
Sample records for suspendidas totales pst

  1. Intercepción de partículas suspendidas totales (PST por cinco especies de árboles urbanos en el Valle de Aburrá

    Directory of Open Access Journals (Sweden)

    Byron Duran Rivera


    Full Text Available Durante los meses de mayo a julio de 2005, se evaluó la capacidad de retención de Partículas Suspendidas Totales (PST en cinco especies arbóreas plantadas en el Valle de Aburrá, mediante la cuantificación de la cantidad de sólidos presentes en el follaje de las especies. Adicionalmente se analizaron características foliares que pudieran influir en la retención de PST. La información obtenida fue extrapolada a la vegetación mantenida por el Metro de Medellín. Se encontró que Syzygium malaccense y Lagerstroemia speciosa, son mas eficientes en cuanto a la intercepción de PST, estimándose que 1379 individuos pertenecientes a las cinco especies evaluadas y establecidas en el perímetro del Metro de Medellín, interceptan 658 Kg/año. Esta investigación buscó generar información que ayude en la toma de decisión de especies a plantar en sitios poluidos, con el fin de maximizar la intercepción de este contaminante.

  2. Partículas suspendidas (PST y partículas respirables (PM10 en el Valle de Aburrá, Colombia

    Directory of Open Access Journals (Sweden)

    Julio César Saldarriaga Molina


    Full Text Available En el Valle de Aburrá, región noroccidental de Colombia, habitado por tres millones de personas, recorrido por 400.000 vehículos aproximadamente y con la presencia de un sector industrial textil, de alimentos y metal-mecánico importante, se evaluaron las concentraciones de partículas suspendidas totales (PST y partículas respirables (PM10, durante el período de diciembre de 2000 a junio de 2001.Las determinaciones de PST y PM10 se realizaron en diez estaciones, distribuidas de norte a sur, cubriendo zonas urbanas y rurales de los municipios de Girardota, Bello, Medellín, Itagüí, Sabaneta y Caldas. Al analizar la relación PM10/PST, se encontró que las mejores correlaciones estadísticas se localizan en las zonas centro y sur del valle de Aburrá. Además se observó la tendencia creciente en la relación PM10/PST, desde 0,527 en la estación rural Girardota (Norte, hasta 0,813 en la estación urbana Caldas (Sur.Dicho gradiente en la relación PM10/PST parece estar relacionado con el régimen de vientos que predomina en el Valle de Aburrá con dirección norte-sur, el cual hace que las partículas más pequeñas migren de norte a sur, incrementando la relación PM10/PST en la misma dirección

  3. Pasarela suspendida en Stuttgart

    Directory of Open Access Journals (Sweden)

    Leonhardt, Fritz


    úblico, al que contribuyeron distintas empresas con proyectos diferentes. De ellos, el elegido consiste en una estructura suspendida, metálica, de arco rebajado y pavimento de pequeño espesor. La obra consiste en un tramo en arco, de 90 m de luz y rampas de acceso, pues dada la gran circulación de peatones no estaba indicada la adopción de escaleras. El canto de la viga cajón, en arco, es de 0,50 m y su anchura de 5,50 m. Longitudinalmente, la viga es continua, hallándose suspendida por cables que, partiendo de una, torre metálica, se unen a la pasarela en cinco puntos distintos de suspensión, espaciados a 18, 17, 17, 17 y 18 m, respectivamente. Para seguridad de la torre de suspensión de cables, se procedió a la hinca de pilotes, sobre los cuales se preparó el dado de cimientos. Aunque el terreno no tenga suficiente capacidad de sustentación para evitar asientos de importancia relativa, esto no tiene gran importancia, ya que la, obra está suspendida y los asientos diferenciales, aun de unos cuantos centímetros, no modifican la estabilidad y resistencia de la obra.

  4. PST user's guide

    International Nuclear Information System (INIS)

    Rempe, J.L.; Cebull, M.J.; Gilbert, B.G.


    The Parametric Source Term (PST) software allows estimation of radioactivity release fractions for Level 2 Probabilistic Safety Assessments (PSAs). PST was developed at the Idaho National Engineering Laboratory (INEL) for the Nuclear Regulatory Commission's (NRC's) Accident Sequence Precursor (ASP) Program. PST contains a framework of equations that model activity transport between volumes in the release pathway from the core, through the vessel, through the containment, and to the environment. PST quickly obtains exact solutions to differential equations for activity transport in each volume for each time interval. PST provides a superior method for source term estimation because it: ensures conservation of activity transported across various volumes in the release pathway; provides limited consideration of the time-dependent behavior of input parameter uncertainty distributions; allows input to be quantified using state-of-the-art severe accident analysis code results; increases modeling flexibility because linkage between volumes is specified by user input; and allows other types of Light Water Reactor (LWR) plant designs to be evaluated with minimal modifications. PST is a microcomputer-based system that allows the analyst more flexibility than a mainframe system. PST has been developed to run with both MS DOS and MS Windows 95/NT operating systems. PST has the capability to load ASP Source Term Vector (STV) information, import pre-specified default input for the 6 Pressurized Water Reactors (PWRs) initially analyzed in the NRC ASP program, allow input value modifications for release fraction sensitivity studies, export user-specified default input for the LWR being modeled, report results of radioactivity release calculations at each time interval, and generate formatted results that can interface with other risk assessment codes. This report describes the PST model and provides guidelines for using PST

  5. Evaluation of the air quality regarding total suspended particles and heavy metals (Pb, Cd, Ni, Cu, Cr) in the Hermosillo city, Sonora, Mexico, during a yearly period; Evaluacion de la calidad del aire respecto de particulas suspendidas totales y metales pesados (Pb, Cd, Ni, Cu, Cr) en la Ciudad de Hermosillo, Sonora, Mexico, durante un periodo anual

    Energy Technology Data Exchange (ETDEWEB)

    Cruz C, M. E.; Quintero N, M. [Universidad Autonoma de Baja California, Instituto de Ingenieria, Campus Mexicali, Calle de la Normal s/n, y Blvd. Benito Juarez, Col. Insurgentes Este, Mexicali, Baja California (Mexico); Gomez A, A.; Varela S, J., E-mail: [Universidad de Sonora, Departamento de Ingenieria Quimica y Metalurgia, Blvd. Rosales y Luis Ensina s/n, Edificio 5B, Col. Centro, 83000 Hermosillo, Sonora (Mexico)


    In the present study, the air quality of the city of Hermosillo, Sonora, Mexico was assessed considering total suspended particulates (tsp) and heavy metals (Pb, Cd, Ni, Cu, Cr) from June 2001 through May 2002 in three monitoring sites Centro (Mazon), Nor este (CESUES) and Noroeste (CBTIS). The filter-samples used for that purpose were provided by the Air Quality Evaluation and Improvement Program (PEMCA) of the municipality of Hermosillo. The sampling method was based on high volume sampling frequency set every 6 days with non-simultaneous sampling among the three sampling sites. Filters were dissolved for metal determination by acidic-extraction, and then analyzed by flame atomic absorption spectrophotometry. Results indicate that tsp concentrations at Centro and Noroeste sites were frequently higher than the maximum daily permissible level (260 {mu}g/m{sup 3}), while in the three sites the annual average was higher than the maximum annual permissible level (75 {mu}g/m{sup 3}) both established in the standard NOM-024-Ssa-1993 (Ssa 1994a). According to the Air Quality Standard Index (US EPA 1992a), used in Mexico by Air Quality Metropolitan Index (IMECA) the results indicate that the air quality in the city of Hermosillo regarding tsp was placed between no satisfactory and poor. In regard to heavy metals (Pb, Cd, Ni, Cu, Cr), concentrations detected were below the maximum permissible levels and/or criteria taking into account the standard NOM-026-Ssa-1993 (Ssa 1994b), the Who criterion (2000), the European Union criterion (Cec 2003), and the European Environmental Agency criteria (EEA 2004). Such findings would mean that airborne metals are of no concern; however, air quality is still classified as no satisfactory due to high particulate matter concentrations. Keeping air quality parameters monitoring is recommended in order to get extensive data for use in risk studies of air quality and health (morbidity/mortality), as well as topographic conditions

  6. Pst Pst (1896-1898. Een erotisch weekblad tussen naturalisme en utopie

    Directory of Open Access Journals (Sweden)

    Janna Coomans


    Full Text Available Amsterdam-based Pst Pst (1896-1898 was more than an erotic magazine. It not only tried to excite and provoke its audience with drawings of naked ladies and obscene jests, it also contained elements of two important literary trends: utopianism and naturalism. On the one hand, it was naturalistic in its attempt to uncover morals and sexual practices that were concealed in public discourse. The magazine ridiculed the double standard of Dutch society through jokes and prints about prostitution. On the other hand, it described the manifestations, mainly the nightlife, of the urban bohemian subculture to which it was - both geographically and mentally - connected. Pst Pst tried to dissociate itself from social conventions by creating a small world of its own. It announced mysterious erotic events, placed extravagant fake advertisements and depicted prostitutes as insatiable, merry young girls. Obviously, Pst Pst was not the only publication engaged in the production of erotica, but in this period it was the only erotic magazine, with corresponding characteristics such as a connection with a specific audience and an engagement with current affairs.

  7. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1. (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A


    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  8. Evaluación cualitativa en ambientes laborales con partículas suspendidas

    Directory of Open Access Journals (Sweden)

    Mayra Islas Galicia


    Full Text Available El presente trabajo muestra el diseño y aplicación de una encuesta que incluye principios de ergonomía para evaluar el ambiente laboral desde la perspectiva de los trabajadores en centros donde se emiten partículas suspendidas capaces de generar contaminación. El objetivo que se persigue al realizar dicha evaluación es promover la participación de los trabajadores en la identificación de áreas de oportunidad en cuatro dimensiones: Calidad del Aire, Capacitación, Salud, y Seguridad y Bienestar. A su vez, que la encuesta sirva como herramienta complementaria a los alcances de la NOM-010-STPS-2014 que regula las condiciones de seguridad e higiene en centros de trabajo donde se emplean sustancias químicas. La metodología que se siguió para el logro de los objetivos de este trabajo, incluyó:1 La revisión en detalle de la Norma Oficial Mexicana NOM-010-STPS2014 y la Norma Internacional UNE EN ISO 6385:2004 “Principios ergonómicos para el diseño de sistemas de trabajo”, con la finalidad de comprender su contenido en cuanto alcances, limitaciones, y aplicación de la ergonomía; 2El diseño del instrumento de medición (encuesta, que a su vez contempló: el establecimiento de las dimensiones, la elaboración de las aseveraciones y formato de respuesta, y la aplicación de la encuesta;3 Los cálculos para la obtención de resultados. La encuesta diseñada se aplicó en empresas de diferente giro, que estuvieran dentro del campo de cobertura de la NOM-010-STPS-2014; los resultados se presentan a través de un modelo gráfico que evalúa la Importancia y Desempeño, a partir de los cuales se puede destacar la necesidad de efectuar mejoras a las condiciones de trabajo y algunas cuestiones de carácter administrativo.

  9. Parallel Evolution and Horizontal Gene Transfer of the pst Operon in Firmicutes from Oligotrophic Environments

    Directory of Open Access Journals (Sweden)

    Alejandra Moreno-Letelier


    Full Text Available The high affinity phosphate transport system (pst is crucial for phosphate uptake in oligotrophic environments. Cuatro Cienegas Basin (CCB has extremely low P levels and its endemic Bacillus are closely related to oligotrophic marine Firmicutes. Thus, we expected the pst operon of CCB to share the same evolutionary history and protein similarity to marine Firmicutes. Orthologs of the pst operon were searched in 55 genomes of Firmicutes and 13 outgroups. Phylogenetic reconstructions were performed for the pst operon and 14 concatenated housekeeping genes using maximum likelihood methods. Conserved domains and 3D structures of the phosphate-binding protein (PstS were also analyzed. The pst operon of Firmicutes shows two highly divergent clades with no correlation to the type of habitat nor a phylogenetic congruence, suggesting horizontal gene transfer. Despite sequence divergence, the PstS protein had a similar 3D structure, which could be due to parallel evolution after horizontal gene transfer events.

  10. Structure-function aspects of PstS in multi-drug-resistant Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Olga Zaborina


    Full Text Available The increasing prevalence of multi-drug-resistant (MDR strains of Pseudomonas aeruginosa among critically ill humans is of significant concern. In the current study, we show that MDR clinical isolates of P. aeruginosa representing three distinct genotypes that display high virulence against intestinal epithelial cells, form novel appendage-like structures on their cell surfaces. These appendages contain PstS, an extracellular phosphate binding protein. Using anti-PstS antibodies, we determined that the PstS-rich appendages in MDR strains are involved in adherence to and disruption of the integrity of cultured intestinal epithelial cell monolayers. The outer surface-expressed PstS protein was also identified to be present in P. aeruginosa MPAO1, although to a lesser degree, and its role in conferring an adhesive and barrier disruptive phenotype against intestinal epithelial cells was confirmed using an isogenic DeltaPstS mutant. Formation of the PstS rich appendages was induced during phosphate limitation and completely suppressed in phosphate-rich media. Injection of MDR strains directly into the intestinal tract of surgically injured mice, a known model of phosphate limitation, caused high mortality rates (60%-100%. Repletion of intestinal phosphate in this model completely prevented mortality. Finally, significantly less outer surface PstS was observed in the MPAO1 mutant DeltaHxcR thus establishing a role for the alternative type II secretion system Hxc in outer surface PstS expression. Gene expression analysis performed by RT-PCR confirmed this finding and further demonstrated abundant expression of pstS analogous to pa5369, pstS analogous to pa0688/pa14-55410, and hxcX in MDR strains. Taken together, these studies provide evidence that outer surface PstS expression confers a highly virulent phenotype of MDR isolates against the intestinal epithelium that alters their adhesive and barrier disrupting properties against the intestinal

  11. Estimación del riesgo a la exposición de partículas suspendidas en el Valle de Toluca

    Directory of Open Access Journals (Sweden)

    Jesus Hernán Flores Ruiz


    Full Text Available Las partículas PM10 suspendidas en la atmósfera afectan el sistema respiratorio humano, además presentan un riesgo potencial cancerígeno debido a la gran cantidad de hidrocarburos que se quema en la atmósfera. Se estimó la exposición de las partículas PM10 suspendidas en el Valle de Toluca y sus alrededores, con la información de 8 años, proporcionada por la Red Automática Monitoreo de la Zona Metropolitana del Valle de Toluca (rama t. Para la estimación de riesgo se tomó en consideración la distribución de Gumbel-1 de Valores Extremos, asimismo se utilizaron diferentes periodos de retorno y la ocurrencia probabilística en intervalos de tiempo de 1, 5, 10, 12.5, 15, 17.5 y 20 años. Se infirió, estadísticamente, un alto grado de riesgo a la salud, debido a la magnitud de la concentración media de estas partículas y se predice que, de existir las condiciones actuales, esta relación estadística permanecerá invariante dentro de los próximos 20 años.

  12. The effect of porcine somatotropin (pST) and gender on production ...

    African Journals Online (AJOL)

    The effect of porcine somatotropin (pST) and gender on production parameters and tissue yield of pigs slaughtered at 135 kg live weight. ... No significant pST effects were found for live weight, carcass weight, % bone, % fat or % lean meat, but a significant increase in percentage skin was found. Keywords: triterpenoid, stem ...

  13. Conception and Associated Evaluation of a Problem-Solving Training (PST) for Patients in the Hospital Context of Hematopoietic Stem Cell Transplantation (HSCT). (United States)

    Balck, Friedrich; Zimmermann, Anja; Neumann, Anja


    It appears from empirical studies that the problem-solving ability of patients is associated with the experience of distress and the patients' mental state. The goals of this study were the (1) conception and (2) associated evaluation of the psychological short-time intervention "problem-solving training" (PST) for patients hospitalized for hematopoietic stem cell transplantation (HSCT). (1) The conception of the PST comprised a multi-stage development phase. An existing manual for outpatients diagnosed with cancer was adapted to the specific situation of a HSCT. This was followed by development of a manual, definition of the general framework, instruction of coaches, and implementation in a hospital setting. (2) The associated evaluation of PST was conducted from the patients' and the coaches' point of view. A total of 22 patients and five coaches evaluated the training. The training was evaluated by both patients and coaches as being well achievable with the exception of a limited time frame for the first module. The manual explanations were judged to be intelligible by all participants. Regarding on-topic alertness, patients were, on average, rated as "rather "to "very attentive." The patients evaluated the response to their needs as "good." They further assessed their overall condition due to the training as "good." This study provides preliminary evidence for the feasibility of PST by using the developed manual (Psychological Short-Term Intervention PST for Patients During HSCT). Based on this, it is conceivable to implement this intervention in similar situations to the advantage of a different patient clientele.

  14. Using Self-Guided Treatment Software (ePST to Teach Clinicians How to Deliver Problem-Solving Treatment for Depression

    Directory of Open Access Journals (Sweden)

    James A. Cartreine


    Full Text Available Problem-solving treatment (PST offers a promising approach to the depression care; however, few PST training opportunities exist. A computer-guided, interactive media program has been developed to deliver PST electronically (ePST, directly to patients. The program is a six-session, weekly intervention modeled on an evidence-based PST protocol. Users are guided through each session by a clinician who is presented via hundreds of branching audio and video clips. Because expert clinician behaviors are modeled in the program, not only does the ePST program have the potential to deliver PST to patients but it may also serve as a training tool to teach clinicians how to deliver PST. Thirteen social workers and trainees used ePST self-instructionally and subsequently attended a day-long workshop on PST. Participants’ PST knowledge level increased significantly from baseline to post-ePST (P=.001 and did not increase significantly further after attending the subsequent workshop. Additionally, attending the workshop did not significantly increase the participants' skill at performing PST beyond the use of the ePST program. Using the ePST program appears to train novices to a sufficient level of competence to begin practicing PST under supervision. This self-instructional training method could enable PST for depression to be widely disseminated, although follow-up supervision is still required.

  15. Using Self-Guided Treatment Software (ePST) to Teach Clinicians How to Deliver Problem-Solving Treatment for Depression. (United States)

    Cartreine, James A; Chang, Trina E; Seville, Janette L; Sandoval, Luis; Moore, John B; Xu, Shuai; Hegel, Mark T


    Problem-solving treatment (PST) offers a promising approach to the depression care; however, few PST training opportunities exist. A computer-guided, interactive media program has been developed to deliver PST electronically (ePST), directly to patients. The program is a six-session, weekly intervention modeled on an evidence-based PST protocol. Users are guided through each session by a clinician who is presented via hundreds of branching audio and video clips. Because expert clinician behaviors are modeled in the program, not only does the ePST program have the potential to deliver PST to patients but it may also serve as a training tool to teach clinicians how to deliver PST. Thirteen social workers and trainees used ePST self-instructionally and subsequently attended a day-long workshop on PST. Participants' PST knowledge level increased significantly from baseline to post-ePST (P = .001) and did not increase significantly further after attending the subsequent workshop. Additionally, attending the workshop did not significantly increase the participants' skill at performing PST beyond the use of the ePST program. Using the ePST program appears to train novices to a sufficient level of competence to begin practicing PST under supervision. This self-instructional training method could enable PST for depression to be widely disseminated, although follow-up supervision is still required.

  16. Analyzing State Sequences with Probabilistic Suffix Trees: The PST R Package

    Directory of Open Access Journals (Sweden)

    Alexis Gabadinho


    Full Text Available This article presents the PST R package for categorical sequence analysis with probabilistic suffix trees (PSTs, i.e., structures that store variable-length Markov chains (VLMCs. VLMCs allow to model high-order dependencies in categorical sequences with parsimonious models based on simple estimation procedures. The package is specifically adapted to the field of social sciences, as it allows for VLMC models to be learned from sets of individual sequences possibly containing missing values; in addition, the package is extended to account for case weights. This article describes how a VLMC model is learned from one or more categorical sequences and stored in a PST. The PST can then be used for sequence prediction, i.e., to assign a probability to whole observed or artificial sequences. This feature supports data mining applications such as the extraction of typical patterns and outliers. This article also introduces original visualization tools for both the model and the outcomes of sequence prediction. Other features such as functions for pattern mining and artificial sequence generation are described as well. The PST package also allows for the computation of probabilistic divergence between two models and the fitting of segmented VLMCs, where sub-models fitted to distinct strata of the learning sample are stored in a single PST.

  17. Phosphate signaling through alternate conformations of the PstSCAB phosphate transporter. (United States)

    Vuppada, Ramesh K; Hansen, Colby R; Strickland, Kirsta A P; Kelly, Keilen M; McCleary, William R


    Phosphate is an essential compound for life. Escherichia coli employs a signal transduction pathway that controls the expression of genes that are required for the high-affinity acquisition of phosphate and the utilization of alternate sources of phosphorous. These genes are only expressed when environmental phosphate is limiting. The seven genes for this signaling pathway encode the two-component regulatory proteins PhoB and PhoR, as well as the high-affinity phosphate transporter PstSCAB and an auxiliary protein called PhoU. As the sensor kinase PhoR has no periplasmic sensory domain, the mechanism by which these cells sense environmental phosphate is not known. This paper explores the hypothesis that it is the alternating conformations of the PstSCAB transporter which are formed as part of the normal phosphate transport cycle that signal phosphate sufficiency or phosphate limitation. We tested two variants of PstB that are predicted to lock the protein in either of two conformations for their signaling output. We observed that the pstBQ160K mutant, predicted to reside in an inward-facing, open conformation signaled phosphate sufficiency whereas the pstBE179Q mutant, predicted to reside in an outward-facing, closed conformation signaled phosphate starvation. Neither mutant showed phosphate transport. These results support the hypothesis that the alternating conformations of the PstSCAB transporter are sensed by PhoR and PhoU. This sensory mechanism thus controls the alternate autokinase and phospho-PhoB phosphatase activities of PhoR, which ultimately control the signaling state of the response regulator PhoB.

  18. Significant genotype difference in the CYP2E1 PstI polymorphism of indigenous groups in Sabah, Malaysia with Asian and non-Asian populations. (United States)

    Goh, Lucky Poh Wah; Chong, Eric Tzyy Jiann; Chua, Kek Heng; Chuah, Jitt Aun; Lee, Ping-Chin


    CYP2E1 PstI polymorphism G-1259C (rs3813867) genotype distributions vary significantly among different populations and are associated with both diseases, like cancer, and adverse drug effects. To date, there have been limited genotype distributions and allele frequencies of this polymorphism reported in the three major indigenous ethnic groups (KadazanDusun, Bajau, and Rungus) in Sabah, also known as North Borneo. The aim of this study was to investigate the genotype distributions and allele frequencies of the CYP2E1 PstI polymorphism G-1259C in these three major indigenous peoples in Sabah. A total of 640 healthy individuals from the three dominant indigenous groups were recruited for this study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at G-1259C polymorphic site of CYP2E1 gene was performed using the Pst I restriction enzyme. Fragments were analyzed using agarose gel electrophoresis and confirmed by direct sequencing. Overall, the allele frequencies were 90.3% for c1 allele and 9.7% for c2 allele. The genotype frequencies for c1/c1, c1/c2 and c2/c2 were observed as 80.9%, 18.8%, and 0.3%, respectively. A highly statistical significant difference (ppopulations. However, among these three indigenous groups, there was no statistical significant difference (p>0.001) in their genotype distributions. The three major indigenous ethnic groups in Sabah show unique genotype distributions when compared with other populations. This finding indicates the importance of establishing the genotype distributions of CYP2E1 PstI polymorphism in the indigenous populations.

  19. PsT1: A Low-Cost Optical Simulator for Psychomotor Skills Training in Neuroendoscopy. (United States)

    Espinoza, Daniel Lorias; González Carranza, Vicente; Chico-Ponce de León, Fernando; Martinez, Arturo Minor


    Well-developed psychomotor skills are important for competence in minimally invasive surgery. Neuroendoscopy is no exception, and adaptation to different visual perspectives and careful handling of the surgical instruments are mandatory. Few training systems, however, focus on developing psychomotor skills for neuroendoscopy. Here, we introduce a new training system called PsT1 that provides visual feedback via the use of simple optics that emulate the endoscope at 0° and 30°. Time and error metrics are generated automatically with integrated software to ensure objective assessment. Neuroendoscopic optics were emulated with a low-cost, commercially available universal serial bus 2.0 camera and a light-emitting diode light source. Visual feedback of 30° was obtained by displacing the optical axis of the universal serial bus camera by 30°, and metrics (time, precision, and errors) were generated automatically by the software. Three evaluation modules were developed (spatial adaptation, depth adaptation, and dissection), and 35 expert and nonexpert neurosurgeons performed an initial evaluation of the system. A total of 81% and 90% of surgeons agreed that the visuals were satisfactory and movement and control were accurately replicated, respectively. The advantages and disadvantages of the system were compared. Here, we present a novel, low-cost, and easy-to-implement training system for developing basic neuroendoscopic psychomotor skills. The use of objective metrics, surgical instruments, and emulation of the neuroendoscope at 0° and 30° are competitive advantages of the current system. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Chapter 3: The influence of porcine somatatropin (pST) on ...

    African Journals Online (AJOL)

    SStC Botha

    Despite the advances made in terms of genetics, associated problems with breeding lean pigs, such as the occurrence of pale, soft and exudative (PSE) meat, has slowed down the progress in breeding leaner animals. The production of recombinant porcine somatotropin (pST) has made it economically viable to produce ...

  1. Microdomain fluctuations in lead scandium tantalate (PST) observed by high resolution transmission electron microscopy

    International Nuclear Information System (INIS)

    Bursill, L.A.; Peng, Julin.


    The value of the high-resolution transmission electron microscopy (HRTEM) and dark-field imaging techniques for obtaining nanocrystalline structural information is demonstrated for lead scandium tantalite (PST). Chemical domain textures, polar domain fluctuations and HRTEM images of disordered and ordered PTS are discussed. 5 refs., 5 figs

  2. Exploring of PST-TBPM in Monitoring Bridge Dynamic Deflection in Vibration (United States)

    Zhang, Guojian; Liu, Shengzhen; Zhao, Tonglong; Yu, Chengxin


    This study adopts digital photography to monitor bridge dynamic deflection in vibration. Digital photography used in this study is based on PST-TBPM (photographing scale transformation-time baseline parallax method). Firstly, a digital camera is used to monitor the bridge in static as a zero image. Then, the digital camera is used to monitor the bridge in vibration every three seconds as the successive images. Based on the reference system, PST-TBPM is used to calculate the images to obtain the bridge dynamic deflection in vibration. Results show that the average measurement accuracies are 0.615 pixels and 0.79 pixels in X and Z direction. The maximal deflection of the bridge is 7.14 pixels. PST-TBPM is valid in solving the problem-the photographing direction not perpendicular to the bridge. Digital photography used in this study can assess the bridge health through monitoring the bridge dynamic deflection in vibration. The deformation trend curves depicted over time also can warn the possible dangers.

  3. Sublingual immunization with the phosphate-binding-protein (PstS) reduces oral colonization by Streptococcus mutans. (United States)

    Ferreira, E L; Batista, M T; Cavalcante, R C M; Pegos, V R; Passos, H M; Silva, D A; Balan, A; Ferreira, L C S; Ferreira, R C C


    Bacterial ATP-binding cassette (ABC) transporters play a crucial role in the physiology and pathogenicity of different bacterial species. Components of ABC transporters have also been tested as target antigens for the development of vaccines against different bacterial species, such as those belonging to the Streptococcus genus. Streptococcus mutans is the etiological agent of dental caries, and previous studies have demonstrated that deletion of the gene encoding PstS, the substrate-binding component of the phosphate uptake system (Pst), reduced the adherence of the bacteria to abiotic surfaces. In the current study, we generated a recombinant form of the S. mutans PstS protein (rPstS) with preserved structural features, and we evaluated the induction of antibody responses in mice after sublingual mucosal immunization with a formulation containing the recombinant protein and an adjuvant derived from the heat-labile toxin from enterotoxigenic Escherichia coli strains. Mice immunized with rPstS exhibited systemic and secreted antibody responses, measured by the number of immunoglobulin A-secreting cells in draining lymph nodes. Serum antibodies raised in mice immunized with rPstS interfered with the adhesion of bacteria to the oral cavity of naive mice challenged with S. mutans. Similarly, mice actively immunized with rPstS were partially protected from oral colonization after challenge with the S. mutans NG8 strain. Therefore, our results indicate that S. mutans PstS is a potential target antigen capable of inducing specific and protective antibody responses after sublingual administration. Overall, these observations raise interesting perspectives for the development of vaccines to prevent dental caries. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. A French national breast and thyroid cancer screening programme for survivors of childhood, adolescent and young adult (CAYA) cancers - DeNaCaPST programme. (United States)

    Demoor-Goldschmidt, Charlotte; Drui, Delphine; Doutriaux, Isabelle; Michel, Gérard; Auquier, Pascal; Dumas, Agnès; Berger, Claire; Bernier, Valérie; Bohrer, Sandrine; Bondiau, Pierre-Yves; Filhon, Bruno; Fresneau, Brice; Freycon, Claire; Stefan, Dinu; Helfre, Sylvie; Jackson, Angela; Kerr, Christine; Laprie, Anne; Leseur, Julie; Mahé, Marc-André; Oudot, Caroline; Pluchard, Claire; Proust, Stéphanie; Sudour-Bonnange, Hélène; Vigneron, Céline; Lassau, Nathalie; Schlumberger, Martin; Conter, Cécile Faure; de Vathaire, Florent


    Survival of childhood, adolescent and young adult (CAYA) cancers has increased with progress in the management of the treatments and has reached more than 80% at 5 years. Nevertheless, these survivors are at great risk of second cancers and non-malignant co-morbidities in later life. DeNaCaPST is a non-interventional study whose aim is to organize a national screening for thyroid cancer and breast cancer in survivors of CAYA cancers. It will study the compliance with international recommendations, with the aim, regarding a breast screening programme, of offering for every woman living in France, at equal risk, an equal screening. DeNaCaPST trial is coordinated by the INSERM 1018 unit in cooperation with the LEA (French Childhood Cancer Survivor Study for Leukaemia) study's coordinators, the long term follow up committee and the paediatric radiation committee of the SFCE (French Society of Childhood Cancers). A total of 35 centres spread across metropolitan France and la Reunion will participate. FCCSS (French Childhood Cancer Survivor Study), LEA and central registry will be interrogated to identify eligible patients. To participate, centers agreed to perform a complete "long-term follow-up consultations" according to good clinical practice and the guidelines of the SFCE (French Society of Children Cancers). As survival has greatly improved in childhood cancers, detection of therapy-related malignancies has become a priority even if new radiation techniques will lead to better protection for organs at risk. International guidelines have been put in place because of the evidence for increased lifetime risk of breast and thyroid cancer. DeNaCaPST is based on these international recommendations but it is important to recognize that they are based on expert consensus opinion and are supported by neither nonrandomized observational studies nor prospective randomized trials in this specific population. Over-diagnosis is a phenomenon inherent in any screening program and

  5. Early Progressive Strength Training to Enhance Recovery After Fast-Track Total Knee Arthroplasty

    DEFF Research Database (Denmark)

    Jakobsen, Thomas Linding; Kehlet, Henrik; Husted, Henrik


    OBJECTIVE: To compare 7 weeks of supervised physical rehabilitation with or without progressive strength training (PST) commenced early after fast-track total knee arthroplasty (TKA) on functional performance. METHODS: In total, 82 patients with a unilateral primary TKA were randomized to 2...... different interventions: 7 weeks of supervised physical rehabilitation with PST (PST group) and without PST (CON group) commenced early after fast-track TKA. The primary outcome was the maximal distance walked in 6 minutes (6-minute walk test). Secondary outcomes were lower extremity strength and power......, knee joint effusion and range of motion, knee pain, and self-reported disability and quality of life. All outcome measures were assessed before TKA (baseline) and 4, 8, and 26 weeks after TKA. RESULTS: There was no statistically significant difference between the PST and CON groups in the change score...

  6. Core-corona PSt/P(BA-AA) composite particles by two-stage emulsion polymerization (United States)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun


    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA-AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA-AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core-corona composite particles, P(St/P(BA-AA)), could be regulated and controlled by varying the concentrations of P(BA-AA) or the mass ratio of BA:AA in P(BA-AA). The experimental results indicate that 3.0-6.0 wt% of P(BA-AA) is required to obtain stable composite emulsions, and P(BA-AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core-corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA-A). The regular morphology of the colloidal film is expected to facilitate potential application of core-corona particles in the field of light scattering. Furthermore, the diversity of core-corona particles can be expanded by replacing P(BA-AA) corona particles with other amphiphilic particles.

