WorldWideScience

Sample records for sustained matrix protein

  1. Denatured Whey Protein Powder as a New Matrix Excipient: Design and Evaluation of Mucoadhesive Tablets for Sustained Drug Release Applications.

    Science.gov (United States)

    Hsein, Hassana; Garrait, Ghislain; Tamani, Fahima; Beyssac, Eric; Hoffart, Valérie

    2017-02-01

    In earlier study, we proposed denatured whey protein (DWP) powder obtained by atomization as a new excipient to promote oral drug delivery. In this work, we evaluate the possibility to formulate tablets based on DWP powders and to characterize their role as a matrix mucoadhesive excipient. Tablets containing increased amount of DWP (10 to 30%) were produced by direct compression after mixing with theophylline, microcrystalline cellulose, Aerosil® and magnesium stearate. Dissolution behaviors of obtained tablets were evaluated in different USP buffers (pH 1.2, 4.5 and 6.8) and in simulated gastric and intestinal fluids and mechanisms analyzed by multiple mathematical models. Swelling, erosion and mucoadhesion were also evaluated. Finally, release and absorption were studied in the artificial digestive system (TIM 1). Tablets based on DWP and containing 300 mg of theophylline were obtained by direct compression. These tablets exhibited controlled release driven by diffusion starting from 15% DWP content whatever the pH studied. They also showed a great extent of swelling and water uptake while matrix weight loss was limited. Addition of enzymes accelerated drug release which became governed by erosion according to Peppas model. The present study shows that DWP powders can be successfully used as a pharmaceutical excipient, and in particular as a matrix mucoadhesive controlled release tablets.

  2. Sustained-release of FGF-2 from a hybrid hydrogel of heparin-poloxamer and decellular matrix promotes the neuroprotective effects of proteins after spinal injury

    Directory of Open Access Journals (Sweden)

    Xu HL

    2018-02-01

    Full Text Available  He-Lin Xu,1,* Fu-Rong Tian,1,* Jian Xiao,1,* Pian-Pian Chen,1 Jie Xu,1 Zi-Liang Fan,1 Jing-Jing Yang,1 Cui-Tao Lu,1 Ying-Zheng Zhao1,2 1Department of Pharmaceutics, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, 2Hainan Medical College, Haikou, China *These authors contributed equally to this work Introduction: The short lifetime of protein-based therapies has largely limited their therapeutic efficacy in injured nervous post-spinal cord injury (post-SCI. Methods: In this study, an affinity-based hydrogel delivery system provided sustained-release of proteins, thereby extending the efficacy of such therapies. The affinity-based hydrogel was constructed using a novel polymer, heparin-poloxamer (HP, as a temperature-sensitive bulk matrix and decellular spinal cord extracellular matrix (dscECM as an affinity depot of drug. By tuning the concentration of HP in formulation, the cold ternary fibroblast growth factor-2 (FGF2-dscECM-HP solution could rapidly gelatinize into a hydrogel at body temperature. Due to the strong affinity for FGF2, hybrid FGF2-dscECM-HP hydrogel enabled sustained-release of encapsulated FGF2 over an extended period in vitro. Results: Compared to free FGF2, it was observed that both neuron functions and tissue morphology after SCI were clearly recovered in rats treated with FGF2-dscECM-HP hydrogel. Moreover, the expression of neurofilament protein and the density of axons were increased after treatment with hybrid FGF2-dscECM-HP. In addition, the neuroprotective effects of FGF2-dscECM-HP were related to inhibition of chronic endoplasmic reticulum stress-induced apoptosis.Conclusion: The results revealed that a hybrid hydrogel system may be a potential carrier to deliver macromolecular proteins to the injured site and enhance the therapeutic effects of proteins.Keywords: spinal cord injury, decellularized extracellular matrix, thermosensitive hydrogel, adsorption, basic fibroblast growth factor

  3. Preparation and Characterization of Sustained Release Matrix ...

    African Journals Online (AJOL)

    Purpose: To formulate matrix type sustained-release (SR) tablets of tizanidine hydrochloride (TH) for prolonged drug release and improvement in motor activity after spinal injuries. Methods: Matrix tablets were prepared by the wet granulation method using four polymers (hydroxyl propyl methyl cellulose [HPMC] K 100, ethyl ...

  4. Formulation of Sustained-Release Diltiazem Matrix Tablets Using ...

    African Journals Online (AJOL)

    Formulation of Sustained-Release Diltiazem Matrix Tablets Using Hydrophilic Gum Blends. A Moin, H.G Shivakumar. Abstract. Purpose: To develop sustained release matrix tablets of diltiazem hydrochloride (DTZ) using karaya gum (K) alone or in combination with locust bean gum (LB) and hydroxypropyl methylcellulose ...

  5. Ubiquitination of specific mitochondrial matrix proteins

    Energy Technology Data Exchange (ETDEWEB)

    Lehmann, Gilad [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ziv, Tamar [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Braten, Ori [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Admon, Arie [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Udasin, Ronald G. [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ciechanover, Aaron, E-mail: aaroncie@tx.technion.ac.il [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel)

    2016-06-17

    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  6. Determination of insoluble avian eggshell matrix proteins

    Czech Academy of Sciences Publication Activity Database

    Mikšík, Ivan; Sedláková, Pavla; Lacinová, Kateřina; Pataridis, Statis; Eckhardt, Adam

    2010-01-01

    Roč. 397, č. 1 (2010), s. 205-214 ISSN 1618-2642 R&D Projects: GA MŠk(CZ) 1M0510; GA ČR(CZ) GA203/09/0675; GA ČR(CZ) GA203/08/1428 Institutional research plan: CEZ:AV0Z50110509 Keywords : eggshell proteins * insoluble proteins * matrix proteins Subject RIV: CE - Biochemistry Impact factor: 3.841, year: 2010

  7. Metal matrix composites for sustainable lotus-effect surfaces.

    Science.gov (United States)

    Nosonovsky, Michael; Hejazi, Vahid; Nyong, Aniedi E; Rohatgi, Pradeep K

    2011-12-06

    The lotus effect involving roughness-induced superhydrophobicity is a way to design nonwetting, self-cleaning, omniphobic, icephobic, and antifouling surfaces. However, such surfaces require micropatterning, which is extremely vulnerable to even small wear rates. This limits the applicability of the lotus effects to situations when wear is practically absent. To design sustainable superhydrophobic surfaces, we suggest using metal matrix composites (MMCs) with hydrophobic reinforcement in the bulk of the material, rather than only at its surface. Such surfaces, if properly designed, provide roughness and heterogeneity needed for superhydrophobicity. In addition, they are sustainable, since when the surface layer is deteriorated and removed due to wear, hydrophobic reinforcement and roughness remains. We present a model and experimental data on wetting of MMCs. We also conducted selected experiments with graphite-reinforced MMCs and showed that the contact angle can be determined from the model. In order to decouple the effects of reinforcement and roughness, the experiments were conducted for initially smooth and etched matrix and composite materials. © 2011 American Chemical Society

  8. Matrix Model for Choosing Green Marketing Sustainable Strategic Alternatives

    Directory of Open Access Journals (Sweden)

    Cătălina Sitnikov

    2015-08-01

    Full Text Available Green marketing examines the symbiotic role played by marketing in ensuring sustainable business, exploring issues concerning the environment and the way strategic decisions can influence it. At present, the environmental issues concern more and more the competitive approach any organization can implement. Based on this approach, organizations can gain competitive advantage by managing environmental variables and by developing and implementing green marketing strategies. Considering the importance and impact of green marketing, by using theoretical concepts and defining a set of research directions, the paper and the research conducted were focused on creating a matrix model for choosing the optimal green marketing strategy, oriented towards competitive advantage. The model is based on the correlation that can be established among the generic strategies of competitive advantage, the variables of extended marketing mix (7Ps and the green marketing strategy matrix. There are also analyzed the implications that may be generated within a company by the adoption of a green marketing strategy and its role in promoting the environmental benefits of products.

  9. Assessing Agricultural Intensification Strategies with a Sustainable Agriculture Matrix

    Science.gov (United States)

    Zhang, X.; Davidson, E. A.

    2017-12-01

    To meet the growing global demand for food and bioenergy, agricultural production must nearly double by 2050, placing additional pressures on the environment and the society. Thus, how to efficiently use limited land, water, and nutrient resources to produce more food with low pollution (MoFoLoPo) is clearly one of the major challenges of this century. The increasingly interconnected global market provides a great opportunity for reallocating crop production to the countries and regions that use natural resources more efficiently. For example, it is estimated that optimizing the allocation of crop production around the world can mitigate 41% of nitrogen lost to the environment. However, higher efficiency in nutrients use does not necessarily lead to higher efficiency in land use or water use. In addition, the increasing share of international trade in food supply may introduce additional systemic risk and affect the resilience of global food system. Using the data/indicator from a Sustainable Agriculture Matrix and an international trade matrix, we developed a simple model to assess the trade-offs of international trade considering resource use efficiencies (including water, land, nitrogen, and phosphorus), economic costs and benefits, and the resilience of food system.

  10. A comparative analysis of viral matrix proteins using disorder predictors

    Directory of Open Access Journals (Sweden)

    Dunker A Keith

    2008-10-01

    Full Text Available Abstract Background A previous study (Goh G.K.-M., Dunker A.K., Uversky V.N. (2008 Protein intrinsic disorder toolbox for comparative analysis of viral proteins. BMC Genomics. 9 (Suppl. 2, S4 revealed that HIV matrix protein p17 possesses especially high levels of predicted intrinsic disorder (PID. In this study, we analyzed the PID patterns in matrix proteins of viruses related and unrelated to HIV-1. Results Both SIVmac and HIV-1 p17 proteins were predicted by PONDR VLXT to be highly disordered with subtle differences containing 50% and 60% disordered residues, respectively. SIVmac is very closely related to HIV-2. A specific region that is predicted to be disordered in HIV-1 is missing in SIVmac. The distributions of PID patterns seem to differ in SIVmac and HIV-1 p17 proteins. A high level of PID for the matrix does not seem to be mandatory for retroviruses, since Equine Infectious Anemia Virus (EIAV, an HIV cousin, has been predicted to have low PID level for the matrix; i.e. its matrix protein p15 contains only 21% PID residues. Surprisingly, the PID percentage and the pattern of predicted disorder distribution for p15 resemble those of the influenza matrix protein M1 (25%. Conclusion Our data might have important implications in the search for HIV vaccines since disorder in the matrix protein might provide a mechanism for immune evasion.

  11. Statistical Optimization of Sustained Release Venlafaxine HCI Wax Matrix Tablet.

    Science.gov (United States)

    Bhalekar, M R; Madgulkar, A R; Sheladiya, D D; Kshirsagar, S J; Wable, N D; Desale, S S

    2008-01-01

    The purpose of this research was to prepare a sustained release drug delivery system of venlafaxine hydrochloride by using a wax matrix system. The effects of bees wax and carnauba wax on drug release profile was investigated. A 3(2) full factorial design was applied to systemically optimize the drug release profile. Amounts of carnauba wax (X(1)) and bees wax (X(2)) were selected as independent variables and release after 12 h and time required for 50% (t(50)) drug release were selected as dependent variables. A mathematical model was generated for each response parameter. Both waxes retarded release after 12 h and increases the t(50) but bees wax showed significant influence. The drug release pattern for all the formulation combinations was found to be approaching Peppas kinetic model. Suitable combination of two waxes provided fairly good regulated release profile. The response surfaces and contour plots for each response parameter are presented for further interpretation of the results. The optimum formulations were chosen and their predicted results found to be in close agreement with experimental findings.

  12. FORMULATION OF ACECLOFENAC SUSTAINED RELEASE MATRIX TABLET USING HYDROPHILIC NATURAL GUM

    OpenAIRE

    Parasuram Rajam Radhika; Pankaj R. Kharkate; Thangavel Sivakumar

    2011-01-01

    In order to reduce production costs, a simple, direct compression sustained release formulation consisting of drug Aceclofenac and by using hydrophilic polymer guar gum and tamarind gum as the release modifier was investigated. No interaction between drug and polymer was confirmed by FTIR, which shows the suitability of all excipients with the drug to formulate the sustained release matrix tablets. Five batches of sustained release matrix tablets of Aceclofenac with both guar gum and tamarind...

  13. The requirement of matrix ATP for the import of precursor proteins into the mitochondrial matrix and intermembrane space

    NARCIS (Netherlands)

    Stuart, Rosemary A.; Gruhler, Albrecht; Klei, Ida van der; Guiard, Bernard; Koll, Hans; Neupert, Walter

    1994-01-01

    The role of ATP in the matrix for the import of precursor proteins into the various mitochondrial subcompartments was investigated by studying protein translocation at experimentally defined ATP levels. Proteins targeted to the matrix were neither imported or processed when matrix ATP was depleted.

  14. In vivo extracellular matrix protein expression by human periodontal ...

    African Journals Online (AJOL)

    It is well known that the orthodontic force applied to teeth generates a series of events that remodel the periodontal ligament (PDL). Extracellular matrix proteins (ECM) are described as molecular regulators of these events. However, the exact contribution of these proteins in human PDL modeling by orthodontic force ...

  15. Candidates of trichocyst matrix proteins of the dinoflagellate Oxyrrhis marina.

    Science.gov (United States)

    Rhiel, Erhard; Wöhlbrand, Lars; Rabus, Ralf; Voget, Sonja

    2018-01-01

    Trichocysts are a common cell organelle of ciliates and dinoflagellates. They are composed of trichocyst matrix proteins and have been intensely investigated and characterized in ciliates. Here, for the first time, data have been obtained for trichocyst matrix proteins of a dinoflagellate. A DELTA-BLAST search using 14 available and complete amino acid sequences of mature trichocyst matrix proteins of the ciliate Paramecium tetraurelia resulted in 16 hits for the dinoflagellate Oxyrrhis marina when the E values and bit values to be scored were 40. They code for proteins with acidic pI values and exceeded the precursors of the trichocyst matrix proteins of the ciliate approximately twofold in length. The values calculated for coverage, identity, and positives ranged from 76 to 100, 21.5 to 28.3, and 44.9 to 53.9%, respectively. Protein conformation predictions indicate coiled-coil domains which are a common feature of mature ciliate trichocyst matrix proteins. As often several EST sequences of O. marina matched with a queried mature trichocyst matrix protein of P. tetraurelia, a multigene family can be assumed for trichocyst proteins in this dinophyte, too. Trichocyst-enriched fractions of O. marina were isolated and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis. When samples were incubated with loading buffer without a reducing agent, the banding pattern was mainly composed of three regions in the range of >90, 75-60, and 50-35 kDa, with each region consisting of four to five bands. Tryptic in gel digestion of proteins excised from these three gel regions followed by mass spectrometry confirmed that up to 14 of the 16 predicted proteins were present within the trichocyst-enriched fractions. When the samples were reduced with either ß-mercaptoethanol or dithiothreitol, the proteins of the three regions disappeared almost completely and proteins in the range of 27 to 15 kDa became the dominating bands. Up to 12 of the predicted proteins

  16. Cartilage oligomeric matrix protein enhances the vascularization of acellular nerves

    Directory of Open Access Journals (Sweden)

    Wei-ling Cui

    2016-01-01

    Full Text Available Vascularization of acellular nerves has been shown to contribute to nerve bridging. In this study, we used a 10-mm sciatic nerve defect model in rats to determine whether cartilage oligomeric matrix protein enhances the vascularization of injured acellular nerves. The rat nerve defects were treated with acellular nerve grafting (control group alone or acellular nerve grafting combined with intraperitoneal injection of cartilage oligomeric matrix protein (experimental group. As shown through two-dimensional imaging, the vessels began to invade into the acellular nerve graft from both anastomotic ends at day 7 post-operation, and gradually covered the entire graft at day 21. The vascular density, vascular area, and the velocity of revascularization in the experimental group were all higher than those in the control group. These results indicate that cartilage oligomeric matrix protein enhances the vascularization of acellular nerves.

  17. Formulation of Sustained-Release Matrix Tablets Using Cross ...

    African Journals Online (AJOL)

    Matrix tablets of DTZ were prepared using varying ratios of unmodified karaya gum (K) and MK by direct compression. ... SEM images of the tablets before and after dissolution showed some morphological changes on the tablet surface while FTIR and DSC thermogram studies confirmed that there was no chemical ...

  18. Enamel matrix proteins; old molecules for new applications.

    Science.gov (United States)

    Lyngstadaas, S P; Wohlfahrt, J C; Brookes, S J; Paine, M L; Snead, M L; Reseland, J E

    2009-08-01

    Emdogain (enamel matrix derivative, EMD) is well recognized in periodontology, where it is used as a local adjunct to periodontal surgery to stimulate regeneration of periodontal tissues lost to periodontal disease. The biological effect of EMD is through stimulation of local growth factor secretion and cytokine expression in the treated tissues, inducing a regenerative process that mimics odontogenesis. The major (>95%) component of EMD is Amelogenins (Amel). No other active components have so far been isolated from EMD, and several studies have shown that purified amelogenins can induce the same effect as the complete EMD. Amelogenins comprise a family of highly conserved extracellular matrix proteins derived from one gene. Amelogenin structure and function is evolutionary well conserved, suggesting a profound role in biomineralization and hard tissue formation. A special feature of amelogenins is that under physiological conditions the proteins self-assembles into nanospheres that constitute an extracellular matrix. In the body, this matrix is slowly digested by specific extracellular proteolytic enzymes (matrix metalloproteinase) in a controlled process, releasing bioactive peptides to the surrounding tissues for weeks after application. Based on clinical and experimental observations in periodontology indicating that amelogenins can have a significant positive influence on wound healing, bone formation and root resorption, several new applications for amelogenins have been suggested. New experiments now confirm that amelogenins have potential for being used also in the fields of endodontics, bone regeneration, implantology, traumatology, and wound care.

  19. Expression, purification and crystallization of a lyssavirus matrix (M) protein

    Energy Technology Data Exchange (ETDEWEB)

    Assenberg, René [Division of Structural Biology and Oxford Protein Production Facility, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Delmas, Olivier [UPRE Lyssavirus Dynamics and Host Adaptation, WHO Collaborating Centre for Reference and Research on Rabies, Institut Pasteur, 28 Rue du Docteur Roux, 75724 Paris CEDEX 15 (France); Graham, Stephen C.; Verma, Anil; Berrow, Nick; Stuart, David I.; Owens, Raymond J. [Division of Structural Biology and Oxford Protein Production Facility, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Bourhy, Hervé [UPRE Lyssavirus Dynamics and Host Adaptation, WHO Collaborating Centre for Reference and Research on Rabies, Institut Pasteur, 28 Rue du Docteur Roux, 75724 Paris CEDEX 15 (France); Grimes, Jonathan M., E-mail: jonathan@strubi.ox.ac.uk [Division of Structural Biology and Oxford Protein Production Facility, The Henry Wellcome Building for Genomic Medicine, Oxford University, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2008-04-01

    The expression, purification and crystallization of the full-length matrix protein from three lyssaviruses is described. The matrix (M) proteins of lyssaviruses (family Rhabdoviridae) are crucial to viral morphogenesis as well as in modulating replication and transcription of the viral genome. To date, no high-resolution structural information has been obtained for full-length rhabdovirus M. Here, the cloning, expression and purification of the matrix proteins from three lyssaviruses, Lagos bat virus (LAG), Mokola virus and Thailand dog virus, are described. Crystals have been obtained for the full-length M protein from Lagos bat virus (LAG M). Successful crystallization depended on a number of factors, in particular the addition of an N-terminal SUMO fusion tag to increase protein solubility. Diffraction data have been recorded from crystals of native and selenomethionine-labelled LAG M to 2.75 and 3.0 Å resolution, respectively. Preliminary analysis indicates that these crystals belong to space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 56.9–57.2, c = 187.9–188.6 Å, consistent with the presence of one molecule per asymmetric unit, and structure determination is currently in progress.

  20. Cartilage oligomeric matrix protein enhances matrix assembly during chondrogenesis of human mesenchymal stem cells.

    Science.gov (United States)

    Haleem-Smith, Hana; Calderon, Raul; Song, Yingjie; Tuan, Rocky S; Chen, Faye H

    2012-04-01

    Cartilage oligomeric matrix protein/thrombospondin-5 (COMP/TSP5) is an abundant cartilage extracellular matrix (ECM) protein that interacts with major cartilage ECM components, including aggrecan and collagens. To test our hypothesis that COMP/TSP5 functions in the assembly of the ECM during cartilage morphogenesis, we have employed mesenchymal stem cell (MSC) chondrogenesis in vitro as a model to examine the effects of COMP over-expression on neo-cartilage formation. Human bone marrow-derived MSCs were transfected with either full-length COMP cDNA or control plasmid, followed by chondrogenic induction in three-dimensional pellet or alginate hydrogel culture. MSC chondrogenesis and ECM production was estimated based on quantitation of sulfated glycosaminoglycan (sGAG) accumulation, immunohistochemistry of the presence and distribution of cartilage ECM proteins, and real-time RT-PCR analyis of mRNA expression of cartilage markers. Our results showed that COMP over-expression resulted in increased total sGAG content during the early phase of MSC chondrogenesis, and increased immuno-detectable levels of aggrecan and collagen type II in the ECM of COMP-transfected pellet and alginate cultures, indicating more abundant cartilaginous matrix. COMP transfection did not significantly increase the transcript levels of the early chondrogenic marker, Sox9, or aggrecan, suggesting that enhancement of MSC cartilage ECM was effected at post-transcriptional levels. These findings strongly suggest that COMP functions in mesenchymal chondrogenesis by enhancing cartilage ECM organization and assembly. The action of COMP is most likely mediated not via direct changes in cartilage matrix gene expression but via interactions of COMP with other cartilage ECM proteins, such as aggrecan and collagens, that result in enhanced assembly and retention.

  1. Development of Sustained Release Capsules Containing “Coated Matrix Granules of Metoprolol Tartrate”

    OpenAIRE

    Siddique, Sabahuddin; Khanam, Jasmina; Bigoniya, Papiya

    2010-01-01

    The objective of this investigation was to prepare sustained release capsule containing coated matrix granules of metoprolol tartrate and to study its in vitro release and in vivo absorption. The design of dosage form was performed by choosing hydrophilic hydroxypropyl methyl cellulose (HPMC K100M) and hydrophobic ethyl cellulose (EC) polymers as matrix builders and Eudragit® RL/RS as coating polymers. Granules were prepared by composing drug with HPMC K100M, EC, dicalcium phosphate by wet gr...

  2. Development and evaluation of Ketoprofen sustained release matrix tablet using Hibiscus rosa-sinensis leaves mucilage

    OpenAIRE

    Kaleemullah, M.; Jiyauddin, K.; Thiban, E.; Rasha, S.; Al-Dhalli, S.; Budiasih, S.; Gamal, O.E.; Fadli, A.; Eddy, Y.

    2016-01-01

    Currently, the use of natural gums and mucilage is of increasing importance in pharmaceutical formulations as valuable drug excipient. Natural plant-based materials are economic, free of side effects, biocompatible and biodegradable. Therefore, Ketoprofen matrix tablets were formulated by employing Hibiscus rosa-sinensis leaves mucilage as natural polymer and HPMC (K100M) as a synthetic polymer to sustain the drug release from matrix system. Direct compression method was used to develop susta...

  3. Enamel matrix protein derivatives: role in periodontal regeneration

    Directory of Open Access Journals (Sweden)

    Rathva VJ

    2011-12-01

    Full Text Available Vandana J RathvaDepartment of Periodontics, KM Shah Dental College and Hospital, Sumandeep University, Gujarat, IndiaAbstract: The role of regenerative periodontal therapy is the reconstitution of lost periodontal structures, ie, new formation of root cementum, periodontal ligament, and alveolar bone. The outcome of basic research has pointed to the important role of enamel matrix protein derivative (EMD in periodontal wound healing. Histologic results from animal and human studies have shown that treatment with EMD promotes periodontal regeneration. Moreover, clinical studies have indicated that treatment with EMD positively influences periodontal wound healing in humans. The goal of this paper is to review the existing literature on EMD.Keywords: enamel matrix protein derivative, Emdogain®, periodontal regeneration

  4. Improved gel electrophoresis matrix for hydrophobic protein separation and identification.

    Science.gov (United States)

    Tokarski, Caroline; Fillet, Marianne; Rolando, Christian

    2011-03-01

    We propose an improved acrylamide gel for the separation of hydrophobic proteins. The separation strategy is based on the incorporation of N-alkylated and N,N'-dialkylated acrylamide monomers in the gel composition in order to increase hydrophobic interactions between the gel matrix and the membrane proteins. Focusing on the most efficient monomer, N,N'-dimethylacrylamide, the potentiality of the new matrix was evaluated on membrane proteins of the human colon HCT-116 cell line. Protein analysis was performed using an adapted analytical strategy based on FT-ICR tandem mass spectrometry. As a result of this comparative study, including advanced reproducibility experiments, more hydrophobic proteins were identified in the new gel (average GRAVY: -0.085) than in the classical gel (average GRAVY: -0.411). Highly hydrophobic peptides were identified reaching a GRAVY value up to 1.450, therefore indicating their probable locations in the membrane. Focusing on predicted transmembrane domains, it can be pointed out that 27 proteins were identified in the hydrophobic gel containing up to 11 transmembrane domains; in the classical gel, only 5 proteins containing 1 transmembrane domain were successfully identified. For example, multiple ionic channels and receptors were characterized in the hydrophobic gel such as the sodium/potassium channel and the glutamate or the transferrin receptors whereas they are traditionally detected using specific enrichment techniques such as immunoprecipitation. In total, membrane proteins identified in the classical gel are well documented in the literature, while most of the membrane proteins only identified on the hydrophobic gel have rarely or never been described using a proteomic-based approach. 2010 Elsevier Inc. All rights reserved.

  5. Interaction between the enamel matrix proteins amelogenin and ameloblastin

    International Nuclear Information System (INIS)

    Ravindranath, Hanumanth H.; Chen, Li-Sha; Zeichner-David, Margaret; Ishima, Rieko; Ravindranath, Rajeswari M.H.

    2004-01-01

    Enamel matrix consists of amelogenin and non-amelogenins. Though amelogenin is not involved in nucleation of minerals, the enamel mineralization is impaired when amelogenin or other matrix protein (ameloblastin/enamelin) genes are mutated. We hypothesize that amelogenin may promote enamel mineralization by interacting with the calcium-binding matrix proteins. Specific binding of amelogenin to N-acetylglucosamine (GlcNAc), GlcNAc-mimicking peptides (GMps), and their carrier proteins and the identification of amelogenin-trityrosyl-motif-peptide (ATMP) as a GlcNAc/GMp-binding domain in amelogenin favor the hypothesis. This study tested the interaction of amelogenin with ameloblastin, a carrier of GMp sequence at intermittent sites. Neither GlcNAc nor sialic acids were identified in the recombinant-ameloblastin. Amelogenin bound to recombinant-ameloblastin in both Western blots and in ELISA. More specifically, [ 3 H]ATMP bound to both recombinant and native ameloblastins. Dosimetry and Scatchard analyses showed the specific interaction between ATMP and ameloblastin, suggesting that amelogenin may interact with ameloblastin to form a heteromolecular assembly

  6. Interaction between the enamel matrix proteins amelogenin and ameloblastin.

    Science.gov (United States)

    Ravindranath, Hanumanth H; Chen, Li-Sha; Zeichner-David, Margaret; Ishima, Rieko; Ravindranath, Rajeswari M H

    2004-10-22

    Enamel matrix consists of amelogenin and non-amelogenins. Though amelogenin is not involved in nucleation of minerals, the enamel mineralization is impaired when amelogenin or other matrix protein (ameloblastin/enamelin) genes are mutated. We hypothesize that amelogenin may promote enamel mineralization by interacting with the calcium-binding matrix proteins. Specific binding of amelogenin to N-acetylglucosamine (GlcNAc), GlcNAc-mimicking peptides (GMps), and their carrier proteins and the identification of amelogenin-trityrosyl-motif-peptide (ATMP) as a GlcNAc/GMp-binding domain in amelogenin favor the hypothesis. This study tested the interaction of amelogenin with ameloblastin, a carrier of GMp sequence at intermittent sites. Neither GlcNAc nor sialic acids were identified in the recombinant-ameloblastin. Amelogenin bound to recombinant-ameloblastin in both Western blots and in ELISA. More specifically, [(3)H]ATMP bound to both recombinant and native ameloblastins. Dosimetry and Scatchard analyses showed the specific interaction between ATMP and ameloblastin, suggesting that amelogenin may interact with ameloblastin to form a heteromolecular assembly.

  7. Dry fractionation for sustainable production of functional legume protein concentrates

    NARCIS (Netherlands)

    Schutyser, M.A.I.; Pelgrom, P.J.M.; Goot, van der A.J.; Boom, R.M.

    2015-01-01

    Plant proteins gain increasing interest as part of a sustainable diet. Because plant materials not only contain protein, they are generally isolated via an energy intensive wet fractionation. This review discusses dry fractionation as an alternative and more sustainable route for producing

  8. Molecular events in matrix protein metabolism in the aging kidney

    Science.gov (United States)

    Sataranatarajan, Kavithalakshmi; Feliers, Denis; Mariappan, Meenalakshmi M.; Lee, Hak Joo; Lee, Myung Ja; Day, Robert T.; Yalamanchili, Hima Bindu; Choudhury, Goutam G.; Barnes, Jeffrey L.; Van Remmen, Holly; Richardson, Arlan; Kasinath, Balakuntalam S.

    2018-01-01

    Summary We explored molecular events associated with aging-induced matrix changes in the kidney. C57BL6 mice were studied in youth, middle age, and old age. Albuminuria and serum cystatin C level (an index of glomerular filtration) increased with aging. Renal hypertrophy was evident in middle-aged and old mice and was associated with glomerulomegaly and increase in mesangial fraction occupied by extracellular matrix. Content of collagen types I and III and fibronectin was increased with aging; increment in their mRNA varied with the phase of aging. The content of ZEB1 and ZEB2, collagen type I transcription inhibitors, and their binding to the collagen type Iα2 promoter by ChIP assay also showed age-phase-specific changes. Lack of increase in mRNA and data from polysome assay suggested decreased degradation as a potential mechanism for kidney collagen type I accumulation in the middle-aged mice. These changes occurred with increment in TGFβ mRNA and protein and activation of its SMAD3 pathway; SMAD3 binding to the collagen type Iα2 promoter was also increased. TGFβ-regulated microRNAs (miRs) exhibited selective regulation. The renal cortical content of miR-21 and miR-200c, but not miR-192, miR-200a, or miR-200b, was increased with aging. Increased miR-21 and miR-200c contents were associated with reduced expression of their targets, Sprouty-1 and ZEB2, respectively. These data show that aging is associated with complex molecular events in the kidney that are already evident in the middle age and progress to old age. Agephase-specific regulation of matrix protein synthesis occurs and involves matrix protein-specific transcriptional and post-transcriptional mechanisms. PMID:23020145

  9. Evaluating the environmental sustainability of biomass-based energy strategy: Using an impact matrix framework

    International Nuclear Information System (INIS)

    Weldu, Yemane W.; Assefa, Getachew

    2016-01-01

    A roadmap for a more sustainable energy strategy is complex, as its development interacts critically with the economic, social, and environmental dimensions of sustainable development. This paper applied an impact matrix method to evaluate the environmental sustainability and to identify the desirable policy objectives of biomass-based energy strategy for the case of Alberta. A matrix with the sustainability domains on one axis and areas of environmental impact on the other was presented to evaluate the nexus effect of policy objectives and bioenergy production. As per to our analysis, economic diversification, technological innovation, and resource conservation came up as the desirable policy objectives of sustainable development for Alberta because they demonstrated environmental benefits in all environmental impact categories, namely climate change, human health, and ecosystem. On the other hand, human health and ecosystem impacts were identified as trade-offs when the policy objectives for sustainability were energy security, job creation, and climate change. Thus, bioenergy can mitigate climate change but may impact human health and ecosystem which then in turn can become issues of concern. Energy strategies may result in shifting of risks from one environmental impact category to another, and from one sustainable domain to another if the technical and policy-related issues are not identified.

  10. Protein-Polymer Matrix Mediated Synthesis of Silver Nanoparticles

    Directory of Open Access Journals (Sweden)

    Swati Mishra

    2014-09-01

    Full Text Available Silver nanoparticles were synthesized in the protein-polymer matrices of two different ratios to obtain a stringent control over the morphology. UV-visible spectrophotometry showed a single plasmon resonance peak at 416nm and 418nm respectively, confirming the formation of silver nanoparticles. X-ray diffractometry confirmed that the peaks matched with that of the reference silver. Both confocal microscopy and FEG-SEM confirmed the uniform morphology of the synthesized particles dependent on the template ratio. Doubling the protein-polymer concentration results in greater stability, more nucleation sites and hence restricted growth. Photoluminescence of the sample in the doubled matrix was found to be much greater at any given wavelength, meaning the flexibility and rigidity of interacting molecules affects the luminescence signal. The interaction in turn is dependent on the proximity of the proteins and polymer in the dispersion that forms a template and dictates the synthesis.

  11. Predicting protein-protein interactions from multimodal biological data sources via nonnegative matrix tri-factorization.

    Science.gov (United States)

    Wang, Hua; Huang, Heng; Ding, Chris; Nie, Feiping

    2013-04-01

    Protein interactions are central to all the biological processes and structural scaffolds in living organisms, because they orchestrate a number of cellular processes such as metabolic pathways and immunological recognition. Several high-throughput methods, for example, yeast two-hybrid system and mass spectrometry method, can help determine protein interactions, which, however, suffer from high false-positive rates. Moreover, many protein interactions predicted by one method are not supported by another. Therefore, computational methods are necessary and crucial to complete the interactome expeditiously. In this work, we formulate the problem of predicting protein interactions from a new mathematical perspective--sparse matrix completion, and propose a novel nonnegative matrix factorization (NMF)-based matrix completion approach to predict new protein interactions from existing protein interaction networks. Through using manifold regularization, we further develop our method to integrate different biological data sources, such as protein sequences, gene expressions, protein structure information, etc. Extensive experimental results on four species, Saccharomyces cerevisiae, Drosophila melanogaster, Homo sapiens, and Caenorhabditis elegans, have shown that our new methods outperform related state-of-the-art protein interaction prediction methods.

  12. An innovative protocol for schwann cells extracellular matrix proteins extraction.

    Science.gov (United States)

    Parisi, L; Zomer Volpato, F; Cagol, N; Siciliano, M; Migliaresi, C; Motta, A; Sala, R

    2016-12-01

    The evidence that extracellular matrix (ECM) components could represent new targets for drugs designed to approach degenerative disease, requires their analysis. Before the analysis, proteins should be extracted from ECM and solubilized. Currently, few protocols for ECM proteins extraction and solubilization are available in literature, and most of them are based mainly on the use of proteolytic enzymes, such as trypsin, which often lead to proteins damage. Moreover, no methods have been so far proposed to solubilize Schwann Cell ECM, which may represent an important target for the therapy of neurodegenerative disorders. In our study, we propose to solubilize SC ECM through the use of surfactants and urea. We compared our method of solubilization, with one of that proposed in literature for a general ECM, mainly based on the use of enzymes. We want to highlight the benefit of solubilizing SC ECM, avoiding the use of proteolytic enzymes. To compare the amount of proteins extracted with both methods, MicroBCA assay was used, while the quality of the proteins extracted was observed through the SDS-PAGE. The results obtained confirm a better solubilization of SC ECM proteins with the proposed protocol, both quantitatively and qualitatively, showing a higher concentration of proteins extracted and a better enrichment of protein fractions, if compared to the enzyme-based protocol. Our results show that SC ECM could be efficiently solubilized through the use of surfactant and urea, avoiding the use of enzyme-base methods. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 3175-3180, 2016. © 2016 Wiley Periodicals, Inc.

  13. Sustainable protein production and consumption : pigs of peas?

    NARCIS (Netherlands)

    Aiking, H.; Boer, de J.; Vereijken, J.M.

    2006-01-01

    Sustainable Protein Production and Consumption: Pigs or Peas? is a book that presents and explores the PROFETAS programme for development of a more sustainable food system by studying the feasibility of substituting meat with plant based alternatives. The emphasis is on improving the food system by

  14. Immunohistochemical localization of dentin matrix protein 1 in human dentin

    Directory of Open Access Journals (Sweden)

    G Orsini

    2009-08-01

    Full Text Available Dentin matrix protein 1 (DMP1 is a non-collagenous matrix protein with a recognized role in the formation of mineralized tissues such as dentin. The aim of this study was to analyze the distribution of DMP1 in human dentin by means of immunofluorescence and high-resolution immunogold labeling. Fully developed, sound human dentin specimens were submitted to fluorescence labeling and post-embedding immunolabeling techniques with a rabbit polyclonal antihuman DMP1 antibody followed by corresponding fluorochrome- conjugated or gold-conjugated secondary antibodies. Both immunofluorescence and immunogold labeling showed an intense labeling associated with the peritubular dentin. In addition, at the ultrastructural level, there was also a moderate and diffuse immunoreaction over intertubular dentin, and a weak labeling within predentin which increased in density towards the mineralization front. This study suggests that in adult human teeth, like in rodents, DMP1 is prevalently concentrated at the level of peritubular dentin and this feature is preserved also in fully developed-teeth. These data are consistent with what has been observed in rodents and suggest that DMP1 plays a role in maintenance of the dentin tubular space.

  15. NMR Structure of the Myristylated Feline Immunodeficiency Virus Matrix Protein

    Directory of Open Access Journals (Sweden)

    Lola A. Brown

    2015-04-01

    Full Text Available Membrane targeting by the Gag proteins of the human immunodeficiency viruses (HIV types-1 and -2 is mediated by Gag’s N-terminally myristylated matrix (MA domain and is dependent on cellular phosphatidylinositol-4,5-bisphosphate [PI(4,5P2]. To determine if other lentiviruses employ a similar membrane targeting mechanism, we initiated studies of the feline immunodeficiency virus (FIV, a widespread feline pathogen with potential utility for development of human therapeutics. Bacterial co-translational myristylation was facilitated by mutation of two amino acids near the amino-terminus of the protein (Q5A/G6S; myrMAQ5A/G6S. These substitutions did not affect virus assembly or release from transfected cells. NMR studies revealed that the myristyl group is buried within a hydrophobic pocket in a manner that is structurally similar to that observed for the myristylated HIV-1 protein. Comparisons with a recent crystal structure of the unmyristylated FIV protein [myr(-MA] indicate that only small changes in helix orientation are required to accommodate the sequestered myr group. Depletion of PI(4,5P2 from the plasma membrane of FIV-infected CRFK cells inhibited production of FIV particles, indicating that, like HIV, FIV hijacks the PI(4,5P2 cellular signaling system to direct intracellular Gag trafficking during virus assembly.

  16. NMR Structure of the Myristylated Feline Immunodeficiency Virus Matrix Protein

    Science.gov (United States)

    Brown, Lola A.; Cox, Cassiah; Baptiste, Janae; Summers, Holly; Button, Ryan; Bahlow, Kennedy; Spurrier, Vaughn; Kyser, Jenna; Luttge, Benjamin G.; Kuo, Lillian; Freed, Eric O.; Summers, Michael F.

    2015-01-01

    Membrane targeting by the Gag proteins of the human immunodeficiency viruses (HIV types-1 and -2) is mediated by Gag’s N-terminally myristylated matrix (MA) domain and is dependent on cellular phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2]. To determine if other lentiviruses employ a similar membrane targeting mechanism, we initiated studies of the feline immunodeficiency virus (FIV), a widespread feline pathogen with potential utility for development of human therapeutics. Bacterial co-translational myristylation was facilitated by mutation of two amino acids near the amino-terminus of the protein (Q5A/G6S; myrMAQ5A/G6S). These substitutions did not affect virus assembly or release from transfected cells. NMR studies revealed that the myristyl group is buried within a hydrophobic pocket in a manner that is structurally similar to that observed for the myristylated HIV-1 protein. Comparisons with a recent crystal structure of the unmyristylated FIV protein [myr(-)MA] indicate that only small changes in helix orientation are required to accommodate the sequestered myr group. Depletion of PI(4,5)P2 from the plasma membrane of FIV-infected CRFK cells inhibited production of FIV particles, indicating that, like HIV, FIV hijacks the PI(4,5)P2 cellular signaling system to direct intracellular Gag trafficking during virus assembly. PMID:25941825

  17. Influence of Natural, Synthetic Polymers and Fillers on sustained release matrix tablets of Pregabalin

    OpenAIRE

    Vijaya Durga. K; Ashok Kumar. P; Suresh V Kulkarni

    2013-01-01

    The objective of the present study was to develop sustained release matrix tablets of Pregabalin for the treatment of neuropathic pain and epilepsy. The tablets were prepared by wet granulation and formulated using drug with Hydrophilic, hydrophobic, synthetic, natural polymers and 4 different fillers were used. The effect of Polymer concentration, combination and fillers on drug release rate was analyzed for the formulations F-1 to F-17. The tablets were subjected to physicochemical studies,...

  18. Development and evaluation of Ketoprofen sustained release matrix tablet using Hibiscus rosa-sinensis leaves mucilage

    Directory of Open Access Journals (Sweden)

    M. Kaleemullah

    2017-07-01

    Full Text Available Currently, the use of natural gums and mucilage is of increasing importance in pharmaceutical formulations as valuable drug excipient. Natural plant-based materials are economic, free of side effects, biocompatible and biodegradable. Therefore, Ketoprofen matrix tablets were formulated by employing Hibiscus rosa-sinensis leaves mucilage as natural polymer and HPMC (K100M as a synthetic polymer to sustain the drug release from matrix system. Direct compression method was used to develop sustained released matrix tablets. The formulated matrix tablets were evaluated in terms of physical appearance, weight variation, thickness, diameter, hardness, friability and in vitro drug release. The difference between the natural and synthetic polymers was investigated concurrently. Matrix tablets developed from each formulation passed all standard physical evaluation tests. The dissolution studies of formulated tablets revealed sustained drug release up to 24 h compared to the reference drug Apo Keto® SR tablets. The dissolution data later were fitted into kinetic models such as zero order equation, first order equation, Higuchi equation, Hixson Crowell equation and Korsmeyer-Peppas equation to study the release of drugs from each formulation. The best formulations were selected based on the similarity factor (f2 value of 50% and more. Through the research, it is found that by increasing the polymers concentration, the rate of drug release decreased for both natural and synthetic polymers. The best formulation was found to be F3 which contained 40% Hibiscus rosa-sinensis mucilage polymer and showed comparable dissolution profile to the reference drug with f2 value of 78.03%. The release kinetics of this formulation has shown to follow non-Fickian type which involved both diffusion and erosion mechanism. Additionally, the statistical results indicated that there was no significant difference (p > 0.05 between the F3 and reference drug in terms of MDT and

  19. Development and evaluation of Ketoprofen sustained release matrix tablet using Hibiscus rosa-sinensis leaves mucilage.

    Science.gov (United States)

    Kaleemullah, M; Jiyauddin, K; Thiban, E; Rasha, S; Al-Dhalli, S; Budiasih, S; Gamal, O E; Fadli, A; Eddy, Y

    2017-07-01

    Currently, the use of natural gums and mucilage is of increasing importance in pharmaceutical formulations as valuable drug excipient. Natural plant-based materials are economic, free of side effects, biocompatible and biodegradable. Therefore, Ketoprofen matrix tablets were formulated by employing Hibiscus rosa-sinensis leaves mucilage as natural polymer and HPMC (K100M) as a synthetic polymer to sustain the drug release from matrix system. Direct compression method was used to develop sustained released matrix tablets. The formulated matrix tablets were evaluated in terms of physical appearance, weight variation, thickness, diameter, hardness, friability and in vitro drug release. The difference between the natural and synthetic polymers was investigated concurrently. Matrix tablets developed from each formulation passed all standard physical evaluation tests. The dissolution studies of formulated tablets revealed sustained drug release up to 24 h compared to the reference drug Apo Keto® SR tablets. The dissolution data later were fitted into kinetic models such as zero order equation, first order equation, Higuchi equation, Hixson Crowell equation and Korsmeyer-Peppas equation to study the release of drugs from each formulation. The best formulations were selected based on the similarity factor ( f 2 ) value of 50% and more. Through the research, it is found that by increasing the polymers concentration, the rate of drug release decreased for both natural and synthetic polymers. The best formulation was found to be F3 which contained 40% Hibiscus rosa-sinensis mucilage polymer and showed comparable dissolution profile to the reference drug with f 2 value of 78.03%. The release kinetics of this formulation has shown to follow non-Fickian type which involved both diffusion and erosion mechanism. Additionally, the statistical results indicated that there was no significant difference (p > 0.05) between the F3 and reference drug in terms of MDT and T50% with p

  20. A matrix in life cycle perspective for selecting sustainable materials for buildings in Sri Lanka

    Energy Technology Data Exchange (ETDEWEB)

    Abeysundara, U.G. Yasantha [Ministry of Education, Isurupaya, Battaramulla (Sri Lanka); Babel, Sandhya [Environmental Technology Program, School of Biochemical Engineering and Technology, Sirindhorn International Institute of Technology, Thammasat University, P.O. Box 22, Pathumthani 12121 (Thailand); Gheewala, Shabbir [The Joint Graduate School of Energy and Environment, King Mongkut' s University of Technology Thonburi, Bangkok 10140 (Thailand)

    2009-05-15

    This paper presents a matrix to select sustainable materials for buildings in Sri Lanka, taking into consideration environmental, economic and social assessments of materials in a life cycle perspective. Five building elements, viz., foundations, roofs, ceilings, doors and windows, and floors are analyzed based on materials used for these elements. Environmental burdens associated with these elements are analyzed in terms of embodied energy and environmental impacts such as global warming, acidification and nutrient enrichment. Economic analysis is based on market prices and affordability of materials. Social factors that are taken into account are thermal comfort, interior (aesthetics), ability to construct quickly, strength and durability. By compiling the results of analyses, two building types with minimum and maximum impacts are identified. These two cases along with existing buildings are compared in a matrix of environmental, economic and social scores. Analysis of the results also indicates need for higher consideration of environmental parameters in decision-making over social and economic factors, as social and economic scores do not vary much between cases. Hence, this matrix helps decision-makers to select sustainable materials for buildings, meaningfully, and thus helps to move towards a more sustainable buildings and construction sector. (author)

  1. Extracellular matrix-associated proteins form an integral and dynamic system during Pseudomonas aeruginosa biofilm development

    Directory of Open Access Journals (Sweden)

    Weipeng eZhang

    2015-05-01

    Full Text Available Though the essential role of extracellular matrix in biofilm development has been extensively documented, the function of matrix-associated proteins is elusive. Determining the dynamics of matrix-associated proteins would be a useful way to reveal their functions in biofilm development. Therefore, we applied iTRAQ-based quantitative proteomics to evaluate matrix-associated proteins isolated from different phases of Pseudomonas aeruginosa ATCC27853 biofilms. Among the identified 389 proteins, 54 changed their abundance significantly. The increased abundance of stress resistance and nutrient metabolism-related proteins over the period of biofilm development was consistent with the hypothesis that biofilm matrix forms micro-environments in which cells are optimally organized to resist stress and use available nutrients. Secreted proteins, including novel putative effectors of the type III secretion system were identified, suggesting that the dynamics of pathogenesis-related proteins in the matrix are associated with biofilm development. Interestingly, there was a good correlation between the abundance changes of matrix-associated proteins and their expression. Further analysis revealed complex interactions among these modulated proteins, and the mutation of selected proteins attenuated biofilm development. Collectively, this work presents the first dynamic picture of matrix-associated proteins during biofilm development, and provides evidences that the matrix-associated proteins may form an integral and well regulated system that contributes to stress resistance, nutrient acquisition, pathogenesis and the stability of the biofilm.

  2. Perrenial Grasses for Sustainable European Protein Production

    DEFF Research Database (Denmark)

    Jørgensen, Uffe; Lærke, Poul Erik

    2016-01-01

    benefits, a reduction of nitrate leaching equivalent to 23,000 tonnes N annually was estimated. This is approximately the reduction required by the WFD for Denmark. Even though much more organic matter will be mobilized for biorefining, soil carbon levels are estimated to be largely unchanged...... production into grass production. Grasses and legumes have higher contents of protein with better quality (high lysine and methionine contents) than grain and seed crops. Thus, substituting imported soya bean protein with protein extracted from perennial grasses is an interesting option....

  3. Extracellular matrix proteins: a positive feedback loop in lung fibrosis?

    Science.gov (United States)

    Blaauboer, Marjolein E; Boeijen, Fee R; Emson, Claire L; Turner, Scott M; Zandieh-Doulabi, Behrouz; Hanemaaijer, Roeland; Smit, Theo H; Stoop, Reinout; Everts, Vincent

    2014-02-01

    Lung fibrosis is characterized by excessive deposition of extracellular matrix. This not only affects tissue architecture and function, but it also influences fibroblast behavior and thus disease progression. Here we describe the expression of elastin, type V collagen and tenascin C during the development of bleomycin-induced lung fibrosis. We further report in vitro experiments clarifying both the effect of myofibroblast differentiation on this expression and the effect of extracellular elastin on myofibroblast differentiation. Lung fibrosis was induced in female C57Bl/6 mice by bleomycin instillation. Animals were sacrificed at zero to five weeks after fibrosis induction. Collagen synthesized during the week prior to sacrifice was labeled with deuterium. After sacrifice, lung tissue was collected for determination of new collagen formation, microarray analysis, and histology. Human lung fibroblasts were grown on tissue culture plastic or BioFlex culture plates coated with type I collagen or elastin, and stimulated to undergo myofibroblast differentiation by 0-10 ng/ml transforming growth factor (TGF)β1. mRNA expression was analyzed by quantitative real-time PCR. New collagen formation during bleomycin-induced fibrosis was highly correlated to gene expression of elastin, type V collagen and tenascin C. At the protein level, elastin, type V collagen and tenascin C were highly expressed in fibrotic areas as seen in histological sections of the lung. Type V collagen and tenascin C were transiently increased. Human lung fibroblasts stimulated with TGFβ1 strongly increased gene expression of elastin, type V collagen and tenascin C. The extracellular presence of elastin increased gene expression of the myofibroblastic markers α smooth muscle actin and type I collagen. The extracellular matrix composition changes dramatically during the development of lung fibrosis. The increased levels of elastin, type V collagen and tenascin C are probably the result of increased

  4. A National Scale Sustainable Agriculture Matrix of Indicators to Inform Policy

    Science.gov (United States)

    Davidson, E. A.; Zhang, X.

    2017-12-01

    The ratification of Sustainable Development Goals (SDGs) by all member countries of the United Nations demonstrates the determination of the international community in moving towards a sustainable future. To enable and encourage accountability, independent and transparent measurements of national sustainability efforts are essential. Among all sectors, agriculture is fundamental to all three pillars of sustainability, namely environment, society, and economy. However, the definition of a sustainable agriculture and the feasibility of measuring it remain elusive, in part because it encompasses both biophysical and socio-economic components that are still poorly integrated. Therefore, we have been developing a Sustainable Agriculture Matrix (SAM) on a national scale in order to measure country-level performance in agriculture. First proposed by Swaminathan for agricultural research and policy in 1990s, SAM is a collection of indicators measuring sustainable agriculture from environmental, social, and economic dimensions. The environmental dimension evaluates various impacts of agricultural production on the environment, such as water consumption and nutrient pollution. The economic dimension quantifies the costs and benefits for major stakeholders involved in agricultural production, including government, industry, farmers, and consumers. The social dimension considers three major aspects: 1) social welfare (e.g., hunger and poverty rate, nutritional quality, demography of rural community); 2) equity over sectors, space, and gender (e.g., access to resources/services and opportunities, distribution of income, land ownership and tenure rights); 3) systemic risk (e.g., fragility of the global agricultural production and trade system, resilience of a farm or a country to market and natural shocks). Translating the illustrative concepts into measureable indicators will not only provide an independent and transparent measurement of national performance in the

  5. Vitamin K-dependent proteins: osteocalcin, matrix Gla-protein and extra osseous effects

    Directory of Open Access Journals (Sweden)

    Yu V Pankratova

    2013-06-01

    Full Text Available Vitamin K - is a fat-soluble vitamin which plays an important role in the metabolism of bone and connective tissue, maintenance blood clotting properties. Vitamin K is involved in carboxylation of glutamic acid residues in the polypeptide chains of 14 human proteins, providing them with the necessary functional properties. Lack of vitamin K-dependent carboxylation of these proteins leads to changes in their biological activity. In this literature review we cover the mechanisms of vitamin K-dependent carboxylation and none bone actions of osteocalcin and matrix Gla-protein with different degrees of carboxylation.

  6. Responsibility and Sustainability in a Food Chain: A Priority Matrix Analysis

    Directory of Open Access Journals (Sweden)

    Francesco Caracciolo

    2011-12-01

    Full Text Available  This paper shows the results of empirical research conducted to assess the sustainability of a typical food supply chain, suggesting feasible solutions to satisfy inter-dimensional requisites of durable development. The analysis was conducted with reference to the supply chain of the San Marzano tomato (SMZ, a typical local food. The product is endowed with an origin certification label (PDO, meeting demand within high-value market niches. The SMZ is a flagship product in the Italian region of Campania and has benefited from several regionally funded interventions, such as genetic research and support for the application for EU certification of origin. Two key findings emerged from the research. First, the results allowed us to define a Stakeholder Priority and Responsibilities’ Matrix (SPRM, and monitor the sustainability trend of SMZ food supply chains. Second, the consistency between the adoption of quality strategy (brand of origin and sustainable development of the sector was evaluated. Despite its intrinsic characteristics and its organized, well-defined structure, the SMZ food supply chain is unable to address sustainable objectives without considerable public intervention and support. In terms of sustainability, to be able to show desirable food chain characteristics, the existence of a fully collaborative relationship between the actors has to be ascertained. Identifying shared goals is essential to assign and implement coordinated actions, pooling responsibility for product quality into social and environmental dimensions.

  7. Sustained-release of caffeine from a polymeric tablet matrix: An in vitro and pharmacokinetic study

    International Nuclear Information System (INIS)

    Tan, Donna; Zhao Bin; Moochhala, Shabbir; Yang Yiyan

    2006-01-01

    Caffeine is utilized as a stimulant to impart a desired level of alertness during certain working hours. Usually, a single dose of caffeine induces 2-3 h of alertness coupled with side effects whereas a longer effect of 8-12 h is very useful for both daily life and military action. Thus, there is a need to deliver the stimulant continuously to an individual at one time to impart an increased level of alertness for the period stated after administration. This study aimed to design a polymeric microparticle system for sustained delivery of caffeine using a polymeric matrix. Poly(ethylene oxide) (PEO) was used as the erodible matrix material and the caffeine polymeric tablets were fabricated by compression using a Graseby Specac hydraulic press. In vitro release profiles as well as the pharmacokinetics studies data were obtained. Caffeine tablets fabricated using various polymers showed a high initial burst release type profile as compared to the caffeine-PEO-tablet. The PK studies showed sustained delivery of caffeine resulted in two expected phenomena: a reduction in the initial high rate of caffeine release (burst release) as well as a reduction in the change in caffeine concentration in the systemic circulation. A simple two-component system for sustained-release caffeine formulation therefore has been achieved

  8. Formulation and in vivo evaluation of diclofenac sodium sustained release matrix tablet: effect of compression force.

    Science.gov (United States)

    Taha, Ehab Ibrahim; Shazly, Gamal Abdel-Ghany; Harisa, Gamaleldin Ibrahim; Barakat, Nahla Sedik; Al-Enazi, Fouza Kayem; Elbagory, Ibrahim Mostafa

    2015-03-01

    In the present study, Diclofenac Sodium (DS) matrix tablets were prepared by direct compression method under different compression forces (5, 10, 15 and 20 KN), using ethylcellulose as matrix forming material. The produced tablets were characterized on the foundation of satisfactory tablet properties such as hardness, friability, drug content, weight variations and in vitro drug release rate. Differential scanning calorimetry (DSC), Fourier Transform Infrared (FT-IR) spectroscopy and X-ray diffraction have been used to investigate any incompatibilities of the tablet's ingredients. Additionally, in vivo bioavailability has been investigated on beagle dogs. Data obtained revealed that, upon increasing compression force the in vitro drug release was sustained and the T(max) value was four hours (for formulations compressed at 15 and 20 kN) compared to the conventional voltarine(®) 50 tablets (T(max) value of 2 hours).

  9. Sustained prevention of biofilm formation on a novel silicone matrix suitable for medical devices

    DEFF Research Database (Denmark)

    Steffensen, Søren Langer; Merete H., Vestergaard,; Jensen, Minna Grønning

    2015-01-01

    ciprofloxacin was loaded into the polymer matrix by a post-polymerization loading procedure. Sustained release of ciprofloxacin was demonstrated, and the release could be controlled by varying the hydrogel content in the range 13–38% (w/w) and by changing the concentration of ciprofloxacin during loading...... in the range of 1–20 mg/mL. Devices containing 25% (w/w) hydrogel and loaded with ciprofloxacin displayed a strong antibacterial effect against Staphylococcus aureus bacterial colonization and subsequent biofilm formation on the device material was inhibited for 29 days. In conclusion, the hydrogel...

  10. Storage and sustained release of volatile substances from a hollow silica matrix

    Energy Technology Data Exchange (ETDEWEB)

    Wang Jiexin [Key Lab for Nanomaterials, Ministry of Education, Beijing 100029 (China); Ding Haomin [Research Center of the Ministry of Education for High Gravity Engineering and Technology, Beijing University of Chemical Technology, Beijing 100029 (China); Tao Xia [Key Lab for Nanomaterials, Ministry of Education, Beijing 100029 (China); Chen Jianfeng [Key Lab for Nanomaterials, Ministry of Education, Beijing 100029 (China)

    2007-06-20

    Porous hollow silica nanospheres (PHSNSs) prepared by adopting a nanosized CaCO{sub 3} template were utilized for the first time as a novel carrier for the storage and sustained release of volatile substances. Two types of volatile substances, Indian pipal from perfumes and peroxyacetic acid from disinfectants, were selected and then tested by one simple adsorption process with two separate comparative carriers, i.e. activated carbon and solid porous silica. It was demonstrated that a high storage capacity (9.6 ml{sub perfume}/mg{sub carrier}) of perfume could be achieved in a PHSNS matrix, which was almost 14 times as much as that of activated carbon. The perfume release profiles showed that PHSNSs exhibited sustained multi-stage release behaviour, while the constant release of activated carbon at a low level was discerned. Further, a Higuchi model study proved that the release process of perfume in both carriers followed a Fickian diffusion mechanism. For peroxyacetic acid as a disinfectant model, PHSNSs also displayed a much better delayed-delivery process than a solid porous silica system owing to the existence of unique hollow frameworks. Therefore, the aforementioned excellent sustained-release behaviours would make PHSNSs a promising carrier for storage and sustained delivery applications of volatile substances.

  11. Oligomerization and polymerization of the filovirus matrix protein VP40

    International Nuclear Information System (INIS)

    Timmins, Joanna; Schoehn, Guy; Kohlhaas, Christine; Klenk, Hans-Dieter; Ruigrok, Rob W.H.; Weissenhorn, Winfried

    2003-01-01

    The matrix protein VP40 from Ebola virus plays an important role in the assembly process of virus particles by interacting with cellular factors, cellular membranes, and the ribonuclearprotein particle complex. Here we show that the N-terminal domain of VP40 folds into a mixture of two different oligomeric states in vitro, namely hexameric and octameric ringlike structures, as detected by gel filtration chromatography, chemical cross-linking, and electron microscopy. Octamer formation depends largely on the interaction with nucleic acids, which in turn confers in vitro SDS resistance. Refolding experiments with a nucleic acid free N-terminal domain preparation reveal a mostly dimeric form of VP40, which is transformed into an SDS resistant octamer upon incubation with E. coli nucleic acids. In addition, we demonstrate that the N-terminal domain of Marburg virus VP40 also folds into ringlike structures, similar to Ebola virus VP40. Interestingly, Marburg virus VP40 rings reveal a high tendency to polymerize into rods composed of stacked rings. These results may suggest distinct roles for different oligomeric forms of VP40 in the filovirus life cycle

  12. Oligomerization and polymerization of the filovirus matrix protein VP40.

    Science.gov (United States)

    Timmins, Joanna; Schoehn, Guy; Kohlhaas, Christine; Klenk, Hans-Dieter; Ruigrok, Rob W H; Weissenhorn, Winfríed

    2003-08-01

    The matrix protein VP40 from Ebola virus plays an important role in the assembly process of virus particles by interacting with cellular factors, cellular membranes, and the ribonuclearprotein particle complex. Here we show that the N-terminal domain of VP40 folds into a mixture of two different oligomeric states in vitro, namely hexameric and octameric ringlike structures, as detected by gel filtration chromatography, chemical cross-linking, and electron microscopy. Octamer formation depends largely on the interaction with nucleic acids, which in turn confers in vitro SDS resistance. Refolding experiments with a nucleic acid free N-terminal domain preparation reveal a mostly dimeric form of VP40, which is transformed into an SDS resistant octamer upon incubation with E. coli nucleic acids. In addition, we demonstrate that the N-terminal domain of Marburg virus VP40 also folds into ringlike structures, similar to Ebola virus VP40. Interestingly, Marburg virus VP40 rings reveal a high tendency to polymerize into rods composed of stacked rings. These results may suggest distinct roles for different oligomeric forms of VP40 in the filovirus life cycle.

  13. Formulation and evaluation of sustained release matrix tablet of rabeprazole using wet granulation technique

    Directory of Open Access Journals (Sweden)

    Ruqaiyah Khan

    2014-01-01

    Full Text Available Introduction: Rabeprazole, a member of substituted benzimidazoles, inhibits the final step in gastric acid secretions. This drug claims to cause fastest acid separation (due to higher pKa, and more rapidly converts to the active species to aid gastric mucin synthesis. The most significant pharmacological action of Rabeprazole is dose dependent suppression of gastric acid secretion; without anticholinergic or H2-blocking action. It completely abolishes the hydrochloric acid secretion as it is powerful inhibitor of gastric acid. Rabeprazole is acid labile and hence commonly formulated as an enteric coated tablet. The absorption of rabeprazole occurs rapidly as soon as tablet leaves the stomach. Aim: In the present study an attempt was made to formulate and evaluate Rabeprazole sustained release matrix tablet using wet granulation technique incorporating various polymers like HPMC-E15, Carbopol934, and sodium carboxymethyl cellulose (CMC. Materials and Methods: The Formulated tablets were evaluated for different physicochemical properties like rheological properties, weight variation, thickness, hardness, % friability, in vitro release studies and drug content. Results: Studies revealed that all the physicochemical parameters comply with the official standards. The in vitro release studies exhibits the release up to 90%, over a prolonged period of time which confirms the extended release profile of formulation, having better bioavailability as well as decreased dosing frequency with reduced doses. Conclusion: The sustained release matrix tablets of rabiprazole shown better bioavailability, efficacy and potency, when compared with official standards.

  14. Photolytic Cross-Linking to Probe Protein-Protein and Protein-Matrix Interactions in Lyophilized Powders.

    Science.gov (United States)

    Iyer, Lavanya K; Moorthy, Balakrishnan S; Topp, Elizabeth M

    2015-09-08

    Protein structure and local environment in lyophilized formulations were probed using high-resolution solid-state photolytic cross-linking with mass spectrometric analysis (ssPC-MS). In order to characterize structure and microenvironment, protein-protein, protein-excipient, and protein-water interactions in lyophilized powders were identified. Myoglobin (Mb) was derivatized in solution with the heterobifunctional probe succinimidyl 4,4'-azipentanoate (SDA) and the structural integrity of the labeled protein (Mb-SDA) confirmed using CD spectroscopy and liquid chromatography/mass spectrometry (LC-MS). Mb-SDA was then formulated with and without excipients (raffinose, guanidine hydrochloride (Gdn HCl)) and lyophilized. The freeze-dried powder was irradiated with ultraviolet light at 365 nm for 30 min to produce cross-linked adducts that were analyzed at the intact protein level and after trypsin digestion. SDA-labeling produced Mb carrying up to five labels, as detected by LC-MS. Following lyophilization and irradiation, cross-linked peptide-peptide, peptide-water, and peptide-raffinose adducts were detected. The exposure of Mb side chains to the matrix was quantified based on the number of different peptide-peptide, peptide-water, and peptide-excipient adducts detected. In the absence of excipients, peptide-peptide adducts involving the CD, DE, and EF loops and helix H were common. In the raffinose formulation, peptide-peptide adducts were more distributed throughout the molecule. The Gdn HCl formulation showed more protein-protein and protein-water adducts than the other formulations, consistent with protein unfolding and increased matrix interactions. The results demonstrate that ssPC-MS can be used to distinguish excipient effects and characterize the local protein environment in lyophilized formulations with high resolution.

  15. Development of sustained release capsules containing "coated matrix granules of metoprolol tartrate".

    Science.gov (United States)

    Siddique, Sabahuddin; Khanam, Jasmina; Bigoniya, Papiya

    2010-09-01

    The objective of this investigation was to prepare sustained release capsule containing coated matrix granules of metoprolol tartrate and to study its in vitro release and in vivo absorption. The design of dosage form was performed by choosing hydrophilic hydroxypropyl methyl cellulose (HPMC K100M) and hydrophobic ethyl cellulose (EC) polymers as matrix builders and Eudragit® RL/RS as coating polymers. Granules were prepared by composing drug with HPMC K100M, EC, dicalcium phosphate by wet granulation method with subsequent coating. Optimized formulation of metoprolol tartrate was formed by using 30% HPMC K100M, 20% EC, and ratio of Eudragit® RS/RL as 97.5:2.5 at 25% coating level. Capsules were filled with free flowing optimized granules of uniform drug content. This extended the release period upto 12 h in vitro study. Similarity factor and mean dissolution time were also reported to compare various dissolution profiles. The network formed by HPMC and EC had been coupled satisfactorily with the controlled resistance offered by Eudragit® RS. The release mechanism of capsules followed Korsemeyer-Peppas model that indicated significant contribution of erosion effect of hydrophilic polymer. Biopharmaceutical study of this optimized dosage form in rabbit model showed 10 h prolonged drug release in vivo. A close correlation (R(2) = 0.9434) was established between the in vitro release and the in vivo absorption of drug. The results suggested that wet granulation with subsequent coating by fluidized bed technique, is a suitable method to formulate sustained release capsules of metoprolol tartrate and it can perform therapeutically better than conventional immediate release dosage form.

  16. Combined role of type IX collagen and cartilage oligomeric matrix protein in cartilage matrix assembly: Cartilage oligomeric matrix protein counteracts type IX collagen-induced limitation of cartilage collagen fibril growth in mouse chondrocyte cultures

    NARCIS (Netherlands)

    Blumbach, K.; Bastiaansen-Jenniskens, Y.M.; Groot, J. de; Paulsson, M.; Osch, G.J.V.M. van; Zaucke, F.

    2009-01-01

    Objective. Defects in the assembly and composition of cartilage extracellular matrix are likely to result in impaired matrix integrity and increased susceptibility to cartilage degeneration. The aim of this study was to determine the functional interaction of the collagen fibril-associated proteins

  17. The Geocybernetic Assessment Matrix (GAM) — A new assessment tool for evaluating the level and nature of sustainability or unsustainability

    International Nuclear Information System (INIS)

    Phillips, Jason

    2016-01-01

    Evaluating sustainability from EIA-based assessments has been problematic at best. This is due to the use of reductionist and qualitative approaches which is dependent upon the perspective of the assessor(s). Therefore, a more rigorous and holistic approach is required to evaluate sustainability in a more consistent way. In this paper, a matrix-based methodology in order to assess the indicated level and nature of sustainability for any project, policy, indicators, legislation, regulation, or other framework is described. The Geocybernetic Assessment Matrix (GAM) is designed to evaluate the level and nature of sustainability or unsustainability occurring in respect the fundamental and complex geocybernetic paradigms. The GAM method is described in detail in respect to the theory behind it and the methodology. The GAM is then demonstrated using an appropriate case study — Part 1 of the UK Climate Change Act (2008) concerning carbon budgets and targets. The results indicate that the Part 1 of Act may not achieve the desired goals in contributing towards sustainable development through the stated mechanisms for carbon budgets and targets. The paper then discusses the broader context of the GAM with respect to the core themes evident in the development and application of the GAM of: sustainability science; sustainability assessment; application value of the GAM; and future research and development. - Highlights: • A new assessment tool called the Geocybernetic Assessment Matrix (GAM) described. • GAM evaluates the level and nature of sustainability or unsustainability. • GAM demonstrated by application to Part 1 of the UK Climate Change Act (CCA). • Part 1 of CCA has significant flaws in achieving a sustainable pathway. • GAM offers a potentially useful tool for quantitatively evaluating sustainability.

  18. The Geocybernetic Assessment Matrix (GAM) — A new assessment tool for evaluating the level and nature of sustainability or unsustainability

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Jason, E-mail: jp1@tiscali.co.uk

    2016-01-15

    Evaluating sustainability from EIA-based assessments has been problematic at best. This is due to the use of reductionist and qualitative approaches which is dependent upon the perspective of the assessor(s). Therefore, a more rigorous and holistic approach is required to evaluate sustainability in a more consistent way. In this paper, a matrix-based methodology in order to assess the indicated level and nature of sustainability for any project, policy, indicators, legislation, regulation, or other framework is described. The Geocybernetic Assessment Matrix (GAM) is designed to evaluate the level and nature of sustainability or unsustainability occurring in respect the fundamental and complex geocybernetic paradigms. The GAM method is described in detail in respect to the theory behind it and the methodology. The GAM is then demonstrated using an appropriate case study — Part 1 of the UK Climate Change Act (2008) concerning carbon budgets and targets. The results indicate that the Part 1 of Act may not achieve the desired goals in contributing towards sustainable development through the stated mechanisms for carbon budgets and targets. The paper then discusses the broader context of the GAM with respect to the core themes evident in the development and application of the GAM of: sustainability science; sustainability assessment; application value of the GAM; and future research and development. - Highlights: • A new assessment tool called the Geocybernetic Assessment Matrix (GAM) described. • GAM evaluates the level and nature of sustainability or unsustainability. • GAM demonstrated by application to Part 1 of the UK Climate Change Act (CCA). • Part 1 of CCA has significant flaws in achieving a sustainable pathway. • GAM offers a potentially useful tool for quantitatively evaluating sustainability.

  19. Growth of thin films of low molecular weight proteins by matrix assisted pulsed laser evaporation (MAPLE)

    DEFF Research Database (Denmark)

    Matei, Andreea; Schou, Jørgen; Constantinescu, C.

    2011-01-01

    Thin films of lysozyme and myoglobin grown by matrix assisted pulsed laser evaporation (MAPLE) from a water ice matrix have been investigated. The deposition rate of these two low molecular weight proteins (lysozyme: 14307 amu and myoglobin: 17083 amu) exhibits a maximum of about 1–2 ng/cm2 per...

  20. Matrix proteins as centralized organizers of negative-sense RNA virions.

    Science.gov (United States)

    Liljeroos, Lassi; Butcher, Sarah J

    2013-01-01

    Matrix proteins are essential components of most negative-sense RNA, enveloped viruses. They serve a wide range of duties ranging from self-driven membrane budding and coordination of other viral components to modulation of viral transcription. The functional similarity between these proteins is striking, despite major differences in their structures. Whereas biochemical and structural studies have partly been hindered by the inherent aggregation properties of these proteins, their cellular functions are beginning to be understood. In this review we summarize the current knowledge on negative-sense RNA virus matrix proteins and their interactions with other viral and cellular proteins. We also discuss the similarities and differences in matrix protein functions between the different families within the negative-sense RNA viruses.

  1. Extracellular matrix proteins: A positive feedback loop in lung fibrosis?

    NARCIS (Netherlands)

    Blaauboer, M.E.; Boeijen, F.R.; Emson, C.L.; Turner, S.M.; Zandieh Doulabi, B.; Hanemaaijer, R.; Smit, T.H.; Stoop, R.; Everts, V.

    2014-01-01

    Lung fibrosis is characterized by excessive deposition of extracellular matrix. This not only affects tissue architecture and function, but it also influences fibroblast behavior and thus disease progression. Here we describe the expression of elastin, type V collagen and tenascin C during the

  2. In vivo extracellular matrix protein expression by human periodontal ...

    African Journals Online (AJOL)

    ONOS

    2010-08-23

    Aug 23, 2010 ... periodontal tissues that are composed of different matrix components specific to different types of periodontal tissues (Matsuura et al., 1995). Periodontal ligament (PDL) cells possess osteogenic potential and play important roles in bone biology, such as necrotic processes, bone resorption, bone modeling,.

  3. Matrix protein 2 of influenza A virus blocks autophagosome fusion with lysosomes

    DEFF Research Database (Denmark)

    Gannagé, Monique; Dormann, Dorothee; Albrecht, Randy

    2009-01-01

    demonstrate that influenza A virus inhibits macroautophagy, a cellular process known to be manipulated by diverse pathogens. Influenza A virus infection causes accumulation of autophagosomes by blocking their fusion with lysosomes, and one viral protein, matrix protein 2, is necessary and sufficient...... for this inhibition of autophagosome degradation. Macroautophagy inhibition by matrix protein 2 compromises survival of influenza virus-infected cells but does not influence viral replication. We propose that influenza A virus, which also encodes proapoptotic proteins, is able to determine the death of its host cell...

  4. Novel Polyurethane Matrix Systems Reveal a Particular Sustained Release Behavior Studied by Imaging and Computational Modeling.

    Science.gov (United States)

    Campiñez, María Dolores; Caraballo, Isidoro; Puchkov, Maxim; Kuentz, Martin

    2017-07-01

    The aim of the present work was to better understand the drug-release mechanism from sustained release matrices prepared with two new polyurethanes, using a novel in silico formulation tool based on 3-dimensional cellular automata. For this purpose, two polymers and theophylline as model drug were used to prepare binary matrix tablets. Each formulation was simulated in silico, and its release behavior was compared to the experimental drug release profiles. Furthermore, the polymer distributions in the tablets were imaged by scanning electron microscopy (SEM) and the changes produced by the tortuosity were quantified and verified using experimental data. The obtained results showed that the polymers exhibited a surprisingly high ability for controlling drug release at low excipient concentrations (only 10% w/w of excipient controlled the release of drug during almost 8 h). The mesoscopic in silico model helped to reveal how the novel biopolymers were controlling drug release. The mechanism was found to be a special geometrical arrangement of the excipient particles, creating an almost continuous barrier surrounding the drug in a very effective way, comparable to lipid or waxy excipients but with the advantages of a much higher compactability, stability, and absence of excipient polymorphism.

  5. Inflammatory and fibrotic proteins proteomically identified as key protein constituents in urine and stone matrix of patients with kidney calculi.

    Science.gov (United States)

    Boonla, Chanchai; Tosukhowong, Piyaratana; Spittau, Björn; Schlosser, Andreas; Pimratana, Chaowat; Krieglstein, Kerstin

    2014-02-15

    To uncover whether urinary proteins are incorporated into stones, the proteomic profiles of kidney stones and urine collected from the same patients have to be explored. We employed 1D-PAGE and nanoHPLC-ESI-MS/MS to analyze the proteomes of kidney stone matrix (n=16), nephrolithiatic urine (n=14) and healthy urine (n=3). We identified 62, 66 and 22 proteins in stone matrix, nephrolithiatic urine and healthy urine, respectively. Inflammation- and fibrosis-associated proteins were frequently detected in the stone matrix and nephrolithiatic urine. Eighteen proteins were exclusively found in the stone matrix and nephrolithiatic urine, considered as candidate biomarkers for kidney stone formation. S100A8 and fibronectin, representatives of inflammation and fibrosis, respectively, were up-regulated in nephrolithiasis renal tissues. S100A8 was strongly expressed in infiltrated leukocytes. Fibronectin was over-expressed in renal tubular cells. S100A8 and fibronectin were immunologically confirmed to exist in nephrolithiatic urine and stone matrix, but in healthy urine they were undetectable. Conclusion, both kidney stones and urine obtained from the same patients greatly contained inflammatory and fibrotic proteins. S100A8 and fibronectin were up-regulated in stone-baring kidneys and nephrolithiatic urine. Therefore, inflammation and fibrosis are suggested to be involved in the formation of kidney calculi. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Complex Matrix for the Analysis of Sustainable Transformative Learning: An Assessment Methodology of Sustainability Integration in Universities

    Science.gov (United States)

    Palma, Lisiane Celia; Pedrozo, Eugênio Ávila

    2015-01-01

    Several papers propose analytical methods relating to the inclusion of sustainability in courses and universities. However, as sustainability is a complex subject, methodological proposals on the topic must avoid making disjointed analyses which focus exclusively on curricula or on organisational strategy, as often seen in the literature.…

  7. Collagen XII and XIV, New Partners of Cartilage Oligomeric Matrix Protein in the Skin Extracellular Matrix Suprastructure*

    Science.gov (United States)

    Agarwal, Pallavi; Zwolanek, Daniela; Keene, Douglas R.; Schulz, Jan-Niklas; Blumbach, Katrin; Heinegård, Dick; Zaucke, Frank; Paulsson, Mats; Krieg, Thomas; Koch, Manuel; Eckes, Beate

    2012-01-01

    The tensile and scaffolding properties of skin rely on the complex extracellular matrix (ECM) that surrounds cells, vasculature, nerves, and adnexus structures and supports the epidermis. In the skin, collagen I fibrils are the major structural component of the dermal ECM, decorated by proteoglycans and by fibril-associated collagens with interrupted triple helices such as collagens XII and XIV. Here we show that the cartilage oligomeric matrix protein (COMP), an abundant component of cartilage ECM, is expressed in healthy human skin. COMP expression is detected in the dermal compartment of skin and in cultured fibroblasts, whereas epidermis and HaCaT cells are negative. In addition to binding collagen I, COMP binds to collagens XII and XIV via their C-terminal collagenous domains. All three proteins codistribute in a characteristic narrow zone in the superficial papillary dermis of healthy human skin. Ultrastructural analysis by immunogold labeling confirmed colocalization and further revealed the presence of COMP along with collagens XII and XIV in anchoring plaques. On the basis of these observations, we postulate that COMP functions as an adapter protein in human skin, similar to its function in cartilage ECM, by organizing collagen I fibrils into a suprastructure, mainly in the vicinity of anchoring plaques that stabilize the cohesion between the upper dermis and the basement membrane zone. PMID:22573329

  8. Evaluation of gum mastic (Pistacia lentiscus as a microencapsulating and matrix forming material for sustained drug release

    Directory of Open Access Journals (Sweden)

    Dinesh M. Morkhade

    2017-09-01

    Full Text Available In this study, a natural gum mastic was evaluated as a microencapsulating and matrix-forming material for sustained drug release. Mastic was characterized for its physicochemical properties. Microparticles were prepared by oil-in-oil solvent evaporation method. Matrix tablets were prepared by wet and melt granulation techniques. Diclofenac sodium (DFS and diltiazem hydrochloride (DLTZ were used as model drugs. Mastic produced discrete and spherical microspheres with DLTZ and microcapsules with DFS. Particle size and drug loading of microparticles was in the range of 22–62 µm and 50–87%, respectively. Increase in mastic: drug ratio increased microparticle size, improved drug loading and decreased the drug release rate. Microparticles with gum: drug ratio of 2:1 could sustain DLTZ release up to 12 h and released 57% DFS in 12 h. Mastic produced tablets with acceptable pharmacotechnical properties. A 30% w/w of mastic in tablet could sustain DLTZ release for 5 h from wet granulation, and DFS release for 8 h and 11 h from wet and melt granulation, respectively. Results revealed that a natural gum mastic can be used successfully to formulate matrix tablets and microparticles for sustained drug release.

