic architecture of socioemotional behavior. Recently, common polymorphisms in GTF2I, which is found within the WS microdeletion, have been associated with reduced social anxiety in the general population. Identifying neural phenotypes affected by these polymorphisms will help advance our understanding not only of this specific genetic association but also the broader neurogenetic mechanisms of variability in socioemotional behavior. Methods Through an ongoing parent protocol, the Duke Neurogenetics Study, we measured threat-related amygdala reactivity to fearful and angry facial expressions using functional MRI (fMRI), assessed trait personality using the Revised NEO Personality Inventory, and imputed GTF2I rs13227433 from saliva-derived DNA using custom Illumina arrays. Participants included 808 non-Hispanic Caucasian, African American, and Asian university students. Results The GTF2I rs13227433 AA genotype, previously associated with lower social anxiety, predicted decreased threat-related amygdala reactivity. An indirect effect of GTF2I genotype on the warmth facet of extraversion was mediated by decreased threat-related amygdala reactivity in women but not men. Conclusions A common polymorphism in the WS gene GTF2I associated with reduced social anxiety predicts decreased threat-related amygdala reactivity, which mediates an association between genotype and increased warmth in women. These results are consistent with reduced threat-related amygdala reactivity in WS and suggest that common variation in GTF2I contributes to broader variability in socioemotional brain function and behavior, with implications for understanding the neurogenetic bases of WS as well as social anxiety. PMID:26853120

  10. Fluvastatin increases insulin-like growth factor-1 gene expression in rat model of metabolic syndrome

    International Nuclear Information System (INIS)

    Mansy, Wael H.; Sourour, Doaa A.; Shaker, Olfat G.; Mahfouz, Mahmoud M.


    Insulin-like growth factor-1 (IGF-1) was found to have a role in both glucose homeostasis and cardiovascular diseases. The present study was designed to compare the effects of fluvastatin and metformin on IGF-1 mRNA expression within the liver and other individual components of the metabolic syndrome induced in rats by high fructose feeding. Rats fed 60% fructose in diet for 6 weeks were treated daily with fluvastatin (3.75 mg/kg/day) during the last two weeks and were compared with untreated fructose fed group. Fasting levels of plasma cholesterol, triglyceride, glucose, insulin, nitric oxide products, IGF-1 mRNA within the liver as well as systolic blood pressure and body weight were determined. Compared to control rats, the fructose fed group developed hypertension, hyperlipidemia, hyperinsulinemia, hyperglycemia and endothelial dysfunction as well as decreased levels of plasma IGF-1 and its mRNA within the liver. Fructose fed rats treated with fluvastatin or metformin for 2 weeks showed significant decrease in plasma cholesterol, triglyceride, insulin and glucose levels compared to untreated fructose fed group. Also, both drugs increased significantly plasma levels of nitric oxide products and IGF-1 together with significant increase in IGF-1 mRNA within the liver. However, only metformin treated rats showed significant decrease in systolic blood pressure compared to fructose fed group. This study showed that in a rat model of insulin resistance, fluvastatin improves the metabolic profile and increases plasma level of IGF-1 and its gene expression as effective as metformin. (author)

  11. Alport Syndrome: De Novo Mutation in the COL4A5 Gene Converting Glycine 1205 to Valine

    Directory of Open Access Journals (Sweden)

    Pilar Antón-Martín


    Full Text Available Background Alport syndrome is a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family. It is a genetically heterogeneous disease with different mutations and forms of inheritance that presents with renal affection, hearing loss and eye defects. Several new mutations related to X-linked forms have been previously determined. Methods We report the case of a 12 years old male and his family diagnosed with Alport syndrome after genetic analysis was performed. Result Anew mutation determining a nucleotide change C.3614G > T (p. Gly1205Val in hemizygosis in the COL4A5 gene was found. This molecular defect has not been previously described. Conclusion Molecular biology has helped us to comprehend the mechanisms of pathophysiology in Alport syndrome. Genetic analysis provides the only conclusive diagnosis of the disorder at the moment. Our contribution with a new mutation further supports the need of more sophisticated molecular methods to increase the mutation detection rates with lower costs and less time.

  12. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II. (United States)

    Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa


    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome.

  13. The contribution of GPR98 and DFNB31 genes to a Spanish Usher syndrome type 2 cohort. (United States)

    García-García, Gema; Besnard, Thomas; Baux, David; Vaché, Christel; Aller, Elena; Malcolm, Sue; Claustres, Mireille; Millan, Jose M; Roux, Anne-Françoise


    Usher syndrome type 2 (USH2) is an autosomal recessive disease characterized by moderate to severe hearing loss and retinitis pigmentosa. To date, three disease-causing genes have been identified, USH2A, GPR98, and DFNB31, of which USH2A is clearly the major contributor. The aim of this work was to determine the contribution of GPR98 and DFNB31 genes in a Spanish cohort of USH2A negative patients using exhaustive molecular analysis, including sequencing, dosage, and splicing analysis. Linkage analysis was performed to prioritize the gene to study, followed by sequencing of exons and intron-exon boundaries of the selected gene, GPR98 (90 exons) or DFNB31 (12 exons). Functional splicing analyses and comparative genomic hybridization array to detect large rearrangements were performed when appropriate. We confirmed that mutations in GPR98 contribute a significant but minor role to Usher syndrome type 2. In a group of patients referred for molecular diagnosis, 43 had been found to be positive for USH2A mutations, the remaining 19 without USH2A alterations were screened, and seven different mutations were identified in the GPR98 gene in seven patients (five in the homozygous state), of which six were novel. All detected mutations result in a truncated protein; deleterious missense mutations were not found. No pathological mutations were identified in the DFNB31 gene. In Spain, USH2A and GPR98 are responsible for 95.8% and 5.2% of USH2 mutated cases, respectively. DFNB31 plays a minor role in the Spanish population. There was a group of patients in whom no mutation was found. These findings confirm the importance of including at least GPR98 analysis for comprehensive USH2 molecular diagnosis.

  14. Electrocardiography in Noonan syndrome PTPN11 gene mutation--phenotype characterization.

    NARCIS (Netherlands)

    Croonen, E.A.; Burgt, I. van der; Kapusta, L.; Draaisma, J.M.T.


    Noonan syndrome is a developmental disorder with distinctive facial features, short stature and cardiac abnormalities. In this cross-sectional study, we evaluated characteristic electrocardiographic (ECG) findings and cardiac abnormalities in 84 patients with Noonan syndrome, 56 (67%) of who were

  15. Klinefelter syndrome comorbidities linked to increased X chromosome gene dosage and altered protein interactome activity

    DEFF Research Database (Denmark)

    Belling, Kirstine González-Izarzugaza; Russo, Francesco; Jensen, Anders Boeck


    Klinefelter syndrome (KS) (47,XXY) is the most common male sex chromosome aneuploidy. Diagnosis and clinical supervision remain a challenge due to varying phenotypic presentation and insufficient characterization of the syndrome. Here we combine health data-driven epidemiology and molecular level...