  7. Exploring of PST-TBPM in Monitoring Dynamic Deformation of Steel Structure in Vibration (United States)

    Chen, Mingzhi; Zhao, Yongqian; Hai, Hua; Yu, Chengxin; Zhang, Guojian


    In order to monitor the dynamic deformation of steel structure in the real-time, digital photography is used in this paper. Firstly, the grid method is used correct the distortion of digital camera. Then the digital cameras are used to capture the initial and experimental images of steel structure to obtain its relative deformation. PST-TBPM (photographing scale transformation-time baseline parallax method) is used to eliminate the parallax error and convert the pixel change value of deformation points into the actual displacement value. In order to visualize the deformation trend of steel structure, the deformation curves are drawn based on the deformation value of deformation points. Results show that the average absolute accuracy and relative accuracy of PST-TBPM are 0.28mm and 1.1‰, respectively. Digital photography used in this study can meet accuracy requirements of steel structure deformation monitoring. It also can warn the safety of steel structure and provide data support for managers’ safety decisions based on the deformation curves on site.

  8. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya, E-mail:; Liao, Shijun [South China University of Technology, School of Chemistry and Chemical Engineering (China)


    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  9. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    International Nuclear Information System (INIS)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun


    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  10. Design of the PST: A Diagnostic for 1-D Imaging of Fast Z-Pinch Power Emissions

    International Nuclear Information System (INIS)

    Rochau, Gregory A.; Derzon, Mark S.; Chandler, Gordon A.; Lazier, Steven Earl


    Fast Z-pinch technology developed on the Z machine at Sandia National Laboratories can produce up to 230 TW of thermal x-ray power for applications in inertial confinement fusion (ICF) and weapons physics experiments. During implosion, these Z-pinches develop Rayleigh-Taylor (R-T) instabilities which are very difficult to diagnose and which functionally diminish the overall pinch quality. The Power-Space-Time (PST) instrument is a newly configured diagnostic for measuring the pinch power as a function of both space and time in a Z-pinch. Placing the diagnostic at 90 degrees from the Z-pinch axis, the PST provides a new capability in collecting experimental data on R-T characteristics for making meaningful comparisons to magneto-hydrodynamic computer models. This paper is a summary of the PST diagnostic design. By slit-imaging the Z-pinch x-ray emissions onto a linear scintillator/fiber-optic array coupled to a streak camera system, the PST can achieve ∼100 microm spatial resolution and ∼1.3 ns time resolution. Calculations indicate that a 20 microm thick scintillating detection element filtered by 1,000 angstrom of Al is theoretically linear in response to Plankian x-ray distributions corresponding to plasma temperatures from 40 eV to 150 eV, By calibrating this detection element to x-ray energies up to 5,000 eV, the PST can provide pinch power as a function of height and time in a Z-pinch for temperatures ranging from ∼40 eV to ∼400 eV. With these system pm-meters, the PST can provide data for an experimental determination of the R-T mode number, amplitude, and growth rate during the late-time pinch implosion

  11. WHO Parents Skills Training (PST) programme for children with developmental disorders and delays delivered by Family Volunteers in rural Pakistan: study protocol for effectiveness implementation hybrid cluster randomized controlled trial. (United States)

    Hamdani, S U; Akhtar, P; Zill-E-Huma; Nazir, H; Minhas, F A; Sikander, S; Wang, D; Servilli, C; Rahman, A


    Development disorders and delays are recognised as a public health priority and included in the WHO mental health gap action programme (mhGAP). Parents Skills Training (PST) is recommended as a key intervention for such conditions under the WHO mhGAP intervention guide. However, sustainable and scalable delivery of such evidence based interventions remains a challenge. This study aims to evaluate the effectiveness and scaled-up implementation of locally adapted WHO PST programme delivered by family volunteers in rural Pakistan. The study is a two arm single-blind effectiveness implementation-hybrid cluster randomised controlled trial. WHO PST programme will be delivered by 'family volunteers' to the caregivers of children with developmental disorders and delays in community-based settings. The intervention consists of the WHO PST along with the WHO mhGAP intervention for developmental disorders adapted for delivery using the android application on a tablet device. A total of 540 parent-child dyads will be recruited from 30 clusters. The primary outcome is child's functioning, measured by WHO Disability Assessment Schedule - child version (WHODAS-Child) at 6 months post intervention. Secondary outcomes include children's social communication and joint engagement with their caregiver, social emotional well-being, parental health related quality of life, family empowerment and stigmatizing experiences. Mixed method will be used to collect data on implementation outcomes. Trial has been retrospectively registered at (NCT02792894). This study addresses implementation challenges in the real world by incorporating evidence-based intervention strategies with social, technological and business innovations. If proven effective, the study will contribute to scaled-up implementation of evidence-based packages for public mental health in low resource settings. Registered with as Family Networks (FaNs) for Children with Developmental

  12. Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp. (United States)

    Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P


    The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the

  13. Genome-wide analysis of the Pho regulon in a pstCA mutant of Citrobacter rodentium.

    Directory of Open Access Journals (Sweden)

    Catherine Cheng

    Full Text Available The phosphate-specific transport operon, pstSCAB-phoU, of Gram-negative bacteria is an essential part of the Pho regulon. Its key roles are to encode a high-affinity inorganic phosphate transport system and to prevent activation of PhoB in phosphate-rich environments. In general, mutations in pstSCAB-phoU lead to the constitutive expression of the Pho regulon. Previously, we constructed a pstCA deletion mutant of Citrobacter rodentium and found it to be attenuated for virulence in mice, its natural host. This attenuation was dependent on PhoB or PhoB-regulated gene(s because a phoB mutation restored virulence for mice to the pstCA mutant. To investigate how downstream genes may contribute to the virulence of C. rodentium, we used microarray analysis to investigate global gene expression of C. rodentium strain ICC169 and its isogenic pstCA mutant when grown in phosphate-rich medium. Overall 323 genes of the pstCA mutant were differentially expressed by at least 1.5-fold compared to the wild-type C. rodentium. Of these 145 were up-regulated and 178 were down-regulated. Differentially expressed genes included some involved in phosphate homoeostasis, cellular metabolism and protein metabolism. A large number of genes involved in stress responses and of unknown function were also differentially expressed, as were some virulence-associated genes. Up-regulated virulence-associated genes in the pstCA mutant included that for DegP, a serine protease, which appeared to be directly regulated by PhoB. Down-regulated genes included those for the production of the urease, flagella, NleG8 (a type III-secreted protein and the tad focus (which encodes type IVb pili in Yersinia enterocolitica. Infection studies using C57/BL6 mice showed that DegP and NleG8 play a role in bacterial virulence. Overall, our study provides evidence that Pho is a global regulator of gene expression in C. rodentium and indicates the presence of at least two previously unrecognized

  14. Structures of OppA and PstS from Yersinia pestis indicate variability of interactions with transmembrane domains

    DEFF Research Database (Denmark)

    Tanabe, Mikio; Mirza, Osman; Bertrand, Thomas


    -infective development. Here, the crystallization of five proteins (OppA, PstS, PiuA, YrbD and CysP) from Yersinia pestis, the causative agent of plague, are reported that diffracted to resolution limits ranging from 1.6 to 5 A. The first crystal structures of ABC system components from Y. pestis, OppA and Pst...

  15. PhoU Allows Rapid Adaptation to High Phosphate Concentrations by Modulating PstSCAB Transport Rate in Sinorhizobium meliloti. (United States)

    diCenzo, George C; Sharthiya, Harsh; Nanda, Anish; Zamani, Maryam; Finan, Turlough M


    Maintenance of cellular phosphate homeostasis is essential for cellular life. The PhoU protein has emerged as a key regulator of this process in bacteria, and it is suggested to modulate phosphate import by PstSCAB and control activation of the phosphate limitation response by the PhoR-PhoB two-component system. However, a proper understanding of PhoU has remained elusive due to numerous complications of mutating phoU , including loss of viability and the genetic instability of the mutants. Here, we developed two sets of strains of Sinorhizobium meliloti that overcame these limitations and allowed a more detailed and comprehensive analysis of the biological and molecular activities of PhoU. The data showed that phoU cannot be deleted in the presence of phosphate unless PstSCAB is inactivated also. However, phoU deletions were readily recovered in phosphate-free media, and characterization of these mutants revealed that addition of phosphate to the environment resulted in toxic levels of PstSCAB-mediated phosphate accumulation. Phosphate uptake experiments indicated that PhoU significantly decreased the PstSCAB transport rate specifically in phosphate-replete cells but not in phosphate-starved cells and that PhoU could rapidly respond to elevated environmental phosphate concentrations and decrease the PstSCAB transport rate. Site-directed mutagenesis results suggested that the ability of PhoU to respond to phosphate levels was independent of the conformation of the PstSCAB transporter. Additionally, PhoU-PhoU and PhoU-PhoR interactions were detected using a bacterial two-hybrid screen. We propose that PhoU modulates PstSCAB and PhoR-PhoB in response to local, internal fluctuations in phosphate concentrations resulting from PstSCAB-mediated phosphate import. IMPORTANCE Correct maintenance of cellular phosphate homeostasis is critical in all kingdoms of life and in bacteria involves the PhoU protein. This work provides novel insights into the role of the Sinorhizobium

  16. Immunodominant PstS1 antigen of mycobacterium tuberculosis is a potent biological response modifier for the treatment of bladder cancer

    Directory of Open Access Journals (Sweden)

    Böhle Andreas


    Full Text Available Abstract Background Bacillus Calmette Guérin (BCG-immunotherapy has a well-documented and successful clinical history in the treatment of bladder cancer. However, regularly observed side effects, a certain degree of nonresponders and restriction to superficial cancers remain a major obstacle. Therefore, alternative treatment strategies are intensively being explored. We report a novel approach of using a well defined immunostimulatory component of Mycobacterium tuberculosis for the treatment of bladder cancer. The phosphate transport protein PstS1 which represents the phosphate binding component of a mycobacterial phosphate uptake system is known to be a potent immunostimulatory antigen of M. tuberculosis. This preclinical study was designed to test the potential of recombinant PstS1 to serve as a non-viable and defined immunotherapeutic agent for intravesical bladder cancer therapy. Methods Mononuclear cells (PBMCs were isolated from human peripheral blood and stimulated with PstS1 for seven days. The activation of PBMCs was determined by chromium release assay, IFN-γ ELISA and measurement of lymphocyte proliferation. The potential of PstS1 to activate monocyte-derived human dendritic cells (DC was determined by flow cytometric analysis of the marker molecules CD83 and CD86 as well as the release of the cytokines TNF-α and IL-12. Survival of presensitized and intravesically treated, tumor-bearing mice was analyzed by Kaplan-Meier curve and log rank test. Local and systemic immune response in PstS1-immunotherapy was investigated by anti-PstS1-specific ELISA, splenocyte proliferation assay and immunohistochemistry. Results Our in vitro experiments showed that PstS1 is able to stimulate cytotoxicity, IFN-γ release and proliferation of PBMCs. Further investigations showed the potential of PstS1 to activate monocyte-derived human dendritic cells (DC. In vivo studies in an orthotopic murine bladder cancer model demonstrated the therapeutic

  17. New Invertebrate Vectors for PST, Spirolides and Okadaic Acid in the North Atlantic

    Directory of Open Access Journals (Sweden)

    Luis M. Botana


    Full Text Available The prevalence of poisoning events due to harmful algal blooms (HABs has declined during the last two decades through monitoring programs and legislation, implemented mainly for bivalves. However, new toxin vectors and emergent toxins pose a challenge to public health. Several locations on the Portuguese coast were surveyed between 2009 and 2010 for three distinct biotoxin groups [saxitoxin (PST, spirolide (SPX and okadaic acid (OA], in 14 benthic species of mollusks and echinoderms. Our main goals were to detect new vectors and unravel the seasonal and geographical patterns of these toxins. PSTs were analyzed by the Lawrence method, SPXs by LC-MS/MS, and OA by LC-MS/MS and UPLC-MS/MS. We report 16 new vectors for these toxins in the North Atlantic. There were differences in toxin contents among species, but no significant geographical or seasonal patterns were found. Our results suggest that legislation should be adjusted to extend the monitoring of marine toxins to a wider range of species besides edible bivalves.


    Directory of Open Access Journals (Sweden)

    Lilia Araujo


    Full Text Available En este trabajo se describe un método de análisis de kresoxim-metil y trifloxystrobin en muestras de agua mediante microextracción con gota suspendida y cromatografía de gases-espectrometría de masa. Se investigó la influencia del disolvente de extracción, velocidad de agitación, fuerza iónica, volumen de muestra, tiempo de extracción, volumen de la gota y temperatura de extracción en la respuesta analítica. Ambos fungicidas fueron extraídos con 2 μL de n-heptano. El método presentó buena linealidad para el intervalo entre 0,2 a 10 μg/L (r = 0,998-0,999. Se encontraron límites de detección de 4,0 ng/L para el kresoxim-metil y 7,0 ng/L para el trifloxis trobin. El método fue validado para muestras de agua encontrándose porcentajes de recuperación entre 83,0- 109,6%. La metodología es sencilla, de bajo costo, adecuada sensibilidad y por consiguiente recomendable para el análisis de residuos de kresoxim-metil y trifloxystrobin en muestras de agua.

  19. Resistensi 10 Galur Kacang Tanah Hasil Silangan antara Arachis cardenassii dan A. hypogaea terhadap Infeksi Peanut stripe virus (PStV

    Directory of Open Access Journals (Sweden)

    Ahmad Riduan


    Full Text Available One of the pathogen infecting peanut in Indonesia is Peanut stripe virus (PStV,, causing stripe and blotch symptoms on infected peanut leaves. The objectives of this research were to evaluate effects of PStV infection on yield of 10 introgression lines of peanut derived from crossing of Arachis cardenasii and A. hypogaea, and to determine the tolerance of these lines against PStV infection. Peanut plants were grown in polybag containing 10 kg of potting soils and were grown under glasshouse conditions. The experimental unit consisted of four plants grown separately in four containers and for each treatment was replicated four times. Peanut plants were inoculated mechanically with Bogor isolate of PStV at 15 days after planting (dap and harvested at 95-100 dap. Results of the experiment indicated peanut cv. Gajah belonged to moderate tolerance while Kelinci was sensitive against PStV infection. Introgression line NC-CS11, CS30 and WS4 were grouped as tolerance while NC-CS51, WSl, and WS3 were moderate tolerance. The tolerance lines showed mild mosaic symptoms, did not show reduction of plant height and peanut yield upon inoculation with PStV. Introgresion line NC-CS15, CS20,CS22, and CS50 were sensitive against PStV infection, showed moderate to severe mosaic/blotch symptoms, reduction of plant height and peanut yield due to PStV infection. Among the tolerance and moderate tolerance lines, only NC-CS30 showed higher yield as compared to peanut cv. Gajah or Kelinci. Therefore, this line may be developed further as commercial peanut cultivar or be use as donor germplasm for PStV tolerance mechanisms in peanut breeding.

  20. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.


    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  1. Altered Regulation of the Diguanylate Cyclase YaiC Reduces Production of Type 1 Fimbriae in a Pst Mutant of Uropathogenic Escherichia coli CFT073. (United States)

    Crépin, Sébastien; Porcheron, Gaëlle; Houle, Sébastien; Harel, Josée; Dozois, Charles M


    The pst gene cluster encodes the phosphate-specific transport (Pst) system. Inactivation of the Pst system constitutively activates the two-component regulatory system PhoBR and attenuates the virulence of pathogenic bacteria. In uropathogenic Escherichia coli strain CFT073, attenuation by inactivation of pst is predominantly attributed to the decreased expression of type 1 fimbriae. However, the molecular mechanisms connecting the Pst system and type 1 fimbriae are unknown. To address this, a transposon library was constructed in the pst mutant, and clones were tested for a regain in type 1 fimbrial production. Among them, the diguanylate cyclase encoded by yaiC ( adrA in Salmonella ) was identified to connect the Pst system and type 1 fimbrial expression. In the pst mutant, the decreased expression of type 1 fimbriae is connected by the induction of yaiC This is predominantly due to altered expression of the FimBE-like recombinase genes ipuA and ipbA , affecting at the same time the inversion of the fim promoter switch ( fimS ). In the pst mutant, inactivation of yaiC restored fim -dependent adhesion to bladder cells and virulence. Interestingly, the expression of yaiC was activated by PhoB, since transcription of yaiC was linked to the PhoB-dependent phoA-psiF operon. As YaiC is involved in cyclic di-GMP (c-di-GMP) biosynthesis, an increased accumulation of c-di-GMP was observed in the pst mutant. Hence, the results suggest that one mechanism by which deletion of the Pst system reduces the expression of type 1 fimbriae is through PhoBR-mediated activation of yaiC , which in turn increases the accumulation of c-di-GMP, represses the fim operon, and, consequently, attenuates virulence in the mouse urinary tract infection model. IMPORTANCE Urinary tract infections (UTIs) are common bacterial infections in humans. They are mainly caused by uropathogenic Escherichia coli (UPEC). We previously showed that interference with phosphate homeostasis decreases the

  2. The polymorphism of CYP2E1 Rsa I/Pst I gene and susceptibility to respiratory system cancer: a systematic review and meta-analysis of 34 studies. (United States)

    Xu, Li; Yang, Mingyuan; Zhao, Tiejun; Jin, Hai; Xu, Zhiyun; Li, Ming; Chen, Hezhong


    The purpose of this articles is to determine whether the cytochrome P450 2E1 (CYP2E1) Rsa I/Pst I gene polymorphism is correlated with respiratory system cancers. Respiratory system cancers included lung cancer, laryngeal cancer, nasopharyngeal cancer, and cancers of other respiratory organs, which are the most common malignant tumors worldwide; the significant relationship between CYP2E1 Rsa I/Pst I gene polymorphism and some respiratory system cancer have been reported, but results of some other studies are controversial. The pooled odds ratio (OR) with 95% confidence interval (CI) was calculated to assess the association. PubMed, EMBASE, Cochrane Library Databases, China National Knowledge Infrastructure, and Wanfang Database (up to July 20, 2014) were searched for all case-control studies those mainly studied the relationship between CYP2E1 Rsa I/Pst I gene polymorphism and the susceptibility of respiratory system cancer. A total of 332 articles were collected, among which 34 studies that involved 7028 cases and 9822 controls fulfilled the inclusion criteria after being assessed by 2 reviewers. When stratified by cancer site, the C2/C2 polymorphism could increase the risk of nasopharyngeal cancer under the homozygote model (C2C2 vs C1C1: OR = 1.85, 95% CI = 1.20-2.85, P = 0.005) and recessive model (C2C2 vs C1C2/C1C1: OR = 1.89, 95% CI = 1.23-2.89, P = 0.003). Protection effect was found in lung cancer in heterozygote model (C1C2 vs C1C1: OR = 0.82, 95% CI = 0.74-0.91, P respiratory system cancer. Furthermore, significant association was also found in Asian populations.

  3. Total suspended particles (TSP) and breathable particles (PM10) in Aburra Valley, Colombia

    International Nuclear Information System (INIS)

    Saldarriaga Molina, Julio Cesar; Echeverri Londono, Carlos Alberto; Molina Perez Francisco Jose


    In the Aburra's valley, nor-western region of Colombia, inhabited by 3 million people, crossed by 400,000 vehicles; with the presence of establishments of industrial sectors: textile, foods and metal-mechanical; The concentrations of total suspended particles (PST) and breathable particles (PM 1 0) were evaluated, during the period: December of 2000 to June of 2001. The determinations of PST and PM 1 0 were performed in ten stations, distributed of north to the south, covering urban and rural zones with the municipalities of: Girardota, Bello, Medellin, Itagui, Sabaneta and Caldas. When analyzing relation PM 1 0/PST, was that the best statistical correlations are located in the zones center and the south of the valley. In addition the increasing tendency in relation PM 1 0/PST was observed, from 0.527 for the rural station Girardota (North), to 0.813 in the urban station Caldas (South). This gradient in relation PM 1 0/PST apparently this related to the wind regime that predominates in the Valley of Aburra with direction the north-south, which causes that the fine particles migrate of north to the south, increasing relation PM 1 0/PST in the same direction

  4. Differential effects of Pax3 on expression of polysialyltransferases STX and PST in TGF-β-treated normal murine mammary gland cells (United States)

    Guo, Dong; Guo, Jia; Li, Xiang


    Glycosylation of certain proteins at the mammalian cell surface is an essential event in carcinogenesis. Sialylation, one type of glycosylation, can act on multiple cell-behaviors, such as migration, growth, and malignant invasion. Two polysialyltransferases, ST8Sia II (STX) and ST8Sia IV (PST), are responsible for synthesis of polysialic acid on neural cell adhesion molecule. We showed previously that STX and PST are oppositely expressed in normal murine mammary gland cells undergoing transforming growth factor-β-induced epithelial-mesenchymal transition. The molecular basis for regulation of STX and PST remained unclear. In the present study, we observed that transcription factor Pax3 upregulates STX expression, downregulates PST expression, and modulates upregulated expression of PSA, which attaches primarily to neural cell adhesion molecule to form PSA-NCAM. Overexpression of Pax3 in normal murine mammary gland cells transformed the expression of epithelial-mesenchymal transition markers E-cadherin and N-cadherin, and significantly promoted cell migration, but had no effect on cell proliferation. PMID:27651434

  5. Characterization and Genetic Analysis of Rice Mutantcrr1Exhibiting Compromised Non-host Resistance toPuccinia striiformisf. sp.tritici(Pst). (United States)

    Zhao, Jing; Yang, Yuheng; Yang, Donghe; Cheng, Yulin; Jiao, Min; Zhan, Gangming; Zhang, Hongchang; Wang, Junyi; Zhou, Kai; Huang, Lili; Kang, Zhensheng


    Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most devastating diseases of wheat in China. Rapid change to virulence following release of resistant cultivars necessitates ongoing discovery and exploitation of new resistance resources. Considerable effort has been directed at non-host resistance (NHR) which is believed to be durable. In the present study we identified rice mutant crr1 (compromised resistance to rust 1) that exhibited compromised NHR to Pst . Compared with wild type rice variety Nipponbare, crr1 mutant displayed a threefold increase in penetration rate by Pst , and enhanced hyphal growth. The pathogen also developed haustoria in crr1 mesophyll cells, but failed to sporulate. The response to the adapted rice pathogen Magnaporthe oryzae was unchanged in crr1 relative to the wild type. Several defense-related genes involved in the SA- and JA-mediated defense pathways response and in phytoalexin synthesis (such as OsPR1a , OsLOX1 , and OsCPS4 ) were more rapidly and strongly induced in infected crr1 leaves than in the wild type, suggesting that other layers of defense are still in effect. Genetic analysis and mapping located the mutant loci at a region between markers ID14 and RM25792, which cover about 290 kb genome sequence on chromosome 10. Further fine mapping and cloning of the locus should provide further insights into NHR to rust fungi in rice, and may reveal new strategies for improving rust resistance in wheat.

  6. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.


    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  7. Use of the rep technique for allele replacement to construct mutants with deletions of the pstSCAB-phoU operon: evidence of a new role for the PhoU protein in the phosphate regulon. (United States)

    Steed, P M; Wanner, B L


    The phosphate regulon is negatively regulated by the PstSCAB transporter and PhoU protein by a mechanism that may involve protein-protein interaction(s) between them and the Pi sensor protein, PhoR. In order to study such presumed interaction(s), mutants with defined deletions of the pstSCAB-phoU operon were made. This was done by construction of M13 recombinant phage carrying these mutations and by recombination of them onto the chromosome by using a rep host (which cannot replicate M13) for allele replacement. These mutants were used to show that delta (pstSCAB-phoU) and delta (pstB-phoU) mutations abolished Pi uptake by the PstSCAB transporter, as expected, and that delta phoU mutations had no effect on uptake. Unexpectedly, delta phoU mutations had a severe growth defect, and this growth defect was (largely) alleviated by a compensatory mutation in the pstSCAB genes or in the phoBR operon, whose gene products positively regulate expression of the pstSCAB-phoU operon. Because delta phoU mutants that synthesize a functional PstSCAB transporter constitutively grew extremely poorly, the PhoU protein must have a new role, in addition to its role as a negative regulator. A role for the PhoU protein in intracellular Pi metabolism is proposed. Further, our results contradict those of M. Muda, N. N. Rao, and A. Torriani (J. Bacteriol. 174:8057-8064, 1992), who reported that the PhoU protein was required for Pi uptake. Images PMID:8226621

  8. The role of autophagy in chloroplast degradation and chlorophagy in immune defenses during Pst DC3000 (AvrRps4 infection.

    Directory of Open Access Journals (Sweden)

    Junjian Dong

    Full Text Available BACKGROUND: Chlorosis of leaf tissue normally observed during pathogen infection may result from the degradation of chloroplasts. There is a growing evidence to suggest that the chloroplast plays a significant role during pathogen infection. Although most degradation of the organelles and cellular structures in plants is mediated by autophagy, its role in chloroplast catabolism during pathogen infection is largely unknown. RESULTS: In this study, we investigated the function of autophagy in chloroplast degradation during avirulent Pst DC3000 (AvrRps4 infection. We examined the expression of defensive marker genes and suppression of bacterial growth using the electrolyte leakage assay in normal light (N and low light (L growing environments of wild-type and atg5-1 plants during pathogen treatment. Stroma-targeted GFP proteins (CT-GFP were observed with LysoTracker Red (LTR staining of autophagosome-like structures in the vacuole. The results showed that Arabidopsis expressed a significant number of small GFP-labeled bodies when infected with avirulent Pst DC3000 (AvrRps4. While barely detectable, there were small GFP-labeled bodies in plants with the CT-GFP expressing atg5-1 mutation. The results showed that chloroplast degradation depends on autophagy and this may play an important role in inhibiting pathogen growth. CONCLUSION: Autophagy plays a role in chloroplast degradation in Arabidopsis during avirulent Pst DC3000 (AvrRps4 infection. Autophagy dependent chloroplast degradation may be the primary source of reactive oxygen species (ROS as well as the pathogen-response signaling molecules that induce the defense response.

  9. The PST Project, Willie Herron's Street Mural Asco East of No West (2011 and the Mural Remix Tour: Power Relations on the Los Angeles Art Scene

    Directory of Open Access Journals (Sweden)

    Eva Zetterman


    Full Text Available This article departs from the huge art-curating project Pacific Standard Time: Art in L.A., 1945-1980, a Getty funded initiative running in Southern California from October 2011 to April 2012 with a collaboration of more than sixty cultural institutions coming together to celebrate the birth of the L.A. art scene. One of the Pacific Standard Time (PST exhibitions was Asco: Elite of the Obscure, A Retrospective, 1972-1987, running from September to December 2011 at the Los Angeles County Museum of Art (LACMA. This was the first retrospective of a conceptual performance group of Chicanos from East Los Angeles, who from the early 1970s to the mid 1980s acted out critical interventions in the politically contested urban space of Los Angles. In conjunction with the Asco retrospective at LACMA, the Getty Foundation co-sponsored a new street mural by the Chicano artist Willie Herron, paying homage to his years in the performance group Asco. The PST exhibition program also included so-called Mural Remix Tours, taking fine art audiences from LACMA to Herron's place-specific new mural in City Terrace in East Los Angeles. This article analyze the inclusion in the PST project of Herron's site-specific mural in City Terrace and the Mural Remix Tours to East Los Angeles with regard to the power relations of fine art and critical subculture, center and periphery, the mainstream and the marginal. As a physical monument dependent on a heavy sense of the past, Herron's new mural, titled Asco: East of No West, transforms the physical and social environment of City Terrace, changing its public space into an official place of memory. At the same time, as an art historical monument officially added to the civic map of Los Angeles, the mural becomes a permanent reminder of the segregation patterns that still exist in the urban space of Los Angeles.

  10. Dual projection of chiral p-forms in D = 2: The non-Abelian, PST and supersymmetric formulations of Hull's notons

    International Nuclear Information System (INIS)

    Abreu, E.M.C.


    Chiral p-forms are, in fact, present in many supersymmetric and supergravity models in two, six and ten dimensions. In this work, the dual projection procedure, which is essentially equivalent to a canonical transformation, is used to diagonalize some theories in D = 2 (0-forms). The dual projection performed here provides an alternative way of gauging the chiral components without the necessity of constraints. It is shown, through the dual projection, that the nonmover field (the noton) initially introduced by Hull to cancel out the Siegel anomaly, has non-Abelian, PST and supersymmetric formulations. (author)

  11. Inflammation and post-operative recovery in patients undergoing total knee arthroplasty-secondary analysis of a randomized controlled trial

    DEFF Research Database (Denmark)

    Langkilde, A; Jakobsen, T L; Bandholm, T Q


    OBJECTIVE: Reduced function persists for many patients after total knee arthroplasty (TKA). Inflammation is part of osteoarthritis' pathophysiology, and surgery induces a marked inflammatory response. We therefore wanted to explore the role of inflammation in long-term recovery after TKA, and thus...... conducted this secondary analysis of our randomized controlled trial (RCT) of physical rehabilitation ± progressive strength training (PST). We aimed to investigate whether (1) inflammation is associated with functional performance, knee-extension strength, and knee pain before TKA; (2) PST affects...... factor (TNF)-α at baseline; day 1, week 4, 8, and 26 after TKA. RESULTS: At baseline, suPAR (P = 006) was negatively associated with 6MWT. Neither baseline nor surgery-induced inflammation modified the response to rehabilitation ± PST. Only surgery-induced IL-10 was associated with Δ6MWT26 weeks...

  12. A PstI polymorphism at 3'UTR of goat POU1F1 gene and its effect on cashmere production. (United States)

    Lan, X Y; Shu, J H; Chen, H; Pan, C Y; Lei, C Z; Wang, X; Liu, S Q; Zhang, Y B


    POU1F1 is a positive regulator for prolactin (PRL) whose metabolites may directly or indirectly affect some aspects of the hair growth cycle, therefore, POU1F1 gene is an important candidate gene for cashmere traits selection through marker-assisted selection (MAS). Hence, in this study, the PCR-RFLP method was applied to detect a T>C transition determining a PstI polymorphism at the 3'UTR of POU1F1 locus and evaluate its associations with cashmere traits in 847 Inner Mongolia White Cashmere goats. In the analyzed population, the allelic frequencies for the T and C alleles are 0.959 and 0.041, respectively and the genotypic frequencies are in Hardy-Weinberg equilibrium (P > 0.05). Moreover, significant statistical relationships between the PstI polymorphism of POU1F1 gene and goat cashmere yields were found (*P cashmere yields in 2, 4, and 5 years old individuals, as well as with average cashmere yield. Hence, TT genotype is suggested to be a molecular marker for senior cashmere yield.

  13. Determining the Advantages, Costs, and Trade-Offs of a Novel Sodium Channel Mutation in the Copepod Acartia hudsonica to Paralytic Shellfish Toxins (PST.

    Directory of Open Access Journals (Sweden)

    Michael Finiguerra

    Full Text Available The marine copepod Acartia hudsonica was shown to be adapted to dinoflagellate prey, Alexandrium fundyense, which produce paralytic shellfish toxins (PST. Adaptation to PSTs in other organisms is caused by a mutation in the sodium channel. Recently, a mutation in the sodium channel in A. hudsonica was found. In this study, we rigorously tested for advantages, costs, and trade-offs associated with the mutant isoform of A. hudsonica under toxic and non-toxic conditions. We combined fitness with wild-type: mutant isoform ratio measurements on the same individual copepod to test our hypotheses. All A. hudsonica copepods express both the wild-type and mutant sodium channel isoforms, but in different proportions; some individuals express predominantly mutant (PMI or wild-type isoforms (PWI, while most individuals express relatively equal amounts of each (EI. There was no consistent pattern of improved performance as a function of toxin dose for egg production rate (EPR, ingestion rate (I, and gross growth efficiency (GGE for individuals in the PMI group relative to individuals in the PWI expression group. Neither was there any evidence to indicate a fitness benefit to the mutant isoform at intermediate toxin doses. No clear advantage under toxic conditions was associated with the mutation. Using a mixed-diet approach, there was also no observed relationship between individual wild-type: mutant isoform ratios and among expression groups, on both toxic and non-toxic diets, for eggs produced over three days. Lastly, expression of the mutant isoform did not mitigate the negative effects of the toxin. That is, the reductions in EPR from a toxic to non-toxic diet for copepods were independent of expression groups. Overall, the results did not support our hypotheses; the mutant sodium channel isoform does not appear to be related to adaptation to PST in A. hudsonica. Other potential mechanisms responsible for the adaptation are discussed.