  9. Suppression of matrix protein synthesis in endothelial cells by herpes simplex virus is not dependent on viral protein synthesis

    International Nuclear Information System (INIS)

    Kefalides, N.A.

    1986-01-01

    The synthesis of matrix proteins by human endothelial cells (EC) in vitro was studied before and at various times after infection with Herpes Simplex virus Type 1 (HSV-1) or 2 (HSV-2). Monolayers of EC were either mock-infected or infected with virus for 1 hr at a multiplicity infection (MOI) of 5 to 20 at 37 0 C. Control and infected cultures were pulse-labeled for 1 or 2 hrs with either [ 14 C]proline or [ 35 S]methionine. Synthesis of labeled matrix proteins was determined by SDS-gel electrophoresis. Suppression of synthesis of fibronectin, Type IV collagen and thrombospondin began as early as 2 hrs and became almost complete by 10 hrs post-infection. The degree of suppression varied with the protein and the virus dose. Suppression of Type IV collagen occurred first followed by that of fibronectin and then thrombospondin. Infection of EC with UV irradiated HSV-1 or HSV-2 resulted in suppression of host-cell protein synthesis as well as viral protein synthesis. Infection with intact virus in the presence of actinomycin-D resulted in suppression of both host-cell and viral protein synthesis. The data indicate that infection of EC with HSV leads to suppression of matrix protein synthesis which does not depend on viral protein synthesis

  10. Proteins of Insoluble Matrix of Avian (Gallus Gallus) Eggshell

    Czech Academy of Sciences Publication Activity Database

    Mikšík, Ivan; Eckhardt, Adam; Sedláková, Pavla; Mikulíková, Kateřina

    2007-01-01

    Roč. 48, č. 1 (2007), s. 1-8 ISSN 0300-8207 R&D Projects: GA MŠk(CZ) 1M0510; GA ČR(CZ) GA203/06/1044; GA ČR(CZ) GA203/05/2539 Institutional research plan: CEZ:AV0Z50110509 Keywords : eggshell * avian proteins Subject RIV: CE - Biochemistry Impact factor: 1.085, year: 2007

  11. Degenerated human intervertebral discs contain autoantibodies against extracellular matrix proteins

    Directory of Open Access Journals (Sweden)

    S Capossela

    2014-04-01

    Full Text Available Degeneration of intervertebral discs (IVDs is associated with back pain and elevated levels of inflammatory cells. It has been hypothesised that discogenic pain is a direct result of vascular and neural ingrowth along annulus fissures, which may expose the avascular nucleus pulposus (NP to the systemic circulation and induce an autoimmune reaction. In this study, we confirmed our previous observation of antibodies in human degenerated and post-traumatic IVDs cultured in vitro. We hypothesised that the presence of antibodies was due to an autoimmune reaction against specific proteins of the disc. Furthermore we identified antigens which possibly trigger an autoimmune response in degenerative disc diseases. We demonstrated that degenerated and post-traumatic IVDs contain IgG antibodies against typical extracellular proteins of the disc, particularly proteins of the NP. We identified IgGs against collagen type II and aggrecan, confirming an autoimmune reaction against the normally immune privileged NP. We also found specific IgGs against collagens types I and V, but not against collagen type III. In conclusion, this study confirmed the association between disc degeneration and autoimmunity, and may open the avenue for future studies on developing prognostic, diagnostic and therapy-monitoring markers for degenerative disc diseases.

  12. Matrix Pre-coated Targets for High Throughput MALDI Imaging of Proteins

    OpenAIRE

    Yang, Junhai; Caprioli, Richard M.

    2014-01-01

    We have developed matrix pre-coated targets for imaging proteins in thin tissue sections by MALDI MS (matrix-assisted laser desorption/ionization mass spectrometry). Gold covered microscope slides were coated with sinapinic acid (SA) in batches in advance and were shown to be stable for over 6 months when kept in the dark. The sample preparation protocol using these SA pre-coated targets involves treatment with diisopropylethylamine (DIEA)-H2O vapor, transforming the matrix layer to a viscous...

  13. Fractionation of the Gulf toadfish intestinal precipitate organic matrix reveals potential functions of individual proteins.

    Science.gov (United States)

    Schauer, Kevin L; Grosell, Martin

    2017-06-01

    The regulatory mechanisms behind the production of CaCO 3 in the marine teleost intestine are poorly studied despite being essential for osmoregulation and responsible for a conservatively estimated 3-15% of annual oceanic CaCO 3 production. It has recently been reported that the intestinally derived precipitates produced by fish as a byproduct of their osmoregulatory strategy form in conjunction with a proteinaceous matrix containing nearly 150 unique proteins. The individual functions of these proteins have not been the subject of investigation until now. Here, organic matrix was extracted from precipitates produced by Gulf toadfish (Opsanus beta) and the matrix proteins were fractionated by their charge using strong anion exchange chromatography. The precipitation regulatory abilities of the individual fractions were then analyzed using a recently developed in vitro calcification assay, and the protein constituents of each fraction were determined by mass spectrometry. The different fractions were found to have differing effects on both the rate of carbonate mineral production, as well as the morphology of the crystals that form. Using data collected from the calcification assay as well as the mass spectrometry experiments, individual calcification promotional indices were calculated for each protein, giving the first insight into the functions each of these matrix proteins may play in regulating precipitation. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Calcinosis in juvenile dermatomyositis : a possible role for the vitamin K-dependent protein matrix Gla protein

    NARCIS (Netherlands)

    Van Summeren, M. J. H.; Spliet, W. G. M.; Van Royen-Kerkhof, A.; Vermeer, C.; Lilien, M.; Kuis, W.; Schurgers, L. J.

    Objectives. The aims of the present study were to investigate whether the calcification inhibitor matrix Gla protein (MGP) is expressed in muscle biopsies of patients with juvenile dermatomyositis (JDM), and whether different forms of MGP are differentially expressed in JDM patients with and without

  15. Sustainable protein from biogas. The perspective of susteine

    International Nuclear Information System (INIS)

    Oosterhuis, N.; Hooijer, H.

    2007-12-01

    Production of single-cell protein (Susteine) on the basis of biogas (methane) from manure digestion might be an interesting option to reduce the amounts of manure from cattle, pigs and poultry and also might be an option for a sustainable production of high-value protein. An earlier made investigation leaded to the conclusion that many questions had to be answered to make a better picture of this opportunity for the Dutch agricultural society. In this study we investigated the feasibility of such a process and product. It is concluded that the product will be accepted in the market as long as the HACCP-requirements which are applicable in the feed production are fulfilled. The product as such, assuming that the quality is comparable to the product as was produced by Norferm, could get an attractive position especially in the application for piglets. A quantity of 10.000 t/y could easily be sold in this market segment. Of course the product first has to be registered, which needs additional studies. Technically we foresee no major hurdles in the production of Susteine on basis of methane from biogas. The biogas has to be purified to such a quality that SCP-production is feasible, however, technologies are available. It needs a further investigation to establish the quality requirements for such a process. The scale of operation of the biogas installation creates a financial-economic problem. In order to produce 10.000 t protein / year, a quantity of 30-35 million m 3 of biogas is needed, for which 2 million ton of manure has to be digested. In case a centralized production of gas and protein is foreseen, the number of transport movements will be unacceptable. Besides the quantity of manure to be transported also approximately the same amount of digested material has to be transported. A unique opportunity in The Netherlands is the presence of a pipe network for natural gas. Such a network could serve as a transport system of locally produced, purified, biogas and a

  16. The application of an enamel matrix protein derivative (Emdogain) in regenerative periodontal therapy: a review.

    NARCIS (Netherlands)

    Sculean, A.; Schwarz, F.; Becker, J.; Brecx, M.

    2007-01-01

    Regenerative periodontal therapy aims at reconstitution of the lost periodontal structures such as new formation of root cementum, periodontal ligament and alveolar bone. Findings from basic research indicate that enamel matrix protein derivative (EMD) has a key role in periodontal wound healing.

  17. Topical application of amelogenin extracellular matrix protein in non-healing venous ulcers

    Directory of Open Access Journals (Sweden)

    Burçin Abud

    2014-12-01

    Full Text Available Background and Design: Treatment of chronic venous ulcers of the lower extremity is still an important difficulty. The principal treatment of these ulcers includes compression therapy, local wound care and surgery. Unresponsiveness to these standard treatments is a frequent situation with negative effects on life quality and reductions in personal productivity. Therefore, there is a need for new applications to increase the effectiveness of treatment in treatment-resistant cases. In the present study, we retrospectively evaluated the results of topical application of amelogenin extracellular matrix protein in resistant venous ulcers. Materials and Methods: We analyzed the records of patients with treatment-resistant venous ulceration who were treated with amelogenin extracellular matrix protein between June 2011 and December 2012.. Results: 26 patients (21 male and 5 female with a total number of 28 ulcers (24 patients with 1 ulcer, 2 patients with two ulcers were evaluated. The patients were treated with topically applied amelogenin extracellular matrix protein and regional four bandage compression. Bandages were changed weekly. Each cure continued for six weeks. In fourteen patients (15 ulcers, we observed a complete healing by the end of the first cure. In another twelve cases (13 ulcers, the same period resulted with a reduction in wound diameter. We continued to the second cure for these patients. By the end of the second cure, complete healing was achieved in five cases (6 ulcers. Conclusion: Topical application of amelogenin extracellular matrix protein may be considered as an effective therapeutic choice for refractory venous ulcers.

  18. One-step separation of myristoylated and nonmyristoylated retroviral matrix proteins

    Czech Academy of Sciences Publication Activity Database

    Doležal, Michal; Zábranský, Aleš; Hrabal, R.; Ruml, T.; Pichová, Iva; Rumlová, Michaela

    2013-01-01

    Roč. 92, č. 1 (2013), s. 94-99 ISSN 1046-5928 R&D Projects: GA ČR GA204/09/1388 Institutional support: RVO:61388963 Keywords : matrix protein * mouse mammary tumor virus * murine leukemia virus * myristoylation * N-myristoyltransferase * retrovirus Subject RIV: CE - Biochemistry Impact factor: 1.508, year: 2013

  19. INTEGRINS AND EXTRACELLULAR MATRIX-PROTEINS IN THE DIFFERENT COMPONENTS OF THE WILMS-TUMOR

    NARCIS (Netherlands)

    PERINGA, J; MOLENAAR, WM; TIMENS, W

    The Wilms' tumour (WT) is composed of blastema, epithelium and mesenchyme; the epithelium and possibly also the mesenchyme develop from the blastema, parallel to embryonal development. Since interactions between cell adhesion receptors and extracellular matrix (ECM) proteins play an important role

  20. Location and distribution of non-collagenous matrix proteins in musculoskeletal tissues of rat.

    Science.gov (United States)

    Kannus, P; Jozsa, L; Järvinen, T A; Järvinen, T L; Kvist, M; Natri, A; Järvinen, M

    1998-11-01

    The study assessed immunohistochemically the location and distribution of various non-collagenous matrix proteins (fibronectin, laminin, tenascin-C, osteocalcin, thrombospondin-1, vitronectin and undulin) in musculoskeletal tissues of rat. Fibronectin and thrombospondin-1 were found to be ubiquitous in the studied tissues. High immunoreactivity of these proteins was found in the extracellular matrix of the anatomical sites where firm bindings are needed, i.e. between muscle fibres and fibre bundles, between the collagen fibres of a tendon and at myotendinous junctions, osteotendinous junctions and articular cartilage. Tenascin-C was found in the extracellular matrix of regions where especially high forces are transmitted from one tissue component to the other, such as myotendinous junctions and osteotendinous junctions. Laminin was demonstrated in the basement membranes of the muscle cells and capillaries of the muscle-tendon units. Osteocalcin immunoreactivity concentrated in the extracellular matrix of areas of newly formed bone tissue, i.e. in the subperiosteal and subchondral regions, osteoid tissue and mineralized fibrocartilage zone of the osteotendinous junction. Mild vitronectin activity could be seen in the extracellular matrix of the osteotendinous and myotendinous junctions, and high activity around the bone marrow cells. Undulin could be demonstrated in the extracellular matrix (i.e. on the collagen fibres) of the tendon and epimysium only. However, it was co-distributed with fibronectin and tenascin-C. Together, these findings on the normal location and distribution of these non-collagenous proteins in the musculoskeletal tissues help to form the basis of knowledge against which the location and distribution of the these proteins in various pathological processes could be compared.

  1. Controlled protein delivery from electrospun non-wovens: novel combination of protein crystals and a biodegradable release matrix.

    Science.gov (United States)

    Puhl, Sebastian; Li, Linhao; Meinel, Lorenz; Germershaus, Oliver

    2014-07-07

    Poly-ε-caprolactone (PCL) is an excellent polymer for electrospinning and matrix-controlled drug delivery combining optimal processability and good biocompatibility. Electrospinning of proteins has been shown to be challenging via the use of organic solvents, frequently resulting in protein unfolding or aggregation. Encapsulation of protein crystals represents an attractive but largely unexplored alternative to established protein encapsulation techniques because of increased thermodynamic stability and improved solvent resistance of the crystalline state. We herein explore the electrospinning of protein crystal suspensions and establish basic design principles for this novel type of protein delivery system. PCL was deployed as a matrix, and lysozyme was used as a crystallizing model protein. By rational combination of lysozyme crystals 0.7 or 2.1 μm in diameter and a PCL fiber diameter between 1.6 and 10 μm, release within the first 24 h could be varied between approximately 10 and 100%. Lysozyme loading of PCL microfibers between 0.5 and 5% was achieved without affecting processability. While relative release was unaffected by loading percentage, the amount of lysozyme released could be tailored. PCL was blended with poly(ethylene glycol) and poly(lactic-co-glycolic acid) to further modify the release rate. Under optimized conditions, an almost constant lysozyme release over 11 weeks was achieved.

  2. Sustained release of a water-soluble drug from alginate matrix tablets prepared by wet granulation method.

    Science.gov (United States)

    Mandal, Sanchita; Basu, Sanat Kumar; Sa, Biswanath

    2009-01-01

    Alginate matrix tablet of diltiazem hydrochloride (DTZ), a water-soluble drug, was prepared using sodium alginate (SAL) and calcium gluconate (CG) by the conventional wet granulation method for sustained release of the drug. The effect of formulation variables like SAL/CG ratio, drug load, microenvironmental pH modulator, and processing variable like compression force on the extent of drug release was examined. The tablets prepared with 1:2 w/w ratio of SAL/CG produced the most sustained release of the drug extending up to 13.5 h. Above and below this ratio, the drug release was faster. The drug load and the hardness of the tablets produced minimal variation in drug release. The addition of alkaline or acidic microenvironmental modulators did not extend the release; instead, these excipients produced somewhat faster release of diltiazem. This study revealed that proper selection of SAL/CG ratio is important to produce alginate matrix tablet by wet granulation method for sustained release of DTZ.

  3. Matrix Sublimation/Recrystallization for Imaging Proteins by Mass Spectrometry at High Spatial Resolution

    Science.gov (United States)

    Yang, Junhai; Caprioli, Richard M.

    2011-01-01

    We have employed matrix deposition by sublimation for protein image analysis on tissue sections using a hydration/recrystallization process that produces high quality MALDI mass spectra and high spatial resolution ion images. We systematically investigated different washing protocols, the effect of tissue section thickness, the amount of sublimated matrix per unit area and different recrystallization conditions. The results show that an organic solvent rinse followed by ethanol/water rinses substantially increased sensitivity for the detection of proteins. Both the thickness of tissue section and amount of sinapinic acid sublimated per unit area have optimal ranges for maximal protein signal intensity. Ion images of mouse and rat brain sections at 50, 20 and 10 µm spatial resolution are presented and are correlated with H&E stained optical images. For targeted analysis, histology directed imaging can be performed using this protocol where MS analysis and H&E staining are performed on the same section. PMID:21639088

  4. Matrix-insensitive protein assays push the limits of biosensors in medicine

    DEFF Research Database (Denmark)

    Gaster, Richard S; Hall, Drew A; Nielsen, Carsten Haagen

    2009-01-01

    Advances in biosensor technologies for in vitro diagnostics have the potential to transform the practice of medicine. Despite considerable work in the biosensor field, there is still no general sensing platform that can be ubiquitously applied to detect the constellation of biomolecules in diverse....... Here we present a magnetic nanosensor technology that is matrix insensitive yet still capable of rapid, multiplex protein detection with resolution down to attomolar concentrations and extensive linear dynamic range. The matrix insensitivity of our platform to various media demonstrates that our...

  5. The Regional-Matrix Approach to the Training of Highly Qualified Personnel for the Sustainable Development of the Mining Region

    Science.gov (United States)

    Zhernov, Evgeny; Nehoda, Evgenia

    2017-11-01

    The state, regional and industry approaches to the problem of personnel training for building an innovative knowledge economy at all levels that ensures sustainable development of the region are analyzed in the article using the cases of the Kemerovo region and the coal industry. A new regional-matrix approach to the training of highly qualified personnel is proposed, which allows to link the training systems with the regional economic matrix "natural resources - cognitive resources" developed by the author. A special feature of the new approach is the consideration of objective conditions and contradictions of regional systems of personnel training, which have formed as part of economic systems of regions differ-entiated in the matrix. The methodology of the research is based on the statement about the interconnectivity of general and local knowledge, from which the understanding of the need for a combination of regional, indus-try and state approaches to personnel training is derived. A new form of representing such a combination is the proposed approach, which is based on matrix analysis. The results of the research can be implemented in the practice of modernization of professional education of workers in the coal industry of the natural resources extractive region.

  6. Identification of the Mamestra configurata (Lepidoptera: Noctuidae) peritrophic matrix proteins and enzymes involved in peritrophic matrix chitin metabolism.

    Science.gov (United States)

    Toprak, Umut; Erlandson, Martin; Baldwin, Doug; Karcz, Steve; Wan, Lianglu; Coutu, Cathy; Gillott, Cedric; Hegedus, Dwayne D

    2016-10-01

    The peritrophic matrix (PM) is essential for insect digestive system physiology as it protects the midgut epithelium from damage by food particles, pathogens, and toxins. The PM is also an attractive target for development of new pest control strategies due to its per os accessibility. To understand how the PM performs these functions, the molecular architecture of the PM was examined using genomic and proteomic approaches in Mamestra configurata (Lepidoptera: Noctuidae), a major pest of cruciferous oilseed crops in North America. Liquid chromatography-tandem mass spectrometry analyses of the PM identified 82 proteins classified as: (i) peritrophins, including a new class with a CBDIII domain; (ii) enzymes involved in chitin modification (chitin deacetylases), digestion (serine proteases, aminopeptidases, carboxypeptidases, lipases and α-amylase) or other reactions (β-1,3-glucanase, alkaline phosphatase, dsRNase, astacin, pantetheinase); (iii) a heterogenous group consisting of polycalin, REPATs, serpin, C-Type lectin and Lsti99/Lsti201 and 3 novel proteins without known orthologs. The genes encoding PM proteins were expressed predominantly in the midgut. cDNAs encoding chitin synthase-2 (McCHS-2), chitinase (McCHI), and β-N-acetylglucosaminidase (McNAG) enzymes, involved in PM chitin metabolism, were also identified. McCHS-2 expression was specific to the midgut indicating that it is responsible for chitin synthesis in the PM, the only chitinous material in the midgut. In contrast, the genes encoding the chitinolytic enzymes were expressed in multiple tissues. McCHS-2, McCHI, and McNAG were expressed in the midgut of feeding larvae, and NAG activity was present in the PM. This information was used to generate an updated model of the lepidopteran PM architecture. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  7. Distinct profile of vascular progenitor attachment to extracellular matrix proteins in cancer patients.

    Science.gov (United States)

    Labonté, Laura; Li, Yuhua; Addison, Christina L; Brand, Marjorie; Javidnia, Hedyeh; Corsten, Martin; Burns, Kevin; Allan, David S

    2012-04-01

    Vascular progenitor cells (VPCs) facilitate angiogenesis and initiate vascular repair by homing in on sites of damage and adhering to extracellular matrix (ECM) proteins. VPCs also contribute to tumor angiogenesis and induce angiogenic switching in sites of metastatic cancer. In this study, the binding of attaching cells in VPC clusters that form in vitro on specific ECM proteins was investigated. VPC cluster assays were performed in vitro on ECM proteins enriched in cancer cells and in remodelling tissue. Profiles of VPC clusters from patients with cancer were compared to healthy controls. The role of VEGF and integrin-specific binding of angiogenic attaching cells was addressed. VPC clusters from cancer patients were markedly increased on fibronectin relative to other ECM proteins tested, in contrast to VPC clusters from control subjects, which formed preferentially on laminin. Specific integrin-mediated binding of attaching cells in VPC clusters was matrix protein-dependent. Furthermore, cancer patients had elevated plasma VEGF levels compared to healthy controls and VEGF facilitated preferential VPC cluster formation on fibronectin. Incubating cells from healthy controls with VEGF induced a switch from the 'healthy' VPC binding profile to the profile observed in cancer patients with a marked increase in VPC cluster formation on fibronectin. The ECM proteins laminin and fibronectin support VPC cluster formation via specific integrins on attaching cells and can facilitate patterns of VPC cluster formation that are distinct in cancer patients. Larger studies, however, are needed to gain insight on how tumor angiogenesis may differ from normal repair processes.

  8. Matrix pre-coated targets for high throughput MALDI imaging of proteins.

    Science.gov (United States)

    Yang, Junhai; Caprioli, Richard M

    2014-05-01

    We have developed matrix pre-coated targets for imaging proteins in thin tissue sections by matrix-assisted laser desorption/ionization mass spectrometry. Gold covered microscope slides were coated with sinapinic acid (SA) in batches in advance and were shown to be stable for over 6 months when kept in the dark. The sample preparation protocol using these SA pre-coated targets involves treatment with diisopropylethylamine (DIEA)-H2 O vapor, transforming the matrix layer to a viscous ionic liquid. This SA-DIEA ionic liquid layer extracts proteins and other analytes from tissue sections that are thaw mounted to this target. DIEA is removed by the immersion of the target into diluted acetic acid, allowing SA to co-crystallize with extracted analytes directly on the target. Ion images (3-70 kDa) of sections of mouse brain and rat kidney at spatial resolution down to 10 µm were obtained. Use of pre-coated slides greatly reduces sample preparation time for matrix-assisted laser desorption/ionization imaging while providing high throughput, low cost and high spatial resolution images. Copyright © 2014 John Wiley & Sons, Ltd.

  9. ADAM 12 cleaves extracellular matrix proteins and correlates with cancer status and stage

    DEFF Research Database (Denmark)

    Roy, Roopali; Wewer, Ulla M; Zurakowski, David

    2004-01-01

    -Sepharose affinity chromatography followed by protein identification by matrix-assisted laser desorption/ionization-time of flight mass spectrometry. Four peptides were identified that spanned the amino acid sequence of ADAM 12. Immunoblot analysis using ADAM 12-specific antibodies detected an approximately 68-k...... or casein. Gelatinase activity of ADAM 12 was completely abrogated by zinc chelators 1,10-phenanthroline and EDTA and was partially inhibited by the hydroxamate inhibitor Marimastat. Endogenous matrix metalloprotease inhibitor TIMP-3 inhibited activity. To validate our initial identification of this enzyme...... is a gelatinase, that it can be detected in breast cancer patient urine, and that increased urinary levels of this protein correlate with breast cancer progression. They further support the possibility that detection of urinary ADAM 12 may prove useful in the development of noninvasive diagnostic and prognostic...

  10. Identification of bovine sperm acrosomal proteins that interact with a 32-kDa acrosomal matrix protein.

    Science.gov (United States)

    Nagdas, Subir K; Smith, Linda; Medina-Ortiz, Ilza; Hernandez-Encarnacion, Luisa; Raychoudhury, Samir

    2016-03-01

    Mammalian fertilization is accomplished by the interaction between sperm and egg. Previous studies from this laboratory have identified a stable acrosomal matrix assembly from the bovine sperm acrosome termed the outer acrosomal membrane-matrix complex (OMC). This stable matrix assembly exhibits precise binding activity for acrosin and N-acetylglucosaminidase. A highly purified OMC fraction comprises three major (54, 50, and 45 kDa) and several minor (38-19 kDa) polypeptides. The set of minor polypeptides (38-19 kDa) termed "OMCrpf polypeptides" is selectively solubilized by high-pH extraction (pH 10.5), while the three major polypeptides (55, 50, and 45 kDa) remain insoluble. Proteomic identification of the OMC32 polypeptide (32 kDa polypeptide isolated from high-pH soluble fraction of OMC) yielded two peptides that matched the NCBI database sequence of acrosin-binding protein. Anti-OMC32 recognized an antigenically related family of polypeptides (OMCrpf polypeptides) in the 38-19-kDa range with isoelectric points ranging between 4.0 and 5.1. Other than glycohydrolases, OMC32 may also be complexed to other acrosomal proteins. The present study was undertaken to identify and localize the OMC32 binding polypeptides and to elucidate the potential role of the acrosomal protein complex in sperm function. OMC32 affinity chromatography of a detergent-soluble fraction of bovine cauda sperm acrosome followed by mass spectrometry-based identification of bound proteins identified acrosin, lactadherin, SPACA3, and IZUMO1. Co-immunoprecipitation analysis also demonstrated the interaction of OMC32 with acrosin, lactadherin, SPACA3, and IZUMO1. Our immunofluorescence studies revealed the presence of SPACA3 and lactadherin over the apical segment, whereas IZUMO1 is localized over the equatorial segment of Triton X-100 permeabilized cauda sperm. Immunoblot analysis showed that a significant portion of SPACA3 was released after the lysophosphatidylcholine (LPC)-induced acrosome

  11. The application of an enamel matrix protein derivative (Emdogain) in regenerative periodontal therapy: a review.

    OpenAIRE

    Sculean, A.; Schwarz, F.; Becker, J.; Brecx, M.

    2007-01-01

    Regenerative periodontal therapy aims at reconstitution of the lost periodontal structures such as new formation of root cementum, periodontal ligament and alveolar bone. Findings from basic research indicate that enamel matrix protein derivative (EMD) has a key role in periodontal wound healing. Histological results from animal and human studies have shown that treatment with EMD promotes periodontal regeneration. Moreover, clinical studies have indicated that treatment with EMD positively i...

  12. Nuclear matrix proteins are covalently linked to DNA after ionizing radiation

    International Nuclear Information System (INIS)

    Cress, A.E.

    1985-01-01

    The authors investigated the production of covalent DNA protein crosslinks (DPC) with ionizing radiation. A particular class of nonhistone chromosomal proteins becomes covalently bound to the DNA after 5,000 rads of X-ray. They partially purified these complexes by CsCl density gradient sedimentation. The incorporation of /sup 35/S-met and one dimensional SDS polyacrylimide gel electrophoresis reveals that the proteins involved in the DPC correspond in MW, solubility and predominance to a subset of the nuclear matrix proteins. The DPC are removed after the repair of double and single-stranded scissions is complete as judged by neutral and alkaline elutions. The removal process of the DPC is independent of RNA and protein synthesis inhibition. These data are interesting since these proteins have similar characteristics to the proposed nuclear attachment sites of DNA loops involved in the organization of the genome. The authors are presently using ''Western'' blotting and two dimensional electrophoresis to further identify the specific proteins involved in the DPC. Their current working hypothesis is that the protein involved in the DPC consists primarily of structural nuclear proteins which become covalently crosslinked after ionizing radiation

  13. Superoxide activates mitochondrial uncoupling protein 2 from the matrix side. Studies using targeted antioxidants.

    Science.gov (United States)

    Echtay, Karim S; Murphy, Michael P; Smith, Robin A J; Talbot, Darren A; Brand, Martin D

    2002-12-06

    Superoxide activates nucleotide-sensitive mitochondrial proton transport through the uncoupling proteins UCP1, UCP2, and UCP3 (Echtay, K. S., et al. (2002) Nature 415, 1482-1486). Two possible mechanisms were proposed: direct activation of the UCP proton transport mechanism by superoxide or its products and a cycle of hydroperoxyl radical entry coupled to UCP-catalyzed superoxide anion export. Here we provide evidence for the first mechanism and show that superoxide activates UCP2 in rat kidney mitochondria from the matrix side of the mitochondrial inner membrane: (i) Exogenous superoxide inhibited matrix aconitase, showing that external superoxide entered the matrix. (ii) Superoxide-induced uncoupling was abolished by low concentrations of the mitochondrially targeted antioxidants 10-(6'-ubiquinonyl)decyltriphenylphosphonium (mitoQ) or 2-[2-(triphenylphosphonio)ethyl]-3,4-dihydro-2,5,7,8-tetramethyl-2H-1-benzopyran-6-ol bromide (mitoVit E), which are ubiquinone (Q) or tocopherol derivatives targeted to the matrix by covalent attachment to triphenylphosphonium cation. However, superoxide-induced uncoupling was not affected by similar concentrations of the nontargeted antioxidants Q(o), Q(1), decylubiquinone, vitamin E, or 6-hydroxy-2,5,7,8-tetramethylchroman 2-carboxylic acid (TROLOX) or of the mitochondrially targeted but redox-inactive analogs decyltriphenylphosphonium or 4-chlorobutyltriphenylphosphonium. Thus matrix superoxide appears to be necessary for activation of UCP2 by exogenous superoxide. (iii) When the reduced to oxidized ratio of mitoQ accumulated by mitochondria was increased by inhibiting cytochrome oxidase, it induced nucleotide-sensitive uncoupling that was not inhibited by external superoxide dismutase. Under these conditions quinols are known to produce superoxide, and because mitoQ is localized within the mitochondrial matrix this suggests that production of superoxide in the matrix was sufficient to activate UCP2. Furthermore, the superoxide

  14. Detection of HOCl-mediated protein oxidation products in the extracellular matrix of human atherosclerotic plaques

    DEFF Research Database (Denmark)

    Woods, Alan A; Linton, Stuart M; Davies, Michael Jonathan

    2003-01-01

    Oxidation is believed to play a role in atherosclerosis. Oxidized lipids, sterols and proteins have been detected in early, intermediate and advanced human lesions at elevated levels. The spectrum of oxidized side-chain products detected on proteins from homogenates of advanced human lesions has...... been interpreted in terms of the occurrence of two oxidative mechanisms, one involving oxygen-derived radicals catalysed by trace transition metal ions, and a second involving chlorinating species (HOCl or Cl2), generated by the haem enzyme myeloperoxidase (MPO). As MPO is released extracellularly...... for 83-96% of the total oxidized protein side-chain products detected in these plaques. Oxidation of matrix components extracted from healthy artery tissue, and model proteins, with reagent HOCl is shown to give rise to a similar pattern of products to those detected in advanced human lesions...

  15. Annexin A2 Mediates the Localization of Measles Virus Matrix Protein at the Plasma Membrane.

    Science.gov (United States)

    Koga, Ritsuko; Kubota, Marie; Hashiguchi, Takao; Yanagi, Yusuke; Ohno, Shinji

    2018-02-28

    Annexins are a family of structurally related proteins that bind negatively charged membrane phospholipids in a Ca 2+ -dependent manner. Annexin A2 (AnxA2), a member of the family, has been implicated in a variety of cellular functions including the organization of membrane domains, vesicular trafficking and cell-cell adhesion. AnxA2 generally forms the heterotetrameric complex with a small Ca 2+ -binding protein S100A10. Measles virus (MV), a member of the family Paramyxoviridae , is an enveloped virus with a nonsegmented negative strand RNA genome. Knockdown of AnxA2 greatly reduced MV growth in cells, without affecting its entry and viral RNA production. In MV-infected, AnxA2-knockdown cells, the expression level of the matrix (M) protein, but not other viral proteins, was reduced compared with that in control cells, and the distribution of the M protein at the plasma membrane was decreased. The M protein lines the inner surface of the envelope and plays an important role in virus assembly by connecting the nucleocapsid to the envelope proteins. The M protein bound to AnxA2 independently of AnxA2's phosphorylation or its association with S100A10, and was co-localized with AnxA2 within cells. Truncation of the N-terminal 10 amino acid residues, but not the N-terminal 5 residues, compromised the ability of the M protein to interact with AnxA2 and localize at the plasma membrane. These results indicate that AnxA2 mediates the localization of the MV M protein at the plasma membrane by interacting with its N-terminal region (especially residues at positions 6-10), thereby aiding in MV assembly. IMPORTANCE Measles virus (MV) is an important human pathogen, still claiming ∼ 100,000 lives per year despite the presence of effective vaccines, and causes occasional outbreaks even in developed countries. Replication of viruses largely relies on the functions of host cells. Our study revealed that the reduction of the host protein annexin A2 compromises the replication of

  16. Preparation and In-Vitro Evaluation of Sustained Release Matrix Diclofenac Sodium Tablets Using HPMC KM 100 and Gums

    Directory of Open Access Journals (Sweden)

    Zafar Iqbal, Raza Khan, Fazli Nasir, Jamshaid Ali Khan, Lateef Ahmad, Abad Khan, Yaser Shah

    2010-12-01

    Full Text Available Objectives: The impact of hydroxypropylmethyl cellulose(HPMC K 100M alone and in combination with the guar gum,xanthan gum and gum tragacanth on the release of the diclofenac sodium matrix tablets were evaluated.Materials and Methods: The granules were prepared using wet granulation method and compressed into tablets using different ratio of drug and gum ratio. The physical properties of the tablets were within acceptable pharmacopeial limits.The release profiles of the matrix tablets were evaluated in vitro,using USP dissolution apparatus II (paddle method.Results: The formulations containing HPMC K 100M drug ratio1:1.3 and 1:1.6 and formulations containing HPMC, gum and drug with different ratio also sustained the release of diclofenac sodium for 12 hours. The mechanism of drug release from the matrix tablets was studied using Zero order, First order, Higuchi and Korsmeyer’s models using regression coefficient method. The stability of the selected formulations was evaluated at 40˚C and 70% RH for 6 months.Conclusions: HPMC K100M alone and in combination with natural gums as the retarding material retarded the release upto 12 hours and showed little deviation from the theoretical release pattern.

  17. Application of green fluorescent protein-labeled assay for the study of subcellular localization of Newcastle disease virus matrix protein.

    Science.gov (United States)

    Duan, Zhiqiang; Li, Qunhui; He, Liang; Zhao, Guo; Chen, Jian; Hu, Shunlin; Liu, Xiufan

    2013-12-01

    Green fluorescent protein (GFP) used as a powerful marker of gene expression in vivo has so far been applied widely in studying the localizations and functions of protein in living cells. In this study, GFP-labeled assay was used to investigate the subcellular localization of matrix (M) protein of different virulence and genotype Newcastle disease virus (NDV) strains. The M protein of ten NDV strains fused with GFP (GFP-M) all showed nuclear-and-nucleolar localization throughout transfection, whereas that of the other two strains were observed in the nucleus and nucleolus early in transfection but in the cytoplasm late in transfection. In addition, mutations to the previously defined nuclear localization signal in the GFP-M fusion protein were studied as well. Single changes at positions 262 and 263 did not affect nuclear localization of M, while changing both of these arginine residues to asparagine caused re-localization of M mainly to the cytoplasm. The GFP-M was validated as a suitable system for studying the subcellular localization of M protein and could be used to assist us in further identifying the signal sequences responsible for the nucleolar localization and cytoplasmic localization of M protein. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. The expression of apoptotic proteins and matrix metalloproteinases in odontogenic myxomas.

    Science.gov (United States)

    Bast, Brian T; Pogrel, M Anthony; Regezi, Joseph A

    2003-12-01

    The odontogenic myxoma is a rare benign tumor affecting the jaws. We hypothesize that odontogenic myxomas have dysregulated antiapoptotic mechanisms to assist in neoplastic growth. We believe that antiapoptotic proteins of the Bcl-2 family are over expressed and that tumor cells must generate some form of matrix proteinase. The aim of this study was to evaluate odontogenic myxomas for the expression of cell cycle protein Ki-67, apoptosis-regulating proteins Bcl-2, Bcl-XL, Bak, and Bax, and matrix metalloproteinases MMP-2, MMP-3, and MMP-9. Odontogenic myxomas submitted to oral pathology between 1974 and 1998 were evaluated. Twenty-six paraffin-embedded tissue sections were used in a standard immunohistochemistry protocol and incubated with one of the following antibodies: Bcl-2, Bcl-XL, Bak, Bax, or Ki-67. The sections were then incubated with anti-immunoglobulin conjugated to peroxidase-labeled dextran polymer in a Tris-HCl buffer. Counts of positive (staining) cells were completed in 5 high-power fields for each specimen. Each slide was reviewed by 2 investigators, and final data were pooled and averaged. Specimen slides showed an increase in cells staining positively for anti-apoptotic proteins Bcl-2 and Bcl-X. An average of 6.5% of specimen cells were positive for Bcl-2 and 10.4% for Bcl-X. Control tissue showed only 1.1% of cells to be positive for Bcl-2 and 1.2% for Bcl-X. Less than 1% of both specimen and control cells stained positively for Ki-67. Proapoptotic proteins (Bak and Bax) were not detected in tumor cells. Ninety percent of tumor cells stained positively for MMP-2 compared with 10% of controls. Specimen and controls were negative for MMP-3 and MMP-9. Odontogenic myxoma tumor cells did not show an increase in cell division. Less than 1% of tumor and control cells were positive for Ki-67. Odontogenic myxoma tumor cells showed increased expression of antiapoptotic proteins (Bcl-2 and Bcl-X) and the matrix metalloproteinase MMP-2. This study suggests

  19. Modulation of matrix mineralization by Vwc2-like protein and its novel splicing isoforms.

    Science.gov (United States)

    Ohyama, Yoshio; Katafuchi, Michitsuna; Almehmadi, Ahmed; Venkitapathi, Sundharamani; Jaha, Haytham; Ehrenman, Jason; Morcos, Joseph; Aljamaan, Reem; Mochida, Yoshiyuki

    2012-02-03

    In search of new cysteine knot protein (CKP) family members, we found a novel gene called von Willebrand factor C domain-containing protein 2-like (Vwc2l, also known as Brorin-like) and its transcript variants (Vwc2l-1, Vwc2l-2 and Vwc2l-3). Based on the deduced amino acid sequence, Vwc2l-1 has a signal peptide and 2 cysteine-rich (CR) domains, while Vwc2l-2 lacks a part of 2nd CR domain and Vwc2l-3 both CR domains. Although it has been reported that the expression of Brorin-like was predominantly observed in brain, we found that Vwc2l transcript variants were detected in more ubiquitous tissues. In osteoblasts, the induction of Vwc2l expression was observed at matrix mineralization stage. When Vwc2l was stably transfected into osteoblasts, the matrix mineralization was markedly accelerated in Vwc2l-expressing clones compared to that in the control, indicating the modulatory effect of Vwc2l protein on osteoblastic cell function. The mechanistic insight of Vwc2l-modulation was further investigated and we found that the expression of Osterix, one of the key osteogenic markers, was significantly increased by addition of all Vwc2l isoform proteins. Taken together, Vwc2l is a novel secreted protein that promotes matrix mineralization by modulating Osterix expression likely through TGF-β superfamily growth factor signaling pathway. Our data may provide mechanistic insights into the biological functions of this novel CKP member in bone and further suggest a novel approach to enhance osteoblast function, which enables to accerelate bone formation, regeneration and healing. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Biophysical characterization and crystal structure of the Feline Immunodeficiency Virus p15 matrix protein.

    Science.gov (United States)

    Serrière, Jennifer; Robert, Xavier; Perez, Magali; Gouet, Patrice; Guillon, Christophe

    2013-06-24

    Feline Immunodeficiency Virus (FIV) is a viral pathogen that infects domestic cats and wild felids. During the viral replication cycle, the FIV p15 matrix protein oligomerizes to form a closed matrix that underlies the lipidic envelope of the virion. Because of its crucial role in the early and late stages of viral morphogenesis, especially in viral assembly, FIV p15 is an interesting target in the development of potential new therapeutic strategies. Our biochemical study of FIV p15 revealed that it forms a stable dimer in solution under acidic conditions and at high concentration, unlike other retroviral matrix proteins. We determined the crystal structure of full-length FIV p15 to 2 Å resolution and observed a helical organization of the protein, typical for retroviral matrix proteins. A hydrophobic pocket that could accommodate a myristoyl group was identified, and the C-terminal end of FIV p15, which is mainly unstructured, was visible in electron density maps. As FIV p15 crystallizes in acidic conditions but with one monomer in the asymmetric unit, we searched for the presence of a biological dimer in the crystal. No biological assembly was detected by the PISA server, but the three most buried crystallographic interfaces have interesting features: the first one displays a highly conserved tryptophan acting as a binding platform, the second one is located along a 2-fold symmetry axis and the third one resembles the dimeric interface of EIAV p15. Because the C-terminal end of p15 is involved in two of these three interfaces, we investigated the structure and assembly of a C-terminal-truncated form of p15 lacking 14 residues. The truncated FIV p15 dimerizes in solution at a lower concentration and crystallizes with two molecules in the asymmetric unit. The EIAV-like dimeric interface is the only one to be retained in the new crystal form. The dimeric form of FIV p15 in solution and its extended C-terminal end are characteristic among lentiviral matrix proteins

  1. Matrix proteins of Nipah and Hendra viruses interact with beta subunits of AP-3 complexes.

    Science.gov (United States)

    Sun, Weina; McCrory, Thomas S; Khaw, Wei Young; Petzing, Stephanie; Myers, Terrell; Schmitt, Anthony P

    2014-11-01

    Paramyxoviruses and other negative-strand RNA viruses encode matrix proteins that coordinate the virus assembly process. The matrix proteins link the viral glycoproteins and the viral ribonucleoproteins at virus assembly sites and often recruit host machinery that facilitates the budding process. Using a co-affinity purification strategy, we have identified the beta subunit of the AP-3 adapter protein complex, AP3B1, as a binding partner for the M proteins of the zoonotic paramyxoviruses Nipah virus and Hendra virus. Binding function was localized to the serine-rich and acidic Hinge domain of AP3B1, and a 29-amino-acid Hinge-derived polypeptide was sufficient for M protein binding in coimmunoprecipitation assays. Virus-like particle (VLP) production assays were used to assess the relationship between AP3B1 binding and M protein function. We found that for both Nipah virus and Hendra virus, M protein expression in the absence of any other viral proteins led to the efficient production of VLPs in transfected cells, and this VLP production was potently inhibited upon overexpression of short M-binding polypeptides derived from the Hinge region of AP3B1. Both human and bat (Pteropus alecto) AP3B1-derived polypeptides were highly effective at inhibiting the production of VLPs. VLP production was also impaired through small interfering RNA (siRNA)-mediated depletion of AP3B1 from cells. These findings suggest that AP-3-directed trafficking processes are important for henipavirus particle production and identify a new host protein-virus protein binding interface that could become a useful target in future efforts to develop small molecule inhibitors to combat paramyxoviral infections. Henipaviruses cause deadly infections in humans, with a mortality rate of about 40%. Hendra virus outbreaks in Australia, all involving horses and some involving transmission to humans, have been a continuing problem. Nipah virus caused a large outbreak in Malaysia in 1998, killing 109 people

  2. Cell survival, activation and apoptosis of hepatic stellate cells: modulation by extracellular matrix proteins.

    Science.gov (United States)

    Priya, Sulochana; Sudhakaran, Perumana R

    2008-12-01

    Cytokines and growth factors released by various hepatic cells exert both paracrine and autocrine effects on hepatic stellate cell (HSC) activation during liver injury. The aim of the present study was to examine whether the surrounding extracellular matrix (ECM) influences the activation, transdifferentiation and survival of HSCs. An in vitro model system of isolated HSCs maintained in culture on different matrix protein substrata was employed. The rate of loss of HSC-specific retinol uptake activity and gain of myofibroblast-like activity such as (35)[S] proteoglycan synthesis varied in cells maintained on different matrix proteins and was in the order collagen I > collagen IV >/= laminin. (3)[H]-thymidine incorporation by HSCs maintained on different matrix proteins varied and was in the order collagen I > collagen IV > laminin. MTT assay revealed that the growth inhibition in response to curcumin was significantly low in cells maintained on collagen I. Apoptotic marker activities such as DNA fragmentation, 4',6'-diamidino-2-phenylindole dihydrochloride (DAPI) staining, annexin staining and caspase-3 activities showed that cells maintained on collagen I showed minimal apoptosis than those maintained on collagen IV, laminin and polylysine, showing the influence of ECM on HSC apoptosis. Experiments using blocking antibodies showed that the collagen I effect was mediated through alpha(2)beta(1) integrin. These results indicate that ECM influences activation, transdifferentiation and survival of HSCs, and suggest that apart from diffusible factors, the surrounding ECM also influences HSC behavior critical in both the progression of the fibrosis and the restitution of the liver during recovery after hepatic injury.

  3. Preparation and comparative evaluation of sustained release metoclopramide hydrochloride matrix tablets

    Science.gov (United States)

    Abdel-Rahman, Sayed I.; Mahrous, Gamal M.; El-Badry, Mahmoud

    2009-01-01

    Metoclopramide hydrochloride (MCP) is commonly used for the management of gastrointestinal disorders. Frequent administration and the undesired side effects (extra pyramidal symptoms) of the drug on the central nervous system due to the fluctuations of its plasma concentrations may lead to patient incompliance, and hence, improper therapy. Therefore, the present work will be devoted to formulate the drug in sustained release formulations. MCP was incorporated in 12 formulae containing different polymers and/or different polymer ratios. These polymers were hydroxypropylmethyl cellulose (HPMC), carboxymethylcellulose (CMC) and ethyl cellulose (EC). Sodium starch glycolate (SSG) was added to some formulae in different amounts in order to soften and/or disintegrate the tablets. Both direct compression and granulation techniques were used to prepare the tablets. The physical properties were found to be satisfactory for all the formulae. The dissolution profiles of the tablets were constructed using the change-over method. The drug release involved a combination of both diffusion and polymer-chain relaxation mechanisms. The time required to release 50% of MCP ranged from 1.2 to more than 8 h. Direct compression and dry granulation techniques produced sufficient sustaining of the drug release. However, the pellets made by wet granulation released MCP in about 2 h, i.e., pelletization spheronization technique was not effective in sustaining the drug. PMID:23960711

  4. Enhance and Maintain Chondrogenesis of Synovial Fibroblasts by Cartilage Extracellular Matrix Protein Matrilins

    Science.gov (United States)

    Pei, Ming; Luo, Junming; Chen, Qian

    2008-01-01

    Summary Objective Cartilage-specific extracellular matrix (ECM) proteins have been proposed to play key roles in modulating cellular phenotypes during chondrogenesis of mesenchymal stem cells. Matrilin (MATN) 1 and 3 are among the most up-regulated ECM proteins during chondrogenesis. The aim of this study was to analyze their roles in chondrogenesis of mesenchymal fibroblasts from synovium. Methods Primary synovial fibroblasts (SFBs) were purified from porcine synovium and incubated in pellet culture for 18 days. Chondrogenesis of SFB was analyzed by histological staining with safranin-O/fast green, and by quantifying glycosaminoglycans with dimethylmethylene blue assay. The mRNA levels of chondrogenic markers including collagen II, aggrecan, and Sox 9 were quantified by real-time RT-PCR, while the protein levels of Col II and matrilins were determined by western blot analysis. Results SFBs underwent chondrogenesis after incubation with TGF-β1 for three days; however, this process was attenuated during the subsequent incubation period. Expression of a MATN1 or 3 cDNA maintained and further enhanced chondrogenesis of SFBs as shown by increased cartilaginous matrix areas, elevated amount of glycosaminoglycans, and stimulated expression of chondrogenic markers. Conclusion Our findings suggest a novel function for MATN1 and 3 to maintain and enhance chondrogenesis of mesenchymal fibroblasts initiated by TGF-β. Our results also support a critical role of cartilage-specific ECM proteins to modulate cellular phenotypes in the microenvironment during chondrogenic differentiation. PMID:18282772

  5. Enhancing and maintaining chondrogenesis of synovial fibroblasts by cartilage extracellular matrix protein matrilins.

    Science.gov (United States)

    Pei, M; Luo, J; Chen, Q

    2008-09-01

    Cartilage-specific extracellular matrix (ECM) proteins have been proposed to play key roles in modulating cellular phenotypes during chondrogenesis of mesenchymal stem cells. Matrilin (MATN)1 and MATN3 are among the most up-regulated ECM proteins during chondrogenesis. The aim of this study was to analyze their roles in chondrogenesis of mesenchymal fibroblasts from synovium. Primary synovial fibroblasts (SFBs) were purified from porcine synovium and incubated in pellet culture for 18 days. Chondrogenesis of SFB was analyzed by histological staining with safranin-O/fast green, and by quantifying glycosaminoglycans (GAG) with dimethylmethylene blue assay. The mRNA levels of chondrogenic markers including collagen II, aggrecan, and Sox 9 were quantified by real-time reverse transcription polymerase chain reaction, while the protein levels of Col II and MATNs were determined by western blot analysis. SFBs underwent chondrogenesis after incubation with transforming growth factor-beta1 (TGF-beta1) for 3 days; however, this process was attenuated during the subsequent incubation period. Expression of a Matn1 or Matn3 cDNA maintained and further enhanced chondrogenesis of SFBs as shown by increased cartilaginous matrix areas, elevated amount of GAG, and stimulated expression of chondrogenic markers. Our findings suggest a novel function for MATN1 and MATN3 to maintain and enhance chondrogenesis of mesenchymal fibroblasts initiated by TGF-beta. Our results also support a critical role of cartilage-specific ECM proteins to modulate cellular phenotypes in the microenvironment during chondrogenic differentiation.

  6. Crosslinking of a Peritrophic Matrix Protein Protects Gut Epithelia from Bacterial Exotoxins

    Science.gov (United States)

    Shibata, Toshio; Maki, Kouki; Hadano, Jinki; Fujikawa, Takumi; Kitazaki, Kazuki; Koshiba, Takumi; Kawabata, Shun-ichiro

    2015-01-01

    Transglutaminase (TG) catalyzes protein-protein crosslinking, which has important and diverse roles in vertebrates and invertebrates. Here we demonstrate that Drosophila TG crosslinks drosocrystallin, a peritrophic matrix protein, to form a stable fiber structure on the gut peritrophic matrix. RNA interference (RNAi) of the TG gene was highly lethal in flies and induced apoptosis of gut epithelial cells after oral infection with Pseudomonas entomophila. Moreover, AprA, a metalloprotease secreted by P. entomophila, digested non-crosslinked drosocrystallin fibers, but not drosocrystallin fibers crosslinked by TG. In vitro experiments using recombinant drosocrystallin and monalysin proteins demonstrated that monalysin, a pore-forming exotoxin of P. entomophila, was adsorbed on the crosslinked drosocrystallin fibers in the presence of P. entomophila culture supernatant. In addition, gut-specific TG-RNAi flies had a shorter lifespan than control flies after ingesting P. entomophila, whereas the lifespan after ingesting AprA-knockout P. entomophila was at control levels. We conclude that drosocrystallin fibers crosslinked by TG, but not non-crosslinked drosocrystallin fibers, form an important physical barrier against exotoxins of invading pathogenic microbes. PMID:26506243

  7. Crosslinking of a Peritrophic Matrix Protein Protects Gut Epithelia from Bacterial Exotoxins.

    Directory of Open Access Journals (Sweden)

    Toshio Shibata

    2015-10-01

    Full Text Available Transglutaminase (TG catalyzes protein-protein crosslinking, which has important and diverse roles in vertebrates and invertebrates. Here we demonstrate that Drosophila TG crosslinks drosocrystallin, a peritrophic matrix protein, to form a stable fiber structure on the gut peritrophic matrix. RNA interference (RNAi of the TG gene was highly lethal in flies and induced apoptosis of gut epithelial cells after oral infection with Pseudomonas entomophila. Moreover, AprA, a metalloprotease secreted by P. entomophila, digested non-crosslinked drosocrystallin fibers, but not drosocrystallin fibers crosslinked by TG. In vitro experiments using recombinant drosocrystallin and monalysin proteins demonstrated that monalysin, a pore-forming exotoxin of P. entomophila, was adsorbed on the crosslinked drosocrystallin fibers in the presence of P. entomophila culture supernatant. In addition, gut-specific TG-RNAi flies had a shorter lifespan than control flies after ingesting P. entomophila, whereas the lifespan after ingesting AprA-knockout P. entomophila was at control levels. We conclude that drosocrystallin fibers crosslinked by TG, but not non-crosslinked drosocrystallin fibers, form an important physical barrier against exotoxins of invading pathogenic microbes.

  8. Prediction of residue-residue contact matrix for protein-protein interaction with Fisher score features and deep learning.

    Science.gov (United States)

    Du, Tianchuan; Liao, Li; Wu, Cathy H; Sun, Bilin

    2016-11-01

    Protein-protein interactions play essential roles in many biological processes. Acquiring knowledge of the residue-residue contact information of two interacting proteins is not only helpful in annotating functions for proteins, but also critical for structure-based drug design. The prediction of the protein residue-residue contact matrix of the interfacial regions is challenging. In this work, we introduced deep learning techniques (specifically, stacked autoencoders) to build deep neural network models to tackled the residue-residue contact prediction problem. In tandem with interaction profile Hidden Markov Models, which was used first to extract Fisher score features from protein sequences, stacked autoencoders were deployed to extract and learn hidden abstract features. The deep learning model showed significant improvement over the traditional machine learning model, Support Vector Machines (SVM), with the overall accuracy increased by 15% from 65.40% to 80.82%. We showed that the stacked autoencoders could extract novel features, which can be utilized by deep neural networks and other classifiers to enhance learning, out of the Fisher score features. It is further shown that deep neural networks have significant advantages over SVM in making use of the newly extracted features. Copyright © 2016. Published by Elsevier Inc.

  9. Improved success of sparse matrix protein crystallization screening with heterogeneous nucleating agents.

    Directory of Open Access Journals (Sweden)

    Anil S Thakur

    2007-10-01

    Full Text Available Crystallization is a major bottleneck in the process of macromolecular structure determination by X-ray crystallography. Successful crystallization requires the formation of nuclei and their subsequent growth to crystals of suitable size. Crystal growth generally occurs spontaneously in a supersaturated solution as a result of homogenous nucleation. However, in a typical sparse matrix screening experiment, precipitant and protein concentration are not sampled extensively, and supersaturation conditions suitable for nucleation are often missed.We tested the effect of nine potential heterogenous nucleating agents on crystallization of ten test proteins in a sparse matrix screen. Several nucleating agents induced crystal formation under conditions where no crystallization occurred in the absence of the nucleating agent. Four nucleating agents: dried seaweed; horse hair; cellulose and hydroxyapatite, had a considerable overall positive effect on crystallization success. This effect was further enhanced when these nucleating agents were used in combination with each other.Our results suggest that the addition of heterogeneous nucleating agents increases the chances of crystal formation when using sparse matrix screens.

  10. The Role of Structural Extracellular Matrix Proteins in Urothelial Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Andrea Brunner

    2007-01-01

    Full Text Available The extracellular matrix (ECM plays a key role in the modulation of cancer cell invasion. In urothelial carcinoma of the bladder (UC the role of ECM proteins has been widely studied. The mechanisms, which are involved in the development of invasion, progression and generalization, are complex, depending on the interaction of ECM proteins with each other as well as with cancer cells. The following review will focus on the pathogenetic role and prognostic value of structural proteins, such as laminins, collagens, fi bronectin (FN, tenascin (Tn-C and thrombospondin 1 (TSP1 in UC. In addition, the role of integrins mediating the interaction of ECM molecules and cancer cells will be addressed, since integrin-mediated FN, Tn-C and TSP1 interactions seem to play an important role during tumor cell invasion and angiogenesis.

  11. Upregulation of matrix synthesis in chondrocyte-seeded agarose following sustained bi-axial cyclic loading

    Directory of Open Access Journals (Sweden)

    Belinda Pingguan-Murphy

    2012-08-01

    Full Text Available OBJECTIVES: The promotion of extracellular matrix synthesis by chondrocytes is a requisite part of an effective cartilage tissue engineering strategy. The aim of this in vitro study was to determine the effect of bi-axial cyclic mechanical loading on cell proliferation and the synthesis of glycosaminoglycans by chondrocytes in threedimensional cultures. METHOD: A strain comprising 10% direct compression and 1% compressive shear was applied to bovine chondrocytes seeded in an agarose gel during two 12-hour conditioning periods separated by a 12-hour resting period. RESULTS: The bi-axial-loaded chondrocytes demonstrated a significant increase in glycosaminoglycan synthesis compared with samples exposed to uni-axial or no loading over the same period (p<0.05. The use of a free-swelling recovery period prior to the loading regime resulted in additional glycosaminoglycan production and a significant increase in DNA content (p<0.05, indicating cell proliferation. CONCLUSIONS: These results demonstrate that the use of a bi-axial loading regime results in increased matrix production compared with uni-axial loading.

  12. Dynamic culture substrate that captures a specific extracellular matrix protein in response to light

    Directory of Open Access Journals (Sweden)

    Jun Nakanishi, Hidekazu Nakayama, Kazuo Yamaguchi, Andres J Garcia and Yasuhiro Horiike

    2011-01-01

    Full Text Available The development of methods for the off–on switching of immobilization or presentation of cell-adhesive peptides and proteins during cell culture is important because such surfaces are useful for the analysis of the dynamic processes of cell adhesion and migration. This paper describes a chemically functionalized gold substrate that captures a genetically tagged extracellular matrix protein in response to light. The substrate was composed of mixed self-assembled monolayers (SAMs of three disulfide compounds containing (i a photocleavable poly(ethylene glycol (PEG, (ii nitrilotriacetic acid (NTA and (iii hepta(ethylene glycol (EG7. Although the NTA group has an intrinsic high affinity for oligohistidine tag (His-tag sequences in its Ni2+-ion complex, the interaction was suppressed by the steric hindrance of coexisting PEG on the substrate surface. Upon photoirradiation of the substrate to release the PEG chain from the surface, this interaction became possible and hence the protein was captured at the irradiated regions, while keeping the non-specific adsorption of non-His-tagged proteins blocked by the EG7 underbrush. In this way, we selectively immobilized a His-tagged fibronectin fragment (FNIII7–10 to the irradiated regions. In contrast, when bovine serum albumin—a major serum protein—was added as a non-His-tagged protein, the surface did not permit its capture, with or without irradiation. In agreement with these results, cells were selectively attached to the irradiated patterns only when a His-tagged FNIII7-10 was added to the medium. These results indicate that the present method is useful for studying the cellular behavior on the specific extracellular matrix protein in cell-culturing environments.

  13. A spatio-temporal analysis of matrix protein and nucleocapsid trafficking during vesicular stomatitis virus uncoating.

    Directory of Open Access Journals (Sweden)

    Chad E Mire

    2010-07-01

    Full Text Available To study VSV entry and the fate of incoming matrix (M protein during virus uncoating we used recombinant viruses encoding M proteins with a C-terminal tetracysteine tag that could be fluorescently labeled using biarsenical (Lumio compounds. We found that uncoating occurs early in the endocytic pathway and is inhibited by expression of dominant-negative (DN Rab5, but is not inhibited by DN-Rab7 or DN-Rab11. Uncoating, as defined by the separation of nucleocapsids from M protein, occurred between 15 and 20 minutes post-entry and did not require microtubules or an intact actin cytoskeleton. Unexpectedly, the bulk of M protein remained associated with endosomal membranes after uncoating and was eventually trafficked to recycling endosomes. Another small, but significant fraction of M distributed to nuclear pore complexes, which was also not dependent on microtubules or polymerized actin. Quantification of fluorescence from high-resolution confocal micrographs indicated that after membrane fusion, M protein diffuses across the endosomal membrane with a concomitant increase in fluorescence from the Lumio label which occurred soon after the release of RNPs into the cytoplasm. These data support a new model for VSV uncoating in which RNPs are released from M which remains bound to the endosomal membrane rather than the dissociation of M protein from RNPs after release of the complex into the cytoplasm following membrane fusion.

  14. Electrospray ionization and matrix assisted laser desorption/ionization mass spectrometry: powerful analytical tools in recombinant protein chemistry

    DEFF Research Database (Denmark)

    Andersen, Jens S.; Svensson, B; Roepstorff, P

    1996-01-01

    Electrospray ionization and matrix assisted laser desorption/ionization are effective ionization methods for mass spectrometry of biomolecules. Here we describe the capabilities of these methods for peptide and protein characterization in biotechnology. An integrated analytical strategy is presen......Electrospray ionization and matrix assisted laser desorption/ionization are effective ionization methods for mass spectrometry of biomolecules. Here we describe the capabilities of these methods for peptide and protein characterization in biotechnology. An integrated analytical strategy...

  15. Matrix Gla Protein is Involved in Crystal Formation in Kidney of Hyperoxaluric Rats

    Directory of Open Access Journals (Sweden)

    Xiuli Lu

    2013-02-01

    Full Text Available Background: Matrix Gla protein (MGP is a molecular determinant regulating vascular calcification of the extracellular matrix. However, it is still unclear how MGP may be invovled in crystal formation in the kidney of hyperoxaluric rats. Methods: Male Sprague-Dawley rats were divided into the hyperoxaluric group and control group. Hyperoxaluric rats were administrated by 0.75% ethylene glycol (EG for up to 8 weeks. Renal MGP expression was detected by the standard avidin-biotin complex (ABC method. Renal crystal deposition was observed by a polarizing microscope. Total RNA and protein from the rat kidney tissue were extracted. The levels of MGP mRNA and protein expression were analyzed by the real-time polymerase chain reaction (RT-PCR and Western blot. Results: Hyperoxaluria was induced successfully in rats. The MGP was polarly distributed, on the apical membrane of renal tubular epithelial cells, and was found in the ascending thick limbs of Henle's loop (cTAL and the distal convoluted tubule (DCT in hyperoxaluric rats, its expression however, was present in the medullary collecting duct (MCD in stone-forming rats. Crystals with multilaminated structure formed in the injurious renal tubules with lack of MGP expression.MGP mRNA expression was significantly upregulated by the crystals' stimulations. Conclusion: Our results suggested that the MGP was involved in crystals formation by the continuous expression, distributing it polarly in the renal tubular cells and binding directly to the crystals.

  16. Cartilage oligomeric matrix protein in patients with juvenile idiopathic arthritis: relation to growth and disease activity

    DEFF Research Database (Denmark)

    Bjørnhart, Birgitte; Juul, Anders; Nielsen, Susan

    2009-01-01

    OBJECTIVE: Cartilage oligomeric matrix protein (COMP) has been identified as a prognostic marker of progressive joint destruction in rheumatoid arthritis. In this population based study we evaluated associations between plasma concentrations of COMP, disease activity, and growth velocity in patie......OBJECTIVE: Cartilage oligomeric matrix protein (COMP) has been identified as a prognostic marker of progressive joint destruction in rheumatoid arthritis. In this population based study we evaluated associations between plasma concentrations of COMP, disease activity, and growth velocity...... significantly reduced compared to healthy children (p correlated negatively with C-reactive protein (CRP; r = -0.29, p = 0.01) and thrombocyte count (r = -0.28, p = 0.02). COMP levels in the JIA patients correlated positively with growth velocity (cm/yr) (r = 0.38, p = 0.0003) and growth velocity...... (SDS) (r = 0.29, p = 0.007). CONCLUSION: We found reduced COMP levels in children with JIA compared with healthy children. COMP levels in JIA correlated negatively with inflammatory activity as evaluated by CRP and the thrombocyte counts, and were associated with reduced growth rate....

  17. Expression of extracellular matrix proteins: tenascin-C, fibronectin and galectin-3 in prostatic adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Monika Ulamec

    2015-12-01

    Full Text Available Introduction: The interchanged stromal-epithelial relations and altered expression profiles of various extracellular matrix (ECM proteins creates a suitable microenvironment for cancer development and growth. We support the opinion that remodeling of the extracellular matrix (ECM plays an important role in the cancer progression. The aim of this study was to examine the expression of ECM proteins tenascin-C, fibronectin and galectin-3 in prostatic adenocarcinoma. Methods: Glands and surrounding stroma were analyzed in randomly selected specimens from 52 patients with prostate cancer and 28 patients with benign prostatic hyperplasia (BHP. To evaluate the intensity of tenascin-C, fibronectin and galectin-3 expression the percentage of positively immunostained stromal cells was examined.Results: Compared to BPH, stroma of prostatic adenocarcinoma showed statistically significant increase in tenascin-C expression (p<0.001, predominantly around neoplastic glands, while fibronectin (p=0.001 and galectin-3 (p<0.001 expression in the same area was decreased.Conclusions: Our study confirms changes in the expression of ECM proteins of prostate cancer which may have important role in the cancer development.

  18. Myristoylation drives dimerization of matrix protein from mouse mammary tumor virus

    Czech Academy of Sciences Publication Activity Database

    Doležal, Michal; Zábranský, Aleš; Dostál, Jiří; Vaněk, O.; Brynda, Jiří; Lepšík, Martin; Hadravová, Romana; Pichová, Iva

    2016-01-01

    Roč. 13, Jan 5 (2016), č. článku 2. ISSN 1742-4690 R&D Projects: GA MŠk LO1302; GA MŠk(CZ) LO1304; GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : dimerization * matrix protein * MMTV * molecular dynamics * mouse mammary tumor virus * myristoylation Subject RIV: CE - Biochemistry Impact factor: 3.867, year: 2016 http://retrovirology.biomedcentral.com/articles/10.1186/s12977-015-0235-8

  19. Original research paper. Formulation and pharmaceutical development of quetiapine fumarate sustained release matrix tablets using a QbD approach.

    Science.gov (United States)

    Gavan, Alexandru; Porfire, Alina; Marina, Cristina; Tomuta, Ioan

    2017-03-01

    The main objective of the present study was to apply QbD methodology in the development of once-a-day sustained release quetiapine tablets. The quality target product profile (QTPP) was defined after the pharmaceutical properties and kinetic release of the innovator product, Seroquel XR 200 mg. For the D-optimal experimental design, the level and ratio of matrix forming agents and the type of extragranular diluent were chosen as independent inputs, which represented critical formulation factors. The critical quality attributes (CQAs) studied were the cumulative percentages of quetiapine released after certain time intervals. After the analysis of the experimental design, optimal formulas and the design space were defined. Optimal formulas demonstrated zero-order release kinetics and a dissolution profile similar to the innovator product, with f2 values of 74.53 and 83.74. It was concluded that the QbD approach allowed fast development of sustained release tablets with similar dissolution behavior as the innovator product.

  20. Simulation of Forest Environment as a Measure to sustain Protein ...

    African Journals Online (AJOL)

    Leaves from domesticated and wild Vegetables were harvested and protein, vitamin A (ß-carotene) and C content determined. It was observed that domestication and shade types under which of wild Vegetables were grown had effects on their nutritive values (the protein, vitamin A and C contents). Nevertheless, banana ...

  1. Dry fractionation for sustainable production of plant protein concentrates

    NARCIS (Netherlands)

    Pelgrom, P.J.M.

    2015-01-01

    The global demand for protein-rich foods is expected to double in the coming decades due to the increasing prosperity and world population. To keep up with the demand, the transition from an animal to a plant-based protein supply is desirable from long-term economic and environmental perspectives.

  2. HIV-1 matrix protein p17 and its variants promote human triple negative breast cancer cell aggressiveness.

    Science.gov (United States)

    Caccuri, Francesca; Giordano, Francesca; Barone, Ines; Mazzuca, Pietro; Giagulli, Cinzia; Andò, Sebastiano; Caruso, Arnaldo; Marsico, Stefania

    2017-01-01

    The introduction of cART has changed the morbidity and mortality patterns affecting HIV-infected (HIV + ) individuals. The risk of breast cancer in HIV + patients has now approached the general population risk. However, breast cancer has a more aggressive clinical course and poorer outcome in HIV + patients than in general population, without correlation with the CD4 or virus particles count. These findings suggest a likely influence of HIV-1 proteins on breast cancer aggressiveness and progression. The HIV-1 matrix protein (p17) is expressed in different tissues and organs of successfully cART-treated patients and promotes migration of different cells. Variants of p17 (vp17s), characterized by mutations and amino acid insertions, differently from the prototype p17 (refp17), also promote B-cell proliferation and transformation. Wound-healing assay, matrigel-based invasion assay, and anchorage-independent proliferation assay were employed to compare the biological activity exerted by refp17 and three different vp17s on the triple-negative human breast cancer cell line MDA-MB 231. Intracellular signaling was investigated by western blot analysis. Motility and invasiveness increased in cells treated with both refp17 and vp17s compared to untreated cells. The effects of the viral proteins were mediated by binding to the chemokine receptor CXCR2 and activation of the ERK1/2 signaling pathway. However, vp17s promoted MDA-MB 231 cell growth and proliferation in contrast to refp17-treated or not treated cells. In the context of the emerging role of the microenvironment in promoting and supporting cancer cell growth and metastatic spreading, here we provide the first evidence that exogenous p17 may play a crucial role in sustaining breast cancer cell migration and invasiveness, whereas some p17 variants may also be involved in cancer cell growth and proliferation.

  3. Contribution of matrix converter in microgeneration for a sustainable energy planning; Contribuicao do conversor matricial na microgeracao para um planejamento energetico sustentavel

    Energy Technology Data Exchange (ETDEWEB)

    Romero, Javier Alexis Andrade; Romero, Jesus Franklin Andrade [Universidade Federal do ABC (UFABC), Santo Andre, SP (Brazil). Programa de Pos-Graduacao em Energia], emails: javier.romero@ufabc.edu.br, jesus.romero@ufabc.edu.br

    2010-07-01

    Once microturbine (MT) based generation systems present suitable and short term application conditions in distributed generation, a rigorous sustainability evaluation is necessary. In this work a Two Stage Matrix Converter (CM2E) that improves the energy efficiency performance is evaluated. In this sense, an analysis based on technological indicators regarding a sustainable energy planning is presented in technological, economic, social and environmental dimensions (author)

  4. Admixtures in Cement-Matrix Composites for Mechanical Reinforcement, Sustainability, and Smart Features

    Science.gov (United States)

    Bastos, Guillermo; Patiño-Barbeito, Faustino; Patiño-Cambeiro, Faustino; Armesto, Julia

    2016-01-01

    For more than a century, several inclusions have been mixed with Portland cement—nowadays the most-consumed construction material worldwide—to improve both the strength and durability required for construction. The present paper describes the different families of inclusions that can be combined with cement matrix and reviews the achievements reported to date regarding mechanical performance, as well as two other innovative functionalities of growing importance: reducing the high carbon footprint of Portland cement, and obtaining new smart features. Nanomaterials stand out in the production of such advanced features, allowing the construction of smart or multi-functional structures by means of thermal- and strain-sensing, and photocatalytic properties. The first self-cleaning concretes (photocatalytic) have reached the markets. In this sense, it is expected that smart concretes will be commercialized to address specialized needs in construction and architecture. Conversely, other inclusions that enhance strength or reduce the environmental impact remain in the research stage, in spite of the promising results reported in these issues. Despite the fact that such functionalities are especially profitable in the case of massive cement consumption, the shift from the deeply established Portland cement to green cements still has to overcome economic, institutional, and technical barriers. PMID:28774091

  5. Spaceflight has compartment- and gene-specific effects on mRNA levels for bone matrix proteins in rat femur

    Science.gov (United States)

    Evans, G. L.; Morey-Holton, E.; Turner, R. T.

    1998-01-01

    In the present study, we evaluated the possibility that the abnormal bone matrix produced during spaceflight may be associated with reduced expression of bone matrix protein genes. To test this possibility, we investigated the effects of a 14-day spaceflight (SLS-2 experiment) on steady-state mRNA levels for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), osteocalcin, osteonectin, and prepro-alpha(1) subunit of type I collagen in the major bone compartments of rat femur. There were pronounced site-specific differences in the steady-state levels of expression of the mRNAs for the three bone matrix proteins and GAPDH in normal weight-bearing rats, and these relationships were altered after spaceflight. Specifically, spaceflight resulted in decreases in mRNA levels for GAPDH (decreased in proximal metaphysis), osteocalcin (decreased in proximal metaphysis), osteonectin (decreased in proximal and distal metaphysis), and collagen (decreased in proximal and distal metaphysis) compared with ground controls. There were no changes in mRNA levels for matrix proteins or GAPDH in the shaft and distal epiphysis. These results demonstrate that spaceflight leads to site- and gene-specific decreases in mRNA levels for bone matrix proteins. These findings are consistent with the hypothesis that spaceflight-induced decreases in bone formation are caused by concomitant decreases in expression of genes for bone matrix proteins.

  6. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2007-01-01

    Full Text Available Abstract Background Nipah virus (NiV is an emerging paramyxovirus distinguished by its ability to cause fatal disease in both animal and human hosts. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the Paramyxoviridae family. NiV and HeV are also restricted to Biosafety Level-4 containment and this has hampered progress towards examining details of their replication and morphogenesis. Here, we have established recombinant expression systems to study NiV particle assembly and budding through the formation of virus-like particles (VLPs. Results When expressed by recombinant Modified Vaccinia virus Ankara (rMVA or plasmid transfection, individual NiV matrix (M, fusion (F and attachment (G proteins were all released into culture supernatants in a membrane-associated state as determined by sucrose density gradient flotation and immunoprecipitation. However, co-expression of F and G along with M revealed a shift in their distribution across the gradient, indicating association with M in VLPs. Protein release was also altered depending on the context of viral proteins being expressed, with F, G and nucleocapsid (N protein reducing M release, and N release dependent on the co-expression of M. Immunoelectron microscopy and density analysis revealed VLPs that were similar to authentic virus. Differences in the budding dynamics of NiV proteins were also noted between rMVA and plasmid based strategies, suggesting that over-expression by poxvirus may not be appropriate for studying the details of recombinant virus particle assembly and release. Conclusion Taken together, the results indicate that NiV M, F, and G each possess some ability to bud from expressing cells, and that co-expression of these viral proteins results in a more organized budding process with M playing a central role. These findings will aid our understanding of paramyxovirus particle assembly in general and could help facilitate the development of a novel vaccine

  7. Secreted protein acidic and rich in cysteine is a matrix scavenger chaperone.

    Directory of Open Access Journals (Sweden)

    Alexandre Chlenski

    Full Text Available Secreted Protein Acidic and Rich in Cysteine (SPARC is one of the major non-structural proteins of the extracellular matrix (ECM in remodeling tissues. The functional significance of SPARC is emphasized by its origin in the first multicellular organisms and its high degree of evolutionary conservation. Although SPARC has been shown to act as a critical modulator of ECM remodeling with profound effects on tissue physiology and architecture, no plausible molecular mechanism of its action has been proposed. In the present study, we demonstrate that SPARC mediates the disassembly and degradation of ECM networks by functioning as a matricellular chaperone. While it has low affinity to its targets inside the cells where the Ca(2+ concentrations are low, high extracellular concentrations of Ca(2+ activate binding to multiple ECM proteins, including collagens. We demonstrated that in vitro, this leads to the inhibition of collagen I fibrillogenesis and disassembly of pre-formed collagen I fibrils by SPARC at high Ca(2+ concentrations. In cell culture, exogenous SPARC was internalized by the fibroblast cells in a time- and concentration-dependent manner. Pulse-chase assay further revealed that internalized SPARC is quickly released outside the cell, demonstrating that SPARC shuttles between the cell and ECM. Fluorescently labeled collagen I, fibronectin, vitronectin, and laminin were co-internalized with SPARC by fibroblasts, and semi-quantitative Western blot showed that SPARC mediates internalization of collagen I. Using a novel 3-dimensional model of fluorescent ECM networks pre-deposited by live fibroblasts, we demonstrated that degradation of ECM depends on the chaperone activity of SPARC. These results indicate that SPARC may represent a new class of scavenger chaperones, which mediate ECM degradation, remodeling and repair by disassembling ECM networks and shuttling ECM proteins into the cell. Further understanding of this mechanism may provide

  8. Processing of the glycosomal matrix-protein import receptor PEX5 of Trypanosoma brucei

    International Nuclear Information System (INIS)

    Gualdrón-López, Melisa; Michels, Paul A.M.