  16. Sex and Genes, Part 1: Sexuality and down, Prader-Willi, and Williams Syndromes (United States)

    Watson, Shelley Lynn; Richards, Deborah A.; Miodrag, Nancy; Fedoroff, J. Paul


    Specific genetic syndromes affect individuals' sexual development, experiences, and fertility. Individuals with specific syndromes can also display inappropriate sexual behavior resulting from vulnerabilities presented by their genetic makeup. Using clinical case studies, we discuss the specific impact that Down, Prader-Willi, and Williams…

  17. The Behavioural Phenotype of Smith-Magenis Syndrome: Evidence for a Gene-Environment Interaction (United States)

    Taylor, L.; Oliver, C.


    Background: Behaviour problems and a preference for adult contact are reported to be prominent in the phenotype of Smith-Magenis syndrome. In this study we examined the relationship between social interactions and self-injurious and aggressive/disruptive behaviour in Smith-Magenis syndrome to explore potential operant reinforcement of problem…

  18. Beneficial effect of CETP gene polymorphism in combination with a Mediterranean diet influencing lipid metabolism in metabolic syndrome patients: CORDIOPREV study (United States)

    The cholesteryl ester transfer protein (CETP) gene has been implicated in high-density lipoprotein (HDL-C) metabolism. However, little is known about the impact of this gene on metabolic syndrome (MetS) patients and its interaction with diet. Here, we evaluate whether the consumption of a Mediterran...

  19. Development of the Zebra Danio Model: Carcinogenesis and Gene Transfer Studies (United States)


    Volhard, C. (1992). The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of...protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo

  20. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole


    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  1. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome. (United States)

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael


    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  2. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome. (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam


    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  3. AIRE variations in Addison's disease and autoimmune polyendocrine syndromes (APS): partial gene deletions contribute to APS I. (United States)

    Bøe Wolff, A S; Oftedal, B; Johansson, S; Bruland, O; Løvås, K; Meager, A; Pedersen, C; Husebye, E S; Knappskog, P M


    Autoimmune Addison's disease (AAD) is often associated with other components in autoimmune polyendocrine syndromes (APS). Whereas APS I is caused by mutations in the AIRE gene, the susceptibility genes for AAD and APS II are unclear. In the present study, we investigated whether polymorphisms or copy number variations in the AIRE gene were associated with AAD and APS II. First, nine SNPs in the AIRE gene were analyzed in 311 patients with AAD and APS II and 521 healthy controls, identifying no associated risk. Second, in a subgroup of 25 of these patients, AIRE sequencing revealed three novel polymorphisms. Finally, the AIRE copy number was determined by duplex quantitative PCR in 14 patients with APS I, 161 patients with AAD and APS II and in 39 healthy subjects. In two Scandinavian APS I patients previously reported to be homozygous for common AIRE mutations, we identified large deletions of the AIRE gene covering at least exon 2 to exon 8. We conclude that polymorphisms in the AIRE gene are not associated with AAD and APS II. We further suggest that DNA analysis of the parents of patients found to be homozygous for mutations in AIRE, always should be performed.

  4. Dysregulation of X-Linked Gene Expression in Klinefelter’s Syndrome and Association With Verbal Cognition (United States)

    Vawter, Marquis P.; Harvey, Philip D.; DeLisi, Lynn E.


    Klinefelter’s Syndrome (KS) is a chromosomal karyotype with one or more extra X chromosomes. KS individuals often show language impairment and the phenotype might be due to overexpression of genes on the extra X chromosome(s). We profiled mRNA derived from lymphoblastoid cell lines from males with documented KS and control males using the Affymetrix U133P microarray platform. There were 129 differentially expressed genes (DEGs) in KS group compared with controls after Benjamini–Hochberg false discovery adjustment. The DEGs included 14 X chromosome genes which were significantly over-represented. The Y chromosome had zero DEGs. In exploratory analysis of gene expression–cognition relationships, 12 DEGs showed significant correlation of expression with measures of verbal cognition in KS. Overexpression of one pseudoautosomal gene, GTPBP6 (GTP binding protein 6, putative) was inversely correlated with verbal IQ (r = −0.86, P < 0.001) and four other measures of verbal ability. Overexpression of XIST was found in KS compared to XY controls suggesting that silencing of many genes on the X chromosome might occur in KS similar to XX females. The microarray findings for eight DEGs were validated by quantitative PCR. The 14 X chromosome DEGs were not differentially expressed in prior studies comparing female and male brains suggesting a dysregulation profile unique to KS. Examination of X-linked DEGs, such as GTPBP6, TAF9L, and CXORF21, that show verbal cognition–gene expression correlations may establish a causal link between these genes, neurodevelopment, and language function. A screen of candidate genes may serve as biomarkers of KS for early diagnosis. PMID:17347996

  5. Correlations of gene expression with ratings of inattention and hyperactivity/impulsivity in tourette syndrome: a pilot study

    Directory of Open Access Journals (Sweden)

    Tian Yingfang


    Full Text Available Abstract Background Inattentiveness, impulsivity and hyperactivity are the primary behaviors associated with attention-deficit hyperactivity disorder (ADHD. Previous studies showed that peripheral blood gene expression signatures can mirror central nervous system disease. Tourette syndrome (TS is associated with inattention (IA and hyperactivity/impulsivity (HI symptoms over 50% of the time. This study determined if gene expression in blood correlated significantly with IA and/or HI rating scale scores in participants with TS. Methods RNA was isolated from the blood of 21 participants with TS, and gene expression measured on Affymetrix human U133 Plus 2.0 arrays. To identify the genes that correlated with Conners’ Parents Ratings of IA and HI ratings of symptoms, an analysis of covariance (ANCOVA was performed, controlling for age, gender and batch. Results There were 1201 gene probesets that correlated with IA scales, 1625 that correlated with HI scales, and 262 that correlated with both IA and HI scale scores (Prp|>0.4. Immune, catecholamine and other neurotransmitter pathways were associated with IA and HI behaviors. A number of the identified genes (n=27 have previously been reported in ADHD genetic studies. Many more genes correlated with either IA or HI scales alone compared to those that correlated with both IA and HI scales. Conclusions These findings support the concept that the pathophysiology of ADHD and/or its subtypes in TS may involve the interaction of multiple genes. These preliminary data also suggest gene expression may be useful for studying IA and HI symptoms that relate to ADHD in TS and perhaps non-TS participants. These results will need to be confirmed in future studies.