  14. INSOLVENSI DALAM HUKUM KEPAILITAN DI INDONESIA (Studi Putusan No.48/Pailit/2012/Pn.Niaga.Jkt.Pst Antara PT. Telekomunikasi Selular Vs PT. Primajaya Informatika

    Directory of Open Access Journals (Sweden)

    hervana wahyu Prihatmaka


    Full Text Available Amendments to the Bankruptcy Law is dominant protect the interests of creditors, because it should be a provision which requires that the debtor should have to go bankrupt. This is contrary to the philosophy of universal bankruptcy. This study aims to determine the bankruptcy provisions in the bankruptcy law in Indonesia and analyze the determination of bankruptcy within the bankruptcy decision No. 48/Bankrupt/2012/PN.NIAGA.JKT.PST. This research is a normative law with normative juridical approach. The data used in this research is secondary data. This study uses literature study with qualitative analysis methods. The authors conclude, first, the provisions of bankruptcy in Indonesia is based on article 2, paragraph (1, which is when the debtor does not repay the debt that will be the bankruptcy estate will go into phase bankruptcy with two possibilities, namely (i after being declared bankrupt (ii Through PKPU. Secondly, Award Bankrupt Assets not yet in the stage of bankruptcy because of the Supreme Court overturned the decision of the Commercial Court Decision Number 48/Bankrupt/2012/PN.NIAGA.JKT.PST through decision Number 704K/Pdt.Sus/2012, which ended before the bankruptcy Telkomsel Meeting Debt Verification completed. Advice, first there should be amendments to the Law No. 37 of 2004 specifically test the concept of insolvency and bankruptcy. The authors are aware that this study is not perfect, so the authors hope that further research is done, to continue and resolve the issues raised in this study. Keywords: Bankruptcy, Insolvency, the Rule of Law

  15. Total protein (United States)

    ... page: // Total protein To use the sharing features on this page, please enable JavaScript. The total protein test measures the total amount of two classes ...

  16. Cubierta suspendida para una nave industrial, en Mantua (Italia

    Directory of Open Access Journals (Sweden)

    Nervi, Pier Luigi


    Full Text Available This building is owned by the Burgo Society, and will house one of the three largest paper making machines in the world. It occupies a surface of 250 by 50 metres, and has no intermediate supports. The roof is undoubtedly the most important feature of it. Two framed towers, 50 m high, and of a distinctive outline, support four main cables, from which secondary hangers support the metal framework of the roof itself. The towers are separated 163 m from each other, and the suspension cables extend a further 43 m on each side of them. The enclosing walls consist of metal columns, separated by large glazed panels, and based on brick and concrete foundations. The joint between the independent vertical walls and the horizontal roof has been effected with plastic materials, which allow for the relative deflections of both the walls and the roof.Este edificio ha sido construido por la Sociedad Burgo, para albergar una de las tres mayores máquinas del mundo en la fabricación de papel. Su planta, de 350x30, está libre de soportes intermedios. La cubierta es, sin duda, la parte más interesante de la obra. Dos torres porticadas de 50 m de altura y graciosa línea soportan cuatro cables principales, desde los cuales parten los secundarios que sostienen el reticulado metálico de la cubierta propiamente dicha. Estas torres están situadas entre sí a 163 m, con dos vuelos laterales de 43 metros. Los muros de cerramiento están formados por montantes metálicos, con grandes zonas intermedias de cristal, sobre base de fábrica de ladrillo y hormigón. La unión entre muros independientes y cubierta se ha realizado con materiales plásticos, con objeto de permitir los movimientos relativos de ambos elementos constructivos.

  17. Total algorithms

    NARCIS (Netherlands)

    Tel, G.

    We define the notion of total algorithms for networks of processes. A total algorithm enforces that a "decision" is taken by a subset of the processes, and that participation of all processes is required to reach this decision. Total algorithms are an important building block in the design of

  18. Totally James (United States)

    Owens, Tom


    This article presents an interview with James Howe, author of "The Misfits" and "Totally Joe". In this interview, Howe discusses tolerance, diversity and the parallels between his own life and his literature. Howe's four books in addition to "The Misfits" and "Totally Joe" and his list of recommended books with lesbian, gay, bisexual, transgender,…


    Directory of Open Access Journals (Sweden)

    Ingrid Vilar Accioly


    Full Text Available Características cariotípicas do microcrustáceo Artemia franciscana Kellog, 1906, introduzida nas salinas do litoral nordeste do Brasil, na década de 70, foram investigadas através de coloração convencional, bandamento C, endonucleases de restrição (EcoRI, PstI e KpnI e Ag-NORs. O cariótipo consiste de 42 cromossomos, onde se individualiza sobre alguns pares a presença de constrições secundárias. Grandes blocos heterocromáticos encontram-se distribuídos nas porções teloméricas da maioria dos cromossomos. A digestão com PstI e KpnI revelou um padrão similar ao obtido pelo bandamento C. Preparações tratadas com EcoRI apresentam digestão das regiões heterocromáticas indicando a presença de sítios de restrição nestas regiões. Ag-NORs múltiplas estão associadas a blocos heterocromáticos. Os dados apresentados representam passo inicial para identificação de possíveis modificações ocorridas após o isolamento geográfico desta amostra, assim como no entendimento das modificações evolutivas ocorridas no cariótipo deste grupo. Palavras-chave: bandamento cromossômico, camarão de água salgada, citogenética de crustáceos. DOI:

  20. Total Thyroidectomy

    Directory of Open Access Journals (Sweden)

    Lopez Moris E


    Full Text Available Total thyroidectomy is a surgery that removes all the thyroid tissue from the patient. The suspect of cancer in a thyroid nodule is the most frequent indication and it is presume when previous fine needle puncture is positive or a goiter has significant volume increase or symptomes. Less frequent indications are hyperthyroidism when it is refractory to treatment with Iodine 131 or it is contraindicated, and in cases of symptomatic thyroiditis. The thyroid gland has an important anatomic relation whith the inferior laryngeal nerve and the parathyroid glands, for this reason it is imperative to perform extremely meticulous dissection to recognize each one of these elements and ensure their preservation. It is also essential to maintain strict hemostasis, in order to avoid any postoperative bleeding that could lead to a suffocating neck hematoma, feared complication that represents a surgical emergency and endangers the patient’s life.It is essential to run a formal technique, without skipping steps, and maintain prudence and patience that should rule any surgical act.

  1. Pollutant Source Tracking (PST) Technical Guidance (United States)


    James A.Water, Leigh A.Burgonyne, David E.A. Catcheside, Winnie Dejonghe, Natalie Leys, Karolien Vanbroekhoven, Priyabrata Pattnaik and Duane Graves...Belshaw, G.W. Canters , E.C. de Waal, U. Weser, B.K. Burgess, and B. Salvato. 2002. Mass fractionation processes of transition metal isotopes. Earth and

  2. Finiteness of PST self-dual models

    International Nuclear Information System (INIS)

    Del Cima, Oswaldo M.; Piguet, Olivier; Sarandy, Marcelo S.


    The Pasti-Sorokin-Tonin model for describing chiral forms is considered at the quantum level. We study the ultraviolet and infrared behaviour of the model in two, four and six dimensions in the framework of algebraic renormalization. The absence of anomalies, as well as the finiteness, up to non-physical renormalizations, are shown in all dimensions analyzed. (author)

  3. Eramu Tallinnas : Lootuse pst. 78 = Private home, Lootuse puiestee : Lootuse pst. 78, Tallinn / Epp Lankots

    Index Scriptorium Estoniae

    Lankots, Epp, 1976-


    Kahepereelamu mõlemad korterid ulatuvad läbi kahe tasapinna, nende vahele jääb saunast, panipaigast ning tehnilistest ruumidest koosnev plokk. Arhitektid: Tõnu Laigu, Tõnu Laanemäe. Sisearhitekt: Taevo Gans. Ill.: 2 värv. välis- ja 2 sisevaadet

  4. PSt-b-PU-b-PSt copolymers using tetraphenylethane-urethane macroinitiator through SARA ATRP

    Directory of Open Access Journals (Sweden)

    P. Chmielarz


    Full Text Available The course of supplemental activator and reducing agent (SARA atom transfer radical polymerization (ATRP has been presented in the presence of Cu0. The novelty of this work is that SARA ATRP has been used for the first time to synthesize polystyrene-b-polyurethane-b-polystyrene copolymers by using tetraphenylethane-urethane macroinitiator as transitional products reacting with styrene in the presence of CuIIBr2/TPMA catalyst complex. The influence of copper surface area on the polymerization was examined. It was confirmed that in all cases, both the molecular weight of resulting copolymer increases linearly with increasing conversion as well as the value of ln([M]0/[M] as a function of polymerization time increases linearly. A successful formation of the urethane-styrene copolymers was confirmed by NMR spectral studies.

  5. Total iron binding capacity (United States)

    ... page: // Total iron binding capacity To use the sharing features on this page, please enable JavaScript. Total iron binding capacity (TIBC) is a blood test to ...

  6. Technique of total thyroidectomy

    International Nuclear Information System (INIS)

    Rao, R.S.


    It is essential to define the various surgical procedures that are carried out for carcinoma of the thyroid gland. They are thyroid gland, subtotal lobectomy, total thyroidectomy and near total thyroidectomy

  7. Total parenteral nutrition (United States)

    ... Total parenteral nutrition To use the sharing features on this page, please enable JavaScript. Total parenteral nutrition (TPN) is a method of feeding that bypasses ...

  8. Total parenteral nutrition - infants (United States)

    ... Total parenteral nutrition - infants To use the sharing features on this page, please enable JavaScript. Total parenteral nutrition (TPN) is a method of feeding that bypasses ...

  9. Total well dominated trees

    DEFF Research Database (Denmark)

    Finbow, Arthur; Frendrup, Allan; Vestergaard, Preben D.

    cardinality then G is a total well dominated graph. In this paper we study composition and decomposition of total well dominated trees. By a reversible process we prove that any total well dominated tree can both be reduced to and constructed from a family of three small trees....

  10. Reemplazo total de cadera


    Sánchez Vergel, Alfredo; Fundación Valle de Lili


    Definición/Tipos de prótesis/ ¿Qué pacientes se podrían beneficiar de un reemplazo total de cadera?/Artrosis de cadera/Tipos de artrosis de cadera/Alternativas al reemplazo total de cadera/Preguntas frecuentes sobre el reemplazo total de cadera.

  11. Efectos de la aplicación de coberturas de sombreo suspendidas sobre balsas de riego


    Maestre Valero, José Francisco


    [SPA] En las últimas décadas la escasez de agua para riego ha aumentado en las regiones áridas y semiáridas. Así ocurre en la Cuenca del Segura (sureste de España), donde el incremento de la demanda agrícola ha ejercido una fuerte presión sobre los recursos hídricos, alcanzando un déficit estructural de 460 hm3 que afecta a 2,7·105 ha de regadío (CHS, 2007). Con el objetivo de mejorar la eficiencia y la productividad del uso del agua en la agricultura de esta cuenca, los sistemas tradicionale...

  12. Totalization Data Exchange (TDEX) (United States)

    Social Security Administration — The Totalization Data Exchange (TDEX) process is an exchange between SSA and its foreign country partners to identify deaths of beneficiaries residing abroad. The...

  13. Total Synthesis of Avrainvilleol. (United States)

    Wegener, Aaron; Miller, Kenneth A


    The first total synthesis of the marine natural product avrainvilleol is reported. The total synthesis features the first application of the transition-metal-free coupling of a tosyl hydrazone and a boronic acid to the preparation of a complex natural product, and the first example of this coupling with a hindered diortho substituted hydrazone substrate.

  14. Laparoscopic total pancreatectomy (United States)

    Wang, Xin; Li, Yongbin; Cai, Yunqiang; Liu, Xubao; Peng, Bing


    Abstract Rationale: Laparoscopic total pancreatectomy is a complicated surgical procedure and rarely been reported. This study was conducted to investigate the safety and feasibility of laparoscopic total pancreatectomy. Patients and Methods: Three patients underwent laparoscopic total pancreatectomy between May 2014 and August 2015. We reviewed their general demographic data, perioperative details, and short-term outcomes. General morbidity was assessed using Clavien–Dindo classification and delayed gastric emptying (DGE) was evaluated by International Study Group of Pancreatic Surgery (ISGPS) definition. Diagnosis and Outcomes: The indications for laparoscopic total pancreatectomy were intraductal papillary mucinous neoplasm (IPMN) (n = 2) and pancreatic neuroendocrine tumor (PNET) (n = 1). All patients underwent laparoscopic pylorus and spleen-preserving total pancreatectomy, the mean operative time was 490 minutes (range 450–540 minutes), the mean estimated blood loss was 266 mL (range 100–400 minutes); 2 patients suffered from postoperative complication. All the patients recovered uneventfully with conservative treatment and discharged with a mean hospital stay 18 days (range 8–24 days). The short-term (from 108 to 600 days) follow up demonstrated 3 patients had normal and consistent glycated hemoglobin (HbA1c) level with acceptable quality of life. Lessons: Laparoscopic total pancreatectomy is feasible and safe in selected patients and pylorus and spleen preserving technique should be considered. Further prospective randomized studies are needed to obtain a comprehensive understanding the role of laparoscopic technique in total pancreatectomy. PMID:28099344

  15. Total synthesis of ciguatoxin. (United States)

    Hamajima, Akinari; Isobe, Minoru


    Something fishy: Ciguatoxin (see structure) is one of the principal toxins involved in ciguatera poisoning and the target of a total synthesis involving the coupling of three segments. The key transformations in this synthesis feature acetylene-dicobalthexacarbonyl complexation.

  16. Total 2004 results

    Energy Technology Data Exchange (ETDEWEB)



    This document presents the 2004 results of Total Group: consolidated account, special items, number of shares, market environment, adjustment for amortization of Sanofi-Aventis merger-related intangibles, 4. quarter 2004 results (operating and net incomes, cash flow), upstream (results, production, reserves, recent highlights), downstream (results, refinery throughput, recent highlights), chemicals (results, recent highlights), Total's full year 2004 results (operating and net income, cash flow), 2005 sensitivities, Total SA parent company accounts and proposed dividend, adoption of IFRS accounting, summary and outlook, main operating information by segment for the 4. quarter and full year 2004: upstream (combined liquids and gas production by region, liquids production by region, gas production by region), downstream (refined product sales by region, chemicals), Total financial statements: consolidated statement of income, consolidated balance sheet (assets, liabilities and shareholder's equity), consolidated statements of cash flows, business segments information. (J.S.)

  17. Total 2004 results

    International Nuclear Information System (INIS)


    This document presents the 2004 results of Total Group: consolidated account, special items, number of shares, market environment, adjustment for amortization of Sanofi-Aventis merger-related intangibles, 4. quarter 2004 results (operating and net incomes, cash flow), upstream (results, production, reserves, recent highlights), downstream (results, refinery throughput, recent highlights), chemicals (results, recent highlights), Total's full year 2004 results (operating and net income, cash flow), 2005 sensitivities, Total SA parent company accounts and proposed dividend, adoption of IFRS accounting, summary and outlook, main operating information by segment for the 4. quarter and full year 2004: upstream (combined liquids and gas production by region, liquids production by region, gas production by region), downstream (refined product sales by region, chemicals), Total financial statements: consolidated statement of income, consolidated balance sheet (assets, liabilities and shareholder's equity), consolidated statements of cash flows, business segments information. (J.S.)

  18. Genoptraening efter total knaealloplastik

    DEFF Research Database (Denmark)

    Holm, Bente; Kehlet, Henrik


    The short- and long-term benefits of post-discharge physiotherapy regimens after total knee arthroplasty are debatable. A national survey including hospitals in Denmark that perform total knee arthroplasty showed a large variability in indication and regimen for post-knee arthroplasty rehabilitat......The short- and long-term benefits of post-discharge physiotherapy regimens after total knee arthroplasty are debatable. A national survey including hospitals in Denmark that perform total knee arthroplasty showed a large variability in indication and regimen for post-knee arthroplasty...... rehabilitation. Since hospital stay duration has decreased considerably, the need for post-discharge physiotherapy may also have changed. Thus, the indication for and types of rehabilitation programmes need to be studied within the context of fast-track knee arthroplasty....

  19. Genoptraening efter total knaealloplastik

    DEFF Research Database (Denmark)

    Holm, Bente; Kehlet, Henrik


    The short- and long-term benefits of post-discharge physiotherapy regimens after total knee arthroplasty are debatable. A national survey including hospitals in Denmark that perform total knee arthroplasty showed a large variability in indication and regimen for post-knee arthroplasty rehabilitat......The short- and long-term benefits of post-discharge physiotherapy regimens after total knee arthroplasty are debatable. A national survey including hospitals in Denmark that perform total knee arthroplasty showed a large variability in indication and regimen for post-knee arthroplasty...... rehabilitation. Since hospital stay duration has decreased considerably, the need for post-discharge physiotherapy may also have changed. Thus, the indication for and types of rehabilitation programmes need to be studied within the context of fast-track knee arthroplasty. Udgivelsesdato: 2009-Feb-23...

  20. Total lymphoid irradiation

    International Nuclear Information System (INIS)

    Sutherland, D.E.; Ferguson, R.M.; Simmons, R.L.; Kim, T.H.; Slavin, S.; Najarian, J.S.


    Total lymphoid irradiation by itself can produce sufficient immunosuppression to prolong the survival of a variety of organ allografts in experimental animals. The degree of prolongation is dose-dependent and is limited by the toxicity that occurs with higher doses. Total lymphoid irradiation is more effective before transplantation than after, but when used after transplantation can be combined with pharmacologic immunosuppression to achieve a positive effect. In some animal models, total lymphoid irradiation induces an environment in which fully allogeneic bone marrow will engraft and induce permanent chimerism in the recipients who are then tolerant to organ allografts from the donor strain. If total lymphoid irradiation is ever to have clinical applicability on a large scale, it would seem that it would have to be under circumstances in which tolerance can be induced. However, in some animal models graft-versus-host disease occurs following bone marrow transplantation, and methods to obviate its occurrence probably will be needed if this approach is to be applied clinically. In recent years, patient and graft survival rates in renal allograft recipients treated with conventional immunosuppression have improved considerably, and thus the impetus to utilize total lymphoid irradiation for its immunosuppressive effect alone is less compelling. The future of total lymphoid irradiation probably lies in devising protocols in which maintenance immunosuppression can be eliminated, or nearly eliminated, altogether. Such protocols are effective in rodents. Whether they can be applied to clinical transplantation remains to be seen

  1. Totally optimal decision rules

    KAUST Repository

    Amin, Talha


    Optimality of decision rules (patterns) can be measured in many ways. One of these is referred to as length. Length signifies the number of terms in a decision rule and is optimally minimized. Another, coverage represents the width of a rule’s applicability and generality. As such, it is desirable to maximize coverage. A totally optimal decision rule is a decision rule that has the minimum possible length and the maximum possible coverage. This paper presents a method for determining the presence of totally optimal decision rules for “complete” decision tables (representations of total functions in which different variables can have domains of differing values). Depending on the cardinalities of the domains, we can either guarantee for each tuple of values of the function that totally optimal rules exist for each row of the table (as in the case of total Boolean functions where the cardinalities are equal to 2) or, for each row, we can find a tuple of values of the function for which totally optimal rules do not exist for this row.

  2. Totally Nonnegative Matrices

    CERN Document Server

    Fallat, Shaun M


    Totally nonnegative matrices arise in a remarkable variety of mathematical applications. This book is a comprehensive and self-contained study of the essential theory of totally nonnegative matrices, defined by the nonnegativity of all subdeterminants. It explores methodological background, historical highlights of key ideas, and specialized topics.The book uses classical and ad hoc tools, but a unifying theme is the elementary bidiagonal factorization, which has emerged as the single most important tool for this particular class of matrices. Recent work has shown that bidiagonal factorization

  3. Qualità totale e mobilità totale Total Quality and Total Mobility

    Directory of Open Access Journals (Sweden)

    Giuseppe Trieste


    Full Text Available FIABA ONLUS (Italian Fund for Elimination of Architectural Barriers was founded in 2000 with the aim of promoting a culture of equal opportunities and, above all, it has as its main goal to involve public and private institutions to create a really accessible and usable environment for everyone. Total accessibility, Total usability and Total mobility are key indicators to define quality of life within cities. A supportive environment that is free of architectural, cultural and psychological barriers allows everyone to live with ease and universality. In fact, people who access to goods and services in the urban context can use to their advantage time and space, so they can do their activities and can maintain relationships that are deemed significant for their social life. The main aim of urban accessibility is to raise the comfort of space for citizens, eliminating all barriers that discriminate people, and prevent from an equality of opportunity. “FIABA FUND - City of ... for the removal of architectural barriers” is an idea of FIABA that has already affected many regions of Italy as Lazio, Lombardy, Campania, Abruzzi and Calabria. It is a National project which provides for opening a bank account in the cities of referring, in which for the first time, all together, individuals and private and public institutions can make a donation to fund initiatives for the removal of architectural barriers within its own territory for a real and effective total accessibility. Last February the fund was launched in Rome with the aim of achieving a Capital without barriers and a Town European model of accessibility and usability. Urban mobility is a prerequisite to access to goods and services, and to organize activities related to daily life. FIABA promotes the concept of sustainable mobility for all, supported by the European Commission’s White Paper. We need a cultural change in management and organization of public means, which might focus on

  4. Total Water Management - Report (United States)

    There is a growing need for urban water managers to take a more holistic view of their water resource systems as population growth, urbanization, and current operations put different stresses on the environment and urban infrastructure. Total Water Management (TWM) is an approac...

  5. Total knee arthroplasty

    DEFF Research Database (Denmark)

    Schrøder, Henrik M.; Petersen, Michael M.


    Total knee arthroplasty (TKA) is a successful treatment of the osteoarthritic knee, which has increased dramatically over the last 30 years. The indication is a painful osteoarthritic knee with relevant radiographic findings and failure of conservative measures like painkillers and exercise...

  6. Total versus subtotal hysterectomy

    DEFF Research Database (Denmark)

    Gimbel, Helga; Zobbe, Vibeke; Andersen, Anna Birthe


    The aim of this study was to compare total and subtotal abdominal hysterectomy for benign indications, with regard to urinary incontinence, postoperative complications, quality of life (SF-36), constipation, prolapse, satisfaction with sexual life, and pelvic pain at 1-year postoperative. Eighty...

  7. Total Quality Management Seminar. (United States)

    Massachusetts Career Development Inst., Springfield.

    This booklet is one of six texts from a workplace literacy curriculum designed to assist learners in facing the increased demands of the workplace. The booklet contains seven sections that cover the following topics: (1) meaning of total quality management (TQM); (2) the customer; (3) the organization's culture; (4) comparison of management…

  8. Total Quality Management Simplified. (United States)

    Arias, Pam


    Maintains that Total Quality Management (TQM) is one method that helps to monitor and improve the quality of child care. Lists four steps for a child-care center to design and implement its own TQM program. Suggests that quality assurance in child-care settings is an ongoing process, and that TQM programs help in providing consistent, high-quality…

  9. Total synthesis of aquatolide

    NARCIS (Netherlands)

    Saya, J.M.; Vos, K.; Klein Nijenhuis, R.A.; van Maarseveen, J.H.; Ingemann, S.; Hiemstra, H.


    A total synthesis of the sesquiterpene lactone aquatolide has been accomplished. The central step is an intramolecular [2 + 2]-photocycloaddition of an allene onto an alpha,beta-unsaturated delta-lactone. Other key steps are an intramolecular Horner-Wadsworth-Emmons reaction to close the lactone and

  10. CSF total protein (United States)

    CSF total protein is a test to determine the amount of protein in your spinal fluid, also called cerebrospinal fluid (CSF). ... The normal protein range varies from lab to lab, but is typically about 15 to 60 milligrams per deciliter (mg/dL) ...

  11. Total 2004 annual report

    International Nuclear Information System (INIS)


    This annual report of the Group Total brings information and economic data on the following topics, for the year 2004: the corporate governance, the corporate social responsibility, the shareholder notebook, the management report, the activities, the upstream (exploration and production) and downstream (refining and marketing) operating, chemicals and other matters. (A.L.B.)

  12. Total Cost of Ownership

    DEFF Research Database (Denmark)

    Zachariassen, Frederik


    Total Cost of Ownership (TCO), som giver et bud på, hvordan virksomheder kan opnå en bedre indsigt i, hvilke leverandører der forårsager hvilke omkostninger og dermed danne et forbedret beslutningsgrundlag for besparelser i leverandørleddet. I artiklen argumenteres først og fremmest for, hvorfor TCO er...

  13. Total design of participation

    DEFF Research Database (Denmark)

    Munch, Anders V.


    The idea of design as an art made not only for the people, but also by the people is an old dream going back at least to William Morris. It is, however, reappearing vigoriously in many kinds of design activism and grows out of the visions of a Total Design of society. The ideas of participation b...... for? To which degree should everyone be educated in ’design literacy’ to participate? Total design of participation is an artistic intervention in society and must be discussed in this utopian tradition....... by Tim Brown can be compared to considerations by László Moholy-Nagy and Walter Gropuis on the training and education of active and capable citizens. This opens, though, some dilemmas to discuss: To what extend is the capability of creativity then a (pre)condition to be a citizen of the society wished...


    Directory of Open Access Journals (Sweden)

    Anca ȘERBAN


    Full Text Available The purpose of this paper is to present the evolution of the Balanced Scorecard from a measurement instrument to a strategic performance management tool and to highlight the advantages of implementing the Total Performance Scorecard, especially for Human Resource Management. The study has been accomplished using the methodology of bibliographic study and various secondary sources. Implementing the classical Balanced Scorecard indicated over the years, repeatedly failure. It can be indicated that the crucial level is determined by the learning and growth perspective. It has been developed from a human perspective, which focused on staff satisfaction, innovation perspective with focus on future developments. Integrating the Total Performance Scorecard in an overall framework assures the company’s success, by keeping track of the individual goals, the company’s objectives and strategic directions. Like this, individual identity can be linked to corporate brand, individual aspirations to business goals and individual learning objectives to needed organizational capabilities.

  15. Total 2003 Results

    International Nuclear Information System (INIS)


    This document presents the 2003 results of Total Group: consolidated account, special items, number of shares, market environment, 4. quarter 2003 results, full year 2003 results, upstream (key figures, proved reserves), downstream key figures, chemicals key figures, parent company accounts and proposed dividends, 2004 sensitivities, summary and outlook, operating information by segment for the 4. quarter and full year 2003: upstream (combined liquids and gas production by region, liquids production by region, gas production by region), downstream (refinery throughput by region, refined product sales by region, chemicals), impact of allocating contribution of Cepsa to net operating income by business segment: equity in income (loss) and affiliates and other items, Total financial statements: consolidated statement of income, consolidated balance sheet (assets, liabilities and shareholder's equity), consolidated statements of cash flows, business segments information. (J.S.)

  16. Outpatient Total Joint Arthroplasty. (United States)

    Bert, Jack M; Hooper, Jessica; Moen, Sam


    Outpatient total joint arthroplasty (OTJA) allows for a safe, cost effective pathway for appropriately selected patients. With current pressures on arthroplasty surgeons and their associated institutions to reduce costs per episode of care, it is important to define the steps and challenges associated with establishing an outpatient arthroplasty program. Several studies have outlined techniques of selecting patients suitable for this type of postoperative pathway. With emerging concerns about patients who undergo outpatient arthroplasty being at increased risk of medical complications, which may lessen projected cost savings, it is important to identify value-based strategies to optimize patient recovery after OTJA. This article reviews digital techniques for patient selection and data collection, operating room efficiency systems, and provides a summary of methods to build and maintain value in outpatient total joint replacement within the framework of bundled payment reimbursement.

  17. Totally parallel multilevel algorithms (United States)

    Frederickson, Paul O.


    Four totally parallel algorithms for the solution of a sparse linear system have common characteristics which become quite apparent when they are implemented on a highly parallel hypercube such as the CM2. These four algorithms are Parallel Superconvergent Multigrid (PSMG) of Frederickson and McBryan, Robust Multigrid (RMG) of Hackbusch, the FFT based Spectral Algorithm, and Parallel Cyclic Reduction. In fact, all four can be formulated as particular cases of the same totally parallel multilevel algorithm, which are referred to as TPMA. In certain cases the spectral radius of TPMA is zero, and it is recognized to be a direct algorithm. In many other cases the spectral radius, although not zero, is small enough that a single iteration per timestep keeps the local error within the required tolerance.

  18. Total quality accounting


    Andrijašević Maja


    The focus of competitive "battle" shifted from the price towards non-price instruments, above all, towards quality that became the key variable for profitability increase and achievement of better comparative position of a company. Under such conditions, management of a company, which, according to the established and certified system of total quality, strives towards achieving of a better market position, faces the problem of quality cost measurement and determination. Management, above all,...

  19. Total - annual report 2005

    International Nuclear Information System (INIS)


    This annual report presents the activities and results of TOTAL S.A., french society on oil and gas. It deals with statistics, the managers, key information on financial data and risk factors, information on the Company, unresolved Staff Comments, employees, major Shareholders, consolidated statements, markets, security, financial risks, defaults dividend arrearages and delinquencies, controls and procedures, code of ethics and financial statements. (A.L.B.)

  20. Total aerosol effect


    Lohmann, Ulrike; Rotstayn, Leon; Storelvmo, Trude; Jones, Andrew; Menon, Surabi; Quaas, Johannes; Ekman, Annica M. L.; Koch, Dorothy; Ruedy, Reto A.


    Uncertainties in aerosol radiative forcings, especially those associated with clouds, contribute to a large extent to uncertainties in the total anthropogenic forcing. The interaction of aerosols with clouds and radiation introduces feedbacks which can affect the rate of precipitation formation. In former assessments of aerosol radiative forcings, these effects have not been quantified. Also, with global aerosol-climate models simulating interactively aerosols and cloud microphysical prope...

  1. Cervical Total Disc Arthroplasty


    Basho, Rahul; Hood, Kenneth A.


    Symptomatic adjacent segment degeneration of the cervical spine remains problematic for patients and surgeons alike. Despite advances in surgical techniques and instrumentation, the solution remains elusive. Spurred by the success of total joint arthroplasty in hips and knees, surgeons and industry have turned to motion preservation devices in the cervical spine. By preserving motion at the diseased level, the hope is that adjacent segment degeneration can be prevented. Multiple cervical disc...

  2. Total space in resolution

    Czech Academy of Sciences Publication Activity Database

    Bonacina, I.; Galesi, N.; Thapen, Neil


    Roč. 45, č. 5 (2016), s. 1894-1909 ISSN 0097-5397 R&D Projects: GA ČR GBP202/12/G061 EU Projects: European Commission(XE) 339691 - FEALORA Institutional support: RVO:67985840 Keywords : total space * resolution random CNFs * proof complexity Subject RIV: BA - General Mathematics Impact factor: 1.433, year: 2016

  3. Total Absorption Spectroscopy

    International Nuclear Information System (INIS)

    Rubio, B.; Gelletly, W.


    The problem of determining the distribution of beta decay strength (B(GT)) as a function of excitation energy in the daughter nucleus is discussed. Total Absorption Spectroscopy is shown to provide a way of determining the B(GT) precisely. A brief history of such measurements and a discussion of the advantages and disadvantages of this technique, is followed by examples of two recent studies using the technique. (authors)

  4. Sobredentadura total superior implantosoportada

    Directory of Open Access Journals (Sweden)

    Luis Orlando Rodríguez García


    Full Text Available Se presenta un caso de un paciente desdentado total superior, rehabilitado en la consulta de implantología de la Clínica "Pedro Ortiz" del municipio Habana del Este en Ciudad de La Habana, Cuba, en el año 2009, mediante prótesis sobre implantes osteointegrados, técnica que se ha incorporado a la práctica estomatológica en Cuba como alternativa al tratamiento convencional en los pacientes desdentados totales. Se siguió un protocolo que comprendió una fase quirúrgica, procedimiento con o sin realización de colgajo y carga precoz o inmediata. Se presenta un paciente masculino de 56 años de edad, que acudió a la consulta multidisciplinaria, preocupado, porque se le habían elaborado tres prótesis en los últimos dos años y ninguna reunía los requisitos de retención que él necesitaba para sentirse seguro y cómodo con las mismas. El resultado final fue la satisfacción total del paciente, con el mejoramiento de la calidad estética y funcional.