    2013-01-01

    Highlights: ► Most eukaryotic cells have a single gene for the peroxin PEX5. ► PEX5 is sensitive to in vitro proteolysis in distantly related organisms. ► TbPEX5 undergoes N-terminal truncation in vitro and possibly in vivo. ► Truncated TbPEX5 is still capable of binding PTS1-containing proteins. ► PEX5 truncation is physiologically relevant or an evolutionary conserved artifact. -- Abstract: Glycolysis in kinetoplastid protists such as Trypanosoma brucei is compartmentalized in peroxisome-like organelles called glycosomes. Glycosomal matrix-protein import involves a cytosolic receptor, PEX5, which recognizes the peroxisomal-targeting signal type 1 (PTS1) present at the C-terminus of the majority of matrix proteins. PEX5 appears generally susceptible to in vitro proteolytic processing. On western blots of T. brucei, two PEX5 forms are detected with apparent M r of 100 kDa and 72 kDa. 5′-RACE-PCR showed that TbPEX5 is encoded by a unique transcript that can be translated into a protein of maximally 72 kDa. However, recombinant PEX5 migrates aberrantly in SDS–PAGE with an apparent M r of 100 kDa, similarly as observed for the native peroxin. In vitro protease susceptibility analysis of native and 35 S-labelled PEX5 showed truncation of the 100 kDa form at the N-terminal side by unknown parasite proteases, giving rise to the 72 kDa form which remains functional for PTS1 binding. The relevance of these observations is discussed

  9. Abnormal recruitment of extracellular matrix proteins by excess Notch3 ECD: a new pathomechanism in CADASIL.

    Science.gov (United States)

    Monet-Leprêtre, Marie; Haddad, Iman; Baron-Menguy, Céline; Fouillot-Panchal, Maï; Riani, Meriem; Domenga-Denier, Valérie; Dussaule, Claire; Cognat, Emmanuel; Vinh, Joelle; Joutel, Anne

    2013-06-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, one of the most common inherited small vessel diseases of the brain, is characterized by a progressive loss of vascular smooth muscle cells and extracellular matrix accumulation. The disease is caused by highly stereotyped mutations within the extracellular domain of the NOTCH3 receptor (Notch3(ECD)) that result in an odd number of cysteine residues. While CADASIL-associated NOTCH3 mutations differentially affect NOTCH3 receptor function and activity, they all are associated with early accumulation of Notch3(ECD)-containing aggregates in small vessels. We still lack mechanistic explanation to link NOTCH3 mutations with small vessel pathology. Herein, we hypothesized that excess Notch3(ECD) could recruit and sequester functionally important proteins within small vessels of the brain. We performed biochemical, nano-liquid chromatography-tandem mass spectrometry and immunohistochemical analyses, using cerebral and arterial tissue derived from patients with CADASIL and mouse models of CADASIL that exhibit vascular lesions in the end- and early-stage of the disease, respectively. Biochemical fractionation of brain and artery samples demonstrated that mutant Notch3(ECD) accumulates in disulphide cross-linked detergent-insoluble aggregates in mice and patients with CADASIL. Further proteomic and immunohistochemical analyses identified two functionally important extracellular matrix proteins, tissue inhibitor of metalloproteinases 3 (TIMP3) and vitronectin (VTN) that are sequestered into Notch3(ECD)-containing aggregates. Using cultured cells, we show that increased levels or aggregation of Notch3 enhances the formation of Notch3(ECD)-TIMP3 complex, promoting TIMP3 recruitment and accumulation. In turn, TIMP3 promotes complex formation including NOTCH3 and VTN. In vivo, brain vessels from mice and patients with CADASIL exhibit elevated levels of both insoluble cross

  10. Nuclear localization and secretion competence are conserved among henipavirus matrix proteins.

    Science.gov (United States)

    McLinton, Elisabeth C; Wagstaff, Kylie M; Lee, Alexander; Moseley, Gregory W; Marsh, Glenn A; Wang, Lin-Fa; Jans, David A; Lieu, Kim G; Netter, Hans J

    2017-04-01

    Viruses of the genus Henipavirus of the family Paramyxoviridae are zoonotic pathogens, which have emerged in Southeast Asia, Australia and Africa. Nipah virus (NiV) and Hendra virus are highly virulent pathogens transmitted from bats to animals and humans, while the henipavirus Cedar virus seems to be non-pathogenic in infection studies. The full replication cycle of the Paramyxoviridae occurs in the host cell's cytoplasm, where viral assembly is orchestrated by the matrix (M) protein. Unexpectedly, the NiV-M protein traffics through the nucleus as an essential step to engage the plasma membrane in preparation for viral budding/release. Comparative studies were performed to assess whether M protein nuclear localization is a common feature of the henipaviruses, including the recently sequenced (although not yet isolated) Ghanaian bat henipavirus (Kumasi virus, GH-M74a virus) and Mojiang virus. Live-cell confocal microscopy revealed that nuclear translocation of GFP-fused M protein is conserved between henipaviruses in both human- and bat-derived cell lines. However, the efficiency of M protein nuclear localization and virus-like particle budding competency varied. Additionally, Cedar virus-, Kumasi virus- and Mojiang virus-M proteins were mutated in a bipartite nuclear localization signal, indicating that a key lysine residue is essential for nuclear import, export and induction of budding events, as previously reported for NiV-M. The results of this study suggest that the M proteins of henipaviruses may utilize a similar nucleocytoplasmic trafficking pathway as an essential step during viral replication in both humans and bats.

  11. Effects of extracellular matrix proteins on the growth of haematopoietic progenitor cells

    Energy Technology Data Exchange (ETDEWEB)

    Celebi, Betuel; Pineault, Nicolas [Hema-Quebec, Research and Development Department, Quebec City, G1V 5C3, PQ (Canada); Mantovani, Diego, E-mail: nicolas.pineault@hema-quebec.qc.ca [Laboratory for Biomaterials and Bioengineering, Department of Materials Engineering and University Hospital Research Center, Laval University, Quebec City, G1V 0A6, PQ (Canada)

    2011-10-15

    Umbilical cord blood (UCB) transplantation and haematological recovery are currently limited by the amount of haematopoietic progenitor cells (HPCs) present in each unit. HPCs and haematopoietic stem cells (HSCs) normally interact with cells and extracellular matrix (ECM) proteins present within the endosteal and vascular niches. Hence, we investigated whether coating of culture surfaces with ECM proteins normally present in the marrow microenvironment could benefit the ex vivo expansion of HPCs. Towards this, collagen types I and IV (COL I and IV), laminin (LN) and fibronectin (FN) were tested individually or as component of two ECM-mix complexes. Individually, ECM proteins had both common and unique properties on the growth and differentiation of UCB CD34+ cells; some ECM proteins favoured the differentiation of some lineages over that of others (e.g. FN for erythroids), some the expansion of HPCs (e.g. LN and megakaryocyte (MK) progenitor) while others had less effects. Next, two ECM-mix complexes were tested; the first one contained all four ECM proteins (4ECMp), while the second 'basement membrane-like structure' was without COL I (3ECMp). Removal of COL I led to strong reductions in cell growth and HPCs expansion. Interestingly, the 4ECMp-mix complex reproducibly increased CD34+ (1.3-fold) and CD41+ (1.2-fold) cell expansions at day 6 (P < 0.05) versus control, and induced greater myeloid progenitor expansion (P < 0.05) than 3ECMp. In conclusion, these results suggest that optimization of BM ECM protein complexes could provide a better environment for the ex vivo expansion of haematopoietic progenitors than individual ECM protein.

  12. Effects of extracellular matrix proteins on the growth of haematopoietic progenitor cells

    International Nuclear Information System (INIS)

    Celebi, Betuel; Pineault, Nicolas; Mantovani, Diego

    2011-01-01

    Umbilical cord blood (UCB) transplantation and haematological recovery are currently limited by the amount of haematopoietic progenitor cells (HPCs) present in each unit. HPCs and haematopoietic stem cells (HSCs) normally interact with cells and extracellular matrix (ECM) proteins present within the endosteal and vascular niches. Hence, we investigated whether coating of culture surfaces with ECM proteins normally present in the marrow microenvironment could benefit the ex vivo expansion of HPCs. Towards this, collagen types I and IV (COL I and IV), laminin (LN) and fibronectin (FN) were tested individually or as component of two ECM-mix complexes. Individually, ECM proteins had both common and unique properties on the growth and differentiation of UCB CD34+ cells; some ECM proteins favoured the differentiation of some lineages over that of others (e.g. FN for erythroids), some the expansion of HPCs (e.g. LN and megakaryocyte (MK) progenitor) while others had less effects. Next, two ECM-mix complexes were tested; the first one contained all four ECM proteins (4ECMp), while the second 'basement membrane-like structure' was without COL I (3ECMp). Removal of COL I led to strong reductions in cell growth and HPCs expansion. Interestingly, the 4ECMp-mix complex reproducibly increased CD34+ (1.3-fold) and CD41+ (1.2-fold) cell expansions at day 6 (P < 0.05) versus control, and induced greater myeloid progenitor expansion (P < 0.05) than 3ECMp. In conclusion, these results suggest that optimization of BM ECM protein complexes could provide a better environment for the ex vivo expansion of haematopoietic progenitors than individual ECM protein.

  13. Periostin is an extracellular matrix protein required for eruption of incisors in mice

    International Nuclear Information System (INIS)

    Kii, Isao; Amizuka, Norio; Minqi, Li; Kitajima, Satoshi; Saga, Yumiko; Kudo, Akira

    2006-01-01

    A characteristic tooth of rodents, the incisor continuously grows throughout life by the constant formation of dentin and enamel. Continuous eruption of the incisor is accompanied with formation of shear zone, in which the periodontal ligament is remodeled. Although the shear zone plays a role in the remodeling, its molecular biological aspect is barely understood. Here, we show that periostin is essential for formation of the shear zone. Periostin -/- mice showed an eruption disturbance of incisors. Histological observation revealed that deletion of periostin led to disappearance of the shear zone. Electron microscopy revealed that the disappearance of the shear zone resulted from a failure in digestion of collagen fibers in the periostin -/- mice. Furthermore, immunohistochemical analysis using anti-periostin antibodies demonstrated the restricted localization of periostin protein in the shear zone. Periostin is an extracellular matrix protein, and immunoelectron microscopy showed a close association of periostin with collagen fibrils in vivo. These results suggest that periostin functions in the remodeling of collagen matrix in the shear zone

  14. New low-flux mixed matrix membranes that offer superior removal of protein-bound toxins from human plasma

    Science.gov (United States)

    Pavlenko, Denys; van Geffen, Esmée; van Steenbergen, Mies J.; Glorieux, Griet; Vanholder, Raymond; Gerritsen, Karin G. F.; Stamatialis, Dimitrios

    2016-10-01

    Hemodialysis is a widely available and well-established treatment for patients with End Stage Renal Disease (ESRD). However, although life-sustaining, patient mortality rates are very high. Several recent studies corroborated the link between dialysis patients’ outcomes and elevated levels of protein-bound uremic toxins (PBUT) that are poorly removed by conventional hemodialysis. Therefore, new treatments are needed to improve their removal. Recently, our group showed that the combination of dialysis and adsorption on one membrane, the mixed matrix membrane (MMM), can effectively remove those toxins from human plasma. However, these first MMMs were rather large in diameter and their mass transport characteristics needed improvement before application in the clinical setting. Therefore, in this study we developed a new generation of MMMs that have a smaller diameter and optimized characteristics offering superior ability in removing the PBUT indoxyl sulfate (IS) and p-cresyl sulfate (pCS) in comparison to first generation MMMs (30 and 125% respectively), as well as, a commercial dialysis membrane (more than 100% better removal).

  15. In vitro evaluation of the interactions between human corneal endothelial cells and extracellular matrix proteins

    International Nuclear Information System (INIS)

    Choi, Jin San; Kim, Eun Young; Kim, Min Jeong; Giegengack, Matthew; Khan, Faraaz A; Soker, Shay; Khang, Gilson

    2013-01-01

    The corneal endothelium is the innermost cell layer of the cornea and rests on Descemet's membrane consisting of various extracellular matrix (ECM) proteins which can directly affect the cellular behaviors such as cell adhesion, proliferation, polarity, morphogenesis and function. The objective of this study was to investigate the interactions between the ECM environment and human corneal endothelial cells (HCECs), with the ultimate goal to improve cell proliferation and function in vitro. To evaluate the interaction of HCECs with ECM proteins, cells were seeded on ECM-coated tissue culture dishes, including collagen type I (COL I), collagen type IV (COL IV), fibronectin (FN), FNC coating mix (FNC) and laminin (LM). Cell adhesion and proliferation of HCECs on each substratum and expression of CEC markers were studied. The results showed that HCECs plated on the COL I, COL IV, FN and FNC-coated plates had enhanced cell adhesion initially; the number for COL I, COL IV, FN and FNC was significantly higher than the control (P < 0.05). In addition, cells grown on ECM protein-coated dishes showed more compact cellular morphology and CEC marker expression compared to cells seeded on uncoated dishes. Collectively, our results suggest that an adequate ECM protein combination can provide a long-term culture environment for HCECs for corneal endothelium transplantation. (paper)

  16. Self-reinforcement and protein sustained delivery of hyaluronan hydrogel by tailoring a dually cross-linked network

    International Nuclear Information System (INIS)

    Luo, Chunhong; Xu, Guoguang; Wang, Xinghui; Tu, Mei; Zeng, Rong; Rong, Jianhua; Zhao, Jianhao

    2015-01-01

    A series of self-reinforcing hyaluronan hydrogels were developed to improve mechanical properties and protein sustained delivery thanks to a dually cross-linked network. Hyaluronan gel particles (HGPs, 1–5 μm in diameter) with different cross-linking densities, i.e. HGPs-1.5, HGPs-3 and HGPs-15, were prepared in an inverse emulsion system and used as the reinforcing phase after glycidyl methacrylation, while glycidyl methacrylated hyaluronan with a substitution degree of 45.2% was synthesized as the matrix phase. These two phases were cross-linked under ultraviolet irradiation to form self-reinforcing hyaluronan hydrogels (srHAs) that showed typical cross-linked structure of HGPs connecting the matrix phase by cross-section observation. In comparison to hyaluronan bulk gels and their blends with HGPs, srHAs distinctly enhanced the mechanical properties and BSA long-term sustained delivery, especially srHA-1.5 showed the highest compressive modulus of 220 ± 15 kPa and the slowest BSA delivery (67% release at 14 d). The 3T3 fibroblast cell culture showed that all the srHAs had no cytotoxicity. - Highlights: • New self-reinforcing HA hydrogels with a dually cross-linked network were developed. • Self-reinforcing HA hydrogels greatly enhanced the mechanical properties. • Self-reinforcing HA hydrogels prolonged the sustained delivery of BSA. • The self-reinforcing mechanism and BSA diffusion mechanism were discussed. • Self-reinforcing HA hydrogels had no cytotoxicity to 3T3 fibroblast cells

  17. Self-reinforcement and protein sustained delivery of hyaluronan hydrogel by tailoring a dually cross-linked network

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Chunhong; Xu, Guoguang; Wang, Xinghui [Department of Materials Science and Engineering, College of Science and Engineering, Jinan University, Guangzhou 510632 (China); Tu, Mei; Zeng, Rong; Rong, Jianhua [Department of Materials Science and Engineering, College of Science and Engineering, Jinan University, Guangzhou 510632 (China); Engineering Research Center of Artificial Organs and Materials, Ministry of Education, Guangzhou 510632 (China); Zhao, Jianhao, E-mail: jhzhao@jnu.edu.cn [Department of Materials Science and Engineering, College of Science and Engineering, Jinan University, Guangzhou 510632 (China); Engineering Research Center of Artificial Organs and Materials, Ministry of Education, Guangzhou 510632 (China)

    2015-01-01

    A series of self-reinforcing hyaluronan hydrogels were developed to improve mechanical properties and protein sustained delivery thanks to a dually cross-linked network. Hyaluronan gel particles (HGPs, 1–5 μm in diameter) with different cross-linking densities, i.e. HGPs-1.5, HGPs-3 and HGPs-15, were prepared in an inverse emulsion system and used as the reinforcing phase after glycidyl methacrylation, while glycidyl methacrylated hyaluronan with a substitution degree of 45.2% was synthesized as the matrix phase. These two phases were cross-linked under ultraviolet irradiation to form self-reinforcing hyaluronan hydrogels (srHAs) that showed typical cross-linked structure of HGPs connecting the matrix phase by cross-section observation. In comparison to hyaluronan bulk gels and their blends with HGPs, srHAs distinctly enhanced the mechanical properties and BSA long-term sustained delivery, especially srHA-1.5 showed the highest compressive modulus of 220 ± 15 kPa and the slowest BSA delivery (67% release at 14 d). The 3T3 fibroblast cell culture showed that all the srHAs had no cytotoxicity. - Highlights: • New self-reinforcing HA hydrogels with a dually cross-linked network were developed. • Self-reinforcing HA hydrogels greatly enhanced the mechanical properties. • Self-reinforcing HA hydrogels prolonged the sustained delivery of BSA. • The self-reinforcing mechanism and BSA diffusion mechanism were discussed. • Self-reinforcing HA hydrogels had no cytotoxicity to 3T3 fibroblast cells.

  18. The human metapneumovirus matrix protein stimulates the inflammatory immune response in vitro.

    Directory of Open Access Journals (Sweden)

    Audrey Bagnaud-Baule

    Full Text Available Each year, during winter months, human Metapneumovirus (hMPV is associated with epidemics of bronchiolitis resulting in the hospitalization of many infants. Bronchiolitis is an acute illness of the lower respiratory tract with a consequent inflammation of the bronchioles. The rapid onset of inflammation suggests the innate immune response may have a role to play in the pathogenesis of this hMPV infection. Since, the matrix protein is one of the most abundant proteins in the Paramyxoviridae family virion, we hypothesized that the inflammatory modulation observed in hMPV infected patients may be partly associated with the matrix protein (M-hMPV response. By western blot analysis, we detected a soluble form of M-hMPV released from hMPV infected cell as well as from M-hMPV transfected HEK 293T cells suggesting that M-hMPV may be directly in contact with antigen presenting cells (APCs during the course of infection. Moreover, flow cytometry and confocal microscopy allowed determining that M-hMPV was taken up by dendritic cells (moDCs and macrophages inducing their activation. Furthermore, these moDCs enter into a maturation process inducing the secretion of a broad range of inflammatory cytokines when exposed to M-hMPV. Additionally, M-hMPV activated DCs were shown to stimulate IL-2 and IFN-γ production by allogeneic T lymphocytes. This M-hMPV-mediated activation and antigen presentation of APCs may in part explain the marked inflammatory immune response observed in pathology induced by hMPV in patients.

  19. RAGE-mediated extracellular matrix proteins accumulation exacerbates HySu-induced pulmonary hypertension.

    Science.gov (United States)

    Jia, Daile; He, Yuhu; Zhu, Qian; Liu, Huan; Zuo, Caojian; Chen, Guilin; Yu, Ying; Lu, Ankang

    2017-05-01

    Extracellular matrix (ECM) proteins accumulation contributes to the progression of pulmonary arterial hypertension (PAH), a rare and fatal cardiovascular condition defined by high pulmonary arterial pressure, whether primary, idiopathic, or secondary to other causes. The receptor for advanced glycation end products (RAGE) is constitutively expressed in the lungs and plays an important role in ECM deposition. Nonetheless, the mechanisms by which RAGE mediates ECM deposition/formation in pulmonary arteries and its roles in PAH progression remain unclear. Expression of RAGE and its activating ligands, S100/calgranulins and high mobility group box 1 (HMGB1), were increased in both human and mouse pulmonary arterial smooth muscle cells (PASMCs) under hypoxic conditions and were also strikingly upregulated in pulmonary arteries in hypoxia plus SU5416 (HySu)-induced PAH in mice. RAGE deletion alleviated pulmonary arterial pressure and restrained extracellular matrix accumulation in pulmonary arteries in HySu-induced PAH murine model. Moreover, blocking RAGE activity with a neutralizing antibody in human PASMCs, or RAGE deficiency in mouse PASMCs exposed to hypoxia, suppressed the expression of fibrotic proteins by reducing TGF-β1 expression. RAGE reconstitution in deficient mouse PASMCs restored hypoxia-stimulated TGF-β1 production via ERK1/2 and p38 MAPK pathway activation and subsequently increased ECM protein expression. Interestingly, HMGB1 acting on RAGE, not toll-like receptor 4 (TLR4), induced ECM deposition in PASMCs. Finally, in both idiopathic PAH patients and HySu-induced PAH mice, soluble RAGE (sRAGE) levels in serum were significantly elevated compared to those in controls. Activation of RAGE facilitates the development of hypoxia-induced pulmonary hypertension by increase of ECM deposition in pulmonary arteries. Our results indicate that sRAGE may be a potential biomarker for PAH diagnosis and disease severity, and that RAGE may be a promising target for

  20. Economic approach to environmental sustainability of protein foods

    NARCIS (Netherlands)

    Zhu, X.; Ierland, van E.C.

    2006-01-01

    Intensive animal production systems in Europe, particularly in the Netherlands result in a series of environmental problems mainly due to manure surplus. This study aims to make contributions to identifying the solutions to the problems related to protein production and consumption. The first

  1. Evidence for ubiquitin-regulated nuclear and subnuclear trafficking among Paramyxovirinae matrix proteins.

    Directory of Open Access Journals (Sweden)

    Mickey Pentecost

    2015-03-01

    Full Text Available The paramyxovirus matrix (M protein is a molecular scaffold required for viral morphogenesis and budding at the plasma membrane. Transient nuclear residence of some M proteins hints at non-structural roles. However, little is known regarding the mechanisms that regulate the nuclear sojourn. Previously, we found that the nuclear-cytoplasmic trafficking of Nipah virus M (NiV-M is a prerequisite for budding, and is regulated by a bipartite nuclear localization signal (NLSbp, a leucine-rich nuclear export signal (NES, and monoubiquitination of the K258 residue within the NLSbp itself (NLSbp-lysine. To define whether the sequence determinants of nuclear trafficking identified in NiV-M are common among other Paramyxovirinae M proteins, we generated the homologous NES and NLSbp-lysine mutations in M proteins from the five major Paramyxovirinae genera. Using quantitative 3D confocal microscopy, we determined that the NES and NLSbp-lysine are required for the efficient nuclear export of the M proteins of Nipah virus, Hendra virus, Sendai virus, and Mumps virus. Pharmacological depletion of free ubiquitin or mutation of the conserved NLSbp-lysine to an arginine, which inhibits M ubiquitination, also results in nuclear and nucleolar retention of these M proteins. Recombinant Sendai virus (rSeV-eGFP bearing the NES or NLSbp-lysine M mutants rescued at similar efficiencies to wild type. However, foci of cells expressing the M mutants displayed marked fusogenicity in contrast to wild type, and infection did not spread. Recombinant Mumps virus (rMuV-eGFP bearing the homologous mutations showed similar defects in viral morphogenesis. Finally, shotgun proteomics experiments indicated that the interactomes of Paramyxovirinae M proteins are significantly enriched for components of the nuclear pore complex, nuclear transport receptors, and nucleolar proteins. We then synthesize our functional and proteomics data to propose a working model for the ubiquitin

  2. The methylotrophic yeast Hansenula polymorpha contains an inducible import pathway for peroxisomal matrix proteins with an N-terminal targeting signal (PTS2 proteins)

    NARCIS (Netherlands)

    Faber, Klaas Nico; Haima, Pieter; Gietl, Christine; Harder, Willem; Ab, Geert; Veenhuis, Marten

    1994-01-01

    Two main types of peroxisomal targeting signals have been identified that reside either at the extreme C terminus (PTS1) or the N terminus (PTS2) of the protein. In the methylotrophic yeast Hansenula polymorpha the majority of peroxisomal matrix proteins are of the PTS1 type. Thus far, for H.

  3. A Novel Acidic Matrix Protein, PfN44, Stabilizes Magnesium Calcite to Inhibit the Crystallization of Aragonite*

    Science.gov (United States)

    Pan, Cong; Fang, Dong; Xu, Guangrui; Liang, Jian; Zhang, Guiyou; Wang, Hongzhong; Xie, Liping; Zhang, Rongqing

    2014-01-01

    Magnesium is widely used to control calcium carbonate deposition in the shell of pearl oysters. Matrix proteins in the shell are responsible for nucleation and growth of calcium carbonate crystals. However, there is no direct evidence supporting a connection between matrix proteins and magnesium. Here, we identified a novel acidic matrix protein named PfN44 that affected aragonite formation in the shell of the pearl oyster Pinctada fucata. Using immunogold labeling assays, we found PfN44 in both the nacreous and prismatic layers. In shell repair, PfN44 was repressed, whereas other matrix proteins were up-regulated. Disturbing the function of PfN44 by RNAi led to the deposition of porous nacreous tablets with overgrowth of crystals in the nacreous layer. By in vitro circular dichroism spectra and fluorescence quenching, we found that PfN44 bound to both calcium and magnesium with a stronger affinity for magnesium. During in vitro calcium carbonate crystallization and calcification of amorphous calcium carbonate, PfN44 regulated the magnesium content of crystalline carbonate polymorphs and stabilized magnesium calcite to inhibit aragonite deposition. Taken together, our results suggested that by stabilizing magnesium calcite to inhibit aragonite deposition, PfN44 participated in P. fucata shell formation. These observations extend our understanding of the connections between matrix proteins and magnesium. PMID:24302723

  4. Protein functional properties prediction in sparsely-label PPI networks through regularized non-negative matrix factorization.

    Science.gov (United States)

    Wu, Qingyao; Wang, Zhenyu; Li, Chunshan; Ye, Yunming; Li, Yueping; Sun, Ning

    2015-01-01

    Predicting functional properties of proteins in protein-protein interaction (PPI) networks presents a challenging problem and has important implication in computational biology. Collective classification (CC) that utilizes both attribute features and relational information to jointly classify related proteins in PPI networks has been shown to be a powerful computational method for this problem setting. Enabling CC usually increases accuracy when given a fully-labeled PPI network with a large amount of labeled data. However, such labels can be difficult to obtain in many real-world PPI networks in which there are usually only a limited number of labeled proteins and there are a large amount of unlabeled proteins. In this case, most of the unlabeled proteins may not connected to the labeled ones, the supervision knowledge cannot be obtained effectively from local network connections. As a consequence, learning a CC model in sparsely-labeled PPI networks can lead to poor performance. We investigate a latent graph approach for finding an integration latent graph by exploiting various latent linkages and judiciously integrate the investigated linkages to link (separate) the proteins with similar (different) functions. We develop a regularized non-negative matrix factorization (RNMF) algorithm for CC to make protein functional properties prediction by utilizing various data sources that are available in this problem setting, including attribute features, latent graph, and unlabeled data information. In RNMF, a label matrix factorization term and a network regularization term are incorporated into the non-negative matrix factorization (NMF) objective function to seek a matrix factorization that respects the network structure and label information for classification prediction. Experimental results on KDD Cup tasks predicting the localization and functions of proteins to yeast genes demonstrate the effectiveness of the proposed RNMF method for predicting the protein

  5. Nell1-deficient mice have reduced expression of extracellular matrix proteins causing cranial and vertebral defects

    Energy Technology Data Exchange (ETDEWEB)

    Desai, Jayashree [University of Tennessee, Knoxville (UTK) & Oak Ridge National Laboratory (ORNL); Shannon, Mark E. [Applied Biosystems; Johnson, Mahlon D. [University of Tennessee Graduate School of Medicine; Ruff, David W. [Applied Biosystems; Hughes, Lori A [ORNL; Kerley, Marilyn K [ORNL; Carpenter, D A [ORNL; Johnson, Dabney K [ORNL; Rinchik, Eugene M. [University of Tennessee, Knoxville (UTK) & Oak Ridge National Laboratory (ORNL); Culiat, Cymbeline T [ORNL

    2006-01-01

    The mammalian Nell1 gene encodes a protein kinase C-b1 (PKC-b1) binding protein that belongs to a new class of cell-signaling molecules controlling cell growth and differentiation. Over-expression of Nell1 in the developing cranial sutures in both human and mouse induces craniosynostosis, the premature fusion of the growing cranial bone fronts. Here, we report the generation, positional cloning and characterization of Nell16R, a recessive, neonatal-lethal point mutation in the mouse Nell1 gene, induced by N-ethyl-N-nitrosourea. Nell16R has a T!A base change that converts a codon for cysteine into a premature stop codon [Cys(502)Ter], resulting in severe truncation of the predicted protein product and marked reduction in steady-state levels of the transcript. In addition to the expected alteration of cranial morphology, Nell16R mutants manifest skeletal defects in the vertebral column and ribcage, revealing a hitherto undefined role for Nell1 in signal transduction in endochondral ossification. Real-time quantitative reverse transcription-PCR assays of 219 genes showed an association between the loss of Nell1 function and reduced expression of genes for extracellular matrix (ECM) proteins critical for chondrogenesis and osteogenesis. Several affected genes are involved in the human cartilage disorder Ehlers-Danlos Syndrome and other disorders associated with spinal curvature anomalies. Nell16R mutant mice are a new tool for elucidating basic mechanisms in osteoblast and chrondrocyte differentiation in the developing skull and vertebral column and understanding how perturbations in the production of ECM proteins can lead to anomalies in these structures.

  6. Novel serological neo-epitope markers of extracellular matrix proteins for the detection of portal hypertension.

    Science.gov (United States)

    Leeming, D J; Karsdal, M A; Byrjalsen, I; Bendtsen, F; Trebicka, J; Nielsen, M J; Christiansen, C; Møller, S; Krag, A

    2013-11-01

    The hepatic venous pressure gradient (HVPG) is an invasive, but important diagnostic and prognostic marker in cirrhosis with portal hypertension (PHT). During cirrhosis, remodelling of fibrotic tissue by matrix metalloproteinases (MMPs) is a permanent process generating small fragments of degraded extracellular matrix (ECM) proteins known as neoepitopes, which are then released into the circulation. To investigate their potential as plasma markers for detection of PHT. Ninety-four patients with alcoholic cirrhosis and 20 liver-healthy controls were included. Clinical and laboratory data of the patients were collected. All patients received HVPG measurement with blood sampling. In these samples, the following degradation or formation markers were measured: C1M (type I-collagen), C3M and PRO-C3 (type III collagen), C4M and P4NP 7S (type IV collagen), C5M (type V collagen), C6M (type VI collagen), BGM (biglycan), ELM (elastin), CRPM (CRP). All ECM markers except for CRPM correlated significantly with HVPG. Interestingly, C4M, C5M and ELM levels were significantly higher in patients with HVPG >10 mmHg. Multiple regression analysis identified PRO-C3, C6M and ELM as significant determinants, while the models A and B including PRO-C3, ELM, C6M and model for end-stage liver disease (MELD) provided better description of PHT (r = 0.75, P models provided odds ratios of >100 for having clinical significant PHT. These novel non-invasive extracellular matrix markers reflect the degree of liver dysfunction. The different degrees of portal hypertension correlated with these circulating neoepitopes. Using a single blood sample, these neoepitopes in combination with MELD detect the level of portal hypertension. © 2013 The Authors. Alimentary Pharmacology and Therapeutics published by John Wiley & Sons Ltd.

  7. Role of the Vibrio cholerae matrix protein Bap1 in cross-resistance to antimicrobial peptides.

    Directory of Open Access Journals (Sweden)

    Marylise Duperthuy

    Full Text Available Outer membrane vesicles (OMVs that are released from Gram-negative pathogenic bacteria can serve as vehicles for the translocation of effectors involved in infectious processes. In this study we have investigated the role of OMVs of the Vibrio cholerae O1 El Tor A1552 strain in resistance to antimicrobial peptides (AMPs. To assess this potential role, we grew V. cholerae with sub-lethal concentrations of Polymyxin B (PmB or the AMP LL-37 and analyzed the OMVs produced and their effects on AMP resistance. Our results show that growing V. cholerae in the presence of AMPs modifies the protein content of the OMVs. In the presence of PmB, bacteria release OMVs that are larger in size and contain a biofilm-associated extracellular matrix protein (Bap1. We demonstrated that Bap1 binds to the OmpT porin on the OMVs through the LDV domain of OmpT. In addition, OMVs from cultures incubated in presence of PmB also provide better protection for V. cholerae against LL-37 compared to OMVs from V. cholerae cultures grown without AMPs or in presence of LL-37. Using a bap1 mutant we showed that cross-resistance between PmB and LL-37 involved the Bap1 protein, whereby Bap1 on OMVs traps LL-37 with no subsequent degradation of the AMP.

  8. The influenza A virus matrix protein as a marker to monitor initial virus internalisation.

    Science.gov (United States)

    Eierhoff, Thorsten; Ludwig, Stephan; Ehrhardt, Christina

    2009-01-01

    The uptake of influenza A viruses (IAV) into cells represents an attractive antiviral drug target, e.g., by interfering with essential cellular or viral entry factors. So far, this process could only be studied by time-consuming microscopical methods. Thus, there is a lack of rapid and easy assay systems to monitor viral entry. Here, we describe a rapid procedure to analyse internalisation of IAV via Western blot detection of virion-associated matrix protein (M1), the most abundant protein within the viral particle. The assay is broadly applicable and detects different virus strains of various subtypes. As a proof of principle, treatment of cells with various known or presumed entry inhibitors resulted in reduced M1 levels. Removal of sialic acids, the receptors for IAV, led to a complete loss of the M1 signal, indicating that virus internalisation can be monitored already at the stage of attachment. Prevention of endosomal acidification resulted in a delayed degradation of M1 indicative of IAV particles trapped in endosomes. Thus, early detection of the virus-associated M1 protein is a rapid method to monitor different steps of influenza virus internalisation and has potential for application as a screening method for drugs that interfere with the uptake of IAV.

  9. The YPLGVG sequence of the Nipah virus matrix protein is required for budding

    Directory of Open Access Journals (Sweden)

    Yan Lianying

    2008-11-01

    Full Text Available Abstract Background Nipah virus (NiV is a recently emerged paramyxovirus capable of causing fatal disease in a broad range of mammalian hosts, including humans. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the family Paramyxoviridae. Recombinant expression systems have played a crucial role in studying the cell biology of these Biosafety Level-4 restricted viruses. Henipavirus assembly and budding occurs at the plasma membrane, although the details of this process remain poorly understood. Multivesicular body (MVB proteins have been found to play a role in the budding of several enveloped viruses, including some paramyxoviruses, and the recruitment of MVB proteins by viral proteins possessing late budding domains (L-domains has become an important concept in the viral budding process. Previously we developed a system for producing NiV virus-like particles (VLPs and demonstrated that the matrix (M protein possessed an intrinsic budding ability and played a major role in assembly. Here, we have used this system to further explore the budding process by analyzing elements within the M protein that are critical for particle release. Results Using rationally targeted site-directed mutagenesis we show that a NiV M sequence YPLGVG is required for M budding and that mutation or deletion of the sequence abrogates budding ability. Replacement of the native and overlapping Ebola VP40 L-domains with the NiV sequence failed to rescue VP40 budding; however, it did induce the cellular morphology of extensive filamentous projection consistent with wild-type VP40-expressing cells. Cells expressing wild-type NiV M also displayed this morphology, which was dependent on the YPLGVG sequence, and deletion of the sequence also resulted in nuclear localization of M. Dominant-negative VPS4 proteins had no effect on NiV M budding, suggesting that unlike other viruses such as Ebola, NiV M accomplishes budding independent of MVB cellular proteins

  10. Regulatory roles of microtubule-associated proteins in neuronal morphogenesis. Involvement of the extracellular matrix

    Directory of Open Access Journals (Sweden)

    Ramírez G.

    1999-01-01

    Full Text Available As a result of recent investigations, the cytoskeleton can be viewed as a cytoplasmic system of interconnected filaments with three major integrative levels: self-assembling macromolecules, filamentous polymers, e.g., microtubules, intermediate filaments and actin filaments, and supramolecular structures formed by bundles of these filaments or networks resulting from cross-bridges between these major cytoskeletal polymers. The organization of this biological structure appears to be sensitive to fine spatially and temporally dependent regulatory signals. In differentiating neurons, regulation of cytoskeleton organization is particularly relevant, and the microtubule-associated protein (MAP tau appears to play roles in the extension of large neuritic processes and axons as well as in the stabilization of microtubular polymers along these processes. Within this context, tau is directly involved in defining neuronal polarity as well as in the generation of neuronal growth cones. There is increasing evidence that elements of the extracellular matrix contribute to the control of cytoskeleton organization in differentiating neurons, and that these regulations could be mediated by changes in MAP activity. In this brief review, we discuss the possible roles of tau in mediating the effects of extracellular matrix components on the internal cytoskeletal arrays and its organization in growing neurons.

  11. The role of Matrix Gla Protein in ossification and recovery of the avian growth plate

    Directory of Open Access Journals (Sweden)

    Harel eDan

    2012-07-01

    Full Text Available ECM mineralization is an essential physiologic process in bone, teeth, and hypertrophic cartilage. Matrix Gla Protein (MGP, an inhibitor of mineralization, is expressed by chondrocytes and vascular smooth muscle cells to inhibit calcification of those soft tissues.Tibial Dyschondroplasia (TD, a skeletal abnormality apparent as a plug of non-vascularized, non-mineralized, white opaque cartilage in the tibial growth plate of avian species can serve as a good model for studying process and genes involved in matrix mineralization and calcification. In this work, we studied the involvement of MGP in the development of TD, as well as in the processes of spontaneous and induced recovery from this syndrome. First, we found that during normal bone development, MGP is expressed in specific time and locations, starting from wide spread expression in the yet un-ossified diaphysis during embryonic development, to specific expression in hypertrophic chondrocytes adjacent to the chondro-osseous junction and the secondary ossification center just prior to calcification. In addition, we show that MGP is not expressed in the impaired TD lesion, however when the lesion begins to heal, it strongly express MGP prior to its calcification. Moreover, we show that when calcification is inhibited, a gap is formed between the expression zones of MGP and BMP2 and that this gap is closed during the healing process. To conclude, we suggest that MGP, directly or through interaction with BMP2, plays a role as ossification regulator, rather then simple inhibitor that acts prior to ossification.

  12. Use of Emdogain enamel matrix proteins in the surgical treatment of aggressive periodontitis.

    Science.gov (United States)

    Kiernicka, Małgorzata; Owczarek, Barbara; Gałkowska, Ewa; Wysokińska-Miszczuk, Joanna

    2003-01-01

    One of the ways of treating of the aggressive forms of periodontitis is the method of guided tissue regeneration using enamel matrix proteins included in Emdogain preparation. The aim of work was clinical evaluation of the complex treatment of those periodontolyses using the above mentioned material as the implant material. 35 intrabony pockets were operated in 11 patients aged 17-50. The treatment results were described with the use of clinical indices of API and SBI, indices of pockets depth PPD and the loss of the attachment CAL indices before and within the period of 8 to 12 months after the surgeries. The values of the examined features were submitted to statistical analysis using Shapiro-Wilks and Wilcoxon's tests. The treatment that was applied led to extremely statistically significant improvement of the examined parameters.

  13. Membrane association and localization dynamics of the Ebola virus matrix protein VP40.

    Science.gov (United States)

    Gc, Jeevan B; Gerstman, Bernard S; Chapagain, Prem P

    2017-10-01

    The Ebola virus matrix protein VP40 is a major structural protein that provides the scaffolding for new Ebola virus particles. For this, VP40 is first trafficked to the lower leaflet of the plasma membrane (PM) in its dimeric form. Once associated with the PM, the VP40 dimers undergo structural rearrangements and oligomerize into hexamers and filaments that make up the virus matrix. Therefore, association of the VP40 dimers and their stabilization at the PM is a crucial step in the Ebola life-cycle. To understand the molecular details of the VP40 dimer-PM interactions, we investigated the dimer association with the inner leaflet of the PM using detailed all-atom molecular dynamics (MD) simulations. The formation of the dimer-PM complex is facilitated by the interactions of the VP40 lysine residues and the anionic lipids POPS, POPI, and PIP 2 in the PM. In contrast, the dimer fails to associate with a membrane without POPS, POPI, or PIP 2 lipids. We explored the mechanisms of the association and identified important residues and lipids involved in localization and stabilization of VP40 dimers at the PM. MD simulations elucidate the role of a C-terminal α-helix alignment parallel to the lipid bilayer surface as well as the creation of membrane defects that allow partial insertion of the hydrophobic residue V276 into the membrane to further stabilize the VP40 dimer-PM complex. Understanding the mechanisms of the VP40 dimer-PM association that facilitate oligomerization can be important for potentially targeting the VP40 for small molecules that can interfere with the virus life-cycle. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Extracellular matrix mineralization in periodontal tissues: Noncollagenous matrix proteins, enzymes, and relationship to hypophosphatasia and X-linked hypophosphatemia.

    Science.gov (United States)

    McKee, Marc D; Hoac, Betty; Addison, William N; Barros, Nilana M T; Millán, José L; Chaussain, Catherine

    2013-10-01

    As broadly demonstrated for the formation of a functional skeleton, proper mineralization of periodontal alveolar bone and teeth - where calcium phosphate crystals are deposited and grow within an extracellular matrix - is essential for dental function. Mineralization defects in tooth dentin and cementum of the periodontium invariably lead to a weak (soft or brittle) dentition in which teeth become loose and prone to infection and are lost prematurely. Mineralization of the extremities of periodontal ligament fibers (Sharpey's fibers) where they insert into tooth cementum and alveolar bone is also essential for the function of the tooth-suspensory apparatus in occlusion and mastication. Molecular determinants of mineralization in these tissues include mineral ion concentrations (phosphate and calcium), pyrophosphate, small integrin-binding ligand N-linked glycoproteins and matrix vesicles. Amongst the enzymes important in regulating these mineralization determinants, two are discussed at length here, with clinical examples given, namely tissue-nonspecific alkaline phosphatase and phosphate-regulating gene with homologies to endopeptidases on the X chromosome. Inactivating mutations in these enzymes in humans and in mouse models lead to the soft bones and teeth characteristic of hypophosphatasia and X-linked hypophosphatemia, respectively, where the levels of local and systemic circulating mineralization determinants are perturbed. In X-linked hypophosphatemia, in addition to renal phosphate wasting causing low circulating phosphate levels, phosphorylated mineralization-regulating small integrin-binding ligand N-linked glycoproteins, such as matrix extracellular phosphoglycoprotein and osteopontin, and the phosphorylated peptides proteolytically released from them, such as the acidic serine- and aspartate-rich-motif peptide, may accumulate locally to impair mineralization in this disease. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Interactive effects of LPS and dentine matrix proteins on human dental pulp stem cells.

    Science.gov (United States)

    Widbiller, M; Eidt, A; Wölflick, M; Lindner, S R; Schweikl, H; Hiller, K-A; Buchalla, W; Galler, K M

    2018-01-29

    To investigate the combinatorial effects of lipopolysaccharide (LPS) and extracted dentine matrix proteins (eDMP) on regenerative and inflammatory responses in human dental pulp stem cells (DPSCs). Culture media were supplemented with several concentrations of LPS, eDMP and combinations of both. Cell viability was assessed over 1 week by MTT assay; cell survival was evaluated after 24 h and 7 days by flow cytometry. The expression of mineralization-associated marker genes was determined by real-time quantitative polymerase chain reaction (RT-qPCR). To analyse the inflammatory response, secretion of interleukin 6 (IL-6) was quantified in the initial and the late phase of cell culture by enzyme-linked immunosorbent assay (ELISA). Data were treated nonparametrically and Mann-Whitney U-tests were performed to compare all experimental groups (α = 0.05). Whereas LPS had no impact on viability, eDMP led to a concentration-dependent decrease, which was significant after 7 days (P ≤ 0.024). A moderate decline of cell survival induced by LPS was detected after 48 h (P ≤ 0.026), whereas eDMP was able to reverse this effect. eDMP alone caused increased expression of tested marker genes, LPS had no regulatory effect. Combined eDMP and LPS induced an upregulation of collagen type I and osteocalcin, whereas expression levels of dentine matrix acidic phosphoprotein and dentine sialophosphoprotein were similar to the control. IL-6-secretion was increased by LPS over time. eDMP markedly elevated initial production of IL-6 (P ≤ 0.002), but suppressed LPS-induced cytokine production in the later phase. Lipopolysaccharide did not affect cell viability but interfered with odontoblast-like cell differentiation of DPSCs. Proteins from the dentine matrix may have a protective effect, attenuate the detrimental impact of LPS and thus play an important role during pulp repair. © 2018 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  16. Desphospho-Uncarboxylated Matrix-Gla Protein Is Increased Postoperatively in Cardiovascular Risk Patients

    Directory of Open Access Journals (Sweden)

    Sofia Dahlberg

    2018-01-01

    Full Text Available Background: Matrix Gla protein (MGP is an extrahepatic protein that is dependent on glutamate carboxylation, a vitamin K-dependent process. Its dysfunctional form, desphospho-uncarboxylated-MGP, has been associated with increased arterial calcification and stiffness. The aim of this study was to measure the degree of postoperative carboxylation of MGP and two other Gla proteins in patients scheduled for abdominal or orthopaedic surgery. Methods: Forty patients undergoing abdominal or orthopaedic surgery were included. Blood samples were collected preoperatively and four days after the surgery. Desphospho-carboxylated MGP (dp-cMGP, desphospho-uncarboxylated MGP (dp-ucMGP, carboxylated osteocalcin (OC (cOC, uncarboxylated OC (ucOC, and uncarboxylated prothrombin (PIVKA-II were analysed. Results: Preoperatively, 29 patients had dp-ucMGP levels above the reference values. Patients with pre-existing cardiovascular comorbidities had higher dp-ucMGP preoperatively compared with patients with no record of cardiovascular disease. Postoperatively, this number increased to 36 patients, and median dp-ucMGP levels increased (p < 0.0001 and correlated to a PIVKA-II increase (r = 0.44. On the other hand, dp-cMGP levels did not significantly alter. Decreased levels of ucOC and cOC were seen after surgery (p = 0.017 and p = 0.0033, respectively. Comorbidities, possible nutritional defects, and complications affecting Gla protein activity and function were identified. Conclusions. Dp-ucMGP was high preoperatively, and had further increased postoperatively. This pattern was linked to several comorbidities, possible nutritional defects, and postoperative complications, which motivates further research about potential interactions between perioperative corrective treatments with vitamin K supplements, cardiovascular biomarkers, and incidents of stroke and myocardial infarction events.

  17. Peeping into human renal calcium oxalate stone matrix: characterization of novel proteins involved in the intricate mechanism of urolithiasis.

    Directory of Open Access Journals (Sweden)

    Kanu Priya Aggarwal

    Full Text Available BACKGROUND: The increasing number of patients suffering from urolithiasis represents one of the major challenges which nephrologists face worldwide today. For enhancing therapeutic outcomes of this disease, the pathogenic basis for the formation of renal stones is the need of hour. Proteins are found as major component in human renal stone matrix and are considered to have a potential role in crystal-membrane interaction, crystal growth and stone formation but their role in urolithiasis still remains obscure. METHODS: Proteins were isolated from the matrix of human CaOx containing kidney stones. Proteins having MW>3 kDa were subjected to anion exchange chromatography followed by molecular-sieve chromatography. The effect of these purified proteins was tested against CaOx nucleation and growth and on oxalate injured Madin-Darby Canine Kidney (MDCK renal epithelial cells for their activity. Proteins were identified by Matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF MS followed by database search with MASCOT server. In silico molecular interaction studies with CaOx crystals were also investigated. RESULTS: Five proteins were identified from the matrix of calcium oxalate kidney stones by MALDI-TOF MS followed by database search with MASCOT server with the competence to control the stone formation process. Out of which two proteins were promoters, two were inhibitors and one protein had a dual activity of both inhibition and promotion towards CaOx nucleation and growth. Further molecular modelling calculations revealed the mode of interaction of these proteins with CaOx at the molecular level. CONCLUSIONS: We identified and characterized Ethanolamine-phosphate cytidylyltransferase, Ras GTPase-activating-like protein, UDP-glucose:glycoprotein glucosyltransferase 2, RIMS-binding protein 3A, Macrophage-capping protein as novel proteins from the matrix of human calcium oxalate stone which play a critical role in kidney stone

  18. Interaction of glutaric aciduria type 1-related glutaryl-CoA dehydrogenase with mitochondrial matrix proteins.

    Directory of Open Access Journals (Sweden)

    Jessica Schmiesing

    Full Text Available Glutaric aciduria type 1 (GA1 is an inherited neurometabolic disorder caused by mutations in the GCDH gene encoding glutaryl-CoA dehydrogenase (GCDH, which forms homo- and heteromeric complexes in the mitochondrial matrix. GA1 patients are prone to the development of encephalopathic crises which lead to an irreversible disabling dystonic movement disorder. The clinical and biochemical manifestations of GA1 vary considerably and lack correlations to the genotype. Using an affinity chromatography approach we report here for the first time on the identification of mitochondrial proteins interacting directly with GCDH. Among others, dihydrolipoamide S-succinyltransferase (DLST involved in the formation of glutaryl-CoA, and the β-subunit of the electron transfer flavoprotein (ETFB serving as electron acceptor, were identified as GCDH binding partners. We have adapted the yellow fluorescent protein-based fragment complementation assay and visualized the oligomerization of GCDH as well as its direct interaction with DLST and ETFB in mitochondria of living cells. These data suggest that GCDH is a constituent of multimeric mitochondrial dehydrogenase complexes, and the characterization of their interrelated functions may provide new insights into the regulation of lysine oxidation and the pathophysiology of GA1.

  19. The widely expressed extracellular matrix protein SMOC-2 promotes keratinocyte attachment and migration.

    Science.gov (United States)

    Maier, Silke; Paulsson, Mats; Hartmann, Ursula

    2008-08-01

    SMOC-2 is a recently discovered member of the BM-40/SPARC/osteonectin family of extracellular multidomain proteins of so far unknown function. While we have shown earlier that the homologous protein SMOC-1 is associated with basement membranes, in this study we demonstrate that, in the mouse, SMOC-2 could be detected in a large number of non-basement membrane localizations, often showing a diffuse tissue distribution. A more distinct expression pattern was seen in skin where SMOC-2 is mainly present in the basal layers of the epidermis. Functionally, recombinant SMOC-2 stimulated attachment of primary epidermal cells as well as several epidermal-derived cell lines but had no effect on the attachment of non-epidermal cells. Inhibition experiments using blocking antibodies against individual integrin subunits allowed the identification of alphavbeta6 and alphavbeta1 integrins as important cellular receptors for SMOC-2. Cell attachment as well as the formation of focal adhesions could be attributed to the extracellular calcium-binding domain. The calcium-binding domain also stimulated migration, but not proliferation of keratinocyte-like HaCaT cells. We conclude that SMOC-2, like other members of the BM40/SPARC family, acts as a regulator of cell-matrix interactions.

  20. Future Protein Supply and Demand: Strategies and Factors Influencing a Sustainable Equilibrium.

    Science.gov (United States)

    Henchion, Maeve; Hayes, Maria; Mullen, Anne Maria; Fenelon, Mark; Tiwari, Brijesh

    2017-07-20

    A growing global population, combined with factors such as changing socio-demographics, will place increased pressure on the world's resources to provide not only more but also different types of food. Increased demand for animal-based protein in particular is expected to have a negative environmental impact, generating greenhouse gas emissions, requiring more water and more land. Addressing this "perfect storm" will necessitate more sustainable production of existing sources of protein as well as alternative sources for direct human consumption. This paper outlines some potential demand scenarios and provides an overview of selected existing and novel protein sources in terms of their potential to sustainably deliver protein for the future, considering drivers and challenges relating to nutritional, environmental, and technological and market/consumer domains. It concludes that different factors influence the potential of existing and novel sources. Existing protein sources are primarily hindered by their negative environmental impacts with some concerns around health. However, they offer social and economic benefits, and have a high level of consumer acceptance. Furthermore, recent research emphasizes the role of livestock as part of the solution to greenhouse gas emissions, and indicates that animal-based protein has an important role as part of a sustainable diet and as a contributor to food security. Novel proteins require the development of new value chains, and attention to issues such as production costs, food safety, scalability and consumer acceptance. Furthermore, positive environmental impacts cannot be assumed with novel protein sources and care must be taken to ensure that comparisons between novel and existing protein sources are valid. Greater alignment of political forces, and the involvement of wider stakeholders in a governance role, as well as development/commercialization role, is required to address both sources of protein and ensure food

  1. Future Protein Supply and Demand: Strategies and Factors Influencing a Sustainable Equilibrium

    Directory of Open Access Journals (Sweden)

    Maeve Henchion

    2017-07-01

    Full Text Available A growing global population, combined with factors such as changing socio-demographics, will place increased pressure on the world’s resources to provide not only more but also different types of food. Increased demand for animal-based protein in particular is expected to have a negative environmental impact, generating greenhouse gas emissions, requiring more water and more land. Addressing this “perfect storm” will necessitate more sustainable production of existing sources of protein as well as alternative sources for direct human consumption. This paper outlines some potential demand scenarios and provides an overview of selected existing and novel protein sources in terms of their potential to sustainably deliver protein for the future, considering drivers and challenges relating to nutritional, environmental, and technological and market/consumer domains. It concludes that different factors influence the potential of existing and novel sources. Existing protein sources are primarily hindered by their negative environmental impacts with some concerns around health. However, they offer social and economic benefits, and have a high level of consumer acceptance. Furthermore, recent research emphasizes the role of livestock as part of the solution to greenhouse gas emissions, and indicates that animal-based protein has an important role as part of a sustainable diet and as a contributor to food security. Novel proteins require the development of new value chains, and attention to issues such as production costs, food safety, scalability and consumer acceptance. Furthermore, positive environmental impacts cannot be assumed with novel protein sources and care must be taken to ensure that comparisons between novel and existing protein sources are valid. Greater alignment of political forces, and the involvement of wider stakeholders in a governance role, as well as development/commercialization role, is required to address both sources of

  2. A Novel Matrix Protein Hic31 from the Prismatic Layer of Hyriopsis Cumingii Displays a Collagen-Like Structure.

    Directory of Open Access Journals (Sweden)

    Xiaojun Liu

    Full Text Available In this study, we clone and characterize a novel matrix protein, hic31, from the mantle of Hyriopsis cumingii. The amino acid composition of hic31 consists of a high proportion of Glycine residues (26.67%. Tissue expression detection by RT-PCR indicates that hic31 is expressed specifically at the mantle edge. In situ hybridization results reveals strong signals from the dorsal epithelial cells of the outer fold at the mantle edge, and weak signals from inner epithelial cells of the same fold, indicating that hic31 is a prismatic-layer matrix protein. Although BLASTP results identify no shared homology with other shell-matrix proteins or any other known proteins, the hic31 tertiary structure is similar to that of collagen I, alpha 1 and alpha 2. It has been well proved that collagen forms the basic organic frameworks in way of collagen fibrils and minerals present within or outside of these fibrils. Therefore, hic31 might be a framework-matrix protein involved in the prismatic-layer biomineralization. Besides, the gene expression of hic31 increase in the early stages of pearl sac development, indicating that hic31 may play important roles in biomineralization of the pearl prismatic layer.

  3. The HIV matrix protein p17 subverts nuclear receptors expression and induces a STAT1-dependent proinflammatory phenotype in monocytes.

    Directory of Open Access Journals (Sweden)

    Barbara Renga

    Full Text Available BACKGROUND: Long-term remission of HIV-1 disease can be readily achieved by combinations of highly effective antiretroviral therapy (HAART. However, a residual persistent immune activation caused by circulating non infectious particles or viral proteins is observed under HAART and might contribute to an higher risk of non-AIDS pathologies and death in HIV infected persons. A sustained immune activation supports lipid dysmetabolism and increased risk for development of accelerated atehrosclerosis and ischemic complication in virologically suppressed HIV-infected persons receiving HAART. AIM: While several HIV proteins have been identified and characterized for their ability to maintain immune activation, the role of HIV-p17, a matrix protein involved in the viral replication, is still undefined. RESULTS: Here, we report that exposure of macrophages to recombinant human p17 induces the expression of proinflammatory and proatherogenic genes (MCP-1, ICAM-1, CD40, CD86 and CD36 while downregulating the expression of nuclear receptors (FXR and PPARγ that counter-regulate the proinflammatory response and modulate lipid metabolism in these cells. Exposure of macrophage cell lines to p17 activates a signaling pathway mediated by Rack-1/Jak-1/STAT-1 and causes a promoter-dependent regulation of STAT-1 target genes. These effects are abrogated by sera obtained from HIV-infected persons vaccinated with a p17 peptide. Ligands for FXR and PPARγ counteract the effects of p17. CONCLUSIONS: The results of this study show that HIV p17 highjacks a Rack-1/Jak-1/STAT-1 pathway in macrophages, and that the activation of this pathway leads to a simultaneous dysregulation of immune and metabolic functions. The binding of STAT-1 to specific responsive elements in the promoter of PPARγ and FXR and MCP-1 shifts macrophages toward a pro-atherogenetic phenotype characterized by high levels of expression of the scavenger receptor CD36. The present work identifies p17 as a

  4. Influenza A virus infection engenders a poor antibody response against the ectodomain of matrix protein 2

    Directory of Open Access Journals (Sweden)

    Wunner William

    2006-12-01

    Full Text Available Abstract Background Matrix protein 2 (M2 is an integral tetrameric membrane protein of influenza A virus (IAV. Its ectodomain (M2e shows remarkably little diversity amongst human IAV strains. As M2e-specific antibodies (Abs have been shown to reduce the severity of infection in animals, M2e is being studied for its capability of providing protection against a broad range of IAV strains. Presently, there is little information about the concentration of M2e-specific Abs in humans. Two previous studies made use of ELISA and Western blot against M2e peptides and recombinant M2 protein as immunosorbents, respectively, and reported Ab titers to be low or undetectable. An important caveat is that these assays may not have detected all Abs capable of binding to native tetrameric M2e. Therefore, we developed an assay likely to detect all M2e tetramer-specific Abs. Results We generated a HeLa cell line that expressed full length tetrameric M2 (HeLa-M2 or empty vector (HeLa-C10 under the control of the tetracycline response element. These cell lines were then used in parallel as immunosorbents in ELISA. The assay was standardized and M2e-specific Ab titers quantified by means of purified murine or chimeric (mouse variable regions, human constant regions M2e-specific Abs in the analysis of mouse and human sera, respectively. We found that the cell-based ELISA was substantially more effective than immobilized M2e peptide in detecting M2e-specific Abs in sera of mice that had recovered from repetitive IAV infections. Still, titers remained low ( Conclusion The results provide convincing evidence that M2e-specific Ab-mediated protection is currently lacking or suboptimal in humans.

  5. Extracellular matrix protein in calcified endoskeleton: a potential additive for crystal growth and design

    Science.gov (United States)

    Azizur Rahman, M.; Fujimura, Hiroyuki; Shinjo, Ryuichi; Oomori, Tamotsu

    2011-06-01

    In this study, we demonstrate a key function of extracellular matrix proteins (ECMPs) on seed crystals, which are isolated from calcified endoskeletons of soft coral and contain only CaCO 3 without any living cells. This is the first report that an ECMP protein extracted from a marine organism could potentially influence in modifying the surface of a substrate for designing materials via crystallization. We previously studied with the ECMPs from a different type of soft coral ( Sinularia polydactyla) without introducing any seed crystals in the process , which showed different results. Thus, crystallization on the seed in the presence of ECMPs of present species is an important first step toward linking function to individual proteins from soft coral. For understanding this interesting phenomenon, in vitro crystallization was initiated in a supersaturated solution on seed particles of calcite (1 0 4) with and without ECMPs. No change in the crystal growth shape occurred without ECMPs present during the crystallization process. However, with ECMPs, the morphology and phase of the crystals in the crystallization process changed dramatically. Upon completion of crystallization with ECMPs, an attractive crystal morphology was found. Scanning electron microscopy (SEM) was utilized to observe the crystal morphologies on the seeds surface. The mineral phases of crystals nucleated by ECMPs on the seeds surface were examined by Raman spectroscopy. Although 50 mM Mg 2+ is influential in making aragonite in the crystallization process, the ECMPs significantly made calcite crystals even when 50 mM Mg 2+ was present in the process. Crystallization with the ECMP additive seems to be a technically attractive strategy to generate assembled micro crystals that could be used in crystals growth and design in the Pharmaceutical and biotechnology industries.

  6. Matrix-Assisted Laser Desorption/Ionization Imaging Mass Spectrometry for the Investigation of Proteins and Peptides

    Science.gov (United States)

    Burnum, Kristin E.; Frappier, Sara L.; Caprioli, Richard M.

    2008-07-01

    Mass spectrometry (MS) is an excellent technology for molecular imaging because of its high data dimensionality. MS can monitor thousands of individual molecular data channels measured as mass-to-charge (m/z). We describe the use of matrix-assisted laser desorption/ionization (MALDI) MS for the image analysis of proteins, peptides, lipids, drugs, and metabolites in tissues. We discuss the basic instrumentation and sample preparation methods needed to produce high-resolution images and high image reproducibility. Matrix-addition protocols are briefly discussed along with normal operating procedures, and selected biological and medical applications of MALDI imaging MS are described. We give examples of both two- and three-dimensional imaging, including normal mouse embryo implantation, sperm maturation in mouse epididymis, protein distributions in brain sections, protein alterations as a result of drug administration, and protein changes in brain due to neurodegeneration and tumor formation. Advantages of this technology and future challenges for its improvement are discussed.

  7. Combining enamel matrix proteins with mechanical stimuli potentiates human periodontal ligament fibroblasts proliferation and periodontium remodeling.

    Science.gov (United States)

    Zou, Rui; Wan, Wanting; Li, Jingjing; Du, Chanyuan; Wang, Yijie; Qian, Tian; Niu, Lin

    2018-02-27

    Collagen I (Col-I) and matrix metalloproteinase-1 (MMP-1) have been implicated in the regeneration and remodeling of the periodontium. Studies have shown that enamel matrix proteins (EMPs) and mechanical stimuli can promote the synthesis and degradation, respectively, of Col-I and MMP-1. However, the effects of the combination of EMPs and mechanical stimuli on human periodontal ligament are not known. Our aim was to test the combined effects of EMPs and mechanical stimuli on the proliferation of human periodontal ligament fibroblasts (HPDLFs) and Col-I and MMP-1 mRNA expression. Primary HPDLFs were isolated using an enzyme digestion method. To select the optimum EMP concentration and the optimum magnitude and loading time of mechanical stimuli, HPDLFs were stimulated with gradient concentration of EMPs (0 µg/mL, 25 µg/mL, 50 µg/mL, 100 µg/mL and 200 µg/mL) and mechanical stimuli (0 kPa, 25 kPa, 50 kPa, 100 kPa, and 200 kPa for 0 h, 3 h, 6 h, 12 h, and 24 h), respectively. The cell proliferative response was tested by the MTT assay. The impact of EMPs combined with mechanical stimuli on Col-I and MMP-1 mRNA expression were measured by reverse transcription polymerase chain reaction. 100 µg/mL of EMPs and a 50 kPa mechanical stimulus were chosen as the optimum parameters due to the higher proliferation rates than other doses. The combination of 100 µg/mL of EMPs and a 50 kPa mechanical stimulus significantly stimulated HPDLFs proliferation and increased Col-I and MMP-1 expression levels compared with incubation with two factors alone. We concluded that the combination of EMPs and mechanical stimulus have synergistic effects on cell growth, cell number, collagen turnover, and periodontium remodeling.

  8. The effect of enamel matrix proteins and deproteinized bovine bone mineral on heterotopic bone formation.

    Science.gov (United States)

    Donos, Nikolaos; Kostopoulos, Lambros; Tonetti, Maurizio; Karring, Thorkild; Lang, Niklaus P

    2006-08-01

    To evaluate the osteoinductive potential of deproteinized bovine bone mineral (DBBM) and an enamel matrix derivative (EMD) in the muscle of rats. Sixteen rats were used in this study. The animals were divided in three groups. Group A: a pouch was created in one of the pectoralis profundis muscles of the thorax of the rats and DBBM particles (Bio-Oss) were placed into the pouch. Healing: 60 days. Group B: a small pouch was created on both pectoralis profundis muscles at each side of the thorax midline. In one side, a mixture of EMD (Emdogain) mixed with DBBM was placed into one of the pouches, whereas in the contralateral side of the thorax the pouch was implanted with DBBM mixed with the propylene glycol alginate (PGA--carrier for enamel matrix proteins of EMD). Healing: 60 days. Group C: the same procedure as group B, but with a healing period of 120 days. Qualitative histological analysis of the results was performed. At 60 days, the histological appearance of the DBBM particles implanted alone was similar to that of the particles implanted together with EMD or PGA at both 60 and 120 days. The DBBM particles were encapsulated into a connective tissue stroma and an inflammatory infiltrate. At 120 days, the DBBM particles implanted together with EMD or PGA exhibited the presence of resorption lacunae in some cases. Intramuscular bone formation was not encountered in any group. The implantation of DBBM particles alone, combined with EMD or its carrier (PGA) failed to exhibit extraskeletal, bone-inductive properties.

  9. [The nuclear matrix proteins (mol. mass 38 and 50 kDa) are transported by chromosomes in mitosis].

    Science.gov (United States)

    Murasheva, M I; Chentsov, Iu S

    2010-01-01

    It was shown by immunofluorescence method that serum M68 and serum K43 from patients with autoimmune disease stain interphase nuclei and periphery of mitotic chromosomes of pig kidney cells. Western blotting reveals the polypeptide with mol. mass of 50 kDa in serum M68, and the polypeptide with mol. mass of 38 kDa in serum K43. In the nuclear protein matrix, the antibodies to protein with mol. mass of 38 kDa stained only nucleolar periphery, while the antibodies to the protein with mol. mass of 50 kDa stained both the nucleolar periphery and all the interphase nucleus. It shows that among all components of nuclear protein matrix (lamina, internuclear network, residual nucleoli) only nucleolar periphery contains the 38 kDa protein, while the 50 kDa protein is a part of residual nucleolar periphery and takes part in nuclear protein network formation. In the interphase cells, both proteins were in situ localized in the nuclei, but one of them with mol. mass of 50 kDa was in the form of small clearly outlined granules, while the other (38 kDa) was in the form of small bright granules against the background of diffusely stained nuclei. Both proteins were also revealed as continuous ring around nucleolar periphery. During all mitotic stages, the 50 kDa protein was seen on the chromosomal periphery as a cover, and the 38 kDa protein formed separate fragments and granules around them. After nuclear and chromosome decondensation induced by hypotonic treatment, both antibodies stain interphase nuclei in diffuse manner, but in mitotic cells they stained the surface of the swollen chromosomes. The polypeptide with mol. mass of 50 kDa maintained strong connection with chromosome periphery both in norm and under condition of decondensation induced by hypotonic treatment and at subsequent recondensation in isotonic medium. In contrast, the protein with mol. mass of 38 kDa partially lost the contact with a chromosome during recondensation appearing also in the form of granules in

  10. Dimerization Efficiency of Canine Distemper Virus Matrix Protein Regulates Membrane-Budding Activity.

    Science.gov (United States)

    Bringolf, Fanny; Herren, Michael; Wyss, Marianne; Vidondo, Beatriz; Langedijk, Johannes P; Zurbriggen, Andreas; Plattet, Philippe

    2017-08-15

    Paramyxoviruses rely on the matrix (M) protein to orchestrate viral assembly and budding at the plasma membrane. Although the mechanistic details remain largely unknown, structural data suggested that M dimers and/or higher-order oligomers may facilitate membrane budding. To gain functional insights, we employed a structure-guided mutagenesis approach to investigate the role of canine distemper virus (CDV) M protein self-assembly in membrane-budding activity. Three six-alanine-block (6A-block) mutants with mutations located at strategic oligomeric positions were initially designed. While the first one includes residues potentially residing at the protomer-protomer interface, the other two display amino acids located within two distal surface-exposed α-helices proposed to be involved in dimer-dimer contacts. We further focused on the core of the dimeric interface by mutating asparagine 138 (N138) to several nonconservative amino acids. Cellular localization combined with dimerization and coimmunopurification assays, performed under various denaturing conditions, revealed that all 6A-block mutants were impaired in self-assembly and cell periphery accumulation. These phenotypes correlated with deficiencies in relocating CDV nucleocapsid proteins to the cell periphery and in virus-like particle (VLP) production. Conversely, all M-N138 mutants remained capable of self-assembly, though to various extents, which correlated with proper accumulation and redistribution of nucleocapsid proteins at the plasma membrane. However, membrane deformation and VLP assays indicated that the M-N138 variants exhibiting the most reduced dimerization propensity were also defective in triggering membrane remodeling and budding, despite proper plasma membrane accumulation. Overall, our data provide mechanistic evidence that the efficiency of CDV M dimerization/oligomerization governs both cell periphery localization and membrane-budding activity. IMPORTANCE Despite the availability of

  11. Effect of EDTA root conditioning on the healing of intrabony defects treated with an enamel matrix protein derivative.

    NARCIS (Netherlands)

    Sculean, A.; Berakdar, M.; Willershausen, B.; Arweiler, N.B.; Becker, J.M.; Schwarz, F.

    2006-01-01

    BACKGROUND: Regenerative periodontal therapy with an enamel matrix protein derivative (EMD) has been shown to promote regeneration in intrabony periodontal defects. However, in most clinical studies, root surface conditioning with EDTA was performed in conjunction with the application of EMD, and,

  12. Bap, a biofilm matrix protein of Staphylococcus aureus prevents cellular internalization through binding to GP96 host receptor.

    Directory of Open Access Journals (Sweden)

    Jaione Valle

    Full Text Available The biofilm matrix, composed of exopolysaccharides, proteins, nucleic acids and lipids, plays a well-known role as a defence structure, protecting bacteria from the host immune system and antimicrobial therapy. However, little is known about its responsibility in the interaction of biofilm cells with host tissues. Staphylococcus aureus, a leading cause of biofilm-associated chronic infections, is able to develop a biofilm built on a proteinaceous Bap-mediated matrix. Here, we used the Bap protein as a model to investigate the role that components of the biofilm matrix play in the interaction of S. aureus with host cells. The results show that Bap promotes the adhesion but prevents the entry of S. aureus into epithelial cells. A broad analysis of potential interaction partners for Bap using ligand overlayer immunoblotting, immunoprecipitation with purified Bap and pull down with intact bacteria, identified a direct binding between Bap and Gp96/GRP94/Hsp90 protein. The interaction of Bap with Gp96 provokes a significant reduction in the capacity of S. aureus to invade epithelial cells by interfering with the fibronectin binding protein invasion pathway. Consistent with these results, Bap deficient bacteria displayed an enhanced capacity to invade mammary gland epithelial cells in a lactating mice mastitis model. Our observations begin to elucidate the mechanisms by which components of the biofilm matrix can facilitate the colonization of host tissues and the establishment of persistent infections.

  13. Regulation of complement by cartilage oligomeric matrix protein allows for a novel molecular diagnostic principle in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Happonen, Kaisa E; Saxne, Tore; Aspberg, Anders

    2010-01-01

    Cartilage oligomeric matrix protein (COMP) is a structural component of cartilage, where it catalyzes collagen fibrillogenesis. Elevated amounts of COMP are found in serum during increased turnover of cartilage associated with active joint disease, such as rheumatoid arthritis (RA) and osteoarthr...

  14. Expression of uncarboxylated matrix Gla protein in ankylosing spondylitis and its significance

    Directory of Open Access Journals (Sweden)

    Han-qing HUANG

    2013-07-01

    Full Text Available Objective To investigate the serum level of uncarboxylated matrix Gla protein (ucMGP in ankylosing spondylitis (AS patients, and to evaluate its diagnostic value and the relation of ucMGP to inflammation and ossification process in AS. Methods Eight-two AS patients and 76 healthy controls were enrolled in this randomized controlled study. The clinical indices (age, gender, course of disease, disease activity, changes in radiographic studies, and indices of bone metabolism or inflammation, including erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, osteocalcin (OC, and bone-specific alkaline phosphatase (BALP were evaluated or measured. The disease activity was assessed by Bath Ankylosing Spondylitis Disease Activity Index (BASDAI, and changes in radiographic pictures were evaluated according to the modified Stoke AS Spine Score (mSASSS, and serum level of ucMGP was measured by a competitive ELISA. The relationship between ucMGP and clinical indexes, radiographic scoring, indices in bone metabolism or inflammation was estimated by SPSS software, and the diagnostic value of ucMGP was analyzed by receiver operator characteristic (ROC curve. Results The levels of ESR and CRP in AS patients were higher than those in healthy controls, but the serum ucMGP was lower (2958±654nmol/L compared with healthy controls (4551±1036nmol/L, P0, r=-0.715, P1, r=-0.741, P10, r=-0.776, P<0.01; mSASSS <10, r=-0.297, P=0.028. Conclusion Serum ucMGP may serve as a diagnostic biomarker of AS and progression index of ossification, especially in late stage of AS.

  15. Expression of bone matrix proteins during the osseus healing of topical conditioned implants: an experimental study.

    Science.gov (United States)

    Schlegel, Karl Andreas; Thorwarth, Michael; Plesinac, Alexandra; Wiltfang, Joerg; Rupprecht, Stephan

    2006-12-01

    Osseointegration of implants depends on time and local bone conditions regarding quality and quantity. This led to the bone classification by Lekholm et al. The aim of the present study was to follow the expression of bone matrix proteins during the phase of osseointegration after conditioning of the bone bed by means of immunohistochemistry. In the porcine frontal skull, implant beds of identical size were created. Before placement of the implants (Ankylos 4 x 3.5 mm), the implant beds were conditioned using bone condensation (cond), an osteoinductive collagen (Co) and platelet-rich plasma (PRP). These conditioning methods were compared with standard procedure. The animals were sacrificed after 2, 4 and 8 weeks. The specimens were then analyzed by light microcopy and immunohistochemistry for expression of bone morphogenic proteins (BMP)2, procollagen I and osteocalcin (OC). Light microscopy revealed an initial effect of condensation and the bovine collagen at 2 weeks in comparison with the standard group. The PRP did not achieve a significant effect. At 8 weeks, the results of the standard, bone condensation and the bovine collagen group had aligned. The PRP group showed a significantly lower bone-implant contact (BIC) (P=0.003) compared with the standard group. BMP2 expression was significantly higher in all evaluated test groups at 4 and 8 weeks, as well as at 2 weeks in the condensation group. The procollagen I expression at 2 weeks was significantly increased for PRP and lower in the collagen and condensation group compared with standard procedure. Values for 4 and 8 weeks were slightly higher than in the standard group. No significant differences were obvious in the OC group at any time. During the initial healing phase, an effect of the evaluated methods of topical bone conditioning can be demonstrated by differences in the expression of BMP2 and procollagen I. These findings had leveled at 8 weeks and were, in contrast, not detectable in the expression of

  16. Spatial Expression of Otolith Matrix Protein-1 and Otolin-1 in Normally and Kinetotically Swimming Fish.

    Science.gov (United States)

    Weigele, Jochen; Franz-Odendaal, Tamara A; Hilbig, Reinhard

    2015-10-01

    Kinetosis (motion sickness) has been repeatedly shown to affect some fish of a given clutch following the transition from 1g to microgravity or from hypergravity to 1g. This susceptibility to kinetosis may be correlated with irregular inner ear otolith growth. Otoliths are mainly composed of calcium carbonate and matrix proteins, which play an important role in the process of otolith mineralization. Here, we examine the morphology of otoliths and the expression pattern of the major otolith proteins OMP-1 and otolin-1 in a series of hypergravity experiments. In the utricle, OMP-1 is present in centripetal (medial) and centrifugal (lateral) regions of the meshwork area. In the saccule, OMP-1 was expressed within a dorsal and a ventral narrow band of the meshwork area opposite to the periphery of the sulcus acusticus. In normal animals, the spatial expression pattern of OMP-1 reaches more posteriorly in the centrifugal aspect and is considerably broader in the centripetal portion of the utricle compared to kinetotic animals. However, otolin-1 was not expressed in the utricule. In the saccule, no differences were observed for either gene when comparing normal and kinetotically behaving fish. The difference in the utricular OMP-1 expression pattern between normally and kinetotically swimming fish indicates a different otolith morphology and thus a different geometry of the otoliths resting on the corresponding sensory maculae. As the utricle is the endorgan responsible for sensing gravity, the aberrant morphology of the utricular otoliths, based on OMP-1 expression, likely leads to the observed kinetotic behavior. © 2015 Wiley Periodicals, Inc.

  17. The nuclear matrix protein HNRNPU maintains 3D genome architecture globally in mouse hepatocytes.

    Science.gov (United States)

    Fan, Hui; Lv, Pin; Huo, Xiangru; Wu, Jicheng; Wang, Qianfeng; Cheng, Lu; Liu, Yun; Tang, Qi-Qun; Zhang, Ling; Zhang, Feng; Zheng, Xiaoqi; Wu, Hao; Wen, Bo

    2018-02-01

    Eukaryotic chromosomes are folded into higher-order conformations to coordinate genome functions. In addition to long-range chromatin loops, recent chromosome conformation capture (3C)-based studies have indicated higher levels of chromatin structures including compartments and topologically associating domains (TADs), which may serve as units of genome organization and functions. However, the molecular machinery underlying these hierarchically three-dimensional (3D) chromatin architectures remains poorly understood. Via high-throughput assays, including in situ Hi-C, DamID, ChIP-seq, and RNA-seq, we investigated roles of the Heterogeneous Nuclear Ribonucleoprotein U (HNRNPU), a nuclear matrix (NM)-associated protein, in 3D genome organization. Upon the depletion of HNRNPU in mouse hepatocytes, the coverage of lamina-associated domains (LADs) in the genome increases from 53.1% to 68.6%, and a global condensation of chromatin was observed. Furthermore, disruption of HNRNPU leads to compartment switching on 7.5% of the genome, decreases TAD boundary strengths at borders between A (active) and B (inactive) compartments, and reduces chromatin loop intensities. Long-range chromatin interactions between and within compartments or TADs are also significantly remodeled upon HNRNPU depletion. Intriguingly, HNRNPU mainly associates with active chromatin, and 80% of HNRNPU peaks coincide with the binding of CTCF or RAD21. Collectively, we demonstrated that HNRNPU functions as a major factor maintaining 3D chromatin architecture, suggesting important roles of NM-associated proteins in genome organization. © 2018 Fan et al.; Published by Cold Spring Harbor Laboratory Press.