  6. Expansion of the clinical ocular spectrum of Wolfram Syndrome in a family carrying a novel WFS1 gene deletion. (United States)

    Chacón-Camacho, Oscar; Arce-Gonzalez, Rocio; Granillo-Alvarez, Mariella; Flores-Limas, Sanjuanita; Ramírez, Magdalena; Zenteno, Juan C


    To present the results of the clinical and molecular analyses of a familial case of Wolfram Syndrome (WFS) associated with a novel ocular anomaly. Full ophthalmologic examination was performed in two WFS siblings. Visante OCT imaging was used for assessing anterior segment anomalies. Genetic analysis included PCR amplification and exon-by-exon nucleotide sequencing of the WFS1 gene. Ocular anomalies in both affected siblings included congenital cataract, glaucoma, and optic atrophy. Interestingly, microspherophakia, a feature that has not been previously associated with WFS, was observed in both siblings. Genetic analysis disclosed a novel c.1525_1539 homozygous deletion in exon 8 of WFS1 in DNA from both affected patients. The recognition of microspherophakia in two siblings carrying a novel WFS1 mutation expands the clinical and molecular spectrum of Wolfram syndrome.

  7. The first missense mutation of NHS gene in a Tunisian family with clinical features of NHS syndrome including cardiac anomaly. (United States)

    Chograni, Manèl; Rejeb, Imen; Jemaa, Lamia Ben; Châabouni, Myriam; Bouhamed, Habiba Chaabouni


    Nance-Horan Syndrome (NHS) or X-linked cataract-dental syndrome is a disease of unknown gene action mechanism, characterized by congenital cataract, dental anomalies, dysmorphic features and, in some cases, mental retardation. We performed linkage analysis in a Tunisian family with NHS in which affected males and obligate carrier female share a common haplotype in the Xp22.32-p11.21 region that contains the NHS gene. Direct sequencing of NHS coding exons and flanking intronic sequences allowed us to identify the first missense mutation (P551S) and a reported SNP-polymorphism (L1319F) in exon 6, a reported UTR-SNP (c.7422 C>T) and a novel one (c.8239 T>A) in exon 8. Both variations P551S and c.8239 T>A segregate with NHS phenotype in this family. Although truncations, frame-shift and copy number variants have been reported in this gene, no missense mutations have been found to segregate previously. This is the first report of a missense NHS mutation causing NHS phenotype (including cardiac defects). We hypothesize also that the non-reported UTR-SNP of the exon 8 (3'-UTR) is specific to the Tunisian population.

  8. A novel mutation in the endothelin B receptor gene in a moroccan family with shah-waardenburg syndrome. (United States)

    Doubaj, Yassamine; Pingault, Véronique; Elalaoui, Siham C; Ratbi, Ilham; Azouz, Mohamed; Zerhouni, Hicham; Ettayebi, Fouad; Sefiani, Abdelaziz


    Waardenburg syndrome (WS) is a neurocristopathy disorder combining sensorineural deafness and pigmentary abnormalities. The presence of additional signs defines the 4 subtypes. WS type IV, also called Shah-Waardenburg syndrome (SWS), is characterized by the association with congenital aganglionic megacolon (Hirschsprung disease). To date, 3 causative genes have been related to this congenital disorder. Mutations in the EDNRB and EDN3 genes are responsible for the autosomal recessive form of SWS, whereas SOX10 mutations are inherited in an autosomal dominant manner. We report here the case of a 3-month-old Morrocan girl with WS type IV, born to consanguineous parents. The patient had 3 cousins who died in infancy with the same symptoms. Molecular analysis by Sanger sequencing revealed the presence of a novel homozygous missense mutation c.1133A>G (p.Asn378Ser) in the EDNRB gene. The proband's parents as well as the parents of the deceased cousins are heterozygous carriers of this likely pathogenic mutation. This molecular diagnosis allows us to provide genetic counseling to the family and eventually propose prenatal diagnosis to prevent recurrence of the disease in subsequent pregnancies.

  9. Clinical Variability in a Family with an Ectodermal Dysplasia Syndrome and a Nonsense Mutation in the TP63 Gene. (United States)

    Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair


    Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.

  10. R229Q Polymorphism of NPHS2 Gene in Group of Iraqi Children with Steroid-Resistant Nephrotic Syndrome

    Directory of Open Access Journals (Sweden)

    Shatha Hussain Ali


    Full Text Available Background. The polymorphism R229Q is one of the most commonly reported podocin sequence variations among steroid-resistant nephrotic syndromes (SRNS. Aim of the Study. We investigated the frequency and risk of this polymorphism among a group of Iraqi children with SRNS and steroid-sensitive nephrotic syndrome (SSNS. Patients and Methods. A prospective case control study which was conducted in Al-Imamein Al-Kadhimein Medical City, spanning the period from the 1st of April 2015 to 30th of November 2015. Study sample consisted of 54 children having NS, divided into 2 groups: patients group consisted of 27 children with SRNS, and control group involved 27 children with SSNS. Both were screened by real time polymerase chain reaction for R229Q in exon 5 of NPHS2 gene. Results. Molecular study showed R229Q polymorphism in 96.3% of SRNS and 100% of SSNS. There were no phenotypic or histologic characteristics of patients bearing homozygous R229Q polymorphism and the patients with heterozygous R229Q polymorphism. Conclusion. Polymorphism R229Q of NPHS2 gene is prevalent in Iraqi children with SRNS and SSNS. Further study needs to be done, for other exons and polymorphism of NPHS2 gene in those patients.

  11. Gene therapy restores auditory and vestibular function in a mouse model of Usher syndrome type 1c. (United States)

    Pan, Bifeng; Askew, Charles; Galvin, Alice; Heman-Ackah, Selena; Asai, Yukako; Indzhykulian, Artur A; Jodelka, Francine M; Hastings, Michelle L; Lentz, Jennifer J; Vandenberghe, Luk H; Holt, Jeffrey R; Géléoc, Gwenaëlle S


    Because there are currently no biological treatments for hearing loss, we sought to advance gene therapy approaches to treat genetic deafness. We focused on Usher syndrome, a devastating genetic disorder that causes blindness, balance disorders and profound deafness, and studied a knock-in mouse model, Ush1c c.216G>A, for Usher syndrome type IC (USH1C). As restoration of complex auditory and balance function is likely to require gene delivery systems that target auditory and vestibular sensory cells with high efficiency, we delivered wild-type Ush1c into the inner ear of Ush1c c.216G>A mice using a synthetic adeno-associated viral vector, Anc80L65, shown to transduce 80-90% of sensory hair cells. We demonstrate recovery of gene and protein expression, restoration of sensory cell function, rescue of complex auditory function and recovery of hearing and balance behavior to near wild-type levels. The data represent unprecedented recovery of inner ear function and suggest that biological therapies to treat deafness may be suitable for translation to humans with genetic inner ear disorders.