  5. TOTAL annual report 2003

    International Nuclear Information System (INIS)


    This 2003 annual report of the Group Total provides economical results and information of the society on the following topics: keys data, the corporate governance (Directors charter, board of directors, audit committee, nomination and remuneration committee, internal control procedures, compensation of directors and executive officers), the corporate social responsibility (environmental stewardship, the future of energy management, the safety enhancement, the human resources, ethics and local development), the investor relations, the management report, the upstream exploration and production, the downstream refining, marketing, trading and shipping, the chemicals and financial and legal information. (A.L.B.)

  6. Total Synthesis of Strychnine. (United States)

    Lee, Geun Seok; Namkoong, Gil; Park, Jisook; Chen, David Y-K


    The total synthesis of the flagship Strychnos indole alkaloid, strychnine, has been accomplished. The developed synthetic sequence features a novel vinylogous 1,4-addition, a challenging iodinium salt mediated silyl enol ether arylation, a palladium-catalyzed Heck reaction, and a streamlined late-stage conversion to strychnine. Furthermore, an application of asymmetric counterion-directed catalysis (ACDC) in the context of target-oriented organic synthesis has been rendered access to an optically active material. The synthetic sequence described herein represents the most concise entry to optically active strychnine to date. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Total Synthesis of Hyperforin. (United States)

    Ting, Chi P; Maimone, Thomas J


    A 10-step total synthesis of the polycyclic polyprenylated acylphloroglucinol (PPAP) natural product hyperforin from 2-methylcyclopent-2-en-1-one is reported. This route was enabled by a diketene annulation reaction and an oxidative ring expansion strategy designed to complement the presumed biosynthesis of this complex meroterpene. The described work enables the preparation of a highly substituted bicyclo[3.3.1]nonane-1,3,5-trione motif in only six steps and thus serves as a platform for the construction of easily synthesized, highly diverse PPAPs modifiable at every position.

  8. Total quality accounting

    Directory of Open Access Journals (Sweden)

    Andrijašević Maja


    Full Text Available The focus of competitive "battle" shifted from the price towards non-price instruments, above all, towards quality that became the key variable for profitability increase and achievement of better comparative position of a company. Under such conditions, management of a company, which, according to the established and certified system of total quality, strives towards achieving of a better market position, faces the problem of quality cost measurement and determination. Management, above all, cost accounting can help in solving of this problem, but the question is how much of its potential is being used for that purpose.

  9. Total knee arthroplasty

    DEFF Research Database (Denmark)

    Schrøder, Henrik M.; Petersen, Michael M.


    Total knee arthroplasty (TKA) is a successful treatment of the osteoarthritic knee, which has increased dramatically over the last 30 years. The indication is a painful osteoarthritic knee with relevant radiographic findings and failure of conservative measures like painkillers and exercise...... surgeon seems to positively influence the rate of surgical complications and implant survival. The painful TKA knee should be thoroughly evaluated, but not revised except if a relevant indication can be established. The most frequent indications for revision are: aseptic loosening, instability, infection...

  10. Supravaginal eller total hysterektomi?

    DEFF Research Database (Denmark)

    Edvardsen, L; Madsen, E M


    is examined. It is concluded that the risk of developing carcinoma of the cervical stump is low, and no longer a weighty indication for the total in preference to the supravaginal hysterectomy as long as subsequent screening of the cervix is performed. At the same time it is important to inform the women...... carefully after the supravaginal operation in order to secure that subsequent screening actually is taking place. One must have a normal smear and offer a colposcopic examination before the operation. In general the rate of complications after both kind of hysterectomies is low. However, a few new studies...

  11. Total 2004 fact book

    International Nuclear Information System (INIS)


    This report presents the activities and results of the Group Total-Fina-Elf for the year 2004. It brings information and economic data on the following topics: the corporate and business; the upstream activities with the reserves, the costs, standardized measure and changes of discounted future net cash flow,oil and gas acreage, drilling, liquefied natural gas, pipelines; downstream activities with refining and marketing maps, refinery, petroleum products, sales, retail gasoline outlets; chemicals with sales and operating income by sector, major applications, base chemicals and polymers, intermediates and performance polymers. (A.L.B.)

  12. Total Factbook 2003

    International Nuclear Information System (INIS)


    This report presents the activities and results of the Group Total-Fina-Elf for the year 2003. It brings information and economic data on the following topics: the corporate and business; the upstream activities with the reserves, the costs, standardized measure and changes of discounted future net cash flow,oil and gas acreage, drilling, liquefied natural gas, pipelines; downstream activities with refining and marketing maps, refinery, petroleum products, sales, retail gasoline outlets; chemicals with sales and operating income by sector, major applications, base chemicals and polymers, intermediates and performance polymers. (A.L.B.)

  13. Total quality is people

    International Nuclear Information System (INIS)

    Vogel, C.E.


    Confronted by changing market conditions and increased global competition, in 1983 the Commercial Nuclear Fuel Division (CNFD) of Westinghouse Electric embarked on an ambitious plan to make total quality the centerpiece of its long-term business strategy. Five years later, the division's efforts in making continuous quality improvement a way of life among its more than 2,000 employees gained national recognition when it was named a charter recipient of the Malcolm Baldridge National Quality Award. What CNFD achieved during the 1980s was a cultural transformation, characterized by an empowered work force committed to a common vision. The company's quality program development strategy is described

  14. Total Logistic Plant Solutions

    Directory of Open Access Journals (Sweden)

    Dusan Dorcak


    Full Text Available The Total Logistics Plant Solutions, plant logistics system - TLPS, based on the philosophy of advanced control processes enables complex coordination of business processes and flows and the management and scheduling of production in the appropriate production plans and planning periods. Main attributes of TLPS is to create a comprehensive, multi-level, enterprise logistics information system, with a certain degree of intelligence, which accepts the latest science and research results in the field of production technology and logistics. Logistic model of company understands as a system of mutually transforming flows of materials, energy, information, finance, which is realized by chain activities and operations

  15. Total ankle joint replacement. (United States)


    Ankle arthritis results in a stiff and painful ankle and can be a major cause of disability. For people with end-stage ankle arthritis, arthrodesis (ankle fusion) is effective at reducing pain in the shorter term, but results in a fixed joint, and over time the loss of mobility places stress on other joints in the foot that may lead to arthritis, pain and dysfunction. Another option is to perform a total ankle joint replacement, with the aim of giving the patient a mobile and pain-free ankle. In this article we review the efficacy of this procedure, including how it compares to ankle arthrodesis, and consider the indications and complications. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  16. Total process surveillance: (TOPS)

    International Nuclear Information System (INIS)

    Millar, J.H.P.


    A Total Process Surveillance system is under development which can provide, in real-time, additional process information from a limited number of raw measurement signals. This is achieved by using a robust model based observer to generate estimates of the process' internal states. The observer utilises the analytical reduncancy among a diverse range of transducers and can thus accommodate off-normal conditions which lead to transducer loss or damage. The modular hierarchical structure of the system enables the maximum amount of information to be assimilated from the available instrument signals no matter how diverse. This structure also constitutes a data reduction path thus reducing operator cognitive overload from a large number of varying, and possibly contradictory, raw plant signals. (orig.)

  17. On total disc replacement. (United States)

    Berg, Svante


    Low back pain consumes a large part of the community's resources dedicated to health care and sick leave. Back disorders also negatively affect the individual leading to pain suffering, decreased quality-of-life and disability. Chronic low back pain (CLBP) due to degenerative disc disease (DDD) is today often treated with fusion when conservative treatment has failed and symptoms are severe. This treatment is as successful as arthroplasty is for hip arthritis in restoring the patient's quality of life and reducing disability. Even so, there are some problems with this treatment, one of these being recurrent CLBP from an adjacent segment (ASD) after primarily successful surgery. This has led to the development of alternative surgical treatments and devices that maintain or restore mobility, in order to reduce the risk for ASD. Of these new devices, the most frequently used are the disc prostheses used in Total Disc Replacement (TDR). This thesis is based on four studies comparing total disc replacement with posterior fusion. The studies are all based on a material of 152 patients with DDD in one or two segments, aged 20-55 years that were randomly treated with either posterior fusion or TDR. The first study concerned clinical outcome and complications. Follow-up was 100% at both one and two years. It revealed that both treatment groups had a clear benefit from treatment and that patients with TDR were better in almost all outcome scores at one-year follow-up. Fusion patients continued to improve during the second year. At two-year follow-up there was a remaining difference in favour of TDR for back pain. 73% in the TDR group and 63% in the fusion group were much better or totally pain-free (n.s.), while twice as many patients in the TDR group were totally pain free (30%) compared to the fusion group (15%). Time of surgery and total time in hospital were shorter in the TDR group. There was no difference in complications and reoperations, except that seventeen of the

  18. Primary total elbow arthroplasty

    Directory of Open Access Journals (Sweden)

    Suresh Kumar


    Full Text Available Background: Primary total elbow arthroplasty (TEA is a challenging procedure for orthopedic surgeons. It is not performed as frequently as compared to hip or knee arthroplasty. The elbow is a nonweight-bearing joint; however, static loading can create forces up to three times the body weight and dynamic loading up to six times. For elderly patients with deformity and ankylosis of the elbow due to posttraumatic arthritis or rheumatoid arthritis or comminuted fracture distal humerus, arthroplasty is one of the option. The aim of this study is to analyze the role of primary total elbow arthroplasty in cases of crippling deformity of elbow. Materials and Methods: We analyzed 11 cases of TEA, between December 2002 and September 2012. There were 8 females and 3 males. The average age was 40 years (range 30-69 years. The indications for TEA were rheumatoid arthritis, comminuted fracture distal humerus with intraarticular extension, and posttraumatic bony ankylosis of elbow joint. The Baksi sloppy (semi constrained hinge elbow prosthesis was used. Clinico-radiological followup was done at 1 month, 3 months, 6 months, 1 year, and then yearly basis. Results: In the present study, average supination was 70° (range 60-80° and average pronation was 70° (range 60-80°. Average flexion was 135° (range 130-135°. However, in 5 cases, there was loss of 15 to 35° (average 25° of extension (45° out of 11 cases. The mean Mayo elbow performance score was 95.4 points (range 70-100. Arm length discrepancy was only in four patients which was 36% out of 11 cases. Clinico-radiologically all the elbows were stable except in one case and no immediate postoperative complication was noted. Radiolucency or loosening of ulnar stem was seen in 2 cases (18% out of 11 cases, in 1 case it was noted after 5 years and in another after 10 years. In second case, revision arthroplasty was done, in which only ulnar hinge section, hinge screw and lock screw with hexagonal head

  19. Total disc replacement. (United States)

    Vital, J-M; Boissière, L


    Total disc replacement (TDR) (partial disc replacement will not be described) has been used in the lumbar spine since the 1980s, and more recently in the cervical spine. Although the biomechanical concepts are the same and both are inserted through an anterior approach, lumbar TDR is conventionally indicated for chronic low back pain, whereas cervical TDR is used for soft discal hernia resulting in cervicobrachial neuralgia. The insertion technique must be rigorous, with precise centering in the disc space, taking account of vascular anatomy, which is more complex in the lumbar region, particularly proximally to L5-S1. All of the numerous studies, including prospective randomized comparative trials, have demonstrated non-inferiority to fusion, or even short-term superiority regarding speed of improvement. The main implant-related complication is bridging heterotopic ossification with resulting loss of range of motion and increased rates of adjacent segment degeneration, although with an incidence lower than after arthrodesis. A sufficiently long follow-up, which has not yet been reached, will be necessary to establish definitively an advantage for TDR, particularly in the cervical spine. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  20. Total equipment parts configuration

    International Nuclear Information System (INIS)

    Ferrare, J.


    Florida Power ampersand Lights's (FP ampersand L's) Turkey Point units were built prior to the establishment of American Society of Mechanical Engineers' Sec. III requirements. Since that time, FP ampersand L has voluntarily committed to procuring some spare and replacement parts in compliance with the ordering requirements of ASME Sec. III. New subsystems were designed according to ASME Sec. III requirements. In 1978, 10CFR21 of the Code of Federal Regulations was federally mandated. Environmental qualification concerns and the Three Mile Island incident further complicated the stocking and ordering of spare and replacement parts. Turkey Point assembled a team of quality assurance, quality control, and engineering people and obtained permission to directly access the store department computer so that catalog descriptions could be quickly made available for use by the plant. The total equipment parts configuration (TEPC) system was designed and developed under the direction of the procurement document review team at the Turkey Point nuclear plant. The system is a network of related computer data bases that identifies the equipment at the plant. The equipment (or components that make up a piece of equipment) is identified by a tag/component code system. Each component is further broken down by the manufacturer's parts list or bill of material. A description of the data available to the user, the ways these data can be accessed and displayed, and a description of the data bases and their relation to each other are summarized in this paper

  1. Incapacidad laboral total

    Directory of Open Access Journals (Sweden)

    Orlando Díaz Tabares


    Full Text Available Se realizó un estudio longitudinal, descriptivo y retrospectivo con el objetivo de conocer el comportamiento de la incapacidad permanente para el trabajo en el municipio "San Cristóbal" durante el decenio 1982-1991, y se aplicó el método de encuesta por el que se recogieron datos que fueron extraídos del modelo oficial de peritaje médico laboral y de la entrevista con el peritado. Los resultados fueron plasmados en tablas de contingencias donde se relacionan las variables por cada año estudiado, y se aplicó la prueba estadística de chi cuadrado. El número de individuos dictaminados con incapacidad laboral total fue de 693; predominó en reportes el año 1988 con 114 casos y muy discretamente el sexo femenino sobre el masculino, el grupo etáreo de 45 a 54 años con 360 casos y la artrosis como entidad valorada por ortopedia, con análisis estadísticos significativos. No resultó estadísticamente significativo, el predominio de la hipertensión arterial sistémica entre las entidades valoradas por la especialidad de medicina interna como causas de incapacidad laboral. Fue muy significativa la variación del número de dictaminados por la comisión en cada uno de los años estudiados y que el porcentaje de ellos que se encontraban realizando trabajos que demandan esfuerzo físico de moderado a intenso al momento de aplicar la encuesta, ascendió al 64,9.A longitudinal, descriptive and retrospective study was conducted in order to know the behavior of permanent labor disability at the municipality of San Cristóbal during 1982-1991. A survey was done to collect data taken from the official model of medical inspections and from the interview with the disabled worker. The results were shown in contingency tables where the variables are related by every year studied. The chi square statistical test was applied. The number of individuals with labor disability was 693. As for reports, the year 1988 predominated with 114. There was a discreet

  2. Fractionation and determination of total antioxidant capacity, total ...

    African Journals Online (AJOL)

    There was a strong relationship (R2 = 0.77) between total antioxidant activity and total flavonoid contents and (R2 = 0.6517) for total phenolic content of the fractions. The present study demonstrated that V. doniana leaves extracts contain high amounts of flavonoids and phenolic compounds so that these compounds are ...

  3. Making PMMA, PMA, PVAc and PSt nano particles using radiation

    International Nuclear Information System (INIS)

    Hidi, P.; Napper, D.H.; Sangster, D.F.


    Full text: During the last decade considerable research effort has been directed to making very small (10-50 nm diam.) nano size polymer particles. Most of the techniques described used more than one surfactant at high concentrations and resulted in relatively low polymer concentration. We have developed methods to make nano size polymer particles from methyl methacrylate (MMA), methyl acrylate (MA), vinyl acetat (Vac) and styrene (St) with a single anionic surfactant and gamma radiation. We succeeded in making nano particles in up to 15% concentration and with much higher polymer/ surfactant ratio than the earlier methods. With the radiation technique we can obtain high yield of polymer and can control the particle size of the polymer in the 2 S 2 0 8 ) instead of gamma irradiation. At present we prefer gamma initiation, because we have much better control and reproducibility of the exothermic polymerisation reaction, hence the critical parameters can be evaluated more accurately. We have started to use the different nano particles prepared for adsorption studies, as seeds for polymerisation and for making transparent gels with nano structure. We are also looking for other applications of the nano particles. It should be noted that the surface area of 1 gram of 20 nm diameter spheres is 300m 2

  4. Kaubamaja Lemon : Estonia pst. 1/3, Tallinn / Piret Lindpere

    Index Scriptorium Estoniae

    Lindpere, Piret, 1963-


    1953. a. projekteeritud ja 1958. a. valminud Eesti Energia peahoone (arhitektid P. Tarvas, U. Tölpus) ümberehitus Lemoni kaubamajaks (arhitekt Martin Aunin). 3.-5. korrusel paiknevad büroopinnad. Fassaadi täienduseks on projekteeritud mettallkonstruktsioonil punktkinnitusega eenduv klaasvitriin. 4 välis- ja 3 sisevaadet

  5. Kaubamaja "Lemon" - Arco Ärikeskus : Estonia pst. 1, Tallinn

    Index Scriptorium Estoniae


    1958. a. valminud hoone rekonstrueerimine. Projekteerija: EA Reng. Arhitekt Martin Aunin. Ehituskonstruktsioonid: Riho Märtson. Insenertehnilised osad: Karmo Pajo, Maarika Kurvits, Eha Treial. Valgusinstallatsioon: Meeli Kõiva. Kaupluste mööbel, kohtvalgustus: Priit Põldme, Ants Tolli, Ruth-Helene Kaasik, Hugo Mitt, Mart Vesker, Tarmo Piirmets. Projekt 2001, valmis 2002. I korruse põhiplaan, 4 vaadet

  6. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    Triton X-100 lysis method.17 DNA (1 - 3 ~g) was amplified by. PCR using 1 unit of Taq1 polymerase in 50 ~l of reaction mixture containing polymerase buffer and 1 pmol of oligonucleotides. The primers used were: 5' GAGCGCTCTCGAGGAGTACAC 3' [bp 2238 - 2258] and. 5' GACTGGCTTCCACTGCTGTGC 3' [bp 2956 ...

  7. Hoiupanga peahoone. Tallinn, Rävala pst. 5

    Index Scriptorium Estoniae


    Projekteerimise ajaloost: 1985. a. Tallinna Moemaja arhitektuurikonkurss ja 1988. a. RPIs "Eesti Tööstusprojekt" valmis ENSV Kergetööstuse Ministeeriumi Teaduslik-Tehnilise Keskuse ja Tallinna Moemaja I ehitusjärgu projekt (R. Kurvitz, U. Muru); !991. a. AS Astlanda ärikeskuse tellimusel krundi hoonestamiseks eskiisprojekt (J. Okas, M. Lõoke) ning alternatiivprojekt (T. Altosaar). Kvartali hoonestuskava: Arhitektuuribüroo Kalle Rõõmus. Projekteerijad: SRV OY, arhitekt Kari Mökkälä, Arhitektuuribüroo Kalle Rõõmus, arhitekt Kullervo Kliimand. Sisekujundus: ARS Interjöörprojekt, autorid Karolin Kõll, Eero Jürgenson, Martin Pärn. Projektijuht: SRV Teräsbetooni Oy. Ehituse peatöövõtt: Eesti Ehitus. Konstruktiivne osa: E - Inseneribüroo. Projekt 1995-97, valmis 1997. Täismonteeritav karkasssüsteemis 7-korruseline büroohoone

  8. Comparison of Serum Concentrations of Total Cholesterol and Total ...

    African Journals Online (AJOL)

    Tuberculosis (TB) is one of the most dangerous tropical diseases that complicates HIV infection in Nigeria to date. Over two million Nigerians are known to be infected with TB and many more are at risk of the infection. Serum concentrations of total cholesterol and total lipid of 117 female TB patients attending chest clinic at ...

  9. Changes in total and differential white cell counts, total lymphocyte ...

    African Journals Online (AJOL)

    Background: Published reports on the possible changes in the various immune cell populations, especially the total lymphocyte and CD4 cell counts, during the menstrual cycle in Nigerian female subjects are relatively scarce. Aim: To determine possible changes in the total and differential white blood cell [WBC] counts, ...

  10. Investigation Of Total Phenolic, Total Flavonoid, Antioxidantand Allyl ...

    African Journals Online (AJOL)

    Background: This study was carried out to investigate the total polyphenol (TP), total flavonoid (TF), antioxidative effect and allyl isothyocyanate (ITC) content in different organs of wasabi plant grown in an organic system. Materials and Methods: Invitro study of methanol and boiled water extracts of wasabi were conducted ...

  11. Construcciones suspendidas y gestión del turno conversacional en la evaluación de la afasia

    Directory of Open Access Journals (Sweden)

    Carlos Hernández Sacristán


    Full Text Available Les suspensions de constructions syntaxiques préalablement initiées sont des phénomènes très fréquents dans la conversation quotidienne. On les associe fréquemment à la négociation du changement de tour de parole. Cette dernière situation peut être décrite comme une transformation particulière à travers laquelle un déficit littéral dans l’expression est réévalué par les interlocuteurs en tant que moyen symbolique pour l’exercice de déterminées fonctions pragmatiques ou pour l’expression de certains signifiés. Nous explorons ici les différents contextes dans lesquels se manifestent ces fonctions et ces signifiés, tout en tenant en compte des interactions conversationnelles entre sujets aphasiques et des sujets parlants normaux (c’est-à-dire, non aphasiques, et tout en assumant l’intérêt du phénomène pour l’évaluation de l’aphasie. Étant donné que les constructions suspendues stimulent l’interaction, elles contribuent au dynamisme conversationnel, mais cette fonction d’appui peut présenter, comme contrepartie, un effet de masquage du déficit syntaxique qui limiterait le processus de récupération.

  12. Total body irradiation: current indications

    International Nuclear Information System (INIS)

    Giraud, P.; Danhier, S.; Dubray, B.; Cosset, J.M.


    The choice of dose and fractionation for total body irradiation is made difficult by the large number of considerations to be taken into account. The outcome of bone marrow transplantation after total body irradiation can be understood in terms of tumor cell killing, engraftment, and normal tissue damage, each of these endpoints being influenced by irradiation-, disease-, transplant-, and patient- related factors. Interpretation of clinical data is further hampered by the overwhelming influence of logistic constraints, the small numbers of randomized studies, and the concomitant variations in total dose and fraction size or dose rate. So far, three cautious conclusions can be drawn in order to tentatively adapt the total body irradiation schedule to clinically-relevant situations. Firstly, the organs at risk for normal tissue damage (lung, liver, lens, kidney) are protected by delivering small doses per fraction at low dose rate. This suggests that, when toxicity is at stake (e.g. in children), fractionated irradiation should be preferred, provided that inter-fraction intervals are long enough. Secondly, fractionated irradiation should be avoided in case of T-cell depleted transplant, given the high risk of graft rejection in this setting. An alternative would be to increase total (or fractional) dose of fractionated total body irradiation, but this approach is likely to induce more normal tissue toxicity. Thirdly, clinical data have shown higher relapse rates in chronic myeloid leukemia after fractionated or low dose rate total body irradiation, suggesting that fractionated irradiation should not be recommended, unless total (or fractional) dose is increased. Total body irradiation-containing regimens, primarily cyclophosphamide / total body irradiation, are either equivalent to or better than the chemotherapy-only regimens, primarily busulfan / cyclophosphamide. Busulfan / cyclophosphamide certainly represents a reasonable alternative, especially in patients who

  13. Stereoselective total synthesis of sphingolipids

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 128; Issue 11. Stereoselective total synthesis of sphingolipids. PARAMESH JANGILI PERLA ... Keywords. 1,2-Diacetyl D-erythro-sphinganine; 1,2-diacetyl L-threo-sphinganine; D-erythro-sphinganine triacetate; sphingolipids; total synthesis; Garner aldehyde.

  14. Total hip arthroplasty in Denmark

    DEFF Research Database (Denmark)

    Pedersen, Alma Becic; Johnsen, Søren Paaske; Overgaard, Søren


    The annual number of total hip arthroplasties (THA) has increased in Denmark over the past 15 years. There is, however, limited detailed data available on the incidence of THAs.......The annual number of total hip arthroplasties (THA) has increased in Denmark over the past 15 years. There is, however, limited detailed data available on the incidence of THAs....

  15. Fractionation and determination of total antioxidant capacity, total ...

    African Journals Online (AJOL)



    ) and total flavonoids content (TFC) of aqueous, ethanol, n-. Hexane extract as well as ethanol extract fractions of Vitex doniana leaves were determined. Ethanol extract showed the highest 1,1-diphenyl-2-picrylhydrazyl ...

  16. Totality eclipses of the Sun

    CERN Document Server

    Littmann, Mark; Willcox, Ken


    A total eclipse of the Sun is the most awesome sight in the heavens. Totality: Eclipses of the Sun takes you to eclipses of the past, present, and future, and lets you see - and feel - why people travel to the ends of the Earth to observe them. - ;A total eclipse of the Sun is the most awesome sight in the heavens. Totality: Eclipses of the Sun takes you to eclipses of the past, present, and future, and lets you see - and feel - why people travel to the ends of the Earth to observe them. Totality: Eclipses of the Sun is the best guide and reference book on solar eclipses ever written. It explains: how to observe them; how to photograph and videotape them; why they occur; their history and mythology; and future eclipses - when and where to see them. Totality also tells the remarkable story of how eclipses shocked scientists, revealed the workings of the Sun, and made Einstein famous. And the book shares the experiences and advice of many veteran eclipse observers. Totality: Eclipses of the Sun is profusely ill...

  17. Total Product Life Cycle (TPLC) (United States)

    U.S. Department of Health & Human Services — The Total Product Life Cycle (TPLC) database integrates premarket and postmarket data about medical devices. It includes information pulled from CDRH databases...

  18. Leadership and Total Quality Management (United States)


    leadership and management skills yields increased productivity. This paper will focus on the skills required of senior level leaders (leaders at the...publication until it has been cleared by the appropriate mii..-, service or government agency. Leadership and Total Quality Management An Individual Study...llty Codes fAvti1 and/or DltISpecial Abstract AUTHOR: Harry D. Gatanas, LTC, USA TITLE: Leadership and Total Quality Management FORMAT- Individual

  19. Total body water and total body potassium in anorexia nervosa

    Energy Technology Data Exchange (ETDEWEB)

    Dempsey, D.T.; Crosby, L.O.; Lusk, E.; Oberlander, J.L.; Pertschuk, M.J.; Mullen, J.L.


    In the ill hospitalized patient with clinically relevant malnutrition, there is a measurable decrease in the ratio of the total body potassium to total body water (TBK/TBW) and a detectable increase in the ratio of total exchangeable sodium to total exchangeable potassium (Nae/Ke). To evaluate body composition analyses in anorexia nervosa patients with chronic uncomplicated semistarvation, TBK and TBW were measured by whole body K40 counting and deuterium oxide dilution in 10 females with stable anorexia nervosa and 10 age-matched female controls. The ratio of TBK/TBW was significantly (p less than 0.05) higher in anorexia nervosa patients than controls. The close inverse correlation found in published studies between TBK/TBW and Nae/Ke together with our results suggest that in anorexia nervosa, Nae/Ke may be low or normal. A decreased TBK/TBW is not a good indicator of malnutrition in the anorexia nervosa patient. The use of a decreased TBK/TBW ratio or an elevated Nae/Ke ratio as a definition of malnutrition may result in inappropriate nutritional management in the patient with severe nonstressed chronic semistarvation.

  20. Total 2004 annual report; TOTAL 2004 rapport annuel

    Energy Technology Data Exchange (ETDEWEB)



    This annual report of the Group Total brings information and economic data on the following topics, for the year 2004: the corporate governance, the corporate social responsibility, the shareholder notebook, the management report, the activities, the upstream (exploration and production) and downstream (refining and marketing) operating, chemicals and other matters. (A.L.B.)

  1. Total body water and total body potassium in anorexia nervosa

    International Nuclear Information System (INIS)

    Dempsey, D.T.; Crosby, L.O.; Lusk, E.; Oberlander, J.L.; Pertschuk, M.J.; Mullen, J.L.


    In the ill hospitalized patient with clinically relevant malnutrition, there is a measurable decrease in the ratio of the total body potassium to total body water (TBK/TBW) and a detectable increase in the ratio of total exchangeable sodium to total exchangeable potassium (Nae/Ke). To evaluate body composition analyses in anorexia nervosa patients with chronic uncomplicated semistarvation, TBK and TBW were measured by whole body K40 counting and deuterium oxide dilution in 10 females with stable anorexia nervosa and 10 age-matched female controls. The ratio of TBK/TBW was significantly (p less than 0.05) higher in anorexia nervosa patients than controls. The close inverse correlation found in published studies between TBK/TBW and Nae/Ke together with our results suggest that in anorexia nervosa, Nae/Ke may be low or normal. A decreased TBK/TBW is not a good indicator of malnutrition in the anorexia nervosa patient. The use of a decreased TBK/TBW ratio or an elevated Nae/Ke ratio as a definition of malnutrition may result in inappropriate nutritional management in the patient with severe nonstressed chronic semistarvation

  2. Total Ozone Prediction: Stratospheric Dynamics (United States)

    Jackman, Charles H.; Kawa, S. Ramdy; Douglass, Anne R.


    The correct prediction of total ozone as a function of latitude and season is extremely important for global models. This exercise tests the ability of a particular model to simulate ozone. The ozone production (P) and loss (L) will be specified from a well- established global model and will be used in all GCMs for subsequent prediction of ozone. This is the "B-3 Constrained Run" from M&MII. The exercise mostly tests a model stratospheric dynamics in the prediction of total ozone. The GCM predictions will be compared and contrasted with TOMS measurements.

  3. Sobredentadura total superior implantosoportada Superior total overdenture on implants

    Directory of Open Access Journals (Sweden)

    Luis Orlando Rodríguez García


    Full Text Available Se presenta un caso de un paciente desdentado total superior, rehabilitado en la consulta de implantología de la Clínica "Pedro Ortiz" del municipio Habana del Este en Ciudad de La Habana, Cuba, en el año 2009, mediante prótesis sobre implantes osteointegrados, técnica que se ha incorporado a la práctica estomatológica en Cuba como alternativa al tratamiento convencional en los pacientes desdentados totales. Se siguió un protocolo que comprendió una fase quirúrgica, procedimiento con o sin realización de colgajo y carga precoz o inmediata. Se presenta un paciente masculino de 56 años de edad, que acudió a la consulta multidisciplinaria, preocupado, porque se le habían elaborado tres prótesis en los últimos dos años y ninguna reunía los requisitos de retención que él necesitaba para sentirse seguro y cómodo con las mismas. El resultado final fue la satisfacción total del paciente, con el mejoramiento de la calidad estética y funcional.This is the case of a total maxilla edentulous patient seen in consultation of the "Pedro Ortíz" Clinic Implant of Habana del Este municipality in 2009 and con rehabilitation by prosthesis over osteointegration implants added to stomatology practice in Cuba as an alternative to conventional treatment in patients totally edentulous. We follow a protocol including a surgery or surgical phase, technique without or with flap creation and early or immediate load. This is a male patient aged 56 came to our multidisciplinary consultation worried because he had three prostheses in last two years and any fulfilled the requirements of retention to feel safe and comfortable with prostheses. The final result was the total satisfaction of rehabilitated patient improving its aesthetic and functional quality.