  18. Not All Inner Ears are the Same: Otolith Matrix Proteins in the Inner Ear of Sub-Adult Cichlid Fish, Oreochromis Mossambicus, Reveal Insights Into the Biomineralization Process.

    Science.gov (United States)

    Weigele, Jochen; Franz-Odendaal, Tamara A; Hilbig, Reinhard

    2016-02-01

    The fish ear stones (otoliths) consist mainly of calcium carbonate and have lower amounts of a proteinous matrix. This matrix consists of macromolecules, which directly control the biomineralization process. We analyzed the composition of this proteinous matrix by mass spectrometry in a shotgun approach. For this purpose, an enhanced protein purification technique was developed that excludes any potential contamination of proteins from body fluids. Using this method we identified eight proteins in the inner ear of Oreochromis mossambicus. These include the common otolith matrix proteins (OMP-1, otolin-1, neuroserpin, SPARC and otoconin), and three proteins (alpha tectorin, otogelin and transferrin) not previously localized to the otoliths. Moreover, we were able to exclude the occurrence of two matrix proteins (starmaker and pre-cerebellin-like protein) known from other fish species. In further analyses, we show that the absence of the OMP starmaker corresponds to calcitic otoliths and that pre-cerebellin-like protein is not present at any stage during the development of the otoliths of the inner ear. This study shows O. mossambicus does not have all of the known otolith proteins indicating that the matrix proteins in the inner ear of fish are not the same across species. Further functional studies of the novel proteins we identified during otolith development are required. © 2015 Wiley Periodicals, Inc.

  19. Haemophilus influenzae P4 Interacts With Extracellular Matrix Proteins Promoting Adhesion and Serum Resistance.

    Science.gov (United States)

    Su, Yu-Ching; Mukherjee, Oindrilla; Singh, Birendra; Hallgren, Oskar; Westergren-Thorsson, Gunilla; Hood, Derek; Riesbeck, Kristian

    2016-01-15

    Interaction with the extracellular matrix (ECM) is one of the successful colonization strategies employed by nontypeable Haemophilus influenzae (NTHi). Here we identified Haemophilus lipoprotein e (P4) as a receptor for ECM proteins. Purified recombinant P4 displayed a high binding affinity for laminin (Kd = 9.26 nM) and fibronectin (Kd = 10.19 nM), but slightly less to vitronectin (Kd = 16.51 nM). A P4-deficient NTHi mutant showed a significantly decreased binding to these ECM components. Vitronectin acquisition conferred serum resistance to both P4-expressing NTHi and Escherichia coli transformants. P4-mediated bacterial adherence to pharynx, type II alveolar, and bronchial epithelial cells was mainly attributed to fibronectin. Importantly, a significantly reduced bacterial infection was observed in the middle ear of the Junbo mouse model when NTHi was devoid of P4. In conclusion, our data provide new insight into the role of P4 as an important factor for Haemophilus colonization and subsequent respiratory tract infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Modulation of enamel matrix proteins on the formation and nano-assembly of hydroxyapatite in vitro

    International Nuclear Information System (INIS)

    Li Hong; Huang Weiya; Zhang Yuanming; Xue Bo; Wen Xuejun

    2012-01-01

    Natural enamel has a hierarchically nanoassembled architecture that is regulated by enamel matrix proteins (EMPs) during the formation of enamel crystals. To understand the role of EMPs on enamel mineralization, calcium phosphate (CaP) growth experiments in both the presence and absence of native rat EMPs in a single diffusion system were conducted. The morphology and organization of formed CaP crystals were examined by X-Ray Diffraction (XRD), High-Resolution Transmission Microscopy (HRTEM) and Selected Area Electron Diffraction (SAED). In the system containing the EMPs, hydroxyapatite (HAP) with hierarchical lamellar nanostructure can be formed and the aligned HAP assembly tightly bundled by 3–4 rod-like nanocrystals like an enamel prism. However, in the absence of EMPs, only a sheet-like structure of octacalcium phosphate (OCP) phase was presented. EMPs promote HAP formation and inhibit the growth of OCP on the (010) plane. It is discussed that the organized Amelogenin/Amorphous Calcium Phosphate might be the precursor to the bundled HAP crystal prism. The study benefits the understanding of biomineralization of tooth enamel. - Highlights: ► An aligned hydroxyapatite crystal bundled by rod-like nanosize crystals was obtained. ► An organized Amel/ACP would be the precursor of the bundled hydroxyapatite crystal prism. ► EMPs inhibit the growth of octacalcium phosphate in a defined plane.

  1. Neural cell alignment by patterning gradients of the extracellular matrix protein laminin

    Science.gov (United States)

    Chelli, Beatrice; Barbalinardo, Marianna; Valle, Francesco; Greco, Pierpaolo; Bystrenova, Eva; Bianchi, Michele; Biscarini, Fabio

    2014-01-01

    Anisotropic orientation and accurate positioning of neural cells is achieved by patterning stripes of the extracellular matrix protein laminin on the surface of polystyrene tissue culture dishes by micromoulding in capillaries (MIMICs). Laminin concentration decreases from the entrance of the channels in contact with the reservoir towards the end. Immunofluorescence analysis of laminin shows a decreasing gradient of concentration along the longitudinal direction of the stripes. The explanation is the superposition of diffusion and convection of the solute, the former dominating at length scales near the entrance (characteristic length around 50 μm), the latter further away (length scale in excess of 900 μm). These length scales are independent of the channel width explored from about 15 to 45 μm. Neural cells are randomly seeded and selectively adhere to the pattern, leaving the unpatterned areas depleted even upon 6 days of incubation. Cell alignment was assessed by the orientation of the long axis of the 4′,6-diamidino-2-phenylindole-stained nuclei. Samples on patterned the laminin area exhibit a large orientational order parameter. As control, cells on the unpatterned laminin film exhibit no preferential orientation. This implies that the anisotropy of laminin stripes is an effective chemical stimulus for cell recruiting and alignment. PMID:24501672

  2. Cutaneous and Systemic Findings Associated With Nuclear Matrix Protein 2 Antibodies in Adult Dermatomyositis Patients.

    Science.gov (United States)

    Rogers, Anna; Chung, Lorinda; Li, Shufeng; Casciola-Rosen, Livia; Fiorentino, David F

    2017-12-01

    To characterize the cutaneous and systemic clinical phenotype of dermatomyositis patients with antinuclear matrix protein 2 (anti-NXP-2) antibodies. We conducted a retrospective cohort analysis of 178 dermatomyositis patients seen at the Stanford University Clinic. An electronic chart review employing a keyword search strategy was performed to collect clinical and laboratory data. Anti-NXP-2 antibodies were assayed by immunoprecipitation using NXP-2 produced by in vitro transcription/translation. Antibodies to NXP-2 were detected in 20 of the 178 patients (11%). Anti-NXP-2 antibodies were associated with male sex (50% versus 25%; P = 0.02), dysphagia (74% versus 39%; P = 0.006), myalgia (89% versus 52%; P = 0.002), peripheral edema (35% versus 11%; P = 0.016), and calcinosis (37% versus 11%; P = 0.007). These patients were less likely to be clinically amyopathic (5% versus 23%; P = 0.08). Five of the 20 patients with anti-NXP-2 antibodies (25%) had an associated internal malignancy. No other cutaneous characteristics were associated with anti-NXP-2 antibodies, except a decreased frequency of Gottron's sign (44% versus 75%; P = 0.012) and a greater likelihood of having mild skin disease. Dermatomyositis patients with anti-NXP-2 antibodies have a distinct and often severe systemic phenotype that includes myalgia, peripheral edema, and significant dysphagia, despite having milder inflammatory skin disease. © 2017, American College of Rheumatology.

  3. Modulation of enamel matrix proteins on the formation and nano-assembly of hydroxyapatite in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Li Hong, E-mail: tlihong@jnu.edu.cn [Department of Materials Science and Engineering, Jinan University, Guangzhou, Guangdong 510630 (China); Department of Bioengineering, Clemson University, Charleston, SC 29425 (United States); Huang Weiya [Department of Chemistry, Jinan University, Guangzhou, Guangdong 510630 (China); Department of Materials Science and Engineering, Taizhou, Taizhou University, Zhejiang 317000 (China); Zhang Yuanming [Department of Chemistry, Jinan University, Guangzhou, Guangdong 510630 (China); Xue Bo [Department of Materials Science and Engineering, Jinan University, Guangzhou, Guangdong 510630 (China); Wen Xuejun [Department of Bioengineering, Clemson University, Charleston, SC 29425 (United States)

    2012-05-01

    Natural enamel has a hierarchically nanoassembled architecture that is regulated by enamel matrix proteins (EMPs) during the formation of enamel crystals. To understand the role of EMPs on enamel mineralization, calcium phosphate (CaP) growth experiments in both the presence and absence of native rat EMPs in a single diffusion system were conducted. The morphology and organization of formed CaP crystals were examined by X-Ray Diffraction (XRD), High-Resolution Transmission Microscopy (HRTEM) and Selected Area Electron Diffraction (SAED). In the system containing the EMPs, hydroxyapatite (HAP) with hierarchical lamellar nanostructure can be formed and the aligned HAP assembly tightly bundled by 3-4 rod-like nanocrystals like an enamel prism. However, in the absence of EMPs, only a sheet-like structure of octacalcium phosphate (OCP) phase was presented. EMPs promote HAP formation and inhibit the growth of OCP on the (010) plane. It is discussed that the organized Amelogenin/Amorphous Calcium Phosphate might be the precursor to the bundled HAP crystal prism. The study benefits the understanding of biomineralization of tooth enamel. - Highlights: Black-Right-Pointing-Pointer An aligned hydroxyapatite crystal bundled by rod-like nanosize crystals was obtained. Black-Right-Pointing-Pointer An organized Amel/ACP would be the precursor of the bundled hydroxyapatite crystal prism. Black-Right-Pointing-Pointer EMPs inhibit the growth of octacalcium phosphate in a defined plane.

  4. Detection of Cartilage Oligomeric Matrix Protein Using a Quartz Crystal Microbalance

    Directory of Open Access Journals (Sweden)

    Chih-Hsin Hung

    2010-12-01

    Full Text Available Current methods for diagnosing early stage osteoarthritis (OA based on the magnetic resonance imaging and enzyme-linked immunosorbent assay methods are specific, but require specialized laboratory facilities and highly trained personal to obtain a definitive result. In this work, a user friendly and non-invasive quartz crystal microbalance (QCM immunosensor method has been developed to detect Cartilage Oligomeric Matrix Protein (COMP for early stage OA diagnosis. This QCM immunosensor was fabricated to immobilize COMP antibodies utilizing the self-assembled monolayer technique. The surface properties of the immunosensor were characterized by its FTIR and electrochemical impedance spectra (EIS. The feasibility study was based on urine samples obtained from 41 volunteers. Experiments were carried out in a flow system and the reproducibility of the electrodes was evaluated by the impedance measured by EIS. Its potential dynamically monitored the immunoreaction processes and could increase the efficiency and sensitivity of COMP detection in laboratory-cultured preparations and clinical samples. The frequency responses of the QCM immunosensor changed from 6 kHz when testing 50 ng/mL COMP concentration. The linear regression equation of frequency shift and COMP concentration was determined as: y = 0.0872 x + 1.2138 (R2 = 0.9957. The COMP in urine was also determined by both QCM and EIS for comparison. A highly sensitive, user friendly and cost effective analytical method for the early stage OA diagnosis has thus been successfully developed.

  5. Nanoscale Viscoelasticity of Extracellular Matrix Proteins in Soft Tissues: a Multiscale Approach

    Science.gov (United States)

    Miri, Amir K.; Heris, Hossein K.; Mongeau, Luc; Javid, Farhad

    2013-01-01

    We propose that the bulk viscoelasticity of soft tissues results from two length-scale-dependent mechanisms: the time-dependent response of extracellular matrix proteins (ECM) at the nanometer scale and the biophysical interactions between the ECM solid structure and interstitial fluid at the micrometer scale. The latter was modeled using the poroelasticity theory with an assumption of free motion of the interstitial fluid within the porous ECM structure. Following a recent study (Heris, H.K., Miri, A.K., Tripathy, U., Barthelat, F., Mongeau, L., 2013. Journal of the Mechanical Behavior of Biomedical Materials), atomic force microscopy was used to perform creep loading and 50-nm sinusoidal oscillations on porcine vocal folds. The proposed model was calibrated by a finite element model to accurately predict the nanoscale viscoelastic moduli of ECM. A linear correlation was observed between the in-depth distribution of the viscoelastic moduli and that of hyaluronic acids in the vocal fold tissue. We conclude that hyaluronic acids may regulate the vocal fold viscoelasticity at nanoscale. The proposed methodology offers a characterization tool for biomaterials used in vocal fold augmentations. PMID:24317493

  6. Peroxisomal matrix protein import - Suppression of protein import defects in Hansenula polymorpha pex mutants by overproduction of the PTS1 receptor pex5p

    NARCIS (Netherlands)

    Kiel, JAKW; Veenhuis, M

    2000-01-01

    In the past decade, much progress has been made in understanding the mechanisms that govern sorting of proteins to the peroxisomal lumen. This article summarizes the principal features of how peroxisomal matrix enzymes are thought to reach the peroxisome. In addition, it describes recent data that

  7. Synthesis of noncollagenous extracellular matrix proteins during development of mineralized nodules by rat periodontal ligament cells in vitro.

    Science.gov (United States)

    Ramakrishnan, P R; Lin, W L; Sodek, J; Cho, M I

    1995-07-01

    To characterize the mineralized nodules produced by rat periodontal ligament (PDL) cells in vitro, we have studied the synthesis and distribution of mineralized tissue proteins at various stages of nodule formation. PDL cells were obtained from coagulum in the socket at 2 days after tooth extraction and cultured in Dulbecco's Modified Eagles Medium (DMEM) containing 10% fetal bovine serum and antibiotics. Confluent cells were grown in the presence of ascorbic acid (50 micrograms/ml), dexamethasone (5 microM), and beta-glycerophosphate (10 mM) for 3 weeks. Four stages showing distinct morphological characteristics during development of mineralized nodules were identified. Protein synthesis and deposition of proteins into the matrix were studied during these stages by metabolic labeling with [35S]methionine for 24 hours. Large quantities of SPARC (secreted protein, acidic and rich in cysteine) were synthesized by confluent cells but decreased during the progress of mineralized nodule formation. Two forms of osteopontin (OPN) (67 kDa and 61 kDa) were synthesized in comparable quantities by confluent cells; OPN and bone sialoprotein (BSP) were induced by dexamethasone and represented the major proteins in the mineralized matrix. The 67 kDa form of OPN was the predominant species in the mineralized matrix. Both OPN and BSP were localized by immunogold electron microscopy on globular as well as fused electron-dense structures at sites of tissue mineralization.

  8. Spatially resolved protein hydrogen exchange measured by matrix-assisted laser desorption ionization in-source decay

    DEFF Research Database (Denmark)

    Rand, Kasper D; Bache, Nicolai; Nedertoft, Morten M

    2011-01-01

    Mass spectrometry has become a powerful tool for measuring protein hydrogen exchange and thereby reveal the structural dynamics of proteins in solution. Here we describe the successful application of a matrix-assisted laser desorption ionization (MALDI) mass spectrometry approach based on in......-source decay (ISD) to measure spatially resolved amide backbone hydrogen exchange. By irradiating deuterated protein molecules in a crystalline matrix with a high laser fluence, they undergo prompt fragmentation. Spatially resolved deuteration levels are readily obtained by mass analysis of consecutive...... fragment ions. MALDI ISD analysis of deuterated cytochrome c yielded an extensive series of c-fragment ions which originate from cleavage of nearly all N-C(α) bonds (Cys17 to Glu104) allowing for a detailed analysis of the deuterium content of the backbone amides. While hydrogen scrambling can be major...

  9. Receptor tyrosine phosphatase beta is expressed in the form of proteoglycan and binds to the extracellular matrix protein tenascin

    DEFF Research Database (Denmark)

    Barnea, G; Grumet, M; Milev, P

    1994-01-01

    immunohistochemical studies indicated that both RPTP beta and the extracellular matrix protein tenascin are localized in similar regions of the central nervous system. We have performed co-aggregation assays with red and green Co-vaspheres coated with tenascin and 3F8 PG, respectively, showing that the extracellular......The extracellular domain of receptor type protein tyrosine phosphatase beta (RPTP beta) exhibits striking sequence similarity with a soluble, rat brain chondroitin sulfate proteoglycan (3F8 PG). Immunoprecipitation experiments of cells transfected with RPTP beta expression vector and metabolically...... domain of RPTP beta (3F8 PG) binds specifically to tenascin. The interaction between a receptor tyrosine phosphatase and an extracellular matrix protein may have a role in development of the mammalian central nervous system....

  10. Pigments and proteins in green bacterial chlorosomes studied by matrix-assisted laser desorption ionization mass spectrometry

    DEFF Research Database (Denmark)

    Persson, S; Sönksen, C P; Frigaard, N-U

    2000-01-01

    We have used matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) for mass determination of pigments and proteins in chlorosomes, the light-harvesting organelles from the photosynthetic green sulfur bacterium Chlorobium tepidum. By applying a small volume (1...... homologs in a small amount of green bacterial cells. In addition to information on pigments, the MALDI spectra also contained peaks from chlorosome proteins. Thus we have been able with high precision to confirm the molecular masses of the chlorosome proteins CsmA and CsmE which have been previously...

  11. Human osteoblast-like cells respond to mechanical strain with increased bone matrix protein production independent of hormonal regulation

    Science.gov (United States)

    Harter, L. V.; Hruska, K. A.; Duncan, R. L.

    1995-01-01

    Exposure of osteosarcoma cell lines to chronic intermittent strain increases the activity of mechano-sensitive cation (SA-cat) channels. The impact of mechano-transduction on osteoblast function has not been well studied. We analyzed the expression and production of bone matrix proteins in human osteoblast-like osteosarcoma cells, OHS-4, in response to chronic intermittent mechanical strain. The OHS-4 cells exhibit type I collagen production, 1,25-Dihydroxyvitamin D-inducible osteocalcin, and mineralization of the extracellular matrix. The matrix protein message level was determined from total RNA isolated from cells exposed to 1-4 days of chronic intermittent strain. Northern analysis for type I collagen indicated that strain increased collagen message after 48 h. Immunofluorescent labeling of type I collagen demonstrated that secretion was also enhanced with mechanical strain. Osteopontin message levels were increased several-fold by the application of mechanical load in the absence of vitamin D, and the two stimuli together produced an additive effect. Osteocalcin secretion was also increased with cyclic strain. Osteocalcin levels were not detectable in vitamin D-untreated control cells. However, after 4 days of induced load, significant levels of osteocalcin were observed in the medium. With vitamin D present, osteocalcin levels were 4 times higher in the medium of strained cells compared to nonstrained controls. We conclude that mechanical strain of osteoblast-like cells is sufficient to increase the transcription and secretion of matrix proteins via mechano-transduction without hormonal induction.

  12. Airway remodelling and inflammation in asthma are dependent on the extracellular matrix protein fibulin-1c.

    Science.gov (United States)

    Liu, Gang; Cooley, Marion A; Nair, Prema M; Donovan, Chantal; Hsu, Alan C; Jarnicki, Andrew G; Haw, Tatt Jhong; Hansbro, Nicole G; Ge, Qi; Brown, Alexandra C; Tay, Hock; Foster, Paul S; Wark, Peter A; Horvat, Jay C; Bourke, Jane E; Grainge, Chris L; Argraves, W Scott; Oliver, Brian G; Knight, Darryl A; Burgess, Janette K; Hansbro, Philip M

    2017-12-01

    Asthma is a chronic inflammatory disease of the airways. It is characterized by allergic airway inflammation, airway remodelling, and airway hyperresponsiveness (AHR). Asthma patients, in particular those with chronic or severe asthma, have airway remodelling that is associated with the accumulation of extracellular matrix (ECM) proteins, such as collagens. Fibulin-1 (Fbln1) is an important ECM protein that stabilizes collagen and other ECM proteins. The level of Fbln1c, one of the four Fbln1 variants, which predominates in both humans and mice, is increased in the serum and airways fluids in asthma but its function is unclear. We show that the level of Fbln1c was increased in the lungs of mice with house dust mite (HDM)-induced chronic allergic airway disease (AAD). Genetic deletion of Fbln1c and therapeutic inhibition of Fbln1c in mice with chronic AAD reduced airway collagen deposition, and protected against AHR. Fbln1c-deficient (Fbln1c -/- ) mice had reduced mucin (MUC) 5 AC levels, but not MUC5B levels, in the airways as compared with wild-type (WT) mice. Fbln1c interacted with fibronectin and periostin that was linked to collagen deposition around the small airways. Fbln1c -/- mice with AAD also had reduced numbers of α-smooth muscle actin-positive cells around the airways and reduced airway contractility as compared with WT mice. After HDM challenge, these mice also had fewer airway inflammatory cells, reduced interleukin (IL)-5, IL-13, IL-33, tumour necrosis factor (TNF) and CXCL1 levels in the lungs, and reduced IL-5, IL-33 and TNF levels in lung-draining lymph nodes. Therapeutic targeting of Fbln1c reduced the numbers of GATA3-positive Th2 cells in the lymph nodes and lungs after chronic HDM challenge. Treatment also reduced the secretion of IL-5 and IL-13 from co-cultured dendritic cells and T cells restimulated with HDM extract. Human epithelial cells cultured with Fbln1c peptide produced more CXCL1 mRNA than medium-treated controls. Our data show

  13. Can microbes compete with cows for sustainable protein production - A feasibility study on high quality protein

    DEFF Research Database (Denmark)

    Vestergaard, Mike; Chan, Siu Hung Joshua; Jensen, Peter Ruhdal

    2016-01-01

    An increasing population and their increased demand for high-protein diets will require dramatic changes in the food industry, as limited resources and environmental issues will make animal derived foods and proteins, gradually more unsustainable to produce. To explore alternatives to animal...... derived proteins, an economic model was built around the genome-scale metabolic network of E. coli to study the feasibility of recombinant protein production as a food source. Using a novel model, we predicted which microbial production strategies are optimal for economic return, by capturing the tradeoff...... between the market prices of substrates, product output and the efficiency of microbial production. A case study with the food protein, Bovine Alpha Lactalbumin was made to evaluate the upstream economic feasibilities. Simulations with different substrate profiles at maximum productivity were used...

  14. Some effects of enamel matrix proteins on wound healing in the dento-gingival region.

    Science.gov (United States)

    Wennström, Jan L; Lindhe, Jan

    2002-01-01

    The aim of the present study was to evaluate by clinical means the effect of enamel matrix proteins on the healing of a soft tissue wound produced by periodontal pocket instrumentation. The study was performed as an intra-individual, longitudinal trial of 3 weeks duration with a double-masked, split-mouth, placebo-controlled and randomized design. The patient material was comprised of 28 subjects with moderately advanced, chronic periodontitis. Each patient presented with 3 sites in each of 2 jaw quadrants with a probing pocket depth (PPD) of >or=5 mm and bleeding following pocket probing (BoP). Baseline examination, including assessments of plaque, gingival inflammation, PPD, BoP and root dentin sensitivity, was carried out one week after oral hygiene instruction and careful self-performed plaque control. All experimental sites were scaled and root planed, and the soft tissue wall of the pocket was curetted to remove the pocket epithelium and adjacent granulation tissue. The site was carefully irrigated with saline. When the bleeding from the pocket had ceased, a 24% EDTA gel was applied in the site and retained for 2 min. This was followed by careful irrigation with saline. Left and right jaw quadrants were then randomized to subgingival application of enamel matrix derivative (Emdogain) or vehicle-control. All sites were re-examined after 1, 2 and 3 weeks. In addition, a visual analogue scale (VAS) was used to score the degree of post-treatment discomfort. The primary endpoints of treatment success were defined as (i) pocket closure (PPD Emdogain at 1 week and at 2% of the control sites (p=0.001). At 2 weeks, the corresponding figures were 25% versus 12% (p =0.028). Absence of BoP was at 1 week 57% for the Emdogain treated sites compared to 35% for the control sites (p=0.003). At 2 weeks, this endpoint was reached in 73% and 59% of the test and control sites, respectively (p=0.051). In terms of the endpoint defined for probing pocket depth, PPD Emdogain treated

  15. Fitting evolution of matrix protein 1 from influenza A virus using analytical solution of system of differential equations.

    Science.gov (United States)

    Yan, Shaomin; Li, Zhenchong; Wu, Guang

    2010-04-01

    The understanding of evolutionary mechanism is important, and equally important is to describe the evolutionary process. If so, we would know where the biological evolution will go. At species level, we would know whether and when a species will extinct or be prosperous. At protein level, we would know when a protein family will mutate more. In our previous study, we explored the possibility of using the differential equation to describe the evolution of protein family from influenza A virus based on the assumption that the mutation process is the exchange of entropy between protein family and its environment. In this study, we use the analytical solution of system of differential equations to fit the evolution of matrix protein 1 family from influenza A virus. Because the evolutionary process goes along the time course, it can be described by differential equation. The results show that the evolution of a protein family can be fitted by the analytical solution. With the obtained fitted parameters, we may predict the evolution of matrix protein 1 family from influenza A virus. Our model would be the first step towards the systematical modeling of biological evolution and paves the way for further modeling.

  16. EcmPred: Prediction of extracellular matrix proteins based on random forest with maximum relevance minimum redundancy feature selection

    KAUST Repository

    Kandaswamy, Krishna Kumar Umar

    2013-01-01

    The extracellular matrix (ECM) is a major component of tissues of multicellular organisms. It consists of secreted macromolecules, mainly polysaccharides and glycoproteins. Malfunctions of ECM proteins lead to severe disorders such as marfan syndrome, osteogenesis imperfecta, numerous chondrodysplasias, and skin diseases. In this work, we report a random forest approach, EcmPred, for the prediction of ECM proteins from protein sequences. EcmPred was trained on a dataset containing 300 ECM and 300 non-ECM and tested on a dataset containing 145 ECM and 4187 non-ECM proteins. EcmPred achieved 83% accuracy on the training and 77% on the test dataset. EcmPred predicted 15 out of 20 experimentally verified ECM proteins. By scanning the entire human proteome, we predicted novel ECM proteins validated with gene ontology and InterPro. The dataset and standalone version of the EcmPred software is available at http://www.inb.uni-luebeck.de/tools-demos/Extracellular_matrix_proteins/EcmPred. © 2012 Elsevier Ltd.

  17. Healing of periodontal defects treated with enamel matrix proteins and root surface conditioning--an experimental study in dogs.

    Science.gov (United States)

    Sakallioğlu, Umur; Açikgöz, Gökhan; Ayas, Bülent; Kirtiloğlu, Tuğrul; Sakallioğlu, Eser

    2004-05-01

    Application of enamel matrix proteins has been introduced as an alternative method for periodontal regenerative therapy. It is claimed that this approach provides periodontal regeneration by a biological approach, i.e. creating a matrix on the root surfaces that promotes cementum, periodontal ligament (PDL) and alveolar bone regeneration, thus mimicking the events occurring during tooth development. Although there have been numerous in vitro and in vivo studies demonstrating periodontal regeneration, acellular cementum formation and clinical outcomes via enamel matrix proteins usage, their effects on the healing pattern of soft and hard periodontal tissues are not well-established and compared with root conditioning alone. In the present study, the effects of Emdogain (Biora, Malmö, Sweden), an enamel matrix derivative mainly composed of enamel matrix proteins (test), on periodontal wound healing were evaluated and compared with root surface conditioning (performed with 36% orthophosphoric acid) alone (control) histopathologically and histomorphometrically by means of the soft and hard tissue profile of periodontium. An experimental periodontitis model performed at premolar teeth of four dogs were used in the study and the healing pattern of periodontal tissues was evaluated at days 7, 14, 21, 28 (one dog at each day), respectively. At day 7, soft tissue attachment evaluated by means of connective tissue and/or epithelial attachment to the root surfaces revealed higher connective tissue attachment rate in the test group and the amount of new connective tissue proliferation in the test group was significantly greater than the control group (p0.05). A firm attachment of acellular cementum to the root dentin with functional organization of its collagen fibers was noted, and, the accumulation and organization of cellular cementum in the control group was more irregular than the cellular cementum formed in the test group. The amount of new bone was 2.41+/-0.75 mm in

  18. Sustainability

    OpenAIRE

    Harris, Nora; Shealy, Tripp; Klotz, Leidy

    2016-01-01

    Across fields, more sustainable and resilient outcomes are being realized through a whole systems design perspective, which guides decision-makers to consider the entire system affected including interdependent physical and social networks. Although infrastructure is extremely interdependent, consisting of diverse stakeholders and networks, the infrastructure design and construction process is often fragmented. This fragmentation can result in unnecessary tradeoffs, leading to poor outcomes f...

  19. Principles of hydrogen radical mediated peptide/protein fragmentation during matrix-assisted laser desorption/ionization mass spectrometry.

    Science.gov (United States)

    Asakawa, Daiki

    2016-07-01

    Matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) is a very easy way to obtain large sequence tags and, thereby, reliable identification of peptides and proteins. Recently discovered new matrices have enhanced the MALDI-ISD yield and opened new research avenues. The use of reducing and oxidizing matrices for MALDI-ISD of peptides and proteins favors the production of fragmentation pathways involving "hydrogen-abundant" and "hydrogen-deficient" radical precursors, respectively. Since an oxidizing matrix provides information on peptide/protein sequences complementary to that obtained with a reducing matrix, MALDI-ISD employing both reducing and oxidizing matrices is a potentially useful strategy for de novo peptide sequencing. Moreover, a pseudo-MS(3) method provides sequence information about N- and C-terminus extremities in proteins and allows N- and C-terminal side fragments to be discriminated within the complex MALDI-ISD mass spectrum. The combination of high mass resolution of a Fourier transform-ion cyclotron resonance (FTICR) analyzer and the software suitable for MALDI-ISD facilitates the interpretation of MALDI-ISD mass spectra. A deeper understanding of the MALDI-ISD process is necessary to fully exploit this method. Thus, this review focuses first on the mechanisms underlying MALDI-ISD processes, followed by a discussion of MALDI-ISD applications in the field of proteomics. © 2014 Wiley Periodicals, Inc., Mass Spec Rev 35:535-556, 2016. © 2014 Wiley Periodicals, Inc.

  20. Smart sustainable bottle (SSB) system for E. coli based recombinant protein production.

    Science.gov (United States)

    Li, Zhaopeng; Carstensen, Bettina; Rinas, Ursula

    2014-11-05

    Recombinant proteins are usually required in laboratories interested in the protein but not in the production process itself. Thus, technical equipment which is easy to handle and straight forward protein production procedures are of great benefit to those laboratories. Companies selling single use cultivation bags and bioreactors are trying to satisfy at least part of these needs. However, single-use systems can contribute to major costs which might be acceptable when "good manufacturing practices" are required but not acceptable for most laboratories facing tight funding. The assembly and application of a simple self-made "smart sustainable bottle" (SSB) system for E. coli based protein production is presented. The core of the SSB system is a 2-L glass bottle which is operated at constant temperature, air flow, and stirrer speed without measurement and control of pH and dissolved oxygen. Oxygen transfer capacities are in the range as in conventional bioreactors operated at intermediate aeration rates and by far exceed those found in conventional shaking flasks and disposable bioreactors. The SSB system was applied for the production of various recombinant proteins using T7-based expression systems and a defined autoinduction medium. The production performance regarding amount and solubility of proteins with robust and delicate properties was as good as in state-of-the-art stirred tank commercial bioreactors. The SSB system represents a low cost protein production device applicable for easy, effective, and reproducible recombinant protein production.

  1. Can microbes compete with cows for sustainable protein production - A feasibility study on high quality protein

    Science.gov (United States)

    Vestergaard, Mike; Chan, Siu Hung Joshua; Jensen, Peter Ruhdal

    2016-11-01

    An increasing population and their increased demand for high-protein diets will require dramatic changes in the food industry, as limited resources and environmental issues will make animal derived foods and proteins, gradually more unsustainable to produce. To explore alternatives to animal derived proteins, an economic model was built around the genome-scale metabolic network of E. coli to study the feasibility of recombinant protein production as a food source. Using a novel model, we predicted which microbial production strategies are optimal for economic return, by capturing the tradeoff between the market prices of substrates, product output and the efficiency of microbial production. A case study with the food protein, Bovine Alpha Lactalbumin was made to evaluate the upstream economic feasibilities. Simulations with different substrate profiles at maximum productivity were used to explore the feasibility of recombinant Bovine Alpha Lactalbumin production coupled with market prices of utilized materials. We found that recombinant protein production could be a feasible food source and an alternative to traditional sources.

  2. Can microbes compete with cows for sustainable protein production - A feasibility study on high quality protein.

    Science.gov (United States)

    Vestergaard, Mike; Chan, Siu Hung Joshua; Jensen, Peter Ruhdal

    2016-11-08

    An increasing population and their increased demand for high-protein diets will require dramatic changes in the food industry, as limited resources and environmental issues will make animal derived foods and proteins, gradually more unsustainable to produce. To explore alternatives to animal derived proteins, an economic model was built around the genome-scale metabolic network of E. coli to study the feasibility of recombinant protein production as a food source. Using a novel model, we predicted which microbial production strategies are optimal for economic return, by capturing the tradeoff between the market prices of substrates, product output and the efficiency of microbial production. A case study with the food protein, Bovine Alpha Lactalbumin was made to evaluate the upstream economic feasibilities. Simulations with different substrate profiles at maximum productivity were used to explore the feasibility of recombinant Bovine Alpha Lactalbumin production coupled with market prices of utilized materials. We found that recombinant protein production could be a feasible food source and an alternative to traditional sources.

  3. Matrix metalloproteinase-20 mediates dental enamel biomineralization by preventing protein occlusion inside apatite crystals

    Science.gov (United States)

    Prajapati, Saumya; Tao, Jinhui; Ruan, Qichao; De Yoreo, James J.; Moradian-Oldak, Janet

    2015-01-01

    Reconstruction of enamel-like materials is a central topic of research in dentistry and material sciences. The importance of precise proteolytic mechanisms in amelogenesis to form a hard tissue with more than 95% mineral content has already been reported. A mutation in the Matrix Metalloproteinase-20 (MMP-20) gene results in hypomineralized enamel that is thin, disorganized and breaks from the underlying dentin. We hypothesized that the absence of MMP-20 during amelogenesis results in the occlusion of amelogenin in the enamel hydroxyapatite crystals. We used spectroscopy and electron microscopy techniques to qualitatively and quantitatively analyze occluded proteins within the isolated enamel crystals from MMP-20 null and Wild type (WT) mice. Our results showed that the isolated enamel crystals of MMP-20 null mice had more organic macromolecules occluded inside them than enamel crystals from the WT. The crystal lattice arrangements of MMP-20 null enamel crystals analyzed by High Resolution Transmission Electron Microscopy (HRTEM) were found to be significantly different from those of the WT. Raman studies indicated that the crystallinity of the MMP-20 null enamel crystals was lower than that of the WT. In conclusion, we present a novel functional mechanism of MMP-20, specifically prevention of unwanted organic material entrapped in the forming enamel crystals, which occurs as the result of precise amelogenin cleavage. MMP-20 action guides the growth morphology of the forming hydroxyapatite crystals and enhances their crystallinity. Elucidating such molecular mechanisms can be applied in the design of novel biomaterials for future clinical applications in dental restoration or repair. PMID:26513418

  4. Vitamin K-Dependent Carboxylation of Matrix Gla Protein Influences the Risk of Calciphylaxis.

    Science.gov (United States)

    Nigwekar, Sagar U; Bloch, Donald B; Nazarian, Rosalynn M; Vermeer, Cees; Booth, Sarah L; Xu, Dihua; Thadhani, Ravi I; Malhotra, Rajeev

    2017-06-01

    Matrix Gla protein (MGP) is a potent inhibitor of vascular calcification. The ability of MGP to inhibit calcification requires the activity of a vitamin K-dependent enzyme, which mediates MGP carboxylation. We investigated how MGP carboxylation influences the risk of calciphylaxis in adult patients receiving dialysis and examined the effects of vitamin K deficiency on MGP carboxylation. Our study included 20 patients receiving hemodialysis with calciphylaxis (cases) and 20 patients receiving hemodialysis without calciphylaxis (controls) matched for age, sex, race, and warfarin use. Cases had higher plasma levels of uncarboxylated MGP (ucMGP) and carboxylated MGP (cMGP) than controls. However, the fraction of total MGP that was carboxylated (relative cMGP concentration = cMGP/[cMGP + uncarboxylated MGP]) was lower in cases than in controls (0.58±0.02 versus 0.69±0.03, respectively; P =0.003). In patients not taking warfarin, cases had a similarly lower relative cMGP concentration. Each 0.1 unit reduction in relative cMGP concentration associated with a more than two-fold increase in calciphylaxis risk. Vitamin K deficiency associated with lower relative cMGP concentration in multivariable adjusted analyses ( β =-8.99; P =0.04). In conclusion, vitamin K deficiency-mediated reduction in relative cMGP concentration may have a role in the pathogenesis of calciphylaxis. Whether vitamin K supplementation can prevent and/or treat calciphylaxis requires further study. Copyright © 2017 by the American Society of Nephrology.

  5. Comparative analysis of extracellular matrix proteins in chronic pancreatitis: differences between pancreatic head and tail.

    Science.gov (United States)

    Muehling, B; Kolb, A; Ramadani, M; Schmidt, E; Gansauge, F; Beger, H G

    2004-03-01

    In patients with chronic pancreatitis (cP) with an inflammatory mass in the pancreatic head, the degree of fibrosis in the pancreatic head compared with the tail should be determined and differences in the expression pattern of collagen types I, III, and IV; laminin; vitronectin; and fibronectin should be evaluated. From 12 patients with alcohol-induced and idiopathic cP who underwent surgery due to local complications, 24 corresponding cP tissue samples from the pancreatic head and the resection margin were obtained. The degree of fibrosis was calculated using a computer-assisted method (Adobe Photo Shop). The expression pattern of extracellular matrix proteins (ECMPs) was investigated by immunostaining using the streptavidin-peroxidase technique. In each case, the degree of fibrosis was higher in the pancreatic head than in the resection margin. For alcohol-induced cP, the median degree of fibrosis in the head was 64% versus 47% in the resection margin, and for idiopathic cP, it was 40% versus 32%. Staining intensity of collagen type IV and laminin in the head was higher than in the resection surface. In degenerative tissue, collagen types I, III, and IV and laminin were moderately expressed, fibronectin was weakly expressed, and vitronectin was not expressed, with no differences between the head and resection margin. Basement membranes in the head and the resection margin predominantly consisted of collagen types I, III, and IV and laminin. In ductal epithelia, collagen type IV staining in the head was stronger than in the resection margin. In cP with an inflammatory mass in the head, the degree of fibrosis in the pancreatic head is higher than in the resection margin. Differences in the expression pattern of ECMPs could be detected for collagen type IV and laminin. These results underline the hypothesis of the pancreatic head being the pacemaker of cP in which collagen type IV and laminin may play an important role.

  6. Autogenous bone graft associated with enamel matrix proteins in bone repair.

    Science.gov (United States)

    Prata, Celina A; Lacerda, Suzie A; Brentegani, Luiz Guilherme

    2007-12-01

    Autogenous bone has been used with success as implants in intrabony defects, because of its biological advantages and osteogenic potential. The objective of this study was to evaluate histological and histometrically the bony repair in intrabony defects after dental extractions in rats with graft of a combination of the enamel matrix protein (EMP) (Emdogain, Strauman USA, LLC, Andover, MA. Headquarters in Basel, Switzerland) and autogenous bone. Male rats (Rattus norvegicus, Wistar variety) weighing from 250 to 300 g were anesthetized and submitted to the extraction of the superior incisive and divided in (a) group with autogenous bone (fragment of bone of the alveolar ridge was grafted inside the alveolus) and (b) group with autogenous bone associated with EMP. The animals were killed on the 7th, 21st, and 42nd day after the extraction. The maxillae were processed to obtain fine sections (5 microm) stained with hematoxylin-eosin. The percentual volume of bone tissue in contiguous areas of the graft was calculated through a counting point system of image. The results showed that the bone fragments grafted in the cervical third of the alveolus developed a progressive osseointegration without foreign-body reaction. The quantification of the bony repair in the areas adjacent to the graft showed that the autogenous bone associated with EMP produced a greater amount of bone (10%-15% by analysis of variance, P = 0.05) in all the studied periods. It was concluded that the autogenous bone associated with EMP grafted in bony defects, immediately after the dental extraction in rats, demonstrated biocompatibility and accelerated the repair of bone defect.

  7. Matrix Gla protein species and risk of cardiovascular events in type 2 diabetic patients.

    Science.gov (United States)

    Dalmeijer, Geertje W; van der Schouw, Yvonne T; Magdeleyns, Elke J; Vermeer, Cees; Verschuren, W M Monique; Boer, Jolanda M A; Beulens, Joline W J

    2013-11-01

    To investigate the relationship of circulating matrix Gla protein (MGP) species with incident cardiovascular disease (CVD) or coronary heart disease (CHD) in type 2 diabetic patients. EPIC-NL is a prospective cohort study among 40,011 Dutch men and women. At baseline (1993-1997), 518 participants were known to have type 2 diabetes. MGP levels were measured by ELISA techniques in baseline plasma samples. The incidence of fatal and nonfatal CVD and CVD subtypes-CHD, peripheral arterial disease (PAD), heart failure, and stroke-were obtained by linkage to national registers. Cox proportional hazard models were used to calculate hazard ratios (HRs), adjusted for sex, waist-to-hip ratio, physical activity, and history of CVD. During a median 11.2 years of follow-up, 160 cases of CVD were documented. Higher circulating desphospho-uncarboxylated MGP (dp-ucMGP) levels were significantly associated with higher risk of CVD, with an HR per SD (HRSD) of 1.21 (95% CI 1.06-1.38), PAD (HRSD 1.32 [95% CI 1.07-1.65]), and heart failure (HRSD 1.75 [95% CI 1.42-2.17]) after adjustment. Higher circulating dp-ucMGP levels were not related to risk of CHD (HRSD 1.12 [95% CI 0.94-1.34]) or stroke (HRSD 1.05 [95% CI 0.73-1.49]). Circulating desphospho-carboxylated MGP and circulating total-uncarboxylated MGP levels were not associated with CVD or CVD subtypes. High dp-ucMGP levels were associated with increased CVD risk among type 2 diabetic patients, especially with the subtypes PAD and heart failure, while other MGP species were not related to CVD risk. These results suggest that a poor vitamin K status is associated with increased CVD risk.

  8. Matrix metalloproteinase-20 mediates dental enamel biomineralization by preventing protein occlusion inside apatite crystals.

    Science.gov (United States)

    Prajapati, Saumya; Tao, Jinhui; Ruan, Qichao; De Yoreo, James J; Moradian-Oldak, Janet

    2016-01-01

    Reconstruction of enamel-like materials is a central topic of research in dentistry and material sciences. The importance of precise proteolytic mechanisms in amelogenesis to form a hard tissue with more than 95% mineral content has already been reported. A mutation in the Matrix Metalloproteinase-20 (MMP-20) gene results in hypomineralized enamel that is thin, disorganized and breaks from the underlying dentin. We hypothesized that the absence of MMP-20 during amelogenesis results in the occlusion of amelogenin in the enamel hydroxyapatite crystals. We used spectroscopy and electron microscopy techniques to qualitatively and quantitatively analyze occluded proteins within the isolated enamel crystals from MMP-20 null and Wild type (WT) mice. Our results showed that the isolated enamel crystals of MMP-20 null mice had more organic macromolecules occluded inside them than enamel crystals from the WT. The crystal lattice arrangements of MMP-20 null enamel crystals analyzed by High Resolution Transmission Electron Microscopy (HRTEM) were found to be significantly different from those of the WT. Raman studies indicated that the crystallinity of the MMP-20 null enamel crystals was lower than that of the WT. In conclusion, we present a novel functional mechanism of MMP-20, specifically prevention of unwanted organic material entrapped in the forming enamel crystals, which occurs as the result of precise amelogenin cleavage. MMP-20 action guides the growth morphology of the forming hydroxyapatite crystals and enhances their crystallinity. Elucidating such molecular mechanisms can be applied in the design of novel biomaterials for future clinical applications in dental restoration or repair. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Upregulation of intervertebral disc-cell matrix synthesis by pulsed electromagnetic field is mediated by bone morphogenetic proteins.

    Science.gov (United States)

    Okada, Motohiro; Kim, Jin Hwan; Hutton, William C; Yoon, Sangwook Tim

    2013-05-01

    An in vitro study on the effects of pulsed electromagnetic field (PEMF) on intervertebral disc-cell matrix synthesis. The objective of the study was to determine whether (1) PEMF can upregulate intervertebral disc-cell matrix synthesis and (2) any upregulation obtained is through transforming growth factor (TGF)-β or bone morphogenetic proteins (BMPs). PEMF has been reported to produce cell proliferation, enhance cell function, and upregulate matrix synthesis in cell types such as osteoblasts, chondroblasts, endothelial cells, and fibroblasts through the upregulation of several growth factors. PEMF has been used clinically in the treatment of delayed bone union. However, PEMF has never been tested on human intervertebral disc cells. The PEMF signal used was similar to that used in the clinical treatment of delayed fracture healing. Human disc cells were treated with PEMF for 8 hours per day for 3 days. Quantitative real-time polymerase chain reaction was performed to determine mRNA expression levels of aggrecan, collagen-2, TGF-β, BMP-2, and BMP-7. Sulfated glycosaminoglycan synthesis was analyzed using the dimethylmethylene blue (DMMB) method. Western blot analysis was performed to determine the protein levels of TGF-β, BMP-2, and BMP-7. To determine whether any action of PEMF was through BMP, recombinant human Noggin was used at a dose of 100 ng/mL to block BMP. PEMF could upregulate intervertebral disc-cell matrix synthesis. BMP-7 was markedly upregulated by PEMF and was upregulated much more than BMP-2. TGF-β was not upregulated by PEMF. The effect of PEMF on disc-cell matrix was entirely inhibited in the presence of Noggin. PEMF acts through BMPs to upregulate intervertebral disc-cell matrix synthesis.

  10. Proteomic analysis of the crayfish gastrolith chitinous extracellular matrix reveals putative protein complexes and a central role for GAP 65.

    Science.gov (United States)

    Glazer, Lilah; Roth, Ziv; Weil, Simy; Aflalo, Eliahu D; Khalaila, Isam; Sagi, Amir

    2015-10-14

    Chitin is a major component of arthropod cuticles, where it forms a three-dimensional network that constitutes the scaffold upon which cuticles form. The chitin fibers that form this network are closely associated with specific structural proteins, while the cuticular matrix contains many additional structural, enzymatic and other proteins. We study the crayfish gastrolith as a simple model for the assembly of calcified cuticular structures, with particular focus on the proteins involved in this process. The present study integrates a gastrolith-forming epithelium transcriptomic library with data from mass spectrometry analysis of proteins extracted from the gastrolith matrix to obtain a near-complete picture of gastrolith protein content. Using native protein separation we identified 24 matrix proteins, of which 14 are novel. Further analysis led to discovery of three putative protein complexes, all containing GAP 65 the most abundant gastrolith structural protein. Using immunological methods we further studied the role of GAP 65 in the gastrolith matrix and forming epithelium, as well as in the newly identified protein complexes. We propose that gastrolith matrix construction is a sequential process in which protein complexes are dynamically assembled and disassembled around GAP 65, thus changing their functional properties to perform each step in the construction process. The scientific interest on which this study is based arises from three main features of gastroliths: (1) Gastroliths possess partial analogy to cuticles both in structural and molecular properties, and may be regarded, with the appropriate reservations (see Introduction), as simple models for cuticle assembly. At the same time, gastroliths are terminally assembled during a well-defined period, which can be controlled in the laboratory, making them significantly easier to study than cuticles. (2) Gastroliths, like the crayfish exoskeleton, contain stable amorphous calcium carbonate (ACC) rather

  11. Biological mediators and periodontal regeneration: a review of enamel matrix proteins at the cellular and molecular levels.

    Science.gov (United States)

    Bosshardt, Dieter D

    2008-09-01

    Despite a large body of clinical and histological data demonstrating beneficial effects of enamel matrix proteins (EMPs) for regenerative periodontal therapy, it is less clear how the available biological data can explain the mechanisms underlying the supportive effects of EMPs. To analyse all available biological data of EMPs at the cellular and molecular levels that are relevant in the context of periodontal wound healing and tissue formation. A stringent systematic approach was applied using the key words "enamel matrix proteins" OR "enamel matrix derivative" OR "emdogain" OR "amelogenin". The literature search was performed separately for epithelial cells, gingival fibroblasts, periodontal ligament cells, cementoblasts, osteogenic/chondrogenic/bone marrow cells, wound healing, and bacteria. A total of 103 papers met the inclusion criteria. EMPs affect many different cell types. Overall, the available data show that EMPs have effects on: (1) cell attachment, spreading, and chemotaxis; (2) cell proliferation and survival; (3) expression of transcription factors; (4) expression of growth factors, cytokines, extracellular matrix constituents, and other macromolecules; and (5) expression of molecules involved in the regulation of bone remodelling. All together, the data analysis provides strong evidence for EMPs to support wound healing and new periodontal tissue formation.

  12. A Human Nuclear Shuttling Protein That Interacts with Human Immunodeficiency Virus Type 1 Matrix Is Packaged into Virions

    Science.gov (United States)

    Gupta, Kalpana; Ott, David; Hope, Thomas J.; Siliciano, Robert F.; Boeke, Jef D.

    2000-01-01

    Active nuclear import of the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC) is essential for the productive infection of nondividing cells. Nuclear import of the PIC is mediated by the HIV-1 matrix protein, which also plays several critical roles during viral entry and possibly during virion production facilitating the export of Pr55Gag and genomic RNA. Using a yeast two-hybrid screen, we identified a novel human virion-associated matrix-interacting protein (VAN) that is highly conserved in vertebrates and expressed in most human tissues. Its expression is upregulated upon activation of CD4+ T cells. VAN is efficiently incorporated into HIV-1 virions and, like matrix, shuttles between the nucleus and cytoplasm. Furthermore, overexpression of VAN significantly inhibits HIV-1 replication in tissue culture. We propose that VAN regulates matrix nuclear localization and, by extension, both nuclear import of the PIC and export of Pr55Gag and viral genomic RNA during virion production. Our data suggest that this regulatory mechanism reflects a more global process for regulation of nucleocytoplasmic transport. PMID:11090181

  13. Glomerular Protein Levels of Matrix Metalloproteinase-1 and Tissue Inhibitor of Metalloproteinase-1 Are Lower in Diabetic Subjects

    Science.gov (United States)

    Cornish, Toby C.; Bagnasco, Serena M.; Macgregor, Anne M.; Lu, Jie; Selvin, Elizabeth; Halushka, Marc K.

    2009-01-01

    Matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) regulate extracellular matrix turnover throughout the body, including in renal glomeruli. We investigated protein levels of multiple MMPs (MMP-1, MMP-2, MMP-3, and MMP-9) and TIMP-1 in glomeruli and investigated whether disease phenotypes were associated with levels of these proteins. Renal cortex was collected from 100 adult autopsy subjects arrayed across 17 tissue microarrays. Immunohistochemical staining intensity for each MMP and TIMP-1 was determined using quantitative color deconvolution techniques. We observed significantly decreased glomerular MMP-1 and TIMP-1 staining in subjects with diabetes, hypertension, and an estimated glomerular filtration rate contains online supplemental material at http://www.jhc.org. Please visit this article online to view these materials. (J Histochem Cytochem 57:995–1001, 2009) PMID:19506087

  14. Identification of Proteins with Potential Osteogenic Activity Present in the Water-Soluble Matrix Proteins from Crassostrea gigas Nacre Using a Proteomic Approach

    Directory of Open Access Journals (Sweden)

    Daniel V. Oliveira

    2012-01-01

    Full Text Available Nacre, when implanted in vivo in bones of dogs, sheep, mice, and humans, induces a biological response that includes integration and osteogenic activity on the host tissue that seems to be activated by a set of proteins present in the nacre water-soluble matrix (WSM. We describe here an experimental approach that can accurately identify the proteins present in the WSM of shell mollusk nacre. Four proteins (three gigasin-2 isoforms and a cystatin A2 were for the first time identified in WSM of Crassostrea gigas nacre using 2DE and LC-MS/MS for protein identification. These proteins are thought to be involved in bone remodeling processes and could be responsible for the biocompatibility shown between bone and nacre grafts. These results represent a contribution to the study of shell biomineralization process and opens new perspectives for the development of new nacre biomaterials for orthopedic applications.

  15. GOLGA2/GM130, cis-Golgi Matrix Protein, is a Novel Target of Anticancer Gene Therapy

    OpenAIRE

    Chang, Seung-Hee; Hong, Seong-Ho; Jiang, Hu-Lin; Minai-Tehrani, Arash; Yu, Kyeong-Nam; Lee, Jae-Ho; Kim, Ji-Eun; Shin, Ji-Young; Kang, Bitna; Park, Sungjin; Han, Kiwon; Chae, Chanhee; Cho, Myung-Haing

    2012-01-01

    Achievement of long-term survival of patients with lung cancer treated with conventional chemotherapy is still difficult for treatment of metastatic and advanced tumors. Despite recent progress in investigational therapies, survival rates are still disappointingly low and novel adjuvant and systemic therapies are urgently needed. A recently elucidated secretory pathway is attracting considerable interest as a promising anticancer target. The cis-Golgi matrix protein, GOLGA2/GM130, plays an im...

  16. Insoluble eggshell matrix proteins - their peptide mapping and partial characterization by capillary electrophoresis and high-performance liquid chromatography

    Czech Academy of Sciences Publication Activity Database

    Mikšík, Ivan; Charvátová, Jana; Eckhardt, Adam; Deyl, Zdeněk

    2003-01-01

    Roč. 24, č. 5 (2003), s. 843-852 ISSN 0173-0835 R&D Projects: GA ČR GA203/02/1467; GA ČR GA203/00/D032 Institutional research plan: CEZ:AV0Z5011922 Keywords : eggshell matrix protein * peptide mapping Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 4.040, year: 2003

  17. Land-based production of animal protein: impacts, efficiency, and sustainability.

    Science.gov (United States)

    Wu, Guoyao; Bazer, Fuller W; Cross, H Russell

    2014-11-01

    Land-based production of high-quality protein by livestock and poultry plays an important role in improving human nutrition, growth, and health, as well as economical and social developments worldwide. With exponential growth of the global population and marked rises in meat consumption per capita, demands for animal-source protein are expected to increase by 72% between 2013 and 2050. This raises concerns about the sustainability and environmental impacts of animal agriculture. An attractive solution to meeting the increasing needs for animal products and mitigating undesired effects of agricultural practices is to enhance the efficiency of animal growth, reproduction, and lactation. Breeding techniques may help achieve this goal, but have only met with limited success. A promising, mechanism-based approach is to optimize the proportion and amounts of amino acids in diets for maximizing whole-body protein synthesis and feed efficiency. Improvements in farm animal productivity will not only decrease the contamination of soils, groundwater, and air by excessive manure, but will also help sustain animal agriculture to produce high-quality protein for the expanding population in the face of diminishing resources. © 2014 New York Academy of Sciences.

  18. Extracellular matrix protein fibulin-1 plasma levels are associated with increased cardiovascular risk in chronic kidney disease

    DEFF Research Database (Denmark)

    Scholze, Alexandra

    INTRODUCTION AND AIMS: Fibulin-1 is one of the few extracellular matrix proteins present in blood in high concentrations. We aimed to define the relationship between plasma fibulin-1 levels and risk markers of cardiovascular disease in patients with chronic kidney disease. METHODS: Plasma fibulin-1...... was determined in patients with chronic kidney disease (n=32; median age, 63 years; inter-quartile range, 51 to 73 years). Serological biomarkers related to cardiovascular disease (fibrinogen, interleukin 6, C-reactive protein) were measured. Arterial applanation tonometry was used to determine central...... in chronic kidney disease....

  19. Poly(lactic-co-glycolic acid) devices: Production and applications for sustained protein delivery.

    Science.gov (United States)

    Lee, Parker W; Pokorski, Jonathan K

    2018-03-13

    Injectable or implantable poly(lactic-co-glycolic acid) (PLGA) devices for the sustained delivery of proteins have been widely studied and utilized to overcome the necessity of repeated administrations for therapeutic proteins due to poor pharmacokinetic profiles of macromolecular therapies. These devices can come in the form of microparticles, implants, or patches depending on the disease state and route of administration. Furthermore, the release rate can be tuned from weeks to months by controlling the polymer composition, geometry of the device, or introducing additives during device fabrication. Slow-release devices have become a very powerful tool for modern medicine. Production of these devices has initially focused on emulsion-based methods, relying on phase separation to encapsulate proteins within polymeric microparticles. Process parameters and the effect of additives have been thoroughly researched to ensure protein stability during device manufacturing and to control the release profile. Continuous fluidic production methods have also been utilized to create protein-laden PLGA devices through spray drying and electrospray production. Thermal processing of PLGA with solid proteins is an emerging production method that allows for continuous, high-throughput manufacturing of PLGA/protein devices. Overall, polymeric materials for protein delivery remain an emerging field of research for the creation of single administration treatments for a wide variety of disease. This review describes, in detail, methods to make PLGA devices, comparing traditional emulsion-based methods to emerging methods to fabricate protein-laden devices. This article is categorized under: Biology-Inspired Nanomaterials > Protein and Virus-Based Structures Implantable Materials and Surgical Technologies > Nanomaterials and Implants Biology-Inspired Nanomaterials > Peptide-Based Structures. © 2018 Wiley Periodicals, Inc.

  20. Overexpression of Dentin matrix protein 1 in Nestin+cells causes bone loss in mouse long bone.

    Science.gov (United States)

    Pan, Min; Weng, Yuteng; Sun, Yao

    2017-08-19

    The well-known matrix protein Dentin matrix protein 1 (DMP1) is expressed by osteoblasts and osteocytes in bone, and it controls bone mineralization. Recently, it has been found that DMP1 is also expressed in other cell types, such as chondrocytes. Nestin + cells are one important type of progenitor cell in bone marrow and are associated with bone remodeling. In our preliminary experiment, DMP1 could also be detected in Nestin + cells in bone marrow. This study was designed to explore the effect on bone of DMP1 in Nestin + cells. A transgenic mouse model with DMP1 expression driven by the Nestin promoter was generated. In vivo and in vitro experiments revealed that overexpression of DMP1 in Nestin + cells could limit the proliferation and osteogenic differentiation of BMMSCs, subsequently leading to decreased bone mass. Lower expression of bone matrix protein and a lower bone deposition rate were also observed. Meanwhile, overexpression of DMP1 in Nestin + cells had no influence on osteoclast activity. These data indicate that DMP1 plays negative roles in differentiation of Nestin + cells and bone formation. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Novel serological neo-epitope markers of extracellular matrix proteins for the detection of portal hypertension

    DEFF Research Database (Denmark)

    Leeming, Diana Julie; Karsdal, M A; Byrjalsen, I

    2013-01-01

    The hepatic venous pressure gradient (HVPG) is an invasive, but important diagnostic and prognostic marker in cirrhosis with portal hypertension (PHT). During cirrhosis, remodelling of fibrotic tissue by matrix metalloproteinases (MMPs) is a permanent process generating small fragments of degrade...

  2. Transient association of MCM complex proteins with the nuclear matrix during initiation of mammalian DNA replication.

    Science.gov (United States)

    Hesketh, Emma L; Knight, John R P; Wilson, Rosemary H C; Chong, James P J; Coverley, Dawn

    2015-01-01

    The minichromosome maintenance complex (MCM2-7) is the putative DNA helicase in eukaryotes, and essential for DNA replication. By applying serial extractions to mammalian cells synchronized by release from quiescence, we reveal dynamic changes to the sub-nuclear compartmentalization of MCM2 as cells pass through late G1 and early S phase, identifying a brief window when MCM2 becomes transiently attached to the nuclear-matrix. The data distinguish 3 states that correspond to loose association with chromatin prior to DNA replication, transient highly stable binding to the nuclear-matrix coincident with initiation, and a post-initiation phase when MCM2 remains tightly associated with chromatin but not the nuclear-matrix. The data suggests that functional MCM complex loading takes place at the nuclear-matrix.

  3. Complexes of vesicular stomatitis virus matrix protein with host Rae1 and Nup98 involved in inhibition of host transcription.

    Science.gov (United States)

    Rajani, Karishma R; Pettit Kneller, Elizabeth L; McKenzie, Margie O; Horita, David A; Chou, Jeff W; Lyles, Douglas S

    2012-09-01

    Vesicular stomatitis virus (VSV) suppresses antiviral responses in infected cells by inhibiting host gene expression at multiple levels, including transcription, nuclear cytoplasmic transport, and translation. The inhibition of host gene expression is due to the activity of the viral matrix (M) protein. Previous studies have shown that M protein interacts with host proteins Rae1 and Nup98 that have been implicated in regulating nuclear-cytoplasmic transport. However, Rae1 function is not essential for host mRNA transport, raising the question of how interaction of a viral protein with a host protein that is not essential for gene expression causes a global inhibition at multiple levels. We tested the hypothesis that there may be multiple M protein-Rae1 complexes involved in inhibiting host gene expression at multiple levels. Using size exclusion chromatography and sedimentation velocity analysis, it was determined that Rae1 exists in high, intermediate, and low molecular weight complexes. The intermediate molecular weight complexes containing Nup98 interacted most efficiently with M protein. The low molecular weight form also interacted with M protein in cells that overexpress Rae1 or cells in which Nup98 expression was silenced. Silencing Rae1 expression had little if any effect on nuclear accumulation of host mRNA in VSV-infected cells, nor did it affect VSV's ability to inhibit host translation. Instead, silencing Rae1 expression reduced the ability of VSV to inhibit host transcription. M protein interacted efficiently with Rae1-Nup98 complexes associated with the chromatin fraction of host nuclei, consistent with an effect on host transcription. These results support the idea that M protein-Rae1 complexes serve as platforms to promote the interaction of M protein with other factors involved in host transcription. They also support the idea that Rae1-Nup98 complexes play a previously under-appreciated role in regulation of transcription.

  4. Complexes of vesicular stomatitis virus matrix protein with host Rae1 and Nup98 involved in inhibition of host transcription.

    Directory of Open Access Journals (Sweden)

    Karishma R Rajani

    2012-09-01

    Full Text Available Vesicular stomatitis virus (VSV suppresses antiviral responses in infected cells by inhibiting host gene expression at multiple levels, including transcription, nuclear cytoplasmic transport, and translation. The inhibition of host gene expression is due to the activity of the viral matrix (M protein. Previous studies have shown that M protein interacts with host proteins Rae1 and Nup98 that have been implicated in regulating nuclear-cytoplasmic transport. However, Rae1 function is not essential for host mRNA transport, raising the question of how interaction of a viral protein with a host protein that is not essential for gene expression causes a global inhibition at multiple levels. We tested the hypothesis that there may be multiple M protein-Rae1 complexes involved in inhibiting host gene expression at multiple levels. Using size exclusion chromatography and sedimentation velocity analysis, it was determined that Rae1 exists in high, intermediate, and low molecular weight complexes. The intermediate molecular weight complexes containing Nup98 interacted most efficiently with M protein. The low molecular weight form also interacted with M protein in cells that overexpress Rae1 or cells in which Nup98 expression was silenced. Silencing Rae1 expression had little if any effect on nuclear accumulation of host mRNA in VSV-infected cells, nor did it affect VSV's ability to inhibit host translation. Instead, silencing Rae1 expression reduced the ability of VSV to inhibit host transcription. M protein interacted efficiently with Rae1-Nup98 complexes associated with the chromatin fraction of host nuclei, consistent with an effect on host transcription. These results support the idea that M protein-Rae1 complexes serve as platforms to promote the interaction of M protein with other factors involved in host transcription. They also support the idea that Rae1-Nup98 complexes play a previously under-appreciated role in regulation of transcription.

  5. Electrochemistry and biosensing reactivity of heme proteins adsorbed on the structure-tailored mesoporous Nb2O5 matrix

    International Nuclear Information System (INIS)

    Xu Xin; Tian Bozhi; Zhang Song; Kong Jilie; Zhao Dongyuan; Liu Baohong

    2004-01-01

    The highly ordered mesoporous niobium oxides fabricated by self-adjusted synthesis have been used as immobilization matrices of heme proteins including Cytochrome c (Cyt C) and horseradish peroxidase (HRP) for their large surface areas, narrow pore size distributions and good biocompatibility. The assembling process was investigated by cyclic voltammetry, amperometry and potential step chronoamperometry in details. Niobium oxide matrices with different structural features were templated with the surfactants and the selectivity of these hosts to specific protein characteristics was determined. It was observed that proteins could be readily assembled onto the mesoporous films with detectable retention of bioactivity. The Nb 2 O 5 matrix with a tailored pore size and counterpoised surface charge to that of hemes allowed for a maximum adsorption capacity of biomolecules. The adsorbed redox molecules exhibited direct electrochemical behavior and gave a pair of well-defined quasi-reversible cyclic voltammetric peaks, indicating that the mesoporous niobium oxide matrix could effectively promote the direct electron transfer between the protein redox site adsorbed and the electrode surface. The midpoint redox potentials of adsorbed Cyt-c and HRP were 14 and -122 mV versus SCE, respectively. Furthermore, the immobilized HRP onto Nb 2 O 5 derived electrode presented good bioactivity and thus was fabricated as an amperometric biosensor for the response of hydrogen peroxide in the range from 0.1 μM to 0.1 mM

  6. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  7. Formulation and evaluation of sustained release matrix tablets of pioglitazone hydrochloride using processed Aloe vera mucilage as release modifier

    Directory of Open Access Journals (Sweden)

    Manoj Choudhary

    2015-01-01

    Full Text Available Background: Natural gums and mucilage which hydrates and swells on contact with aqueous media are used as additives in the formulation of hydrophilic drug delivery system. Aim: The purpose of this study was to develop a new monolithic matrix system for complete delivery of Pioglitazone hydrochloride (HCl, in a zero-order manner over an extended time period using processed Aloe vera gel mucilage (PAG as a release modifier. Materials and Methods: The matrices were prepared by dry blending of selected ratios of polymer and ingredients using direct compression technique. Physicochemical properties of dried powdered mucilage of A. vera were studied. Various formulations of pioglitazone HCl and A. vera mucilage were prepared using different drug: Polymer ratios viz., 1:1, 1:2, 1:3, 1:4, 1:5 for PAG by direct compression technique. Results: The formulated matrix tablets were found to have better uniformity of weight and drug content with low statistical deviation. The swelling behavior and in vitro release rate characteristics were also studied. Conclusion: The study proved that the dried A. vera mucilage can be used as a matrix forming material for controlled release of Pioglitazone HCl matrix tablets.

  8. Bicontinuous cubic liquid crystals as sustained delivery systems for peptides and proteins.

    Science.gov (United States)

    Rizwan, Shakila B; Boyd, Ben J; Rades, Thomas; Hook, Sarah

    2010-10-01

    Self-assembling lipid-based liquid crystalline systems are a broad and active area of research. Of these mesophases, the cubic phase with its highly twisted bilayer and two non-intersecting water channels has been investigated extensively for drug delivery. The cubic phase has been shown to accommodate and control the release of drugs with varying physicochemical properties. Also, the lipids used to prepare these delivery systems are generally cheap, safe and biodegradable, making these systems highly attractive. Early research investigating the potential of cubic phases as delivery systems showed that several peptides or proteins entrapped within these gel-based systems showed retarded release. Furthermore, entrapment within the cubic phase protected the selected peptide or protein from chemical and physical degradation with its native confirmation and bioactivity retained. In this review, the literature pertaining to the delivery of various bioactives from cubic liquid crystalline phases is examined, with a particular focus on peptides and proteins. The scope and limitations of the cubic phases in this respect and the future of cubic liquid crystalline systems as sustained delivery systems are highlighted. The reader will be able to gain an understanding of the properties of the bicontinuous cubic phase and how its structural attributes make these systems desirable for sustained delivery of bioactives, in particular peptides and proteins, but also how these same structural properties have hindered progress towards clinical applications. Current strategies to overcome these issues will also be discussed. The bicontinuous cubic phase offers great potential in the field of peptide and protein delivery, but limited research in this area precludes definite conclusions to its future in this respect.

  9. Nuclear Matrix protein SMAR1 represses HIV-1 LTR mediated transcription through chromatin remodeling

    International Nuclear Information System (INIS)

    Sreenath, Kadreppa; Pavithra, Lakshminarasimhan; Singh, Sandeep; Sinha, Surajit; Dash, Prasanta K.; Siddappa, Nagadenahalli B.; Ranga, Udaykumar; Mitra, Debashis; Chattopadhyay, Samit

    2010-01-01

    Nuclear Matrix and MARs have been implicated in the transcriptional regulation of host as well as viral genes but their precise role in HIV-1 transcription remains unclear. Here, we show that > 98% of HIV sequences contain consensus MAR element in their promoter. We show that SMAR1 binds to the LTR MAR and reinforces transcriptional silencing by tethering the LTR MAR to nuclear matrix. SMAR1 associated HDAC1-mSin3 corepressor complex is dislodged from the LTR upon cellular activation by PMA/TNFα leading to an increase in the acetylation and a reduction in the trimethylation of histones, associated with the recruitment of RNA Polymerase II on the LTR. Overexpression of SMAR1 lead to reduction in LTR mediated transcription, both in a Tat dependent and independent manner, resulting in a decreased virion production. These results demonstrate the role of SMAR1 in regulating viral transcription by alternative compartmentalization of LTR between the nuclear matrix and chromatin.

  10. A Simple Sonication Improves Protein Signal in Matrix-Assisted Laser Desorption Ionization Imaging

    Science.gov (United States)

    Lin, Li-En; Su, Pin-Rui; Wu, Hsin-Yi; Hsu, Cheng-Chih

    2018-02-01

    Proper matrix application is crucial in obtaining high quality matrix-assisted laser desorption ionization (MALDI) mass spectrometry imaging (MSI). Solvent-free sublimation was essentially introduced as an approach of homogeneous coating that gives small crystal size of the organic matrix. However, sublimation has lower extraction efficiency of analytes. Here, we present that a simple sonication step after the hydration in standard sublimation protocol significantly enhances the sensitivity of MALDI MSI. This modified procedure uses a common laboratory ultrasonicator to immobilize the analytes from tissue sections without noticeable delocalization. Improved imaging quality with additional peaks above 10 kDa in the spectra was thus obtained upon sonication treatment. [Figure not available: see fulltext.

  11. Matrix-assisted laser desorption/ionisation mass spectrometry imaging and its development for plant protein imaging

    Directory of Open Access Journals (Sweden)

    Millar A Harvey

    2011-07-01

    Full Text Available Abstract Matrix-Assisted Laser Desorption/Ionisation (MALDI mass spectrometry imaging (MSI uses the power of high mass resolution time of flight (ToF mass spectrometry coupled to the raster of lasers shots across the cut surface of tissues to provide new insights into the spatial distribution of biomolecules within biological tissues. The history of this technique in animals and plants is considered and the potential for analysis of proteins by this technique in plants is discussed. Protein biomarker identification from MALDI-MSI is a challenge and a number of different approaches to address this bottleneck are discussed. The technical considerations needed for MALDI-MSI are reviewed and these are presented alongside examples from our own work and a protocol for MALDI-MSI of proteins in plant samples.

  12. Structure and dynamics of Ebola virus matrix protein VP40 by a coarse-grained Monte Carlo simulation

    Science.gov (United States)

    Pandey, Ras; Farmer, Barry

    Ebola virus matrix protein VP40 (consisting of 326 residues) plays a critical role in viral assembly and its functions such as regulation of viral transcription, packaging, and budding of mature virions into the plasma membrane of infected cells. How does the protein VP40 go through structural evolution during the viral life cycle remains an open question? Using a coarse-grained Monte Carlo simulation we investigate the structural evolution of VP40 as a function of temperature with the input of a knowledge-based residue-residue interaction. A number local and global physical quantities (e.g. mobility profile, contact map, radius of gyration, structure factor) are analyzed with our large-scale simulations. Our preliminary data show that the structure of the protein evolves through different state with well-defined morphologies which can be identified and quantified via a detailed analysis of structure factor.

  13. Preparation of sustained release matrix pellets by melt agglomeration in the fluidized bed: influence of formulation variables and modelling of agglomerate growth.

    Science.gov (United States)

    Pauli-Bruns, Anette; Knop, Klaus; Lippold, Bernhard C

    2010-03-01

    The one-step preparation of sustained release matrix pellets, using a melting procedure in a fluidized bed apparatus, was tested in a 2(3) full factorial design of experiments, using microcrystalline wax as lipophilic binder, theophylline as model drug and talc as additional matrix forming agent. The three influence parameters were (A) size of binder particles, (B) fraction of theophylline in solid particles and (C) fraction of microcrystalline wax in formulation. The response variables were agglomerate size and size distribution, dissolution time, agglomerate crush resistance, sphericity, yield and porosity. Nearly spherical pellets comprising a smooth, closed surface could be obtained with the used method, exhibiting the hollow core typical for the immersion and layering mechanism. The reproducibility was very good concerning all responses. The size of agglomerates is proportional to the size of the binder particles, which serve as cores for pellet formation in the molten state in the fluidized bed. Additionally, the agglomerate size is influenced by the volume of the solid particles in relation to the binder particles, with more solid particles leading to larger agglomerates and vice versa. Dissolution times vary in a very wide range, resulting from the interplay between amount of drug in relation to the meltable matrix substance microcrystalline wax and the non-meltable matrix substance talc. The change of binder particle size does not lead to a structural change of the matrix; both dissolution times and porosity are not significantly altered. Agglomerate crush resistance is low due to the hollow core of the pellets. However, it is significantly increased if the volume fraction of microcrystalline wax in the matrix is high, which means that the matrix is mechanically better stabilized. A theoretical model has been established to quantitatively explain agglomerate growth and very good accordance of the full particle size distributions between predicted and

  14. Molecular energy dissipation in nanoscale networks of Dentin Matrix Protein 1 is strongly dependent on ion valence

    Science.gov (United States)

    Adams, J; Fantner, G E; Fisher, L W; Hansma, P K

    2008-01-01

    The fracture resistance of biomineralized tissues such as bone, dentin, and abalone is greatly enhanced through the nanoscale interactions of stiff inorganic mineral components with soft organic adhesive components. A proper understanding of the interactions that occur within the organic component, and between the organic and inorganic components, is therefore critical for a complete understanding of the mechanics of these tissues. In this paper, we use Atomic Force Microscope (AFM) force spectroscopy and dynamic force spectroscopy to explore the effect of ionic interactions within a nanoscale system consisting of networks of Dentin Matrix Protein 1 (DMP1) (a component of both bone and dentin organic matrix), a mica surface, and an AFM tip. We find that DMP1 is capable of dissipating large amounts of energy through an ion-mediated mechanism, and that the effectiveness increases with increasing ion valence. PMID:18843380

  15. Molecular energy dissipation in nanoscale networks of dentin matrix protein 1 is strongly dependent on ion valence

    Energy Technology Data Exchange (ETDEWEB)

    Adams, J; Fantner, G E; Hansma, P K [Department of Physics, Broida Hall, University of California, Santa Barbara, CA 93106 (United States); Fisher, L W [Craniofacial and Skeletal Diseases Branch, NIDCR, NIH, DHHS, Bethesda, MD 20892 (United States)], E-mail: adams@physics.ucsb.edu, E-mail: fantner@physics.ucsb.edu, E-mail: lfisher@dir.nidcr.nih.gov, E-mail: prasant@physics.ucsb.edu

    2008-09-24

    The fracture resistance of biomineralized tissues such as bone, dentin, and abalone is greatly enhanced through the nanoscale interactions of stiff inorganic mineral components with soft organic adhesive components. A proper understanding of the interactions that occur within the organic component, and between the organic and inorganic components, is therefore critical for a complete understanding of the mechanics of these tissues. In this paper, we use atomic force microscope (AFM) force spectroscopy and dynamic force spectroscopy to explore the effect of ionic interactions within a nanoscale system consisting of networks of dentin matrix protein 1 (DMP1) (a component of both bone and dentin organic matrix), a mica surface and an AFM tip. We find that DMP1 is capable of dissipating large amounts of energy through an ion-mediated mechanism, and that the effectiveness increases with increasing ion valence.

  16. Combined antiretroviral therapy attenuates hepatic extracellular matrix remodeling in HIV patients assessed by novel protein fingerprint markers

    DEFF Research Database (Denmark)

    Leeming, Diana J; Anadol, Evrim; Schierwagen, Robert

    2014-01-01

    OBJECTIVES: Combined antiretroviral therapy (cART) attenuates hepatic fibrosis in hepatitis C virus and HIV coinfected patients. However, the role of HIV or cART on hepatic fibrosis in HIV monoinfection is discussed controversially. During liver fibrosis, matrix metalloproteinases (MMPs) degrade...... extracellular matrix (ECM) proteins into small soluble fragments, which reflect hepatic remodeling processes. This study used these novel biomarkers to investigate the effect of HIV and cART on hepatic fibrosis remodeling. DESIGN: In 249 patients with HIV monoinfection and 55 healthy controls, the serum levels...... and fibrosis using transient elastography (Fibroscan). RESULTS: C3M, BGM, C4M and P4NP 7S were significantly elevated in HIV patients compared to controls and correlated to HIV viral loads and inversely to cART duration. C4M, P4NP 7S and ELM were lower in patients under cART therapy and in patients without HIV...