  12. Variation in the Williams syndrome GTF2I gene and anxiety proneness interactively affect prefrontal cortical response to aversive stimuli. (United States)

    Jabbi, M; Chen, Q; Turner, N; Kohn, P; White, M; Kippenhan, J S; Dickinson, D; Kolachana, B; Mattay, V; Weinberger, D R; Berman, K F


    Characterizing the molecular mechanisms underlying the heritability of complex behavioral traits such as human anxiety remains a challenging endeavor for behavioral neuroscience. Copy-number variation (CNV) in the general transcription factor gene, GTF2I, located in the 7q11.23 chromosomal region that is hemideleted in Williams syndrome and duplicated in the 7q11.23 duplication syndrome (Dup7), is associated with gene-dose-dependent anxiety in mouse models and in both Williams syndrome and Dup7. Because of this recent preclinical and clinical identification of a genetic influence on anxiety, we examined whether sequence variation in GTF2I, specifically the single-nucleotide polymorphism rs2527367, interacts with trait and state anxiety to collectively impact neural response to anxiety-laden social stimuli. Two hundred and sixty healthy adults completed the Tridimensional Personality Questionnaire Harm Avoidance (HA) subscale, a trait measure of anxiety proneness, and underwent functional magnetic resonance imaging (fMRI) while matching aversive (fearful or angry) facial identity. We found an interaction between GTF2I allelic variations and HA that affects brain response: in individuals homozygous for the major allele, there was no correlation between HA and whole-brain response to aversive cues, whereas in heterozygotes and individuals homozygous for the minor allele, there was a positive correlation between HA sub-scores and a selective dorsolateral prefrontal cortex (DLPFC) responsivity during the processing of aversive stimuli. These results demonstrate that sequence variation in the GTF2I gene influences the relationship between trait anxiety and brain response to aversive social cues in healthy individuals, supporting a role for this neurogenetic mechanism in anxiety.

  13. A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression (United States)

    Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel


    Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene

  14. UMD-USHbases: a comprehensive set of databases to record and analyse pathogenic mutations and unclassified variants in seven Usher syndrome causing genes. (United States)

    Baux, David; Faugère, Valérie; Larrieu, Lise; Le Guédard-Méreuze, Sandie; Hamroun, Dalil; Béroud, Christophe; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise


    Using the Universal Mutation Database (UMD) software, we have constructed "UMD-USHbases", a set of relational databases of nucleotide variations for seven genes involved in Usher syndrome (MYO7A, CDH23, PCDH15, USH1C, USH1G, USH3A and USH2A). Mutations in the Usher syndrome type I causing genes are also recorded in non-syndromic hearing loss cases and mutations in USH2A in non-syndromic retinitis pigmentosa. Usher syndrome provides a particular challenge for molecular diagnostics because of the clinical and molecular heterogeneity. As many mutations are missense changes, and all the genes also contain apparently non-pathogenic polymorphisms, well-curated databases are crucial for accurate interpretation of pathogenicity. Tools are provided to assess the pathogenicity of mutations, including conservation of amino acids and analysis of splice-sites. Reference amino acid alignments are provided. Apparently non-pathogenic variants in patients with Usher syndrome, at both the nucleotide and amino acid level, are included. The UMD-USHbases currently contain more than 2,830 entries including disease causing mutations, unclassified variants or non-pathogenic polymorphisms identified in over 938 patients. In addition to data collected from 89 publications, 15 novel mutations identified in our laboratory are recorded in MYO7A (6), CDH23 (8), or PCDH15 (1) genes. Information is given on the relative involvement of the seven genes, the number and distribution of variants in each gene. UMD-USHbases give access to a software package that provides specific routines and optimized multicriteria research and sorting tools. These databases should assist clinicians and geneticists seeking information about mutations responsible for Usher syndrome.

  15. Detection of mutations in the COL4A5 gene by SSCP in X-linked Alport syndrome

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Juncker, I; Persson, U


    , three in-frame deletions, four nonsense mutations, and six splice site mutations. Twenty-two of the mutations have not previously been reported. Furthermore, we found one non-pathogenic amino acid substitution, one rare variant in a non-coding region, and one polymorphism with a heterozygosity of 28...... of type IV-collagen. We performed mutation analysis of the COL4A5 gene by PCR-SSCP analysis of each of the 51 exons with flanking intronic sequences in 81 patients suspected of X-linked Alport syndrome including 29 clear X-linked cases, 37 cases from families with a pedigree compatible with X...

  16. Mutations in SWI/SNF chromatin remodeling complex gene ARID1B cause Coffin-Siris syndrome. (United States)

    Santen, Gijs W E; Aten, Emmelien; Sun, Yu; Almomani, Rowida; Gilissen, Christian; Nielsen, Maartje; Kant, Sarina G; Snoeck, Irina N; Peeters, Els A J; Hilhorst-Hofstee, Yvonne; Wessels, Marja W; den Hollander, Nicolette S; Ruivenkamp, Claudia A L; van Ommen, Gert-Jan B; Breuning, Martijn H; den Dunnen, Johan T; van Haeringen, Arie; Kriek, Marjolein


    We identified de novo truncating mutations in ARID1B in three individuals with Coffin-Siris syndrome (CSS) by exome sequencing. Array-based copy-number variation (CNV) analysis in 2,000 individuals with intellectual disability revealed deletions encompassing ARID1B in 3 subjects with phenotypes partially overlapping that of CSS. Taken together with published data, these results indicate that haploinsufficiency of the ARID1B gene, which encodes an epigenetic modifier of chromatin structure, is an important cause of CSS and is potentially a common cause of intellectual disability and speech impairment.