  4. [Risk factors of hypoparathyroidism following total or near total thyroidectomy]. (United States)

    Wang, T X; Yu, W B; Ma, X; Song, Y T; Zhang, N S


    To study the risk factors for postoperative hypoparathyroidism or hypocalcemia. Totally 414 patients with thyroid diseases who underwent total or near total thyroidectomy at Department of Head and Neck Surgery, Peking University Cancer Hospital and Institute from June 2007 to June 2014 were studied retrospectively. There were 119 male and 295 female patients with a median age of 47 years. The clinical and pathological features that related to post-operative hypoparathyroidism were studied by χ(2) test and multivariate Logistic regression analysis. Of the 414 patients, 36.2% developed transient hypocalcemia, 36.5% developed transient hypoparathyroidism, 2.2% developed permanent hypoparathyroidism. In regression analysis, unilateral or bilateral center lymph node dissection were associated with mild transient hypocalcemia after surgery (OR=2.366, P=0.022; OR=5.216, P=0.000); unilateral or bilateral center lymph node dissection as well as surgical options were significant risk factors for severe transient hypocalcemia (OR=4.029, P=0.001; OR=8.384, P=0.000; OR=2.073, P=0.017) and hypoparathyroidism (OR=1.755, P=0.040; OR=4.144, P=0.000; OR=2.287, P=0.000). The parathyroid hormone concentration on postoperative day 1 was an independent risk factor for permanent hypoparathyroidism (OR=2.011, P=0.014). The concentration of parathyroid hormone threshold hypoparathyroidism with accuracy of 95.0%. Bilateral center lymph node dissection is a risk factor of permanent hypoparathyroidism in patients received total thyroidectomy should be taken thoughtfully. The parathyroid hormone concentration on postoperative day 1 provides better prediction for persistent hypoparathyroidism.

  5. Subtotal versus total abdominal hysterectomy

    DEFF Research Database (Denmark)

    Andersen, Lea Laird; Ottesen, Bent; Alling Møller, Lars Mikael


    , randomized clinical trial without blinding. Eleven gynecological departments in Denmark contributed participants to the trial. Women referred for benign uterine diseases who did not have contraindications to subtotal abdominal hysterectomy were randomized to subtotal (n = 161) vs total (n = 158) abdominal...

  6. Endoscopic Transaxillary Near Total Thyroidectomy (United States)

    Ejeh, Ijeoma Acholonu; Speights, Fredne; Rashid, Qammar N.; Ideis, Mustafa


    Background: Since first reported in 1996, endoscopic minimally invasive surgery of the cervical region has been shown to be safe and effective in the treatment of benign thyroid and parathyroid disease. The endoscopic transaxillary technique uses a remote lateral approach to the thyroid gland. Because of the perceived difficulty in accessing the contralateral anatomy of the thyroid gland, this technique has typically been reserved for patients with unilateral disease. Objectives: The present study examines the safety and feasibility of the transaxillary technique in dissecting and assessment of both thyroid lobes in performing near total thyroidectomy. Methods: Prior to this study we successfully performed endoscopic transaxillary thyroid lobectomy in 32 patients between August 2003 and August 2005. Technical feasibility in performing total thyroidectomy using this approach was accomplished first utilizing a porcine model followed by three human cadaver models prior to proceeding to human surgery. After IRB approval three female patients with histories of enlarging multinodular goiter were selected to undergo endoscopic near total thyroidectomy. Results: The average operative time for all models was 142 minutes (range 57–327 min). The three patients in this study had clinically enlarging multinodular goiters with an average size of 4 cm. The contralateral recurrent laryngeal nerve and parathyroid glands were identified in all cases. There was no post-operative bleeding, hoarseness or subcutaneous emphysema. Conclusion: Endoscopic transaxillary near total thyroidectomy is feasible and can be performed safely in human patients with bilateral thyroid disease. PMID:16882421

  7. Total Synthesis of a Gene

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 12. Total Synthesis of a Gene. H G Khorana. Classics Volume 17 Issue 12 December 2012 pp 1174-1197 ... Author Affiliations. H G Khorana1. Professor of Biology and Chemestry, Massachusetts Institute of Technology, Cambridge 02139.

  8. What is Total Quality Management? (United States)

    Bryan, William A.


    Provides a general overview of Total Quality Management (TQM) and explains why there is pressure for change in higher education institutions. Defines TQM and the various themes, tools, and beliefs that make it different from other management approaches. Presents 14 principles and how they might be applied to student affairs. (RJM)

  9. The Total Synthesis of Chlorophyll

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 7. The Total Synthesis of Chlorophyll. Setty Mallikarjuna Babu Subramania Ranganathan. General Article Volume 19 Issue 7 July 2014 pp 645-648. Fulltext. Click here to view fulltext PDF. Permanent link:

  10. First total synthesis of Boehmenan

    Indian Academy of Sciences (India)

    The first total synthesis of dilignan Boehmenan has been achieved. A biomimetic oxidative coupling of the ferulic acid methyl ester in the presence of silver oxide is the crucial step in the synthesis sequence, generating the dihydrobenzofuran skeleton. Hydroxyl group was protected with DHP and reducted with LiAlH4 to ...

  11. Total Quality Management for Schools. (United States)

    Greenwood, Malcolm S.; Gaunt, Helen J.

    Education in the United Kingdom has been shaped by the advent of local school management and the rapid growth of grant-maintained schools. Total Quality Management (TQM) offers a new way of looking at management principles and structures by identifying the needs of both internal and external customers. This book applies principles of TQM…

  12. Total synthesis of proposed auranthine. (United States)

    Kshirsagar, Umesh A; Puranik, Vedavati G; Argade, Narshinha P


    Starting from CBz-protected glutamic anhydride and Boc-protected o-aminobenzyl amine, the first total synthesis of proposed structure of auranthine has been reported. An intramolecular aza-Wittig reaction involving a lactam carbonyl group that delivered the diazepine core unit was the key step in the synthesis.

  13. First total synthesis of Boehmenan

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 126; Issue 3 ... The first total synthesis of dilignan Boehmenan has been achieved. A biomimetic oxidative coupling of the ferulic acid methyl ester in the presence of silver oxide is the crucial step in the synthesis sequence, generating the dihydrobenzofuran skeleton.

  14. The Total Synthesis of Strychnine

    Indian Academy of Sciences (India)

    IAS Admin

    The Total Synthesis of Strychnine. Edited by Setty Mallikarjuna Babu and Subramania Ranganathan. Keywords. Strychnine. N. N. O. H. H. H. H. O. H. Strychnine! No other molecule has captured the popular imagina- tion as strychnine, perhaps because thousands of writers of fiction have used it to dispatch the recipient and ...


    Directory of Open Access Journals (Sweden)

    Predrag Spirić


    Full Text Available Surgical technique of total laryngectomy is well presented in many surgical textbooks. Essentially, it has remained the same since Gluck an Soerensen in 1922 described all its details. Generally, it stresses the U shape skin incision with releasing laryngeal structures and removing larynx from up to down. Further, pharyngeal reconstruction is performed with different kinds of sutures in two or more layers and is finished with skin suture and suction drainage. One of worst complications following this surgery is pharyngocutaneous fistula (PF. Modifications proposed in this this article suggests vertical skin incision with larynx removal from below upwards. In pharyngeal reconstruction we used the running locked suture in submucosal plan with „tobacco sac“ at the end on the tongue base instead of traditional T shaped suture. Suction drains were not used.The aim of study was to present the modified surgical technique of total laryingectomy and its impact on hospital stay duration and pharyngocutanous fistula formation. In this randomized study we analyzed 49 patients operated with modified surgical technique compared to 49 patient operated with traditional surgical technique of total laryngectomy. The modified technique of total laryngectomy was presented. Using modified technique we managed to decrease the PF percentage from previous 20,41% to acceptable 8,16% (p=0,0334. Also, the average hospital stay was shortened from 14,96 to 10,63 days (t =-2.9850; p=0.0358.The modified technique of total laryngectomy is safe, short and efficient surgical intervention which decreases the number of pharyngocutaneos fistulas and shortens the hospital stay.

  16. Edge colouring by total labellings

    DEFF Research Database (Denmark)

    Brandt, Stephan; Rautenbach, D.; Stiebitz, M.


    We introduce the concept of an edge-colouring total k-labelling. This is a labelling of the vertices and the edges of a graph G with labels 1, 2, ..., k such that the weights of the edges define a proper edge colouring of G. Here the weight of an edge is the sum of its label and the labels of its...... two endvertices. We define χ (G) to be the smallest integer k for which G has an edge-colouring total k-labelling. This parameter has natural upper and lower bounds in terms of the maximum degree Δ of G : ⌈ (Δ + 1) / 2 ⌉ ≤ χ (G) ≤ Δ + 1. We improve the upper bound by 1 for every graph and prove χ (G...


    Directory of Open Access Journals (Sweden)



    Full Text Available In aquaculture to get a high production is conditioned by awareness and keeping of an unaltered health condition of the biological material. To be aware of the health condition of the biological material in a fish farm allows us to establish the preventive measures required to prevent spreading of a disease and the treatment to be applied in case that a mass disease occurs. The level of the total protein in serum is, first of all, a synthetically indicator of the nutritional condition of the organism, presenting, at the same time, ample qualitative and quantitative variations depending on species, age, sex, stage of sexual maturity, water temperature and especially in correlation with the health condition of fish. Modification in value of the total protein point out some metabolic perturbations in fish body.

  18. TOTAL annual report 2003; TOTAL rapport annuel 2003

    Energy Technology Data Exchange (ETDEWEB)



    This 2003 annual report of the Group Total provides economical results and information of the society on the following topics: keys data, the corporate governance (Directors charter, board of directors, audit committee, nomination and remuneration committee, internal control procedures, compensation of directors and executive officers), the corporate social responsibility (environmental stewardship, the future of energy management, the safety enhancement, the human resources, ethics and local development), the investor relations, the management report, the upstream exploration and production, the downstream refining, marketing, trading and shipping, the chemicals and financial and legal information. (A.L.B.)

  19. Intrathoracic Hernia after Total Gastrectomy

    Directory of Open Access Journals (Sweden)

    Yoshihiko Tashiro


    Full Text Available Intrathoracic hernias after total gastrectomy are rare. We report the case of a 78-year-old man who underwent total gastrectomy with antecolic Roux-Y reconstruction for residual gastric cancer. He had alcoholic liver cirrhosis and received radical laparoscopic proximal gastrectomy for gastric cancer 3 years ago. Early gastric cancer in the remnant stomach was found by routine upper gastrointestinal endoscopy. We initially performed endoscopic submucosal dissection, but the vertical margin was positive in a pathological result. We performed total gastrectomy with antecolic Roux-Y reconstruction by laparotomy. For adhesion of the esophageal hiatus, the left chest was connected with the abdominal cavity. A pleural defect was not repaired. Two days after the operation, the patient was suspected of having intrathoracic hernia by chest X-rays. Computed tomography showed that the transverse colon and Roux limb were incarcerated in the left thoracic cavity. He was diagnosed with intrathoracic hernia, and emergency reduction and repair were performed. Operative findings showed that the Roux limb and transverse colon were incarcerated in the thoracic cavity. After reduction, the orifice of the hernia was closed by suturing the crus of the diaphragm with the ligament of the jejunum and omentum. After the second operation, he experienced anastomotic leakage and left pyothorax. Anastomotic leakage was improved with conservative therapy and he was discharged 76 days after the second operation.

  20. Total filmless digital radiology service

    International Nuclear Information System (INIS)

    Mun, S.K.; Goeringer, F.; Benson, H.; Horii, S.C.


    The completion of a comprehensive picture archiving and communication system (PACS) at Georgetown University Hospital has allowed us to identify a number of technical, administrative, personnel, and operational issues that will affect a total digital radiology service. With a hospital-wide digital imaging network system, computer simulation of communications and storage options, and economic modeling, we have developed a feasibility study and implementation strategy for the smooth transition to a nearly filmless radiology service over the next several years. This paper describes the technical and operational requirements for various database operations, workstations (used in diagnosis, review, and education), and communications. Site and installation planning, personnel training, and transition operations are discussed

  1. Diverticulosis in total colonic aganglionosis

    International Nuclear Information System (INIS)

    Ivancev, K.; Fork, T.; Haegerstrand, I.; Ivarsson, S.; Kullendorff, C.M.; Lund Univ.; Lund Univ.; Malmoe Allmaenna Sjukhus; Malmoe Allmaenna Sjukhus


    Two infants with total colonic aganglionosis (TCA) extending into the distal part of the ileum are described. Considerable diagnostic delay occurred with the correct diagnosis established first at 3 and 8 months, respectively. Radiologic findings compatible with TCA such as prolonged barium retention, reflux into ileum following barium enema, and foreshortening of colon were not clearly evident initially. Both patients demonstrated multiple acquired colon diverticula which increased both in number and size during the period of observation. These diverticula are probably a late manifestation of the spastic state of the anganglionic colon. Thus demonstration of diverticula supplies a strong evidence of TCA in infants with intestinal obstruction. (orig.)

  2. Diverticulosis in total colonic aganglionosis

    Energy Technology Data Exchange (ETDEWEB)

    Ivancev, K.; Fork, T.; Haegerstrand, I.; Ivarsson, S.; Kullendorff, C.M.

    Two infants with total colonic aganglionosis (TCA) extending into the distal part of the ileum are described. Considerable diagnostic delay occurred with the correct diagnosis established first at 3 and 8 months, respectively. Radiologic findings compatible with TCA such as prolonged barium retention, reflux into ileum following barium enema, and foreshortening of colon were not clearly evident initially. Both patients demonstrated multiple acquired colon diverticula which increased both in number and size during the period of observation. These diverticula are probably a late manifestation of the spastic state of the anganglionic colon. Thus demonstration of diverticula supplies a strong evidence of TCA in infants with intestinal obstruction. (orig.).

  3. Total eclipses of the sun

    CERN Document Server

    Zirker, Jack B


    Eclipses have captured attention and sparked curiosity about the cosmos since the first appearance of humankind. Having been blamed for everything from natural disasters to the fall of kings, they are now invaluable tools for understanding many celestial as well as terrestrial phenomena. This clear, easy-to-understand guide explains what causes total eclipses and how they can be used in experiments to examine everything from the dust between the planets to general relativity. A new chapter has been added on the eclipse of July 11, 1991 (the great Hawaiian eclipse). Originally published in 19

  4. Total Synthesis of Calophyline A. (United States)

    Li, Guang; Xie, Xiaoni; Zu, Liansuo


    Reported herein is the total synthesis of calophyline A, an indoline natural product possessing distinct ring connectivity which has not been synthesized previously. The synthetic route features several key transformations, including an aza-pinacol rearrangement to construct the nitrogen-containing bridged [3.2.2] bicycle, a Heck cyclization to assemble the fused 6/5/6/5 ring system, and a challenging late-stage aldol reaction to generate both a neopentyl quaternary stereogenic center and an oxygen-containing bridged [3.2.1] bicycle. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Total Value of Phosphorus Recovery. (United States)

    Mayer, Brooke K; Baker, Lawrence A; Boyer, Treavor H; Drechsel, Pay; Gifford, Mac; Hanjra, Munir A; Parameswaran, Prathap; Stoltzfus, Jared; Westerhoff, Paul; Rittmann, Bruce E


    Phosphorus (P) is a critical, geographically concentrated, nonrenewable resource necessary to support global food production. In excess (e.g., due to runoff or wastewater discharges), P is also a primary cause of eutrophication. To reconcile the simultaneous shortage and overabundance of P, lost P flows must be recovered and reused, alongside improvements in P-use efficiency. While this motivation is increasingly being recognized, little P recovery is practiced today, as recovered P generally cannot compete with the relatively low cost of mined P. Therefore, P is often captured to prevent its release into the environment without beneficial recovery and reuse. However, additional incentives for P recovery emerge when accounting for the total value of P recovery. This article provides a comprehensive overview of the range of benefits of recovering P from waste streams, i.e., the total value of recovering P. This approach accounts for P products, as well as other assets that are associated with P and can be recovered in parallel, such as energy, nitrogen, metals and minerals, and water. Additionally, P recovery provides valuable services to society and the environment by protecting and improving environmental quality, enhancing efficiency of waste treatment facilities, and improving food security and social equity. The needs to make P recovery a reality are also discussed, including business models, bottlenecks, and policy and education strategies.

  6. Testing EDM of Total Stations

    Directory of Open Access Journals (Sweden)

    Cirbus Ján


    Full Text Available The paper is devoted to testing electrooptical distance measuring devices (EDM built in total stations, than can be used for various tasks in the contemporary geodetic works. A rich market offer and availability of these universal measuring systems with satisfying distance range, excellent accuracy and other parameters, make total stations as dominant terrestrial geodetic instruments.For succesfully applying these instruments, above all for relliable distance measurements, the stability of the modulation frequency is the most important pre-condition. In the article, therefore, there are given some methods to verify the modulation frequency stability. In addition, some ways for determining the EDM distance constant and periodical corrections of the phase measuring unit are introduced for 4 types of EDM : LEICA 1700L, TOPCON GTS6A, TOPCON GTS2, C.ZEISS ELTA50. It were also investigated their possibilities for precise distance survey. Values of the determined constants and periodical corrections are presented in Tab. 2.Based on the investigation results of the 4 EDM types and using the values m obtained for different distances S, equations of the a posteriori standard deviations in form : m = (a+b.S were derived too.

  7. Qualidade total: Um novo paradigma?

    Directory of Open Access Journals (Sweden)

    Suzana da Rosa Tolfo


    Full Text Available Nos últimos anos, o movimento para a implantação da Gestão da Qualidade Total vem crescendo ao redor do mundo. Em razão disso, há uma diversidade de ações realizadas com o nome de "Qualidade Total'. Uma revisão da teoria é complexa, porque existem muitos autores que tratam da questão. Eles escolhem diferentes perspectivas de análises (teóricas e empíricas e há dificuldades em se identificar um corpo conceitual. Há uma ampla difusão de modelos, ferramentas, técnicas, mercado e consultores. Essa popularidade, muitas vezes, faz com que determinadas organizações adotem essa forma de gestão do trabalho sem o conhecimento necessário das implicações que um modelo dessa ordem representa; especialmente no caso brasileiro, suscetível a proposições importadas. O presente artigo propõe um exame daquilo que os fundadores têm articulado sobre TQM, as principais críticas nesta direção e a avaliação de como vem sendo aplicadono nosso país.

  8. Jogging after total hip arthroplasty. (United States)

    Abe, Hirohito; Sakai, Takashi; Nishii, Takashi; Takao, Masaki; Nakamura, Nobuo; Sugano, Nobuhiko


    Jogging has been classified as a high-impact sport, and jogging after total hip arthroplasty (THA) has not been well documented. To investigate the participation rate for postoperative jogging as well as jogging parameters and the influence of jogging on implant stability and bearing wear. Case-control study; Level of evidence, 3. Included in this study were 804 hips in 608 patients (85 men, 523 women) who underwent THA between 2005 and 2011 with follow-up longer than 1 year. The mean patient age was 62 years (range, 26-98 years), and mean follow-up duration was 4.8 years (range, 2.3-7.8 years). Hip resurfacing arthroplasty (HRA) was performed in 81 patients and conventional THA in 527 patients. During routine postsurgical visits, patients were given a questionnaire concerning preoperative and postoperative jogging routines. For joggers, frequency, distance, duration, and velocity of jogging were recorded. Patients who did not jog postoperatively were asked to provide reasons for not jogging. Radiographs concerning implant migration and polyethylene wear were evaluated with specialized software, and serum cobalt and chromium ion concentrations were investigated for patients with metal-on-metal articulation. A total of 33 patients (5.4%) performed jogging preoperatively, and 23 patients (3.8%) performed jogging postoperatively. Of the 23 who jogged postoperatively, conventional THA was performed in 13 patients and HRA in 10 patients. Postoperatively, joggers trained a mean of 4 times (range, 1-7 times) per week, covering a mean distance of 3.6 km (range, 0.5-15 km) in a mean time of 29 minutes (range, 5-90 minutes) per session and at a mean speed of 7.7 km/h (range, 3-18 km/h). No patient complained of pain or showed serum cobalt and chromium ion elevation greater than 7 ppb. No hip showed loosening, abnormal component migration, or excessive wear at a mean 5-year follow-up. There were 74 postoperative non-joggers with an interest in jogging. The reasons given for

  9. Total employment effect of biofuels

    International Nuclear Information System (INIS)

    Stridsberg, S.


    The study examined the total employment effect of both direct production of biofuel and energy conversion to heat and electricity, as well as the indirect employment effect arising from investments and other activities in conjunction with the production organization. A secondary effect depending on the increased capital flow is also included in the final result. The scenarios are based on two periods, 1993-2005 and 2005-2020. In the present study, the different fuels and the different applications have been analyzed individually with regard to direct and indirect employment within each separate sector. The greatest employment effect in the production chain is shown for logging residues with 290 full-time jobs/TWh, whereas other biofuels range between 80 and 280 full-time jobs/TWh. In the processing chain, the corresponding range is 200-300 full-time jobs per each additional TWh. Additionally and finally, there are secondary effects that give a total of 650 full-time jobs/TWh. Together with the predicted increase, this suggests that unprocessed fuel will provide an additional 16 000 annual full-time jobs, and that fuel processing will contribute with a further 5 000 full-time jobs. The energy production from the fuels will provide an additional 13 000 full-time jobs. The total figure of 34 000 annual full-time jobs must then be reduced by about 4000 on account of lost jobs, mainly in the oil sector and to some extent in imports of biofuel. In addition, the anticipated increase in capital turnover that occurs within the biofuel sector, will increase full-time jobs up to year 2020. Finally, a discussion is given of the accomplishment of the programmes anticipated by the scenario, where it is noted that processing of biofuel to wafers, pellets or powder places major demands on access to raw material of good quality and that agrarian fuels must be given priority if they are to enter the system sufficiently fast. Straw is already a resource but is still not accepted by

  10. Conversion total hip arthroplasty: Primary or revision total hip arthroplasty. (United States)

    Schwarzkopf, Ran; Baghoolizadeh, Mahta


    Total hip arthroplasty (THA) is an increasingly common procedure among elderly individuals. Although conversion THA is currently bundled in a diagnosis related group (DRG) with primary THA, there is a lack of literature supporting this classification and it has yet to be identified whether conversion THA better resembles primary or revision THA. This editorial analyzed the intraoperative and postoperative factors and functional outcomes following conversion THA, primary THA, and revision THA to understand whether the characteristics of conversion THA resemble one procedure or the other, or are possibly somewhere in between. The analysis revealed that conversion THA requires more resources both intraoperatively and postoperatively than primary THA. Furthermore, patients undergoing conversion THA present with poorer functional outcomes in the long run. Patients undergoing conversion THA better resemble revision THA patients than primary THA patients. As such, patients undergoing conversion THA should not be likened to patients undergoing primary THA when determining risk stratification and reimbursement rates. Conversion THA procedures should be planned accordingly with proper anticipation of the greater needs both in the operating room, and for in-patient and follow-up care. We suggest that conversion THA be reclassified in the same DRG with revision THA as opposed to primary THA as a step towards better allocation of healthcare resources for conversion hip arthroplasties.

  11. Total quality management implementation guidelines

    Energy Technology Data Exchange (ETDEWEB)


    These Guidelines were designed by the Energy Quality Council to help managers and supervisors in the Department of Energy Complex bring Total Quality Management to their organizations. Because the Department is composed of a rich mixture of diverse organizations, each with its own distinctive culture and quality history, these Guidelines are intended to be adapted by users to meet the particular needs of their organizations. For example, for organizations that are well along on their quality journeys and may already have achieved quality results, these Guidelines will provide a consistent methodology and terminology reference to foster their alignment with the overall Energy quality initiative. For organizations that are just beginning their quality journeys, these Guidelines will serve as a startup manual on quality principles applied in the Energy context.

  12. Total synthesis of mycalamide A. (United States)

    Sohn, Jeong-Hun; Waizumi, Nobuaki; Zhong, H Marlon; Rawal, Viresh H


    This communication describes a concise and efficient total synthesis of mycalamide A by the convergent coupling of pederic acid unit with the mycalamine unit. The left-half, (+)-7-benzoylpederic acid, was synthesized from (2R,3R)-3-methylpent-4-en-2-ol in seven steps and 34.6% overall yield through a route that features a one-step Pd(II)-catalyzed tandem Wacker/Heck cyclization reaction to prepare the tetrahydropyran ring system. The right-half, the mycalamine unit, was synthesized in 21 steps and 10.5% overall yield from diethyl d-tartrate. Effective, stereoselective methods were developed for the assembly of the two parts to yield either mycalamide A or C(10)-epi-mycalamide A.

  13. A total safety management model

    International Nuclear Information System (INIS)

    Obadia, I.J.; Vidal, M.C.R.; Melo, P.F.F.F.


    In nuclear organizations, quality and safety are inextricably linked. Therefore, the search for excellence means reaching excellence in nuclear safety. The International Atomic Energy Agency, IAEA, developed, after the Chernobyl accident, the organizational approach for improving nuclear safety based on the safety culture, which requires a framework necessary to provide modifications in personnel attitudes and behaviors in situations related to safety. This work presents a Total Safety Management Model, based on the Model of Excellence of the Brazilian Quality Award and on the safety culture approach, which represents an alternative to this framework. The Model is currently under validation at the Nuclear Engineering Institute, in Rio de Janeiro, Brazil, and the results of its initial safety culture self assessment are also presented and discussed. (author)

  14. Total quality management program planning

    Energy Technology Data Exchange (ETDEWEB)

    Thornton, P.T.; Spence, K.


    As government funding grows scarce, competition between the national laboratories is increasing dramatically. In this era of tougher competition, there is no for resistance to change. There must instead be a uniform commitment to improving the overall quality of our products (research and technology) and an increased focus on our customers` needs. There has been an ongoing effort to bring the principles of total quality management (TQM) to all Energy Systems employees to help them better prepare for future changes while responding to the pressures on federal budgets. The need exists for instituting a vigorous program of education and training to an understanding of the techniques needed to improve and initiate a change in organizational culture. The TQM facilitator is responsible for educating the work force on the benefits of self-managed work teams, designing a program of instruction for implementation, and thus getting TQM off the ground at the worker and first-line supervisory levels so that the benefits can flow back up. This program plan presents a conceptual model for TQM in the form of a hot air balloon. In this model, there are numerous factors which can individually and collectively impede the progress of TQM within the division and the Laboratory. When these factors are addressed and corrected, the benefits of TQM become more visible. As this occurs, it is hoped that workers and management alike will grasp the ``total quality`` concept as an acceptable agent for change and continual improvement. TQM can then rise to the occasion and take its rightful place as an integral and valid step in the Laboratory`s formula for survival.

  15. The Exosome Total Isolation Chip. (United States)

    Liu, Fei; Vermesh, Ophir; Mani, Vigneshwaran; Ge, Tianjia J; Madsen, Steven J; Sabour, Andrew; Hsu, En-Chi; Gowrishankar, Gayatri; Kanada, Masamitsu; Jokerst, Jesse V; Sierra, Raymond G; Chang, Edwin; Lau, Kenneth; Sridhar, Kaushik; Bermudez, Abel; Pitteri, Sharon J; Stoyanova, Tanya; Sinclair, Robert; Nair, Viswam S; Gambhir, Sanjiv S; Demirci, Utkan


    Circulating tumor-derived extracellular vesicles (EVs) have emerged as a promising source for identifying cancer biomarkers for early cancer detection. However, the clinical utility of EVs has thus far been limited by the fact that most EV isolation methods are tedious, nonstandardized, and require bulky instrumentation such as ultracentrifugation (UC). Here, we report a size-based EV isolation tool called ExoTIC (exosome total isolation chip), which is simple, easy-to-use, modular, and facilitates high-yield and high-purity EV isolation from biofluids. ExoTIC achieves an EV yield ∼4-1000-fold higher than that with UC, and EV-derived protein and microRNA levels are well-correlated between the two methods. Moreover, we demonstrate that ExoTIC is a modular platform that can sort a heterogeneous population of cancer cell line EVs based on size. Further, we utilize ExoTIC to isolate EVs from cancer patient clinical samples, including plasma, urine, and lavage, demonstrating the device's broad applicability to cancers and other diseases. Finally, the ability of ExoTIC to efficiently isolate EVs from small sample volumes opens up avenues for preclinical studies in small animal tumor models and for point-of-care EV-based clinical testing from fingerprick quantities (10-100 μL) of blood.

  16. Total joint replacement preadmission programs. (United States)

    Messer, B


    Patients begin to formulate their expectations of the postoperative hospitalization during the preadmission program. The challenge is to better understand the factors patients consider when formulating judgments about the quality of preadmission education. For example, it may be that perceptions of the preadmission program are influenced by what patients believe about their postoperative pain and functional abilities. Specific attention needs to be given both preoperatively and postoperatively to instructing patients on realistic expectations for recovery. One other method of measuring patient outcomes is with the Health Status Profile (SF-36) (Response Healthcare Information Management, 1995). The SF-36 approach emphasizes the outcome of medical care as the patient sees it, in addition to a clinical evaluation of successful health care. This form is currently initiated in the physician's office and returned for scanning at the preadmission class. The patient then completes another SF-36 at 6 months and every year thereafter to compare measurable outcomes. Patients intending to have elective total joint replacements experience anxiety and require much support and education. An effective preadmission program is a major investment in a patient's recovery, as well as a unique marketing tool to customers. Preadmission programs can be viewed as an opportunity to enhance customer satisfaction. Preadmission clinics are an excellent means for nurses to improve the quality of patient care through patient education. the overall goal of preadmission testing programs is to ensure patient preparedness while increasing quality health care and overall customer satisfaction. To enhance program effectiveness, health care providers must lead collaborative efforts to improve the efficiency of systems.

  17. Reverse hybrid total hip arthroplasty (United States)

    Wangen, Helge; Havelin, Leif I; Fenstad, Anne M; Hallan, Geir; Furnes, Ove; Pedersen, Alma B; Overgaard, Søren; Kärrholm, Johan; Garellick, Göran; Mäkelä, Keijo; Eskelinen, Antti; Nordsletten, Lars


    Background and purpose The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty Register Association (NARA) has already published 2 papers describing results of reverse hybrid THAs in different age groups. Based on data collected over 2 additional years, we wanted to perform in depth analyses of not only the reverse hybrid concept but also of the different cup/stem combinations used. Patients and methods From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk of revision. The main endpoint was revision for any reason. We also performed specific analyses regarding the different reasons for revision and analyses regarding the cup/stem combinations used in more than 500 cases. Results We found a higher rate of revision for reverse hybrids than for cemented THAs, with an adjusted relative risk of revision (RR) of 1.4 (95% CI: 1.3–1.5). At 10 years, the survival rate was 94% (CI: 94–95) for cemented THAs and 92% (95% CI: 92–93) for reverse hybrids. The results for the reverse hybrid THAs were inferior to those for cemented THAs in patients aged 55 years or more (RR =1.1, CI: 1.0–1.3; p revision due to periprosthetic femoral fracture for reverse hybrids than for cemented THAs in patients aged 55 years or more (RR =3.1, CI: 2.2–4.5; p revision than cemented THAs in patients aged 55 or more. The difference in survival was mainly caused by a higher incidence of early revision due to periprosthetic femoral fracture in the reversed hybrid THAs. PMID:28095724

  18. Global Drought Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Drought Total Economic Loss Risk Deciles is a 2.5 minute grid of global drought total economic loss risks. A process of spatially allocating Gross Domestic...

  19. Chinese National Strategy of Total War

    National Research Council Canada - National Science Library

    Good, Michael J


    ... concept of total warfare. This research seeks to determine if China is currently engaged in a total war with the United States across nontraditional forms of conflict including economic, political, information, financial...

  20. Global Drought Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Drought Total Economic Loss Risk Deciles is a 2.5 by 2.5 minute grid of global drought total economic loss risks. A process of spatially allocating Gross...

  1. Global Earthquake Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Earthquake Total Economic Loss Risk Deciles is a 2.5 minute grid of global earthquake total economic loss risks. A process of spatially allocating Gross...

  2. Global Landslide Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Landslide Total Economic Loss Risk Deciles is a 2.5 minute grid of global landslide total economic loss risks. A process of spatially allocating Gross...

  3. Global Multihazard Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Multihazard Total Economic Loss Risk Deciles is a 2.5 minute grid of global multihazard total economic loss risks. First, for each of the considered hazards...

  4. Global Volcano Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Volcano Total Economic Loss Risk Deciles is a 2.5 minute grid of global volcano total economic loss risks. First, subnational distributions of Gross Domestic...

  5. Global Flood Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Flood Total Economic Loss Risk Deciles is a 2.5 minute grid of global flood total economic loss risks. A process of spatially allocating Gross Domestic...

  6. Global Cyclone Total Economic Loss Risk Deciles (United States)

    National Aeronautics and Space Administration — Global Cyclone Total Economic Loss Risk Deciles is a 2.5 minute grid of global cyclone total economic loss risks. A process of spatially allocating Gross Domestic...