  17. ASH1L Suppresses Matrix Metalloproteinase through Mitogen-activated Protein Kinase Signaling Pathway in Pulpitis.

    Science.gov (United States)

    Bei, Yin; Tianqian, Hui; Fanyuan, Yu; Haiyun, Luo; Xueyang, Liao; Jing, Yang; Chenglin, Wang; Ling, Ye

    2017-02-01

    Pulpitis is an inflammation of dental pulp produced by a response to external stimuli. The response entails substantial cellular and molecular activities. Both genetic and epigenetic regulators contribute to the occurrence of pulpitis. However, the epigenetic mechanisms are still poorly understood. In this research, we studied the role of the absent, small, or homeotic-like (ASH1L) gene in the process of pulpitis. Human dental pulp cells (HDPCs) were stimulated with proinflammatory cytokine tumor necrosis factor alpha (TNF-α). Gene expression profiling was performed to assess the occurrence of epigenetic regulators. Pulp tissue from rat experimental pulpitis was subjected to immunofluorescence to detect the occurrence of ASH1L and trimethylation of lysine 4 histone 3 (H3K4me3). The presence of ASH1L in HDPCs that had been generated by TNF-α stimulation was analyzed by Western blot procedures and cellular immunofluorescence. Once detected, ASH1L was silenced through the use of specific small interfering RNA. The effects of ASH1L on the occurrence and operation of matrix metalloproteinases (MMPs) were then tested by analysis of quantitative polymerase chain reactions, Western blotting, and zymography. Chromatin immunoprecipitation was performed to detect whether ASH1L and H3K4me3 were present in the promoter regions of MMPs. We then used Western blot procedures to examine the nuclear factor kappa B and the mitogen-activated protein kinase (MAPK) responses to the silencing of ASH1L. We also examined the specific pathway involved in ASH1L regulation of the MMPs. After stimulating HDPCs with TNF-α, ASH1L emerged as 1 of the most strongly induced epigenetic mediators. We found that TNF-α treatment induced the expression of ASH1L through the nuclear factor kappa B and MAPK signal pathways. ASH1L was found in both the nucleus and the cytoplasm. TNF-α treatment was particularly active in inducing the accumulation of ASH1L in cellular cytoplasm. As is also consistent

  18. Long Polar Fimbriae of Enterohemorrhagic Escherichia coli O157:H7 Bind to Extracellular Matrix Proteins

    Science.gov (United States)

    Farfan, Mauricio J.; Cantero, Lidia; Vidal, Roberto; Botkin, Douglas J.; Torres, Alfredo G.

    2011-01-01

    Adherence to intestinal cells is a key process in infection caused by enterohemorrhagic Escherichia coli (EHEC). Several adhesion factors that mediate the binding of EHEC to intestinal cells have been described, but the receptors involved in their recognition are not fully characterized. Extracellular matrix (ECM) proteins might act as receptors involved in the recognition of enteric pathogens, including EHEC. In this study, we sought to characterize the binding of EHEC O157:H7 to ECM proteins commonly present in the intestine. We found that EHEC prototype strains as well as other clinical isolates adhered more abundantly to surfaces coated with fibronectin, laminin, and collagen IV. Further characterization of this phenotype, by using antiserum raised against the LpfA1 putative major fimbrial subunit and by addition of mannose, showed that a reduced binding of EHEC to ECM proteins was observed in a long polar fimbria (lpf) mutant. We also found that the two regulators, H-NS and Ler, had an effect in EHEC Lpf-mediated binding to ECM, supporting the roles of these tightly regulated fimbriae as adherence factors. Purified Lpf major subunit bound to all of the ECM proteins tested. Finally, increased bacterial adherence was observed when T84 cells, preincubated with ECM proteins, were infected with EHEC. Taken together, these findings suggest that the interaction of Lpf and ECM proteins contributes to the EHEC colonization of the gastrointestinal tract. PMID:21708988

  19. Receptor tyrosine phosphatase beta is expressed in the form of proteoglycan and binds to the extracellular matrix protein tenascin.

    Science.gov (United States)

    Barnea, G; Grumet, M; Milev, P; Silvennoinen, O; Levy, J B; Sap, J; Schlessinger, J

    1994-05-20

    The extracellular domain of receptor type protein tyrosine phosphatase beta (RPTP beta) exhibits striking sequence similarity with a soluble, rat brain chondroitin sulfate proteoglycan (3F8 PG). Immunoprecipitation experiments of cells transfected with RPTP beta expression vector and metabolically labeled with [35S]sulfate and [35S]methionine indicate that the transmembrane form of RPTP beta is indeed a chondroitin sulfate proteoglycan. The 3F8 PG is therefore a variant form composed of the entire extracellular domain of RPTP beta probably generated by alternative RNA splicing. Previous immunohistochemical studies indicated that both RPTP beta and the extracellular matrix protein tenascin are localized in similar regions of the central nervous system. We have performed co-aggregation assays with red and green Co-vaspheres coated with tenascin and 3F8 PG, respectively, showing that the extracellular domain of RPTP beta (3F8 PG) binds specifically to tenascin. The interaction between a receptor tyrosine phosphatase and an extracellular matrix protein may have a role in development of the mammalian central nervous system.

  20. Characterization of a 65 kDa NIF in the nuclear matrix of the monocot Allium cepa that interacts with nuclear spectrin-like proteins.

    Science.gov (United States)

    Pérez-Munive, Clara; Blumenthal, Sonal S D; de la Espina, Susana Moreno Díaz

    2012-01-01

    Plant cells have a well organized nucleus and nuclear matrix, but lack orthologues of the main structural components of the metazoan nuclear matrix. Although data is limited, most plant nuclear structural proteins are coiled-coil proteins, such as the NIFs (nuclear intermediate filaments) in Pisum sativum that cross-react with anti-intermediate filament and anti-lamin antibodies, form filaments 6-12 nm in diameter in vitro, and may play the role of lamins. We have investigated the conservation and features of NIFs in a monocot species, Allium cepa, and compared them with onion lamin-like proteins. Polyclonal antisera against the pea 65 kDa NIF were used in 1D and 2D Western blots, ICM (imunofluorescence confocal microscopy) and IEM (immunoelectron microscopy). Their presence in the nuclear matrix was analysed by differential extraction of nuclei, and their association with structural spectrin-like proteins by co-immunoprecipitation and co-localization in ICM. NIF is a conserved structural component of the nucleus and its matrix in monocots with Mr and pI values similar to those of pea 65 kDa NIF, which localized to the nuclear envelope, perichromatin domains and foci, and to the nuclear matrix, interacting directly with structural nuclear spectrin-like proteins. Its similarities with some of the proteins described as onion lamin-like proteins suggest that they are highly related or perhaps the same proteins.

  1. REFOLDdb: a new and sustainable gateway to experimental protocols for protein refolding.

    Science.gov (United States)

    Mizutani, Hisashi; Sugawara, Hideaki; Buckle, Ashley M; Sangawa, Takeshi; Miyazono, Ken-Ichi; Ohtsuka, Jun; Nagata, Koji; Shojima, Tomoki; Nosaki, Shohei; Xu, Yuqun; Wang, Delong; Hu, Xiao; Tanokura, Masaru; Yura, Kei

    2017-04-24

    More than 7000 papers related to "protein refolding" have been published to date, with approximately 300 reports each year during the last decade. Whilst some of these papers provide experimental protocols for protein refolding, a survey in the structural life science communities showed a necessity for a comprehensive database for refolding techniques. We therefore have developed a new resource - "REFOLDdb" that collects refolding techniques into a single, searchable repository to help researchers develop refolding protocols for proteins of interest. We based our resource on the existing REFOLD database, which has not been updated since 2009. We redesigned the data format to be more concise, allowing consistent representations among data entries compared with the original REFOLD database. The remodeled data architecture enhances the search efficiency and improves the sustainability of the database. After an exhaustive literature search we added experimental refolding protocols from reports published 2009 to early 2017. In addition to this new data, we fully converted and integrated existing REFOLD data into our new resource. REFOLDdb contains 1877 entries as of March 17 th , 2017, and is freely available at http://p4d-info.nig.ac.jp/refolddb/ . REFOLDdb is a unique database for the life sciences research community, providing annotated information for designing new refolding protocols and customizing existing methodologies. We envisage that this resource will find wide utility across broad disciplines that rely on the production of pure, active, recombinant proteins. Furthermore, the database also provides a useful overview of the recent trends and statistics in refolding technology development.

  2. Assessment and Quantification of Noncollagenic Matrix Proteins Released from Human Dentin Powder Incorporated into a Silated Hydroxypropylmethylcellulose Biomedical Hydrogel.

    Science.gov (United States)

    Aubeux, Davy; Beck, Laurent; Weiss, Pierre; Guicheux, Jérome; Enkel, Bénédicte; Pérez, Fabienne; Simon, Stéphane

    2016-09-01

    The dentin extracellular matrix is a reservoir of bioactive molecules sequestered into dentin during dental initial development. They can be released under pathological conditions but also by controlled demineralization with bioactive materials. The purpose of this study was to investigate the ability of a biomedical hydrogel to extract and release these proteins from smashed dentin. Smashed dentin was obtained with 2 different kinds of grinders: a blade mill and a zirconia mortar grinder. The particle size was measured by scanning electron microscopy. Dentin powder was incorporated into a silated hydroxypropylmethylcellulose hydrogel. Several types of mixtures with variable parameters were tested. The mixtures were immersed into phosphate-buffered saline. The supernatants were collected, and the total released proteins were quantified by gel shift migration and Coomassie staining. The presence of transforming growth factor beta 1 was investigated by Western blot analysis and the ELISA. The mixture dentin powder/hydrogel released proteins (from 49.1 μg/mL-137.9 μg/mL according to the mixtures). The release kinetics was growing and started from the first day until stabilization at 14 days. The quantity of released proteins was directly related to the size of the particles and the weight of the powder incorporated into the hydrogel. Gel shift with direct revelation by ultraviolet and Western blot analyses confirmed the presence of transforming growth factor beta 1 using ELISA. We showed that silated hydroxypropylmethylcellulose hydrogel was able to extract dentin matrix proteins from smashed dentin powder. This mixture could be considered a new way of dental treatment for the dentin-pulp complex and bone regeneration. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  3. Conserved Ankyrin Repeat Proteins and Their NIMA Kinase Partners Regulate Extracellular Matrix Remodeling and Intracellular Trafficking in Caenorhabditis elegans.

    Science.gov (United States)

    Lažetić, Vladimir; Fay, David S

    2017-01-01

    Molting is an essential developmental process in nematodes during which the epidermal apical extracellular matrix, the cuticle, is remodeled to accommodate further growth. Using genetic approaches, we identified a requirement for three conserved ankyrin repeat-rich proteins, MLT-2/ANKS6, MLT-3/ANKS3, and MLT-4/INVS, in Caenorhabditis elegans molting. Loss of mlt function resulted in severe defects in the ability of larvae to shed old cuticle and led to developmental arrest. Genetic analyses demonstrated that MLT proteins functionally cooperate with the conserved NIMA kinase family members NEKL-2/NEK8 and NEKL-3/NEK6/NEK7 to promote cuticle shedding. MLT and NEKL proteins were specifically required within the hyp7 epidermal syncytium, and fluorescently tagged mlt and nekl alleles were expressed in puncta within this tissue. Expression studies further showed that NEKL-2-MLT-2-MLT-4 and NEKL-3-MLT-3 colocalize within largely distinct assemblies of apical foci. MLT-2 and MLT-4 were required for the normal accumulation of NEKL-2 at the hyp7-seam cell boundary, and loss of mlt-2 caused abnormal nuclear accumulation of NEKL-2 Correspondingly, MLT-3, which bound directly to NEKL-3, prevented NEKL-3 nuclear localization, supporting the model that MLT proteins may serve as molecular scaffolds for NEKL kinases. Our studies additionally showed that the NEKL-MLT network regulates early steps in clathrin-mediated endocytosis at the apical surface of hyp7, which may in part account for molting defects observed in nekl and mlt mutants. This study has thus identified a conserved NEKL-MLT protein network that regulates remodeling of the apical extracellular matrix and intracellular trafficking, functions that may be conserved across species. Copyright © 2017 by the Genetics Society of America.

  4. Recombinant production of a shell matrix protein in Escherichia coli and its application to the biomimetic synthesis of spherulitic calcite crystals.

    Science.gov (United States)

    Song, Wooho; Bahn, So Yeong; Cha, Hyung Joon; Pack, Seung Pil; Choi, Yoo Seong

    2016-05-01

    To overcome the limited production capability of shell matrix proteins and efficiently conduct in vitro CaCO3 biomineralization studies, a putative recombinant shell matrix protein was prepared and characterized. A glycine-rich protein (GRP_BA) was found in Pinctada fucata as a putative shell matrix protein (NCBI reference sequence; BAA20465). It was genetically redesigned for the production in Escherichia coli. The recombinant protein was obtained in a 400 ml shake-flask culture at approx. 30 mg l(-1) with a purity of >95 %. It efficiently formed a complex with Ca(2+). Ca(2+)-induced agglomeration was like other calcification-related proteins. Spherulitic calcite micro-particles, 20-30 µm diam. with rosette- and sphere-like structures were synthesized in the presence of the recombinant shell protein, which could be formed by stacking and/or aggregation of calcite nanograins and the bound protein. Recombinant production of a shell matrix protein could overcome potential difficulties associated with the limited amount of protein available for biomineralization studies and provide opportunities to fabricate biominerals in practical aspects.

  5. Transient association of MCM complex proteins with the nuclear matrix during initiation of mammalian DNA replication

    OpenAIRE

    Hesketh, Emma L; Knight, John RP; Wilson, Rosemary HC; Chong, James PJ; Coverley, Dawn

    2015-01-01

    The minichromosome maintenance complex (MCM2-7) is the putative DNA helicase in eukaryotes, and essential for DNA replication. By applying serial extractions to mammalian cells synchronized by release from quiescence, we reveal dynamic changes to the sub-nuclear compartmentalization of MCM2 as cells pass through late G1 and early S phase, identifying a brief window when MCM2 becomes transiently attached to the nuclear-matrix. The data distinguish 3 states that correspond to loose association ...

  6. Prognosis by C-reactive protein and matrix metalloproteinase-9 levels in stable coronary heart disease during 15 years of follow-up

    DEFF Research Database (Denmark)

    Eldrup, N; Kragelund, C; Steffensen, R

    2012-01-01

    associate with prognosis in patients with stable coronary heart disease. METHODS AND RESULTS: We measured baseline plasma CRP and matrix metalloproteinase-9 in 1090 patients with stable coronary heart disease and as the primary composite endpoint detected incident unstable angina, myocardial infarction......BACKGROUND AND AIM: Elevated CRP and matrix metalloproteinase-9 associate with increased risk of cardiovascular events, possibly because these plasma proteins mark vulnerable atherosclerotic plaques. We tested the hypothesis that levels of C-reactive protein (CRP) and matrix metalloproteinase-9...

  7. The potentiation of myeloperoxidase activity by the glycosaminoglycan-dependent binding of myeloperoxidase to proteins of the extracellular matrix.

    Science.gov (United States)

    Kubala, Lukáš; Kolářová, Hana; Víteček, Jan; Kremserová, Silvie; Klinke, Anna; Lau, Denise; Chapman, Anna L P; Baldus, Stephan; Eiserich, Jason P

    2013-10-01

    Myeloperoxidase (MPO) is an abundant hemoprotein expressed by neutrophil granulocytes that is recognized to play an important role in the development of vascular diseases. Upon degranulation from circulating neutrophil granulocytes, MPO binds to the surface of endothelial cells in an electrostatic-dependent manner and undergoes transcytotic migration to the underlying extracellular matrix (ECM). However, the mechanisms governing the binding of MPO to subendothelial ECM proteins, and whether this binding modulates its enzymatic functions are not well understood. We investigated MPO binding to ECM derived from aortic endothelial cells, aortic smooth muscle cells, and fibroblasts, and to purified ECM proteins, and the modulation of these associations by glycosaminoglycans. The oxidizing and chlorinating potential of MPO upon binding to ECM proteins was tested. MPO binds to the ECM proteins collagen IV and fibronectin, and this association is enhanced by the pre-incubation of these proteins with glycosaminoglycans. Correspondingly, an excess of glycosaminoglycans in solution during incubation inhibits the binding of MPO to collagen IV and fibronectin. These observations were confirmed with cell-derived ECM. The oxidizing and chlorinating potential of MPO was preserved upon binding to collagen IV and fibronectin; even the potentiation of MPO activity in the presence of collagen IV and fibronectin was observed. Collectively, the data reveal that MPO binds to ECM proteins on the basis of electrostatic interactions, and MPO chlorinating and oxidizing activity is potentiated upon association with these proteins. Our findings provide new insights into the molecular mechanisms underlying the interaction of MPO with ECM proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Comparison of efficacies of different bone substitutes adhered to osteoblasts with and without extracellular matrix proteins

    Directory of Open Access Journals (Sweden)

    Li-Ling Tseng

    2013-12-01

    Conclusion: The results indicated that ECM proteins increased cell attachment to bone substitutes in vitro. The preferential affinity of different bone substitutes to certain ECM proteins was evident. Cerasorb and BoneCeramic had better MG63 human osteosarcoma cell adhesion ability than Bio-Oss and MBCP.

  9. The Staphylococcus aureus extracellular matrix protein (Emp) has a fibrous structure and binds to different extracellular matrices.

    Science.gov (United States)

    Geraci, Jennifer; Neubauer, Svetlana; Pöllath, Christine; Hansen, Uwe; Rizzo, Fabio; Krafft, Christoph; Westermann, Martin; Hussain, Muzaffar; Peters, Georg; Pletz, Mathias W; Löffler, Bettina; Makarewicz, Oliwia; Tuchscherr, Lorena

    2017-10-20

    The extracellular matrix protein Emp of Staphylococcus aureus is a secreted adhesin that mediates interactions between the bacterial surface and extracellular host structures. However, its structure and role in staphylococcal pathogenesis remain unknown. Using multidisciplinary approaches, including circular dichroism (CD) and Fourier transform infrared (FTIR) spectroscopy, transmission electron (TEM) and immunogold transmission electron microscopy, functional ELISA assays and in silico techniques, we characterized the Emp protein. We demonstrated that Emp and its truncated forms bind to suprastructures in human skin, cartilage or bone, among which binding activity seems to be higher for skin compounds. The binding domain is located in the C-terminal part of the protein. CD spectroscopy revealed high contents of β-sheets (39.58%) and natively disordered structures (41.2%), and TEM suggested a fibrous structure consisting of Emp polymers. The N-terminus seems to be essential for polymerization. Due to the uncommonly high histidine content, we suggest that Emp represents a novel type of histidine-rich protein sharing structural similarities to leucine-rich repeats proteins as predicted by the I-TASSER algorithm. These new findings suggest a role of Emp in infections of deeper tissue and open new possibilities for the development of novel therapeutic strategies.

  10. Cheese matrix protects the immunomodulatory surface protein SlpB of Propionibacterium freudenreichii during in vitro digestion.

    Science.gov (United States)

    Rabah, Houem; Ménard, Olivia; Gaucher, Floriane; do Carmo, Fillipe Luiz Rosa; Dupont, Didier; Jan, Gwénaël

    2018-04-01

    Propionibacterium freudenreichii is a traditional Swiss-type cheeses starter and constitutes an emergent probiotic, exerting several beneficial effects, including anti-inflammatory modulation of gut inflammation. This feature relies on several metabolites and on surface proteins, with a prominent role of the surface protein SlpB. In this study, we firstly investigated the relevance to avoid SlpB digestive proteolysis, by comparing the effect of i) P. freudenreichii CIRM-BIA 129, ii) its native Slps, or iii) peptides resulting from Slps digestive proteolysis, with respect to modulation of HT-29 cells response to a lipopolysaccharide (LPS) challenge. The anti-inflammatory effect exerted by P. freudenreichii CIRM-BIA 129 and by its native surface proteins (Slps) on HT-29 cells was abolished by digestive proteolysis. This result confirmed the importance to protect immunomodulatory surface proteins from digestive proteolysis in order to allow gut immune system modulation. Thus, we examined the effect of dairy matrices on P. freudenreichii viability and on SlpB integrity during digestion. In comparison with liquid matrices, the cheese matrix provided an enhanced tolerance towards digestive stresses and protection of SlpB towards proteolysis, during two in vitro digestion models: static and dynamic. Taken together, these results show that cheese is an adequate delivery vehicle for P. freudenreichii immunomodulatory proteins. This opens perspectives for the development of fermented dairy functional foods aimed at target populations at high risk for diet-related diseases with an inflammatory component. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. The requirement for fibroblasts in angiogenesis: fibroblast-derived matrix proteins are essential for endothelial cell lumen formation.

    Science.gov (United States)

    Newman, Andrew C; Nakatsu, Martin N; Chou, Wayne; Gershon, Paul D; Hughes, Christopher C W

    2011-10-01

    A role for fibroblasts in physiological and pathological angiogenesis is now well recognized; however, the precise mechanisms underlying their action have not been determined. Using an in vitro angiogenesis model in combination with a candidate gene approach, column chromatography, and mass spectrometry, we identify two classes of fibroblast-derived factors--one that supports vessel sprouting but not lumen formation, and one that promotes lumen formation. In the absence of fibroblasts a combination of angiopoietin-1, angiogenin, hepatocyte growth factor, transforming growth factor-α, and tumor necrosis factor drives robust endothelial cell (EC) sprouting; however, lumens fail to form. Subsequent addition of fibroblast-conditioned medium restores lumenogenesis. Using small interfering RNA-mediated knockdown, we show that five genes expressed in fibroblasts--collagen I, procollagen C endopeptidase enhancer 1, secreted protein acidic and rich in cysteine, transforming growth factor-β-induced protein ig-h3, and insulin growth factor-binding protein 7--are necessary for lumen formation. Moreover, lumen formation can be rescued by addition of purified protein to knockdown cultures. Finally, using rheology, we demonstrate that the presence of these matricellular proteins results in significantly stiffer gels, which correlates with enhanced lumen formation. These findings highlight the critical role that fibroblast-derived extracellular matrix components play in EC lumen formation and provide potential insight into the role of fibroblasts in the tumor microenvironment.

  12. Influence of ensiling time and inoculation on alteration of the starch-protein matrix in high-moisture corn.

    Science.gov (United States)

    Hoffman, P C; Esser, N M; Shaver, R D; Coblentz, W K; Scott, M P; Bodnar, A L; Schmidt, R J; Charley, R C

    2011-05-01

    The fates of hydrophobic zein proteins, which encapsulate corn starch to create vitreous endosperm, have not been investigated in high-moisture corn (HMC). To assess influences of ensiling time and inoculation on zein proteins in HMC, quadruplicate samples of 2 random corn hybrids (A and B), containing 25.7 and 29.3% moisture, were ground, inoculated with (I) or without 600,000 cfu/g of Lactobacillus buchneri 40788 (Lallemand Animal Nutrition, Milwaukee, WI), and ensiled for 0, 15, 30, 60, 120, and 240 d. Nutrient composition [crude protein (CP), starch, acid detergent fiber, and neutral detergent fiber], fermentation (pH, lactate, and acetate), and protein degradation markers (buffer-soluble CP, isopropanol-soluble CP, and NH(3)-N) were evaluated. At 0 and 240 d, α, γ, δ, and β zein subunits were profiled using HPLC. Data were evaluated as a split-split plot using the PROC MIXED procedures of SAS. Ensiling time and inoculation decreased pH, and altered lactate and acetate contents of HMC. Lactate and acetate contents of A, AI, B, and BI at 240 d were 0.40, 0.32, 1.11, 0.73, and 0, 0.35, 0.30, and 0.87% of DM, respectively. Buffer-soluble CP in HMC increased from 1.5 to 2.0% of DM at 0 d to >4.0% of DM at 240 d. Inoculation had no effect on buffer-soluble CP but increased NH(3)-N content of HMC. Corn A contained more isopropanol-soluble CP than did corn B and peak areas for 6 α, and all γ and δ zein regions were greater for corn A. Ensiling (0 vs. 240 d) decreased all zein subunits with the exception of 2 α and 1 δ subunit. Ensiling decreased (42.2-73.2%) γ zeins, which are primarily responsible for cross-linking in the starch-protein matrix. Despite altering lactate and acetate contents, inoculation had no effect on degrading hydrophobic zein proteins in HMC. Data suggest that hydrophobic zein proteins in the starch-protein matrix of HMC are degraded by proteolytic activity over an extended ensiling time. Copyright © 2011 American Dairy Science

  13. Cartilage oligomeric matrix protein deficiency promotes early onset and the chronic development of collagen-induced arthritis

    DEFF Research Database (Denmark)

    Geng, Hui; Carlsen, Stefan; Nandakumar, Kutty

    2008-01-01

    ABSTRACT: INTRODUCTION: Cartilage oligomeric matrix protein (COMP) is a homopentameric protein in cartilage. The development of arthritis, like collagen-induced arthritis (CIA), involves cartilage as a target tissue. We have investigated the development of CIA in COMP-deficient mice. METHODS: COMP......-deficient mice in the 129/Sv background were backcrossed for 10 generations against B10.Q mice, which are susceptible to chronic CIA. COMP-deficient and wild-type mice were tested for onset, incidence, and severity of arthritis in both the collagen and collagen antibody-induced arthritis models. Serum anti......-collagen II and anti-COMP antibodies as well as serum COMP levels in arthritic and wild-type mice were measured by enzyme-linked immunosorbent assay. RESULTS: COMP-deficient mice showed a significant early onset and increase in the severity of CIA in the chronic phase, whereas collagen II-antibody titers were...

  14. Cloning from purified high endothelial venule cells of hevin, a close relative of the antiadhesive extracellular matrix protein SPARC.

    Science.gov (United States)

    Girard, J P; Springer, T A

    1995-01-01

    High endothelial venules (HEV) in lymphoid tissues support high levels of lymphocyte extravasion from the blood. We purified high endothelial cells from human tonsils by immunomagnetic selection with MECA-79 MAb to construct an HEV cDNA library. Differential screening of this library using cDNA probes from HEV (plus) or flat-walled vessel (minus) endothelial cells allowed us to characterize a novel human cDNA expressed to high levels in HEV. The cDNA encodes a secreted acidic calcium-binding glycoprotein of 664 aa residues, designated hevin, exhibiting 62% identity with the antiadhesive extracellular matrix protein SPARC, over a region of 232 aa spanning more than four fifths of the SPARC coding sequence. The primary structure and sequence of hevin and similar to SPARC-like proteins from rat and quail, called SC1 or QR1. Hevin could contribute to the induction or maintenance of features of the HEV endothelium that facilitate lymphocyte migration.

  15. Serum protein profiling by miniaturized solid-phase extraction and matrix-assisted laser desorption/ionization mass spectrometry

    DEFF Research Database (Denmark)

    Callesen, Anne K; Mohammed, Shabaz; Bunkenborg, Jakob

    2005-01-01

    for translation of MALDI-MS based diagnostic methods to clinical applications. We have investigated a number of MALDI matrices and several miniaturized solid-phase extraction (SPE) methods for serum protein concentration and desalting with the aim of generating reproducible, high-quality protein profiles by MALDI......-MS. We developed a simple protocol for serum profiling that combines a matrix mixture of 2,5-dihydroxybenzoic acid and alpha-cyano-4-hydroxycinnamic acid with miniaturized SPE and MALDI-MS. Functionalized membrane discs with hydrophobic, ion-exchange or chelating properties allowed reproducible MALDI...... indicate that this simple SPE/MALDI-MS method for serum profiling provides a versatile and scalable platform for clinical proteomics....

  16. Effect of apoptosis and response of extracellular matrix proteins after chemotherapy application on human breast cancer cell spheroids.

    Science.gov (United States)

    Oktem, G; Vatansever, S; Ayla, S; Uysal, A; Aktas, S; Karabulut, B; Bilir, A

    2006-02-01

    Multicellular tumor spheroid (MTS) represents a three-dimensional structural form of tumors in laboratory conditions, and it has the characteristics of avascular micrometastases or intervascular spaces of big tumors. Recent studies indicate that extracellular matrix (ECM) proteins play a critical role in tumor metastasis, therefore normal and cancer cells require an ECM for survival, proliferation and differentiation. Doxorubicin and Docetaxel are widely used in the therapy of breast cancer, as well as in in vivo and in vitro studies. In this study, we examined the effect of apoptosis and proliferation of cells on the human breast cancer cell line, MCF-7, by using p53, bcl-2 and Ki67 gene expression, and the tendency to metastasis with extracellular matrix proteins, laminin and type IV collagen after chemotherapy in the spheroid model. The apoptotic cell death in situ was detected by TUNEL method. TUNEL-positive cells and positive immunoreactivities of laminin, type IV collagen, p53 and, bcl-2 were detected in the control group. There was no laminin and type IV collagen immunoreactivities in spheroids of drug groups. While TUNEL-positive cells and p53 immunoreactivity were detected in Docetaxel, Doxorubicin and Docetaxel/Doxorubicin groups, p53 immunoreactivity was not observed in the Docetaxel group. There was no bcl-2 immunoreactivity in either drug group. In addition, we did not detect Ki67 immunoreactivity in both control and drug treatment groups. However, the absence of Ki67 protein in MCF-7 breast multicellular tumor spheroids is possibly related to the cells in G0 or S phase. These chemotherapeutic agents may affect the presence of ECM proteins in this in vitro model of micrometastasis of spheroids. These findings suggest that the possible mechanism of cell death in Doxorubicin and Docetaxel/Doxorubicin treatment groups is related to apoptosis through the p53 pathway. However, we considered the possibility that there is another control mechanism for the

  17. Sequence analysis and expression of the M1 and M2 matrix protein genes of hirame rhabdovirus (HIRRV)

    Science.gov (United States)

    Nishizawa, T.; Kurath, G.; Winton, J.R.

    1997-01-01

    We have cloned and sequenced a 2318 nucleotide region of the genomic RNA of hirame rhabdovirus (HIRRV), an important viral pathogen of Japanese flounder Paralichthys olivaceus. This region comprises approximately two-thirds of the 3' end of the nucleocapsid protein (N) gene and the complete matrix protein (M1 and M2) genes with the associated intergenic regions. The partial N gene sequence was 812 nucleotides in length with an open reading frame (ORF) that encoded the carboxyl-terminal 250 amino acids of the N protein. The M1 and M2 genes were 771 and 700 nucleotides in length, respectively, with ORFs encoding proteins of 227 and 193 amino acids. The M1 gene sequence contained an additional small ORF that could encode a highly basic, arginine-rich protein of 25 amino acids. Comparisons of the N, M1, and M2 gene sequences of HIRRV with the corresponding sequences of the fish rhabdoviruses, infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) indicated that HIRRV was more closely related to IHNV than to VHSV, but was clearly distinct from either. The putative consensus gene termination sequence for IHNV and VHSV, AGAYAG(A)(7), was present in the N-M1, M1-M2, and M2-G intergenic regions of HIRRV as were the putative transcription initiation sequences YGGCAC and AACA. An Escherichia coli expression system was used to produce recombinant proteins from the M1 and M2 genes of HIRRV. These were the same size as the authentic M1 and M2 proteins and reacted with anti-HIRRV rabbit serum in western blots. These reagents can be used for further study of the fish immune response and to test novel control methods.

  18. Tissue-specific and SRSF1-dependent splicing of fibronectin, a matrix protein that controls host cell invasion

    Science.gov (United States)

    Lopez-Mejia, Isabel Cristina; De Toledo, Marion; Della Seta, Flavio; Fafet, Patrick; Rebouissou, Cosette; Deleuze, Virginie; Blanchard, Jean Marie; Jorgensen, Christian; Tazi, Jamal; Vignais, Marie-Luce

    2013-01-01

    Cell invasion targets specific tissues in physiological placental implantation and pathological metastasis, which raises questions about how this process is controlled. We compare dermis and endometrium capacities to support trophoblast invasion, using matching sets of human primary fibroblasts in a coculture assay with human placental explants. Substituting endometrium, the natural trophoblast target, with dermis dramatically reduces trophoblast interstitial invasion. Our data reveal that endometrium expresses a higher rate of the fibronectin (FN) extra type III domain A+ (EDA+) splicing isoform, which displays stronger matrix incorporation capacity. We demonstrate that the high FN content of the endometrium matrix, and not specifically the EDA domain, supports trophoblast invasion by showing that forced incorporation of plasma FN (EDA–) promotes efficient trophoblast invasion. We further show that the serine/arginine-rich protein serine/arginine-rich splicing factor 1 (SRSF1) is more highly expressed in endometrium and, using RNA interference, that it is involved in the higher EDA exon inclusion rate in endometrium. Our data therefore show a mechanism by which tissues can be distinguished, for their capacity to support invasion, by their different rates of EDA inclusion, linked to their SRSF1 protein levels. In the broader context of cancer pathology, the results suggest that SRSF1 might play a central role not only in the tumor cells, but also in the surrounding stroma. PMID:23966470

  19. Comparative adherence of Candida albicans and Candida dubliniensis to human buccal epithelial cells and extracellular matrix proteins.

    Science.gov (United States)

    Jordan, Rachael P C; Williams, David W; Moran, Gary P; Coleman, David C; Sullivan, Derek J

    2014-04-01

    Candida albicans and Candida dubliniensis are very closely related pathogenic yeast species. Despite their close relationship, C. albicans is a far more successful colonizer and pathogen of humans. The purpose of this study was to determine if the disparity in the virulence of the two species is attributed to differences in their ability to adhere to human buccal epithelial cells (BECs) and/or extracellular matrix proteins. When grown overnight at 30°C in yeast extract peptone dextrose, genotype 1 C. dubliniensis isolates were found to be significantly more adherent to human BECs than C. albicans or C. dubliniensis genotypes 2-4 (P albicans to human BECs was observed, and C. dubliniensis genotype 1 and C. albicans adhered to BECs in significantly greater numbers than the other C. dubliniensis genotypes (P albicans to type I and IV collagen, fibronectin, laminin, vitronectin, and proline-rich peptides. These data suggest that C. albicans is not more adherent to epithelial cells or matrix proteins than C. dubliniensis and therefore other factors must contribute to the greater levels of virulence exhibited by C. albicans.

  20. Early diagnostic and prognostic values of anti-cyclic citrullinated peptide antibody and cartilage oligomeric matrix protein in rheumatoid arthritis.

    Science.gov (United States)

    Algergawy, Shereen A; Abd El-Sabour, M; Osman, Ahmed S; Emam, Sherin M; Elham, N

    2013-01-01

    This study aimed to evaluate the role of Anti-Cyclic Citrullinated Peptide (anti-CCP) antibody in comparison to Cartilage oligomeric matrix protein (COMP) in Rheumatoid Arthritis (RA) patients as predictors of the disease activity and cartilage destruction. The study included 60 patients &10 apparently healthy subjects. They were divided into 4 groups. Group 1: consisted of 20 patients with established rheumatoid arthritis( and positive rheumatoid factor). Group 2: 20 suspected (rheumatoid factor negative) patients Group 3: 20 patients with other autoimmune inflammatory diseases (15 with psoaritic arthritis, 5 with systemic lupus erthromatosis).and Group 4: 10 age and sex matched controls. For each patient medical examination and disease activity evaluation using Disease Activity Score (DAS) was performed Anti cyclic citrullinated peptide (anti CCP) level was measured by ELISA method and cartilage oligomeric matrix protein (COMP) was determined by indirect immune fluorescent method. Serum level of anti CCP antibodies and COMP were Significantly related to DAS (disease activity score) and cartilage destruction, the serum presence of COMP was highly significant in rheumatoid arthritis patients than those with other autoimmune disease, the sensitivity of anti CCP in diagnosis of RA was 77.5% and specificity was96.6%. It is concluded that anti CCP, and COMP may be a useful noninvasive markers for disease activity and cartilage destruction.

  1. Impact of cyclic mechanical stimulation on the expression of extracellular matrix proteins in human primary rotator cuff fibroblasts.

    Science.gov (United States)

    Lohberger, Birgit; Kaltenegger, Heike; Stuendl, Nicole; Rinner, Beate; Leithner, Andreas; Sadoghi, Patrick

    2016-12-01

    Mechanical stimulation plays an important role in the development and remodelling of tendons. The aim of the study was to evaluate the effects of mechanical stimulation on the expression of extracellular matrix proteins in human primary rotator cuff (RC) fibroblasts. RC fibroblasts were isolated from patients with degenerative RC tears and characterized using flow cytometry and immunohistochemistry. Cells were stimulated using the Flexcell FX5K™ Tension System. The stimulation regime was a uniaxial sinusoidal waveform with 10 % elongation and a frequency of 0.5 Hz, whereby each cycle consists of 10-s strain and 30-s relaxation. Data were normalized to mechanically unstimulated control groups for every experimental condition. RT-qPCR was performed to determine relative mRNA levels, and collagen production was measured by a colorimetric assay. The positive expression of CD91 and CD10, and negativity for CD45 and CD4 confirmed the fibroblast phenotype of RC primary cells. RT-qPCR revealed that 10 % continuous cyclic strain for 7 and 14 days induced a significant increase in the mRNA expression both on the matrix metalloproteinases MMP1, MMP3, MMP13, and MMP14 and on the extracellular matrix proteins decorin, tenascin-C, and scleraxis. Furthermore, mechanically stimulated groups produced significantly higher amounts of total collagen. These results may contribute to a better understanding of strain-induced tendon remodelling and will form the basis for the correct choice of applied force in rehabilitation after orthopaedic surgery. These findings underline the fact that early passive motion of the joint in order to induce remodelling of the tendon should be included within a rehabilitation protocol for rotator cuff repair.

  2. Some characteristics of matrix-assisted UV laser desorption/ionization mass spectrometric analysis of large proteins

    Science.gov (United States)

    Perera, I. K.; Kantartzoglou, S.; Dyer, P. E.

    1996-12-01

    We have performed experiments to explore the characteristics of the matrix-assisted laser desorption/ionization (MALDI) process and to ascertain optimal operational conditions for observing intact molecular ions of large proteins. In this study, several methods have been adopted for the preparation of analyte samples. Of these, the samples prepared with the simple dried-droplet method were found to be the most suitable for the generation of the large molecular clusters, while the near-uniform spin-coated samples were observed to produce highly reproducible molecular ion signals of relatively high mass resolutions. A resulting mass spectrum which illustrates the formation of cluster ions up to the 26-mer [26M+H]+ of bovine insulin corresponding to a mass of about 150,000 Da, is presented. The effect of fluence on the extent of clustering of protein molecules has been studied, the results revealing the existence of an optimum fluence for detecting the large cluster ions. Investigations have also indicated that the use of polyethylene-coated metallic substrates as sample supports can considerably reduce the fragmentation of the matrix/analyte molecular ions and the desorption of "neat" MALDI matrices deposited on these polyethylene-coated sample probes enhance their aggregation, forming up to the heptamer [7M+H]+ of the matrix, ferulic acid. The dependence of the mass resolution on the applied acceleration voltage and the desorption fluence has been examined and the results obtained are discussed in terms of a simple analysis of the linear time-of-flight mass spectrometer. A spectrum of chicken egg lysozyme (M~14,306) displaying the high mass resolutions (M/[Delta]M~690) that can be attained when the mass spectrometer is operated in the reflectron mode is also presented.

  3. Differences in extracellular matrix proteins between Friesian horses with aortic rupture, unaffected Friesians and Warmblood horses.

    Science.gov (United States)

    Ploeg, M; Gröne, A; van de Lest, C H A; Saey, V; Duchateau, L; Wolsein, P; Chiers, K; Ducatelle, R; van Weeren, P R; de Bruijn, M; Delesalle, C

    2017-09-01

    Unlike in Warmblood horses, aortic rupture is quite common in Friesian horses, in which a hereditary trait is suspected. The aortic connective tissue in affected Friesians shows histological changes such as medial necrosis, elastic fibre fragmentation, mucoid material accumulation and fibrosis with aberrant collagen morphology. However, ultrastructural examination of the collagen fibres of the mid-thoracic aorta has been inconclusive in further elucidating the pathogenesis of the disease. To assess several extracellular matrix (ECM) components biochemically in order to explore a possible underlying breed-related systemic ECM defect in Friesians with aortic rupture. Cadaver study. Tissues from affected Friesians (n = 18), unaffected Friesians (n = 10) and Warmblood horses (n = 30) were compared. Samples were taken from the thoracic aorta at the level of the rupture site, from two locations caudal to the rupture and from the deep digital flexor tendon. Total collagen content, post-translational modifications of collagen formation including lysine hydroxylation, and hydroxylysylpyridinoline (HP), lysylpyridinoline (LP) and pyrrole cross-links were analysed. Additionally, elastin cross-links, glycosaminoglycan content and matrix metalloproteinase (MMP) activity were assessed. Significantly increased MMP activity and increased LP and HP cross-linking, lysine hydroxylation and elastin cross-linking were found at the site of rupture in affected Friesians. These changes may reflect processes involved in healing and aneurysm formation. Unaffected Friesians had less lysine hydroxylation and pyrrole cross-linking within the tendons compared with Warmblood horses. No differences in the matrix of the aorta were found between normal Warmbloods and Friesian horses. Small sample size. The differences in collagen parameters in tendon tissue may reflect differences in connective tissue metabolism between Friesians and Warmblood horses. © 2017 EVJ Ltd.

  4. QRI, a retina-specific gene, encodes an extracellular matrix protein exclusively expressed during neural retina differentiation.

    Science.gov (United States)

    Casado, F J; Pouponnot, C; Jeanny, J C; Lecoq, O; Calothy, G; Pierani, A

    1996-02-01

    Neural retina development results from growth arrest of neuroectodermal precursors and differentiation of postmitotic cells. The QRI gene is specifically expressed in Müller retinal glial cells. Its expression coincides with the stage of withdrawal from the cell cycle and establishment of differentiation and is repressed upon induction of retinal cell proliferation by the v-src gene product. In this report, we show that the QR1 gene encodes several glycosylated proteins that are secreted and can either associate with the extracellular matrix or remain diffusible in the medium. By using pulse-chase experiments, the 100-103 kDa forms seem to appear first and are specifically incorporated into the extracellular matrix, whereas the 108 and 60 kDa polypeptides appear later and are detected as soluble forms in the culture medium. We also report that expression of the QR1 gene is developmentally regulated in the chicken. Its mRNA is first detectable at embryonic day 10, reaches a maximal level at embryonic day 15 and is no longer detected at embryonic day 18. Immunolocalization of the QR1 protein in chicken retina sections during development shows that expression of the protein parallels the differentiation pattern of post-miotic cells (in particular Müller cells and rods), corresponding to the two differentiation gradients in the retina: from the ganglion cell layer to the inner nuclear layer and outer nuclear layer, and from the optic nerve to the iris. At embryonic day 10, expression of the QR1 protein(s) is restricted to the optic nerve region and the inner nuclear layer, colocalizing with Müller cell bodies. As development proceeds, QR1 protein localization spreads towards the iris and towards the outer nuclear layer, following Müller cell elongations towards the photoreceptors. Between embryonic days 16 and 18, the QR1 protein is no longer detectable in the optic nerve region and is concentrated around the basal segment of the photoreceptors in the peripheral

  5. Preparation of bioconjugates by solid-phase conjugation to ion exchange matrix-adsorbed carrier proteins

    DEFF Research Database (Denmark)

    Houen, G.; Olsen, D.T.; Hansen, P.R.

    2003-01-01

    of ovalbumin and various peptides were prepared in a similar manner and used for production of peptide antisera by direct immunization with the conjugates bound to the ion exchanger. Advantages of the method are its solid-phase nature, allowing fast and efficient reactions and intermediate washings......, and immunization experiments with the eluted conjugates showed that the more substituted conjugates gave rise to the highest titers of glutathione antibodies. Direct immunization with the conjugates adsorbed to the ion exchange matrix was possible and gave rise to high titers of glutathione antibodies. Conjugates...

  6. Optimization of metformin HCl 500 mg sustained release matrix tablets using Artificial Neural Network (ANN) based on Multilayer Perceptrons (MLP) model.

    Science.gov (United States)

    Mandal, Uttam; Gowda, Veeran; Ghosh, Animesh; Bose, Anirbandeep; Bhaumik, Uttam; Chatterjee, Bappaditya; Pal, Tapan Kumar

    2008-02-01

    The aim of the present study was to apply the simultaneous optimization method incorporating Artificial Neural Network (ANN) using Multi-layer Perceptron (MLP) model to the development of a metformin HCl 500 mg sustained release matrix tablets with an optimized in vitro release profile. The amounts of HPMC K15M and PVP K30 at three levels (-1, 0, +1) for each were selected as casual factors. In vitro dissolution time profiles at four different sampling times (1 h, 2 h, 4 h and 8 h) were chosen as output variables. 13 kinds of metformin matrix tablets were prepared according to a 2(3) factorial design (central composite) with five extra center points, and their dissolution tests were performed. Commercially available STATISTICA Neural Network software (Stat Soft, Inc., Tulsa, OK, U.S.A.) was used throughout the study. The training process of MLP was completed until a satisfactory value of root square mean (RSM) for the test data was obtained using feed forward back propagation method. The root mean square value for the trained network was 0.000097, which indicated that the optimal MLP model was reached. The optimal tablet formulation based on some predetermined release criteria predicted by MLP was 336 mg of HPMC K15M and 130 mg of PVP K30. Calculated difference (f(1) 2.19) and similarity (f(2) 89.79) factors indicated that there was no difference between predicted and experimentally observed drug release profiles for the optimal formulation. This work illustrates the potential for an artificial neural network with MLP, to assist in development of sustained release dosage forms.

  7. Improved proliferation and differentiation capacity of human mesenchymal stromal cells cultured with basement-membrane extracellular matrix proteins.

    Science.gov (United States)

    Lindner, Ulrich; Kramer, Jan; Behrends, Jochen; Driller, Birgit; Wendler, Nils-Ole; Boehrnsen, Florian; Rohwedel, Jürgen; Schlenke, Peter

    2010-12-01

    In vitro cultured mesenchymal stromal cells (MSC) are characterized by a short proliferative lifespan, an increasing loss of proliferation capacity and progressive reduction of differentiation potential. Laminin-1, laminin-5, collagen IV and fibronectin are important constituents of the basement membrane extracellular matrix (ECM) that are involved in a variety of cellular activities, including cell attachment and motility. The in vitro proliferation capacity of MSC was significantly improved when the cells were incubated in the presence of basement membrane ECM proteins. For example, a mixture of proteins improved proliferation capacity 250-fold in comparison with standard conditions after five passages. Furthermore, in colony-forming unit-fibroblast (CFU-F) assays colony numbers and size were significantly extended. Blocking specific integrin cell-surface receptors, positive effects on the proliferation capacity of MSC were inhibited. Additionally, when MSC were co-cultivated with ECM proteins, cells maintained their multipotential differentiation capacity throughout many culture passages in comparison with cells cultivated on plastic. However, expansion of MSC on laminin-5 suppressed any subsequent chondrogenic differentiation. Our results suggest that expansion of bone marrow-derived MSC in the presence of ECM proteins is a powerful approach for generating large numbers of MSC, showing a prolonged capacity to differentiate into mesodermal cell lineages, with the exception of the lack of chondrogenesis by using laminin-5 coating.

  8. Wax-based sustained release matrix pellets prepared by a novel freeze pelletization technique II. In vitro drug release studies and release mechanisms.

    Science.gov (United States)

    Cheboyina, Sreekhar; Wyandt, Christy M

    2008-07-09

    A novel freeze pelletization technique was evaluated for the preparation of wax-based sustained release matrix pellets. Pellets containing water-soluble drugs were successfully prepared using a variety of waxes. The drug release significantly depended on the wax type used and the aqueous drug solubility. The drug release decreased as the hydrophobicity of wax increased and the drug release increased as the aqueous drug solubility increased. In glyceryl monostearate (GMS) pellets, drug release rate decreased as the loading of theophylline increased. On the contrary, the release rate increased as the drug loading of diltiazem HCl increased in Precirol pellets. Theophylline at low drug loads existed in a dissolved state in GMS pellets and the release followed desorption kinetics. At higher loads, theophylline existed in a crystalline state and the release followed dissolution-controlled constant release for all the waxes studied. However, with the addition of increasing amounts of Brij 76, theophylline release rate increased and the release mechanism shifted to diffusion-controlled square root time kinetics. But the release of diltiazem HCl from Precirol pellets at all drug loads, followed diffusion-controlled square root time kinetics. Therefore, pellets capable of providing a variety of release profiles for different drugs can be prepared using this freeze pelletization technique by suitably modifying the pellet forming matrix compositions.

  9. Human Epididymis Protein 4 Promotes Events Associated with Metastatic Ovarian Cancer via Regulation of the Extracelluar Matrix

    Directory of Open Access Journals (Sweden)

    Jennifer R. Ribeiro

    2018-01-01

    Full Text Available Human epididymis protein 4 (HE4 has received much attention recently due to its diagnostic and prognostic abilities for epithelial ovarian cancer. Since its inclusion in the Risk of Ovarian Malignancy Algorithm (ROMA, studies have focused on its functional effects in ovarian cancer. Here, we aimed to investigate the role of HE4 in invasion, haptotaxis, and adhesion of ovarian cancer cells. Furthermore, we sought to gain an understanding of relevant transcriptional profiles and protein kinase signaling pathways mediated by this multifunctional protein. Exposure of OVCAR8 ovarian cancer cells to recombinant HE4 (rHE4 promoted invasion, haptotaxis toward a fibronectin substrate, and adhesion onto fibronectin. Overexpression of HE4 or treatment with rHE4 led to upregulation of several transcripts coding for extracellular matrix proteins, including SERPINB2, GREM1, LAMC2, and LAMB3. Gene ontology indicated an enrichment of terms related to extracellular matrix, cell migration, adhesion, growth, and kinase phosphorylation. LAMC2 and LAMB3 protein levels were constitutively elevated in cells overexpressing HE4 and were upregulated in a time-dependent manner in cells exposed to rHE4 in the media. Deposition of laminin-332, the heterotrimer comprising LAMC2 and LAMB3 proteins, was increased in OVCAR8 cells treated with rHE4 or conditioned media from HE4-overexpressing cells. Enzymatic activity of matriptase, a serine protease that cleaves laminin-332 and contributes to its pro-migratory functional activity, was enhanced by rHE4 treatment in vitro. Proteomic analysis revealed activation of focal adhesion kinase signaling in OVCAR8 cells treated with conditioned media from HE4-overexpressing cells. Focal adhesions were increased in cells treated with rHE4 in the presence of fibronectin. These results indicate a direct role for HE4 in mediating malignant properties of ovarian cancer cells and validate the need for HE4-targeted therapies that will suppress

  10. RESEARCH ARTICLE Molecular cloning and expression analysis of a matrix Gla protein gene in the spinyhead croaker, Collichthys lucidus.

    Science.gov (United States)

    Song, W; Zhao, M D; Jiang, K J; Zhang, F Y; Zhao, M; Meng, Y Y; Ma, L B

    2016-11-03

    The matrix Gla (gamma-carboxyglutamic acid-rich) protein (MGP), a vitamin K-dependent and Gla-containing protein, is a calcification inhibitor that mainly functions in tissue calcification and mineralization. In this study, we obtained the complete cDNA sequence of MGP from the spinyhead croaker (Collichthys lucidus), which we named Cl-MGP. Cl-MGP was 923 bp long with a 384-bp open reading fragment that encoded 127 amino acids. The predicted MGP protein sequence contained a 19-residue hydrophobic signal peptide, suggesting that it possesses secretory characteristics. The Gla domain and the invariant unit ErraEtCedyspC, which has been identified in all known vitamin K-dependent vertebrate proteins, were highly conserved in Cl-MGP, suggesting that it uses the same mechanism to function as the known proteins. An alignment analysis revealed that Cl-MGP had the highest identity with Larimichthys crocea (93%), which had lost five amino acid residues in the C-terminal. A quantitative real-time polymerase chain reaction revealed that Cl-MGP expression was highest in the gill, followed by the cholecyst and spleen, with almost no expression in the blood, muscle, or testes. The high Cl-MGP expression in the gill is similar to that observed in other fish species, but the relatively high expression found in the cholecyst and spleen is not seen in all species. Future studies should investigate the tissue distributions of both mRNA and proteins in different species, in order to understand the function and evolution of MGP in different species.

  11. Effect of an enamel matrix protein derivative (Emdogain) on ex vivo dental plaque vitality.

    Science.gov (United States)

    Sculean, A; Auschill, T M; Donos, N; Brecx, M; Arweiler, N B

    2001-11-01

    A common clinical observation following surgical periodontal therapy with an enamel matrix derivative (Emdogain) is the improved healing of the soft tissues and the limited inflammation of the operated areas. These clinical observations are empirical and difficult to explain. One of the factors influencing the early wound healing might be a potential antimicrobial effect of Emdogain. To investigate the effect of Emdogain on the vitality of ex vivo supragingival dental plaque and to compare this effect to that of a standard 0.2% chlorhexidine solution. 24 patients suffering from adult periodontitis were included in the study. At the beginning of the experiment, all participants were given a professional tooth cleaning. For the following 4 days, they had to refrain from any kind of oral hygiene measures. At day 5, from each of the volunteers, a voluminous plaque biofilm sample was taken with a sterile curette from the vestibular surfaces of the 1st lower molars and divided into 5 equal parts. Each part was mounted with 5 microl of the following solutions: (1) NaCl, (2) enamel matrix derivative dissolved in water (EMD), (3) enamel matrix derivative dissolved in the vehicle (Emdogain), (4) vehicle (propylene glycol alginate, PGA), (5) 0.2% chlorhexidine digluconate (CHX). After a reaction time of 2 min the test solutions were sucked off, and subsequently the biofilm was stained with a fluorescence dye. The vitality of the plaque flora after the treatments was evaluated under the fluorescence microscope (VF%). Plaque samples treated with NaCl showed a mean vitality of 76.8+/-8%. The EMD, Emdogain, PGA and CHX showed VF values of 54.4+/-9.2, 21.4+/-10.6%, 19.6+/-11.6% and 32.3+/-11.8%, respectively. Emdogain, PGA and CHX showed statistically highly significant reductions (pEmdogain and PGA were found to be statistically significantly different compared to CHX (pEmdogain might have an antibacterial effect on the vitality of the ex vivo supragingival dental plaque flora.

  12. Correlation Between Placental Matrix Metalloproteinase 9 and Tumor Necrosis Factor-α Protein Expression Throughout Gestation in Normal Human Pregnancy.

    Science.gov (United States)

    Basu, Jayasri; Agamasu, Enyonam; Bendek, Bolek; Salafia, Carolyn M; Mishra, Aruna; Lopez, Julia Vasquez; Kroes, Jessica; Dragich, Sharon Claire; Thakur, Ashley; Mikhail, Magdy

    2018-04-01

    Matrix metalloproteinases (MMPs), specifically MMP-9 plays a role in human placentation. The enzyme confers an invasive ability to cytotrophoblasts and degrades the endometrial matrix as the cells infiltrate the decidua to keep up with placental growth. Since tumor necrosis factor-α (TNF-α) can induce the synthesis of MMP-9, we investigated the patterns of changes in and correlation between placental villous MMP-9 and TNF-α expressions throughout normal human gestation. Placentas were obtained from 179 normal pregnant women who underwent elective abortion or term delivery. Chorionic villi isolated from placental samples were grouped as first, second, and third trimester (7 0/7 -13 0/7 , 13 1/7 -23 6/7 , and 37 0/7 -42 4/7 weeks, respectively). Chorionic villous TNF-α and MMP-9 proteins were assayed using enzyme immunoassay kits. There were significant differences in MMP-9 and TNF-α protein expressions among the trimester groups ( P = .001). The MMP-9 protein increased progressively with an increase in gestational age (GA), but TNF-α peaked in the second trimester. Within each trimester group, we searched for the effects of variation of GA in days on the 2 variables. A significant positive correlation between MMP-9 and GA was noted in the first trimester ( r = 0.364, P = .005). No other comparisons were significant. When GA was controlled for, partial correlation revealed a significant positive correlation between TNF-α and MMP-9 only in the second trimester ( r = 0.300, P = .018). We hypothesize that the TNF-α peak and the positive correlation between TNF-α and MMP-9 in the second trimester of normal human gestation could contribute toward a successful pregnancy outcome.

  13. Phototherapy up-regulates dentin matrix proteins expression and synthesis by stem cells from human-exfoliated deciduous teeth.

    Science.gov (United States)

    Turrioni, Ana Paula S; Basso, Fernanda G; Montoro, Liege A; Almeida, Leopoldina de Fátima D de; Costa, Carlos A de Souza; Hebling, Josimeri

    2014-10-01

    The aim of this study was to evaluate the effects of infrared LED (850nm) irradiation on dentin matrix proteins expression and synthesis by cultured stem cells from human exfoliated deciduous teeth (SHED). Near-exfoliation primary teeth were extracted (n=3), and SHED cultures were characterized by immunofluorescence using STRO-1, CD44, CD146, Nanog and OCT3/4 antibodies, before experimental protocol. The SHEDs were seeded (3×10(4) cells/cm(2)) with DMEM containing 10% FBS. After 24-h incubation, the culture medium was replaced by osteogenic differentiation medium, and the cells were irradiated with LED light at energy densities (EDs) of 0 (control), 2, or 4J/cm(2) (n=8). The irradiated SHEDs were then evaluated for alkaline phosphatase (ALP) activity, total protein (TP) production, and collagen synthesis (SIRCOL™ Assay), as well as ALP, collagen type I (Col I), dentin sialophosphoprotein (DSPP), and dentin matrix acidic phosphoprotein (DMP-1) gene expression (qPCR). Data were analyzed by Kruskal-Wallis and Mann-Whitney tests (α=0.05). Increased ALP activity and collagen synthesis, as well as gene expression of DSPP and ALP, were observed for both EDs compared with non-irradiated cells. The ED of 4J/cm(2) also increased gene expression of COL I and DMP-1. In conclusion, infrared LED irradiation was capable of biostimulating SHEDs by increasing the expression and synthesis of proteins related with mineralized tissue formation, with overall better results for the energy dose of 4J/cm(2). Phototherapy is an additional approach for the clinical application of LED in Restorative Dentistry. Infrared LED irradiation of the cavity's floor could biostimulate subjacent pulp cells, improving local tissue healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Matrix rigidity regulates cancer cell growth by modulating cellular metabolism and protein synthesis.

    Directory of Open Access Journals (Sweden)

    Robert W Tilghman

    Full Text Available Tumor cells in vivo encounter diverse types of microenvironments both at the site of the primary tumor and at sites of distant metastases. Understanding how the various mechanical properties of these microenvironments affect the biology of tumor cells during disease progression is critical in identifying molecular targets for cancer therapy.This study uses flexible polyacrylamide gels as substrates for cell growth in conjunction with a novel proteomic approach to identify the properties of rigidity-dependent cancer cell lines that contribute to their differential growth on soft and rigid substrates. Compared to cells growing on more rigid/stiff substrates (>10,000 Pa, cells on soft substrates (150-300 Pa exhibited a longer cell cycle, due predominantly to an extension of the G1 phase of the cell cycle, and were metabolically less active, showing decreased levels of intracellular ATP and a marked reduction in protein synthesis. Using stable isotope labeling of amino acids in culture (SILAC and mass spectrometry, we measured the rates of protein synthesis of over 1200 cellular proteins under growth conditions on soft and rigid/stiff substrates. We identified cellular proteins whose syntheses were either preferentially inhibited or preserved on soft matrices. The former category included proteins that regulate cytoskeletal structures (e.g., tubulins and glycolysis (e.g., phosphofructokinase-1, whereas the latter category included proteins that regulate key metabolic pathways required for survival, e.g., nicotinamide phosphoribosyltransferase, a regulator of the NAD salvage pathway.The cellular properties of rigidity-dependent cancer cells growing on soft matrices are reminiscent of the properties of dormant cancer cells, e.g., slow growth rate and reduced metabolism. We suggest that the use of relatively soft gels as cell culture substrates would allow molecular pathways to be studied under conditions that reflect the different mechanical

  15. Endoplasmic Reticulum Protein TXNDC5 Augments Myocardial Fibrosis by Facilitating Extracellular Matrix Protein Folding and Redox-Sensitive Cardiac Fibroblast Activation.

    Science.gov (United States)

    Shih, Ying-Chun; Chen, Chao-Ling; Zhang, Yan; Mellor, Rebecca L; Kanter, Evelyn M; Fang, Yun; Wang, Hua-Chi; Hung, Chen-Ting; Nong, Jing-Yi; Chen, Hui-Ju; Lee, Tzu-Han; Tseng, Yi-Shuan; Chen, Chiung-Nien; Wu, Chau-Chung; Lin, Shuei-Liong; Yamada, Kathryn A; Nerbonne, Jeanne M; Yang, Kai-Chien

    2018-03-13

    Rationale: Cardiac fibrosis plays a critical role in the pathogenesis of heart failure (HF). Excessive accumulation of extracellular matrix (ECM) resulting from cardiac fibrosis impairs cardiac contractile function and increases arrhythmogenicity. Current treatment options for cardiac fibrosis, however, are limited and there is a clear need to identify novel mediators of cardiac fibrosis to facilitate the development of better therapeutics. Exploiting co-expression gene network analysis on RNA sequencing data from failing human heart, we identified thioredoxin domain containing 5 (TXNDC5), a cardiac fibroblast (CF)-enriched endoplasmic reticulum (ER) protein, as a potential novel mediator of cardiac fibrosis and we completed experiments to test this hypothesis directly. Objective: To determine the functional role of TXNDC5 in the pathogenesis of cardiac fibrosis. Methods and Results: RNASeq and Western blot analyses revealed that TXNDC5 mRNA and protein were highly upregulated in failing human left ventricles (LV) and in hypertrophied/failing mouse LV. In addition, cardiac TXNDC5 mRNA expression levels were positively correlated with those of transcripts encoding transforming growth factor β1 (TGFβ1) and ECM proteins in vivo. TXNDC5 mRNA and protein were increased in human CF (hCF) under TGFβ1 stimulation in vitro. Knockdown of TXNDC5 attenuated TGFβ1-induced hCF activation and ECM protein upregulation independent of SMAD3, whereas increasing expression of TXNDC5 triggered hCF activation and proliferation and increased ECM protein production. Further experiments showed that TXNDC5, a protein disulfide isomerase, facilitated ECM protein folding and that depletion of TXNDC5 led to ECM protein misfolding and degradation in CF. In addition, TXNDC5 promotes hCF activation and proliferation by enhancing JNK activity via increased reactive oxygen species, derived from NAD(P)H oxidase 4. TGFβ1-induced TXNDC5 upregulation in hCF was dependent on ER stress and

  16. Evaluation of Ocimum basilicum L. seed mucilage as rate controlling matrix for sustained release of propranolol HCl

    Directory of Open Access Journals (Sweden)

    Majid Saeedi

    2015-01-01

    Full Text Available Polysaccharide mucilage derived from the seeds of Ocimum basilicum L. (family Lamiaceae was investigated for use in matrix formulations containing propranolol hydrochloride. Basil mucilage was extracted and several tablets were formulated. The effect of mucilage on drug release rate was evaluated in comparison with tablets containing two kinds of hydroxypropyl methylcellulose (HPMC K4M and HPMC K100M as standard polymer. The release data were fitted to several models for kinetic evaluation. The results showed that hardness decreased and friability of tablets increased as the concentration of mucilage increased. The rate of release of propranolol HCl from O. basilicm mucilage matrices was mainly controlled by the drug: mucilage ratio. Drug release was slower from the HPMC K4M and HPMCK100M containing tablets compared to the mucilage containing matrices than the drug release from matrices containing O. basilicum seed mucilage in similar ratios.  Formulations containing O. basilicm mucilage were found to exhibit suitable release pattern. The results of kinetic analysis showed that in tablets containing O. basilicm mucilage the highest correlation coefficient was achieved with the zero order model. The swelling and erosion studies revealed that, as the proportion of mucilage in tablets was increased, there was a corresponding increase in percent swelling and a decrease in percent erosion of tablets.

  17. Evaluation of Plantago major L. seed mucilage as a rate controlling matrix for sustained release of propranolol hydrochloride.

    Science.gov (United States)

    Saeedi, Majid; Morteza-Semnani, Katayoun; Sagheb-Doust, Mehdi

    2013-03-01

    Polysaccharide mucilage derived from the seeds of Plantago major L. (family Plantaginaceae) was investigated for use in matrix formulations containing propranolol hydrochloride. HPMC K4M and tragacanth were used as standards for comparison. The hardness, tensile strength, and friability of tablets increased as the concentration of mucilage increased, indicating good compactibility of mucilage powders. The rate of release of propranolol hydrochloride from P. major mucilage matrices was mainly controlled by the drug/mucilage ratio. Formulations containing P. major mucilage were found to exhibit a release rate comparable to HPMC containing matrices at a lower drug/polymer ratio (drug/HPMC 2:1). These results demonstrated that P. major mucilage is a better release retardant compared to tragacanth at an equivalent content. The results of kinetic analysis showed that in F3 (containing 1:2 drug/mucilage) the highest correlation coefficient was achieved with the zero order model. The swelling and erosion studies revealed that as the proportion of mucilage in tablets was increased, there was a corresponding increase in percent swelling and a decrease in percent erosion of tablets. The DSC and FT-IR studies showed that no formation of complex between the drug and mucilage or changes in crystallinity of the drug had occurred.

  18. In vitro evaluation of sustained released matrix tablets containing ibuprofen: a model poorly water-soluble drug

    Directory of Open Access Journals (Sweden)

    Wendy Leticia Guerra-Ponce

    Full Text Available ABSTRACT A matrix system was developed that releases ibuprofen (IB over a 12-hour period and the influence of the polymer type and concentration on the release rate of the drug was evaluated. Tablets containing different concentrations of Carbopol (CP, hydroxypropyl methylcellulose (HPMC, or ethyl cellulose (EC were prepared using direct compression and the drug content, content uniformity, hardness, friability, dissolution performance, and in vitro release kinetics were examined. Formulated tablets were found to be within acceptable limits for physical and chemical parameters. The release kinetics of the Carbopol(r971P 8% formulation showed the best linearity (r 2 =0.977 in fitting zero-order kinetics, suggesting the release rate was time independent. The drug release from tablets containing 8% CP was extended over approximately 18 hours and the release kinetics were nearly linear, suggesting that this system has the potential to maintain constant plasma drug concentrations over 12 hours, which could reduce the frequency of administration and the occurrence of adverse effects associated with repeated administration of conventional IB tablets.

  19. Food protein aggregates as vitamin-matrix carriers: impact of processing conditions.

    Science.gov (United States)

    Relkin, Perla; Shukat, Rizwan

    2012-10-15

    We studied the ability of protein aggregates for loading and protection of α-tocopherol, a model of heat- and light-sensitive bioactive compounds. Aqueous dispersions of whey proteins (4.5 wt.%, pH 6.7) in the absence and presence of α-tocopherol (4 wt.%) were prepared using an ultradisperser (10,000 rpm for 10 min and 65 °C), and then submitted to further high-pressure homogenisation (HPH) at 300 or 1200 bar for 12 cycles. Relative to free-vitamin dispersions, increasing HPH conditions in the presence of vitamin led to higher protein denaturation, more tryptophan quenching and wavelength blue-shift (by 10nm), in parallel with increased zeta potential values (by -10 mV), particle sizes (by 50%), and newly formed protein dimers, trimers and high molecular weight aggregates. As a result, the degree of vitamin degradation under increasing HPH and long-term storage was shown to decrease from 66% (ultradisper) to 50%, or to 30% (subject to further treatments at 300 or 1200 bar, respectively). Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Identification of the proteins responsible for SAR DNA binding in nuclear matrix of ''Cucurbita pepo''

    International Nuclear Information System (INIS)

    Rzepecki, R.; Markiewicz, E.; Szopa, J.

    1995-01-01

    The nuclear matrices from White bush (''Cucurbita pepo var. patisonina'') cell nuclei have been isolated using three methods: I, standard procedure involving extraction of cell nuclei with 2 M NaCl and 1% Triton X-100; II, the same with pre-treatment of cell nuclei with 0.5 mM CuSO 4 (stabilisation step); and III, method with extraction by lithium diiodosalicylate (LIS), and compared the polypeptide pattern. The isolated matrices specifically bind SAR DNA derived from human β-interferon gene in the exogenous SAR binding assay and in the gel mobility shift assay. Using IgG against the 32 kDa endonuclease we have found in the DNA-protein blot assay that this protein is one of the proteins binding SAR DNA. We have identified three proteins with molecular mass of 65 kDa, 60 kDa and 32 kDa which are responsible for SAR DNA binding in the gel mobility shift assay experiments. (author). 21 refs, 3 figs

  1. Flax fabric reinforced arylated soy protein composites: A brittle-matrix behaviour

    CSIR Research Space (South Africa)

    Kumar, R

    2012-05-01

    Full Text Available Biocomposites were successfully prepared by the reinforcement of soy protein isolate (SPI) with different weight fractions of woven flax fabric. The flax-fabric-reinforced SPI-based composites were then arylated with 2,2-diphenyl-2-hydroxyethanoic...

  2. Molecular Characterization of the Multiple Interactions of SpsD, a Surface Protein from Staphylococcus pseudintermedius, with Host Extracellular Matrix Proteins.

    Directory of Open Access Journals (Sweden)

    Giampiero Pietrocola

    Full Text Available Staphylococcus pseudintermedius, a commensal and pathogen of dogs and occasionally of humans, expresses surface proteins potentially involved in host colonization and pathogenesis. Here, we describe the cloning and characterization of SpsD, a surface protein of S. pseudintermedius reported as interacting with extracellular matrix proteins and corneocytes. A ligand screen and Western immunoblotting revealed that the N-terminal A domain of SpsD bound fibrinogen, fibronectin, elastin and cytokeratin 10. SpsD also interfered with thrombin-induced fibrinogen coagulation and blocked ADP-induced platelet aggregation. The binding site for SpsD was mapped to residues 395-411 in the fibrinogen γ-chain, while binding sites in fibronectin were localized to the N- and C-terminal regions. SpsD also bound to glycine- and serine-rich omega loops within the C-terminal tail region of cytokeratin 10. Ligand binding studies using SpsD variants lacking the C-terminal segment or containing an amino-acid substitution in the putative ligand binding site provided insights into interaction mechanism of SpsD with the different ligands. Together these data demonstrate the multi-ligand binding properties of SpsD and illustrate some interesting differences in the variety of ligands bound by SpsD and related proteins from S. aureus.

  3. Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair (Rae1∙Nup98)

    Energy Technology Data Exchange (ETDEWEB)

    Quan, Beili; Seo, Hyuk-Soo; Blobel, Günter; Ren, Yi [Rockefeller

    2014-07-01

    mRNA export factor 1 (Rae1) and nucleoporin 98 (Nup98) are host cell targets for the matrix (M) protein of vesicular stomatitis virus (VSV). How Rae1 functions in mRNA export and how M protein targets both Rae1 and Nup98 are not understood at the molecular level. To obtain structural insights, we assembled a 1:1:1 complex of M•Rae1•Nup98 and established a crystal structure at 3.15-Å resolution. We found that the M protein contacts the Rae1•Nup98 heterodimer principally by two protrusions projecting from the globular domain of M like a finger and thumb. Both projections clamp to the side of the β-propeller of Rae1, with the finger also contacting Nup98. The most prominent feature of the finger is highly conserved Methionine 51 (Met51) with upstream and downstream acidic residues. The complementary surface on Rae1 displays a deep hydrophobic pocket, into which Met51 fastens like a bolt, and a groove of basic residues on either side, which bond to the acidic residues of the finger. Notably, the M protein competed for in vitro binding of various oligonucleotides to Rae1•Nup98. We localized this competing activity of M to its finger using a synthetic peptide. Collectively, our data suggest that Rae1 serves as a binding protein for the phosphate backbone of any nucleic acid and that the finger of M mimics this ligand. In the context of mRNA export, we propose that a given mRNA segment, after having been deproteinated by helicase, is transiently reproteinated by Nup98-tethered Rae1. We suggest that such repetitive cycles provide cytoplasmic stopover sites required for ratcheting mRNA across the nuclear pore.

  4. Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair (Rae1 • Nup98).

    Science.gov (United States)

    Quan, Beili; Seo, Hyuk-Soo; Blobel, Günter; Ren, Yi

    2014-06-24

    mRNA export factor 1 (Rae1) and nucleoporin 98 (Nup98) are host cell targets for the matrix (M) protein of vesicular stomatitis virus (VSV). How Rae1 functions in mRNA export and how M protein targets both Rae1 and Nup98 are not understood at the molecular level. To obtain structural insights, we assembled a 1:1:1 complex of M•Rae1•Nup98 and established a crystal structure at 3.15-Å resolution. We found that the M protein contacts the Rae1•Nup98 heterodimer principally by two protrusions projecting from the globular domain of M like a finger and thumb. Both projections clamp to the side of the β-propeller of Rae1, with the finger also contacting Nup98. The most prominent feature of the finger is highly conserved Methionine 51 (Met51) with upstream and downstream acidic residues. The complementary surface on Rae1 displays a deep hydrophobic pocket, into which Met51 fastens like a bolt, and a groove of basic residues on either side, which bond to the acidic residues of the finger. Notably, the M protein competed for in vitro binding of various oligonucleotides to Rae1•Nup98. We localized this competing activity of M to its finger using a synthetic peptide. Collectively, our data suggest that Rae1 serves as a binding protein for the phosphate backbone of any nucleic acid and that the finger of M mimics this ligand. In the context of mRNA export, we propose that a given mRNA segment, after having been deproteinated by helicase, is transiently reproteinated by Nup98-tethered Rae1. We suggest that such repetitive cycles provide cytoplasmic stopover sites required for ratcheting mRNA across the nuclear pore.

  5. Immunocytochemical Detection of Dentin Matrix Proteins in Primary Teeth from Patients with Dentinogenesis Imperfecta Associated with Osteogenesis Imperfecta

    Science.gov (United States)

    Orsini, G.; Majorana, A.; Mazzoni, A.; Putignano, A.; Falconi, M.; Polimeni, A.; Breschi, L.

    2014-01-01

    Dentinogenesis imperfecta determines structural alterations of the collagen structure still not completely elucidated. Immunohisto-chemical analysis was used to assay type I and VI collagen, various non-collagenous proteins distribution in human primary teeth from healthy patients or from patients affected by type I dentinogenesis imperfecta (DGI-I) associated with osteogenesis imperfecta (OI). In sound primary teeth, an organized well-known ordered pattern of the type I collagen fibrils was found, whereas atypical and disorganized fibrillar structures were observed in dentin of DGI-I affected patients. Expression of type I collagen was observed in both normal and affected primary teeth, although normal dentin stained more uniformly than DGI-I affected dentin. Reactivity of type VI collagen was significantly lower in normal teeth than in dentin from DGI-I affected patients (P<0.05). Expressions of dentin matrix protein-1 (DMP1) and osteopontin (OPN) were observed in both normal dentin and dentin from DGI-I affected patients, without significant differences, being DMP1 generally more abundantly expressed. Immuno labeling for chondroitin sulfate (CS) and biglycan (BGN) was weaker in dentin from DGI-I-affected patients compared to normal dentin, this decrease being significant only for CS. This study shows ultra-structural alterations in dentin obtained from patients affected by DGI-I, supported by immunocytochemical assays of different collagenous and non-collagenous proteins. PMID:25578972

  6. Identification and characterization of a matrix protein (PPP-10) in the periostracum of the pearl oyster, Pinctada fucata.

    Science.gov (United States)

    Nakayama, Seiji; Suzuki, Michio; Endo, Hirotoshi; Iimura, Kurin; Kinoshita, Shigeharu; Watabe, Shugo; Kogure, Toshihiro; Nagasawa, Hiromichi

    2013-01-01

    The periostracum is a layered structure that is formed as a mollusk shell grows. The shell is covered by the periostracum, which consists of organic matrices that prevent decalcification of the shell. In the present study, we discovered the presence of chitin in the periostracum and identified a novel matrix protein, Pinctada fucata periostracum protein named PPP-10. It was purified from the sodium dodecyl sulfate/dithiothreitol-soluble fraction of the periostracum of the Japanese pearl oyster, P. fucata. The deduced amino acid sequence was determined by a combination of amino acid sequence analysis and cDNA cloning. The open reading frame encoded a precursor protein of 112 amino acid residues including a 21-residue signal peptide. The 91 residues following the signal peptide contained abundant Cys and Tyr residues. PPP-10 was expressed on the outer side of the outer fold in the mantle, indicating that PPP-10 was present in the second or third layer of the periostracum. We also determined that the recombinant PPP-10 had chitin-binding activity and could incorporate chitin into the scaffolds of the periostracum. These results shed light on the early steps in mollusk shell formation.