  17. Cognitive-behavioral phenotypes of Williams syndrome are associated with genetic variation in the GTF2I gene, in a healthy population. (United States)

    Crespi, Bernard J; Hurd, Peter L


    Individuals with Williams syndrome, a neurogenetic condition caused by deletion of a set of genes at chromosomal location 7q11.23, exhibit a remarkable suite of traits including hypersociality with high, nonselective friendliness and low social anxiety, expressive language relatively well-developed but under-developed social-communication skills overall, and reduced visual-spatial abilities. Deletions and duplications of the Williams-syndrome region have also been associated with autism, and with schizophrenia, two disorders centrally involving social cognition. Several lines of evidence have linked the gene GTF2I (General Transcription Factor IIi) with the social phenotypes of Williams syndrome, but a role for this gene in sociality within healthy populations has yet to be investigated. We genotyped a large set of healthy individuals for two single-nucleotide polymorphisms in the GTF2I gene that have recently been significantly associated with autism, and thus apparently exhibit functional effects on autism-related social phenotypes. GTF2I genotypes for these SNPs showed highly significant association with low social anxiety combined with reduced social-communication abilities, which represents a metric of the Williams-syndrome cognitive profile as described from previous studies. These findings implicate the GTF2I gene in the neurogenetic basis of social communication and social anxiety, both in Williams syndrome and among individuals in healthy populations.

  18. Hotspots in PTPN11 Gene Among Indian Children With Noonan Syndrome. (United States)

    Narayanan, Dhanya Lakshmi; Pandey, Himani; Moirangthem, Amita; Mandal, Kausik; Gupta, Rekha; Puri, Ratna Dua; Patil, S J; Phadke, Shubha R


    To test for PTPN11 mutations in clinically diagnosed cases of Noonan syndrome. 17 individuals with clinical diagnosis of Noonan syndrome were included in the study. Sanger sequencing of all the 15 exons of PTPN11 was done. A genotype-phenotype correlation was attempted. Mutation in PTPN11 was detected in 11 out of 17 (64.7%) patients with Noonan syndrome; 72% had mutation in exon 3 and 27 % had mutation in exon 13. PTPN11 mutation accounts for 64.7% of cases with clinical features of Noonan syndrome in India. Majority of the mutations are in exon 3 and exon 13 of PTPN11, making them the hotspots in Indian population.

  19. Possible linkage of non-syndromic cleft lip and palate to the MSX1 homebox gene on chromosome 4p

    Energy Technology Data Exchange (ETDEWEB)

    Wang, S.; Walczak, C.; Erickson, R.P.


    The MSX1 (HOX7) gene has been shown recently to cause cleft palate in a mouse model deficient for its product. Several features of this mouse model make the human homolog of this gene an excellent candidate for non-syndromic cleft palate. We tested this hypothesis by linkage studies in two large multiplex human families using a microsatellite marker in the human MSX1 gene. A LOD score of 1.7 was obtained maximizing at a recombination fraction of 0.09. Computer simulation power calculations using the program SIMLINK indicated that a LOD score this large is expected to occur only about 1/200 times by chance alone for a marker locus with comparable informativeness if unlinked to the disease gene. This suggestive finding is being followed up by attempts to recruit and study additional families and by DNA sequence analyses of the MSX1 gene in these families and other cleft lip and/or cleft palate subjects and these further results will also be reported.

  20. Evidence of inflammatory immune signaling in chronic fatigue syndrome: A pilot study of gene expression in peripheral blood

    Directory of Open Access Journals (Sweden)

    Vernon Suzanne D


    Full Text Available Abstract Background Genomic profiling of peripheral blood reveals altered immunity in chronic fatigue syndrome (CFS however interpretation remains challenging without immune demographic context. The object of this work is to identify modulation of specific immune functional components and restructuring of co-expression networks characteristic of CFS using the quantitative genomics of peripheral blood. Methods Gene sets were constructed a priori for CD4+ T cells, CD8+ T cells, CD19+ B cells, CD14+ monocytes and CD16+ neutrophils from published data. A group of 111 women were classified using empiric case definition (U.S. Centers for Disease Control and Prevention and unsupervised latent cluster analysis (LCA. Microarray profiles of peripheral blood were analyzed for expression of leukocyte-specific gene sets and characteristic changes in co-expression identified from topological evaluation of linear correlation networks. Results Median expression for a set of 6 genes preferentially up-regulated in CD19+ B cells was significantly lower in CFS (p = 0.01 due mainly to PTPRK and TSPAN3 expression. Although no other gene set was differentially expressed at p Conclusion Dissection of blood microarray profiles points to B cell dysfunction with coordinated immune activation supporting persistent inflammation and antibody-mediated NK cell modulation of T cell activity. This has clinical implications as the CD19+ genes identified could provide robust and biologically meaningful basis for the early detection and unambiguous phenotyping of CFS.

  1. Common mutations identified in the MLH1 gene in familial Lynch syndrome


    Jisha Elias; Coral Karunakaran; Snigdha Majumder; Malini Manoharan; Rakshit Shah; Yogesh Mistry; Rajesh Ramanuj; Niraj Bhatt; Arati Khanna- Gupta


    Lynch syndrome (Hereditary Non Polyposis Colorectal Cancer, HNPCC) is one of the most common hereditary familial colorectal cancers (CRC) with an autosomal dominant pattern of inheritance. It accounts for 2-5% of the total CRCs reported worldwide. Although a lower incidence for CRCs have been observed in India, the last decade has shown a remarkable increase of CRC incidences (2-4 %). Features of Lynch syndrome associated colorectal cancer include early age of cancer onset, accelerated car...

  2. Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome. (United States)

    Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M


    Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.

  3. β-Secretases, Alzheimer’s Disease, and Down Syndrome

    Directory of Open Access Journals (Sweden)

    Robin L. Webb


    Full Text Available Individuals with Down Syndrome (DS, or trisomy 21, develop Alzheimer’s disease (AD pathology by approximately 40 years of age. Chromosome 21 harbors several genes implicated in AD, including the amyloid precursor protein and one homologue of the β-site APP cleaving enzyme, BACE2. Processing of the amyloid precursor protein by β-secretase (BACE is the rate-limiting step in the production of the pathogenic Aβ peptide. Increased amounts of APP in the DS brain result in increased amounts of Aβ and extracellular plaque formation beginning early in life. BACE dysregulation potentially represents an overlapping biological mechanism with sporadic AD and a common therapeutic target. As the lifespan for those with DS continues to increase, age-related concerns such as obesity, depression, and AD are of growing concern. The ability to prevent or delay the progression of neurodegenerative diseases will promote healthy aging and improve quality of life for those with DS.

  4. Pioglitazone enhances expression of genes involved in mitochondrial oxidative metabolism in skeletal muscle of women with polycystic ovary syndrome (PCOS)

    DEFF Research Database (Denmark)

    Skov, Vibe

    Aims                Polycystic ovary syndrome (PCOS) is a common endocrine disorder in premenopausal women and is associated with insulin resistance increasing the risk for developing type 2 diabetes mellitus. Studies have shown that thiazolidinediones (TZD) improve metabolic disturbances in PCOS...... patients. We hypothesized that the effect of TZD in PCOS is in part mediated by changes in the transcriptional profile of muscle favoring insulin sensitivity. Methods Using the HG-U133 2.0 Plus expression array from Affymetrix, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene...... expression in skeletal muscle of 10 obese women with PCOS (dataset 1). Furthermore, evaluation of gene expression changes between PCOS patients before treatment and control subjects were performed (dataset 2). All subjects were metabolically characterised by a euglycemic-hyperinsulinemic clamp combined...