  7. Defense meteorological satellite measurements of total ozone

    International Nuclear Information System (INIS)

    Lovill, J.E.; Ellis, J.S.; Luther, F.M.; Sullivan, R.J.; Weichel, R.L.


    A multichannel filter radiometer (MFR) on Defense Meteorological Satellites (DMS) that measured total ozone on a global-scale from March 1977 - February 1980 is described. The total ozone data measured by the MFR were compared with total ozone data taken by surfaced-based Dobson spectrophotometers. When comparisons were made for five months, the Dobson spectrophotometer measured 2-5% more total ozone than the MFR. Comparisons between the Dobson spectrophotometer and the MFR showed a reduced RMS difference as the comparisons were made at closer proximity. A Northern Hemisphere total ozone distribution obtained from MFR data is presented


    Directory of Open Access Journals (Sweden)

    Dominikus Arif Budi Prasetyo pythagors


    Full Text Available Pelabelan graf merupakan bagian dari graf yang berkembang saat ini. Jenis pelabelan pada graf bergantungpada domainnya, yakni pelabelan sisi ajaib, pelabelan titik ajaib, dan pelabelan total ajaib. Pelabelan totalajaib pada graf dibedakan lagi berdasarkan komponen graf yang dievaluasi, yakni pelabelan total sisi ajaibdan pelabelan total titik ajaib. Pada pelabelan ajaib, bobot dari komponen graf yang dievaluasi adalah sama,jika bobotnya tidak sama maka dinamakan pelabelan tak-ajaib (antimagic. Misalkan G adalah graf denganbanyak titik p dan sisi q. Suatu pemetaan bijektif dari komponen-komponen graf ke bilangan bulat positif {1,2, …, (p+q} disebut called (a, d vertex antimagic total labelling (pelabelan total titik ajaib dari graf G jikabobot setiap titik (vertex merupakan barisan aritmetika naik. Pada artikel ini membahas bahwa grafmulticycle mCp memenuhi (a, d vertex antimagic total labelling dan beberapa bentuk pelabelannya.Kata kunci : graph multicycle, vertex antimagic total labeling

  9. [Total pancreatectomy: renaissance of a surgical procedure]. (United States)

    Keck, T; Hopt, U T


    Permanent reduction of morbidity and death in centers for pancreatic surgery has led to a change in the indication for total pancreatectomy from rescue pancreatectomy for complications of pancreatic surgery increasingly to elective surgery, especially in the management of advanced intraductal papillary mucinous neoplasms. We discuss the indication for oncologic total pancreatectomy, rescue pancreatectomy, and removal of the whole pancreas for chronic pancreatitis. Furthermore we describe technical and metabolic aspects following total pancreatectomy.

  10. Total pollution effect of urban surface runoff. (United States)

    Luo, Hongbing; Luo, Lin; Huang, Gu; Liu, Ping; Li, Jingxian; Hu, Sheng; Wang, Fuxiang; Xu, Rui; Huang, Xiaoxue


    For pollution research with regard to urban surface runoff, most sampling strategies to date have focused on differences in land usage. With single land-use sampling, total surface runoff pollution effect cannot be evaluated unless every land usage spot is monitored. Through a new sampling strategy known as mixed stormwater sampling for a street community at discharge outlet adjacent to river, this study assessed the total urban surface runoff pollution effect caused by a variety of land uses and the pollutants washed off from the rain pipe system in the Futian River watershed in Shenzhen City of China. The water quality monitoring indices were COD (chemical oxygen demand), TSS (total suspend solid), TP (total phosphorus), TN (total nitrogen) and BOD (biochemical oxygen demand). The sums of total pollution loads discharged into the river for the four indices of COD, TSS, TN, and TP over all seven rainfall events were very different. The mathematical model for simulating total pollution loads was established from discharge outlet mixed stormwater sampling of total pollution loads on the basis of four parameters: rainfall intensity, total land area, impervious land area, and pervious land area. In order to treat surface runoff pollution, the values of MFF30 (mass first flush ratio) and FF30 (first 30% of runoff volume) can be considered as split-flow control criteria to obtain more effective and economical design of structural BMPs (best management practices) facilities.

  11. Telehealth problem-solving therapy for depressed low-income homebound older adults. (United States)

    Choi, Namkee G; Hegel, Mark T; Marti, Nathan; Marinucci, Mary Lynn; Sirrianni, Leslie; Bruce, Martha L


    To evaluate the acceptance and preliminary efficacy of in-home telehealth delivery of problem-solving therapy (tele-PST) among depressed low-income homebound older adults in a pilot randomized control trial designed to test its feasibility and preliminary efficacy. A total of 121 homebound individuals who were age 50+ and scored 15+ on the 24-item Hamilton Rating Scale for Depression (HAMD) participated in the three-arm randomized control trial, comparing tele-PST with in-person PST and telephone support calls. Six sessions of the PST-primary care were conducted for the PST participants. For tele-PST, sessions 2-6 were conducted via Skype video call. Acceptance of tele-PST or in-person PST was measured with the 11-item, 7-point scale modified Treatment Evaluation Inventory (TEI). A mixed-effect regression analysis was used to examine the effects of treatment group, time, and the interaction term between treatment group and time on the HAMD scores. The TEI score was slightly higher among tele-PST participants than among in-person PST participants. The HAMD scores of tele-PST participants and in-person PST participants at a 12-week follow-up were significantly lower than those of telephone support call participants, and the treatment effects were maintained at a 24-week follow-up. The HAMD scores of tele-PST participants did not differ from those of in-person PST participants. Despite their initial skepticism, almost all participants had extremely positive attitudes toward tele-PST at the 12-week followup. Tele-PST also appears to be an efficacious treatment modality for depressed homebound older adults and to have significant potential to facilitate their access to treatment.

  12. A note on totally normal spaces

    International Nuclear Information System (INIS)

    Zougdani, H.K.


    In this note we give the necessary and sufficient condition for a topological space X such that the product space X x Y is totally normal for any (non discrete) metric space Y, and we show that a totally normal p-space need not be a perfectly normal in general, which makes Theorem 2 doubtful. (author). 6 refs

  13. Total internal reflection effect on gyrotropic interface (United States)

    Glushchenko, Alexander G.; Glushchenko, Eugene P.; Zhukov, Sergey V.


    This article considers the physical features of total internal reflection at gyrotropic and isotropic interfaces for two cases: electrical gyrotropy (plasma) and magnetic gyrotropy (ferrite). It is shown that the plasma magnetization may lead to the formation of the total internal reflection effect, which does not occur in isotropic plasma. The threshold values of the magnetic field, which are necessary for the total internal reflection effect, are determined. The total internal reflection effect on a ferrite-dielectric interface for waves emanating from different angles is observed in various frequency ranges and magnetization fields. The study points out the possibility of changing the total internal reflection angle value in large limits due to a change in the external magnetic field magnitude. The calculation results of the total internal reflection angle dependence on the external magnetic field magnitude are presented. The formulas are elaborated for calculating the total internal reflection angles of different interfaces for gyrotropic and isotropic media. The generalized formulas are defined for calculating the Doppler effect in the gyrotropic media. The study demonstrates how the velocity of the media interface affects the limiting angle of total internal refection.

  14. Custom total occlusal convergence angle sticker fabrication. (United States)

    Cho, Seok-Hwan; Nagy, William W


    This article describes a method of fabricating a custom total occlusal convergence angle sticker with photo editing software and label stickers. The custom total occlusal convergence angle sticker can help clinicians achieve an accurate degree of taper during axial wall reduction of tooth preparation. Copyright © 2015 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  15. Total cardiovascular disease risk assessment: a review.

    LENUS (Irish Health Repository)

    Cooney, Marie Therese


    The high risk strategy for the prevention of cardiovascular disease (CVD) requires an assessment of an individual\\'s total CVD risk so that the most intensive risk factor management can be directed towards those at highest risk. Here we review developments in the assessment and estimation of total CVD risk.

  16. Total Dose Survivability of Hubble Electronic Components (United States)

    Xapsos, M. A.; Stauffer, C.; Jordan, T.; Poivey, C.; Haskins, D. N.; Lum, G.; Pergosky, A. M.; Smith, D. C.; LaBel, K. A.


    A total dose analysis for exposure of electronic parts at the box level is presented for the Hubble Space Telescope. This was done using solid angle sectoring/3-dimensional ray trace and Monte Carlo radiation transport simulations. Results are discussed in terms of parts that are potential total dose concerns.

  17. Records Management in Organization and Total Quality

    Directory of Open Access Journals (Sweden)

    Fahrettin Özdemirci


    Full Text Available In this article the relationship between total quality management and records managemen t are examined. It has also been indicated that the records mana­gement has vita'ly important part for realizing the total quality management approach.

  18. Phytochemical composition, total phenolic content and ferric ...

    African Journals Online (AJOL)

    The increased interest in discovering drugs from natural source led to the investigation of the phytochemical composition, the total phenolic content (TPC) and ferric reducing antioxidant power (FRAP) of leaf, stem and root bark extracts of S. sarmentosus DC. The total phenolic content of the extracts were examined using ...

  19. Timing the total reflection of light

    International Nuclear Information System (INIS)

    Chauvat, Dominique; Bonnet, Christophe; Dunseath, Kevin; Emile, Olivier; Le Floch, Albert


    We have identified for the first time the absolute delay at total reflection, envisioned by Newton. We show that there are in fact two divergent Wigner delays, depending on the polarisation of the incident light. These measurements give a new insight on the passage from total reflection to refraction

  20. Total cross section of highly excited strings

    International Nuclear Information System (INIS)

    Lizzi, F.; Senda, I.


    The unpolarized total cross section for the joining of two highly excited strings is calculated. The calculation is performed by taking the average overall states in the given excitation levels of the initial strings. We find that the total cross section grows with the energy and momentum of the initial states. (author). 8 refs, 1 fig

  1. Sexuality after total vs. subtotal hysterectomy

    DEFF Research Database (Denmark)

    Zobbe, Vibeke Bahn; Gimbel, Helga Margrethe Elisabeth; Andersen, Birthe Margrethe


    The effect of hysterectomy on sexuality is not fully elucidated and until recently total and subtotal hysterectomies have only been compared in observational studies.......The effect of hysterectomy on sexuality is not fully elucidated and until recently total and subtotal hysterectomies have only been compared in observational studies....

  2. Haematocrit, Haemoglobin, Total Protein And Whole Blood ...

    African Journals Online (AJOL)

    The study was performed on a total of one hundred and nineteen apparently healthy mallards, reared under the traditional extensive management system with the aim of establishing the base-line values of packed cell volume (PCV), haemoglobin (Hb), total protein (TP) and whole blood coagulation time (WBCT) of these ...

  3. Total reflection x-ray fluorescence (TXRF)

    International Nuclear Information System (INIS)

    Hockett, R.S.


    Total reflection X-Ray Fluorescence (TXRF) is a glancing x-ray analytical technique which is used primarily to measure surface metal contamination on semiconductor substrates. This is a review of Total reflection X-Ray Fluorescence (TXRF) applications for silicon semiconductor processing. In addition, some comments are made about the future of TXRF, and in particular, synchrotron radiation TXRF (SR-TXRF)

  4. Totally optimal decision trees for Boolean functions

    KAUST Repository

    Chikalov, Igor


    We study decision trees which are totally optimal relative to different sets of complexity parameters for Boolean functions. A totally optimal tree is an optimal tree relative to each parameter from the set simultaneously. We consider the parameters characterizing both time (in the worst- and average-case) and space complexity of decision trees, i.e., depth, total path length (average depth), and number of nodes. We have created tools based on extensions of dynamic programming to study totally optimal trees. These tools are applicable to both exact and approximate decision trees, and allow us to make multi-stage optimization of decision trees relative to different parameters and to count the number of optimal trees. Based on the experimental results we have formulated the following hypotheses (and subsequently proved): for almost all Boolean functions there exist totally optimal decision trees (i) relative to the depth and number of nodes, and (ii) relative to the depth and average depth.

  5. 38 CFR 3.340 - Total and permanent total ratings and unemployability. (United States)


    ... are met. (3) Ratings of total disability on history. In the case of disabilities which have undergone... disability ratings—(1) General. Total disability will be considered to exist when there is present any... substantially gainful occupation. Total disability may or may not be permanent. Total ratings will not be...

  6. Total's LNG activities from Algeria to Yemen

    International Nuclear Information System (INIS)

    Vedrenne, J.P.


    In March 1995, further to an international tender, Total was awarded the leadership of the first LNG project in Yemen. On January 1997 Total announced the extension of the share-holding of the Yemen LNG Co. to include the companies with interests in the Marib area (Hunt-Exxon-Yukong). The Marib area will supply the gas to the future liquefaction plant. The ratification of these agreements confirms the role of Total as lead shareholder with 36% in the share-holding structure and guarantees gas supply from the Marib licence, operated by Hunt-Exxon. (author)

  7. The total irregularity of a graph

    DEFF Research Database (Denmark)

    Abdo, H.; Brandt, S.; Dimitrov, D.


    In this note a new measure of irregularity of a graph G is introduced. It is named the total irregularity of a graph and is defined as irr(t)(G) - 1/2 Sigma(u, v is an element of V(G)) vertical bar d(G)(u) - d(G)(v)vertical bar, where d(G)(u) denotes the degree of a vertex u is an element of V......(G). All graphs with maximal total irregularity are determined. It is also shown that among all trees of the same order the star has the maximal total irregularity....

  8. Need total sulfur content? Use chemiluminescence

    Energy Technology Data Exchange (ETDEWEB)

    Kubala, S.W.; Campbell, D.N. [Fluid Data, Inc., Angleton, TX (United States); DiSanzo, F.P. [Mobil Technology Co., Paulsboro, NJ (United States)


    Regulations issued by the United States Environmental Protection Agency require petroleum refineries to reduce or control the amount of total sulfur present in their refined products. These legislative requirements have led many refineries to search for online instrumentation that can produce accurate and repeatable total sulfur measurements within allowed levels. Several analytical methods currently exist to measure total sulfur content. They include X-ray fluorescence (XRF), microcoulometry, lead acetate tape, and pyrofluorescence techniques. Sulfur-specific chemiluminescence detection (SSCD) has recently received much attention due to its linearity, selectivity, sensitivity, and equimolar response. However, its use has been largely confined to the area of gas chromatography. This article focuses on the special design considerations and analytical utility of an SSCD system developed to determine total sulfur content in gasoline. The system exhibits excellent linearity and selectivity, the ability to detect low minimum levels, and an equimolar response to various sulfur compounds. 2 figs., 2 tabs.

  9. Can You Depend Totally on Computers?

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 3; Issue 2. Can You Depend Totally on Computers? Computer Security, Availability and Correctness. H N Mahabala. General Article Volume 3 Issue 2 February 1998 pp 35-44 ...

  10. Establishing a total information management program

    International Nuclear Information System (INIS)

    Hegstrom, K.L.; Fisher, J.


    A total information management program manages documents for easy access and identifies data elements commonly found in all documents. The program thus links disparate documents by identifying information they share in common

  11. Pulmonary nodules secondary to total parenteral alimentation

    International Nuclear Information System (INIS)

    Landry, B.A.; Melhem, R.E.


    A seven-year-old male, who had a retroperitoneal alveolar rhabdomyosarcoma and was on total parenteral alimentation (TPN) developed muliple pulmonary nodules, indistinguishable from metastases. These proved to be multiple lipid emboli on open biopsy. (orig.)


    Directory of Open Access Journals (Sweden)

    Elena-Sabina HODOR


    Full Text Available Total Rewards Management is a subject of major importance for companies, because, by using models for this, firms can achieve their objectives of high performance. In order to analyse a validated total rewards model in Romanian Accounting and Consulting Companies, it is used The WorldatWork Total Rewards Model, which depict what contributes to applicant attraction and employee motivation and retention. Thus, the methodology of the previous survey is adjusted to the local context. The conclusions for the methodological aspects illustrate that the present research involves three strategic steps in order to achieve the objectives presented: the analysis of organizational environment of the companies from the sample, checking if Total Rewards Model proposed in the previous research is applicable for the same romanian companies from the previous survey, the analysing of the differences between results, and, if necessary, the adaptation of the model for Romania.

  13. Definition of total bootstrap current in tokamaks

    International Nuclear Information System (INIS)

    Ross, D.W.


    Alternative definitions of the total bootstrap current are compared. An analogous comparison is given for the ohmic and auxiliary currents. It is argued that different definitions than those usually employed lead to simpler analyses of tokamak operating scenarios

  14. ROE Total Nitrogen Deposition 1989-1991 (United States)

    U.S. Environmental Protection Agency — This dataset identifies the amount of wet, dry, and total deposition of nitrogen in kilograms per hectare from 1989 to 1991 at a set of point locations across the...

  15. ROE Total Sulfur Deposition 1989-1991 (United States)

    U.S. Environmental Protection Agency — This dataset identifies the amount of wet, dry, and total deposition of sulfur in kilograms per hectare from 1989 to 1991 at a set of point locations across the...

  16. ROE Total Sulfur Deposition 2011-2013 (United States)

    U.S. Environmental Protection Agency — This dataset identifies the amount of wet, dry, and total deposition of sulfur in kilograms per hectare from 2011 to 2013 at a set of point locations across the...

  17. ROE Total Nitrogen Deposition 2011-2013 (United States)

    U.S. Environmental Protection Agency — This dataset identifies the amount of wet, dry, and total deposition of nitrogen in kilograms per hectare from 2011 to 2013 at a set of point locations across the...

  18. The total plasmatic estriol on normal gestation

    International Nuclear Information System (INIS)

    Thiesen, A.L.


    The total plasmatic estriol in normal pregnants was determinated by radioimmunological method using estriol labelled with sup(125)I. The obtained results presented similar results in comparison with methods using sup(19)C and sup(3)H. (author)

  19. Total Coliform Rule (TCR) Federal Register Notice (United States)

    This document provides the FR notice to 40 CFR Parts 141 and 142 Drinking Water: National Primary Drinking Water Regulations; Total Coliforms (Including Fecal Coliforms and E. Coli); Final Rule (26 pp, 5 M).

  20. Revised Total Coliform Rule Lab Sampling Form (United States)

    This form should be completed when a water system collects any required Revised Total Coliform Rule (RTCR) samples. It should also be used when collecting “Special” non-compliance samples for the RTCR.

  1. Revised Total Coliform Webinar for Primacy Agencies (United States)

    This webinar was created to assist Primacy Agencies in the implementation of the Revised Total Coliform Rule. It provides an overview of the requirements in the rule and implementation guidance for Primacy Agencies.

  2. US-Total Electron Content Product (USTEC) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The US Total Electron Content (US-TEC) product is designed to specify TEC over the Continental US (CONUS) in near real-time. The product uses a Kalman Filter data...

  3. NESDIS Blended Total Precipitable Water (TPW) Products (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The blended Total Precipitable Water (TPW) product is derived from multiple sensors/satellites. The Percentage of TPW normal (PCT), or TPW anomaly, shows the...

  4. Total lymphoid irradiation in alloimmunity and autoimmunity

    Energy Technology Data Exchange (ETDEWEB)

    Strober, S.


    Total lymphoid irradiation has been used as an immunosuppressive regimen in autoimmune disease and organ transplantation. The rationale for its use originated from studies of patients with Hodgkin disease, in whom this radiotherapy regimen was noted to induce profound and long-lasting immune suppression and yet was well tolerated, with few long-term side effects. Total lymphoid irradiation is a unique immunosuppressive regimen that produces a selective (and long-lasting) reduction in the number and function of helper T cells and certain subsets of B cells. Conventional immunosuppressive drugs show little selectivity, and their effects are short-lived. The most important aspect of total lymphoid irradiation is the potential for achieving transplantation tolerance and permanent remissions in autoimmune disease in laboratory animals. Attempts are being made to achieve similar goals in humans given total lymphoid irradiation, so that immunosuppressive drugs can be ultimately withdrawn from transplant recipients and patients with lupus nephritis. 28 references.

  5. Pulmonary nodules secondary to total parenteral alimentation

    Energy Technology Data Exchange (ETDEWEB)

    Landry, B.A.; Melhem, R.E.


    A seven-year-old male, who had a retroperitoneal alveolar rhabdomyosarcoma and was on total parenteral alimentation (TPN) developed muliple pulmonary nodules, indistinguishable from metastases. These proved to be multiple lipid emboli on open biopsy. (orig.).



    Petruta Timis


    The aim of the paper is to monitorize the total iron content in some food categories presented in the Romanian peoplediet in order to obtain information about the most indicate food for anaemia. The studied food categories are liver, meat, vegetables, fruits, bread and cereals, chicken egg, nuts and seeds, bees products. Duethe fact that some food are consumed after a thermal treatment, the impact of thermal processing (frying, boiling, roasting) on total iron content comparing with no-proces...

  7. Gemella haemolysans Infection in Total Hip Arthroplasty. (United States)

    Rose, Barry; Jeer, Parminder J S; Spriggins, Anthony J


    Gemella haemolysans is a Gram-positive coccus and commensal of the upper respiratory tract and oral mucosa that rarely causes clinically important infections. There is only one previous report of this organism causing periprosthetic infection, in a total knee arthroplasty. We present a case of septic loosening of an uncemented total hip arthroplasty due to G. haemolysans, in an asplenic patient with insulin dependent diabetes mellitus. Treatment with two-stage revision has been successful at 7 years of follow-up.

  8. Total factor productivity and Bio Economy effects


    Zuniga Gonzalez, Carlos Alberto


    This paper develops a new measure of total factor productivity growth in agricultural Production which incorporates Bio Economic components effects.The new measure is called the Bio Economic-Oriented Total Factor Productivity (BTFP) index, and incorporates components of Bio Economic as liquid biofuels. BTFP measure changes in Bio Economic efficiency and can be decomposed into bio economy efficiency change (BEC), and Bio Economic technological change (BTC) components.An empirical analysis, inv...

  9. A strategic zone for Total's future

    International Nuclear Information System (INIS)

    Legros, E.J.


    In 1997, the Total company investments in the Middle East reached 1.2 billions of French Francs. This region is considered as a major growth zone by the French group. This paper summarizes the Total's participations in oil and gas activities and partnerships of Middle East countries (Abu Dhabi, Dubai, Oman, Qatar, Yemen): exploration, production, development, contracts, permits, technical assistance etc.. (J.S.)

  10. Concomitant Total Wrist and Total Elbow Arthroplasty in a Rheumatoid Patient


    Kane, Patrick M.; Stull, Justin D.; Culp, Randall W.


    Background Concomitant arthroplasty has been described to have several benefits over multistage procedures. Ipsilateral total elbow and total shoulder arthroplasty has been reported with good outcomes in upper extremity concomitant arthroplasty.

  11. Totally implantable catheter embolism: two related cases

    Directory of Open Access Journals (Sweden)

    Rodrigo Chaves Ribeiro

    Full Text Available CONTEXT AND OBJECTIVE: Long-term totally implantable catheters (e.g. Port-a-Cath® are frequently used for long-term venous access in children with cancer. The use of this type of catheter is associated with complications such as infection, extrusion, extravasation and thrombosis. Embolism of catheter fragments is a rare complication, but has potential for morbidity. The aim here was to report on two cases in which embolism of fragments of a long-term totally implantable catheter occurred. DESIGN AND SETTING: Case series study at Hospital do Servidor Público Estadual, São Paulo. METHODS: Retrospective review of catheter embolism in oncological pediatric patients with long-term totally implantable catheters. RESULTS: The first patient was a 3-year-old girl diagnosed with stage IV Wilms' tumor. Treatment was started with the introduction of a totally implantable catheter through the subclavian vein. At the time of removal, it was realized that the catheter had fractured inside the heart. An endovascular procedure was necessary to remove the fragment. The second case was a boy diagnosed with stage II Wilms' tumor at the age of two years. At the time of removal, it was noticed that the catheter had disconnected from the reservoir and an endovascular procedure was also necessary to remove the embolized catheter. CONCLUSION: Embolism of fragments of totally implantable catheters is a rare complication that needs to be recognized even in asymptomatic patients.

  12. Total thyroidectomy for multi - nodular goiter

    International Nuclear Information System (INIS)

    Ali, M.A.; Raziq, S.R.; Khan, W.A.; Majeed, S.


    Objective: To assess the efficacy and safety of total thyroidectomy for benign multi-nodular goiter. Study design: Descriptive study Place and Duration of Study: The study was conducted in the Department of General Surgery, Combined Military Hospital Kharian from January 2004 to December 2008. Materials and Methods: A total of 66 patients with bilateral benign multi-nodular goiter (61 females and 5 males) underwent total thyroidectomy. Sixty two cases were euthyroid while 4 had hyperthyroidism. Surgical dissection techniques involved identifying both recurrent laryngeal nerves through out their course, securing of parathyroid glands with their intact blood supply and ligation of inferior thyroid artery branches close to the thyroid capsule. All the patients were evaluated post operatively for signs of recurrent laryngeal nerve injury and hypoparathyroidism and other complications. All patients were put on thyroxin replacement therapy post-operatively and were followed for 9 to 12 months. There was no injury to the recurrent laryngeal nerves. One case of injury to external laryngeal nerve was found. Transient hypocalcaemia occurred in 4 patients without permanent hypoparathyroidism. All cases of transient hypocalcaemia recovered fully within 3 months. Four patients had occult malignancy diagnosed post-operatively on histo-pathology. In experienced hands, total thyroidectomy is an effective and relatively safe operation for benign multi-nodular goitre and its complication rate is same as that of a sub-total thyroidectomy. (author)

  13. Total lymphoid irradiation of intractable rheumatoid arthritis

    International Nuclear Information System (INIS)

    Herbst, M.; Fritz, H.; Sauer, R.


    Eleven patients with intractable rheumatoid arthritis were treated with fractionated total lymphoid irradiation, (total dose 20 Gy). Lasting improvement in clinical symptoms was found in four patients during treatment and the remaining patients experienced similar benefit within 2 months of irradiation. There was marked reduction in exacerbations and number of joints involved. Morning stiffness, joint swelling and tenderness decreased. Complications included severe fatigue during treatment and acute bacterial arthritis in multiple joints in one patient. Four patients have since died, one of renal failure, another of cardiogenic shock following surgery 3 and 24 months after total lymphoid irradiation. Both had generalised amyloidosis. The third patient developed joint empyema and died of toxic cardiac failure. The fourth died 3 months after resection of a Kaposi's sarcoma complicated by wound infection which responded to treatment. Immunologically, total lymphoid irradiation resulted in suppression of the absolute lymphocyte count and reduction in T-helper cells, the number of T-suppressor cells remaining unchanged. These data provide evidence of T-cell involvement in the pathogenesis of rheumatoid arthritis. Total lymphoid irradiation can induce sustained improvement in clinical disease activity, but severe, possibly fatal, side-effects cannot be ignored. (author)

  14. Concomitant Total Wrist and Total Elbow Arthroplasty in a Rheumatoid Patient. (United States)

    Kane, Patrick M; Stull, Justin D; Culp, Randall W


    Background Concomitant arthroplasty has been described to have several benefits over multistage procedures. Ipsilateral total elbow and total shoulder arthroplasty has been reported with good outcomes in upper extremity concomitant arthroplasty. Case Description A 65-year-old woman presented with ipsilateral left-sided wrist and elbow joint degeneration as a result of longstanding rheumatoid arthritis. Concomitant total wrist and total elbow arthroplasty was performed with satisfactory results at both joints. She tolerated the procedure well and had an uneventful clinical course postoperatively. Literature Review Currently, no literature exists that describes one-stage total wrist and total elbow arthroplasty. Individually, total wrist and total elbow arthroplasty have both been reported to result in good outcomes and patient satisfaction. Previous studies have reported the utility of concomitant ipsilateral upper extremity procedures with a one-stage total elbow and total shoulder arthroplasty having been identified as a cost-saving procedure with expedited return to functionality versus a two-stage procedure. Clinical Relevance Patients with ipsilateral degenerative changes in the wrist and elbow should be considered on an individual case basis for concomitant total wrist and total elbow arthroplasty.

  15. Concomitant Total Wrist and Total Elbow Arthroplasty in a Rheumatoid Patient (United States)

    Kane, Patrick M.; Stull, Justin D.; Culp, Randall W.


    Background Concomitant arthroplasty has been described to have several benefits over multistage procedures. Ipsilateral total elbow and total shoulder arthroplasty has been reported with good outcomes in upper extremity concomitant arthroplasty. Case Description A 65-year-old woman presented with ipsilateral left-sided wrist and elbow joint degeneration as a result of longstanding rheumatoid arthritis. Concomitant total wrist and total elbow arthroplasty was performed with satisfactory results at both joints. She tolerated the procedure well and had an uneventful clinical course postoperatively. Literature Review Currently, no literature exists that describes one-stage total wrist and total elbow arthroplasty. Individually, total wrist and total elbow arthroplasty have both been reported to result in good outcomes and patient satisfaction. Previous studies have reported the utility of concomitant ipsilateral upper extremity procedures with a one-stage total elbow and total shoulder arthroplasty having been identified as a cost-saving procedure with expedited return to functionality versus a two-stage procedure. Clinical Relevance Patients with ipsilateral degenerative changes in the wrist and elbow should be considered on an individual case basis for concomitant total wrist and total elbow arthroplasty. PMID:27104080

  16. Renal function after elective total hip replacement

    DEFF Research Database (Denmark)

    Perregaard, Helene; Damholt, Mette B; Solgaard, Søren


    and the prevalence of chronic kidney disease (CKD) in an elective population of orthopedic patients undergoing primary total hip replacement, hypothesizing that chronic kidney disease predisposes to AKI. Patients and methods - This was a single-center, population-based, retrospective, registry-based cohort study...... involving all primary elective total hip replacements performed from January 2003 through December 2012. Patient demographics and creatinine values were registered. We evaluated the presence of CKD and AKI according to the international guidelines for kidney disease (KDIGO Acute Kidney Injury Workgroup 2013...... ). Results - 3,416 patients were included (2,064 females (60%)). AKI (according to KDIGO criteria) was seen in 75 patients (2.2%, 95% CI: 1.7-2.7) in the course of primary total hip replacement. Of these, 26 had pre-existing CKD of class 3-5. Pre-existing CKD of class 3-5, indicating moderately to severely...

  17. Assay development status report for total cyanide

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, B.C. [Westinghouse Hanford Co., Richland, WA (United States); Jones, T.E.; Pool, K.H. [Pacific Northwest Lab., Richland, WA (United States)


    A validated cyanide assay that is applicable to a variety of tank waste matrices is necessary to resolve certain waste tank safety issues and for purposes of overall waste characterization. The target for this effort is an assay with an applicable range of greater than 1,000 ppM (0.10 wt%) total cyanide and a confidence level greater than 80%. Figure 1 illustrates the operating regime of the proposed cyanide assay method. The Assay Development Status Report for Total Cyanide will summarize the past experience with cyanide analyses on-tank waste matrices and will rate the status of the analytical methods used to assay total cyanide (CN{sup {minus}} ion) in the tank waste matrices as acceptable or unacceptable. This paper will also briefly describe the current efforts for improving analytical resolution of the assays and the attempts at speciation.

  18. Heterotopic bone formation following total shoulder arthroplasty

    DEFF Research Database (Denmark)

    Kjaersgaard-Andersen, P.; Frich, Lars Henrik; Sjøbjerg, J.O.


    the glenohumeral and/or the glenoacromial space. There was no correlation between shoulder pain and the development of ossification. Shoulders with grade III heterotopic bone formation had a limited range of active elevation compared with shoulders without or with only a milder lesion. Men and patients......The incidence and location of heterotopic bone formation following total shoulder arthroplasty were evaluated in 58 Neer Mark-II total shoulder replacements. One year after surgery, 45% had developed some ectopic ossification. In six shoulders (10%) the ossifications roentgenographically bridged...... with osteoarthritis of the shoulder joint were significantly disposed to the development of heterotopic bone. Heterotopic bone formation following total shoulder arthroplasty is frequent, but disabling heterotopic ossifications seem to be rare....