  7. Identification and characterization of a matrix protein (PPP-10) in the periostracum of the pearl oyster, Pinctada fucata☆

    Science.gov (United States)

    Nakayama, Seiji; Suzuki, Michio; Endo, Hirotoshi; Iimura, Kurin; Kinoshita, Shigeharu; Watabe, Shugo; Kogure, Toshihiro; Nagasawa, Hiromichi

    2013-01-01

    The periostracum is a layered structure that is formed as a mollusk shell grows. The shell is covered by the periostracum, which consists of organic matrices that prevent decalcification of the shell. In the present study, we discovered the presence of chitin in the periostracum and identified a novel matrix protein, Pinctada fucata periostracum protein named PPP-10. It was purified from the sodium dodecyl sulfate/dithiothreitol-soluble fraction of the periostracum of the Japanese pearl oyster, P. fucata. The deduced amino acid sequence was determined by a combination of amino acid sequence analysis and cDNA cloning. The open reading frame encoded a precursor protein of 112 amino acid residues including a 21-residue signal peptide. The 91 residues following the signal peptide contained abundant Cys and Tyr residues. PPP-10 was expressed on the outer side of the outer fold in the mantle, indicating that PPP-10 was present in the second or third layer of the periostracum. We also determined that the recombinant PPP-10 had chitin-binding activity and could incorporate chitin into the scaffolds of the periostracum. These results shed light on the early steps in mollusk shell formation. PMID:24251105

  8. Colonization of the meat extracellular matrix proteins by O157 and non-O157 enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    Chagnot, Caroline; Caccia, Nelly; Loukiadis, Estelle; Ganet, Sarah; Durand, Alexandra; Bertin, Yolande; Talon, Régine; Astruc, Thierry; Desvaux, Mickaël

    2014-10-01

    Enterohemorrhagic Escherichia coli (EHEC) are anthropozoonotic agents that range third among food-borne pathogens respective to their incidence and dangerousness in the European Union. EHEC are Shiga-toxin producing E. coli (STEC) responsible for foodborne poisoning mainly incriminated to the consumption of contaminated beef meat. Among the hundreds of STEC serotypes identified, EHEC mainly belong to O157:H7 but non-O157 can represent 20 to 70% of EHEC infections per year. Seven of those serogroups are especially of high-risk for human health, i.e. O26, O45, O103, O111, O121, O145 and O104. While meat can be contaminated all along the food processing chain, EHEC contamination essentially occurs at the dehiding stage of slaughtering. Investigating bacterial colonization to the skeletal-muscle extracellular matrix (ECM) proteins, it appeared that environmental factors influenced specific and non-specific bacterial adhesion of O157 and non-O157 EHEC as well as biofilm formation. Importantly, mechanical treatment (i.e. shaking, centrifugation, pipetting and vortexing) inhibited and biased the results of bacterial adhesion assay. Besides stressing the importance of the protocol to investigate bacterial adhesion to ECM proteins, this study demonstrated that the colonization abilities to ECM proteins vary among EHEC serogroups and should ultimately be taken into consideration to evaluate the risk of contamination for different types of food matrices. Copyright © 2014. Published by Elsevier B.V.

  9. Immunocytochemical detection of dentin matrix proteins in primary teeth from patients with dentinogenesis imperfecta associated with osteogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    G. Orsini

    2014-10-01

    Full Text Available Dentinogenesis imperfecta determines structural alterations of the collagen structure still not completely elucidated. Immunohistochemical analysis was used to assay Type I and VI collagen, various non-collagenous proteins distribution in human primary teeth from healthy patients or from patients affected by type I dentinogenesis imperfecta (DGI-I associated with osteogenesis imperfecta (OI. In sound primary teeth, an organized well-known ordered pattern of the type I collagen fibrils was found, whereas atypical and disorganized fibrillar structures were observed in dentin of DGI-I affected patients. Expression of type I collagen was observed in both normal and affected primary teeth, although normal dentin stained more uniformly than DGI-I affected dentin. Reactivity of type VI collagen was significantly lower in normal teeth than in dentin from DGI-I affected patients (P<0.05. Expressions of dentin matrix protein (DMP-1 and osteopontin (OPN were observed in both normal dentin and dentin from DGI-I affected patients, without significant differences, being DMP1 generally more abundantly expressed. Immunolabeling for chondroitin sulfate (CS and biglycan (BGN was weaker in dentin from DGI-I-affected patients compared to normal dentin, this decrease being significant only for CS. This study shows ultrastructural alterations in dentin obtained from patients affected by DGI-I, supported by immunocytochemical assays of different collagenous and non-collagenous proteins.

  10. Histopathological evaluation of the effects of variable extraoral dry times and enamel matrix proteins (enamel matrix derivatives) application on replanted dogs' teeth.

    Science.gov (United States)

    Barbizam, Joao V B; Massarwa, Rasha; da Silva, Lea Assed Bezerra; da Silva, Raquel Assed Bezerra; Nelson-Filho, Paulo; Consolaro, Alberto; Cohenca, Nestor

    2015-02-01

    The extra-alveolar dry period and storage medium in which the tooth was kept prior to replantation remain the critical factors affecting the survival and regeneration of the damaged periodontium. When the replantation is delayed, replacement root resorption is the most common complication following replantation of an avulsed tooth. The aim of this histological study was to evaluate the periodontal healing of replanted dogs' teeth after 20 min (short) and 60 min (long) extraoral dry time with and without the application of enamel matrix proteins. Eighty mature premolar roots (40 teeth) maxillary and mandibular premolars were extracted, the root canals were accessed, instrumented, and filled using a lateral condensation technique, and the access cavity was restored with amalgam. Each root was randomly assigned to one of experimental groups: Groups I and II: Roots were replanted after an extraoral dry time of 20 min. In group II, Emdogain(®) (Biora, Malmo, Sweden) was applied directly to the external root surface with complete coverage. Groups III and IV: Roots were replanted after an extraoral dry time of 60 min. In group IV, Emdogain(®) was applied to the whole external root surface before replantation. Roots that replanted within a total extraoral dry time of 10 min were used as negative controls, while those replanted after 90 min of extraoral dry time were assigned as positive controls. After 4 months, the dogs were euthanized, and the maxillary and mandibular processes were processed for histology and microscopically evaluated. Statistical analysis showed no significant differences (P = 0.1075) among the experimental groups. The results of this study show that 20 min of extraoral dry time is as detrimental to the PDL cells as 60 or 90 min of extraoral dry time, with avulsed dogs' teeth, even when replanted with an inductive material such as EMD. This study provides strong evidence in relation to the threshold of the extraoral dry time of avulsed teeth

  11. Real Time FRET Based Detection of Mechanical Stress in Cytoskeletal and Extracellular Matrix Proteins.

    Science.gov (United States)

    Meng, Fanjie; Suchyna, Thomas M; Lazakovitch, Elena; Gronostajski, Richard M; Sachs, Frederick

    2011-06-01

    A molecular force sensing cassette (stFRET) was incorporated into actinin, filamin, and spectrin in vascular endothelial cells (BAECs) and into collagen-19 in Caenorhabditis elegans. To estimate the stress sensitivity of stFRET in solution, we used DNA springs. A 60-mer loop of single stranded DNA was covalently linked to the external cysteines of the donor and acceptor. When the complementary DNA was added it formed double stranded DNA with higher persistence length, stretching the linker and substantially reducing FRET efficiency. The probe stFRET detected constitutive stress in all cytoskeletal proteins tested, and in migrating cells the stress was greater at the leading edge than the trailing edge. The stress in actinin, filamin and spectrin could be reduced by releasing focal attachments from the substrate with trypsin. Inhibitors of actin polymerization produced a modest increase in stress on the three proteins suggesting they are mechanically in parallel. Local shear stress applied to the cell with a perfusion pipette showed gradients of stress leading from the site of perfusion. Transgenic C. elegans labeled in collagen-19 produced a behaviorally and anatomically normal animal with constitutive stress in the cuticle. Stretching the worm visibly stretched the probe in collagen showing that we can trace the distribution of mean tissue stress in specific molecules. stFRET is a general purpose dynamic sensor of mechanical stress that can be expressed intracellularly and extracellularly in isolated proteins, cells, tissues, organs and animals.

  12. Treatment of gingival recession using enamel matrix proteins: a case report with 4-year follow-up.

    Science.gov (United States)

    Kuru, Bahar; Yilmaz, Selçuk; Noyan, Ulkü

    2007-05-01

    Obtaining predictable and optimal coverage of exposed root surfaces and correction of corresponding gingival recessions have become important goals of periodontal plastic surgery. Various surgical techniques have been proposed for coverage of root surfaces. A therapeutic advantage may be gained if periodontal regeneration is obtained in addition to coverage of root with gingiva. In this case report, surgical recession coverage was performed as the bilaterally pedicled lateral sliding flap technique with the adjunctive use of enamel matrix derivative bioactive material (Emdogain). A female patient with gingival recession on maxillary central incisors is presented with 4-year follow-up observation. The surgical procedure used in this clinical pilot case study produced a marked reduction in gingival recession that was maintained for 4 years. Initial gingival recession averaged 4.25 mm with a probing depth of 1.25 mm. The 4-year follow-up demonstrated no significant changes in the degree of postoperative results obtained after 1 year. At the 4-year follow-up, a mean of 3.75 mm of root coverage was observed (93.8% root coverage). Probing depth averaged 0.75 mm, indicating a total of 4.25 mm gain of clinical attachment. Within the limits of this case, the results demonstrated the possibility of treating human buccal recessions by means of enamel matrix protein derivative together with the laterally repositioned flap technique, with a predictable reduction in recession and clinical gain in attachment.

  13. Spatiotemporal protein distribution of TGF-betas, their receptors, and extracellular matrix molecules during embryonic tendon development.

    Science.gov (United States)

    Kuo, Catherine K; Petersen, Bryan C; Tuan, Rocky S

    2008-05-01

    Tendon is one of the least understood tissues of the musculoskeletal system in terms of development and morphogenesis. Collagen fibrillogenesis has been the most studied aspect of tendon development, focusing largely on the role of matrix molecules such as collagen type III and decorin. While involvement of matrix molecules in collagen fibrillogenesis during chick tendon development is well understood, the role of growth factors has yet to be elucidated. This work examines the expression patterns of transforming growth factor (TGF) -beta1, -beta2, and -beta3, and their receptors with respect to expression patterns of collagen type III, decorin, and fibronectin. We focus on the intermediate stages of tendon development in the chick embryo, a period during which the tendon micro- and macro-architecture are being established. Our findings demonstrate for the first time that TGF-beta1, -beta2, and -beta3 have distinct spatiotemporal developmental protein localization patterns in the developing tendon and strongly suggest that these isoforms have independent roles in tendon development.

  14. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  15. Evaluation of Urinary Nuclear Matrix Protein-22 as Tumor Marker Versus Tissue Polypeptide Specific Antigen in Bilharzial and Bladder Cancer

    International Nuclear Information System (INIS)

    Ahmed, W.A.; El-Kabany, H.

    2004-01-01

    Urinary nuclear matrix protein-22 (NMP-22) and tissue polypeptide specific antigen (TPS) were determined as potential marker for early detection of bladder tumors in patients with high risk (Bilharzial-patients), monitoring and follow up bladder cancer patients. The objective was to determine sensitivity and specificity of markers for bilharzial and cancer lesions. The levels of two parameters were determined pre and post operation. A total of 110 individuals, 20 healthy, 20 bilharzial patients and 70 bladder cancer patients with confirmed diagnosis were investigated. Urine samples were assayed for NMP-22 and TPS test kits. Some bladder cancer patients were selected to follow up. NMP-22 showed highly significant increase (P,0.001) more than TPS (P<0.01) in bladder cancer patients when compared with bilharzial and control group. Overall sensitivity is 7.8% for TPS and 98.5% for NMP-22

  16. Plasma concentrations of extracellular matrix protein fibulin-1 are related to cardiovascular risk markers in chronic kidney disease and diabetes

    DEFF Research Database (Denmark)

    Scholze, Alexandra; Bladbjerg, Else-Marie; Sidelmann, Johannes J

    2013-01-01

    ABSTRACT: BACKGROUND: Fibulin-1 is one of a few extracellular matrix proteins present in blood in high concentrations. We aimed to define the relationship between plasma fibulin-1 levels and risk markers of cardiovascular disease. METHODS: Plasma fibulin-1 was determined in subjects with chronic...... to determine central hemodynamic and arterial stiffness indices. RESULTS: We observed a positive correlation of fibulin-1 levels with age (r = 0.38; p = 0.033), glycated hemoglobin (r = 0.80; p = 0.003), creatinine (r = 0.35; p = 0.045), and fibrinogen (r = 0.39; p = 0.027). Glomerular filtration rate...... and fibulin-1 were inversely correlated (r = -0.57; p = 0.022). There was a positive correlation between fibulin-1 and central pulse pressure (r = 0.44; p = 0.011) and central augmentation pressure (r = 0.55; p = 0.001). In a multivariable regression model, diabetes, creatinine, fibrinogen and central...

  17. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  18. AMP-Activated Protein Kinase Alleviates Extracellular Matrix Accumulation in High Glucose-Induced Renal Fibroblasts through mTOR Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Xia Luo

    2015-01-01

    Full Text Available Background/Aims: Extracellular matrix accumulation contributes significantly to the pathogenesis of diabetic nephropathy. Although AMP-activated protein kinase (AMPK has been found to inhibit extracellular matrix synthesis by experiments in vivo and vitro, its role in alleviating the deposition of extracellular matrix in renal interstitial fibroblasts has not been well defined. Methods: Currently, we conducted this study to investigate the effects of AMPK on high glucose-induced extracellular matrix synthesis and involved intracellular signaling pathway by using western blot in the kidney fibroblast cell line (NRK-49f. Results: Collagen IV protein levels were significantly increased by high glucose in a time-dependent manner. This was associated with a decrease in Thr72 phosphorylation of AMPK and an increase in phosphorylation of mTOR on Ser2448. High glucose-induced extracellular matrix accumulation and mTOR activation were significantly inhibited by the co-treatment of rAAV-AMPKα1312 (encoding constitutively active AMPKα1 whereas activated by r-AAV-AMPKα1D157A (encoding dominant negative AMPKα1. In cultured renal fibroblasts, overexpression of AMPKα1D157A upregulated mTOR signaling and matrix synthesis, which were ameliorated by co-treatment with the inhibitor of mTOR, rapamycin. Conclusion: Collectively, these findings indicate that AMPK exerts renoprotective effects by inhibiting the accumulation of extracellular matrix through mTOR signaling pathway.

  19. Matrix assisted ionization: new aromatic and nonaromatic matrix compounds producing multiply charged lipid, peptide, and protein ions in the positive and negative mode observed directly from surfaces.

    Science.gov (United States)

    Li, Jing; Inutan, Ellen D; Wang, Beixi; Lietz, Christopher B; Green, Daniel R; Manly, Cory D; Richards, Alicia L; Marshall, Darrell D; Lingenfelter, Steven; Ren, Yue; Trimpin, Sarah

    2012-10-01

    Matrix assisted inlet ionization (MAII) is a method in which a matrix:analyte mixture produces mass spectra nearly identical to electrospray ionization without the application of a voltage or the use of a laser as is required in laserspray ionization (LSI), a subset of MAII. In MAII, the sample is introduced by, for example, tapping particles of dried matrix:analyte into the inlet of the mass spectrometer and, therefore, permits the study of conditions pertinent to the formation of multiply charged ions without the need of absorption at a laser wavelength. Crucial for the production of highly charged ions are desolvation conditions to remove matrix molecules from charged matrix:analyte clusters. Important factors affecting desolvation include heat, vacuum, collisions with gases and surfaces, and even radio frequency fields. Other parameters affecting multiply charged ion production is sample preparation, including pH and solvent composition. Here, findings from over 100 compounds found to produce multiply charged analyte ions using MAII with the inlet tube set at 450 °C are presented. Of the compounds tested, many have -OH or -NH(2) functionality, but several have neither (e.g., anthracene), nor aromaticity or conjugation. Binary matrices are shown to be applicable for LSI and solvent-free sample preparation can be applied to solubility restricted compounds, and matrix compounds too volatile to allow drying from common solvents. Our findings suggest that the physical properties of the matrix such as its morphology after evaporation of the solvent, its propensity to evaporate/sublime, and its acidity are more important than its structure and functional groups.

  20. Matrix Assisted Ionization: New Aromatic and Nonaromatic Matrix Compounds Producing Multiply Charged Lipid, Peptide, and Protein Ions in the Positive and Negative Mode Observed Directly from Surfaces

    Science.gov (United States)

    Li, Jing; Inutan, Ellen D.; Wang, Beixi; Lietz, Christopher B.; Green, Daniel R.; Manly, Cory D.; Richards, Alicia L.; Marshall, Darrell D.; Lingenfelter, Steven; Ren, Yue; Trimpin, Sarah

    2012-10-01

    Matrix assisted inlet ionization (MAII) is a method in which a matrix:analyte mixture produces mass spectra nearly identical to electrospray ionization without the application of a voltage or the use of a laser as is required in laserspray ionization (LSI), a subset of MAII. In MAII, the sample is introduced by, for example, tapping particles of dried matrix:analyte into the inlet of the mass spectrometer and, therefore, permits the study of conditions pertinent to the formation of multiply charged ions without the need of absorption at a laser wavelength. Crucial for the production of highly charged ions are desolvation conditions to remove matrix molecules from charged matrix:analyte clusters. Important factors affecting desolvation include heat, vacuum, collisions with gases and surfaces, and even radio frequency fields. Other parameters affecting multiply charged ion production is sample preparation, including pH and solvent composition. Here, findings from over 100 compounds found to produce multiply charged analyte ions using MAII with the inlet tube set at 450 °C are presented. Of the compounds tested, many have -OH or -NH2 functionality, but several have neither (e.g., anthracene), nor aromaticity or conjugation. Binary matrices are shown to be applicable for LSI and solvent-free sample preparation can be applied to solubility restricted compounds, and matrix compounds too volatile to allow drying from common solvents. Our findings suggest that the physical properties of the matrix such as its morphology after evaporation of the solvent, its propensity to evaporate/sublime, and its acidity are more important than its structure and functional groups.

  1. In vitro re-hardening of artificial enamel caries lesions using enamel matrix proteins or self-assembling peptides

    Directory of Open Access Journals (Sweden)

    Patrick Schmidlin

    2016-02-01

    Full Text Available ABSTRACT Objectives To assess the re-hardening potential of enamel matrix derivatives (EMD and self-assembling peptides in vitro, hypothesizing that these materials may increase the mineralization of artificial carious lesions and improve hardness profiles. Material and Methods Forty-eight enamel samples were prepared from extracted bovine lower central incisors. After embedding and polishing, nail varnish was applied, leaving a defined test area. One third of this area was covered with a flowable composite (non-demineralized control. The remaining area was demineralized in an acidic buffer solution for 18 d to simulate a carious lesion. Half the demineralized area was then covered with composite (demineralized control, while the last third was left open for three test and one control treatments: (A Application of enamel-matrix proteins (EMD - lyophilized protein fractions dissolved in acetic acid, Straumann, (B self-assembling peptides (SAP, Curodont, or (C amine fluoride solution (Am-F, GABA for 5 min each. Untreated samples (D served as control. After treatment, samples were immersed in artificial saliva for four weeks (remineralization phase and microhardness (Knoop depth profiles (25-300 µm were obtained at sections. Two-way ANOVA was calculated to determine differences between the areas (re-hardening or softening. Results Decalcification resulted in significant softening of the subsurface enamel in all groups (A-D. A significant re-hardening up to 125 µm was observed in the EMD and SAP groups. Conclusions This study showed that EMD and SAP were able to improve the hardness profiles when applied to deep demineralized artificial lesions. However, further research is needed to verify and improve this observed effect.

  2. Performance of a novel sieving matrix of poly(vinyl alcohol)/acrylamide copolymer in electrophoretic separations of high molecular weight proteins from red cell membrane.

    Science.gov (United States)

    Matte, Alessandro; Sola, Laura; Chiari, Marcella; Tomelleri, Carlo; Consonni, Roberto; Turrini, Franco; Franceschi, Lucia De

    2014-04-01

    The analysis of high molecular weight (HMW) proteins from complex mixtures is still a challenge in proteomics. This work introduces a novel hydrogel obtained by the copolymerization of an allyl-PVA derivative with acrylamide and bisacrylamide and applies this matrix to the electrophoretic separation of HMW proteins. By inducing gelation of polyacrylamide in the presence of variable amounts of allyl-PVA, it is possible to control and vary the average gel porosity. This gel is easy to produce and handle and offers the advantage of being highly mechanically resistant and macroporous. The new matrix was tested in mono-dimensional separations of complex protein mixtures extracted from red cell membranes with different detergents. The improved performance of this macroporous matrix allowed to identify new proteins by MS and immunoblot analysis using specific antibodies. In particular, the resolution of proteins ranging in size between 97 and 279 kDa was greatly improved here compared to standard polyacrylamide gels, suggesting that this matrix can be a useful tool in routine analysis of HMW proteins in cell biology. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Comparison of CE-MS and LC-MS Analyses of Avian Eggshell Matrix Proteins

    Czech Academy of Sciences Publication Activity Database

    Mikšík, Ivan; Sedláková, Pavla; Mikulíková, Kateřina; Eckhardt, Adam; Kašička, Václav

    2008-01-01

    Roč. 67, Suppl.1 (2008), s. 89-96 ISSN 0009-5893 R&D Projects: GA MŠk(CZ) 1M0510; GA ČR(CZ) GA203/06/1044; GA ČR(CZ) GA203/05/2539 Institutional research plan: CEZ:AV0Z50110509; CEZ:AV0Z40550506 Keywords : eggshell proteins * CE-MS * HPLC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.312, year: 2008

  4. The Central Role of the Matrix Protein in Nipah Virus Assembly and Morphogenesis

    Science.gov (United States)

    2007-03-23

    attention paid to the cytoplasmic domains of these proteins. Co-localization of M and at least one envelope glycoprotein has been observed for SeV (111...from pCP630 (NiV M gene in pFastBac HTa ) using primers 5’- GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5’- GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV...lipid rafts in assembly has received the most attention for MeV. The measles F and H glycoproteins associate with lipid rafts in the trans-Golgi

  5. Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

    Science.gov (United States)

    Ho, Steven C L; Yang, Yuansheng

    2014-08-01

    Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

  6. GOLGA2/GM130, cis-Golgi matrix protein, is a novel target of anticancer gene therapy.

    Science.gov (United States)

    Chang, Seung-Hee; Hong, Seong-Ho; Jiang, Hu-Lin; Minai-Tehrani, Arash; Yu, Kyeong-Nam; Lee, Jae-Ho; Kim, Ji-Eun; Shin, Ji-Young; Kang, Bitna; Park, Sungjin; Han, Kiwon; Chae, Chanhee; Cho, Myung-Haing

    2012-11-01

    Achievement of long-term survival of patients with lung cancer treated with conventional chemotherapy is still difficult for treatment of metastatic and advanced tumors. Despite recent progress in investigational therapies, survival rates are still disappointingly low and novel adjuvant and systemic therapies are urgently needed. A recently elucidated secretory pathway is attracting considerable interest as a promising anticancer target. The cis-Golgi matrix protein, GOLGA2/GM130, plays an important role in glycosylation and transport of protein in the secretory pathway. In this study, the effects of short hairpin RNA (shRNA) constructs targeting GOLGA2/GM130 (shGOLGA2) on autophagy and lung cancer growth were evaluated in vitro and in vivo. Downregulation of GOLGA2/GM130 led to induction of autophagy and inhibition of glycosylation in A549 cells and in the lungs of K-ras(LA1) mice. Furthermore, downregulation of GOLGA2/GM130 decreased angiogenesis and cancer cell invasion in vitro and suppressed tumorigenesis in lung cancer mice model. The tumor specificity of sequence targeting GOLGA2/GM130 was also demonstrated. Taken together, these results suggest that induction of autophagy by shGOLGA2 may induce cell death rather than cell survival. Therefore, downregulation of GOLGA2/GM130 may be a potential therapeutic option for lung cancer.

  7. Expression of cytoskeletal and matrix genes following exposure to ionizing radiation: Dose-rate effects and protein synthesis requirements

    International Nuclear Information System (INIS)

    Woloschak, G.E.

    1994-01-01

    Experiments were designed to examine the effects Of radiation dose-rate and of the protein synthesis inhibitor cycloheximide on expression of cytoskeletal elements (γ- and β-actin and α-tubulin) and matrix elements (fibronectin) in Syrian hamster embryo cells. Past work from our laboratory had already demonstrated optimum time points and doses for examination of radiation effects on accumulation of specific transcripts. Our results here demonstrated little effect of dose-rate for JANUS fission spectrum neutrons when comparing expression of either α-tubulin or fibronectin genes. Past work had already documented similar results for expression of actin transcripts. Effects of cycloheximide revealed that cycloheximide repressed accumulation of α-tubulin following exposure to high dose-rate neutrons or γ rays; this did not occur following similar low dose-rate exposure. (2) Cycloheximide did not affect accumulation of MRNA for actin genes; and that cycloheximide abrogated the moderate induction of fibronectin-mRNA which occurred following exposure to γ rays and high dose-rate neutrons. These results suggest a role for labile proteins in the maintenance of α-tubulin and fibronectin MRNA accumulation following exposure to ionizing radiation. in addition, they suggest that the cellular/molecular response to low dose-rate neutrons may be different from the response to high dose-rate neutrons

  8. Expression of cytoskeletal and matrix genes following exposure to ionizing radiation: Dose-rate effects and protein synthesis requirements

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Felcher, P.; Chang-Liu, Chin-Mei

    1992-01-01

    Experiments were designed to examine the effects of radiation dose-rate and of the protein synthesis inhibitor cycloheximide on expression of cytoskeletal elements (γ- and β-actin and α-tubulin) and matrix elements (fibronectin) in Syrian hamster embryo cells. Past work from our laboratory had already demonstrated optimum time points and doses for examination of radiation effects on accumulation of specific transcripts. Our results here demonstrated little effect of dose-rate for JANUS fission spectrum neutrons when comparing expression of either α-tubulin or fibronectin genes. Past work had already documented similar results for expression of actin transcripts. Effects of cycloheximide, however, revealed several interesting and novel findings: (1) Cycloheximide repressed accumulation of α-tubulin following exposure to high dose-rate neutrons or γ rays; this did not occur following similar low dose-rate exposure (2) Cycloheximide did not affect accumulation of mRNA for actin genes. Cycloheximide abrogated the moderate induction of fibronectin-mRNA which occurred following exposure to γ rays and high dose-rate neutrons. These results suggest a role for labile proteins in the maintenance of α-tubulin and fibronectin mRNA accumulation following exposure to ionizing radiation. In addition, they suggest that the cellular/molecular response to low dose-rate neutrons may be different from the response to high dose-rate neutrons

  9. Altered expression of matrix metalloproteinases and tight junction proteins in rats following PEMF-induced BBB permeability change.

    Science.gov (United States)

    Zhang, Ya Mei; Zhou, Yan; Qiu, Lian Bo; Ding, Gui Rong; Pang, Xiao Feng

    2012-04-01

    To investigate the expression of occludin, ZO-1, MMP-2, and MMP-9 in cerebral microvasculature following Pulse Electromagnetic Field (PEMF) induced BBB permeability change. Sprague-Dawley rats were randomized into PEMF and sham exposed groups (n = 8). After exposure to PEMF at 0.5, 1, 3, 6, and 12 h, BBB permeability was measured by Evans-Blue extravasation. The expression of occludin, ZO-1, MMP-2, and MMP-9 were detected by real-time quantitative reverse transcriptase PCR and western blotting. MMP-2 and MMP-9 activity were detected by EnzChek gelatinase assay. Compared with the sham group, PEMF exposure led to increased permeability of the BBB to EB, which was prolonged after exposure. BBB permeability became progressively more severe, and recovered at 6 h. The gene and protein expression of occludin and ZO-1 were significantly decreased, while MMP-2 and MMP-9 expression were significantly increased after exposure to PEMF. All levels of expression recovered 12 h following PEMF. Changes to BBB permeability were related to the alteration expression of tight junction proteins and matrix metalloproteinase after exposure to PEMF.

  10. Decreased expression of extracellular matrix proteins and trophic factors in the amygdala complex of depressed mice after chronic immobilization stress

    Directory of Open Access Journals (Sweden)

    Jung Soonwoong

    2012-06-01

    Full Text Available Abstract Background The amygdala plays an essential role in controlling emotional behaviors and has numerous connections to other brain regions. The functional role of the amygdala has been highlighted by various studies of stress-induced behavioral changes. Here we investigated gene expression changes in the amygdala in the chronic immobilization stress (CIS-induced depression model. Results Eight genes were decreased in the amygdala of CIS mice, including genes for neurotrophic factors and extracellular matrix proteins. Among these, osteoglycin, fibromodulin, insulin-like growth factor 2 (Igf2, and insulin-like growth factor binding protein 2 (Igfbp2 were further analyzed for histological expression changes. The expression of osteoglycin and fibromodulin simultaneously decreased in the medial, basolateral, and central amygdala regions. However, Igf2 and Igfbp2 decreased specifically in the central nucleus of the amygdala. Interestingly, this decrease was found only in the amygdala of mice showing higher immobility, but not in mice displaying lower immobility, although the CIS regimen was the same for both groups. Conclusions These results suggest that the responsiveness of the amygdala may play a role in the sensitivity of CIS-induced behavioral changes in mice.

  11. Production of H5N1 influenza virus matrix protein 2 ectodomain protein bodies in tobacco plants and in insect cells as a candidate universal influenza vaccine

    Directory of Open Access Journals (Sweden)

    Sandiswa Mbewana

    2015-12-01

    Full Text Available The spread of influenza A viruses is partially controlled and prevented by vaccination. The matrix protein 2 ectodomain (M2e is the most conserved sequence in influenza A viruses, and is therefore a good potential target for a vaccine to protect against multiple virus subtypes. We explored the feasibility of a M2e-based universal influenza A vaccine candidate based on the highly pathogenic avian influenza A virus, H5N1. A synthetic M2e gene was human and plant codon optimised and fused in-frame with a sequence encoding the N-terminal proline-rich domain (Zera® of the γ-zein protein of maize. Zera®M2e was expressed transiently in Nicotiana benthamiana and Sf21 baculovirus / insect cell expression systems, and Zera®M2e protein bodies (PBs were successfully produced in both expression systems. The plant-produced Zera®M2e PBs were purified and injected into Balb/c mice. Western blot analysis using insect cell-produced Zera®M2e PBs and multiple tandem M2e sequences (5xM2e fused with the avian influenza H5N1 transmembrane and cytosolic tail (5xM2e_tHA confirmed the presence of M2e-specific antibodies in immunised mice sera. The immunogenicity of the Zera®M2e indicates that our plant-produced protein has potential as an inexpensive universal influenza A vaccine.

  12. Vitamin k intake and plasma desphospho-uncarboxylated matrix Gla-protein levels in kidney transplant recipients.

    Directory of Open Access Journals (Sweden)

    Paul Y Boxma

    Full Text Available Vitamin K is essential for activation of γ-carboxyglutamate (Gla-proteins including the vascular calcification inhibitor matrix Gla-protein (MGP. Insufficient vitamin K intake leads to production of uncarboxylated, mostly inactive proteins and contributes to an increased cardiovascular risk. In kidney transplant recipients, cardiovascular risk is high but vitamin K intake and status have not been defined. We investigated dietary vitamin K intake, vascular vitamin K status and its determinants in kidney transplant recipients. We estimated vitamin K intake in a cohort of kidney transplant recipients (n = 60 with stable renal function (creatinine clearance 61 [42-77] (median [interquartile range] ml/min, who were 75 [35-188] months after transplantation, using three-day food records and food frequency questionnaires. Vascular vitamin K status was assessed by measuring plasma desphospho-uncarboxylated MGP (dp-ucMGP. Total vitamin K intake was below the recommended level in 50% of patients. Lower vitamin K intake was associated with less consumption of green vegetables (33 vs 40 g/d, p = 0.06 and increased dp-ucMGP levels (621 vs 852 pmol/L, p500 pmol/L in 80% of patients. Multivariate regression identified creatinine clearance, coumarin use, body mass index, high sensitivity-CRP and sodium excretion as independent determinants of dp-ucMGP levels. In a considerable part of the kidney transplant population, vitamin K intake is too low for maximal carboxylation of vascular MGP. The high dp-ucMGP levels may result in an increased risk for arterial calcification. Whether increasing vitamin K intake may have health benefits for kidney transplant recipients should be addressed by future studies.

  13. Pathogenic Naegleria fowleri and non-pathogenic Naegleria lovaniensis exhibit differential adhesion to, and invasion of, extracellular matrix proteins.

    Science.gov (United States)

    Jamerson, Melissa; da Rocha-Azevedo, Bruno; Cabral, Guy A; Marciano-Cabral, Francine

    2012-03-01

    Naegleria fowleri and Naegleria lovaniensis are closely related free-living amoebae found in the environment. N. fowleri causes primary amoebic meningoencephalitis (PAM), a rapidly fatal disease of the central nervous system, while N. lovaniensis is non-pathogenic. N. fowleri infection occurs when the amoebae access the nasal passages, attach to the nasal mucosa and its epithelial lining, and migrate to the brain. This process involves interaction with components of the host extracellular matrix (ECM). Since the ability to invade tissues can be a characteristic that distinguishes pathogenic from non-pathogenic amoebae, the objective of this study was to assess adhesion to, and invasion of, the ECM by these two related but distinct Naegleria species. N. fowleri exhibited a higher level of adhesion to the ECM components laminin-1, fibronectin and collagen I. Scanning electron microscopy revealed that N. fowleri attached on ECM substrata exhibited a spread-out appearance that included the presence of focal adhesion-like structures. Western immunoblotting revealed two integrin-like proteins for both species, but one of these, with a molecular mass of approximately 70 kDa, was detected at a higher level in N. fowleri. Confocal microscopy indicated that the integrin-like proteins co-localized to the focal adhesion-like structures. Furthermore, anti-integrin antibody decreased adhesion of N. fowleri to ECM components. Finally, N. fowleri disrupted 3D ECM scaffolds, while N. lovaniensis had a minimal effect. Collectively, these results indicate a distinction in adhesion to, and invasion of, ECM proteins between N. fowleri and N. lovaniensis.

  14. 3-Phosphoinositide-dependent Protein Kinase-1 (PDK1 promotes invasion and activation of matrix metalloproteinases

    Directory of Open Access Journals (Sweden)

    Zeng Xiao

    2006-03-01

    Full Text Available Abstract Background Metastasis is a major cause of morbidity and mortality in breast cancer with tumor cell invasion playing a crucial role in the metastatic process. PDK1 is a key molecule that couples PI3K to cell proliferation and survival signals in response to growth factor receptor activation, and is oncogenic when expressed in mouse mammary epithelial cells. We now present evidence showing that PDK1-expressing cells exhibit enhanced anchorage-dependent and -independent cell growth and are highly invasive when grown on Matrigel. These properties correlate with induction of MMP-2 activity, increased MT1-MMP expression and a unique gene expression profile. Methods Invasion assays in Matrigel, MMP-2 zymogram analysis, gene microarray analysis and mammary isografts were used to characterize the invasive and proliferative function of cells expressing PDK1. Tissue microarray analysis of human breast cancers was used to measure PDK1 expression in invasive tumors by IHC. Results Enhanced invasion on Matrigel in PDK1-expressing cells was accompanied by increased MMP-2 activity resulting from stabilization against proteasomal degradation. Increased MMP-2 activity was accompanied by elevated levels of MT1-MMP, which is involved in generating active MMP-2. Gene microarray analysis identified increased expression of the ECM-associated genes decorin and type I procollagen, whose gene products are substrates of MT1-MMP. Mammary fat pad isografts of PDK1-expressing cells produced invasive adenocarcinomas. Tissue microarray analysis of human invasive breast cancer indicated that PDK1pSer241 was strongly expressed in 90% of samples. Conclusion These results indicate that PDK1 serves as an important effector of mammary epithelial cell growth and invasion in the transformed phenotype. PDK1 mediates its effect in part by MT1-MMP induction, which in turn activates MMP-2 and modulates the ECM proteins decorin and collagen. The presence of increased PDK1

  15. 3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) promotes invasion and activation of matrix metalloproteinases

    International Nuclear Information System (INIS)

    Xie, Zhihui; Yuan, Hongyan; Yin, Yuzhi; Zeng, Xiao; Bai, Renkui; Glazer, Robert I

    2006-01-01

    Metastasis is a major cause of morbidity and mortality in breast cancer with tumor cell invasion playing a crucial role in the metastatic process. PDK1 is a key molecule that couples PI3K to cell proliferation and survival signals in response to growth factor receptor activation, and is oncogenic when expressed in mouse mammary epithelial cells. We now present evidence showing that PDK1-expressing cells exhibit enhanced anchorage-dependent and -independent cell growth and are highly invasive when grown on Matrigel. These properties correlate with induction of MMP-2 activity, increased MT1-MMP expression and a unique gene expression profile. Invasion assays in Matrigel, MMP-2 zymogram analysis, gene microarray analysis and mammary isografts were used to characterize the invasive and proliferative function of cells expressing PDK1. Tissue microarray analysis of human breast cancers was used to measure PDK1 expression in invasive tumors by IHC. Enhanced invasion on Matrigel in PDK1-expressing cells was accompanied by increased MMP-2 activity resulting from stabilization against proteasomal degradation. Increased MMP-2 activity was accompanied by elevated levels of MT1-MMP, which is involved in generating active MMP-2. Gene microarray analysis identified increased expression of the ECM-associated genes decorin and type I procollagen, whose gene products are substrates of MT1-MMP. Mammary fat pad isografts of PDK1-expressing cells produced invasive adenocarcinomas. Tissue microarray analysis of human invasive breast cancer indicated that PDK1pSer241 was strongly expressed in 90% of samples. These results indicate that PDK1 serves as an important effector of mammary epithelial cell growth and invasion in the transformed phenotype. PDK1 mediates its effect in part by MT1-MMP induction, which in turn activates MMP-2 and modulates the ECM proteins decorin and collagen. The presence of increased PDK1 expression in the majority of invasive breast cancers suggests its

  16. The key role of proinflammatory cytokines, matrix proteins, RANKL/OPG and Wnt/β-catenin in bone healing of hip arthroplasty patients.

    Science.gov (United States)

    Cassuto, Jean; Folestad, Agnetha; Göthlin, Jan; Malchau, Henrik; Kärrholm, Johan

    2018-02-01

    1NP increased immediately after surgery and returned to basal level at 6W followed by a new peak at 10Y returning to basal at 13Y. IL-8 and IL-1β peaked at 5Y post-THA and returned to basal level at 10Y. RANKL/OPG and Wnt/β-catenin remained at preoperative levels until 5Y post-THA when a sustained increase in OPG level, paralleled by a sustained decrease in sclerostin, started and lasted until 18Y. Despite a strong increase by RANKL at 13Y, the OPG/RANKL-ratio remained high between 5Y and 18Y. Dkk-1 and sFRP-1 remained at basal level until 5Y followed by a peak at 7Y and a return to basal level at 15Y. Similarly, RANKL increased after 5Y, peaked at 13Y and returned to basal levels at 18Y, thus coinciding with Wnt-1. In contrast, Wnt3a, Dkk-3, Dkk-4, sFRP-3 and Wif-1 did not differ from preoperative levels or healthy subjects during the course of the follow-up. The primary peak of proinflammatory cytokines involved in the initiation of bone healing after trauma is in line with previous results. The primary phase of increased matrix proteins, P1NP and BALP paralleled by RANKL, OPG and Wnt/β-catenin remaining at preoperative level until 5Y, support a strong formation of mineralized matrix and to a lesser degree bone during this phase. The secondary proinflammatory peak at 5Y is likely a trigger of coupled bone remodeling and neosynthesis as it is followed by increased levels of the bone anabolic turnover marker, BALP, and mediators of the RANKL/OPG and Wnt/β-catenin pathways. A continuous increase by OPG level and the bone turnover marker, BALP, lasting from 5Y until 18Y and paralleled by a similar decrease in sclerostin level support their being key regulators of bone anabolism, whereas the transient and opposed activities of RANKL, Wnt-1, Dkk-1 and sFRP-1 serve as fine tuning tools during the coupled remodeling phase. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. The Glycoprotein and the Matrix Protein of Rabies Virus Affect Pathogenicity by Regulating Viral Replication and Facilitating Cell-to-Cell Spread▿

    OpenAIRE

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J.; Dietzschold, Bernhard

    2007-01-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant ...

  18. Resonance assignments of the myristoylated Y28F/Y67F mutant of the Mason-Pfizer monkey virus matrix protein

    Czech Academy of Sciences Publication Activity Database

    Doležal, Michal; Hrabal, R.; Ruml, T.; Rumlová, Michaela

    2015-01-01

    Roč. 9, č. 2 (2015), s. 229-233 ISSN 1874-2718 Institutional support: RVO:61388963 Keywords : isotopic labeling * matrix protein * M-PMV * myristoylation * resonance assignment * reverse labeling Subject RIV: CE - Biochemistry Impact factor: 0.687, year: 2015

  19. The combined use of enamel matrix proteins and a tetracycline-coated expanded polytetrafluoroethylene barrier membrane in the treatment of intra-osseous defects

    NARCIS (Netherlands)

    Sipos, PM; Loos, BG; Abbas, F; Timmerman, MF; van der Velden, U

    Objectives: The purpose of this split-mouth study was to evaluate the clinical response of enamel matrix proteins (EMPs, Emdogain Gel((R))) in intra-osseous defects with or without a combined application of a tetracycline-coated expanded polytetrafluoroethylene barrier membrane (e-PTFE,

  20. The combined use of enamel matrix proteins and a tetracyclinecoated expanded polytetrafluoroethylene barrier membrane in the treatment of intra-osseous defects

    NARCIS (Netherlands)

    Sipos, P.M.; Loos, B.G.; Abbas, F.; Timmerman, M.F.; Velden, U. van der

    2005-01-01

    Objectives: The purpose of this split-mouth study was to evaluate the clinical response of enamel matrix proteins (EMPs, Emdogain Gel) in intra-osseous defects with or without a combined application of a tetracycline-coated expanded polytetrafluoroethylene barrier membrane (e-PTFE, Gore-Tex).

  1. Intrinsically Disordered Enamel Matrix Protein Ameloblastin Forms Ribbon-like Supramolecular Structures via an N-terminal Segment Encoded by Exon 5

    Czech Academy of Sciences Publication Activity Database

    Wald, Tomáš; Osičková, Adriana; Šulc, Miroslav; Benada, Oldřich; Semerádtová, A.; Řežábková, Lenka; Veverka, Václav; Bednárová, Lucie; Malý, J.; Macek, Pavel; Šebo, Peter; Slabý, Ivan; Vondrášek, Jiří; Osička, Radim

    2013-01-01

    Roč. 288, č. 31 (2013), s. 22333-22345 ISSN 0021-9258 R&D Projects: GA ČR GAP302/10/0427 Institutional support: RVO:61388971 ; RVO:61388963 ; RVO:67985823 ; RVO:86652036 Keywords : Ameloblastin * Extracellular Matrix Proteins * Amelogenin Subject RIV: CE - Biochemistry; CE - Biochemistry (FGU-C) Impact factor: 4.600, year: 2013

  2. The urokinase plasminogen activator receptor-associated protein/endo180 is coexpressed with its interaction partners urokinase plasminogen activator receptor and matrix metalloprotease-13 during osteogenesis

    DEFF Research Database (Denmark)

    Engelholm, L H; Nielsen, B S; Netzel-Arnett, Sarah

    2001-01-01

    The urokinase plasminogen activator receptor-associated protein/Endo180 (uPARAP/Endo180) is a newly discovered member of the macrophage mannose receptor family that was reported to interact with ligand-bound urokinase plasminogen activator receptor (uPAR), matrix metalloprotease-13 (MMP-13), and ...

  3. The anchorless adhesin Eap (extracellular adherence protein) from Staphylococcus aureus selectively recognizes extracellular matrix aggregates but binds promiscuously to monomeric matrix macromolecules

    NARCIS (Netherlands)

    Hansen, Uwe; Hussain, Muzaffar; Villone, Daniela; Herrmann, Mathias; Robenek, Horst; Peters, Georg; Sinha, Bhanu; Bruckner, Peter

    Besides a number of cell wall-anchored adhesins, the majority of Staphylococcus aureus strains produce anchorless, cell wall-associated proteins, such as Eap (extracellular adherence protein). Eap contains four to six tandem repeat (EAP)-domains. Eap mediates diverse biological functions, including

  4. Exocrine pancreas glutamate secretion help to sustain enterocyte nutritional needs under protein restriction.

    Science.gov (United States)

    Araya, S; Kuster, E; Gluch, D; Mariotta, L; Lutz, C; Reding, T V; Graf, R; Verrey, F; Camargo, S M R

    2018-04-01

    Glutamine (Gln) is the most concentrated amino acid in blood and considered conditionally essential. Its requirement is increased during physiological stress, such as malnutrition or illness, despite its production by muscle and other organs. In the malnourished state, Gln has been suggested to have a trophic effect on the exocrine pancreas and small intestine. However, the Gln transport capacity, the functional relationship of these two organs, and the potential role of the Gln-glutamate (Glu) cycle are unknown. We observed that pancreatic acinar cells express lower levels of Glu than Gln transporters. Consistent with this expression pattern, the rate of Glu influx into acinar cells was approximately sixfold lower than that of Gln. During protein restriction, acinar cell glutaminase expression was increased and Gln accumulation was maintained. Moreover, Glu secretion by acinar cells into pancreatic juice and thus into the lumen of the small intestine was maintained. In the intestinal lumen, Glu absorption was preserved and Glu dehydrogenase expression was augmented, potentially providing the substrates for increasing energy production via the TCA cycle. Our findings suggest that one mechanism by which Gln exerts a positive effect on exocrine pancreas and small intestine involves the Gln metabolism in acinar cells and the secretion of Glu into the small intestine lumen. The exocrine pancreas acinar cells not only avidly accumulate Gln but metabolize Gln to generate energy and to synthesize Glu for secretion in the pancreatic juice. Secreted Glu is suggested to play an important role during malnourishment in sustaining small intestinal homeostasis. NEW & NOTEWORTHY Glutamine (Gln) has been suggested to have a trophic effect on exocrine pancreas and small intestine in malnourished states, but the mechanism is unknown. In this study, we suggest that this trophic effect derives from an interorgan relationship between exocrine pancreas and small intestine for Gln

  5. Preparation and rebinding properties of protein-imprinted polysiloxane using mesoporous calcium silicate grafted non-woven polypropylene as matrix.

    Science.gov (United States)

    Kan, Bohong; Feng, Lingzhi; Zhao, Kongyin; Wei, Junfu; Zhu, Dunwan; Zhang, Linhua; Ren, Qian

    2016-03-01

    Calcium silicate particle containing mesoporous SiO2 (CaSiO3@SiO2) was grafted on the surface of non-woven polypropylene. The PP non-woven grafted calcium silicate containing mesoporous SiO2 (PP-g-CaSiO3@SiO2) was used as the matrix to prepare bovine serum albumin (BSA) molecularly imprinted polysiloxane (MIP) by using silanes as the functional monomers and BSA as the template. PP non-woven grafted BSA-imprinted polysiloxane (PP-g-CaSiO3@SiO2 MIP) was characterized by scanning electron microscope (SEM), Fourier transform infrared spectometry (FTIR) and drilling string compensator (DSC). Influence factors on the rebinding capacity of the MIP were investigated, such as grafting degree, the pH in treating CaSiO3 and the type and proportion of silanes. The rebinding properties of BSA on PP-g-CaSiO3@SiO2 and MIP were investigated under different conditions. The results indicated that the rebinding capacity of MIP for BSA reached 56.32 mg/g, which was 2.65 times of NIP. The non-woven polypropylene grafted BSA-imprinted polysiloxane could recognize the template protein and the selectivity factor (β) was above 2.4 when using ovalbumin, hemoglobin and γ-globulin as control proteins. The PP-g-CaSiO3@SiO2 MIP has favorable reusability. Copyright © 2015 John Wiley & Sons, Ltd.

  6. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  7. Biophysical characterization of the olfactomedin domain of myocilin, an extracellular matrix protein implicated in inherited forms of glaucoma.

    Directory of Open Access Journals (Sweden)

    Susan D Orwig

    Full Text Available Myocilin is an eye protein found in the trabecular extracellular matrix (TEM, within the anatomic region that controls fluid flow. Variants of myocilin, localized to its olfactomedin (OLF domain, have been linked to inherited forms of glaucoma, a disease associated with elevated intraocular pressure. OLF domains have also been implicated in psychiatric diseases and cancers by their involvement in signaling, neuronal growth, and development. However, molecular characterization of OLFs has been hampered by challenges in recombinant expression, a hurdle we have recently overcome for the myocilin OLF domain (myoc-OLF. Here, we report the first detailed solution biophysical characterization of myoc-OLF to gain insight into its structure and function. Myoc-OLF is stable in the presence of glycosaminoglycans, as well as in a wide pH range in buffers with functional groups reminiscent of such glycosaminoglycans. Circular dichroism (CD reveals significant β-sheet and β-turn secondary structure. Unexpectedly, the CD signature is reminiscent of α-chymotrypsin as well as another ocular protein family, the βγ-crystallins. At neutral pH, intrinsic tryptophan fluorescence and CD melts indicate a highly cooperative transition with a melting temperature of ∼55 °C. Limited proteolysis combined with mass spectrometry reveals that the compact core structural domain of OLF consists of approximately residues 238-461, which retains the single disulfide bond and is as stable as the full myoc-OLF construct. The data presented here inform new testable hypotheses for interactions with specific TEM components, and will assist in design of therapeutic agents for myocilin glaucoma.

  8. Cell sex affects extracellular matrix protein expression and proliferation of smooth muscle progenitor cells derived from human pluripotent stem cells.

    Science.gov (United States)

    Li, Yanhui; Wen, Yan; Green, Morgaine; Cabral, Elise K; Wani, Prachi; Zhang, Fan; Wei, Yi; Baer, Thomas M; Chen, Bertha

    2017-07-04

    Smooth muscle progenitor cells (pSMCs) differentiated from human pluripotent stem cells (hPSCs) hold great promise for treating diseases or degenerative conditions involving smooth muscle pathologies. However, the therapeutic potential of pSMCs derived from men and women may be very different. Cell sex can exert a profound impact on the differentiation process of stem cells into somatic cells. In spite of advances in translation of stem cell technologies, the role of cell sex and the effect of sex hormones on the differentiation towards mesenchymal lineage pSMCs remain largely unexplored. Using a standard differentiation protocol, two human embryonic stem cell lines (one male line and one female line) and three induced pluripotent stem cell lines (one male line and two female lines) were differentiated into pSMCs. We examined differences in the differentiation of male and female hPSCs into pSMCs, and investigated the effect of 17β-estradiol (E2) on the extracellular matrix (ECM) metabolisms and cell proliferation rates of the pSMCs. Statistical analyses were performed by using Student's t test or two-way ANOVA, p cell proliferation rates. E2 treatment induced the expression of myogenic gene markers and suppressed ECM degradation activities through reduction of MMP activity and increased expression of TIMP-1 in female pSMCs, but not in male pSMCs. hPSC-derived pSMCs from different sexes show differential expression of ECM proteins and proliferation rates. Estrogen appears to promote maturation and ECM protein expression in female pSMCs, but not in male pSMCs. These data suggest that intrinsic cell-sex differences may influence progenitor cell biology.

  9. Cartilage oligomeric matrix protein (COMP) in rheumatoid arthritis and its correlation with sonographic knee cartilage thickness and disease activity.

    Science.gov (United States)

    Sakthiswary, Rajalingham; Rajalingam, Shamala; Hussein, Heselynn; Sridharan, Radhika; Asrul, Abdul Wahab

    2017-12-01

    The aim of the study is to investigate the correlation of serum cartilage oligomeric matrix protein (COMP) levels with articular cartilage damage based on sonographic knee cartilage thickness (KCT) and disease activity in rheumatoid arthritis (RA). A total of 61 RA patients and 27 healthy controls were recruited in this study. Serum samples were obtained from all subjects to determine the serum COMP levels. All subjects had bilateral ultrasound scan of their knees. The KCT was based on the mean of measurements at three sites: the medial condyle, lateral condyle and intercondylar notch. Besides, the RA patients were assessed for their disease activity based on 28-joint-based Disease Activity Score (DAS 28). Serum COMP concentrations were significantly elevated in the RA patients compared to the controls (p = 0.001). The serum COMP levels had an inverse relationship with bilateral KCT in RA subjects and the healthy controls. COMP correlated significantly with disease activity based on DAS 28 (r = 0.299, p = 0.010), disease duration (r = 0.439, p = correlation between serum COMP and DAS 28 scores was comparable to the traditional markers of inflammation: erythrocyte sedimentation rate (ESR) (r = 0.372, p = 0.003) and C-reactive protein (CRP) (r = 0.305, p = 0.017). The serum COMP is a promising biomarker in RA which reflects disease activity and damage to the articular cartilage.

  10. Cell culture model predicts human disease: Altered expression of junction proteins and matrix metalloproteinases in cervical dysplasia

    Directory of Open Access Journals (Sweden)

    Kivi Niina

    2012-08-01

    Full Text Available Abstract Background Cervical cancer is necessarily caused by human papillomaviruses, which encode three oncogenes manifesting their functions by interfering with a number of cellular proteins and pathways: the E5, E6, and E7 proteins. We have earlier found in our microarray studies that the E5 oncogene crucially affects the expression of cellular genes involved in adhesion and motility of epithelial cells. Methods In order to biologically validate our previous experimental findings we performed immunohistochemical staining of a representative set of tissue samples from different grades of high-risk human papillomavirus associated cervical disease as well as normal squamous and columnar cervical epithelium. Three-dimensional collagen raft cultures established from E5-expressing and control epithelial cells were also examined. The expression of p16, matrix metalloproteinase (MMP -7, MMP-16, cytokeratin (CK 8/18, laminin, E-cadherin and beta-catenin was studied. Results In agreement with our previous microarray studies, we found intense staining for E-cadherin and beta-catenin in adherens junctions even in high-grade cervical lesions. Staining for MMP-16 was increased in severe disease as well. No significant change in staining for MMP-7 and cytokeratin 8/18 along with the grade of cervical squamous epithelial disease was observed. Conclusions Here we have confirmed, using tissue material from human papillomavirus associated lesions, some of the cellular gene expression modifications that we earlier reported in an experimental system studying specifically the E5 oncogene of papillomaviruses. These findings were partially surprising in the context of cervical carcinogenesis and emphasize that the complexity of carcinogenesis is not yet fully understood. Microarray approaches provide a wide overwiev of gene expression in experimental settings, which may yield biologically valid biomarkers for disease diagnostics, prognosis, and follow-up.

  11. Outcome of nonunion fractures in dogs treated with fixation, compression resistant matrix, and recombinant human bone morphogenetic protein-2.

    Science.gov (United States)

    Massie, Anna M; Kapatkin, Amy S; Fuller, Mark C; Verstraete, Frank J M; Arzi, Boaz

    2017-03-20

    To report the use of compression resistant matrix (CRM) infused with recombinant human bone morphogenetic protein (rhBMP-2) prospectively in the healing of nonunion long-bone fractures in dogs. A longitudinal cohort of dogs that were presented with nonunion fractures were classified and treated with CRM soaked with rhBMP-2 and fracture fixation. They were followed with serial radiographs and evaluated for healing times and complications according to the time frame and definitions previously established for orthopaedic clinical cases. Eleven nonunion fractures in nine dogs were included. Median healing time was 10 weeks (range: 7-20 weeks). Major perioperative complications due to bandage morbidity were encountered in two of 11 limbs and resolved. All other complications were minor. They occurred perioperatively in eight of 11 limbs. Minor follow-up complications included short-term in one of two limbs, mid-term in one of three, and long-term in four of five limbs. Nine limbs returned to full function and two limbs returned to acceptable function at the last follow-up. Nonunion fractures given a poor prognosis via standard-of-care treatment were successfully repaired using CRM with rhBMP-2 accompanying fixation. These dogs, previously at high risk of failure, returned to full or acceptable function.

  12. Weaponizing human EGF-containing fibulin-like extracellular matrix protein 1 (EFEMP1) for 21st century cancer therapeutics.

    Science.gov (United States)

    Zhou, Yi-Hong; Hu, Yuanjie; Yu, Liping; Ke, Chao; Vo, Christopher; Hsu, Hao; Li, Zhenzhi; Di Donato, Anne T; Chaturbedi, Abhishek; Hwang, Ji Won; Siegel, Eric R; Linskey, Mark E

    2016-01-01

    De-regulated EFEMP1 gene expression in solid tumors has been widely reported with conflicting roles. We dissected EFEMP1 to identify domains responsible for its cell context-dependent dual functions, with the goal being to construct an EFEMP1-derived tumor-suppressor protein (ETSP) that lacked tumor-promoting function. Exon/intron boundaries of EFEMP1 were used as boundaries of functional modules in constructing EFEMP1 variants, with removal of various module(s), and/or mutating an amino acid residue to convert a weak integrin binding-site into a strong one. A series of in vitro assays on cancerous features, and subcutaneous and intracranial xenograft-formation assays, were carried out for effects from overexpression of wild-type and variant forms of EFEMP1 in two glioma subpopulations characterized as tumor mass-forming cells (TMCs) or stem-like tumor initiating cells (STICs), where EFEMP1 showed cellcontext- dependent dual functions. One of the EFEMP1 variants was identified as the sought-after ETSP, which had a stronger tumor-suppression function in TMCs by targeting EGFR and angiogenesis, and a new tumor-suppression function in STICs by targeting NOTCH signaling and MMP2-mediated cell invasion. Therefore, ETSP may form the basis for further important research to develop a novel cancer therapy to treat many types of cancer by its tumor suppressor effect in the extracellular matrix compartment.

  13. Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development.

    Science.gov (United States)

    Wirrig, Elaine E; Snarr, Brian S; Chintalapudi, Mastan R; O'neal, Jessica L; Phelps, Aimee L; Barth, Jeremy L; Fresco, Victor M; Kern, Christine B; Mjaatvedt, Corey H; Toole, Bryan P; Hoffman, Stanley; Trusk, Thomas C; Argraves, W Scott; Wessels, Andy

    2007-10-15

    To expand our insight into cardiac development, a comparative DNA microarray analysis was performed using tissues from the atrioventricular junction (AVJ) and ventricular chambers of mouse hearts at embryonic day (ED) 10.5-11.0. This comparison revealed differential expression of approximately 200 genes, including cartilage link protein 1 (Crtl1). Crtl1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Immunohistochemical studies showed that, initially, Crtl1, versican, and HA are co-expressed in the endocardial lining of the heart, and in the endocardially derived mesenchyme of the AVJ and outflow tract (OFT). At later stages, this co-expression becomes restricted to discrete populations of endocardially derived mesenchyme. Histological analysis of the Crtl1-deficient mouse revealed a spectrum of cardiac malformations, including AV septal and myocardial defects, while expression studies showed a significant reduction in versican levels. Subsequent analysis of the hdf mouse, which carries an insertional mutation in the versican gene (CSPG2), demonstrated that haploinsufficient versican mice display septal defects resembling those seen in Crtl1(-/-) embryos, suggesting that reduced versican expression may contribute to a subset of the cardiac abnormalities observed in the Crtl1(-/-) mouse. Combined, these findings establish an important role for Crtl1 in heart development.

  14. A novel subnucleocapsid nanoplatform for mucosal vaccination against influenza virus that targets the ectodomain of matrix protein 2.

    Science.gov (United States)

    Hervé, Pierre-Louis; Raliou, Mariam; Bourdieu, Christiane; Dubuquoy, Catherine; Petit-Camurdan, Agnès; Bertho, Nicolas; Eléouët, Jean-François; Chevalier, Christophe; Riffault, Sabine

    2014-01-01

    In this study, subnucleocapsid nanorings formed by the recombinant nucleoprotein (N) of the respiratory syncytial virus were evaluated as a platform to anchor heterologous antigens. The ectodomain of the influenza virus A matrix protein 2 (M2e) is highly conserved and elicits protective antibodies when it is linked to an immunogenic carrier, making it a promising target to develop universal influenza vaccines. In this context, one or three M2e copies were genetically linked to the C terminus of N to produce N-M2e and N-3M2e chimeric recombinant nanorings. Mice were immunized intranasally with N-M2e or N-3M2e or with M2e or 3M2e control peptides. N-3M2e-vaccinated mice showed the strongest mucosal and systemic antibody responses. These mice presented a reduced viral load and minor weight loss, and all survived upon challenge with influenza virus A/PR8/34 (H1N1) (PR8). We compared the intranasal route to the subcutaneous route of N-3M2e immunization. Only the intranasal route induced a strong local IgA response and led to the protection of mice upon challenge. Finally, we demonstrated that the induction of anti-M2e antibodies by N-3M2e is not impaired by preexisting anti-N immunity. Overall, these results show that the N nanoring is a potent carrier for mucosal delivery of vaccinal antigens.

  15. Quantitation of cell-matrix adhesion using confocal image analysis of focal contact associated proteins and interference reflection microscopy.

    Science.gov (United States)

    Usson, Y; Guignandon, A; Laroche, N; Lafage-Proust, M H; Vico, L

    1997-08-01

    We have developed an approach for the quantitation of vinculin, a focal contact associated protein, based on a multimodal confocal microscopy and image analysis. Vinculin spot distribution was imaged in confocal fluorescence microscopy and the corresponding focal contacts were imaged in confocal interference reflection microscopy. These images were analyzed with a SAMBA image cytometer. The image analysis program provided 12 morphometric features describing cellular area, shape, and proportions of vinculin spots as well as six topographical features describing the distribution of vinculin and the relative overlap of vinculin and focal contacts. This approach was applied to the study of rat osteosarcoma cells submitted to mechanical stresses: successions of 2g and 0g accelerations during a series of parabolic flights. The measured features were assessed by means of correlation analysis and stepwise discriminant analysis. After correlation analysis, only ten parameters were retained. Quantitation of cell morphological parameters indicated that cell area was significantly affected by gravitational stresses as well as vinculin distribution. Cell area was reduced by 50% and vinculin spots were restricted to cell periphery. Cell adhesion measured by IRM decreased significantly in the first part of the flight and remained stable at the end of the flight. These results suggest that cell-matrix adhesion is affected by gravitational stresses. Image analysis provides useful tools to investigate focal adhesion re-organization under different physiological stimuli.

  16. Circulating uncarboxylated matrix gla protein is associated with vitamin K nutritional status, but not coronary artery calcium, in older adults.

    Science.gov (United States)

    Shea, M Kyla; O'Donnell, Christopher J; Vermeer, Cees; Magdeleyns, Elke J P; Crosier, Michael D; Gundberg, Caren M; Ordovas, José M; Kritchevsky, Stephen B; Booth, Sarah L

    2011-08-01

    Matrix Gla protein (MGP) is a calcification inhibitor in vascular tissue that must be carboxylated by vitamin K to function. Evidence suggests circulating uncarboxylated MGP (ucMGP) is elevated in persons with disease characterized by vascular calcification. The primary purpose of this study was to determine cross-sectional and longitudinal associations between plasma ucMGP, vitamin K status, and coronary artery calcium (CAC) in older adults without coronary heart disease. Genetic determinants of ucMGP were also explored. Cross-sectional associations among baseline plasma ucMGP, vitamin K status biomarkers [plasma phylloquinone, uncarboxylated prothrombin (PIVKA-II), serum uncarboxylated osteocalcin (%ucOC)], CAC, and plausible genetic polymorphisms were examined in 438 community-dwelling adults (60-80 y, 59% women). The effect of phylloquinone supplementation (500 μg/d) for 3 y on plasma ucMGP was determined among 374 participants. At baseline, plasma phylloquinone was lower and %ucOC and PIVKA-II were greater across higher plasma ucMGP quartiles (all P supplemented group, the 3-y change in ucMGP was not associated with the 3-y change in CAC [unstandard β (SE) = -0.02 (0.02); P = 0.44]. Plasma ucMGP was associated with vitamin K status biomarkers and was reduced following phylloquinone supplementation, suggesting it may be a useful marker of vitamin K status in vascular tissue. Plasma ucMGP did not reflect CAC in healthy older adults.

  17. Extracellular matrix protein fibulin-1 plasma levels are associated with increased cardiovascular risk in chronic kidney disease

    DEFF Research Database (Denmark)

    Scholze, Alexandra

    INTRODUCTION AND AIMS: Fibulin-1 is one of the few extracellular matrix proteins present in blood in high concentrations. We aimed to define the relationship between plasma fibulin-1 levels and risk markers of cardiovascular disease in patients with chronic kidney disease. METHODS: Plasma fibulin-1...... hemodynamic and arterial stiffness indices. RESULTS: We observed a positive correlation of fibulin-1 levels with age (r=0.38; p=0.033), glycated hemoglobin (r=0.80; p=0.003), creatinine (r=0.35; p=0.045), and fibrinogen (r=0.39; p=0.027). Glomerular filtration rate and fibulin-1 were inversely correlated (r......=-0.57; p=0.022). There was a positive correlation between fibulin-1 and central pulse pressure (r=0.44; p=0.011) and central augmentation pressure (r=0.55; p=0.001). In a multivariable regression model, diabetes, creatinine, fibrinogen and central augmentation pressure were independent predictors...

  18. Study on the correlation between extracellular matrix protein-1 and the growth, metastasis and angiogenesis of laryngeal carcinoma.

    Science.gov (United States)

    Meng, Xin-Yu; Liu, Juan; Lv, Feng; Liu, Ming-Qiu; Wan, Jing-Ming

    2015-01-01

    To investigate the correlation between extracellular matrix protein-1 (ECM1) and the growth, metastasis and angiogenesis of laryngeal carcinoma. Forty-five samples with laryngeal benign and malignant tumors confirmed by pathology in Laiwu City People's Hospital from March 2006 to March 2011 were collected, in which there were 29 cases with laryngeal carcinoma and 16 with benign tumors. The expression of ECM1 and factor VIII-related antigens in patients with laryngeal carcinoma and those with benign tumors was respectively detected using immunohistochemical method, and the correlation between ECM1 staining grade and microvessel density (MVD) was analyzed. In laryngeal carcinoma tissue, ECM1 was mainly expressed in cytoplasm, less in cytomembrane or intercellular substance. With abundant expression in the tissue of laryngeal benign tumors (benign mesenchymoma and hemangioma), ECM1 was primarily expressed in the connective tissue, which was different from the expression in laryngeal carcinoma tissue. The proportion of positive ECM1 staining (++) in patients with laryngeal carcinoma was dramatically higher than those with benign tumors (pcorrelation analysis revealed that ECM1 staining grade in laryngeal carcinoma tissue had a significantly-positive correlation with MVD (r=0.866, p=0.000). ECM1 expression in laryngeal carcinoma is closely associated with tumor cell growth, metastasis and angiogenesis, which can be considered as an effective predictor in the occurrence and postoperative recurrence of laryngeal carcinoma.

  19. Matrix protein of vesicular stomatitis virus: a potent inhibitor of vascular endothelial growth factor and malignant ascites formation.

    Science.gov (United States)

    Zhou, Y; Wen, F; Zhang, P; Tang, R; Li, Q

    2013-03-01

    Malignant ascites is common in various types of cancers and is difficult to manage. Vascular endothelial growth factor (VEGF) has a pivotal role in malignant ascites. The matrix protein of vesicular stomatitis virus (VSVMP) has been shown to inhibit host gene expression and induce the apoptosis of cancer cells. The present study was designed to determine whether VSVMP suppresses the formation of ascites in ascites-producing peritoneal carcinomatosis. BALB/c female mice, 6-8 weeks old, bearing peritoneal tumors of H22 or MethA cells received an intraperitoneal administration of 50 μg VSVMP/250 μg liposome complexes, 50 μg empty plasmid/250 μg liposome complexes or 0.9% NaCl solution, respectively, every 2 days for 3 weeks. Administration of VSVMP resulted in a significant inhibition in ascites formation, improvement in health condition and prolonged survival of the treated mice. Decreased peritoneum osmolarity and reduced tumor vascularity coincided with dramatic reductions in the VEGF level in ascites fluid and plasma. Examination of floating tumor cells collected from the peritoneal wash revealed an apparently increased number of apoptotic cells and profound downregulation of VEGF mRNA in the VSVMP-treated mice. Our data indicate for the first time that in BALB/c mice bearing H22 or MethA cell peritoneal tumors, VSVMP may inhibit VEGF production and suppress angiogenesis, consequently abolishing ascites formation.

  20. Statistical optimization of bambara groundnut protein isolate-alginate matrix systems on survival of encapsulated Lactobacillus rhamnosus GG

    Directory of Open Access Journals (Sweden)

    Kanyanat Kaewiad

    2017-08-01

    Full Text Available Encapsulation may protect viable probiotic cells. This study aims at the evaluation of a bambara groundnut protein isolate (BGPI-alginate matrix designed for encapsulating a probiotic Lactobacillus rhamnosus GG. The response surface methodology was employed to gain the optimal concentrations of BGPI and alginate on encapsulation efficiency and survival of encapsulated cells. The capsules were prepared at the optimal combination by the traditional extrusion method composed of 8.66% w/v BGPI and 1.85% w/v alginate. The encapsulation efficiency was 97.24%, whereas the survival rates in an acidic condition and after the freeze-drying process were 95.56% and 95.20%, respectively—higher than those using either BGPI or alginate as the encapsulating agent individually. The designed capsules increased the probiotic L. rhamnosus GG survival relative to free cells in a simulated gastric fluid by 5.00 log cfu/ml after 3 h and in a simulated intestinal fluid by 8.06 log cfu/ml after 4 h. The shelf-life studies of the capsules over 6 months at 4 °C and 30 °C indicated that the remaining number of viable cells in a BGPI-alginate capsule was significantly higher than that of free cells in both temperatures. It was demonstrated that the BGPI-alginate capsule could be utilized as a new probiotic carrier for enhanced gastrointestinal transit and storage applied in food and/or pharmaceutical products.

  1. Staurosporine and extracellular matrix proteins mediate the conversion of small cell lung carcinoma cells into a neuron-like phenotype.

    Directory of Open Access Journals (Sweden)

    Tamara Murmann

    Full Text Available Small cell lung carcinomas (SCLCs represent highly aggressive tumors with an overall five-year survival rate in the range of 5 to 10%. Here, we show that four out of five SCLC cell lines reversibly develop a neuron-like phenotype on extracellular matrix constituents such as fibronectin, laminin or thrombospondin upon staurosporine treatment in an RGD/integrin-mediated manner. Neurite-like processes extend rapidly with an average speed of 10 µm per hour. Depending on the cell line, staurosporine treatment affects either cell cycle arrest in G2/M phase or induction of polyploidy. Neuron-like conversion, although not accompanied by alterations in the expression pattern of a panel of neuroendocrine genes, leads to changes in protein expression as determined by two-dimensional gel electrophoresis. It is likely that SCLC cells already harbour the complete molecular repertoire to convert into a neuron-like phenotype. More extensive studies are needed to evaluate whether the conversion potential of SCLC cells is suitable for therapeutic interventions.

  2. Down regulation of NO signaling in Trypanosoma cruzi upon parasite-extracellular matrix interaction: changes in protein modification by nitrosylation and nitration.

    Directory of Open Access Journals (Sweden)

    Milton Pereira

    2015-04-01

    Full Text Available Adhesion of the Trypanosoma cruzi trypomastigotes, the causative agent of Chagas' disease in humans, to components of the extracellular matrix (ECM is an important step in host cell invasion. The signaling events triggered in the parasite upon binding to ECM are less explored and, to our knowledge, there is no data available regarding •NO signaling.Trypomastigotes were incubated with ECM for different periods of time. Nitrated and S-nitrosylated proteins were analyzed by Western blotting using anti-nitrotyrosine and S-nitrosyl cysteine antibodies. At 2 h incubation time, a decrease in NO synthase activity, •NO, citrulline, arginine and cGMP concentrations, as well as the protein modifications levels have been observed in the parasite. The modified proteins were enriched by immunoprecipitation with anti-nitrotyrosine antibodies (nitrated proteins or by the biotin switch method (S-nitrosylated proteins and identified by MS/MS. The presence of both modifications was confirmed in proteins of interest by immunoblotting or immunoprecipitation.For the first time it was shown that T. cruzi proteins are amenable to modifications by S-nitrosylation and nitration. When T. cruzi trypomastigotes are incubated with the extracellular matrix there is a general down regulation of these reactions, including a decrease in both NOS activity and cGMP concentration. Notwithstanding, some specific proteins, such as enolase or histones had, at least, their nitration levels increased. This suggests that post-translational modifications of T. cruzi proteins are not only a reflex of NOS activity, implying other mechanisms that circumvent a relatively low synthesis of •NO. In conclusion, the extracellular matrix, a cell surrounding layer of macromolecules that have to be trespassed by the parasite in order to be internalized into host cells, contributes to the modification of •NO signaling in the parasite, probably an essential move for the ensuing invasion step.

  3. Data set for the proteomic inventory and quantitative analysis of chicken eggshell matrix proteins during the primary events of eggshell mineralization and the active growth phase of calcification

    Directory of Open Access Journals (Sweden)

    Pauline Marie

    2015-09-01

    Full Text Available Chicken eggshell is a biomineral composed of 95% calcite calcium carbonate mineral and of 3.5% organic matrix proteins. The assembly of mineral and its structural organization is controlled by its organic matrix. In a recent study [1], we have used quantitative proteomic, bioinformatic and functional analyses to explore the distribution of 216 eggshell matrix proteins at four key stages of shell mineralization defined as: (1 widespread deposition of amorphous calcium carbonate (ACC, (2 ACC transformation into crystalline calcite aggregates, (3 formation of larger calcite crystal units and (4 rapid growth of calcite as columnar structure with preferential crystal orientation. The current article detailed the quantitative analysis performed at the four stages of shell mineralization to determine the proteins which are the most abundant. Additionally, we reported the enriched GO terms and described the presence of 35 antimicrobial proteins equally distributed at all stages to keep the egg free of bacteria and of 81 proteins, the function of which could not be ascribed.

  4. Gas-phase ionization/desolvation processes and their effect on protein charge state distribution under matrix-assisted laser desorption/ionization conditions.

    Science.gov (United States)

    Alves, Sandra; Fournier, Françoise; Afonso, Carlo; Wind, Franck; Tabet, Jean-Claude

    2006-01-01

    The charge state distribution of proteins was studied as a function of experimental conditions, to improve the understanding of the matrix-assisted laser desorption/ionization (MALDI) mechanisms. The relative abundances of the multiply-charged ions appear to be a function of the matrix chosen, the laser fluence and the matrix-to-analyte molar ratio. A correlation is found between the matrix proton affinity and the yield of singly- versus multiply-charged ions. These results are in good agreement with a model in which gas-phase intracluster reactions play a significant role in analyte ion formation. A new model for endothermic desolvation processes in ultraviolet/MALDI is presented and discussed. It is based upon the existence of highly-charged precursor clusters and, complementary to the ion survivor model of Karas et al., assumes that two energy-dependent processes exist: (i) a soft desolvation involving consecutive losses of neutral matrix molecules, leading to a multiply-charged analyte and (ii) hard desolvation leading to a low charge state analyte, by consecutive losses of charged matrix molecules. These desolvations pathways are discussed in terms of kinetically limited processes. The efficiency of the two competitive desolvation processes seems related to the internal energy carried away by clusters during ablation.

  5. Guanine nucleotide-binding protein (Gα) endocytosis by a cascade of ubiquitin binding domain proteins is required for sustained morphogenesis and proper mating in yeast.

    Science.gov (United States)

    Dixit, Gauri; Baker, Rachael; Sacks, Carly M; Torres, Matthew P; Dohlman, Henrik G

    2014-05-23

    Heterotrimeric G proteins are well known to transmit signals from cell surface receptors to intracellular effector proteins. There is growing appreciation that G proteins are also present at endomembrane compartments, where they can potentially interact with a distinct set of signaling proteins. Here, we examine the cellular trafficking function of the G protein α subunit in yeast, Gpa1. Gpa1 contains a unique 109-amino acid insert within the α-helical domain that undergoes a variety of posttranslational modifications. Among these is monoubiquitination, catalyzed by the NEDD4 family ubiquitin ligase Rsp5. Using a newly optimized method for G protein purification together with biophysical measures of structure and function, we show that the ubiquitination domain does not influence enzyme activity. By screening a panel of 39 gene deletion mutants, each lacking a different ubiquitin binding domain protein, we identify seven that are necessary to deliver Gpa1 to the vacuole compartment including four proteins (Ede1, Bul1, Ddi1, and Rup1) previously not known to be involved in this process. Finally, we show that proper endocytosis of the G protein is needed for sustained cellular morphogenesis and mating in response to pheromone stimulation. We conclude that a cascade of ubiquitin-binding proteins serves to deliver the G protein to its final destination within the cell. In this instance and in contrast to the previously characterized visual system, endocytosis from the plasma membrane is needed for proper signal transduction rather than for signal desensitization. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Thermo- and pH-responsive polymer brushes-grafted gigaporous polystyrene microspheres as a high-speed protein chromatography matrix.