  5. Assessment of the rs4340 ACE gene polymorphism in acute coronary syndrome in a Western Mexican population. (United States)

    Valdez-Haro, A; Valle, Y; Valdes-Alvarado, E; Casillas-Muñoz, F; Muñoz-Valle, J F; Reynoso-Villalpando, G L; Flores-Salinas, H E; Padilla-Gutiérrez, J R


    Acute coronary syndrome (ACS) is considered one of the main causes of death worldwide. Contradictory findings concerning the impact of the angiotensin-converting enzyme (ACE) gene on cardiovascular diseases have been reported. Previous conclusions point out that the variability in results depends on ethnicity and genetic polymorphisms to determine the association of rs4340 polymorphisms of the ACE gene and ACE circulating levels in ACS. Genotyping of rs4340 polymorphisms was performed in a total of 600 individuals from Western Mexico divided into two groups: the ACS and the control group (CG). The polymorphisms were identified by polymerase chain reaction. Serum ACE concentration was determined by enzyme-linked immunosorbent assay. D/D carriers had higher ACE levels than I/I carriers (3.6 vs 2.8 ng/mL, P ACE concentration levels; however, the polymorphism was not associated with ACS.

  6. A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers. (United States)

    Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado


    Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.

  7. Usher Syndrome Type III: Revised Genomic Structure of the USH3 Gene and Identification of Novel Mutations (United States)

    Fields, Randall R.; Zhou, Guimei; Huang, Dali; Davis, Jack R.; Möller, Claes; Jacobson, Samuel G.; Kimberling, William J.; Sumegi, Janos


    Usher syndrome type III is an autosomal recessive disorder characterized by progressive sensorineural hearing loss, vestibular dysfunction, and retinitis pigmentosa. The disease gene was localized to 3q25 and recently was identified by positional cloning. In the present study, we have revised the structure of the USH3 gene, including a new translation start site, 5′ untranslated region, and a transcript encoding a 232–amino acid protein. The mature form of the protein is predicted to contain three transmembrane domains and 204 residues. We have found four new disease-causing mutations, including one that appears to be relatively common in the Ashkenazi Jewish population. We have also identified mouse (chromosome 3) and rat (chromosome 2) orthologues, as well as two human paralogues on chromosomes 4 and 10. PMID:12145752

  8. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA. (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam


    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence


    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  10. Netherton syndrome in one Chinese adult with a novel mutation in the SPINK5 gene and immunohistochemical studies of LEKTI

    Directory of Open Access Journals (Sweden)

    Zhang Xi-Bao


    Full Text Available Background : Netherton syndrome (NS is a severe autosomal recessive ichthyosis. It is characterized by congenital ichthyosiform erythroderma, trichorrhexis invaginata, ichthyosis linearis circumflexa, atopic diathesis, and frequent bacterial infections. The disease is caused by mutations in the SPINK5 (serine protease inhibitor Kazal-type 5 gene, a new type of serine protease inhibitor involved in the regulation of skin barrier formation and immunity. We report one Chinese adult with NS. The patient had typical manifestation of NS except for trichorrhexis invaginata with an atopic diathesis and recurrent staphylococcal infections since birth. Aims: To evaluate the gene mutation and of its product activity of SPINK5 gene in confirmation of the diagnosis of one Chinese adult with NS. Materials and Methods: To screen mutations in the SPINK5 gene, 33 exons and flanking intron boundaries of SPINK5 were amplified with polymerase chain reaction (PCR and used for direct sequencing. In addition, immunohistochemical staining of LEKTI (lymphoepithelial Kazal-type-related inhibitor with specific antibody was used to confirm the diagnosis of NS. The results were compared with that of healthy individuals (twenty-five blood samples. Results: A G318A mutation was found at exon 5 of patient′s SPINK5 gene which is a novel missense mutation. The PCR amplification products with mutation-specific primer were obtained only from the DNA of the patients and their mother, but not from their father and 25 healthy individuals. Immunohistochemical studies indicated there was no LEKTI expression in NS patient′s skin and there was a strong LEKTI expression in the normal human skin. Conclusion: In this report, we describe heterozygous mutation in the SPINK5 gene and expression of LEKTI in one Chinese with NS. The results indicate that defective expression of LEKTI in the epidermis and mutations of SPINK5 gene are reliable for diagnostic feature of NS with atypical

  11. A possible genetic association with chronic fatigue in primary Sjögren's syndrome: a candidate gene study. (United States)

    Norheim, Katrine Brække; Le Hellard, Stephanie; Nordmark, Gunnel; Harboe, Erna; Gøransson, Lasse; Brun, Johan G; Wahren-Herlenius, Marie; Jonsson, Roland; Omdal, Roald


    Fatigue is prevalent and disabling in primary Sjögren's syndrome (pSS). Results from studies in chronic fatigue syndrome (CFS) indicate that genetic variation may influence fatigue. The aim of this study was to investigate single nucleotide polymorphism (SNP) variations in pSS patients with high and low fatigue. A panel of 85 SNPs in 12 genes was selected based on previous studies in CFS. A total of 207 pSS patients and 376 healthy controls were genotyped. One-hundred and ninety-three patients and 70 SNPs in 11 genes were available for analysis after quality control. Patients were dichotomized based on fatigue visual analogue scale (VAS) scores, with VAS fatigue" (n = 53) and VAS ≥50 denominated "high fatigue" (n = 140). We detected signals of association with pSS for one SNP in SLC25A40 (unadjusted p = 0.007) and two SNPs in PKN1 (both p = 0.03) in our pSS case versus control analysis. The association with SLC25A40 was stronger when only pSS high fatigue patients were analysed versus controls (p = 0.002). One SNP in PKN1 displayed an association in the case-only analysis of pSS high fatigue versus pSS low fatigue (p = 0.005). This candidate gene study in pSS did reveal a trend for associations between genetic variation in candidate genes and fatigue. The results will need to be replicated. More research on genetic associations with fatigue is warranted, and future trials should include larger cohorts and multicentre collaborations with sharing of genetic material to increase the statistical power.