  19. Severe Heterotopic Ossification following Total Knee Replacement

    Directory of Open Access Journals (Sweden)

    Alexander L. Dodds


    Full Text Available Although the incidence of minor heterotopic ossification is probably higher than what is usually expected, severe heterotopic ossification (HO is an extremely rare event following total knee replacement surgery. We present the case of a 66-year-old woman who initially had achieved an excellent range of motion following bilateral uncemented rotating platform total knee replacement, before presenting with pain and loss of range of motion at 2 months after surgery. Severe HO was diagnosed on X-rays. Treatment consisted of nonoperative measures only, including physiotherapy with hydrotherapy and anti-inflammatories. She eventually regained her range of motion when seen at 8 months after operation. This case illustrates that nonoperative treatment without the use of radiotherapy or surgery can be used to safely resolve stiffness caused by HO after total knee replacement.

  20. KP solitons, total positivity, and cluster algebras (United States)

    Kodama, Yuji; Williams, Lauren K.


    Soliton solutions of the KP equation have been studied since 1970, when Kadomtsev and Petviashvili [Kadomtsev BB, Petviashvili VI (1970) Sov Phys Dokl 15:539–541] proposed a two-dimensional nonlinear dispersive wave equation now known as the KP equation. It is well-known that the Wronskian approach to the KP equation provides a method to construct soliton solutions. The regular soliton solutions that one obtains in this way come from points of the totally nonnegative part of the Grassmannian. In this paper we explain how the theory of total positivity and cluster algebras provides a framework for understanding these soliton solutions to the KP equation. We then use this framework to give an explicit construction of certain soliton contour graphs and solve the inverse problem for soliton solutions coming from the totally positive part of the Grassmannian. PMID:21562211

  1. Mixed total screening for sulfur isotope

    International Nuclear Information System (INIS)

    Cui Bin; Zhao Lei; Zhan Zhaoyang; He Zhijun


    The research on modern economic geology indicates that most ore deposits formed with characters of multi-origin, multi-stage and multi-genesis. Quantificational research of Sulfur isotope origin is a difficult problem that puzzles Geochemists all along. So the formation process of an ore deposit can be taken as the mix or the superposition of multi totals, which can be described by the mathematics model of mixed total screening. In the study of mid-down Yangtze River and Dongpo ore field in Hunan province, the authors successfully applied the mathematics model of mixed total screening, quantificationally resolved the problem of Sulfur isotope origin and mineralizing matter origin, and found out the mineralizing mechanism. This is very valuable. (authors)

  2. Total factor productivity - a misleading concept

    Directory of Open Access Journals (Sweden)

    Angelo Reati


    Full Text Available The paper criticises the concept of total factor productivity as a measure of technical change and economic performance on two grounds: (i theoretical, because it shares all the weaknesses of the neoclassical production function from which it is derived; (ii its relevance in helping to understand the present technological revolution in computer and information technologies, since it concerns only disembodied technical change. The practical conclusion is that total factor productivity is more a measure of "noise" than a genuine indicator of technical progress. In spite of the above drawbacks, total factor productivity is still widely used in empirical work on technical change. This is all the more surprising since the alternative concept ofproductivity of labour not only avoids the above mentioned criticisms but is theoretically superior to its rival concept because it captures the true nature of present technical change.

  3. Total quality management in orthodontic practice. (United States)

    Atta, A E


    Quality is the buzz word for the new Millennium. Patients demand it, and we must serve it. Yet one must identify it. Quality is not imaging or public relations; it is a business process. This short article presents quality as a balance of three critical notions: core clinical competence, perceived values that our patients seek and want, and the cost of quality. Customer satisfaction is a variable that must be identified for each practice. In my practice, patients perceive quality as communication and time, be it treatment or waiting time. Time is a value and cost that must be managed effectively. Total quality management is a business function; it involves diagnosis, design, implementation, and measurement of the process, the people, and the service. Kazien is a function that reduces value services, eliminates waste, and manages time and cost in the process. Total quality management is a total commitment for continuous improvement.

  4. An Operational Perspective of Total Lightning Information (United States)

    Nadler, David J.; Darden, Christopher B.; Stano, Geoffrey; Buechler, Dennis E.


    The close and productive collaborations between the NWS Warning and Forecast Office, the Short Term Prediction and Research Transition Center at NASA Marshall Space Flight Center and the University of Alabama in Huntsville have provided a unique opportunity for science sharing and technology transfer. One significant technology transfer that has provided immediate benefits to NWS forecast and warning operations is the use of data from the North Alabama Lightning Mapping Array. This network consists of ten VHF receivers deployed across northern Alabama and a base station located at the National Space Science and Technology Center. Preliminary investigations done at WFO Huntsville, along with other similar total lightning networks across the country, have shown distinct correlations between the time rate-of-change of total lightning and trends in intensity/severity of the parent convective cell. Since May 2003 when WFO HUN began receiving these data - in conjunction with other more traditional remotely sensed data (radar, satellite, and surface observations) -- have improved the situational awareness of the WFO staff. The use of total lightning information, either from current ground based systems or future space borne instrumentation, may substantially contribute to the NWS mission, by enhancing severe weather warning and decision-making processes. Operational use of the data has been maximized at WFO Huntsville through a process that includes forecaster training, product implementation, and post event analysis and assessments. Since receiving these data, over 50 surveys have been completed highlighting the use of total lightning information during significant events across the Tennessee Valley. In addition, around 150 specific cases of interest have been archived for collaborative post storm analysis. From these datasets, detailed trending information from radar and total lightning can be compared to corresponding damage reports. This presentation will emphasize

  5. Failure of aseptic revision total knee arthroplasties. (United States)

    Leta, Tesfaye H; Lygre, Stein Håkon L; Skredderstuen, Arne; Hallan, Geir; Furnes, Ove


    In Norway, the proportion of revision knee arthroplasties increased from 6.9% in 1994 to 8.5% in 2011. However, there is limited information on the epidemiology and causes of subsequent failure of revision knee arthroplasty. We therefore studied survival rate and determined the modes of failure of aseptic revision total knee arthroplasties. This study was based on 1,016 aseptic revision total knee arthroplasties reported to the Norwegian Arthroplasty Register between 1994 and 2011. Revisions done for infections were not included. Kaplan-Meier and Cox regression analyses were used to assess the survival rate and the relative risk of re-revision with all causes of re-revision as endpoint. 145 knees failed after revision total knee arthroplasty. Deep infection was the most frequent cause of re-revision (28%), followed by instability (26%), loose tibial component (17%), and pain (10%). The cumulative survival rate for revision total knee arthroplasties was 85% at 5 years, 78% at 10 years, and 71% at 15 years. Revision total knee arthroplasties with exchange of the femoral or tibial component exclusively had a higher risk of re-revision (RR = 1.7) than those with exchange of the whole prosthesis. The risk of re-revision was higher for men (RR = 2.0) and for patients aged less than 60 years (RR = 1.6). In terms of implant survival, revision of the whole implant was better than revision of 1 component only. Young age and male sex were risk factors for re-revision. Deep infection was the most frequent cause of failure of revision of aseptic total knee arthroplasties.

  6. Determination of total solutes in synfuel wastewaters

    Energy Technology Data Exchange (ETDEWEB)

    Wallace, J.R.; Bonomo, F.S.


    Efforts to investigate both lyophilization and the measurement of colligative properties as an indication of total solute content are described. The objective of the work described is to develop a method for measuring total dissolved material in retort wastewaters which is simple and rugged enough to be performed in a field laboratory in support of pollution control tests. The analysis should also be rapid enough to provide timely and pertinent data to the pollution control plant operator. To be of most value, the technique developed also should be applicable to other synfuel wastewaters, most of which contain similar major components as oil shale retort waters. 4 references, 1 table.


    Directory of Open Access Journals (Sweden)



    Full Text Available In order to reach the objective of supplying some relevant information regarding the liquidity inflows and outflows during a financial exercise, the total cash flow analysis must include the analysis of result cashable from operation, of payments and receipts related to the investment and of financing decisions of the last exercise, as well as the analysis of treasury variation (of cash items. The management of total cash flows ensures the correlation of current liquidness flows as consequence of receipts with the payments ’flows, in order to provide payment continuity of mature obligations.

  8. Gemella haemolysans Infection in Total Hip Arthroplasty

    Directory of Open Access Journals (Sweden)

    Barry Rose


    Full Text Available Gemella haemolysans is a Gram-positive coccus and commensal of the upper respiratory tract and oral mucosa that rarely causes clinically important infections. There is only one previous report of this organism causing periprosthetic infection, in a total knee arthroplasty. We present a case of septic loosening of an uncemented total hip arthroplasty due to G. haemolysans, in an asplenic patient with insulin dependent diabetes mellitus. Treatment with two-stage revision has been successful at 7 years of follow-up.

  9. ASVCP guidelines: Allowable total error hematology. (United States)

    Nabity, Mary B; Harr, Kendal E; Camus, Melinda S; Flatland, Bente; Vap, Linda M


    The purpose of this document is to provide total allowable error (TE a ) recommendations for commonly analyzed hematology measurands for veterinary personnel. These guidelines define relevant terminology and highlight considerations specific to hematology measurands. They also provide reasons and guidelines for using TE a in instrument performance evaluation, including recommendations for when the total observed error exceeds the recommended TE a . Biological variation-based quality specifications are briefly discussed. The appendix describes the derivation of the hematology TE a recommendations and provides resources for external quality assurance/proficiency testing programs and a worksheet for implementation of the guidelines. © 2018 American Society for Veterinary Clinical Pathology.

  10. Trying and the Arguments from Total Failure

    DEFF Research Database (Denmark)

    Grünbaum, Thor


    New Volitionalism is a name for certain widespread conception of the nature of intentional action. Some of the standard arguments for New Volitionalism, the so-called arguments from total failure, have even acquired the status of basic assumptions for many other kinds of philosophers. It is there......New Volitionalism is a name for certain widespread conception of the nature of intentional action. Some of the standard arguments for New Volitionalism, the so-called arguments from total failure, have even acquired the status of basic assumptions for many other kinds of philosophers...

  11. TOTAL FINA ELF. Annual report 2002

    International Nuclear Information System (INIS)


    This document is the annual report 2002 of Total-Fina-Elf society, great company on the hydrocarbons market. According to the company objective (set the standard not only with the financial performance, but also with stringent requirements in terms of social and environmental responsibility), it presents the Chairman message, the corporate governance, the social and environmental responsibility, the future of energy, the human resources policy, the investor relations, the overview of Total-Fina-Elf fiscal year with financial information and 2002 industrial events. (A.L.B.)

  12. Development of kits for total PSA monitoring

    International Nuclear Information System (INIS)

    Suprarop, P.


    The development of kits for Total PSA assay has shown promising results. All essential components of the assay were prepared with reproducibility and used to optimize the assay. By choosing two steps method, we could avoid the hook effect and obtain satisfactory Q.C. parameters of the standard curve i.e. blank = 0.8%, maximum binding = 65%. If reference material for calibration of the standard is agree upon, the validation could then be carried out with total confidence. Our final goal is to reduce the step of incubation to just one step with no interference from hook effect

  13. Employee benefits in a total rewards framework. (United States)

    Kwon, Jane; Hein, Pam


    Benefits represent one of the largest investments a company makes in its talent. However, our tendency can be to design, deliver and communicate benefits programs independently, without fully considering how those programs fit within a bigger picture of total rewards. Sure, we need to manage and execute individual benefit programs--but not at the expense of getting a real return on our more significant investment in talent. This article provides employers with perspectives on the value of managing benefits within the broader framework of total rewards, why it works and, most importantly, how to make it work.

  14. TOTAL 2003 activities report in brief

    International Nuclear Information System (INIS)


    This activities report presents the activities of the petroleum industry Group Total for the year 2003. The following topics are detailed: the corporate social responsibility with the environment stewardship, the energy future management, the safety enhancing, the human resources and the ethics and local development; the shareholder information with the Total share and the share-holding structure; the activities with informations on the Group, the main events, the upstream exploration and production,, the downstream refining, marketing, trading and shipping, the chemicals with overview 2003, base chemical and polymers, performance and specialities. (A.L.B.)

  15. Postoperative pain treatment after total knee arthroplasty

    DEFF Research Database (Denmark)

    Karlsen, Anders Peder Højer; Wetterslev, Mik; Hansen, Signe Elisa


    INTRODUCTION: The aim of this systematic review was to document efficacy, safety and quality of evidence of analgesic interventions after total knee arthroplasty (TKA). METHODS: This PRISMA-compliant and PROSPERO-registered review includes all-language randomized controlled trials of medication-b...... of an optimal procedure-specific analgesic regimen after TKA....

  16. Total spectral distributions from Hawking radiation (United States)

    Broda, Bogusław


    Taking into account the time dependence of the Hawking temperature and finite evaporation time of the black hole, the total spectral distributions of the radiant energy and of the number of particles have been explicitly calculated and compared to their temporary (initial) blackbody counterparts (spectral exitances).

  17. Total synthesis of insect antifeedant drimane sesquiterpenes

    NARCIS (Netherlands)

    Jansen, B.J.M.


    The investigations described in this thesis deal with the total synthesis of sesquiterpenes of the drimane family, named for their widespread occurrence in the stem bark of South American Drimys species. These compounds contain the bicyclofarnesol nucleus

  18. Applying Total Quality Management to Business Education. (United States)

    Brown, Daniel J.; Koenig, Harold F.


    Responses from 390 business school alumni (60%) show that students want educators to consider their opinions about their overall educational experience and what happens after graduation. A total quality management approach can help discover customer/student needs, establish a focus on improvement, and implement a process orientation. (SK)

  19. Total hip arthroplasty: an editiorial comment. (United States)

    Peterson, L F


    Total hip arthroplasty has become an accepted method of management of severe painful problems of the hip. It has undergone some dramatic changes, the major thrust now being to more nearly match the mechanical characteristics of the implant to the bone and cartilage they replace.

  20. Crossing Total Occlusions : Navigating Towards Recanalization

    NARCIS (Netherlands)

    Sakes, A.; Regar, E.; Dankelman, J.; Breedveld, P.


    Chronic total occlusions (CTOs) represent the “last frontier” of percutaneous interventions. The main technical challenges lies in crossing the guidewire into the distal true lumen, which is primarily due to three problems: device buckling during initial puncture, inadequate visualization, and the

  1. Crossing Total Occlusions: Navigating Towards Recanalization

    NARCIS (Netherlands)

    A. Sakes (Aimée); E.S. Regar (Eveline); J. Dankelman (Jenny); P. Breedveld (Paul)


    textabstractChronic total occlusions (CTOs) represent the “last frontier” of percutaneous interventions. The main technical challenges lies in crossing the guidewire into the distal true lumen, which is primarily due to three problems: device buckling during initial puncture, inadequate

  2. Design improvements in Total Knee Arthroplasty

    NARCIS (Netherlands)

    Barink, M.


    The thesis deals with three questions concerning the knee joint and total knee arthroplasty. 1. Are there parameters which can be changed to reduce bone resorption, caused by TKA, without affecting other relevant parameters? A debonded anterior flange of the femoral TKA component reduces bone

  3. Concise total syntheses of (+/-)-strychnine and (+/-)-akuammicine. (United States)

    Sirasani, Gopal; Paul, Tapas; Dougherty, William; Kassel, Scott; Andrade, Rodrigo B


    Concise total syntheses of Strychnos alkaloids strychnine (1) and akuammicine (2) have been realized in 13 and 6 operations, respectively. Key steps include (1) the vinylogous Mannich reaction; (2) a novel, sequential one-pot spirocyclization/intramolecular aza-Baylis-Hillman reaction; and (3) a Heck cyclization. The synthesis of 1 proceeds via the Wieland-Gumlich aldehyde (26).

  4. Application of Total Quality Management in Education (United States)

    Farooq, M. S.; Akhtar, M. S.; Ullah, S. Zia; Memon, R. A.


    The purpose of the paper is to analyzing thoughts of the modern management paradigm "Total Quality Management" (TQM), and its application in the field of education. The basic theme of TQM is participatory approach to address the question(s) of quality in business aswell as in the field of education. Reviewing fresh literature from the internet …

  5. Diagnosing total quality management - part 2

    NARCIS (Netherlands)

    Bossink, B.A.G.; Gieskes, J.F.B.; Pas, T.N.M.


    From extensive literature research a total quality management (TQM) model is developed. This model describes the basic elements of the concept of TQM. It also provides a way in which the basic elements can be made operational in practice. Based on this model a quality diagnostic instrument is

  6. Diagnosing Total Quality Management. Part I

    NARCIS (Netherlands)

    Bossink, B.A.G.; Gieskes, J.F.B.; Pas, T.N.M.


    From extensive literature research a total quality management (TQM) model is developed. This model describes the basic elements of the concept of TQM. It also provides the way in which the basic elements can be made operational in practice. Based on this model a quality-diagnostical instrument is

  7. Diagnosing Total Quality Management - part 2

    NARCIS (Netherlands)

    Bossink, B.A.G.; Gieskes, J.F.B.; Pas, T.N.M.


    From extensive literature research a total quality management (TQM) model is developed. This model describes the basic elements of the concept of TQM. It also provides the way in which the basic elements can be made operational in practice. Based on this model a quality-diagnostical instrument is

  8. Total hip arthroplasty for giant cell tumour.

    Directory of Open Access Journals (Sweden)

    Kulkarni S


    Full Text Available A 32 month follow up of an uncommon case of a Giant Cell Tumour affecting the proximal end of femur is presented. Following a wide excision, the hip was reconstructed using Charnley type of low friction total hip arthroplasty. At a 32 month review, there was no recurrence and the function was good.

  9. Accumulation pattern of total nonstructural carbohydrate in ...

    African Journals Online (AJOL)

    The pattern of total nonstructural carbohydrate (TNC) accumulation in strawberry (Fragaria ananassa Duch.) nursery runner plants, cv. eCamarosaf, was determined for three growing seasons. Plant growth and fruit production patterns were also evaluated. The experiments were carried out on plants propagated in high ...

  10. Diagnosing total quality management - part 1

    NARCIS (Netherlands)

    Bossink, B.A.G.; Gieskes, J.F.B.; Pas, T.N.M.


    From extensive literature research a total quality management (TQM) model is developed. This model describes the basic elements of the concept of TQM. It also provides the way in which the basic elements can be made operational in practice. Based on this model a quality-diagnostical instrument is

  11. Accumulation pattern of total nonstructural carbohydrate in ...

    African Journals Online (AJOL)



    Sep 9, 1977 ... 1Instituto Nacional de Tecnología Agropecuaria (INTA), EEA Famaillá, Argentina. 2Department of Plant Sciences, University of California Davis, CA, USA. Accepted 17 October, 2012. The pattern of total nonstructural carbohydrate (TNC) accumulation in strawberry (Fragaria ananassa. Duch.) nursery ...

  12. Chinese National Strategy of Total War

    National Research Council Canada - National Science Library

    Good, Michael J


    ...?s efforts to modernize its military and economy through technological advancement. The results of this research indicates that China does possess a long term national strategy for engagement in a total war with the United States consistent with Chinese military strategy, and is actively pursuing this strategy across all elements of national power.

  13. Brutally Unfair Tactics Totally OK Now

    DEFF Research Database (Denmark)

    Wilson, Douglas


    In this paper, I use a party game that I co-designed, Brutally Unfair Tactics Totally OK Now (B.U.T.T.O.N.), as a case study to suggest some alternative possibilities for the design of digitally-mediated play and games. Specifically, I argue that that intentionally “broken” or otherwise incomplet...

  14. Total shoulder replacement in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Sneppen, O; Fruensgaard, S; Johannsen, Hans Viggo


    A prospective study of 62 Neer mark II total shoulder arthroplasties performed during the period from 1981 to 1990 on 51 patients with rheumatoid arthritis was undertaken to evaluate factors associated with component loosening and proximal humeral migration. Thirty-two (51%) showed proximal migra...

  15. Total and the Algerian shale gas

    International Nuclear Information System (INIS)

    Chapelle, Sophie; Petitjean, Olivier; Maurin, Wilfried; Balvet, Jacqueline; Combes, Maxime; Geze, Francois; Hamouchene, Hamza; Hidouci, Ghazi; Malti, Hocine; Renaud, Juliette; Simon, Antoine; Titouche, Fateh


    This publication proposes a rather detailed and discussed overview of the movement of mobilisation of Algerian people (notably those living in the Sahara) against projects of exploration and exploitation of shale gases in Algeria by the Total group. The authors also recall and comment the long and heavy history of hydrocarbon management in Algeria, the role of international firms and of western interests (notably French interests) in this country, and the position of Total regarding the stake related to shale gases. The authors outline problems created by shale gas exploitation regarding water consumption and waste waters. They also notice that the safety of wells is at the centre of the protest. Problems raised by hydraulic fracturing are reviewed: seismic activity, chemical pollution, air pollution and greenhouse gases, landscape destruction. The attitude of the Algerian government is commented. Then, the authors try to identify and describe the action of Total in the Algerian shale gas sector, discuss the possible French influence, and outline the presence of Total all over the world in this sector

  16. Predicting thyroxine requirements following total thyroidectomy. (United States)

    Mistry, Dipan; Atkin, Stephen; Atkinson, Helen; Gunasekaran, Sinnappa; Sylvester, Deborah; Rigby, Alan S; England, R James


    Optimal thyroxine replacement following total thyroidectomy is critical to avoid symptoms of hypothyroidism. The aim of this study was to determine the best formula to determine the initiated replacement dose of levothyroxine immediately following total thyroidectomy. Prospective study. All patients were initiated on 100 μg levothyroxine and titrated to within the reference range for TSH and free T4. Correlations to height, weight, age, lean body mass (LBM), body surface area (BSA) and body mass index (BMI) were calculated. One hundred consecutive adult patients underwent total thyroidectomy for non-malignant disease. Comparison between three methods of levothyroxine dose prediction, aiming for a levothyroxine dose correct to within 25 μg of actual dose required. Correlations were seen between levothyroxine dose and patient age (r=-0.346, Pregression equation was calculated (predicted levothyroxine dose=[0·943 × bodyweight] + [-1.165 × age] + 125.8), simplified to (levothyroxine dose= bodyweight - age + 125) pragmatically. Initiating patients empirically on 100 μg post-operatively showed that 40% of patients achieved target within 25 μg of their required dose; this increased to 59% when using a weight-only dose calculation (1.6 μg/kg) and to 72% using the simplified regression equation. A simple calculated regression equation gives a more accurate prediction of initiated levothyroxine dose following total thyroidectomy, reducing the need for outpatient attendance for dose titration. © 2011 Blackwell Publishing Ltd.

  17. Flavonoid, hesperidine, total phenolic contents and antioxidant ...

    African Journals Online (AJOL)

    Additionally, the antioxidant activities were also determined by ferric reducing antioxidant power (FRAP) and 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging activity. C. hystrix had the highest flavonoid and total phenolic contents while C. aurantifolia had the highest hesperidine content. The antioxidant activity of ...

  18. Early death following revision total hip arthroplasty. (United States)

    Jones, Mark D; Parry, Michael; Whitehouse, Michael R; Blom, Ashley W


    The frequency of primary total hip arthroplasty procedures is increasing, with a subsequent rise in revision procedures. This study aims to describe timing and surgical mortality associated with revision total hip arthroplasty (THA) compared to those on the waiting list. All patients from a single institution who underwent revision total hip arthroplasty or were added to the waiting list for the same procedure between 2003 and 2013 were recorded. Mortality rates were calculated at 30 and 90 days following surgery or addition to the waiting list. 561 patients were available for the survivorship analysis in the surgical group. Following exclusion, 901 and 484 patients were available for the 30 and the 90-day analysis in the revision THA waiting list group.30- and 90-day mortality rates were significantly greater for the revision THA group compared to the waiting list group (excess surgical mortality at 30 days = 0.357%, p = 0.037; odds ratio of 5.22, excess surgical mortality at 90 days = 0.863%, p = 0.045). Revision total hip arthroplasty is associated with a significant excess surgical mortality rate until 90 days post-operation when compared to the waiting list population. We would encourage other authors with access to larger samples to use our method to quantify excess mortality after both primary and revision arthroplasty procedures.

  19. Technical pearls in total hip arthroplasty

    NARCIS (Netherlands)

    Mulier, M.; Raaijmaakers, M.; van den Bekerom, M.


    Total hip arthroplasty (THA) has had a big impact on the quality of life of millions of patients. Primary THA has a very high success rate and implant survival time of more than 30 years have been reported. However, because of the high number of procedures performed, the small percentage of patients

  20. Adapting Total Quality Management (TQM) to Government. (United States)

    Swiss, James E.


    Total quality management will not work well in government agencies because of stress on products, not services; on well-defined consumer groups; on inputs/processes, not results; and on preoccupation with quality. An effective revised version emphasizes client feedback, performance monitoring, continuous improvement, and worker participation. (SK)

  1. Total Quality Management: The Emperor's Tailor. (United States)

    Alexander, Gary C.; Keeler, Carolyn M.

    Conversations among educators, business leaders, legislators, and educational reformers have generated support for the application of Total Quality Management (TQM) to education. This paper considers whether TQM is indeed the solution to education's problems. After a brief explanation of TQM theory, the paper is organized around four broad issues…

  2. Total Antioxidant Capacity, Polyphenolic composition and ...

    African Journals Online (AJOL)

    The growing interest in the substitution of synthetic food antioxidants with natural ones in the maintenance of human health has fostered increased research on the screening of plants for the identification of antioxidants. The total antioxidant capacity and polyphenolic content of the extracts of the three varieties of rizga flour ...

  3. Food safety and total quality management

    NARCIS (Netherlands)

    Barendsz, A.W.


    Food safety is a growing global concern not only because of its continuing importance for public health but also because of its impact on international trade. The application of total quality management (TQM) provides the best possible care by continuously improving products and services to meet or

  4. Total dissolved carbohydrate in Mahi river estuary

    Digital Repository Service at National Institute of Oceanography (India)

    Bhosle, N.B.; Rokade, M.A.; Zingde, M.D.

    Total dissolved carbohydrate varied from 4.37-15 mg l-1 and 3.71-15.95 mg l-1 in the surface and bottom samples respectively. Highest concentration of carbohydrate was observed at station 1 which decreased downward upto Station 6 which showed...

  5. Tikhonov Regularization and Total Least Squares

    DEFF Research Database (Denmark)

    Golub, G. H.; Hansen, Per Christian; O'Leary, D. P.


    formulation involves a least squares problem, can be recast in a total least squares formulation suited for problems in which both the coefficient matrix and the right-hand side are known only approximately. We analyze the regularizing properties of this method and demonstrate by a numerical example that...


    African Journals Online (AJOL)

    Total hip arthroplasty has been done in Kenya for many years (1). There are only a few medical institutions that are in a position to perform this demanding procedure. The main reasons include: lack of adequate equipments, few trained personnel and the high cost of implants. It is mainly in the teaching and referral hospitals ...

  7. Total Body Opacification 'Technique Neonatal Adrenal Haemorrhage

    African Journals Online (AJOL)


    Dec 11, 1971 ... A case is reported illustrating the possible usefulness of total body opacification in the diagnosis of neonatal adrenal haemorrhage. To derive maximum benefit from this principle, the routine use of an early film coupled with high dosage is urged whenever an intravenous pyelogram is performed for ...

  8. Coordinating Council. Ninth Meeting: Total Quality Management (United States)


    This report summarizes the 9th meeting of the STI Coordinating Council. The council listened to the speakers' understanding of Total Quality Management (TQM) principles and heard stories of successful applications of these principles. Definitions of quality stated were focused on customer satisfaction. Reports presented by the speakers are also included.

  9. Total spectral distributions from Hawking radiation

    Energy Technology Data Exchange (ETDEWEB)

    Broda, Boguslaw [University of Lodz, Department of Theoretical Physics, Faculty of Physics and Applied Informatics, Lodz (Poland)


    Taking into account the time dependence of the Hawking temperature and finite evaporation time of the black hole, the total spectral distributions of the radiant energy and of the number of particles have been explicitly calculated and compared to their temporary (initial) blackbody counterparts (spectral exitances). (orig.)

  10. Biodegradable poly (lactic acid) microspheres containing total ...

    Indian Academy of Sciences (India)

    The fabrication of biodegradable poly(lactic acid) (PLA) microspheres containing total alkaloids of Caulis sinomenii was investigated. The formation, diameter, morphology and properties of the microspheres were characterized using Fourier transform infrared spectroscopy (FT–IR), laser particle size analyser and scanning ...

  11. Segmental blood pressure after total hip replacement

    DEFF Research Database (Denmark)

    Gebuhr, Peter Henrik; Soelberg, M; Henriksen, Jens Henrik


    Twenty-nine patients due to have a total hip replacement had their systemic systolic and segmental blood pressures measured prior to operation and 1 and 6 weeks postoperatively. No patients had signs of ischemia. The segmental blood pressure was measured at the ankle and at the toes. A significan...

  12. Management of hypocalcemia following total thyroidectomy

    International Nuclear Information System (INIS)

    Pahuja, D.N.; Patwardhan, U.N.; Samuel, A.M.


    A retrospective analysis of calcemic status of 500 randomly selected patients, who underwent total thyroidectomy (TTx) for differentiated thyroid carcinoma (DTC) was studied. These patients were followed up from a minimum of 2-3 years, to a maximum of 15-20 years, and calcemic status was ascertained at varying times following their surgery and radioiodine ( 131 ) therapy

  13. Innovations in revision total knee arthroplasty

    NARCIS (Netherlands)

    Meijer, Marrigje


    Osteoarthritis (OA) is the most common joint disorder in the world and total knee arthroplasty (TKA) is thought to be the gold standard for the surgical treatment of end-stage OA. Despite good results, a significant proportion of patients need to have their knee prosthesis replaced, and an increase

  14. Cemented or cementless total knee arthroplasty?

    Directory of Open Access Journals (Sweden)

    Prudhon Jean-Louis


    Full Text Available Introduction: Since 1996 we have been using cementless fixation with hydroxyapatite (HA coating. The purpose of this paper is to compare survivorship of a series of 100 cemented Total Knee Arthroplasty (TKA to a similar series of 100 cementless with a follow up of 11–16 years. Material methods: Both TKA are mobile bearing total knee postero-stabilized. They can be used with cement or without cement. Among 1030 New Wave TKATM implanted from 2002 to 2015 we have identified 100 cemented TKAs and 100 cementless TKAs. All these cases were primary replacement. Differences in survival probability were determined using log-rank test. Results: Survival probabilities at 11 years of follow-up were: Cemented group: 90.2% CI95% [81.9–94.8]; Cementless group: 95.4% CI95% [88.1–98.2]. Comparison between both group showed significant difference, p = 0.32. Discussion: The advantages of cementless TKA are bone stock preservation, cement debris protection and the potential to achieve biologic fixation. Cementless implants rely on a porous or roughened surface to facilitate bone formation. HA has been shown to accelerate bone integration and to decrease micro motion of the components and to increase fixation. With a survival probability of 90.2% (cemented version and 95.4% (cementless version, this total knee prosthesis performs as intended in primary total knee arthroplasty. No statistical differences could be found between cemented and cementless implants.

  15. Total pressing Indonesian gas development, exports

    International Nuclear Information System (INIS)



    Total is on track to become Indonesia's leading gas exporter by the turn of the century. Total's aggressive development of its Mahakam Delta acreage in East Kalimantan is intended to keep pace with growing liquefied natural gas demand, mainly from Japan but also increasingly from South Korea and Taiwan. A frantic scramble is under way among natural gas suppliers in the Pacific Rim region, particularly those with current LNG export facilities, to accommodate projections of soaring natural gas demand in the region. Accordingly, Total's Indonesian gas production goal is the centerpiece of a larger strategy to become a major player in the Far East Asia gas scene. Its goals also fall in line with Indonesia's. Facing flat or declining oil production while domestic oil demand continues to soar along with a rapidly growing economy, Indonesia is heeding some studies that project the country could become a net oil importer by the turn of the century. The paper describes Total's Far East strategy, the Mahakam acreage which it operates, the shift to gas development, added discoveries, future development, project spending levels, and LNG export capacity

  16. Salinity: Electrical conductivity and total dissolved solids (United States)

    The measurement of soil salinity is a quantification of the total salts present in the liquid portion of the soil. Soil salinity is important in agriculture because salinity reduces crop yields by reducing the osmotic potential making it more difficult for the plant to extract water, by causing spe...