    Science.gov (United States)

    Qu, Jian-Bo; Xu, Yu-Liang; Liu, Jun-Yi; Zeng, Jing-Bin; Chen, Yan-Li; Zhou, Wei-Qing; Liu, Jian-Guo

    2016-04-08

    Dual thermo- and pH-responsive chromatography has been proposed using poly(N-isopropylacrylamide-co-butyl methacrylate-co-N,N-dimethylaminopropyl acrylamide) (P(NIPAM-co-BMA-co-DMAPAAM)) brushes grafted gigaporous polystyrene microspheres (GPM) as matrix. Atom transfer radical polymerization (ATRP) initiator was first coupled onto GPM through Friedel-Crafts acylation with 2-bromoisobutyryl bromide. The dual-responsive polymer brushes were then grafted onto GPM via surface-initiated ATRP. The surface composition, gigaporous structure, protein adsorption and dual-responsive chromatographic properties of the matrix (GPM-P(NIPAM-co-BMA-co-DMAPAAM) were characterized in detail. Results showed that GPM were successfully grafted with thermoresponsive cationic polymer brushes and that the gigaporous structure was well maintained. A column packed with GPM-P(NIPAM-co-BMA-co-DMAPAAM presented low backpressure, good permeability and appreciable thermo-responsibility. By changing pH of the mobile phase and temperature of the column in turn, the column can separate three model proteins at the mobile phase velocity up to 2528cmh(-1). A separation mechanism of this matrix was also proposed. All results indicate that the dual thermo- and pH-responsive chromatography matrix has great potentials in 'green' high-speed protein chromatography. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The non-structural protein 5 and matrix protein are antigenic targets of T cell immunity to genotype 1 porcine reproductive and respiratory syndrome viruses

    Directory of Open Access Journals (Sweden)

    Helen eMokhtar

    2016-02-01

    Full Text Available The porcine reproductive and respiratory syndrome virus (PRRSV is the cause of one of the most economically important diseases affecting swine worldwide. Efforts to develop a next-generation vaccine have largely focussed on envelope glycoproteins to target virus-neutralising antibody responses. However, these approaches have failed to demonstrate the necessary efficacy to progress towards market. T cells are crucial to the control of many viruses through cytolysis and cytokine secretion. Since control of PRRSV infection is not dependent on the development of neutralising antibodies, it has been proposed that T cell mediated immunity plays a key role. We therefore hypothesised that conserved T cell antigens represent prime candidates for the development a novel PRRS vaccine. Antigens were identified by screening a proteome-wide synthetic peptide library with T cells from cohorts of pigs rendered immune by experimental infections with a closely-related (subtype 1 or divergent (subtype 3 PRRSV-1 strain. Dominant T cell IFN-γ responses were directed against the non-structural protein 5 (NSP5, and to a lesser extent, the matrix (M protein. The majority of NSP5-specific CD8 T cells and M-specific CD4 T cells expressed a putative effector memory phenotype and were polyfunctional as assessed by co-expression of TNF-α and mobilisation of the cytotoxic degranulation marker CD107a. Both antigens were generally well conserved amongst strains of both PRRSV genotypes. Thus M and NSP5 represent attractive vaccine candidate T cell antigens which should be evaluated further in the context of PRRSV vaccine development.

  8. The Multifunctional Role of the Pallilysin-Associated Treponema pallidum Protein, Tp0750, in Promoting Fibrinolysis and Extracellular Matrix Component Degradation

    Science.gov (United States)

    Houston, Simon; Russell, Shannon; Hof, Rebecca; Roberts, Alanna K.; Cullen, Paul; Irvine, Kyle; Smith, Derek S.; Borchers, Christoph H.; Tonkin, Michelle L.; Boulanger, Martin J.; Cameron, Caroline E.

    2014-01-01

    Summary The mechanisms that facilitate dissemination of the highly invasive spirochete, Treponema pallidum, are incompletely understood. Previous studies showed the treponemal metalloprotease pallilysin (Tp0751) possesses fibrin clot degradation capability, suggesting a role in treponemal dissemination. In the current study we report characterization of the functionally-linked protein Tp0750. Structural modelling predicts Tp0750 contains a von Willebrand factor type A (vWFA) domain, a protein-protein interaction domain commonly observed in extracellular matrix (ECM)-binding proteins. We report Tp0750 is a serine protease that degrades the major clot components fibrinogen and fibronectin. We also demonstrate Tp0750 cleaves a matrix metalloprotease (MMP) peptide substrate that is targeted by several MMPs, enzymes central to ECM remodelling. Through proteomic analyses we show Tp0750 binds the endothelial fibrinolytic receptor, annexin A2, in a specific and dose-dependent manner. These results suggest Tp0750 constitutes a multifunctional protein that is able to (1) degrade infection-limiting clots by both inhibiting clot formation through degradation of host coagulation cascade proteins and promoting clot dissolution by complexing with host proteins involved in the fibrinolytic cascade and (2) facilitate ECM degradation via MMP-like proteolysis of host components. We propose that through these activities Tp0750 functions in concert with pallilysin to enable T. pallidum dissemination. PMID:24303899

  9. Evaluation of the Healing Potential of Demineralized Dentin Matrix Fixed with Recombinant Human Bone Morphogenetic Protein-2 in Bone Grafts

    Directory of Open Access Journals (Sweden)

    Sang-Yun Kim

    2017-09-01

    Full Text Available We aimed to evaluate the efficacy of demineralized dentin matrix (DDM fixed with recombinant human bone morphogenetic protein-2 (rhBMP-2 through an experimental and a clinical study. Unilateral upper second and third premolars of eight beagles were extracted. A mucoperiosteal flap was elevated around the extraction socket, and a bone defect was made using a surgical drill. Each DDM was fixed with rhBMP-2, and autogenous bone was grafted at the bone defect area with a collagenous membrane. The beagles were euthanized at two, four, eight, and 12 weeks after receiving the bone graft. Block specimens involving grafted bone and surrounding natural bone were extracted. A total of 23 patients who received bone grafts using human DDM fixed with rhBMP-2 (AutoBT BMP with implant placements (36 implants; maxilla: 14, mandible: 22 were selected. The implant stability, marginal bone loss, and clinical outcome were evaluated. Three trephine cores were harvested fourmonths after bone grafting, and histologic examination was performed. In the histological evaluation performed four weeks after the bone graft, autogenous bone showed 52% new bone formation and DDM fixed with rhBMP-2 showed 33% new bone formation. Twelve weeks after the bone graft, autogenous bone showed 75% new bone formation and DDM fixed with rhBMP-2 showed 48% new bone formation. In the clinical study, favorable osseointegration was obtained in 35 out of 36 implant sites (one case of osseointegration failure. In all cases, severe complications were not observed. Histomorphometrically, new bone formation was observed in 14.98% of the cases. The residual DDM particles were 6.22%. AutoBT BMP provides good osteoinductive and osteoconductive potential and clinical efficacy.

  10. Identification and Characterization of a Bovine Sperm Acrosomal Matrix Protein and its Mechanism of Interaction with Acrosomal Hydrolases

    Science.gov (United States)

    Nagdas, Subir K; Smith, Linda; Mcnamara, Allen; Hernandez–Encarnacion, Luisa; Medina-Ortiz, Ilza

    2015-01-01

    Fertilization, the union of male and female gametes to create offspring, is an intricate biological process dependent upon several biochemical and physiological events. Our understanding of the functions of protein constituents of the outer acrosomal membrane-associated matrix complex (OMC) is limited. A highly purified OMC fraction isolated from bovine cauda sperm heads is comprised of 54, 50, 45, and 38–19kDa polypeptides. The objective of this study is to identify and to characterize the 45kDa (OMC45) polypeptide and to define its role in binding acrosomal hydrolases and to examine the fate of OMC45 polypeptide during the acrosome reaction. We isolated OMC45 polypeptide from the high-pH insoluble fraction of OMC. Proteomic analysis of OMC45 by MALDI–TOF–TOF yielded 8 peptides that matched the NCBI database sequence of Tektin 3 (TEKT3). Triton X–100–permeabilized cauda sperm exhibited intense staining of the acrosomal segment with anti–OMC45 and anti–TEKT3. The OMC45 polypeptide was solubilized by RIPA (radio-immunoprecipitation assay) buffer extraction. The solubilized fraction was subjected to immunoprecipitation analysis. The OMC45 polypeptide was recovered in the anti–OMC45 immunoprecipitation pellet. An identical blot stained with anti–TEKT3 exhibited the presence of TEKT3 polypeptide in the anti–OMC45 pellet. Our immunofluorescence and biochemical studies confirm the proteomics identification of OMC45 polypeptide; that it exhibits a sequence similarity to TEKT3. OMC45 glycoprotein possesses both N–linked and O–linked oligosaccharides. Deglycosylated OMC45 revealed a significant reduction in both acrosin and N–acetylglucosaminidase (NAGA) binding in comparison with acrosin and NAGA binding to a native OMC45 polypeptide, demonstrating the important role of oligosaccharides in hydrolase binding. OMC45 polypeptide is not released during the acrosome reaction but remains in the particulate cell subfraction, associated with the hybrid

  11. A Novel Subnucleocapsid Nanoplatform for Mucosal Vaccination against Influenza Virus That Targets the Ectodomain of Matrix Protein 2

    Science.gov (United States)

    Hervé, Pierre-Louis; Raliou, Mariam; Bourdieu, Christiane; Dubuquoy, Catherine; Petit-Camurdan, Agnès; Bertho, Nicolas; Eléouët, Jean-François

    2014-01-01

    In this study, subnucleocapsid nanorings formed by the recombinant nucleoprotein (N) of the respiratory syncytial virus were evaluated as a platform to anchor heterologous antigens. The ectodomain of the influenza virus A matrix protein 2 (M2e) is highly conserved and elicits protective antibodies when it is linked to an immunogenic carrier, making it a promising target to develop universal influenza vaccines. In this context, one or three M2e copies were genetically linked to the C terminus of N to produce N-M2e and N-3M2e chimeric recombinant nanorings. Mice were immunized intranasally with N-M2e or N-3M2e or with M2e or 3M2e control peptides. N-3M2e-vaccinated mice showed the strongest mucosal and systemic antibody responses. These mice presented a reduced viral load and minor weight loss, and all survived upon challenge with influenza virus A/PR8/34 (H1N1) (PR8). We compared the intranasal route to the subcutaneous route of N-3M2e immunization. Only the intranasal route induced a strong local IgA response and led to the protection of mice upon challenge. Finally, we demonstrated that the induction of anti-M2e antibodies by N-3M2e is not impaired by preexisting anti-N immunity. Overall, these results show that the N nanoring is a potent carrier for mucosal delivery of vaccinal antigens. PMID:24155388

  12. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    Science.gov (United States)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  13. EspG of enteropathogenic and enterohemorrhagic E. coli binds the Golgi matrix protein GM130 and disrupts the Golgi structure and function.

    Science.gov (United States)

    Clements, Abigail; Smollett, Katherine; Lee, Sau Fung; Hartland, Elizabeth L; Lowe, Martin; Frankel, Gad

    2011-09-01

    The enteric pathogens enteropathogenic Escherichia coli (EPEC), enterohaemorrhagic E. coli (EHEC) and Shigella flexneri all translocate at least one effector protein of the EspG protein family into host cells via a type III secretion system (T3SS). The EspG family comprises EspG, EspG2 and VirA. From a Y2H screen, we identified the Golgi matrix protein GM130 as a potential binding partner of EspG. We confirmed EspG:GM130 protein interaction by affinity co-purification. In co-immunoprecipitation experiments EspG was co-precipitated with GM130 while both GM130 and tubulins were co-precipitated with EspG. When expressed ectopically in HeLa cells, the EspG protein family all localized to the Golgi and induced fragmentation of the Golgi apparatus. All EspG family proteins were also able to disrupt protein secretion to a greater extent than the T3SS effector NleA/EspI, which has previously been shown to localize to the Golgi and interact with SEC24 to disrupt COPII vesicle formation. We hypothesize that EspG:GM130 interaction disrupts protein secretion either through direct disruption of GM130 function or through recruitment of other EspG interacting proteins to the Golgi. © 2011 Blackwell Publishing Ltd.

  14. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone–related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor

    Science.gov (United States)

    Kong, Li; Zhao, Yun-Peng; Tian, Qing-Yun; Feng, Jian-Quan; Kobayashi, Tatsuya; Merregaert, Joseph; Liu, Chuan-Ju

    2016-01-01

    Chondrogenesis and endochondral ossification are precisely controlled by cellular interactions with surrounding matrix proteins and growth factors that mediate cellular signaling pathways. Here, we report that extracellular matrix protein 1 (ECM1) is a previously unrecognized regulator of chondrogenesis. ECM1 is induced in the course of chondrogenesis and its expression in chondrocytes strictly depends on parathyroid hormone–related peptide (PTHrP) signaling pathway. Overexpression of ECM1 suppresses, whereas suppression of ECM1 enhances, chondrocyte differentiation and hypertrophy in vitro and ex vivo. In addition, target transgene of ECM1 in chondrocytes or osteoblasts in mice leads to striking defects in cartilage development and endochondral bone formation. Of importance, ECM1 seems to be critical for PTHrP action in chondrogenesis, as blockage of ECM1 nearly abolishes PTHrP regulation of chondrocyte hypertrophy, and overexpression of ECM1 rescues disorganized growth plates of PTHrP-null mice. Furthermore, ECM1 and progranulin chondrogenic growth factor constitute an interaction network and act in concert in the regulation of chondrogenesis.—Kong, L., Zhao, Y.-P., Tian, Q.-Y., Feng, J.-Q., Kobayashi, T., Merregaert, J., Liu, C.-J. Extracellular matrix protein 1, a direct targeting molecule of parathyroid hormone–related peptide, negatively regulates chondrogenesis and endochondral ossification via associating with progranulin growth factor. PMID:27075243

  15. Extracellular matrix proteins matrix metallopeptidase 9 (MMP9) and soluble intercellular adhesion molecule 1 (sICAM-1) and correlations with clinical staging in euthymic bipolar disorder.

    Science.gov (United States)

    Reininghaus, Eva Z; Lackner, Nina; Birner, Armin; Bengesser, Susanne; Fellendorf, Frederike T; Platzer, Martina; Rieger, Alexandra; Queissner, Robert; Kainzbauer, Nora; Reininghaus, Bernd; McIntyre, Roger S; Mangge, Harald; Zelzer, Sieglinde; Fuchs, Dietmar; Dejonge, Silvia; Müller, Norbert

    2016-03-01

    Matrix metallopeptidase 9 (MMP9) and soluble intercellular adhesion molecule 1 (sICAM-1) are both involved in the restructuring of connective tissues. Evidence also implicates MMP9 and sICAM in cardiovascular and neoplastic diseases, where blood levels may be a marker of disease severity or prognosis. In individuals with bipolar disorder (BD), higher risk for cardiovascular illness has been extensively reported. The aim of this investigation was to measure and compare peripheral levels of serum MMP9 and sICAM in adults with euthymic BD and healthy controls (HC). Furthermore, we focussed on correlations with illness severity and metabolic parameters. MMP9 levels among the BD sample (n = 112) were significantly higher than among the HC (n = 80) (MMP9: F = 9.885, p = 0.002, η(2)  = 0.058) after controlling for confounding factors. Patients with BD in a later, progressive stage of disease showed significantly higher MMP9 as well as sICAM-1 levels compared to patients with BD in an earlier stage of disease (MMP9: F = 5.8, p = 0.018, η(2)  = 0.054; sICAM-1: F = 5.6, p = 0.020, η(2)  = 0.052). Correlation analyses of cognitive measures revealed a negative association between performance on the d2 Test of Attention and MMP9 (r = -0.287, p = 0.018) in the BD sample. Despite the sample being euthymic (i.e., according to conventional criteria) at the time of analysis, we found significant correlations between MMP9 as well as sICAM-1 and subthreshold depressive/hypomanic symptoms. A collection of disparate findings herein point to a role of MMP9 and cICAM-1 in the patho-progressive process of BD: the increased levels of serum MMP9 and sICAM-1, the correlation between higher levels of these parameters, progressive stage, and cognitive dysfunction in BD, and the positive correlation with subthreshold symptoms. As sICAM-1 and MMP9 are reliable biomarkers of inflammatory and early atherosclerotic disease, these markers may provide indications of the

  16. Hydrogels of collagen-inspired telechelic triblock copolymers for the sustained release of proteins

    NARCIS (Netherlands)

    Teles, H.M.; Vermonden, T.; Eggink, G.

    2010-01-01

    We studied the release of entrapped protein from transient gels made of thermosensitive, collagen-inspired ABA triblock copolymers with tailorable properties and with mid blocks of two different lengths (~ 37 kDa and ~ 73 kDa). These polymers were produced as heterologous proteins in recombinant

  17. The potential of dry fractionation processes for sustainable plant protein production

    NARCIS (Netherlands)

    Schutyser, M.A.I.; Goot, van der A.J.

    2011-01-01

    Wet fractionation processes are mainstream technology for producing plant-derived protein isolates. Unfortunately, wet fractionation involves consumption of copious amounts of water and energy. In addition, much of the (native) functionality of proteins is lost during processing. This paper reviews

  18. Pore size is a critical parameter for obtaining sustained protein release from electrochemically synthesized mesoporous silicon microparticles

    Directory of Open Access Journals (Sweden)

    Ester L. Pastor

    2015-10-01

    Full Text Available Mesoporous silicon has become a material of high interest for drug delivery due to its outstanding internal surface area and inherent biodegradability. We have previously reported the preparation of mesoporous silicon microparticles (MS-MPs synthesized by an advantageous electrochemical method, and showed that due to their inner structure they can adsorb proteins in amounts exceeding the mass of the carrier itself. Protein release from these MS-MPs showed low burst effect and fast delivery kinetics with complete release in a few hours. In this work, we explored if tailoring the size of the inner pores of the particles would retard the protein release process. To address this hypothesis, three new MS-MPs prototypes were prepared by electrochemical synthesis, and the resulting carriers were characterized for morphology, particle size, and pore structure. All MS-MP prototypes had 90 µm mean particle size, but depending on the current density applied for synthesis, pore size changed between 5 and 13 nm. The model protein α-chymotrypsinogen was loaded into MS-MPs by adsorption and solvent evaporation. In the subsequent release experiments, no burst release of the protein was detected for any prototype. However, prototypes with larger pores (>10 nm reached 100% release in 24–48 h, whereas prototypes with small mesopores (<6 nm still retained most of their cargo after 96 h. MS-MPs with ∼6 nm pores were loaded with the osteogenic factor BMP7, and sustained release of this protein for up to two weeks was achieved. In conclusion, our results confirm that tailoring pore size can modify protein release from MS-MPs, and that prototypes with potential therapeutic utility for regional delivery of osteogenic factors can be prepared by convenient techniques.

  19. The Matrix Protein of Nipah Virus Targets the E3-Ubiquitin Ligase TRIM6 to Inhibit the IKKε Kinase-Mediated Type-I IFN Antiviral Response.

    Directory of Open Access Journals (Sweden)

    Preeti Bharaj

    2016-09-01

    Full Text Available For efficient replication, viruses have developed mechanisms to evade innate immune responses, including the antiviral type-I interferon (IFN-I system. Nipah virus (NiV, a highly pathogenic member of the Paramyxoviridae family (genus Henipavirus, is known to encode for four P gene-derived viral proteins (P/C/W/V with IFN-I antagonist functions. Here we report that NiV matrix protein (NiV-M, which is important for virus assembly and budding, can also inhibit IFN-I responses. IFN-I production requires activation of multiple signaling components including the IκB kinase epsilon (IKKε. We previously showed that the E3-ubiquitin ligase TRIM6 catalyzes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, and activate IKKε for induction of IFN-I mediated antiviral responses. Using co-immunoprecipitation assays and confocal microscopy we show here that the NiV-M protein interacts with TRIM6 and promotes TRIM6 degradation. Consequently, NiV-M expression results in reduced levels of unanchored K48-linked polyubiquitin chains associated with IKKε leading to impaired IKKε oligomerization, IKKε autophosphorylation and reduced IFN-mediated responses. This IFN antagonist function of NiV-M requires a conserved lysine residue (K258 in the bipartite nuclear localization signal that is found in divergent henipaviruses. Consistent with this, the matrix proteins of Ghana, Hendra and Cedar viruses were also able to inhibit IFNβ induction. Live NiV infection, but not a recombinant NiV lacking the M protein, reduced the levels of endogenous TRIM6 protein expression. To our knowledge, matrix proteins of paramyxoviruses have never been reported to be involved in innate immune antagonism. We report here a novel mechanism of viral innate immune evasion by targeting TRIM6, IKKε and unanchored polyubiquitin chains. These findings expand the universe of viral IFN antagonism strategies and provide a new

  20. The challenge of protein crops as a sustainable source of food and feed for the future

    OpenAIRE

    2017-01-01

    Grain legumes, together with quinoa and amaranth (pseudocereals) and other crops are attractive candidates to satisfy the growing demand for plant protein production worldwide for food and feed. Despite their high value, many protein crops have not been adequately assessed and numerous species are underutilized. Special attention has to be paid to genetic diversity and landraces, and to the key limiting factors affecting yield, including water deficiency and other abiotic and biotic stresses,...

  1. Reproducibility of serum protein profiling by systematic assessment using solid-phase extraction and matrix-assisted laser desorption/ionization mass spectrometry

    DEFF Research Database (Denmark)

    Callesen, Anne K; Christensen, René Depont; Madsen, Jonna S

    2008-01-01

    was determined by enumeration and analysis of protein signals that were detected in at least six out of nine spectra obtained by three triplicate analyses of one serum sample.A candidate for best overall performance as evaluated by the number of peaks generated and the reproducibility of mass spectra was found...... among the tested methods. Up to 418 reproducible peaks were detected in one cancer serum sample. These protein peaks can be part of a possible diagnostic profile, suggesting that this sample preparation method and data acquisition approach is suitable for large-scale analysis of serum samples......Protein profiling of human serum by matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS) is potentially a new diagnostic tool for early detection of human diseases, including cancer. Sample preparation is a key issue in MALDI MS and the analysis of complex samples such as serum...

  2. Profiling and quantitative evaluation of three Nickel-Coated magnetic matrices for purification of recombinant proteins: lelpful hints for the optimized nanomagnetisable matrix preparation

    Directory of Open Access Journals (Sweden)

    Zarei Saeed

    2011-08-01

    Full Text Available Abstract Background Several materials are available in the market that work on the principle of protein magnetic fishing by their histidine (His tags. Little information is available on their performance and it is often quoted that greatly improved purification of histidine-tagged proteins from crude extracts could be achieved. While some commercial magnetic matrices could be used successfully for purification of several His-tagged proteins, there are some which have been proved to operate just for a few extent of His-tagged proteins. Here, we address quantitative evaluation of three commercially available Nickel nanomagnetic beads for purification of two His-tagged proteins expressed in Escherichia coli and present helpful hints for optimized purification of such proteins and preparation of nanomagnetisable matrices. Results Marked differences in the performance of nanomagnetic matrices, principally on the basis of their specific binding capacity, recovery profile, the amount of imidazole needed for protein elution and the extent of target protein loss and purity were obtained. Based on the aforesaid criteria, one of these materials featured the best purification results (SiMAG/N-NTA/Nickel for both proteins at the concentration of 4 mg/ml, while the other two (SiMAC-Nickel and SiMAG/CS-NTA/Nickel did not work well with respect to specific binding capacity and recovery profile. Conclusions Taken together, functionality of different types of nanomagnetic matrices vary considerably. This variability may not only be dependent upon the structure and surface chemistry of the matrix which in turn determine the affinity of interaction, but, is also influenced to a lesser extent by the physical properties of the protein itself. Although the results of the present study may not be fully applied for all nanomagnetic matrices, but provide a framework which could be used to profiling and quantitative evaluation of other magnetisable matrices and also

  3. Importin α5 negatively regulates importin β1-mediated nuclear import of Newcastle disease virus matrix protein and viral replication and pathogenicity in chicken fibroblasts.

    Science.gov (United States)

    Duan, Zhiqiang; Xu, Haixu; Ji, Xinqin; Zhao, Jiafu; Xu, Houqiang; Hu, Yan; Deng, Shanshan; Hu, Shunlin; Liu, Xiufan

    2018-03-13

    The matrix (M) protein of Newcastle disease virus (NDV) is demonstrated to localize in the nucleus via intrinsic nuclear localization signal (NLS), but cellular proteins involved in the nuclear import of NDV M protein and the role of M's nuclear localization in the replication and pathogenicity of NDV remain unclear. In this study, importin β1 was screened to interact with NDV M protein by yeast two-hybrid screening. This interaction was subsequently confirmed by co-immunoprecipitation and pull-down assays. In vitro binding studies indicated that the NLS region of M protein and the amino acids 336-433 of importin β1 that belonged to the RanGTP binding region were important for binding. Importantly, a recombinant virus with M/NLS mutation resulted in a pathotype change of NDV and attenuated viral replication and pathogenicity in chicken fibroblasts and SPF chickens. In agreement with the binding data, nuclear import of NDV M protein in digitonin-permeabilized HeLa cells required both importin β1 and RanGTP. Interestingly, importin α5 was verified to interact with M protein through binding importin β1. However, importin β1 or importin α5 depletion by siRNA resulted in different results, which showed the obviously cytoplasmic or nuclear accumulation of M protein and the remarkably decreased or increased replication ability and pathogenicity of NDV in chicken fibroblasts, respectively. Our findings therefore demonstrate for the first time the nuclear import mechanism of NDV M protein and the negative regulation role of importin α5 in importin β1-mediated nuclear import of M protein and the replication and pathogenicity of a paramyxovirus.

  4. Matriz de indicadores de sustentabilidade para a gestão de resíduos sólidos urbanos Matrix of sustainability indicatorsfor the urban solid waste management

    Directory of Open Access Journals (Sweden)

    Leila Santos Santiago

    2012-06-01

    Full Text Available O artigo apresenta uma matriz de indicadores de sustentabilidade para a gestão de resíduos sólidos urbanos e a forma de sua construção. A construção foi realizada baseando-se em informações adquiridas em referências nacionais e internacionais. Os indicadores foram organizados em uma matriz preliminar, a qual passou por um processo de validação externa, com especialistas, por meio do método Delphi. Para a realização deste método foram necessárias duas rodadas. A matriz final possui 6 dimensões de sustentabilidade: política, tecnológica, econômica/financeira, ambiental/ecológica, conhecimento e inclusão social, contemplando 42 indicadores e 126 descritores. A matriz elaborada poderá ser utilizada como instrumento de avaliação e planejamento da gestão dos resíduos sólidos em municípios.This paper presents a matrix of Sustainability Indicators for the Urban Solid Waste Management and the way of its construction. The construction was performed based on information acquired in national and international references. The indicators were organized into a primary matrix, which has gone an external validation process, with experts through the Delphi method. To perform this method two rounds were necessary. The final matrix has 6 dimensions of sustainability: politics, technology, economic/financial, environmental/ecological, knowledge and social inclusion, comprising 42 indicators, 126 descriptors. The matrix produced can be used as a tool for evaluation and planning of the solid waste management in municipalities.

  5. Preparation and in-vitro in-vivo evaluation of sustained release matrix diclofenac sodium tablets using PVP-K90 and natural gums.

    Science.gov (United States)

    Iqbal, Zafar; Khan, Raza; Nasir, Fazli; Khan, Jamshaid Ali; Rashid, Abdur; Khan, Abbas; Khan, Abad

    2011-10-01

    Conventional dosage form is nowadays mostly replaced by sustained release formulation in order to increase drug efficacy and patient compliance. The sustained release properties of the PVP K90 alone and in combination with guar gum, xanthan gum and gum tragacanth were evaluated using diclofenac sodium (100 mg/tablet) as a model drug. Tablets were processed using wet granulation method and evaluated for sustained drug release properties. The drug release from the formulations was studied in relationship with Commercially available Diclofenac Sodium SR, used as a reference tablets and results were expressed as similarity (f1) and differential factor (f2). The tablets prepared using PVP K90 160 mg/tablet sustained the release of diclofenac sodium for 12 hours. Formulations where the PVP K90 was partially replaced with different gums also sustained the release of drug for 12 hours. The release of the drug from these formulations mainly followed Higuchi model and super case-II and Non-Fickian diffusion. The in-vivo drug release was studied in healthy human volunteers using non-blinded cross over, two period design using Diclofenac Sodium SR Tablets as a reference drug. The relative bioavailability of the formulation containing PVP K90 and gum tragacanth was 0.91. The studies showed that the use of the PVP K90 in combination with gum tragacanth both in-vitro and in-vivo sustained the release of the drug.

  6. The Effector Protein BPE005 from Brucella abortus Induces Collagen Deposition and Matrix Metalloproteinase 9 Downmodulation via Transforming Growth Factor β1 in Hepatic Stellate Cells.

    Science.gov (United States)

    Arriola Benitez, Paula Constanza; Rey Serantes, Diego; Herrmann, Claudia Karina; Pesce Viglietti, Ayelén Ivana; Vanzulli, Silvia; Giambartolomei, Guillermo Hernán; Comerci, Diego José; Delpino, María Victoria

    2016-02-01

    The liver is frequently affected in patients with active brucellosis. In the present study, we identified a virulence factor involved in the modulation of hepatic stellate cell function and consequent fibrosis during Brucella abortus infection. This study assessed the role of BPE005 protein from B. abortus in the fibrotic phenotype induced on hepatic stellate cells during B. abortus infection in vitro and in vivo. We demonstrated that the fibrotic phenotype induced by B. abortus on hepatic stellate (LX-2) cells was dependent on BPE005, a protein associated with the type IV secretion system (T4SS) VirB from B. abortus. Our results indicated that B. abortus inhibits matrix metalloproteinase 9 (MMP-9) secretion through the activity of the BPE005-secreted protein and induces concomitant collagen deposition by LX-2 cells. BPE005 is a small protein containing a cyclic nucleotide monophosphate binding domain (cNMP) that modulates the LX-2 cell phenotype through a mechanism that is dependent on the cyclic AMP (cAMP)/protein kinase A (PKA) signaling pathway. Altogether, these results indicate that B. abortus tilts LX-2 cells to a profibrogenic phenotype employing a functional T4SS and the secreted BPE005 protein through a mechanism that involves the cAMP and PKA signaling pathway. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Decision peptide-driven: a free software tool for accurate protein quantification using gel electrophoresis and matrix assisted laser desorption ionization time of flight mass spectrometry.

    Science.gov (United States)

    Santos, Hugo M; Reboiro-Jato, Miguel; Glez-Peña, Daniel; Nunes-Miranda, J D; Fdez-Riverola, Florentino; Carvallo, R; Capelo, J L

    2010-09-15

    The decision peptide-driven tool implements a software application for assisting the user in a protocol for accurate protein quantification based on the following steps: (1) protein separation through gel electrophoresis; (2) in-gel protein digestion; (3) direct and inverse (18)O-labeling and (4) matrix assisted laser desorption ionization time of flight mass spectrometry, MALDI analysis. The DPD software compares the MALDI results of the direct and inverse (18)O-labeling experiments and quickly identifies those peptides with paralleled loses in different sets of a typical proteomic workflow. Those peptides are used for subsequent accurate protein quantification. The interpretation of the MALDI data from direct and inverse labeling experiments is time-consuming requiring a significant amount of time to do all comparisons manually. The DPD software shortens and simplifies the searching of the peptides that must be used for quantification from a week to just some minutes. To do so, it takes as input several MALDI spectra and aids the researcher in an automatic mode (i) to compare data from direct and inverse (18)O-labeling experiments, calculating the corresponding ratios to determine those peptides with paralleled losses throughout different sets of experiments; and (ii) allow to use those peptides as internal standards for subsequent accurate protein quantification using (18)O-labeling. In this work the DPD software is presented and explained with the quantification of protein carbonic anhydrase. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  8. A laminin 511 matrix is regulated by TAZ and functions as the ligand for the α6Bβ1 integrin to sustain breast cancer stem cells.

    Science.gov (United States)

    Chang, Cheng; Goel, Hira Lal; Gao, Huijie; Pursell, Bryan; Shultz, Leonard D; Greiner, Dale L; Ingerpuu, Sulev; Patarroyo, Manuel; Cao, Shiliang; Lim, Elgene; Mao, Junhao; McKee, Karen Kulju; Yurchenco, Peter D; Mercurio, Arthur M

    2015-01-01

    Understanding how the extracellular matrix impacts the function of cancer stem cells (CSCs) is a significant but poorly understood problem. We report that breast CSCs produce a laminin (LM) 511 matrix that promotes self-renewal and tumor initiation by engaging the α6Bβ1 integrin and activating the Hippo transducer TAZ. Although TAZ is important for the function of breast CSCs, the mechanism is unknown. We observed that TAZ regulates the transcription of the α5 subunit of LM511 and the formation of a LM511 matrix. These data establish a positive feedback loop involving TAZ and LM511 that contributes to stemness in breast cancer. © 2015 Chang et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Increased prothrombin activation in protein S-deficient plasma under flow conditions on endothelial cell matrix: an independent anticoagulant function of protein S in plasma

    NARCIS (Netherlands)

    van't Veer, C.; Hackeng, T. M.; Biesbroeck, D.; Sixma, J. J.; Bouma, B. N.

    1995-01-01

    Protein S is a vitamin K-dependent nonenzymatic coagulation factor involved in the regulation of activated protein C (aPC). In this study, we report an aPC-independent anticoagulant function of protein S in plasma under flow conditions. Plasma, anticoagulated with low-molecular-weight heparin

  10. A feature extraction technique using bi-gram probabilities of position specific scoring matrix for protein fold recognition.

    Science.gov (United States)

    Sharma, Alok; Lyons, James; Dehzangi, Abdollah; Paliwal, Kuldip K

    2013-03-07

    Discovering a three dimensional structure of a protein is a challenging task in biological science. Classifying a protein into one of its folds is an intermediate step for deciphering the three dimensional protein structure. The protein fold recognition can be done by developing feature extraction techniques to accurately extract all the relevant information from a protein sequence and then by employing a suitable classifier to label an unknown protein. Several feature extraction techniques have been developed in the past but with limited recognition accuracy only. In this work, we have developed a feature extraction technique which is based on bi-grams computed directly from Position Specific Scoring Matrices and demonstrated its effectiveness on a benchmark dataset. The proposed technique exhibits an absolute improvement of around 10% compared with existing feature extraction techniques. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. A tri-gram based feature extraction technique using linear probabilities of position specific scoring matrix for protein fold recognition.

    Science.gov (United States)

    Paliwal, Kuldip K; Sharma, Alok; Lyons, James; Dehzangi, Abdollah

    2014-03-01

    In biological sciences, the deciphering of a three dimensional structure of a protein sequence is considered to be an important and challenging task. The identification of protein folds from primary protein sequences is an intermediate step in discovering the three dimensional structure of a protein. This can be done by utilizing feature extraction technique to accurately extract all the relevant information followed by employing a suitable classifier to label an unknown protein. In the past, several feature extraction techniques have been developed but with limited recognition accuracy only. In this study, we have developed a feature extraction technique based on tri-grams computed directly from Position Specific Scoring Matrices. The effectiveness of the feature extraction technique has been shown on two benchmark datasets. The proposed technique exhibits up to 4.4% improvement in protein fold recognition accuracy compared to the state-of-the-art feature extraction techniques.

  12. Hyaluronan microgel as a potential carrier for protein sustained delivery by tailoring the crosslink network

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Chunhong [Department of Materials Science and Engineering, College of Science and Engineering, Jinan University, Guangzhou 510632 (China); Zhao, Jianhao, E-mail: jhzhao@jnu.edu.cn [Department of Materials Science and Engineering, College of Science and Engineering, Jinan University, Guangzhou 510632 (China); Engineering Research Center of Artificial Organs and Materials, Ministry of Education, Guangzhou 510632 (China); Tu, Mei; Zeng, Rong; Rong, Jianhua [Department of Materials Science and Engineering, College of Science and Engineering, Jinan University, Guangzhou 510632 (China); Engineering Research Center of Artificial Organs and Materials, Ministry of Education, Guangzhou 510632 (China)

    2014-03-01

    Hyaluronan (HA) microgels with different crosslink network, i.e. HGPs-1, HGPs-1.5, HGPs-3, HGPs-6 and HGPs-15, were synthesized using divinyl sulfone (DVS) as the crosslinker in an inverse microemulsion system for controlling the sustained delivery of bovine serum albumin (BSA). With increasing the crosslinker content, the average particle size slightly increased from 1.9 ± 0.3 μm to 3.6 ± 0.5 μm by dynamic laser scattering analysis. However, the crosslinker content had no significant effect on the morphology of HA microgels by scanning and transmission electron microscopes. Fourier transform infrared spectroscopy and elemental analysis proved more sulfur participated in the crosslink reaction when raising the crosslinker amount. The water swelling test confirmed the increasing crosslink density with the crosslinker content by calculating the average molecular weight between two crosslink points to be 8.25 ± 2.51 × 10{sup 5}, 1.26 ± 0.43 × 10{sup 5}, 0.96 ± 0.09 × 10{sup 5}, 0.64 ± 0.03 × 10{sup 5}, and 0.11 ± 0.01 × 10{sup 5} respectively. The degradation of HA microgels by hyaluronidase slowed down by enhancing the crosslink density, only about 5% of HGPs-15 was degraded as opposed to over 90% for HGPs-1. BSA loading had no obvious influence on the surface morphology of HA microgels but seemed to induce their aggregation. The increase of crosslink density decreased the BSA loading capacity but facilitated its long-term sustained delivery. When the molar ratio of DVS to repeating unit of HA reached 3 or higher, similar delivery profiles were obtained. Among all these HA microgels, HGPs-3 was the optimal carrier for BSA sustained delivery in this system because it possessed both high BSA loading capacity and long-term delivery profile simultaneously. - Highlights: • HA microgels with different crosslink densities were prepared. • The crosslinker content had little effect on the morphology and size of HA microgels. • The crosslink density

  13. Quantitation of peptides and proteins by matrix-assisted laser desorption/ionization mass spectrometry using (18)O-labeled internal standards

    DEFF Research Database (Denmark)

    Mirgorodskaya, O A; Kozmin, Y P; Titov, M I

    2000-01-01

    for the tested sample by enzymatic hydrolysis of the same sample (with known concentration) in (18)O-water. A mathematical algorithm was developed which uses the isotopic patterns of the substance, the internal standard, and the substance/internal standard mixture for accurate quantitation of the substance......A method for quantitating proteins and peptides in the low picomole and sub-picomole range has been developed using matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) with internal (18)O-labeled standards. A simple procedure is proposed to produce such internal standards...

  14. Amelogenin, an extracellular matrix protein, in the treatment of venous leg ulcers and other hard-to-heal wounds: experimental and clinical evidence

    DEFF Research Database (Denmark)

    Romanelli, M.; Dini, V.; Vowden, P.

    2008-01-01

    Amelogenins are extracellular matrix proteins that, under physiological conditions, self-assemble into globular aggregates up to micron-sizes. Studies with periodontal fibroblasts indicate that attachment to these structures increases the endogenous secretion of multiple growth factors and cell...... proliferation. Pre-clinical and clinical studies indicate that cutaneous wounds benefit from treatment with amelogenins. A randomized controlled trial (RCT) involving patients with hard-to-heal venous leg ulcers (VLUs) (ie, ulcers with a surface > or = area 10 cm2 and duration of > or = 6 months) showed...

  15. A collapsin response mediator protein 2 isoform controls myosin II-mediated cell migration and matrix assembly by trapping ROCK II

    DEFF Research Database (Denmark)

    Yoneda, Atsuko; Morgan-Fisher, Marie; Wait, Robin

    2012-01-01

    -2L but not -2S inhibited fibronectin matrix assembly in fibroblasts. Underlying these responses, CRMP-2L regulated the kinase activity of ROCK II but not ROCK I, independent of GTP-RhoA levels. This study provides a new insight into CRMP-2 as a controller of myosin II-mediated cellular functions...... binding domains but also trapped and inhibited the kinase. CRMP-2L protein levels profoundly affected haptotactic migration and the actin-myosin cytoskeleton of carcinoma cells as well as nontransformed epithelial cell migration in a ROCK activity-dependent manner. Moreover, the ectopic expression of CRMP...

  16. Wax-based sustained release matrix pellets prepared by a novel freeze pelletization technique I. Formulation and process variables affecting pellet characteristics.

    Science.gov (United States)

    Cheboyina, Sreekhar; Wyandt, Christy M

    2008-07-09

    A novel freeze pelletization technique was evaluated for the preparation of wax-based matrix pellets. Pellets containing either theophylline or diltiazem HCl were prepared using various waxes. In this technique, molten waxes along with a dispersed active ingredient were introduced as droplets into an inert and immiscible column of liquid to form pellets. An 80% (w/w) aqueous glycerol solution was found to be the most suitable column liquid for preparing spherical wax pellets. The physical stability of the molten wax suspensions was substantially improved by the addition of a 5% (w/w) colloidal silica gel. Pellet size obtained was directly proportional to the cubic root of the outer radius of the needle tip used to form pellets. Pellet size increased as the ratio of interfacial tension (gamma(LL)) to the density difference (Deltarho) between the molten matrix and the column liquid increased. Moreover, an increase in the drug load of theophylline increased the pellet size. However, an addition of a surfactant to the matrix slightly decreased the pellet size. Microscopic studies indicated that theophylline was homogenously dispersed throughout the matrix and existed in a crystalline state at higher drug loads. The percent drug recoveries ranged from 90.7 to 102.3% with acceptable drug loads up to 20% (w/w). Therefore, wax pellets containing drugs of varying aqueous solubility were successfully prepared using this technique.

  17. Netrin-1 Protects Hepatocytes Against Cell Death Through Sustained Translation During the Unfolded Protein Response.

    Science.gov (United States)

    Lahlali, Thomas; Plissonnier, Marie-Laure; Romero-López, Cristina; Michelet, Maud; Ducarouge, Benjamin; Berzal-Herranz, Alfredo; Zoulim, Fabien; Mehlen, Patrick; Parent, Romain

    2016-05-01

    Netrin-1, a multifunctional secreted protein, is up-regulated in cancer and inflammation. Netrin-1 blocks apoptosis induced by the prototypical dependence receptors deleted in colorectal carcinoma and uncoordinated phenotype-5. Although the unfolded protein response (UPR) triggers apoptosis on exposure to stress, it first attempts to restore endoplasmic reticulum homeostasis to foster cell survival. Importantly, UPR is implicated in chronic liver conditions including hepatic oncogenesis. Netrin-1's implication in cell survival on UPR in this context is unknown. Isolation of translational complexes, determination of RNA secondary structures by selective 2'-hydroxyl acylation and primer extension/dimethyl sulfate, bicistronic constructs, as well as conventional cell biology and biochemistry approaches were used on in vitro-grown hepatocytic cells, wild-type, and netrin-1 transgenic mice. HepaRG cells constitute a bona fide model for UPR studies in vitro through adequate activation of the 3 sensors of the UPR (protein kinase RNA-like endoplasmic reticulum kinase (PERK)), inositol requiring enzyme 1α (IRE1α), and activated transcription factor 6 (ATF6). The netrin-1 messenger RNA 5'-end was shown to fold into a complex double pseudoknot and bear E-loop motifs, both of which are representative hallmarks of related internal ribosome entry site regions. Cap-independent translation of netrin 5' untranslated region-driven luciferase was observed on UPR in vitro. Unlike several structurally related oncogenic transcripts (l-myc, c-myc, c-myb), netrin-1 messenger RNA was selected for translation during UPR both in human hepatocytes and in mice livers. Depletion of netrin-1 during UPR induces apoptosis, leading to cell death through an uncoordinated phenotype-5A/C-mediated involvement of protein phosphatase 2A and death-associated protein kinase 1 in vitro and in netrin transgenic mice. UPR-resistant, internal ribosome entry site-driven netrin-1 translation leads to

  18. Automated high-throughput dense matrix protein folding screen using a liquid handling robot combined with microfluidic capillary electrophoresis.

    Science.gov (United States)

    An, Philip; Winters, Dwight; Walker, Kenneth W

    2016-04-01

    Modern molecular genetics technology has made it possible to swiftly sequence, clone and mass-produce recombinant DNA for the purpose of expressing heterologous genes of interest; however, recombinant protein production systems have struggled to keep pace. Mammalian expression systems are typically favored for their ability to produce and secrete proteins in their native state, but bacterial systems benefit from rapid cell line development and robust growth. The primary drawback to prokaryotic expression systems are that recombinant proteins are generally not secreted at high levels or correctly folded, and are often insoluble, necessitating post-expression protein folding to obtain the active product. In order to harness the advantages of prokaryotic expression, high-throughput methods for executing protein folding screens and the subsequent analytics to identify lead conditions are required. Both of these tasks can be accomplished using a Biomek 3000 liquid handling robot to prepare the folding screen and to subsequently prepare the reactions for assessment using Caliper microfluidic capillary electrophoresis. By augmenting a protein folding screen with automation, the primary disadvantage of Escherichia coli expression has been mitigated, namely the labor intensive identification of the required protein folding conditions. Furthermore, a rigorous, quantitative method for identifying optimal protein folding buffer aids in the rapid development of an optimal production process. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Influence of ensiling time and inoculation on alteration of the starch-protein matrix in high-moisture corn

    Science.gov (United States)

    The fates of hydrophobic zein proteins, which encapsulate corn starch creating vitreous endosperm, have not been investigated in high moisture corn (HMC). To assess influences of ensiling time and inoculation on hydrophobic zein proteins in HMC, quadruplicate samples of two random corns (A and B) co...

  20. Influence of Inoculation and Storage Time on Alteration of the Starch-Protein Matrix in High Moisture Corn

    Science.gov (United States)

    The fates of hydrophobic prolamin (Zein) proteins, which encapsulate corn starch creating vitreous endosperm, have not been investigated in high moisture corn (HMC). To assess influences of inoculation and storage time on hydrophobic proteins in HMC, quadruplicate samples of two random corns (A and ...

  1. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ines eLassowskat

    2014-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3 and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phosphoproteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g. WRKY transcription factors and proteins encoded by the genes from the PEN pathway required for penetration resistance to filamentous pathogens. Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org.

  2. Cartilage Oligomeric Matrix Protein-Angiopoietin-1 Has a Protective Effect of Vascular Endothelial Barrier in Rat With Acute Necrotizing Pancreatitis.

    Science.gov (United States)

    Chen, Ya-Feng; Kong, Ping-Ting; Li, Hong-Chang; Fan, Xin-Juan; Tu, Jia-Min; Xie, Jin-Kun; Tian, Ji-Yun; Pan, Li-Yun; Chen, Teng; Cao, Yi-Jun; Yin, Pei-Hao; Peng, Wen; Feng, Dian-Xu

    2016-01-01

    To investigate the protective effect of angiopoietin-1 (Ang-1) from capillary endothelial damage in rats with acute necrotizing pancreatitis (ANP). 96 male Sprague-Dawley rats were randomly averaged and divided into control group, ANP group, Si-Ang-1 group, and COMP (cartilage oligomeric matrix protein)-Ang-1 group. Animals were killed at 6, 12, and 24 hours after molding. Levels of serum amylase, porcine endothelin 1, C-reactive protein, and Ang-1 were detected; histopathological changes in the pancreas were observed; capillary permeability and Ang-1 expression of the pancreatic tissue were detected by Evans Blue extravasation assay, immunohistochemistry, Western blot, and quantitative polymerase chain reaction. (1) Levels of serum amylase, C-reactive protein, and porcine endothelin-1 increased and level of Ang-1 decrease in the ANP group and Si-Ang-1 group compared with the control group, whereas COMP-Ang-1 group could improve the changes. (2) The order of pancreas pathological changes (mild to severe) is: control group, COMP-Ang-1 group, ANP group, and Si-Ang-1 group. (3) Capillary permeability of the pancreatic tissue in the COMP-Ang-1 group was lower than that in the ANP group. (4) Ang-1 mRNA and protein expression in the COMP-Ang-1 group was significantly higher than in the ANP group. COMP-Ang-1 can upregulate the expression of Ang-1 protein to promote angiogenesis and improve early inflammatory and pathological damage in ANP group.

  3. Meat juice: An alternative matrix for assessing animal health by measuring acute phase proteins. Correlations of pig-MAP and haptoglobin concentrations in pig meat juice and plasma.

    Science.gov (United States)

    Piñeiro, M; Gymnich, S; Knura, S; Piñeiro, C; Petersen, B

    2009-10-01

    Quantification of acute phase proteins (APPs) in blood can be used for monitoring animal health and welfare on farms, and could be also of interest for the detection of diseased animals during the meat inspection process. However serum or plasma is not always available for end-point analysis at slaughter. Meat juice might provide an adequate, alternative matrix that can be easily obtained for post-mortem analysis at abattoirs. The concentrations of pig Major Acute phase Protein (pig-MAP) and haptoglobin, two of the main APPs in pigs, were determined in approximately 300 paired samples of plasma and meat juice from the diaphragm (pars costalis), obtained after freezing and thawing the muscle. APPs concentrations in meat juice were closely correlated to those in plasma (r=0.695 for haptoglobin, r=0.858 for pig-MAP, panimal health in pig production, with implications for food safety and meat quality.

  4. Identification of lipid- and protein-based binders in paintings by direct on-plate wet chemistry and matrix-assisted laser desorption ionization mass spectrometry.

    Science.gov (United States)

    Calvano, Cosima Damiana; van der Werf, Inez Dorothé; Palmisano, Francesco; Sabbatini, Luigia

    2015-01-01

    Direct on-target plate processing of small (ca. 100 μg) fragments of paint samples for MALDI-MS identification of lipid- and protein-based binders is described. Fragments were fixed on a conventional stainless steel target plate by colloidal graphite followed by in situ fast tryptic digestion and matrix addition. The new protocol was first developed on paint replicas composed of chicken egg, collagen, and cow milk mixed with inorganic pigments and then successfully applied on historical paint samples taken from a fifteenth century Italian panel painting. The present work contributes a step forward in the simplification of binder identification in very small paint samples since no conventional solvent extraction is required, speeding up the whole sample preparation to 10 min and reducing lipid/protein loss.

  5. Broad sustainability versus sustainability

    International Nuclear Information System (INIS)

    Hueting, R.; Reijnders, L.

    2002-01-01

    The notion sustainability has many definitions and interpretations, which are not always in favor of the development of sustainability. Therefore, a narrow definition of sustainability is required [nl

  6. Amphipathic alpha-helices and putative cholesterol binding domains of the influenza virus matrix M1 protein are crucial for virion structure organisation.

    Science.gov (United States)

    Tsfasman, Tatyana; Kost, Vladimir; Markushin, Stanislav; Lotte, Vera; Koptiaeva, Irina; Bogacheva, Elena; Baratova, Ludmila; Radyukhin, Victor

    2015-12-02

    The influenza virus matrix M1 protein is an amphitropic membrane-associated protein, forming the matrix layer immediately beneath the virus raft membrane, thereby ensuring the proper structure of the influenza virion. The objective of this study was to elucidate M1 fine structural characteristics, which determine amphitropic properties and raft membrane activities of the protein, via 3D in silico modelling with subsequent mutational analysis. Computer simulations suggest the amphipathic nature of the M1 α-helices and the existence of putative cholesterol binding (CRAC) motifs on six amphipathic α-helices. Our finding explains for the first time many features of this protein, particularly the amphitropic properties and raft/cholesterol binding potential. To verify these results, we generated mutants of the A/WSN/33 strain via reverse genetics. The M1 mutations included F32Y in the CRAC of α-helix 2, W45Y and W45F in the CRAC of α-helix 3, Y100S in the CRAC of α-helix 6, M128A and M128S in the CRAC of α-helix 8 and a double L103I/L130I mutation in both a putative cholesterol consensus motif and the nuclear localisation signal. All mutations resulted in viruses with unusual filamentous morphology. Previous experimental data regarding the morphology of M1-gene mutant influenza viruses can now be explained in structural terms and are consistent with the pivotal role of the CRAC-domains and amphipathic α-helices in M1-lipid interactions. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Knowledge and tools to enhance resilience of beef grazing systems for sustainable animal protein production.

    Science.gov (United States)

    Steiner, Jean L; Engle, David M; Xiao, Xiangming; Saleh, Ali; Tomlinson, Peter; Rice, Charles W; Cole, N Andy; Coleman, Samuel W; Osei, Edward; Basara, Jeffrey; Middendorf, Gerad; Gowda, Prasanna; Todd, Richard; Moffet, Corey; Anandhi, Aavudai; Starks, Patrick J; Ocshner, Tyson; Reuter, Ryan; Devlin, Daniel

    2014-11-01

    Ruminant livestock provides meat and dairy products that sustain health and livelihood for much of the world's population. Grazing lands that support ruminant livestock provide numerous ecosystem services, including provision of food, water, and genetic resources; climate and water regulation; support of soil formation; nutrient cycling; and cultural services. In the U.S. southern Great Plains, beef production on pastures, rangelands, and hay is a major economic activity. The region's climate is characterized by extremes of heat and cold and extremes of drought and flooding. Grazing lands occupy a large portion of the region's land, significantly affecting carbon, nitrogen, and water budgets. To understand vulnerabilities and enhance resilience of beef production, a multi-institutional Coordinated Agricultural Project (CAP), the "grazing CAP," was established. Integrative research and extension spanning biophysical, socioeconomic, and agricultural disciplines address management effects on productivity and environmental footprints of production systems. Knowledge and tools being developed will allow farmers and ranchers to evaluate risks and increase resilience to dynamic conditions. The knowledge and tools developed will also have relevance to grazing lands in semiarid and subhumid regions of the world. © 2014 New York Academy of Sciences.

  8. Structure and barrier properties of human embryonic stem cell-derived retinal pigment epithelial cells are affected by extracellular matrix protein coating.

    Science.gov (United States)

    Sorkio, Anni; Hongisto, Heidi; Kaarniranta, Kai; Uusitalo, Hannu; Juuti-Uusitalo, Kati; Skottman, Heli

    2014-02-01

    Extracellular matrix (ECM) interactions play a vital role in cell morphology, migration, proliferation, and differentiation of cells. We investigated the role of ECM proteins on the structure and function of human embryonic stem cell-derived retinal pigment epithelial (hESC-RPE) cells during their differentiation and maturation from hESCs into RPE cells in adherent differentiation cultures on several human ECM proteins found in native human Bruch's membrane, namely, collagen I, collagen IV, laminin, fibronectin, and vitronectin, as well as on commercial substrates of xeno-free CELLstart™ and Matrigel™. Cell pigmentation, expression of RPE-specific proteins, fine structure, as well as the production of basal lamina by hESC-RPE on different protein coatings were evaluated after 140 days of differentiation. The integrity of hESC-RPE epithelium and barrier properties on different coatings were investigated by measuring transepithelial resistance. All coatings supported the differentiation of hESC-RPE cells as demonstrated by early onset of cell pigmentation and further maturation to RPE monolayers after enrichment. Mature RPE phenotype was verified by RPE-specific gene and protein expression, correct epithelial polarization, and phagocytic activity. Significant differences were found in the degree of RPE cell pigmentation and tightness of epithelial barrier between different coatings. Further, the thickness of self-assembled basal lamina and secretion of the key ECM proteins found in the basement membrane of the native RPE varied between hESC-RPE cultured on compared protein coatings. In conclusion, this study shows that the cell culture substrate has a major effect on the structure and basal lamina production during the differentiation and maturation of hESC-RPE potentially influencing the success of cell integrations and survival after cell transplantation.

  9. Distribution of Cathepsin K in Late Stage of Tooth Germ Development and Its Function in Degrading Enamel Matrix Proteins in Mouse.

    Science.gov (United States)

    Jiang, Tao; Liu, Fen; Wang, Wei-Guang; Jiang, Xin; Wen, Xuan; Hu, Kai-Jin; Xue, Yang

    2017-01-01

    Cathepsin K (CTSK) is a member of cysteine proteinase family, and is predominantly expressed in osteoclastsfor degradationof bone matrix proteins. Given the similarity in physical properties of bone and dental mineralized tissues, including enamel, dentin and cementum, CTSK is likely to take part in mineralization process during odontogenesis. On the other hand, patients with pycnodysostosis caused by mutations of the CTSK gene displayedmultipledental abnormalities, such as hypoplasia of the enamel, obliterated pulp chambers, hypercementosis and periodontal disease. Thereforeitis necessary to study the metabolic role of CTSK in tooth matrix proteins. In this study, BALB/c mice at embryonic day 18 (E18), post-natal day 1 (P1), P5, P10 and P20 were used (5 mice at each time point)for systematic analyses of CTSK expression in the late stage of tooth germ development. We found that CTSK was abundantly expressed in the ameloblasts during secretory and maturation stages (P5 and P10) by immunohistochemistry stainings.During dentinogenesis, the staining was also intense in the mineralization stage (P5 and P10),but not detectable in the early stage of dentin formation (P1) and after tooth eruption (P20).Furthermore, through zymography and digestion test in vitro, CTSK was proved to be capable of hydrolyzing Emdogain and also cleaving Amelogenininto multiple products. Our resultsshed lights on revealing new functions of CTSK and pathogenesis of pycnodysostosis in oral tissues.

  10. Induction of matrix metalloproteinase-2 by tenascin-X deficiency is mediated through the c-Jun N-terminal kinase and protein tyrosine kinase phosphorylation pathway

    International Nuclear Information System (INIS)

    Matsumoto, Ken-ichi; Minamitani, Takeharu; Orba, Yasuko; Sato, Mami; Sawa, Hirofumi; Ariga, Hiroyoshi

    2004-01-01

    The results of our previous study showed that tumor invasion and metastasis are promoted in extracellular matrix (ECM) tenascin-X-deficient (TNX-/-) mice via increased expression of matrix metalloproteinases (MMPs). However, little is known about the relationship between TNX deficiency and activation of MMP genes. In this study, we investigated the molecular mechanism by which TNX deficiency activates the MMP-2 gene. We examined the intracellular signaling pathways that regulate gene expression of the proteinase in isolated fibroblasts. Results of gelatin zymography showed that MMP-2 was induced to a greater extent in TNX-/- fibroblasts embedded in type I collagen than in wild-type fibroblasts. RT-PCR analysis revealed that the increased level of MMP-2 expression was caused at the transcription level. Conversely, stable overexpression of TNX in a fibroblast cell line reduced MMP-2 expression and suppressed MMP-2 promoter activity. In addition, treatment of TNX-/- fibroblasts with SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and genistein, a tyrosine kinase inhibitor, suppressed the increased level of proMMP-2 and increased MMP-2 promoter activity in TNX-/- fibroblasts. Furthermore, increased activation of JNK and tyrosine phosphorylation of certain proteins were observed in TNX-/- fibroblasts. These findings suggest that induction of MMP-2 by TNX deficiency is mediated, at least in part, through the JNK and protein tyrosine kinase phosphorylation pathway

  11. Distribution of Cathepsin K in Late Stage of Tooth Germ Development and Its Function in Degrading Enamel Matrix Proteins in Mouse.

    Directory of Open Access Journals (Sweden)

    Tao Jiang

    Full Text Available Cathepsin K (CTSK is a member of cysteine proteinase family, and is predominantly expressed in osteoclastsfor degradationof bone matrix proteins. Given the similarity in physical properties of bone and dental mineralized tissues, including enamel, dentin and cementum, CTSK is likely to take part in mineralization process during odontogenesis. On the other hand, patients with pycnodysostosis caused by mutations of the CTSK gene displayedmultipledental abnormalities, such as hypoplasia of the enamel, obliterated pulp chambers, hypercementosis and periodontal disease. Thereforeitis necessary to study the metabolic role of CTSK in tooth matrix proteins. In this study, BALB/c mice at embryonic day 18 (E18, post-natal day 1 (P1, P5, P10 and P20 were used (5 mice at each time pointfor systematic analyses of CTSK expression in the late stage of tooth germ development. We found that CTSK was abundantly expressed in the ameloblasts during secretory and maturation stages (P5 and P10 by immunohistochemistry stainings.During dentinogenesis, the staining was also intense in the mineralization stage (P5 and P10,but not detectable in the early stage of dentin formation (P1 and after tooth eruption (P20.Furthermore, through zymography and digestion test in vitro, CTSK was proved to be capable of hydrolyzing Emdogain and also cleaving Amelogenininto multiple products. Our resultsshed lights on revealing new functions of CTSK and pathogenesis of pycnodysostosis in oral tissues.

  12. Assembly of Ebola virus matrix protein VP40 is regulated by latch-like properties of N and C terminal tails.

    Directory of Open Access Journals (Sweden)

    Leslie P Silva

    Full Text Available The matrix protein VP40 coordinates numerous functions in the viral life cycle of the Ebola virus. These range from the regulation of viral transcription to morphogenesis, packaging and budding of mature virions. Similar to the matrix proteins of other nonsegmented, negative-strand RNA viruses, VP40 proceeds through intermediate states of assembly (e.g. octamers but it remains unclear how these intermediates are coordinated with the various stages of the life cycle. In this study, we investigate the molecular basis of synchronization as governed by VP40. Hydrogen/deuterium exchange mass spectrometry was used to follow induced structural and conformational changes in VP40. Together with computational modeling, we demonstrate that both extreme N and C terminal tail regions stabilize the monomeric state through a direct association. The tails appear to function as a latch, released upon a specific molecular trigger such as RNA ligation. We propose that triggered release of the tails permits the coordination of late-stage events in the viral life cycle, at the inner membrane of the host cell. Specifically, N-tail release exposes the L-domain motifs PTAP/PPEY to the transport and budding complexes, whereas triggered C-tail release could improve association with the site of budding.

  13. Renal cell neoplasias: reversion-inducing cysteine-rich protein with Kazal motifs discriminates tumor subtypes, while extracellular matrix metalloproteinase inducer indicates prognosis.

    Science.gov (United States)

    Rabien, Anja; Stephan, Carsten; Kilic, Ergin; Weichert, Wilko; Kristiansen, Glen; Miller, Kurt; Jung, Klaus; Erbersdobler, Andreas

    2013-10-16

    Matrix metalloproteinases can promote invasion and metastasis, which are very frequent in renal cell carcinoma even at the time of diagnosis. Knowing the reversion-inducing cysteine-rich protein with Kazal motifs (RECK) as an inhibitor of matrix metalloproteinases and the extracellular matrix metalloproteinase inducer (EMMPRIN) protein as inducer, we aimed to determine their expression, localization and possible antagonistic action in the pathogenesis and progression of renal cell tumors in a retrospective study. Tumor and adjacent normal tissues of 395 nephrectomized patients were immunostained for RECK and EMMPRIN on a tissue microarray. RECK strongly decreased in renal cell carcinoma compared to normal counterparts (Wilcoxon signed rank test, P<0.001), and it discriminated tumor entities showing the highest expression in oncocytomas. EMMPRIN, however, could be significantly correlated to pT stage and Fuhrman grading (Spearman's correlation coefficient rs=0.289 and rs=0.382, respectively). Higher expression of EMMPRIN was associated with decreased overall survival in Kaplan-Meier analysis (P<0.001), and the EMMPRIN level could independently predict survival for cases without metastasis and involvement of lymph nodes. Decreased RECK expression was confirmed by Western blotting in tissue of eight normal/tumor matches of patients after radical nephrectomy, whereas the EMMPRIN pattern appeared to be heterogeneous. We propose RECK down regulation in renal cell carcinoma to be an early event that facilitates tumor formation and progression. EMMPRIN, however, as a prognostic tumor marker, increases only when aggressiveness is proceeding and could add an additional step to invasive properties of renal cell carcinoma.

  14. Long-lasting humoral immune response induced in HIV-1-infected patients by a synthetic peptide (AT20) derived from the HIV-1 matrix protein p17 functional epitope.

    Science.gov (United States)

    Focà, Emanuele; Iaria, Maria Luisa; Caccuri, Francesca; Fiorentini, Simona; Motta, Davide; Giagulli, Cinzia; Castelli, Francesco; Caruso, Arnaldo

    2015-08-01

    A therapeutic vaccination based on a synthetic peptide (AT20) representative of the HIV-1 matrix protein p17 (p17) functional region, coupled to keyhole limpet hemocyanin (KLH) AT20-KLH was capable of inducing the production of high-avidity antibodies (Abs) toward a previous untargeted p17 hotspot of functional activity in highly active antiretroviral therapy (HAART)-treated HIV-1-infected patients. Since avidity of Abs after immunization and the retention of antigens are important in sustaining the long-lasting production of specific humoral responses, we asked whether AT20-KLH vaccination would result in development of a long-lived immune response. The long-term duration of Ab response to AT20-KLH has been evaluated in 10 patients previously enrolled for the AT20-KLH vaccination trial at day 898 post-immunization. Ab titer and their avidity was assessed using specifically designed ELISA assays, whereas their neutralizing capacity was estimated in vitro using a 'wound sealing assay'. Data obtained show that high titers of specific anti-AT20 Abs were maintained at more than 2 years after the last immunization. Furthermore, these Abs were capable to neutralize exogenous p17, as assessed by ability of sera derived from AT20-KLH-immunized patients to block the ability of p17 to promote cell migration in vitro. This finding attests for a successful AT20-KLH vaccine molecule formulation and for an effective HAART-dependent Ab persistence.

  15. Characterization of a novel Dp71 dystrophin-associated protein complex (DAPC) present in the nucleus of HeLa cells: Members of the nuclear DAPC associate with the nuclear matrix

    International Nuclear Information System (INIS)

    Fuentes-Mera, Lizeth; Rodriguez-Munoz, Rafael; Gonzalez-Ramirez, Ricardo; Garcia-Sierra, Francisco; Gonzalez, Everardo; Mornet, Dominique; Cisneros, Bulmaro

    2006-01-01

    Dystrophin is an essential component in the assembly and maintenance of the dystrophin-associated protein complex (DAPC), which includes members of the dystroglycan, syntrophin, sarcoglycan and dystrobrevin protein families. Distinctive complexes have been described in the cell membrane of different tissues and cultured cells. In this work, we report the identification and characterization of a novel DAPC present in the nuclei of HeLa cells, which contains dystrophin Dp71 as a key component. Using confocal microscopy and cell fractionation analyses, we found the presence of Dp71, β-sarcoglycan, β-dystroglycan, α- and β-syntrophin, α1- and β-dystrobrevin and nNOS in the nuclei of HeLa cells. Furthermore, we demonstrated by co-immunoprecipitation experiments that most of these proteins form a complex in the nuclear compartment. Next, we analyze the possible association of the nuclear DAPC with the nuclear matrix. We found the presence of Dp71, β-dystroglycan, nNOS, β-sarcoglycan, α/β syntrophin, α1-dystrobrevin and β-dystrobrevin in the nuclear matrix protein fractions and in situ nuclear matrix preparations from HeLa cells. Moreover, we found that Dp71, β-dystroglycan and β-dystrobrevin co-immunoprecipitated with the nuclear matrix proteins lamin B1 and actin. The association of members of the nuclear DAPC with the nuclear matrix indicates that they may work as scaffolding proteins involved in nuclear architecture

  16. The bone matrix protein secreted phosphoprotein 24 kD (Spp24): bone metabolism regulator and starting material for biotherapeutic materials.

    Science.gov (United States)

    Murray, Samuel S; Wang, Jeffrey C; Duarte, Maria Eugenia Leite; Zhao, Ke-Wei; Tian, Haijun; Francis, Timothy; Brochmann Murray, Elsa J

    2015-05-01

    Secreted phosphoprotein 24 kD (Spp24) is a bone matrix protein that appears to be derived primarily from the liver and delivered to other tissues in a protective complex. A significant role in bone growth and turnover is suggested by genetic studies that associate the gene locus (SPP2) with bone mineral density and bone quality. The function of this protein in the normal bone environment is unknown but clues are given by the fact that Spp24, or proteolytic products of Spp24, bind cytokines of the TGF-β superfamily and also activate intracellular signaling pathways. Several potential biotherapeutics have been engineered from this protein including materials that enhance BMP-induced bone healing and, on the other hand, materials that inhibit BMPs in clinical situations where this is called for such as reducing BMP-induced inflammation and inhibiting tumors dependent on BMP autocrine systems. As understanding of the structure and function of this protein increases, more opportunities for rationally developed therapeutics will become apparent.

  17. Extracellular matrix proteins and carcinoembryonic antigen-related cell adhesion molecules characterize pancreatic duct fluid exosomes in patients with pancreatic cancer.

    Science.gov (United States)

    Zheng, Jian; Hernandez, Jonathan M; Doussot, Alexandre; Bojmar, Linda; Zambirinis, Constantinos P; Costa-Silva, Bruno; van Beek, Elke J A H; Mark, Milica T; Molina, Henrik; Askan, Gokce; Basturk, Olca; Gonen, Mithat; Kingham, T Peter; Allen, Peter J; D'Angelica, Michael I; DeMatteo, Ronald P; Lyden, David; Jarnagin, William R

    2018-01-12

    Exosomes are nanovesicles that have been shown to mediate carcinogenesis in pancreatic ductal adenocarcinoma (PDAC). Given the direct communication of pancreatic duct fluid with the tumor and its relative accessibility, we aimed to determine the feasibility of isolating and characterizing exosomes from pancreatic duct fluid. Pancreatic duct fluid was collected from 26 patients with PDAC (n = 13), intraductal papillary mucinous neoplasm (IPMN) (n = 8) and other benign pancreatic diseases (n = 5) at resection. Exosomes were isolated by serial ultracentrifugation, proteins were identified by mass spectrometry, and their expression was evaluated by immunohistochemistry. Exosomes were isolated from all specimens with a mean concentration of 5.9 ± 1 × 10 8  particles/mL and most frequent size of 138 ± 9 nm. Among the top 35 proteins that were significantly associated with PDAC, multiple carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) and extracellular matrix (ECM) proteins were identified. Interestingly, CEACAM 1/5 expression by immunohistochemistry was seen only on tumor epithelia whereas tenascin C positivity was restricted to stroma, suggesting that both tumor and stromal cells contributed to exosomes. This is the first study showing that exosome isolation is feasible from pancreatic duct fluid, and that exosomal proteins may be utilized to diagnose patients with PDAC. Copyright © 2017 International Hepato-Pancreato-Biliary Association Inc. Published by Elsevier Ltd. All rights reserved.

  18. Capillary-Channeled Polymer (C-CP) Films as Processing Platforms for Protein Analysis by Matrix-Assisted Laser/Desorption Ionization Mass Spectrometry (MALDI-MS)

    Science.gov (United States)

    Pittman, Jennifer J.; Manard, Benjamin T.; Kowalski, Paul J.; Marcus, R. Kenneth

    2012-01-01

    Polypropylene (PP) capillary-channeled polymer (C-CP) films have parallel, μm-sized channels that induce solution wicking via capillary action. Efficient mass transport from the solution phase to the channel surface leads to adsorption of hydrophobic protein solutes. The basic premise by which C-CP films can be used as media to manipulate analyte solutions (e.g., proteins in buffer), for the purpose of desalting or chromatographic separation prior to MALDI-MS analysis is presented here. Cytochrome c and myoglobin prepared in a Tris-HCl buffer, and ribonuclease A, lysozyme, and transferrin prepared in phosphate buffered saline (PBS), are used as the test solutions to demonstrate the desalting concept. Protein analysis is performed after deposition on a C-CP film with and without a water washing step, followed by spray deposition of a typical sinapinic acid matrix. Extracted MALDI mass spectra exhibit much improved signal-to-noise characteristics after water washing. A mixture of cytochrome c and myoglobin (2 μL of 2.5 μM each in Tris-HCl buffer) was applied, washed with water and spatially separated via simple capillary action (wicking) using a reversed-phase solvent composition of 0.1% trifluoroacetic acid (TFA) in 50:50 acetonitrile (ACN):H2O. Subsequent application of sinapinic acid followed by imaging of the film using MALDI-MS reveals that as the protein solution is wicked down the film, separation occurs.

  19. Sustained protein kinase D activation mediates respiratory syncytial virus-induced airway barrier disruption.

    Science.gov (United States)

    Rezaee, Fariba; DeSando, Samantha A; Ivanov, Andrei I; Chapman, Timothy J; Knowlden, Sara A; Beck, Lisa A; Georas, Steve N

    2013-10-01

    Understanding the regulation of airway epithelial barrier function is a new frontier in asthma and respiratory viral infections. Despite recent progress, little is known about how respiratory syncytial virus (RSV) acts at mucosal sites, and very little is known about its ability to influence airway epithelial barrier function. Here, we studied the effect of RSV infection on the airway epithelial barrier using model epithelia. 16HBE14o- bronchial epithelial cells were grown on Transwell inserts and infected with RSV strain A2. We analyzed (i) epithelial apical junction complex (AJC) function, measuring transepithelial electrical resistance (TEER) and permeability to fluorescein isothiocyanate (FITC)-conjugated dextran, and (ii) AJC structure using immunofluorescent staining. Cells were pretreated or not with protein kinase D (PKD) inhibitors. UV-irradiated RSV served as a negative control. RSV infection led to a significant reduction in TEER and increase in permeability. Additionally it caused disruption of the AJC and remodeling of the apical actin cytoskeleton. Pretreatment with two structurally unrelated PKD inhibitors markedly attenuated RSV-induced effects. RSV induced phosphorylation of the actin binding protein cortactin in a PKD-dependent manner. UV-inactivated RSV had no effect on AJC function or structure. Our results suggest that RSV-induced airway epithelial barrier disruption involves PKD-dependent actin cytoskeletal remodeling, possibly dependent on cortactin activation. Defining the mechanisms by which RSV disrupts epithelial structure and function should enhance our understanding of the association between respiratory viral infections, airway inflammation, and allergen sensitization. Impaired barrier function may open a potential new therapeutic target for RSV-mediated lung diseases.

  20. Shedding of membrane-associated LDL receptor-related protein-1 from microglia amplifies and sustains neuroinflammation.

    Science.gov (United States)

    Brifault, Coralie; Gilder, Andrew S; Laudati, Emilia; Banki, Michael; Gonias, Steven L

    2017-11-10

    In the CNS, microglia are activated in response to injury or infection and in neurodegenerative diseases. The endocytic and cell signaling receptor, LDL receptor-related protein-1 (LRP1), is reported to suppress innate immunity in macrophages and oppose microglial activation. The goal of this study was to identify novel mechanisms by which LRP1 may regulate microglial activation. Using primary cultures of microglia isolated from mouse brains, we demonstrated that LRP1 gene silencing increases expression of proinflammatory mediators; however, the observed response was modest. By contrast, the LRP1 ligand, receptor-associated protein (RAP), robustly activated microglia, and its activity was attenuated in LRP1-deficient cells. An important element of the mechanism by which RAP activated microglia was its ability to cause LRP1 shedding from the plasma membrane. This process eliminated cellular LRP1, which is anti-inflammatory, and generated a soluble product, shed LRP1 (sLRP1), which is potently proinflammatory. Purified sLRP1 induced expression of multiple proinflammatory cytokines and the mRNA encoding inducible nitric-oxide synthase in both LRP1-expressing and -deficient microglia. LPS also stimulated LRP1 shedding, as did the heat-shock protein and LRP1 ligand, calreticulin. Other LRP1 ligands, including α 2 -macroglobulin and tissue-type plasminogen activator, failed to cause LRP1 shedding. Treatment of microglia with a metalloproteinase inhibitor inhibited LRP1 shedding and significantly attenuated RAP-induced cytokine expression. RAP and sLRP1 both caused neuroinflammation in vivo when administered by stereotaxic injection into mouse spinal cords. Collectively, these results suggest that LRP1 shedding from microglia may amplify and sustain neuroinflammation in response to proinflammatory stimuli. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Ischemia in tumors induces early and sustained phosphorylation changes in stress kinase pathways but does not affect global protein levels

    Energy Technology Data Exchange (ETDEWEB)

    Mertins, Philipp; Yang, Feng; Liu, Tao; Mani, DR; Petyuk, Vladislav A.; Gillette, Michael; Clauser, Karl; Qiao, Jana; Gritsenko, Marina A.; Moore, Ronald J.; Levine, Douglas; Townsend, Reid; Erdmann-Gilmore, Petra; Snider, Jacqueline E.; Davies, Sherri; Ruggles, Kelly; Fenyo, David; Kitchens, R. T.; Li, Shunqiang; Olvera, Narcisco; Dao, Fanny; Rodriguez, Henry; Chan, Daniel W.; Liebler, Daniel; White, Forest; Rodland, Karin D.; Mills, Gordon; Smith, Richard D.; Paulovich, Amanda G.; Ellis, Matthew; Carr, Steven A.

    2014-07-01

    Advances in quantitative mass spectrometry (MS)-based proteomics have sparked efforts to characterize the proteomes of tumor samples to provide complementary and unique information inaccessible by genomics. Tumor samples are usually not accrued with proteomic characterization in mind, raising concerns regarding effects of undocumented sample ischemia on protein abundance and phosphosite stoichiometry. Here we report the effects of cold ischemia time on clinical ovarian cancer samples and patient-derived basal and luminal breast cancer xenografts. Tumor tissues were excised and collected prior to vascular ligation, subjected to accurately defined ischemia times up to 60 min, and analyzed by quantitative proteomics and phosphoproteomics using isobaric tags and high-performance, multidimensional LC-MS/MS. No significant changes were detected at the protein level in each tumor type after 60 minutes of ischemia, and the majority of the >25,000 phosphosites detected were also stable. However, large, reproducible increases and decreases in protein phosphorylation at specific sites were observed in up to 24% of the phosphoproteome starting as early as 5 minutes post-excision. Early and sustained activation of stress response, transcriptional regulation and cell death pathways were observed in common across tumor types. Tissue-specific changes in phosphosite stability were also observed suggesting idiosyncratic effects of ischemia in particular lineages. Our study provides insights into the information that may be obtained by proteomic characterization of tumor samples after undocumented periods of ischemia, and suggests caution especially in interpreting activation of stress pathways in such samples as they may reflect sample handling rather than tumor physiology.

  2. Mammalian Otolin: a multimeric glycoprotein specific to the inner ear that interacts with otoconial matrix protein Otoconin-90 and Cerebellin-1.

    Directory of Open Access Journals (Sweden)

    Michael R Deans

    2010-09-01

    Full Text Available The mammalian otoconial membrane is a dense extracellular matrix containing bio-mineralized otoconia. This structure provides the mechanical stimulus necessary for hair cells of the vestibular maculae to respond to linear accelerations and gravity. In teleosts, Otolin is required for the proper anchoring of otolith crystals to the sensory maculae. Otoconia detachment and subsequent entrapment in the semicircular canals can result in benign paroxysmal positional vertigo (BPPV, a common form of vertigo for which the molecular basis is unknown. Several cDNAs encoding protein components of the mammalian otoconia and otoconial membrane have recently been identified, and mutations in these genes result in abnormal otoconia formation and balance deficits.Here we describe the cloning and characterization of mammalian Otolin, a protein constituent of otoconia and the otoconial membrane. Otolin is a secreted glycoprotein of ∼70 kDa, with a C-terminal globular domain that is homologous to the immune complement C1q, and contains extensive posttranslational modifications including hydroxylated prolines and glycosylated lysines. Like all C1q/TNF family members, Otolin multimerizes into higher order oligomeric complexes. The expression of otolin mRNA is restricted to the inner ear, and immunohistochemical analysis identified Otolin protein in support cells of the vestibular maculae and semi-circular canal cristae. Additionally, Otolin forms protein complexes with Cerebellin-1 and Otoconin-90, two protein constituents of the otoconia, when expressed in vitro. Otolin was also found in subsets of support cells and non-sensory cells of the cochlea, suggesting that Otolin is also a component of the tectorial membrane.Given the importance of Otolin in lower organisms, the molecular cloning and biochemical characterization of the mammalian Otolin protein may lead to a better understanding of otoconial development and vestibular dysfunction.