  12. Evidence for gene-environment interaction in a genome wide study of isolated, non-syndromic cleft palate (United States)

    Beaty, Terri H.; Ruczinski, Ingo; Murray, Jeffrey C.; Marazita, Mary L.; Munger, Ronald G.; Hetmanski, Jacqueline B.; Murray, Tanda; Redett, Richard J.; Fallin, M. Daniele; Liang, Kung Yee; Wu, Tao; Patel, Poorav J.; Jin, Sheng C.; Zhang, Tian Xiao; Schwender, Holger; Wu-Chou, Yah Huei; Chen, Philip K; Chong, Samuel S; Cheah, Felicia; Yeow, Vincent; Ye, Xiaoqian; Wang, Hong; Huang, Shangzhi; Jabs, Ethylin W.; Shi, Bing; Wilcox, Allen J.; Lie, Rolv T.; Jee, Sun Ha; Christensen, Kaare; Doheny, Kimberley F.; Pugh, Elizabeth W.; Ling, Hua; Scott, Alan F.


    Non-syndromic cleft palate (CP) is a common birth defect with a complex and heterogeneous etiology involving both genetic and environmental risk factors. We conducted a genome wide association study (GWAS) using 550 case-parent trios, ascertained through a CP case collected in an international consortium. Family based association tests of single nucleotide polymorphisms (SNP) and three common maternal exposures (maternal smoking, alcohol consumption and multivitamin supplementation) were used in a combined 2 df test for gene (G) and gene-environment (G×E) interaction simultaneously, plus a separate 1 df test for G×E interaction alone. Conditional logistic regression models were used to estimate effects on risk to exposed and unexposed children. While no SNP achieved genome wide significance when considered alone, markers in several genes attained or approached genome wide significance when G×E interaction was included. Among these, MLLT3 and SMC2 on chromosome 9 showed multiple SNPs resulting in increased risk if the mother consumed alcohol during the peri-conceptual period (3 months prior to conception through the first trimester). TBK1 on chr. 12 and ZNF236 on chr. 18 showed multiple SNPs associated with higher risk of CP in the presence of maternal smoking. Additional evidence of reduced risk due to G×E interaction in the presence of multivitamin supplementation was observed for SNPs in BAALC on chr. 8. These results emphasize the need to consider G×E interaction when searching for genes influencing risk to complex and heterogeneous disorders, such as non-syndromic CP. PMID:21618603

  13. Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations. (United States)

    Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh


    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Phosphatase and tensin homolog (PTEN) gene mutations and autism: literature review and a case report of a patient with Cowden syndrome, autistic disorder, and epilepsy. (United States)

    Conti, Sara; Condò, Maria; Posar, Annio; Mari, Francesca; Resta, Nicoletta; Renieri, Alessandra; Neri, Iria; Patrizi, Annalisa; Parmeggiani, Antonia


    Phosphatase and tensin homolog (PTEN) gene mutations are associated with a spectrum of clinical disorders characterized by skin lesions, macrocephaly, hamartomatous overgrowth of tissues, and an increased risk of cancers. Autism has rarely been described in association with these variable clinical features. At present, 24 patients with phosphatase and tensin homolog gene mutation, autism, macrocephaly, and some clinical findings described in phosphatase and tensin homolog syndromes have been reported in the literature. We describe a 14-year-old boy with autistic disorder, focal epilepsy, severe and progressive macrocephaly, and multiple papular skin lesions and palmoplantar punctate keratoses, characteristic of Cowden syndrome. The boy has a de novo phosphatase and tensin homolog gene mutation. Our patient is the first case described to present a typical Cowden syndrome and autism associated with epilepsy.

  15. Severe early onset retinitis pigmentosa in a Moroccan patient with Heimler syndrome due to novel homozygous mutation of PEX1 gene. (United States)

    Ratbi, Ilham; Jaouad, Imane Cherkaoui; Elorch, Hamza; Al-Sheqaih, Nada; Elalloussi, Mustapha; Lyahyai, Jaber; Berraho, Amina; Newman, William G; Sefiani, Abdelaziz


    Heimler syndrome (HS) is a rare recessive disorder characterized by sensorineural hearing loss (SNHL), amelogenesis imperfecta, nail abnormalities, and occasional or late-onset retinal pigmentation. It is the mildest form known to date of peroxisome biogenesis disorder caused by hypomorphic mutations of PEX1 and PEX6 genes. We report on a second Moroccan family with Heimler syndrome with early onset, severe visual impairment and important phenotypic overlap with Usher syndrome. The patient carried a novel homozygous missense variant c.3140T > C (p.Leu1047Pro) of PEX1 gene. As standard biochemical screening of blood for evidence of a peroxisomal disorder did not provide a diagnosis in the individuals with HS, patients with SNHL and retinal pigmentation should have mutation analysis of PEX1 and PEX6 genes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Germ-line variants identified by next generation sequencing in a panel of estrogen and cancer associated genes correlate with poor clinical outcome in Lynch syndrome patients. (United States)

    Jóri, Balazs; Kamps, Rick; Xanthoulea, Sofia; Delvoux, Bert; Blok, Marinus J; Van de Vijver, Koen K; de Koning, Bart; Oei, Felicia Trups; Tops, Carli M; Speel, Ernst Jm; Kruitwagen, Roy F; Gomez-Garcia, Encarna B; Romano, Andrea


    The risk to develop colorectal and endometrial cancers among subjects testing positive for a pathogenic Lynch syndrome mutation varies, making the risk prediction difficult. Genetic risk modifiers alter the risk conferred by inherited Lynch syndrome mutations, and their identification can improve genetic counseling. We aimed at identifying rare genetic modifiers of the risk of Lynch syndrome endometrial cancer. A family based approach was used to assess the presence of genetic risk modifiers among 35 Lynch syndrome mutation carriers having either a poor clinical phenotype (early age of endometrial cancer diagnosis or multiple cancers) or a neutral clinical phenotype. Putative genetic risk modifiers were identified by Next Generation Sequencing among a panel of 154 genes involved in endometrial physiology and carcinogenesis. A simple pipeline, based on an allele frequency lower than 0.001 and on predicted non-conservative amino-acid substitutions returned 54 variants that were considered putative risk modifiers. The presence of two or more risk modifying variants in women carrying a pathogenic Lynch syndrome mutation was associated with a poor clinical phenotype. A gene-panel is proposed that comprehends genes that can carry variants with putative modifying effects on the risk of Lynch syndrome endometrial cancer. Validation in further studies is warranted before considering the possible use of this tool in genetic counseling.