  3. Matrix theory

    CERN Document Server

    Franklin, Joel N

    2003-01-01

    Mathematically rigorous introduction covers vector and matrix norms, the condition-number of a matrix, positive and irreducible matrices, much more. Only elementary algebra and calculus required. Includes problem-solving exercises. 1968 edition.

  4. Preparation and characterization of cross-linked excipient of coprocessed xanthan gum-acacia gum as matrix for sustained release tablets

    Science.gov (United States)

    Surini, Silvia; Wati, Dina Risma; Syahdi, Rezi Riadhi

    2018-02-01

    Sustained release tablet is solid dosage form which is designed to release drugs slowly in the body. This research was intended to prepare and characterize the cross-linked excipients of co-processed xanthan gum-acacia gum (CL-Co-XGGA) as matrices for sustained release tablets with gliclazide as a model drug. CL-Co-XGGA excipients were cross-linked materials of co-processed excipients of xanthan gum-acacia gum (Co-XGGA) using sodium trimetaphosphate. Co-processed excipients of xanthan gum-acacia gum were prepared in the ratio of each excipient 1:2, 1:1 and 2:1. Co-XGGA and CL-Co-XGGA excipients were characterized physically, chemically and functionally. Then, the sustained release (SR) tablets were formulated by wet granulation method using CL-Co-XGGA excipients as matrices. Also, the dissolution study of the gliclazide SR tablets was carried out in phosphate buffer medium pH 7,4 containing sodium lauryl sulphate 0.2% for 12 hours. The results showed that the degree of substitution (DS) of CL-Co-XGGA 1:2, 1:1, 2:1 excipients were respectively 0.067, 0.082 and 0.08. Besides that, the excipients gel strengths were 14.03, 17.27 and 20,70 gF, respectively. The cross-linked excipients had improved flow properties and swelling capability compared to the Co-XGGA excipients. The results of the gliclazide SR tablets evaluations showed that all tablets were passed all tablet requirements. Moreover, the gliclazide release from SR tablets F1 - F6 revealed the sustained release profile, which was following zero order kinetics (F1, F2, F3, F6) and Higuchi kinetics (F4 and F5). It could be concluded that the obtained CL-Co-XGGA excipients might be used as matrices for sustained release tablets and could retard drug release up to 8 until 32 hours.

  5. Improvement of gluten-free bread properties by the incorporation of bovine plasma proteins and different saccharides into the matrix.

    Science.gov (United States)

    Rodriguez Furlán, Laura T; Pérez Padilla, Antonio; Campderrós, Mercedes E

    2015-03-01

    The aim of this work was to improve the quality of gluten-free bread, incorporating plasma bovine proteins concentrated by ultrafiltration and freeze-dried with saccharides (inulin and sucrose). The influence of these compounds on textural properties and final bread quality was assessed. The textural studies revealed that with the addition of proteins and inulin, homogeneous and smaller air cells were achieved improving the textural properties while the bread hardness was comparable with breads with gluten. The volume of gluten-free breads increased with increasing proteins and inulin concentrations, reaching a maximum at a protein concentration of 3.5% (w/w). The addition of the enhancers improved moisture retention of the loaves after cooking and an increase of lightness of crumb with respect to the control was observed. The sensory analysis found no statistically significant difference in sensory attributes evaluated with respect to the control, so these ingredients do not negatively affect the organoleptic properties of bread. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Molecular aspects of the interaction between Mason-Pfizer monkey virus matrix protein and artificial phospholipid membrane

    Czech Academy of Sciences Publication Activity Database

    Junková, P.; Prchal, J.; Spiwok, V.; Pleskot, Roman; Kadlec, Jan; Krásný, L.; Hynek, R.; Hrabal, R.; Ruml, T.

    2016-01-01

    Roč. 84, č. 11 (2016), s. 1717-1727 ISSN 0887-3585 Institutional support: RVO:61388963 Keywords : covalent labelling * mass spectrometry * multiscale molecular dynamics * protein-membrane interaction * phosphatidylinositol-(4,5)-bisphosphate * liposomes Subject RIV: CE - Biochemistry Impact factor: 2.289, year: 2016

  7. Fabrication of a novel hemin-based monolithic column and its application in separation of protein from complex bio-matrix.

    Science.gov (United States)

    Jiang, Xiaoya; Zhang, Doudou; Li, Xueying; Wang, Xixi; Bai, Ligai; Liu, Haiyan; Yan, Hongyuan

    2017-05-10

    A novel polymer-based monolithic column was prepared via redox initiation system within the confines of a stainless steel column with 4.6mm i.d. In the processes, hemin and lauryl methacrylate were used as co-monomers; ethylene dimethacrylate as crosslinking agent; n-butyl alcohol, ethanediol, and N, N-dimethylformamide as tri-porogens; benzoyl peroxide and N, N-dimethyl aniline as redox initiation system. The resulting polymer-based monolithic columns were characterized by scanning electron microscopy, nitrogen adsorption-desorption instrument, and mercury intrusion porosimeter, respectively. The results illustrated that the improved monolith had relative uniform porous structure, good permeability, and low back pressure. Aromatic compounds were used to test the chromatographic behavior of the monolith, resulting in highest column efficiency of 19 880 plates per meter with reversed-phase mechanism. Furthermore, the homemade monolith was used as the stationary phase of high performance liquid chromatography to separate proteins from complex bio-matrix, including human plasma, egg white, and snailase. The results showed that the monolithic column occupied good separation ability with these complex bio-samples. Excellent specific character of the homemade hemin-based monolith was that it could simultaneously remove high-abundance proteins (including human serum albumin, immunoglobulin G, and human fibrinogen) from human plasma and separate other proteins to different fractions. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. YKL-40, a mammalian member of the chitinase family, is a matrix protein of specific granules in human neutrophils

    DEFF Research Database (Denmark)

    Volck, B; Price, P A; Johansen, J S

    1998-01-01

    of patients with RA, and the cells are assumed to play a role in joint destruction in that disorder. Therefore, we examined whether neutrophils are a source of YKL-40. YKL-40 was found to colocalize and comobilize with lactoferrin (the most abundant protein of specific granules) but not with gelatinase...... in subcellular fractionation studies on stimulated and unstimulated neutrophils. Double-labeling immunoelectron microscopy confirmed the colocalization of YKL-40 and lactoferrin in specific granules of neutrophils. Immunohistochemistry on bone marrow cells showed that neutrophil precursors begin to synthesize...... YKL-40 at the myelocyte-metamyelocyte stage, the stage of maturation at which other specific granule proteins are formed. Assuming that YKL-40 has a role as an autoantigen in RA by inducing T cell-mediated autoimmune response, YKL-40 released from neutrophils in the inflamed joint could be essential...

  9. Analyses of the in vitro non-enzymatic glycation of peptides/proteins by matrix-assisted laser desorption/ionization mass spectrometry

    Science.gov (United States)

    Lee, Bao-Shiang; Krishnanchettiar, Sangeeth; Lateef, Syed Salman; Gupta, Shalini

    2007-01-01

    Non-enzymatic glycation of proteins with the reducing agent glucose is implicated to be responsible for diabetes-derived complications, food browning, and aging. However, the non-enzymatic glycation process of peptides/proteins is not well understood and further research is needed to gain an understanding of the underlying principles involved in diabetes-related complications. In this study, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry is used to analyze the in vitro glycation of peptides/proteins. In addition to the physiological conditions, harsh conditions (higher concentration of glucose, higher or lower pH, and higher temperature) are also used in this study. Peptides/proteins are reacted with glucose for up to 120 h at 4 [degree sign]C, 37 [degree sign]C, or 65 [degree sign]C. Single and/or multiple glycations are observed using broad pH conditions (from 10% TFA with pKa of 0.5 to pH 10) at various glucose concentrations (from 0.01 M to 1 M). Data suggest that glucose reacts readily with both peptides and proteins, and the efficiency of the glycation increases with higher temperature, higher pH, higher glucose concentration, or longer incubation time. However, influence of the buffer pH on the efficiency of the glycation of peptides is less pronounced compared to that of proteins. This effect could result from denaturation of proteins at higher pH and the resultant exposure of potential glycation sites. This data could lead to the inference that the glycation process of peptides/proteins would occur but proceed very slowly under the diabetes conditions in vivo (37 [degree sign]C, ~neutral pH, ~0.007 M glucose). Postsource decay and MS/MS results of singly glycated angiotensin I, P14R (PPPPPPPPPPPPPPR), and human adrenocorticotropic hormone (ATCH) fragments 1-13 indicate that glucose reacts with the amino group of the N-terminal of ATCH 1-13 and the guanidino group of the arginine residue of both angiotensin I and P14R.

  10. In-vivo Generation of Dental Pulp-Like Tissue Using Human Pulpal Stem Cells, a Collagen Scaffold and Dentin Matrix Protein 1 Following Subcutaneous Transplantation in Mice

    Science.gov (United States)

    Prescott, Rebecca S.; Alsanea, Rajaa; Fayad, Mohamed I.; Johnson, Bradford R.; Wenckus, Christopher S.; Hao, Jianjun; John, Asha S.; George, Anne

    2008-01-01

    The presence of a perforation is known to significantly compromise the outcome of endodontic treatment. One potential use of regenerative endodontic therapy may be the repair of root canal perforations. In addition to nutrients and systemic in-situ interactions, the three main components believed to be essential for tissue regeneration are: stem cells, scaffold, and growth factors. This study investigated the role of each component of the tissue engineering triad in the organization and differentiation of Dental Pulp Stem Cells (DPSCs) in a simulated furcal perforation site using a mouse model. Collagen served as the scaffold and dentin matrix protein 1 (DMP1) was the growth factor. Materials were placed in simulated perforation sites in dentin slices. MTA was the control repair material. At six weeks, the animals were sacrificed and the perforation sites were evaluated by light microscopy and histological staining. Organization of newly derived pulp tissue was seen in the group containing the triad of DPSCs, a collagen scaffold, and DMP1. The other four groups did not demonstrate any apparent tissue organization. Under the conditions of the present study, it may be concluded that the triad of DPSCs, a collagen scaffold, and DMP1 can induce an organized matrix formation similar to that of pulpal tissue, which may lead to hard tissue formation. PMID:18358888

  11. Tissue distribution and measurement of cartilage oligomeric matrix protein in patients with magnetic resonance imaging-detected bone bruises after acute anterior cruciate ligament tears.

    Science.gov (United States)

    Fang, C; Johnson, D; Leslie, M P; Carlson, C S; Robbins, M; Di Cesare, P E

    2001-07-01

    Histologic and immunostaining analyses were performed on articular cartilage/subchondral bone biopsy specimens overlying MRI-detected bone bruises in 12 patients with anterior cruciate ligament (ACL) tears. Staining with toluidine blue for proteoglycan revealed loss of staining from the superficial portion of the articular cartilage. Immunostaining for cartilage oligomeric matrix protein (COMP) showed an increased staining in the superficial matrix of the articular cartilage. Using polyclonal antisera against COMP, the authors performed a competitive enzyme-linked immunosorbent assay (ELISA) on the synovial fluid from the injured and uninjured knees. There was an approximately 10-fold higher synovial fluid COMP levels in injured knees. The COMP levels were greater in those patients who had synovial fluid samples harvested closer to the date of initial injury. Western blot analysis of the synovial fluid showed an increased presence of COMP degradation fragments from injured knees. These results are indicative of a significant injury to the articular cartilage, and may represent preclinical posttraumatic osteoarthritic lesions.

  12. Quantification and pharmacokinetics of alpinetin in rat plasma by UHPLC-MS/MS using protein precipitation coupled with dilution approach to eliminate matrix effects.

    Science.gov (United States)

    Ye, Weijian; Lin, Xiaoji; Zhang, Youting; Xu, Youxiao; Sun, Rui; Wen, Congcong; Wang, Xianqin; Bao, Shihui; Chen, Ruijie

    2018-04-15

    Alpinetin, a bioactive flavonoid, has attracted great attention due to its diverse therapeutic effects, namely anti-oxidant, anti-tumor and anti-inflammatory effects with low systemic toxicity. Various determination methods have been developed in quality control and plant chemistry areas. However, quantification and pharmacokinetics of alpinetin in biological matrix have not been studied. In the present research, a sensitive, efficient and reliable ultrahigh performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method for the determination of alpinetin in rat plasma was developed and validated. Plasma samples were processed with protein precipitation (PP) followed by a 5-fold acetonitrile/water (50:50, v/v) dilution to significantly decrease matrix effect which exited in one step PP method. Determination of alpinetin was conducted using positive electrospray ionization tandem mass spectrometry in multiple reaction monitoring mode. Results demonstrated that the method was precise (3.3%-12.3%), accurate (-5.8% to 10.8%) and linear in the range of 1-1000 ng/mL. The new developed method was subsequently applied to a pharmacokinetic research of alpinetin following oral and intravenous dosing to healthy Sprague-Dawley rats. Alpinetin was demonstrated rapid absorption after oral administration with an absolute bioavailability of ∼15.1% and extensive distribution after dosing. Copyright © 2017. Published by Elsevier B.V.

  13. The biofilm matrix.

    Science.gov (United States)

    Flemming, Hans-Curt; Wingender, Jost

    2010-09-01

    The microorganisms in biofilms live in a self-produced matrix of hydrated extracellular polymeric substances (EPS) that form their immediate environment. EPS are mainly polysaccharides, proteins, nucleic acids and lipids; they provide the mechanical stability of biofilms, mediate their adhesion to surfaces and form a cohesive, three-dimensional polymer network that interconnects and transiently immobilizes biofilm cells. In addition, the biofilm matrix acts as an external digestive system by keeping extracellular enzymes close to the cells, enabling them to metabolize dissolved, colloidal and solid biopolymers. Here we describe the functions, properties and constituents of the EPS matrix that make biofilms the most successful forms of life on earth.

  14. The Gene Expression of Human Endothelial Cells Is Modulated by Subendothelial Extracellular Matrix Proteins: Short-Term Response to Laminar Shear Stress

    Czech Academy of Sciences Publication Activity Database

    Chlupáč, Jaroslav; Filová, Elena; Havlíková, Jana; Matějka, R.; Riedel, Tomáš; Houska, Milan; Brynda, Eduard; Pamula, E.; Rémy, M.; Bareille, R.; Fernandez, P.; Daculsi, R.; Bourget, Ch.; Bačáková, Lucie; Bordenave, L.

    2014-01-01

    Roč. 20, 15-16 (2014), s. 2253-2264 ISSN 2152-4947 R&D Projects: GA ČR(CZ) GAP108/10/1106; GA ČR(CZ) GAP108/11/1857; GA ČR(CZ) GA305/08/0108; GA ČR GAP205/12/1702; GA MŠk(CZ) EE2.3.30.0029; GA MŠk(CZ) ED1.1.00/02.0109; GA MZd(CZ) NT11270 Grant - others:GA MŠk(CZ) Barrande 2005-06-036-1 Institutional support: RVO:67985823 ; RVO:61389013 Keywords : atherosclerosis * endothelial cells * extracellular matrix proteins * tissue engineering Subject RIV: EI - Biotechnology ; Bionics; CD - Macromolecular Chemistry (UMCH-V) Impact factor: 4.448, year: 2014

  15. [Expression of erythroblastic leukemia viral oncogene homolog 3 (ErbB-3) binding protein-1, matrix metalloproteinases, eplthelial cadherin in adenoid cystic carcinoma and correlation analysis].

    Science.gov (United States)

    Sun, Jian; Yu, You-cheng; Luo, Yi-xi; Tian, Zhen

    2012-12-01

    To investigate the expression of ErbB-3 binding protein-1 (EBP-1), matrix metalloproteinase 9 (MMP-9) and E-cadherin (E-cad) in adenoid cystic carcinoma and their correlation. Immunohistochemistry(PV6000 method) was used to detect EBP-1, MMP-9 and E-cad expression in 66 cases of adenoid cystic carcinoma tissues and matched para-cancerous normal tissues. In this study all cases were successfully followed up. The positive expression rate of EBP-1 in adenoid cystic carcinoma tissues was 85%. EBP-1 expression was significantly correlated to pathological pattern and clinical stage (P correlation between EBP-1 and E-cad expression, and positive correlation between EBP-1 and MMP-9. EBP-1 and its correlation with MMP-9 and E-cad may be used as useful indicators for clinical assessment of tumor biological behavior and prognosis in patients with adenoid cystic carcinoma.

  16. The effect of enamel matrix proteins on the spreading, proliferation and differentiation of osteoblasts cultured on titanium surfaces.

    Science.gov (United States)

    Miron, Richard J; Oates, Christine J; Molenberg, Aart; Dard, Michel; Hamilton, Douglas W

    2010-01-01

    Modifications of implant surface topography and chemistry have proven a means to enhance osseointegration, a process that ensures the stability of bone-contacting devices, including titanium dental implants. The commercial product Emdogain is an enamel matrix derivative (EMD) extracted from porcine teeth commonly used in periodontal surgery, where it has been shown to potentiate regeneration of bone. The aim of the present study was to evaluate the effect of EMD on the attachment, proliferation and differentiation of osteoblasts on titanium surfaces in vitro. Pickled (smooth) and SLA (roughened) titanium discs were coated with EMD or left uncoated. Primary rat calvarial osteoblasts were cultured on each surface from 1h to 4 weeks. EMD significantly increased cell spreading and proliferation at time points ranging from 3 to 7 days on both topographies. Alkaline phosphatase activity was significantly increased on EMD-coated titanium compared with titanium alone. Moreover, there was a 6 fold increase in levels of mRNA encoding bone sialoprotein and osteocalcin in osteoblasts cultured on EMD-coated titanium surfaces compared with uncoated surfaces. We conclude that coating of titanium with EMD enhances the proliferation and differentiation of osteoblasts irrespective of the titanium substratum topography.

  17. Extracellular Protein Interactions Mediated by the Neural Cell Adhesion Molecule, NCAM: Heterophilic Interactions Between NCAM and Cell Adhesion Molecules, Extracellular Matrix Proteins, and Viruses

    DEFF Research Database (Denmark)

    Nielsen, Janne; Kulahin, Nikolaj; Walmod, Peter

    2008-01-01

    interactions, thereby modulating a range of biological processes. This review summarizes interactions between NCAM and other CAMs and ECM proteins. Additionally, the role of NCAM as a receptor for rabies virus, and its implications in rabies infections is briefly described. Interactions between NCAM and its...

  18. Static Mechanical Loading Influences the Expression of Extracellular Matrix and Cell Adhesion Proteins in Vaginal Cells Derived From Premenopausal Women With Severe Pelvic Organ Prolapse.

    Science.gov (United States)

    Kufaishi, Hala; Alarab, May; Drutz, Harold; Lye, Stephen; Shynlova, Oksana

    2016-08-01

    Primary human vaginal cells derived from women with severe pelvic organ prolapse (POP-HVCs) demonstrate altered cellular characteristics as compared to cells derived from asymptomatic women (control-HVCs). Using computer-controllable Flexcell stretch unit, we examined whether POP-HVCs react differently to mechanical loading as compared to control-HVCs by the expression of extracellular matrix (ECM) components, cell-ECM adhesion proteins, and ECM degrading and maturating enzymes. Vaginal tissue biopsies from premenopausal patients with Pelvic Organ Prolapse Quantification System stage ≥3 (n = 8) and asymptomatic controls (n = 7) were collected during vaginal hysterectomy or repair. Human vaginal cells were isolated by enzymatic digestion, seeded on collagen (COLI)-coated plates, and stretched (24 hours, 25% elongation). Total RNA was extracted, and 84 genes were screened using Human ECM and Adhesion Molecules polymerase chain reaction array; selected genes were verified by quantitative reverse transcription-polymerase chain reaction. Stretch-conditioned media (SCM) were collected and analyzed by protein array, immunoblotting, and zymography. In mechanically stretched control-HVCs, transcript levels of integrins (ITGA1, ITGA4, ITGAV, and ITGB1) and matrix metalloproteinases (MMPs) 2, 8, and 13 were downregulated (P SCM from POP-HVCs compared to control-HVCs. Primary human vaginal cells derived from women with severe pelvic organ prolapse and control-HVCs react differentially to in vitro mechanical stretch. Risk factors that induce stretch may alter ECM composition and cell-ECM interaction in pelvic floor tissue leading to the abatement of pelvic organ support and subsequent POP development. © The Author(s) 2016.

  19. Unravelling the nuclear matrix proteome

    DEFF Research Database (Denmark)

    Albrethsen, Jakob; Knol, Jaco C; Jimenez, Connie R

    2009-01-01

    The nuclear matrix (NM) model posits the presence of a protein/RNA scaffold that spans the mammalian nucleus. The NM proteins are involved in basic nuclear function and are a promising source of protein biomarkers for cancer. Importantly, the NM proteome is operationally defined as the proteins...

  20. A pH- and temperature-responsive bioresorbable injectable hydrogel based on polypeptide block copolymers for the sustained delivery of proteins in vivo.

    Science.gov (United States)

    Turabee, Md Hasan; Thambi, Thavasyappan; Duong, Huu Thuy Trang; Jeong, Ji Hoon; Lee, Doo Sung

    2018-02-27

    Sustained delivery of protein therapeutics is limited owing to the fragile nature of proteins. Despite its great potential, delivery of proteins without any loss of bioactivity remains a challenge in the use of protein therapeutics in the clinic. To surmount this shortcoming, we report a pH- and temperature-responsive in situ-forming injectable hydrogel based on comb-type polypeptide block copolymers for the controlled delivery of proteins. Polypeptide block copolymers, composed of hydrophilic polyethylene glycol (PEG), temperature-responsive poly(γ-benzyl-l-glutamate) (PBLG), and pH-responsive oligo(sulfamethazine) (OSM), exhibit pH- and temperature-induced sol-to-gel transition behavior in aqueous solutions. Polypeptide block copolymers were synthesized by combining N-carboxyanhydride-based ring-opening polymerization and post-functionalization of the chain-end using N-hydroxy succinimide ester activated OSM. The physical properties of polypeptide-based hydrogels were tuned by varying the composition of temperature- and pH-responsive PBLG and OSM in block copolymers. Polypeptide block copolymers were non-toxic to human embryonic kidney cells at high concentrations (2000 μg mL -1 ). Subcutaneous administration of polypeptide block copolymer sols formed viscoelastic gel instantly at the back of Sprague-Dawley (SD) rats. The in vivo gels exhibited sustained degradation and were found to be bioresorbable in 6 weeks without any noticeable inflammation at the injection site. Anionic characteristics of hydrogels allow efficient loading of a cationic model protein, lysozyme, through electrostatic interaction. Lysozyme-loaded polypeptide block copolymer sols readily formed a viscoelastic gel in vivo and sustained lysozyme release for at least a week. Overall, the results demonstrate an elegant approach to control the release of certain charged proteins and open a myriad of therapeutic possibilities in protein therapeutics.

  1. Cytocompatibility of novel extracellular matrix protein analogs of biodegradable polyester polymers derived from α-hydroxy amino acids.

    Science.gov (United States)

    Lecht, Shimon; Cohen-Arazi, Naomi; Cohen, Gadi; Ettinger, Keren; Momic, Tatjana; Kolitz, Michal; Naamneh, Majdi; Katzhendler, Jehoshua; Domb, Abraham J; Lazarovici, Philip; Lelkes, Peter I

    2014-01-01

    One of the challenges in regenerative medicine is the development of novel biodegradable materials to build scaffolds that will support multiple cell types for tissue engineering. Here we describe the preparation, characterization, and cytocompatibility of homo- and hetero-polyesters of α-hydroxy amino acid derivatives with or without lactic acid conjugation. The polymers were prepared by a direct condensation method and characterized using gel permeation chromatography, (1)H-nuclear magnetic resonance spectroscopy, Fourier transform infrared spectroscopy, differential scanning calorimetry, optical activity, and solubility. The surface charge of the polymers was evaluated using zeta potential measurements. The polymers were coated onto glass cover slips followed by characterization using nano-surface profiler, thin film reflectometry, and atomic force microscopy (AFM). Their interaction with endothelial and neuronal cells was assessed using adhesion, proliferation, and differentiation assays. Of the characterized polymers, Poly-HOVal-LA, but not Poly-(D)HOPhe, significantly augmented nerve growth factor (NGF)-induced neuronal differentiation of the PC12 pheochromcytoma cells. In contrast, Poly-HOLeu increased by 20% the adhesion of endothelial cells, but did not affect PC12 cell differentiation. NGF-induced Erk1/2 phosphorylation in PC12 cells grown on the different polymers was similar to the effect observed for cells cultured on collagen type I. While no significant association could be established between charge and the differentiative/proliferative properties of the polymers, AFM analysis indicated augmentation of NGF-induced neuronal differentiation on smooth polymer surfaces. We conclude that overall selective cytocompatibility and bioactivity might render α-hydroxy amino acid polymers useful as extracellular matrix-mimicking materials for tissue engineering.

  2. Construction of genetically engineered M13K07 helper phage for simultaneous phage display of gold binding peptide 1 and nuclear matrix protein 22 ScFv antibody.

    Science.gov (United States)

    Fatemi, Farnaz; Amini, Seyed Mohammad; Kharrazi, Sharmin; Rasaee, Mohammad Javad; Mazlomi, Mohammad Ali; Asadi-Ghalehni, Majid; Rajabibazl, Masoumeh; Sadroddiny, Esmaeil

    2017-11-01

    The most common techniques of antibody phage display are based on the use of M13 filamentous bacteriophages. This study introduces a new genetically engineered M13K07 helper phage displaying multiple copies of a known gold binding peptide on p8 coat proteins. The recombinant helper phages were used to rescue a phagemid vector encoding the p3 coat protein fused to the nuclear matrix protein 22 (NMP22) ScFv antibody. Transmission electron microscopy (TEM), UV-vis absorbance spectroscopy, and field emission scanning electron microscopy (FE-SEM) with energy dispersive X-ray spectroscopy (EDX) analysis revealed that the expression of gold binding peptide 1 (GBP1) on major coat protein p8 significantly enhances the gold-binding affinity of M13 phages. The recombinant bacteriophages at concentrations above 5×10 4 pfu/ml red-shifted the UV-vis absorbance spectra of gold nanoparticles (AuNPs); however, the surface plasmon resonance of gold nanoparticles was not changed by the wild type bacteriophages at concentrations up to 10 12 pfu/ml. The phage ELISA assay demonstrated the high affinity binding of bifunctional bacteriophages to NMP22 antigen at concentrations of 10 5 and 10 6 pfu/ml. Thus, the p3 end of the bifunctional bacteriophages would be able to bind to specific target antigen, while the AuNPs were assembled along the coat of virus for signal generation. Our results indicated that the complex of antigen-bacteriophages lead to UV-vis spectral changes of AuNPs and NMP22 antigen in concentration range of 10-80μg/ml can be detected by bifunctional bacteriophages at concentration of 10 4 pfu/ml. The ability of bifunctional bacteriophages to bind to antigen and generate signal at the same time, makes this approach applicable for identifying different antigens in immunoassay techniques. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Matriptase-2, a membrane-bound mosaic serine proteinase predominantly expressed in human liver and showing degrading activity against extracellular matrix proteins.

    Science.gov (United States)

    Velasco, Gloria; Cal, Santiago; Quesada, Victor; Sánchez, Luis M; López-Otín, Carlos

    2002-10-04

    We have identified and cloned a fetal liver cDNA encoding a new serine proteinase that has been called matriptase-2. This protein exhibits a domain organization similar to other members of an emerging family of membrane-bound serine proteinases known as type II transmembrane serine proteinases. Matriptase-2 contains a short cytoplasmic domain, a type II transmembrane sequence, a central region with several modular structural domains including two CUB (complement factor C1s/C1r, urchin embryonic growth factor, bone morphogenetic protein) domains and three low density lipoprotein receptor tandem repeats, and finally, a C-terminal catalytic domain with all typical features of serine proteinases. The human matriptase-2 gene maps to 22q12-q13, a location that differs from all type II transmembrane serine proteinase genes mapped to date. Immunofluorescence and Western blot analysis of COS-7 cells transfected with the isolated cDNA confirmed that matriptase-2 is anchored to the cell surface. Matriptase-2 was expressed in Escherichia coli, and the purified recombinant protein hydrolyzed synthetic substrates used for assaying serine proteinases and endogenous proteins such as type I collagen, fibronectin, and fibrinogen. Matriptase-2 could also activate single-chain urokinase plasminogen activator, albeit with low efficiency. These activities were abolished by inhibitors of serine proteinases but not by inhibitors of other classes of proteolytic enzymes. Northern blot analysis demonstrated that matriptase-2 transcripts are only detected at significant levels in both fetal and adult liver, suggesting that this novel serine proteinase may play a specialized role in matrix remodeling processes taking place in this tissue during development or in adult tissues.

  4. Silk-fibronectin protein alloy fibres support cell adhesion and viability as a high strength, matrix fibre analogue

    Science.gov (United States)

    Jacobsen, Matthew M.; Li, David; Gyune Rim, Nae; Backman, Daniel; Smith, Michael L.; Wong, Joyce Y.

    2017-04-01

    Silk is a natural polymer with broad utility in biomedical applications because it exhibits general biocompatibility and high tensile material properties. While mechanical integrity is important for most biomaterial applications, proper function and integration also requires biomaterial incorporation into complex surrounding tissues for many physiologically relevant processes such as wound healing. In this study, we spin silk fibroin into a protein alloy fibre with whole fibronectin using wet spinning approaches in order to synergize their respective strength and cell interaction capabilities. Results demonstrate that silk fibroin alone is a poor adhesive surface for fibroblasts, endothelial cells, and vascular smooth muscle cells in the absence of serum. However, significantly improved cell attachment is observed to silk-fibronectin alloy fibres without serum present while not compromising the fibres’ mechanical integrity. Additionally, cell viability is improved up to six fold on alloy fibres when serum is present while migration and spreading generally increase as well. These findings demonstrate the utility of composite protein alloys as inexpensive and effective means to create durable, biologically active biomaterials.

  5. Direct detection of carbapenemase-associated proteins of Acinetobacter baumannii using nanodiamonds coupled with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Chang, Kai-Chih; Chung, Chin-Yi; Yeh, Chen-Hsing; Hsu, Kuo-Hsiu; Chin, Ya-Ching; Huang, Sin-Siang; Liu, Bo-Rong; Chen, Hsi-An; Hu, Anren; Soo, Po-Chi; Peng, Wen-Ping

    2018-04-01

    The appearance and spread of carbapenem-resistant Acinetobacter baumannii (CRAB) pose a challenge for optimization of antibiotic therapies and outbreak preventions. The carbapenemase production can be detected through culture-based methods (e.g. Modified Hodge Test-MHT) and DNA based methods (e.g. Polymerase Chain Reaction-PCR). The culture-based methods are time-consuming, whereas those of PCR assays need only a few hours but due to its specificity, can only detect known genetic targets encoding carbapenem-resistance genes. Therefore, new approaches to detect carbapenemase-producing A. baumannii are of great importance. Here, we have developed a rapid and novel method using detonation nanodiamonds (DNDs) as a platform for concentration and extraction of A. baumannii carbapenemase-associated proteins prior to matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI TOF-MS) analysis. To concentrate and extract the A. baumannii carbapenemase-associated proteins, we tested several protein precipitation conditions and found a 0.5% trifluoroacetic acid (TFA) solution within the bacterial suspension could result in strong ion signals with DNDs. A total of 66 A. baumannii clinical-isolates including 51 carbapenem-resistant strains and 15 carbapenem-susceptible strains were tested. Our result showed that among the 51 carbapenem-resistant strains 49 strains had a signal at m/z ~40,279 (±87); among the 15 carbapenem-susceptible strains, 4 strains showed a signal at m/z ~40,279. With on-diamond digestion, we confirmed that the captured protein at m/z ~40,279 was related to ADC family extended-spectrum class C beta-lactamase, from A. baumannii. Using this ADC family protein as a biomarker (m/z ~ 40,279) for carbapenem susceptibility testing of A. baumannii, the sensitivity and the specificity could reach 96% and 73% as compared to traditional imipenem susceptibility testing (MIC results). However, the sensitivity and specificity of this method

  6. A Collapsin Response Mediator Protein 2 Isoform Controls Myosin II-Mediated Cell Migration and Matrix Assembly by Trapping ROCK II

    Science.gov (United States)

    Morgan-Fisher, Marie; Wait, Robin; Couchman, John R.; Wewer, Ulla M.

    2012-01-01

    Collapsin response mediator protein 2 (CRMP-2) is known as a regulator of neuronal polarity and differentiation through microtubule assembly and trafficking. Here, we show that CRMP-2 is ubiquitously expressed and a splice variant (CRMP-2L), which is expressed mainly in epithelial cells among nonneuronal cells, regulates myosin II-mediated cellular functions, including cell migration. While the CRMP-2 short form (CRMP-2S) is recognized as a substrate of the Rho-GTP downstream kinase ROCK in neuronal cells, a CRMP-2 complex containing 2L not only bound the catalytic domain of ROCK II through two binding domains but also trapped and inhibited the kinase. CRMP-2L protein levels profoundly affected haptotactic migration and the actin-myosin cytoskeleton of carcinoma cells as well as nontransformed epithelial cell migration in a ROCK activity-dependent manner. Moreover, the ectopic expression of CRMP-2L but not -2S inhibited fibronectin matrix assembly in fibroblasts. Underlying these responses, CRMP-2L regulated the kinase activity of ROCK II but not ROCK I, independent of GTP-RhoA levels. This study provides a new insight into CRMP-2 as a controller of myosin II-mediated cellular functions through the inhibition of ROCK II in nonneuronal cells. PMID:22431514

  7. Three-Dimensional Collagen Type I Matrix Up-Regulates Nuclear Isoforms of the Microtubule Associated Protein Tau Implicated in Resistance to Paclitaxel Therapy in Ovarian Carcinoma

    Science.gov (United States)

    Gurler, Hilal; Yu, Yi; Choi, Jacqueline; Kajdacsy-Balla, Andre A.; Barbolina, Maria V.

    2015-01-01

    Epithelial ovarian carcinoma is the deadliest gynecologic malignancy. One reason underlying treatment failure is resistance to paclitaxel. Expression of the microtubule associated protein tau has recently been proposed as a predictor of response to paclitaxel in ovarian carcinoma patients. Expression of tau was probed using immunohistochemistry in 312 specimens of primary, and 40 specimens of metastatic, ovarian carcinoma. Serous epithelial ovarian carcinoma cell line models were used to determine the expression of tau by Western blot and immunofluorescence staining. Subcellular fractionation and Western blot were employed to examine nuclear and cytoplasmic localization of tau. Gene silencing and clonogenic assays were used to evaluate paclitaxel response. Tau was expressed in 44% of all tested cases. Among the primary serous epithelial ovarian carcinoma cases, 46% were tau-positive. Among the metastatic serous epithelial ovarian carcinomas, 63% were tau-positive. Cell culture experiments demonstrated that tau was expressed in multiple isoforms. Three-dimensional collagen I matrix culture conditions resulted in up-regulation of tau protein. Silencing of tau with specific siRNAs in a combination with three-dimensional culture conditions led to a significant decrease of the clonogenic ability of cells treated with paclitaxel. The data suggest that reduction of tau expression may sensitize ovarian carcinoma to the paclitaxel treatment. PMID:25658796

  8. The Influence of Arginine on the Response of Enamel Matrix Derivative (EMD Proteins to Thermal Stress: Towards Improving the Stability of EMD-Based Products.

    Directory of Open Access Journals (Sweden)

    Alessandra Apicella

    Full Text Available In a current procedure for periodontal tissue regeneration, enamel matrix derivative (EMD, which is the active component, is mixed with a propylene glycol alginate (PGA gel carrier and applied directly to the periodontal defect. Exposure of EMD to physiological conditions then causes it to precipitate. However, environmental changes during manufacture and storage may result in modifications to the conformation of the EMD proteins, and eventually premature phase separation of the gel and a loss in therapeutic effectiveness. The present work relates to efforts to improve the stability of EMD-based formulations such as Emdogain™ through the incorporation of arginine, a well-known protein stabilizer, but one that to our knowledge has not so far been considered for this purpose. Representative EMD-buffer solutions with and without arginine were analyzed by 3D-dynamic light scattering, UV-Vis spectroscopy, transmission electron microscopy and Fourier transform infrared spectroscopy at different acidic pH and temperatures, T, in order to simulate the effect of pH variations and thermal stress during manufacture and storage. The results provided evidence that arginine may indeed stabilize EMD against irreversible aggregation with respect to variations in pH and T under these conditions. Moreover, stopped-flow transmittance measurements indicated arginine addition not to suppress precipitation of EMD from either the buffers or the PGA gel carrier when the pH was raised to 7, a fundamental requirement for dental applications.

  9. Evaluation of a simple protein extraction method for species identification of clinically relevant staphylococci by matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    Science.gov (United States)

    Matsuda, Naoto; Matsuda, Mari; Notake, Shigeyuki; Yokokawa, Hirohide; Kawamura, Yoshiaki; Hiramatsu, Keiichi; Kikuchi, Ken

    2012-12-01

    In clinical microbiology, bacterial identification is labor-intensive and time-consuming. A solution for this problem is the use of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). In this study, we evaluated a modified protein extraction method of identification performed on target plates (on-plate extraction method) with MALDI-TOF (Bruker Microflex LT with Biotyper version 3.0) and compared it to 2 previously described methods: the direct colony method and a standard protein extraction method (standard extraction method). We evaluated the species of 273 clinical strains and 14 reference strains of staphylococci. All isolates were characterized using the superoxide dismutase A sequence as a reference. For the species identification, the on-plate, standard extraction, and direct colony methods identified 257 isolates (89.5%), 232 isolates (80.8%), and 173 isolates (60.2%), respectively, with statistically significant differences among the three methods (P extraction method is at least as good as standard extraction in identification rate and has the advantage of a shorter processing time.

  10. Detecting early kidney damage in horses with colic by measuring matrix metalloproteinase -9 and -2, other enzymes, urinary glucose and total proteins

    Directory of Open Access Journals (Sweden)

    Salonen Hanna

    2007-01-01

    Full Text Available Abstract Background The aim of the study was to investigate urine matrix metalloproteinase (MMP-2 and -9 activity, alkaline phosphatase/creatinine (U-AP/Cr and gamma-glutamyl-transpeptidase/creatinine (U-GGT/Cr ratios, glucose concentration, and urine protein/creatinine (U-Prot/Cr ratio and to compare data with plasma MMP-2 and -9 activity, cystatin-C and creatinine concentrations in colic horses and healthy controls. Horses with surgical colic (n = 5 were compared to healthy stallions (n = 7 that came for castration. Blood and urine samples were collected. MMP gelatinolytic activity was measured by zymography. Results We found out that horses with colic had significantly higher urinary MMP-9 complex and proMMP-9 activities than horses in the control group. Colic horses also had higher plasma MMP-2 activity than the control horses. Serum creatinine, although within reference range, was significantly higher in the colic horses than in the control group. There was no significant increase in urinary alkaline phosphatase, gamma-glutamyltranspeptidase or total proteins in the colic horses compared to the control group. A human cystatin-C test (Dako Cytomation latex immunoassay® based on turbidimetry did not cross react with equine cystatin-C. Conclusion The results indicate that plasma MMP-2 may play a role in the pathogenesis of equine colic and urinary MMP-9 in equine kidney damage.

  11. The Influence of Arginine on the Response of Enamel Matrix Derivative (EMD) Proteins to Thermal Stress: Towards Improving the Stability of EMD-Based Products

    Science.gov (United States)

    Bolisetty, Sreenath; Marascio, Matteo; Gemperli Graf, Anja; Garamszegi, Laszlo; Mezzenga, Raffaele; Fischer, Peter; Månson, Jan-Anders

    2015-01-01

    In a current procedure for periodontal tissue regeneration, enamel matrix derivative (EMD), which is the active component, is mixed with a propylene glycol alginate (PGA) gel carrier and applied directly to the periodontal defect. Exposure of EMD to physiological conditions then causes it to precipitate. However, environmental changes during manufacture and storage may result in modifications to the conformation of the EMD proteins, and eventually premature phase separation of the gel and a loss in therapeutic effectiveness. The present work relates to efforts to improve the stability of EMD-based formulations such as Emdogain™ through the incorporation of arginine, a well-known protein stabilizer, but one that to our knowledge has not so far been considered for this purpose. Representative EMD-buffer solutions with and without arginine were analyzed by 3D-dynamic light scattering, UV-Vis spectroscopy, transmission electron microscopy and Fourier transform infrared spectroscopy at different acidic pH and temperatures, T, in order to simulate the effect of pH variations and thermal stress during manufacture and storage. The results provided evidence that arginine may indeed stabilize EMD against irreversible aggregation with respect to variations in pH and T under these conditions. Moreover, stopped-flow transmittance measurements indicated arginine addition not to suppress precipitation of EMD from either the buffers or the PGA gel carrier when the pH was raised to 7, a fundamental requirement for dental applications. PMID:26670810

  12. Buddleja officinalis suppresses high glucose-induced vascular smooth muscle cell proliferation: role of mitogen-activated protein kinases, nuclear factor-kappaB and matrix metalloproteinases.

    Science.gov (United States)

    Lee, Yun Jung; Kim, Jin Sook; Kang, Dae Gill; Lee, Ho Sub

    2010-02-01

    Diabetes mellitus is a well-established risk factor for vascular diseases caused by atherosclerosis. In the development of diabetic atherogenesis, vascular smooth muscle cell proliferation is recognized as a key event. Thus, we aimed to investigate whether an ethanol extract of Buddleja officinalis (EBO) suppresses high glucose-induced proliferation in primary cultured human aortic smooth muscle cells (HASMC). [(3)H]-thymidine incorporation revealed that incubation of HASMC with a high concentration of glucose (25 mmol/L) increased cell proliferation. The expression levels of cell cycle protein were also increased by treatment with high glucose concentration. Pretreatment of HASMC with EBO significantly attenuated the increase of high glucose-induced cell proliferation as well as p38 mitogen-activated protein kinases (MAPK) and JNK phosphorylation. EBO suppressed high glucose-induced matrix metalloproteinase (MMP)-9 activity in a dose-dependent manner. In addition, EBO suppressed nuclear factor-kappaB (NF-kappaB) nuclear translocation and transcriptional activity in high glucose conditions. Taken together, the present data suggest that EBO could suppress high glucose-induced atherosclerotic processes through inhibition of p38, JNK, NF-kappaB and MMP signal pathways in HASMC.

  13. The glycoprotein and the matrix protein of rabies virus affect pathogenicity by regulating viral replication and facilitating cell-to-cell spread.

    Science.gov (United States)

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J; Dietzschold, Bernhard

    2008-03-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant increase in the pathogenicity of the SN strain bearing the RV G from the pathogenic SB strain. Moreover, the pathogenicity was further increased when both G and M from SB were introduced into SN. Interestingly, the replacement of the G or M gene or both in SN by the corresponding genes of SB was associated with a significant decrease in the rate of viral replication and viral RNA synthesis. In addition, a chimeric SN virus bearing both the M and G genes from SB exhibited more efficient cell-to-cell spread than a chimeric SN virus in which only the G gene was replaced. Together, these data indicate that both G and M play an important role in RV pathogenesis by regulating virus replication and facilitating cell-to-cell spread.

  14. The Glycoprotein and the Matrix Protein of Rabies Virus Affect Pathogenicity by Regulating Viral Replication and Facilitating Cell-to-Cell Spread▿

    Science.gov (United States)

    Pulmanausahakul, Rojjanaporn; Li, Jianwei; Schnell, Matthias J.; Dietzschold, Bernhard

    2008-01-01

    While the glycoprotein (G) of rabies virus (RV) is known to play a predominant role in the pathogenesis of rabies, the function of the RV matrix protein (M) in RV pathogenicity is not completely clear. To further investigate the roles of these proteins in viral pathogenicity, we constructed chimeric recombinant viruses by exchanging the G and M genes of the attenuated SN strain with those of the highly pathogenic SB strain. Infection of mice with these chimeric viruses revealed a significant increase in the pathogenicity of the SN strain bearing the RV G from the pathogenic SB strain. Moreover, the pathogenicity was further increased when both G and M from SB were introduced into SN. Interestingly, the replacement of the G or M gene or both in SN by the corresponding genes of SB was associated with a significant decrease in the rate of viral replication and viral RNA synthesis. In addition, a chimeric SN virus bearing both the M and G genes from SB exhibited more efficient cell-to-cell spread than a chimeric SN virus in which only the G gene was replaced. Together, these data indicate that both G and M play an important role in RV pathogenesis by regulating virus replication and facilitating cell-to-cell spread. PMID:18094173

  15. Microfibril-associated Protein 4 Binds to Surfactant Protein A (SP-A) and Colocalizes with SP-A in the Extracellular Matrix of the Lung

    DEFF Research Database (Denmark)

    Schlosser, Anders; Thomsen, Theresa H.; Shipley, J. Michael

    2006-01-01

    Pulmonary surfactant protein A (SP-A) is an oligomeric collectin that recognizes lipid and carbohydrate moieties present on broad range of micro-organisms, and mediates microbial lysis and clearance. SP-A also modulates multiple immune-related functions including cytokine production and chemotaxis......-A composed of the neck region and carbohydrate recognition domain of SP-A indicating that the interaction between MFAP4 and SP-A is mediated via the collagen domain of SP-A. Monoclonal antibodies directed against MFAP4 and SP-A were used for immunohistochemical analysis, which demonstrates that the two...

  16. Sustainable protein from biogas. The perspective of susteine; Duurzaam eiwit uit biogas. Verkenning van het perspectief van susteine

    Energy Technology Data Exchange (ETDEWEB)

    Oosterhuis, N. [Easthouse Business Solutions, Rolde (Netherlands); Hooijer, H. [We-Do Interim Management and Consultancy, Culemborg (Netherlands)

    2007-12-15

    Production of single-cell protein (Susteine) on the basis of biogas (methane) from manure digestion might be an interesting option to reduce the amounts of manure from cattle, pigs and poultry and also might be an option for a sustainable production of high-value protein. An earlier made investigation leaded to the conclusion that many questions had to be answered to make a better picture of this opportunity for the Dutch agricultural society. In this study we investigated the feasibility of such a process and product. It is concluded that the product will be accepted in the market as long as the HACCP-requirements which are applicable in the feed production are fulfilled. The product as such, assuming that the quality is comparable to the product as was produced by Norferm, could get an attractive position especially in the application for piglets. A quantity of 10.000 t/y could easily be sold in this market segment. Of course the product first has to be registered, which needs additional studies. Technically we foresee no major hurdles in the production of Susteine on basis of methane from biogas. The biogas has to be purified to such a quality that SCP-production is feasible, however, technologies are available. It needs a further investigation to establish the quality requirements for such a process. The scale of operation of the biogas installation creates a financial-economic problem. In order to produce 10.000 t protein / year, a quantity of 30-35 million m{sup 3} of biogas is needed, for which 2 million ton of manure has to be digested. In case a centralized production of gas and protein is foreseen, the number of transport movements will be unacceptable. Besides the quantity of manure to be transported also approximately the same amount of digested material has to be transported. A unique opportunity in The Netherlands is the presence of a pipe network for natural gas. Such a network could serve as a transport system of locally produced, purified, biogas

  17. Presence of Insulin-Like Growth Factor Binding Proteins Correlates With Tumor-Promoting Effects of Matrix Metalloproteinase 9 in Breast Cancer

    Directory of Open Access Journals (Sweden)

    Jae-Hyun Park

    2015-05-01

    Full Text Available The stroma of breast cancer can promote the disease’s progression, but whether its composition and functions are shared among different subtypes is poorly explored. We compared stromal components of a luminal [mouse mammary tumor virus (MMTV–Neu] and a triple-negative/basal-like [C3(1–Simian virus 40 large T antigen (Tag] genetically engineered breast cancer mouse model. The types of cytokines and their expression levels were very different in the two models, as was the extent of innate immune cell infiltration; however, both models showed infiltration of innate immune cells that expressed matrix metalloproteinase 9 (MMP9, an extracellular protease linked to the progression of many types of cancer. By intercrossing with Mmp9 null mice, we found that the absence of MMP9 delayed tumor onset in the C3(1-Tag model but had no effect on tumor onset in the MMTV-Neu model. We discovered that protein levels of insulin-like growth factor binding protein-1 (IGFBP-1, an MMP9 substrate, were increased in C3(1-Tag;Mmp9−/− compared to C3(1-Tag;Mmp9+/+ tumors. In contrast, IGFBP-1 protein expression was low in MMTV-Neu tumors regardless of Mmp9 status. IGFBP-1 binds and antagonizes IGFs, preventing them from activating their receptors to promote cell proliferation and survival. Tumors from C3(1-Tag;Mmp9−/− mice had reduced IGF-1 receptor phosphorylation, consistent with slower tumor onset. Finally, gene expression analysis of human breast tumors showed that high expression of IGFBP mRNA was strongly correlated with good prognosis but not when MMP9 mRNA was also highly expressed. In conclusion, MMP9 has different effects on breast cancer progression depending on whether IGFBPs are expressed.

  18. Association of matrix metalloproteinase (MMP-1, MMP-3 and MMP-9) and cyclooxygenase-2 gene polymorphisms and their proteins with chronic periodontitis.

    Science.gov (United States)

    Loo, Wings T Y; Wang, Min; Jin, L J; Cheung, Mary N B; Li, G R

    2011-10-01

    The objective of this study was to investigate the association amongst the single nucleotide polymorphisms of genes encoding for matrix metalloproteinase (MMP) 1, 3, 9 and cyclooxygenase-2 (COX-2) of subjects. Protein production of MMPs, COX-2 and Vascular Endothelial Growth Factor (VEGF) were also investigated. 280 chronic periodontitis patients and 250 periodontitis-free subjects were selected. DNA was extracted from blood samples of all patients, the polymorphic sites of the genes that encode for metalloproteinases and cyclooxygenase-2 were amplified using PCR, and digested with restriction enzymes. ELISA was used to determine the protein production of MMPs, COX-2 and VEGF. The mean probing depth (PD) was 5.4mm and the clinical attachment loss (CAL) was 6.4mm in patients group with at least 2 years history. 2G/2G genotype of MMP-1, the periodontitis patients presented frequency of 28% and the control only showed 3%. 5A/5A genotype of MMP-3, the periodontitis patients presented higher frequency of 55% than the control 40%. C/C of genotype MMP-9, the periodontitis patients presented higher frequency of 51% than the control 17%. C/C of genotype COX-2, the periodontitis patients demonstrated 28% frequency and the control was 3%. ELISA analysis determined a significant difference (p<0.001) in protein production between patient and control samples for the bio-markers. 12 cases with suspicious genotype of MMPs and in COX-2 showed the serum level was the highest value between other C/C genotype. Combine genotype and serum expression of inflammatory mediators that may be a good bio-marker for diagnosis and prognosis of the periodontitis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Amelogenin, an extracellular matrix protein, in the treatment of venous leg ulcers and other hard-to-heal wounds: Experimental and clinical evidence  ||FREE PAPER||

    Directory of Open Access Journals (Sweden)

    Marco Romanelli

    2008-06-01

    Full Text Available Marco Romanelli1, Valentina Dini1, Peter Vowden2, Magnus S Ågren31Department of Dermatology, University of Pisa, Pisa, Italy; 2Vascular Unit, Bradford Royal Infirmary, Bradford, United Kingdom; 3Department of Surgery K, Bispebjerg Hospitals, Copenhagen University Hospital, Copenhagen, DenmarkAbstract: Amelogenins are extracellular matrix proteins that, under physiological conditions, self-assemble into globular aggregates up to micron-sizes. Studies with periodontal fibroblasts indicate that attachment to these structures increases the endogenous secretion of multiple growth factors and cell proliferation. Pre-clinical and clinical studies indicate that cutaneous wounds benefit from treatment with amelogenins. A randomized controlled trial (RCT involving patients with hard-to-heal venous leg ulcers (VLUs (ie, ulcers with a surface area ≥10 cm2 and duration of ≥6 months showed that the application of amelogenin (Xelma®, Molnlycke Health Care, Gothenburg, Sweden as an adjunct treatment to compression results in significant reduction in ulcer size, improvement in the state of ulcers, reduced pain, and a larger proportion of ulcers with low levels of exudate, compared with treatment with compression alone. Amelogenin therapy was also shown to be safe to use in that there were no significant differences in adverse events noted between patients treated with amelogenin plus compression and those treated with compression alone. Case study evaluations indicate that the benefits of amelogenin therapy demonstrated in the RCT are being repeated in “real life” situations and that amelogenin therapy may also have a role to play in the treatment of other wound types such as diabetic foot ulcers.Keywords: extracellular matrix, amelogenin, venous leg ulcers, diabetic foot ulcers, pyoderma gangrenosum

  20. Facile and green synthesis of CdSe quantum dots in protein matrix: tuning of morphology and optical properties.

    Science.gov (United States)

    Ahmed, M; Guleria, A; Rath, M C; Singh, A K; Adhikari, S; Sarkar, S K

    2014-08-01

    Herein, we have demonstrated a facile and green approach for the synthesis of Cadmium selenide (CdSe) quantum dots (QDs). The process was mediated by bovine serum albumin (BSA) and it was found that BSA plays the dual role of reducing agent as well as a stabilizing agent. The QDs exhibited sharp excitonic absorption features at ~500 nm and subsequently showed reasonably good photoluminescence (PL) at room temperature. The PL is seen to be strongly dependent on the concentration of the precursors and hence, the luminescence of these QDs could be conveniently tuned across the visible spectrum simply by varying molar ratio of the precursors. It can be envisaged from the fact that a red-shift of about 100 nm in the PL peak position was observed when the molar ratio of the precursors ([Cd2+]:[Se2-], in mM) was varied from 10:5 to 10:40. Subsequently, the charge carrier relaxation dynamics associated with the different molar ratio of precursors has been investigated and very interesting information regarding the energy level structures of these QDs were revealed. Most importantly, in conjunction with the optical tuning, the nanomorphology of these nanoparticles was found to vary with the change in molar ratios of Se and Cd precursors. This aspect can provide a new direction of controlling the shape of CdSe nanoparticles. The possible mechanism of the formation as well as for the shape variation of these nanoparticles with the molar ratios of precursors has been proposed, taking into account the role of amino acid residues (present in BSA). Moreover, the QDs were water soluble and possessed fairly good colloidal stability therefore, can have potential applications in catalysis and bio-labeling. On the whole, the present methodology of protein assisted synthesis is relatively new especially for semiconducting nanomaterials and may provide some unique and interesting aspects to control and fine tune the morphology vis-à-vis, their optical properties.

  1. The Diagnostic Utility of Anti-cyclic Citrullinated Peptide Antibodies, Matrix Metalloproteinase-3, Rheumatoid Factor, Erythrocyte Sedimentation Rate, and C-reactive Protein in Patients with Erosive and Non-erosive Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    O. Shovman

    2005-01-01

    Full Text Available Objective: To compare the diagnostic utility of laboratory variables, including matrix metalloproteinase-3 (MMP-3, anti-cyclic citrullinated peptide (CCP antibodies, rheumatoid factor (RF, erythrocyte sedimentation rate (ESR, and C-reactive protein (CRP in patients with erosive and non-erosive rheumatoid arthritis (RA.

  2. Interleukin-1beta-induced release of matrix proteins into culture media causes inhibition of mineralization of nodules formed by periodontal ligament cells in vitro.

    Science.gov (United States)

    Chien, H H; Lin, W L; Cho, M I

    1999-05-01

    The mechanism by which interleukin-1beta (IL-1) inhibits the formation of mineralized tissue nodules by periodontal ligament (PDL) cells in vitro was investigated through the processes of morphological analysis, immunoprecipitation, and Northern blot analysis. PDL cells were obtained from a 2-day-old coagulum in tooth socket and cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bone serum (FBS) and antibiotics. Confluent cells were grown for up to 3 weeks in the presence of ascorbic acid (AA), beta-glycerophosphate (GP), and dexamethasone (Dex), or IL-1. PDL cells cultured in the presence of GP and AA did not differentiate, but those treated with Dex, GP, and AA (Dex group) underwent differentiation, showing four stages (confluent, multilayer, nodule, and mineralization) of disparate morphological characteristics. In contrast, the cells treated with IL-1, Dex, GP, and AA (IL-1 group) did form multilayers but failed to form mineralized nodules. Electron microscopy demonstrated that the Dex-induced mineralized nodules contain multilayers of fibroblastic cells, numerous collagen fibrils, and dense globular as well as fused electron dense patches that are associated with numerous apatite crystals. The nodule-like structures in the IL-1 group were also comprised of multilayered fibroblastic cells, but they contained only a small number of collagen fibrils, and no dense globular or fused patches. Von Kossa staining confirmed the presence of numerous mineralized nodules in the Dex group and their scarceness in the IL-1 group. Northern blot analysis of IL-1-treated cells, however, revealed the presence of mRNAs for type I collagen (Col I), secreted protein, acidic and rich in cysteine (SPARC), osteopontin (OPN), alkaline phosphatase (ALP), bone sialoprotein (BSP), and osteocalcin (OC), whose expression patterns and levels were comparable to those of the Dex group. Immunoprecipitation analysis of OPN and BSP in the cell/matrix layers and the culture

  3. The nuclear export protein of H5N1 influenza A viruses recruits Matrix 1 (M1) protein to the viral ribonucleoprotein to mediate nuclear export.

    Science.gov (United States)

    Brunotte, Linda; Flies, Joe; Bolte, Hardin; Reuther, Peter; Vreede, Frank; Schwemmle, Martin

    2014-07-18

    In influenza A virus-infected cells, replication and transcription of the viral genome occurs in the nucleus. To be packaged into viral particles at the plasma membrane, encapsidated viral genomes must be exported from the nucleus. Intriguingly, the nuclear export protein (NEP) is involved in both processes. Although NEP stimulates viral RNA synthesis by binding to the viral polymerase, its function during nuclear export implicates interaction with viral ribonucleoprotein (vRNP)-associated M1. The observation that both interactions are mediated by the C-terminal moiety of NEP raised the question whether these two features of NEP are linked functionally. Here we provide evidence that the interaction between M1 and the vRNP depends on the NEP C terminus and its polymerase activity-enhancing property for the nuclear export of vRNPs. This suggests that these features of NEP are linked functionally. Furthermore, our data suggest that the N-terminal domain of NEP interferes with the stability of the vRNP-M1-NEP nuclear export complex, probably mediated by its highly flexible intramolecular interaction with the NEP C terminus. On the basis of our data, we propose a new model for the assembly of the nuclear export complex of Influenza A vRNPs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Activation of phagocytic cells by Staphylococcus epidermidis biofilms: effects of extracellular matrix proteins and the bacterial stress protein GroEL on netosis and MRP-14 release.

    Science.gov (United States)

    Dapunt, Ulrike; Gaida, Matthias M; Meyle, Eva; Prior, Birgit; Hänsch, Gertrud M

    2016-07-01

    The recognition and phagocytosis of free-swimming (planktonic) bacteria by polymorphonuclear neutrophils have been investigated in depth. However, less is known about the neutrophil response towards bacterial biofilms. Our previous work demonstrated that neutrophils recognize activating entities within the extracellular polymeric substance (EPS) of biofilms (the bacterial heat shock protein GroEL) and that this process does not require opsonization. Aim of this study was to evaluate the release of DNA by neutrophils in response to biofilms, as well as the release of the inflammatory cytokine MRP-14. Neutrophils were stimulated with Staphylococcus epidermidis biofilms, planktonic bacteria, extracted EPS and GroEL. Release of DNA and of MRP-14 was evaluated. Furthermore, tissue samples from patients suffering from biofilm infections were collected and evaluated by histology. MRP-14 concentration in blood samples was measured. We were able to show that biofilms, the EPS and GroEL induce DNA release. MRP-14 was only released after stimulation with EPS, not GroEL. Histology of tissue samples revealed MRP-14 positive cells in association with neutrophil infiltration and MRP-14 concentration was elevated in blood samples of patients suffering from biofilm infections. Our data demonstrate that neutrophil-activating entities are present in the EPS and that GroEL induces DNA release by neutrophils. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Matrix calculus

    CERN Document Server

    Bodewig, E

    1959-01-01

    Matrix Calculus, Second Revised and Enlarged Edition focuses on systematic calculation with the building blocks of a matrix and rows and columns, shunning the use of individual elements. The publication first offers information on vectors, matrices, further applications, measures of the magnitude of a matrix, and forms. The text then examines eigenvalues and exact solutions, including the characteristic equation, eigenrows, extremum properties of the eigenvalues, bounds for the eigenvalues, elementary divisors, and bounds for the determinant. The text ponders on approximate solutions, as well

  6. Genome-wide identification of chromatin-enriched RNA reveals that unspliced dentin matrix protein-1 mRNA regulates cell proliferation in squamous cell carcinoma.

    Science.gov (United States)

    Suzuki, Shigeki; Hoshino, Hiroaki; Yoshida, Kazuma; Nakanishi, Jun; Tsuchiya-Hirata, Shizu; Kobuke, Seiji; Haruyama, Naoto; Nishimura, Fusanori; Shiba, Hideki

    2018-01-15

    Chromatin-enriched noncoding RNAs (ncRNAs) have emerged as key molecules in epigenetic processes by interacting with chromatin-associated proteins. Recently, protein-coding mRNA genes have been reported to be chromatin-tethered, similar with ncRNA. However, very little is known about whether chromatin-enriched mRNA is involved in the chromatin modification process. Here, we comprehensively examined chromatin-enriched RNA in squamous cell carcinoma (SQCC) cells by RNA subcellular localization analysis, which was a combination of RNA fractionation and RNA-seq. We identified 11 mRNAs as highly chromatin-enriched RNAs. Among these, we focused on the dentin matrix protein-1 (DMP-1) gene because its expression in SQCC cells has not been reported. Furthermore, we clarified that DMP-1 mRNA was retained in chromatin in its unspliced form in SQCC in vitro and in vivo. As the inhibition of the unspliced DMP-1 mRNA (unspDMP-1) expression resulted in decreased cellular proliferation in SQCC cells, we performed ChIP-qPCR to identify cell cycle-related genes whose expression was epigenetically modified by unspDMP-1, and found that the CDKN1B promoter became active in SQCC cells by inhibiting unspDMP-1 expression. This result was further validated by the increased CDKN1B gene expression in the cells treated with siRNA for unspDMP-1 and by restoration of the decreased cellular proliferation rate by simultaneously inhibiting CDKN1B expression in SQCC cells. Further, to examine whether unspDMP-1 was able to associate with the CDKN1B promoter region, SQCC cells stably expressing PP7-mCherry fusion protein were transiently transfected with the unspDMP-1 fused to 24 repeats of the PP7 RNA stem loop (unspDMP-1-24xPP7) and we found that unspDMP-1-24xPP7 was efficiently precipitated with the antibody against mCherry and was significantly enriched in the CDKN1B promoter region. Thus, unspDMP-1 is a novel chromatin-enriched RNA that epigenetically regulates cellular proliferation of SQCC

  7. Matrix superpotentials

    Science.gov (United States)

    Nikitin, Anatoly G.; Karadzhov, Yuri

    2011-07-01

    We present a collection of matrix-valued shape invariant potentials which give rise to new exactly solvable problems of SUSY quantum mechanics. It includes all irreducible matrix superpotentials of the generic form W=kQ+\\frac{1}{k} R+P, where k is a variable parameter, Q is the unit matrix multiplied by a real-valued function of independent variable x, and P and R are the Hermitian matrices depending on x. In particular, we recover the Pron'ko-Stroganov 'matrix Coulomb potential' and all known scalar shape invariant potentials of SUSY quantum mechanics. In addition, five new shape invariant potentials are presented. Three of them admit a dual shape invariance, i.e. the related Hamiltonians can be factorized using two non-equivalent superpotentials. We find discrete spectrum and eigenvectors for the corresponding Schrödinger equations and prove that these eigenvectors are normalizable.

  8. Cultured Pearl Surface Quality Profiling by the Shell Matrix Protein Gene Expression in the Biomineralised Pearl Sac Tissue of Pinctada margaritifera.

    Science.gov (United States)

    Blay, Carole; Planes, Serge; Ky, Chin-Long

    2018-04-16

    Nucleated pearls are produced by molluscs of the Pinctada genus through the biomineralisation activity of the pearl sac tissue within the recipient oyster. The pearl sac originates from graft tissue taken from the donor oyster mantle and its functioning is crucial in determining key factors that impact pearl quality surface characteristics. The specific role of related gene regulation during gem biogenesis was unknown, so we analysed the expression profiles of eight genes encoding nacreous (PIF, MSI60, PERL1) or prismatic (SHEM5, PRISM, ASP, SHEM9) shell matrix proteins or both (CALC1) in the pearl sac (N = 211) of Pinctada margaritifera during pearl biogenesis. The pearls and pearl sacs analysed were from a uniform experimental graft with sequential harvests at 3, 6 and 9 months post-grafting. Quality traits of the corresponding pearls were recorded: surface defects, surface deposits and overall quality grade. Results showed that (1) the first 3 months of culture seem crucial for pearl quality surface determination and (2) all the genes (SHEM5, PRISM, ASP, SHEM9) encoding proteins related to calcite layer formation were over-expressed in the pearl sacs that produced low pearl surface quality. Multivariate regression tree building clearly identified three genes implicated in pearl surface quality, SHEM9, ASP and PIF. SHEM9 and ASP were clearly implicated in low pearl quality, whereas PIF was implicated in high quality. Results could be used as biomarkers for genetic improvement of P. margaritifera pearl quality and constitute a novel perspective to understanding the molecular mechanism of pearl formation.

  9. Matrix-Gla Protein rs4236 [A/G] gene polymorphism and serum and GCF levels of MGP in patients with subgingival dental calculus.

    Science.gov (United States)

    Doğan, Gülnihal Emrem; Demir, Turgut; Aksoy, Hülya; Sağlam, Ebru; Laloğlu, Esra; Yildirim, Abdulkadir

    2016-10-01

    Matrix-Gla Protein (MGP) is one of the major Gla-containing protein associated with calcification process. It also has a high affinity for Ca 2+ and hydroxyapatite. In this study we aimed to evaluate the MGP rs4236 [A/G] gene polymorphism in association with subgingival dental calculus. Also a possible relationship between MGP gene polymorphism and serum and GCF levels of MGP were examined. MGP rs4236 [A/G] gene polymorphism was investigated in 110 patients with or without subgingival dental calculus, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. Additionally, serum and GCF levels of MGP of the patients were compared according to subgingival dental calculus. Comparison of patients with and without subgingival dental calculus showed no statistically significant difference in MGP rs4236 [A/G] gene polymorphism (p=0.368). MGP concentrations in GCF of patients with subgingival dental calculus were statistically higher than those without subgingival dental calculus (p=0.032). However, a significant association was not observed between the genotypes of AA, AG and GG of the MGP rs4236 gene and the serum and GCF concentrations of MGP in subjects. In this study, it was found that MGP rs4236 [A/G] gene polymorphism was not to be associated with subgingival dental calculus. Also, that GCF MGP levels were detected higher in patients with subgingival dental calculus than those without subgingival dental calculus independently of polymorphism, may be the effect of adaptive mechanism to inhibit calculus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Serum Matrix Metalloproteinase-3 in Comparison with Acute Phase Proteins as a Marker of Disease Activity and Radiographic Damage in Early Rheumatoid Arthritis

    Science.gov (United States)

    Ally, Mahmood M. T. M.; Hodkinson, Bridget; Meyer, Pieter W. A.; Musenge, Eustasius; Tikly, Mohammed; Anderson, Ronald

    2013-01-01

    Matrix metalloproteinase-3 (MMP-3) is involved in the immunopathogenesis of rheumatoid arthritis (RA), but little is known about its relationship to genetic susceptibility and biomarkers of disease activity, especially acute phase reactants in early RA. MMP-3 was measured by ELISA in serum samples of 128 disease-modifying, drug-naïve patients and analysed in relation to shared epitope genotype, a range of circulating chemokines/cytokines, acute phase reactants, autoantibodies, cartilage oligomeric protein (COMP), and the simplified disease activity index (SDAI). MMP-3 was elevated >1.86 ng/ml in 56.25% of patients (P < 0.0001), correlated with several biomarkers, notably IL-8, IL-6, IFN γ, VEGF and COMP (r values = 0.22–0.33, P < 0.014–0.0001) and with CRP and SAA levels (r = 0.40 and 0.41, resp., P < 0.0000) and SDAI (r = 0.29, P < 0.0001), but not with erosions or nodulosis. However, the correlations of CRP and SAA with SDAI were stronger (respective values of 0.63 and 0.54, P < 0.001 for both). COMP correlated with smoking, RF, and MMP-3. MMP-3 is significantly associated with disease activity, inflammatory mediators and cartilage breakdown, making it a potential biomarker of disease severity, but seemingly less useful than CRP and SAA as a biomarker of disease activity in early RA. PMID:23690656

  11. Serum Matrix Metalloproteinase-3 in Comparison with Acute Phase Proteins as a Marker of Disease Activity and Radiographic Damage in Early Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Mahmood M. T. M. Ally

    2013-01-01

    Full Text Available Matrix metalloproteinase-3 (MMP-3 is involved in the immunopathogenesis of rheumatoid arthritis (RA, but little is known about its relationship to genetic susceptibility and biomarkers of disease activity, especially acute phase reactants in early RA. MMP-3 was measured by ELISA in serum samples of 128 disease-modifying, drug-naïve patients and analysed in relation to shared epitope genotype, a range of circulating chemokines/cytokines, acute phase reactants, autoantibodies, cartilage oligomeric protein (COMP, and the simplified disease activity index (SDAI. MMP-3 was elevated >1.86 ng/ml in 56.25% of patients (P<0.0001, correlated with several biomarkers, notably IL-8, IL-6, IFN γ, VEGF and COMP (r values = 0.22–0.33, P<0.014–0.0001 and with CRP and SAA levels (r=0.40 and 0.41, resp., P<0.0000 and SDAI (r=0.29, P<0.0001, but not with erosions or nodulosis. However, the correlations of CRP and SAA with SDAI were stronger (respective values of 0.63 and 0.54, P<0.001 for both. COMP correlated with smoking, RF, and MMP-3. MMP-3 is significantly associated with disease activity, inflammatory mediators and cartilage breakdown, making it a potential biomarker of disease severity, but seemingly less useful than CRP and SAA as a biomarker of disease activity in early RA.

  12. MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins.

    Science.gov (United States)

    Sengupta, Srikumar; den Boon, Johan A; Chen, I-How; Newton, Michael A; Stanhope, Stephen A; Cheng, Yu-Juen; Chen, Chien-Jen; Hildesheim, Allan; Sugden, Bill; Ahlquist, Paul

    2008-04-15

    Using highly sensitive microarray-based procedures, we identified eight microRNAs (miRNAs) showing robust differential expression between 31 laser-capture-microdissected nasopharyngeal carcinomas (NPCs) and 10 normal healthy nasopharyngeal epithelial samples. In particular, miRNA mir-29c was expressed at one-fifth the levels in tumors as in normal epithelium. In NPC tumors, the lower mir-29c levels correlated with higher levels of multiple mRNAs whose 3' UTRs can bind mir-29c at target sequences conserved across many vertebrates. In cultured cells, introduction of mir-29c down-regulated these genes at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3' UTRs of these genes. Moreover, for each of several genes tested, mutating the mir-29c target sites in the 3' UTR abrogated mir-29c-induced inhibition of luciferase expression. Most of the mir-29c-targeted genes identified encode extracellular matrix proteins, including multiple collagens and laminin gamma1, that are associated with tumor cell invasiveness and metastatic potential, prominent characteristics of NPC. Thus, we identify eight miRNAs differentially expressed in NPC and demonstrate the involvement of one in regulating genes involved in metastasis.

  13. Caffeic Acid Phenethyl Ester Inhibits Oral Cancer Cell Metastasis by Regulating Matrix Metalloproteinase-2 and the Mitogen-Activated Protein Kinase Pathway

    Directory of Open Access Journals (Sweden)

    Chih-Yu Peng

    2012-01-01

    Full Text Available Caffeic acid phenethyl ester (CAPE, an active component extracted from honeybee hives, exhibits anti-inflammatory and anticancer activities. However, the molecular mechanism by which CAPE affects oral cancer cell metastasis has yet to be elucidated. In this study, we investigated the potential mechanisms underlying the effects of CAPE on the invasive ability of SCC-9 oral cancer cells. Results showed that CAPE attenuated SCC-9 cell migration and invasion at noncytotoxic concentrations (0 μM to 40 μM. Western blot and gelatin zymography analysis findings further indicated that CAPE downregulated matrix metalloproteinase-2 (MMP-2 protein expression and inhibited its enzymatic activity. CAPE exerted its inhibitory effects on MMP-2 expression and activity by upregulating tissue inhibitor of metalloproteinase-2 (TIMP-2 and potently decreased migration by reducing focal adhesion kinase (FAK phosphorylation and the activation of its downstream signaling molecules p38/MAPK and JNK. These data indicate that CAPE could potentially be used as a chemoagent to prevent oral cancer metastasis.

  14. The Expression of Bone Morphogenetic Protein 2 and Matrix Metalloproteinase 2 through Retinoic Acid Receptor Beta Induced by All-Trans Retinoic Acid in Cultured ARPE-19 Cells.

    Directory of Open Access Journals (Sweden)

    Zhenya Gao

    Full Text Available All-trans retinoic acid (ATRA plays an important role in ocular development. Previous studies found that retinoic acid could influence the metabolism of scleral remodeling by promoting retinal pigment epithelium (RPE cells to secrete secondary signaling factors. The purpose of this study was to investigate whether retinoic acid affected secretion of bone morphogenetic protein 2 (BMP-2 and matrix metalloproteinase 2 (MMP-2 and to explore the signaling pathway of retinoic acid in cultured acute retinal pigment epithelial 19 (ARPE-19 cells.The effects of ATRA (concentrations from 10-9 to 10-5 mol/l on the expression of retinoic acid receptors (RARs in ARPE-19 cells were examined at the mRNA and protein levels using reverse transcription-polymerase chain reaction (RT-PCR and western blot assay, respectively. The effects of treating ARPE-19 cells with ATRA concentrations ranging from 10-9 to 10-5 mol/l for 24 h and 48 h or with 10-6mol/l ATRA at different times ranging from 6h to 72h were assessed using real-time quantitative PCR (qPCR and enzyme-linked immunosorbent assay (ELISA. The contribution of RARβ-induced activation of ARPE-19 cells was confirmed using LE135, an antagonist of RARβ.RARβ mRNA levels significantly increased in the ARPE-19 cells treated with ATRA for 24h and 48h. These increases in RARβ mRNA levels were dose dependent (at concentrations of 10-9 to 10-5 mol/l with a maximum effect observed at 10-6 mol/l. There were no significant changes in the mRNA levels of RARα and RARγ. Western blot assay revealed that RARβ protein levels were increased significantly in a time-dependent manner in ARPE-19 cells treated with 10-6 mol/l ATRA from 12 h to 72 h, with a marked increase observed at 24 h and 48 h. The upregulation of RARβ and the ATRA-induced secretion in ARPE-19 cells could be inhibited by the RARβ antagonist LE135.ATRA induced upregulation of RARβ in ARPE-19 cells and stimulated these cells to secrete BMP-2 and MMP-2.

  15. Physiological and clinically attainable concentrations of 1,25-dihydroxyvitamin D3 suppress proliferation and extracellular matrix protein expression in mouse pancreatic stellate cells.

    Science.gov (United States)

    Bläuer, Merja; Sand, Juhani; Laukkarinen, Johanna

    2015-01-01

    Vitamin D is an antiproliferative and differentiation-promoting secosteroid hormone with pleiotropic homeostatic functions in bone and extraskeletal tissues. Signaling of vitamin D is mediated via its ubiquitously expressed nuclear receptor, the vitamin D receptor (VDR). Pancreatic stellate cells have recently been identified as targets of vitamin D action. Our aim was to elucidate the effectiveness of the most potent endogenous vitamin D metabolite, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] on the proliferation and extracellular matrix (ECM) protein expression in pancreatic stellate cells (PSCs) using concentrations of the compound from the physiological and clinically attainable range in humans. Culture-activated mouse PSCs were exposed to 1,25(OH)2D3 concentrations ranging from 0.1 nM to 10 nM for 7 days and subjected to colorimetric crystal violet assay for cell growth assessment and to Western blot and immunohistochemical analyses of VDR, fibronectin and collagen I using protein-specific antibodies. Immunohistochemical localization of VDR was performed on mouse pancreatic tissue and on a set of human specimens obtained at pancreatic surgery. A low basal level of VDR was detected in PSCs that was strongly induced in the presence of ligand. Cell growth was suppressed dose-dependently by 1,25(OH)2D3, the mean percentages of inhibition ranging from 24% at the physiological 0.1 nM concentration to around 60% at 10 nM. Significant 48% and 40% reductions in fibronectin expression were seen at 0.5 nM and 1 nM 1,25(OH)2D3. A minor decrease in collagen I expression was detected at 5 nM. VDR was predominantly localized in the islets of Langerhans in mouse and human tissues. In the latter VDR was expressed also in the exocrine tissue showing individual variation in its cellular distribution. Mouse PSCs express VDR protein and are sensitive 1,25(OH)2D3 target cells with low levels of 1,25(OH)2D3 exerting antiproliferative and antifibrotic effects on activated PSCs in

  16. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

    Energy Technol