  17. Autosomal recessive hyper IgM syndrome associated with activation-induced cytidine deaminase gene in three Turkish siblings presented with tuberculosis lymphadenitis - Case report. (United States)

    Patiroglu, Turkan; Akar, H Haluk; van der Burg, Mirjam; Unal, Ekrem


    The hyper-immunoglobulin M (HIGM) syndrome is a heterogeneous group of genetic disorders characterized by recurrent infections, decreased serum levels of immunoglobulin G (IgG) and IgA, and normal/increased serum levels of IgM. Herein, we describe three Turkish siblings with HIGM syndrome who had a homozygous missense mutation (c.70C>T, p.Arg24Trp) in the activation-induced cytidine deaminase gene which results in autosomal recessive HIGM syndrome. Two of the siblings, sibling 1 and sibling 3, presented with cervical deep abscess and cervical tuberculosis lymphadenitis, respectively.

  18. Association of gene polymorphism of the fat mass and obesity associated gene with metabolic syndrome: a retrospective cohort study in Japanese workers. (United States)

    Kawajiri, Tomoka; Osaki, Yoneatsu; Kishimoto, Takuji


    To investigate whether gene polymorphism of the fat mass and obesity associated gene (FTO) is associated with metabolic syndrome (MS), we used two MS criteria, the National Cholesterol Education Program-Adult Treatment panel III (NCEP-ATPIII) definition in 2003 and the Japanese definition in 2005. Subjects were respectively 859 and 865 Japanese workers at a company in Shimane Prefecture, Japan. They were non-MS individuals in 1998 and had regular health checkups between 1998 and 2006. The Cox proportional hazard regression was used to predict MS. Three SNPs in the FTO, rs9939609, rs1121980 and rs1558902, were genotyped by the TaqMan PCR assay and a retrospective study was performed. The three SNPs in the FTO were significantly associated with body mass index, and rs1121980 and rs1558902 were associated with fasting plasma glucose. MS defined by the NCEP-ATPIII definition was significantly associated with additive and dominant models of rs9939609 and rs1121980, and the dominant model of rs1558902, even after adjusting for confounding factors such as age, sex and lifestyle. MS defined by the Japanese definition was significantly associated with the additive model of rs1121980 and additive and dominant models of rs1558902 in multivariate analysis. These results suggested that FTO gene polymorphisms, rs9939609, rs1121980 and rs1558902, were associated with an increased risk of MS among Japanese workers.

  19. Roles of beta2-adrenergic receptor gene polymorphisms in a Turkish population with obstructive sleep apnea syndrome or obesity. (United States)

    Gök, I; Celebi, I; Hüseyinoğlu, N; Ozic, C


    We determined the distribution of the Arg16Gly and Gln27Glu polymorphisms of the beta-2 adrenergic receptor gene (ADRB2) in patients with obstructive sleep apnea syndrome as well as a control group in Northeastern Turkey. A total of 52 patients diagnosed with obstructive sleep apnea in a sleep laboratory and 78 control subjects were examined. Peripheral blood samples were taken from patients diagnosed with obstructive sleep apnea by polysomnography. DNA was extracted from blood samples and amplified using polymerase chain reaction. Amplification products were digested with restriction enzymes to investigate gene polymorphisms. Restriction products were extracted from agarose gel electrophoresis and polymorphisms were analyzed using gel images. The Arg16Gly polymorphism was observed in 18 of 52 patients and in 23 of 78 controls. The Gln27Glu polymorphism was observed in 21 of 52 patients and in 28 of 78 controls. In conclusion, there was no correlation among polymorphic frequencies between patient and control groups. Based on the results, these polymorphisms do not contribute to the clinical diagnosis of this syndrome. However, the distribution of Arg16Gly vs Gln27Glu polymorphisms may contribute to obesity in patients with a body mass index greater than 30 (P sleep apnea disease are changed.

  20. The Williams syndrome prosociality gene GTF2I mediates oxytocin reactivity and social anxiety in a healthy population. (United States)

    Procyshyn, Tanya L; Spence, Jason; Read, Silven; Watson, Neil V; Crespi, Bernard J


    The neurohormone oxytocin plays a central role in human social behaviour and cognition, and oxytocin dysregulation may contribute to psychiatric disorders. However, genetic factors influencing individual variation in the oxytocinergic system remain poorly understood. We genotyped 169 healthy adults for a functional polymorphism in GTF2I ( general transcription factor II-I ), a gene associated with high prosociality and reduced social anxiety in Williams syndrome, a condition reported to involve high oxytocin levels and reactivity. Participants' salivary oxytocin levels were measured before and after watching a validated empathy-inducing video. Oxytocin reactivity, defined as pre- to post-video percentage change in salivary oxytocin, varied substantially and significantly between individuals with different GTF2I genotypes, with, additionally, a trend towards an interaction between genotype and sex. Individuals with more oxytocin-reactive genotypes also reported significantly lower social anxiety. These findings suggest a model whereby GTF2I has a continuum of effects on human sociality, from the extreme social phenotypes and oxytocin dysregulation associated with gene deletion in Williams syndrome, to individual differences in oxytocin reactivity and sociality associated with common polymorphisms in healthy populations. © 2017 The Author(s).

  1. Unique DNA repair gene variations and potential associations with the primary antibody deficiency syndromes IgAD and CVID.

    Directory of Open Access Journals (Sweden)

    Steven M Offer

    Full Text Available BACKGROUND: Despite considerable effort, the genetic factors responsible for >90% of the antibody deficiency syndromes IgAD and CVID remain elusive. To produce a functionally diverse antibody repertoire B lymphocytes undergo class switch recombination. This process is initiated by AID-catalyzed deamination of cytidine to uridine in switch region DNA. Subsequently, these residues are recognized by the uracil excision enzyme UNG2 or the mismatch repair proteins MutSalpha (MSH2/MSH6 and MutLalpha (PMS2/MLH1. Further processing by ubiquitous DNA repair factors is thought to introduce DNA breaks, ultimately leading to class switch recombination and expression of a different antibody isotype. METHODOLOGY/PRINCIPAL FINDINGS: Defects in AID and UNG2 have been shown to result in the primary immunodeficiency hyper-IgM syndrome, leading us to hypothesize that additional, potentially more subtle, DNA repair gene variations may underlie the clinically related antibody deficiencies syndromes IgAD and CVID. In a survey of twenty-seven candidate DNA metabolism genes, markers in MSH2, RAD50, and RAD52 were associated with IgAD/CVID, prompting further investigation into these pathways. Resequencing identified four rare, non-synonymous alleles associated with IgAD/CVID, two in MLH1, one in RAD50, and one in NBS1. One IgAD patient carried heterozygous non-synonymous mutations in MLH1, MSH2, and NBS1. Functional studies revealed that one of the identified mutations, a premature RAD50 stop codon (Q372X, confers increased sensitivity to ionizing radia