  17. Total Evidence, Uncertainty and A Priori Beliefs

    NARCIS (Netherlands)

    Bewersdorf, Benjamin; Felline, Laura; Ledda, Antonio; Paoli, Francesco; Rossanese, Emanuele


    Defining the rational belief state of an agent in terms of her initial or a priori belief state as well as her total evidence can help to address a number of important philosophical problems. In this paper, I discuss how this strategy can be applied to cases in which evidence is uncertain. I argue

  18. Concepts of total quality management in radiology

    International Nuclear Information System (INIS)

    Pratik Kumar


    Quality is one of the touch-stones to determine the competitive advantage for a service, product or company. Total Quality Management has a large ambit, which encompasses not only the quality of images and services producing these images, but also the customers satisfaction. In health care patients satisfaction is divided into three parts: patient quality, professional quality and management quality

  19. Production Function Geometry with "Knightian" Total Product (United States)

    Truett, Dale B.; Truett, Lila J.


    Authors of principles and price theory textbooks generally illustrate short-run production using a total product curve that displays first increasing and then diminishing marginal returns to employment of the variable input(s). Although it seems reasonable that a temporary range of increasing returns to variable inputs will likely occur as…

  20. A formal model for total quality management

    NARCIS (Netherlands)

    S.C. van der Made-Potuijt; H.B. Bertsch (Boudewijn); L.P.J. Groenewegen


    textabstractTotal Quality Management (TQM) is a systematic approach to managing a company. TQM is systematic in the sense that it is uses facts through observation, analysis and measurable goals. There are theoretical descriptions of this management concept, but there is no formal model of it. A

  1. Total energy calculations and bonding at interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Louie, S.G.


    Some of the concepts and theoretical techniques employed in recent ab initio studies of the electronic and structural properties of surfaces and interfaces are discussed. Results of total energy calculations for the 2 x 1 reconstructed diamond (111) surface and for stacking faults in Si are reviewed. 30 refs., 8 figs.

  2. Estimating total population size for Songbirds (United States)

    Jonathan Bart


    A conviction has developed during the past few years within the avian conservation community that estimates of total population size are needed for many species, especially ones that warrant conservation action. For example, the recently completed monitoring plans for North American shorebirds and landbirds establish estimating population size as a major objective....

  3. Total Quality Management in Libraries: A Sourcebook. (United States)

    O'Neil, Rosanna M., Comp.

    Total Quality Management (TQM) brings together the best aspects of organizational excellence by driving out fear, offering customer-driven products and services, doing it right the first time by eliminating error, and maintaining inventory control without waste. Libraries are service organizations which are constantly trying to improve service.…

  4. A new look at totally positive matrices

    Czech Academy of Sciences Publication Activity Database

    Fiedler, Miroslav


    Roč. 66, č. 3 (2016), s. 597-602 ISSN 0011-4642 R&D Projects: GA ČR(CZ) GA14-07880S Institutional support: RVO:67985840 Keywords : totally positive matrix * Monge matrix * semigroup * Vandermonde-like matrix Subject RIV: BA - General Mathematics Impact factor: 0.364, year: 2016

  5. Total cross section results for deuterium electrodisintegration

    International Nuclear Information System (INIS)

    Skopik, D.M.; Murphy, J.J. II; Shin, Y.M.


    Theoretical total cross sections for deuterium electrodisintegration are presented as a function of incident electron energy. The cross section has been calculated using virtual photon theory with Partovi's photodisintegration calculation for E/subx/ > 10 MeV and effective range theory for E/subx/ 2 H(e, n) reaction in Tokamak reactors

  6. Alternative Measures of Total Factor Productivity Growth

    NARCIS (Netherlands)

    Ten Raa, T.; Shestalova, V.


    The four main approaches to the measurement of total factor productivity (TFP)-growth and its decomposition are (i) Solow's residual analysis, (ii) the Index Number Approach, (iii) Input-Output Analysis (IO), and (iv) Data Envelopment Analysis (DEA).The corresponding measures of TFP growth are based

  7. Financial impact of a capitation matrix system on total knee and total hip arthroplasty. (United States)

    Taylor, Benjamin; Fankhauser, Richard A; Fowler, Terry


    Total hip and total knee arthroplasty are high-volume surgical procedures that have a substantial economic impact for the healthcare system. This study analyzes the financial effect of a capitation matrix system on total knee and total hip implant costs over a 1-year period at a community hospital system. The matrix implant levels were based on implant characteristics, correlating increased technological sophistication of the various implants with increased but capitated payment to vendors. In the first year after the implementation of the matrix system, implant costs for the hospital decreased by 26.1% per implant for 369 total hip procedures and also by 26.1% per implant for 934 total knee procedures.

  8. Asymptotic Behaviour of Total Generalised Variation

    KAUST Repository

    Papafitsoros, Konstantinos


    © Springer International Publishing Switzerland 2015. The recently introduced second order total generalised variation functional TGV2 β,α has been a successful regulariser for image processing purposes. Its definition involves two positive parameters α and β whose values determine the amount and the quality of the regularisation. In this paper we report on the behaviour of TGV2 β,α in the cases where the parameters α, β as well as their ratio β/α becomes very large or very small. Among others, we prove that for sufficiently symmetric two dimensional data and large ratio β/α, TGV2 β,α regularisation coincides with total variation (TV) regularization

  9. Quality Indicators for the Total Testing Process. (United States)

    Plebani, Mario; Sciacovelli, Laura; Aita, Ada


    ISO 15189:2012 requires the use of quality indicators (QIs) to monitor and evaluate all steps of the total testing process, but several difficulties dissuade laboratories from effective and continuous use of QIs in routine practice. An International Federation of Clinical Chemistry and Laboratory Medicine working group addressed this problem and implemented a project to develop a model of QIs to be used in clinical laboratories worldwide to monitor and evaluate all steps of the total testing process, and decrease error rates and improve patient services in laboratory testing. All laboratories are invited, at no cost, to enroll in the project and contribute to harmonized management at the international level. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Hyperphosphatemic Tumoral Calcinosis after Total Knee Arthroplasty

    Directory of Open Access Journals (Sweden)

    Takeshi Mochizuki


    Full Text Available We report a case of hyperphosphatemic tumoral calcinosis (TC that occurred after total knee arthroplasty. A 64-year-old Japanese man presented with painful swellings in both shoulders, the left elbow, and the right hip that developed after he underwent total knee arthroplasty (TKA. The pathology of the patient’s bone at the time of TKA included a thick osteoid seam with calcareous deposition at the margin of the trabecular bone, which is not generally seen in osteoarthritis. Computed tomography scans of the swollen joints demonstrated leaflet and amorphous calcification masses around the joints. We diagnosed the patient with TC. The present case highlights that TC lesions are rare but should be considered in the differential diagnosis of subcutaneous soft and hard masses around the joint.

  11. Total body irradiation in chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Advani, S.H.; Dinshaw, K.A.; Nair, C.N.; Ramakrishnan, G.


    Total body irradiation (TBI), given as 10 rad daily for five days a week for a total dose of 150 rad has been used in an attempt to control the chronic phase of chronic myeloid leukemia (CML). Thirteen patients with CML received fractionated TBI leading to rapid and good control of WBC count without any adverse reaction. The chronic phase of CML could also be controlled with TBI, even in three patients who were resistant to busulfan. Following TBI, WBC count remained under control for a period of 32 weeks as compared to 40 weeks following vusulfan alone. Repeat TBI was also well tolerated with good response. It appears that TBI is an effective and safe therapy for controlling the chronic phase of CML

  12. An unusual case of total ophthalmoplegia

    Directory of Open Access Journals (Sweden)

    Chowdhury Ravindra


    Full Text Available An eight-year-old male child presented with drooping of the left eyelid with a history of penetrating injury of hard palate by an iron spoon seven days ago, which had already been removed by the neurosurgeon as the computed tomography scan revealed a spoon in the left posterior ethmoid and sphenoid bone penetrating into the middle cranial fossa. On examination, visual acuity was 20/20 in each eye and left eye showed total ophthalmoplegia. Oral cavity revealed a hole in the left lateral part of the hard palate. We managed the case with tapering dose of systemic prednisolone. The total ophthalmoplegia was markedly improved in one month. Cases of foreign bodies in the orbit with intracranial extension are not unusual, but the path this foreign body traveled through the hard palate without affecting the optic nerve, internal carotid artery or cavernous sinus makes an interesting variation.

  13. Total gastrectomy for non-neoplastic diseases

    DEFF Research Database (Denmark)

    Bjorn, Niels; Ainsworth, Alan Patrick; Mortensen, Michael Bau


    Background: The aim of this study was to describe patients who had total gastrectomy for non-neoplastic diseases within a well-defined geographical area. Material and Methods: Retrospective study of patients who had gastrectomy for a non-neoplastic disease at the Department of Surgery, Odense...... University Hospital from 1 January 2005 to 31 December 2014. Results: A total of 268 gastrectomies were performed with the 10-year period. Of these, ten (4%) were done for non-neoplastic diseases. Two were men and eight women with a median age of 51 years (range 31 to 96 years). Six had emergency surgery...... of 10 and 2 of 10, respectively. Histology of the resected specimens showed: Oedema, inflammation and/or necrosis (n=6), Menetrier's disease (n=2) and perforation (n=2). Conclusions: Gastrectomy for non-neoplastic diseases accounts for less than 5% of all gastrectomies. The majority of these cases...

  14. Total parenteral alimentation in childhood general considerations. (United States)

    Shmerling, D H


    The paper presents a discussion of the definition, the indications and some of the difficulties and complications of total long-term parenteral alimentation in infants and children. The problems of protein quality, the inadequacy of the E/T ratio, the quantities and quality of carbohydrates and the metabolic complications due to inappropriate electrolyte and mineral salts composition are reviewed. It is pointed out that the optimal amounts of some of the components used are still under investigation, that there seems to be no imperative reason not to use glucose as the sole carbohydrate in this age group and that most of the possible long-term sequelae and complications of total long-term parenteral alimentation will have to be looked for by prospective studies of the children treated.

  15. Total elbow arthroplasty: a radiographic outcome study

    Energy Technology Data Exchange (ETDEWEB)

    Bai, Xue Susan [University of Washington, Department of Radiology, Box 357115, Seattle, WA (United States); Petscavage-Thomas, Jonelle M. [Penn State Hershey Medical Center, Department of Radiology, Hershey, PA (United States); Ha, Alice S. [University of Washington, Department of Radiology, Box 354755, Seattle, WA (United States)


    Total elbow arthroplasty (TEA) is becoming a popular alternative to arthrodesis for patients with end-stage elbow arthrosis and comminuted distal humeral fractures. Prior outcome studies have primarily focused on surgical findings. Our purpose is to determine the radiographic outcome of TEA and to correlate with clinical symptoms such as pain. This is an IRB-approved retrospective review from 2005 to 2015 of all patients with semiconstrained TEA. All available elbow radiographs and clinical data were reviewed. Data analysis included descriptive statistics and Kaplan-Meier survival curves for radiographic and clinical survival. A total of 104 total elbow arthroplasties in 102 patients were reviewed; 75 % were in women and the mean patient age was 63.1 years. Mean radiographic follow-up was 826 days with average of four radiographs per patient. Seventy TEAs (67 %) developed radiographic complications, including heterotopic ossification (48 %), perihardware lucency (27 %), periprosthetic fracture (23 %), hardware subluxation/dislocation (7 %), polyethylene wear (3 %), and hardware fracture/dislodgement (3 %); 56 patients (55 %) developed symptoms of elbow pain or instability and 30 patients (30 %) underwent at least one reoperation. In patients with radiographic complications, 66 % developed elbow pain, compared to 19 % of patients with no radiologic complications (p = 0.001). Of the patients with radiographic complications, 39 % had at least one additional surgery compared to 0 % of patients without radiographic complications (p = 0.056). Radiographic complications are common in patients after total elbow arthroplasty. There is a strong positive association between post-operative radiographic findings and clinical outcome. Knowledge of common postoperative radiographic findings is important for the practicing radiologist. (orig.)

  16. Total Cholesterol and Cholesterol Species Determination




    Authors: Wei Zou ### Abstract Total cholesterol and cholesterol species analysis are critical in cardiovascular disease research. The protocol shows procedures that can be used for analysing tissue lipid extracts, lymph, bile or serum. ### Reagents 1. Free cholesterol standard solution (1 mg/mL in ethanol) - Cholesterol palmitate standard solution (1 mg/mL in chloroform): Add 106.383 mg of cholesterol palmitate (94%, Sigma) into a volumetric flask, top with chloroform. ...

  17. On the variability of total solar irradiance


    Pelt, Jaan; Kärner, Olavi


    Knowing the variability of total solar irradiance (TSI) at the top of the atmosphere is crucial for specifying solar influence to climate variability. Satellite measured TSI data are available only for the last 32 years. But there is an opportunity to estimate approximate daily TSI values on the basis of the observed variability of solar activity. A common approach is based using data for Wolf sunspot numbers. Series of daily data from the DAVOS based TSI starting from 1978 have been compared...

  18. Total intravenous anesthesia for major burn surgery


    Cancio, Leopoldo C; Cuenca, Phillip B; Walker, Stephen C; Shepherd, John M


    Total intravenous anesthesia (TIVA) is frequently used for major operations requiring general anesthesia in critically ill burn patients. We reviewed our experience with this approach. Methods: During a 22-month period, 547 major burn surgeries were performed in this center’s operating room and were staffed by full-time burn anesthesiologists. The records of all 123 TIVA cases were reviewed; 112 records were complete and were included. For comparison, 75 cases were selected at random from a t...

  19. Assessing Operational Total Lightning Visualization Products (United States)

    Stano, Geoffrey T.; Darden, Christopher B.; Nadler, David J.


    In May 2003, NASA's Short-term Prediction Research and Transition (SPoRT) program successfully provided total lightning data from the North Alabama Lightning Mapping Array (NALMA) to the National Weather Service (NWS) office in Huntsville, Alabama. The major accomplishment was providing the observations in real-time to the NWS in the native Advanced Weather Interactive Processing System (AWIPS) decision support system. Within days, the NALMA data were used to issue a tornado warning initiating seven years of ongoing support to the NWS' severe weather and situational awareness operations. With this success, SPoRT now provides real-time NALMA data to five forecast offices as well as working to transition data from total lightning networks at Kennedy Space Center and the White Sands Missile Range to the surrounding NWS offices. The only NALMA product that has been transitioned to SPoRT's partner NWS offices is the source density product, available at a 2 km resolution in 2 min intervals. However, discussions with users of total lightning data from other networks have shown that other products are available, ranging from spatial and temporal variations of the source density product to the creation of a flash extent density. SPoRT and the Huntsville, Alabama NWS are evaluating the utility of these variations as this has not been addressed since the initial transition in 2003. This preliminary analysis will focus on what products will best support the operational warning decision process. Data from 19 April 2009 are analyzed. On this day, severe thunderstorms formed ahead of an approaching cold front. Widespread severe weather was observed, primarily south of the Tennessee River with multiple, weak tornadoes, numerous severe hail reports, and wind. This preliminary analysis is the first step in evaluation which product(s) are best suited for operations. The ultimate goal is selecting a single product for use with all total lightning networks to streamline training and



    Liviu ILIES


    Human resources are the most important component of quality management. The total management quality has as an organizational philosophy the Japanese concept of “Kaizen” meaning the continuos improvement. In order to promote the improvement in quality it is necessary to have a general view, requiring understanding skill from managers, team spirit, understanding of change and its implementation in organization, that is continuos leadership.

  1. Counterterrorism and cybersecurity total information awareness

    CERN Document Server

    Lee, Newton


    Provides a broad survey of the United States' counterterrorism history, the use of artificial intelligence in data mining, social media and privacy, cyber attacks and prevention, and longstanding issues of war and peace Closely examines how Total Information Awareness, a governmental data mining project focused on scanning public and private data, plays an integral role in cybersecurity Analyzes recent cyberattacks across the globe orchestrated by 'hacktivist' groups, such as Anonymous

  2. Total synthesis of (+)-antroquinonol and (+)-antroquinonol D. (United States)

    Sulake, Rohidas S; Chen, Chinpiao


    The first total synthesis of (+)-antroquinonol and (+)-antroquinonol D, two structurally unique quinonols with a sesquiterpene side chain, is described. The route features an iridium-catalyzed olefin isomerization-Claisen rearrangement reaction (ICR), lactonization, and Grubbs olefin metathesis. The requisite α,β-unsaturation was achieved via the selenylation/oxidation protocol and elimination of β-methoxy group to provide two natural products from a common intermediate.

  3. Total spina bifida occulta of the sacrum


    Senoglu N; Senoglu M; Gumusalan Y


    Spina bifida occulta results from abnormal neurulation, characterized by incomplete dorsal midline closure of the osseous tissues; thus leaving the spinal cord relatively unprotected. Spina bifida occulta of the sacrum is the most common type of spinal abnormality. We report a case of total spina bifida occulta, in a dried sacrum specimen. This developmental defect must be considered for the sake of patient safety before undertaking caudal epidural block. If not, serious complications such as...

  4. Total fact-book 2000-2005

    Energy Technology Data Exchange (ETDEWEB)



    TOTAL S.A., a French society incorporated in France on March 28, 1924, together with its subsidiaries and affiliates, is the fourth largest publicly-traded integrated oil and gas company in the world. This document provides statistical data and information on the corporate (highlights, statements), upstream (production, costs,main producing fields, drilling), upstream maps, downstream (refining, distillation, retail gasoline outlets) and chemicals (sales, specialities). (A.L.B.)

  5. Total syntheses of (-)-haemanthidine, (+)-pretazettine, and (+)-tazettine. (United States)

    Baldwin, S W; Debenham, J S


    [structures: see text] The total syntheses of the amaryllidaceae alkaloids haemanthidine, pretazettine, and tazettine as optically pure enantiomers are reported. Using D-mannose as the starting material, the critical relative stereochemical relationships are established with an intramolecular nitrone-alkene cycloaddition reaction. The synthetic route leads successively to (-)-haemanthidine and then to (+)-pretazettine and (+)-tazettine, taking advantage of the well-established complex relationships among these three alkaloids.

  6. Total fact-book 2000-2005

    International Nuclear Information System (INIS)


    TOTAL S.A., a French society incorporated in France on March 28, 1924, together with its subsidiaries and affiliates, is the fourth largest publicly-traded integrated oil and gas company in the world. This document provides statistical data and information on the corporate (highlights, statements), upstream (production, costs,main producing fields, drilling), upstream maps, downstream (refining, distillation, retail gasoline outlets) and chemicals (sales, specialities). (A.L.B.)



    Ivica Batinić


    Strong competition in the market has caused the development of a new management approach known as Total Quality Management (TQM). Due to importance that quality plays in achieving competitive advantage, the hotel industry started to apply TQM. During the introduction of these systems, hotel companies may use different approaches to suit their own buseiness requirements. In doing so, 'TQM standards' can be used, or various international standards and models of business ...

  8. Total quality management in hotel industry


    Mitreva, Elizabeta; Saneva, Dusica; Miteva, Natasa


    Total quality management (TQM) is a systematic management approach aiming at continuous increase of the value offered to consumers through improvement of service quality. In hotel industry, success is achieved through service quality, which stands as a key factor for sustainability in the twenty-first century. Nowadays, quality is the basic factor for survival on the market, better competition, and greater profitability. TQM is a process that starts and ends with the consumer. The aim of this...

  9. Total Lightning Activity Associated with Tornadic Storms (United States)

    Goodman, Steven J.; Buechler, Dennis; Hodanish, Stephen; Sharp, David; Williams, Earle; Boldi, Bob; Matlin, Anne; Weber, Mark


    Severe storms often have high flash rates (in excess of one flash per second) and are dominated by intracloud lightning activity. In addition to the extraordinary flash rates, there is a second distinguishing lightning characteristic of severe storms that seems to be important. When the total lightning history is examined, one finds sudden increases in the lightning rate, which we refer to as lightning "jumps," that precede the occurrence of severe weather by ten or more minutes. These jumps are typically 30-60 flashes/min, and are easily identified as anomalously large derivatives in the flash rate. This relationship is associated with updraft intensification and updraft strength is an important factor in storm severity (through the accumulation of condensate aloft and the stretching of vorticity). In several cases, evidence for diminishment of midlevel rotation and the descent of angular momentum from aloft is present prior to the appearance of the surface tornado. Based on our experience with severe and tornadic storms in Central Florida, we believe the total lightning may augment the more traditional use of NEXRAD radars and storm spotters. However, a more rigorous relation of these jumps to storm kinematics is needed if we are to apply total lightning in a decision tree that leads to improved warning lead times and decreased false alarm rates.

  10. Total quality in spent fuel pool reracking

    International Nuclear Information System (INIS)

    Cranston, J.S.; Bradbury, R.B.; Cacciapouti, R.J.


    The nuclear utility environment is one of strict cost control under prescriptive regulations and increasing public scrutiny. This paper presents the results of A Total Quality approach, by a dedicated team, that addresses the need for increased on-site spent fuel storage in this environment. Innovations to spent fuel pool reracking, driven by utilities' specific technical needs and shrinking budgets, have resulted in both product improvements and lower prices. A Total Quality approach to the entire turnkey project is taken, thereby creating synergism and process efficiency in each of the major phases of the project: design and analysis, licensing, fabrication, installation and disposal. Specific technical advances and the proven quality of the team members minimizes risk to the utility and its shareholders and provides a complete, cost effective service. Proper evaluation of spent fuel storage methods and vendors requires a full understanding of currently available customer driven initiatives that reduce cost while improving quality. In all phases of a spent fuel reracking project, from new rack design and analysis through old rack disposal, the integration of diverse experts, at all levels and throughout all phases of a reracking project, better serves utility needs. This Total Quality environment in conjunction with many technical improvements results in a higher quality product at a lower cost

  11. Hypoparathyroidism after total thyroidectomy: incidence and resolution. (United States)

    Ritter, Kathryn; Elfenbein, Dawn; Schneider, David F; Chen, Herbert; Sippel, Rebecca S


    Parathyroid hormone (PTH) levels are often measured after thyroid surgery and are used to detect patients at risk for postoperative hypoparathyroidism. However, there is a lack of consensus in the literature about how to define the recovery of parathyroid gland function and when to classify hypoparathyroidism as permanent. The goals of this study were to determine the incidence of low postoperative PTH in total thyroidectomy patients and to monitor their time course to recovery of parathyroid gland function. We identified 1054 consecutive patients who underwent a total or completion thyroidectomy from January, 2006-December, 2013. Low PTH was defined as a PTH measurement hypoparathyroid if they had not recovered within 1 y. Recovery of parathyroid gland function was defined as PTH ≥10 pg/mL and no need for therapeutic calcium or activated vitamin D (calcitriol) supplementation to prevent hypocalcemic symptoms. Of 1054 total thyroidectomy patients, 189 (18%) had a postoperative PTH hypoparathyroidism. Surprisingly, 50% of those patients had recovery of PTH levels yet still required supplementation to avoid symptoms. Most patients with a low postoperative PTH recover function quickly, but it can take up to 1 y for full resolution. Hypoparathyroidism needs to be defined not only by PTH levels but also by medication requirements. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Recovery from Permanent Hypoparathyroidism After Total Thyroidectomy. (United States)

    Kim, Seok-Mo; Kim, Hyeung Kyoo; Kim, Kuk-Jin; Chang, Ho Jin; Kim, Bup-Woo; Lee, Yong Sang; Chang, Hang-Seok; Park, Cheong Soo


    Permanent hypoparathyroidism after total thyroidectomy is a rare but potentially serious iatrogenic complication. The aim of this study was to investigate the rate of recovery from postoperative, permanent hypoparathyroidism in patients undergoing thyroidectomy without parathyroid autotransplantation. This study was a prospective case series with a postoperative follow-up of up to 3 years. We enrolled patients with thyroid cancer who underwent total thyroidectomy with central compartment dissection, with or without lateral neck dissection, and who had postoperative permanent hypoparathyroidism, defined as serum levels of intact parathyroid hormone (PTH) hypoparathyroidism was defined as return to normal serum levels of PTH (15-65 pg/mL) and calcium (8.5-10.1 mg/dL) without calcium and/or vitamin D supplementation. In the 1467 patients who underwent total thyroidectomy, 22 presented with permanent postoperative hypoparathyroidism. In 5 of these 22 patients, the PTH levels increased steadily and returned to normal in 27.6±2.9 months, after which supplementation of calcium and vitamin D could be discontinued. Although recovery from permanent hypoparathyroidism is rare, patients should be monitored for serum PTH levels so that unnecessary treatments such as calcium and vitamin D supplementation can be avoided.

  13. Total synthesis of the indolizidine alkaloid tashiromine

    Directory of Open Access Journals (Sweden)

    McElhinney Alison D


    Full Text Available Abstract Background Tashiromine 1 is a naturally occurring indolizidine alkaloid. It has been the subject of thirteen successful total syntheses to date. Our own approach centres on the stereoselective construction of the indolizidine core by capture of an electrophilic acyliminium species by a pendant allylsilane. The key cyclisation precursor is constructed using olefin cross-metathesis chemistry, which has the potential to facilitate both racemic and asymmetric approaches, depending upon the choice of the allylsilane metathesis partner. Results The use of the allyltrimethylsilane cross-metathesis approach enables the rapid construction of the key cyclisation precursor 3 (3 steps from commercial materials, which undergoes acid-induced cyclisation to give the desired bicyclic indolizidine skeleton as a 96:4 mixture of diastereomers. Simple functional group interconversions allowed the completion of the total synthesis of racemic tashiromine in six steps (19% overall yield. Three chiral α-alkoxyallylsilanes (12,14 and 15 were prepared in enantioenriched form and their cross-metathesis reactions studied as part of a putative asymmetric approach to tashiromine. In the event, α-hydroxysilane 12 underwent isomerisation under the reaction conditions to acylsilane 17, while silanes 14 and 15 were unreactive towards metathesis. Conclusion A concise, stereoselective total synthesis of racemic tashiromine has been developed. Attempts to translate this into an asymmetric synthesis have thus far been unsuccessful.

  14. Total Variation Depth for Functional Data

    KAUST Repository

    Huang, Huang


    There has been extensive work on data depth-based methods for robust multivariate data analysis. Recent developments have moved to infinite-dimensional objects such as functional data. In this work, we propose a new notion of depth, the total variation depth, for functional data. As a measure of depth, its properties are studied theoretically, and the associated outlier detection performance is investigated through simulations. Compared to magnitude outliers, shape outliers are often masked among the rest of samples and harder to identify. We show that the proposed total variation depth has many desirable features and is well suited for outlier detection. In particular, we propose to decompose the total variation depth into two components that are associated with shape and magnitude outlyingness, respectively. This decomposition allows us to develop an effective procedure for outlier detection and useful visualization tools, while naturally accounting for the correlation in functional data. Finally, the proposed methodology is demonstrated using real datasets of curves, images, and video frames.

  15. Total generating costs: coal and nuclear plants

    International Nuclear Information System (INIS)


    The study was confined to single and multi-unit coal- and nuclear-fueled electric-generating stations. The stations are composed of 1200-MWe PWRs; 1200-MWe BWRs; 800-and 1200-MWe High-Sulfur Coal units, and 800- and 1200-MWe Low-Sulfur Coal units. The total generating cost estimates were developed for commercial operation dates of 1985 and 1990; for 5 and 8% escalation rates, for 10 and 12% discount rates; and, for capacity factors of 50, 60, 70, and 80%. The report describes the methodology for obtaining annualized capital costs, levelized coal and nuclear fuel costs, levelized operation and maintenance costs, and the resulting total generating costs for each type of station. The costs are applicable to a hypothetical Middletwon site in the Northeastern United States. Plant descriptions with general design parameters are included. The report also reprints for convenience, summaries of capital cost by account type developed in the previous commercial electric-power cost studies. Appropriate references are given for additional detailed information. Sufficient detail is given to allow the reader to develop total generating costs for other cases or conditions

  16. Total body irradiation: current indications; L`irradiation corporelle totale: les indications actuelles

    Energy Technology Data Exchange (ETDEWEB)

    Giraud, P.; Danhier, S.; Dubray, B.; Cosset, J.M. [Institut Curie, 75 - Paris (France)


    The choice of dose and fractionation for total body irradiation is made difficult by the large number of considerations to be taken into account. The outcome of bone marrow transplantation after total body irradiation can be understood in terms of tumor cell killing, engraftment, and normal tissue damage, each of these endpoints being influenced by irradiation-, disease-, transplant-, and patient- related factors. Interpretation of clinical data is further hampered by the overwhelming influence of logistic constraints, the small numbers of randomized studies, and the concomitant variations in total dose and fraction size or dose rate. So far, three cautious conclusions can be drawn in order to tentatively adapt the total body irradiation schedule to clinically-relevant situations. Firstly, the organs at risk for normal tissue damage (lung, liver, lens, kidney) are protected by delivering small doses per fraction at low dose rate. This suggests that, when toxicity is at stake (e.g. in children), fractionated irradiation should be preferred, provided that inter-fraction intervals are long enough. Secondly, fractionated irradiation should be avoided in case of T-cell depleted transplant, given the high risk of graft rejection in this setting. An alternative would be to increase total (or fractional) dose of fractionated total body irradiation, but this approach is likely to induce more normal tissue toxicity. Thirdly, clinical data have shown higher relapse rates in chronic myeloid leukemia after fractionated or low dose rate total body irradiation, suggesting that fractionated irradiation should not be recommended, unless total (or fractional) dose is increased. Total body irradiation-containing regimens, primarily cyclophosphamide / total body irradiation, are either equivalent to or better than the chemotherapy-only regimens, primarily busulfan / cyclophosphamide. Busulfan / cyclophosphamide certainly represents a reasonable alternative, especially in patients who

  17. Fluorogenic membrane overlays to enumerate total coliforms, Escherichia coli, and total Vibrionaceae in shellfish and seawater (United States)

    Three assays were developed to enumerate total coliforms, Escherichia coli, and total Vibrionaceae in shellfish and other foods and in seawater and other environmental samples. Assays involve membrane overlays of overnight colonies on non-selective agar plates to detect ß-glucuronidase and lysyl am...

  18. Assessment of total efficiency in adiabatic engines (United States)

    Mitianiec, W.


    The paper presents influence of ceramic coating in all surfaces of the combustion chamber of SI four-stroke engine on working parameters mainly on heat balance and total efficiency. Three cases of engine were considered: standard without ceramic coating, fully adiabatic combustion chamber and engine with different thickness of ceramic coating. Consideration of adiabatic or semi-adiabatic engine was connected with mathematical modelling of heat transfer from the cylinder gas to the cooling medium. This model takes into account changeable convection coefficient based on the experimental formulas of Woschni, heat conductivity of multi-layer walls and also small effect of radiation in SI engines. The simulation model was elaborated with full heat transfer to the cooling medium and unsteady gas flow in the engine intake and exhaust systems. The computer program taking into account 0D model of engine processes in the cylinder and 1D model of gas flow was elaborated for determination of many basic engine thermodynamic parameters for Suzuki DR-Z400S 400 cc SI engine. The paper presents calculation results of influence of the ceramic coating thickness on indicated pressure, specific fuel consumption, cooling and exhaust heat losses. Next it were presented comparisons of effective power, heat losses in the cooling and exhaust systems, total efficiency in function of engine rotational speed and also comparison of temperature inside the cylinder for standard, semi-adiabatic and full adiabatic engine. On the basis of the achieved results it was found higher total efficiency of adiabatic engines at 2500 rpm from 27% for standard engine to 37% for full adiabatic engine.

  19. Total urogenital sinus mobilization for ambiguous genitalia. (United States)

    Jesus, Vinicius Menezes; Buriti, Francisco; Lessa, Rodrigo; Toralles, Maria Betânia; Oliveira, Luciana Barros; Barroso, Ubirajara


    Genital ambiguity is a very common phenomenon in disorders of sex development (DSD). According to the Chicago Consensus 2006, feminizing genitoplasty, when indicated, should be performed in the most virilized cases (Prader III to V). Advances in the knowledge of genital anatomy in DSD have enabled the development and improvement of various surgical techniques. Mobilization of the urogenital sinus (MUS), first described by Peña, has become incorporated by most surgeons. However, the proximity of the urethral sphincter prompts concern over urinary incontinence, especially for full mobilization of the urogenital sinus. To retrospectively evaluate the short-term surgical results of feminizing genitoplasty with total mobilization of the urogenital sinus in patients with DSD. Review of medical records of all patients undergoing feminizing genitoplasty with mobilization of the urogenital sinus. We evaluated the rates of complications from surgery and of urinary incontinence, as well as cosmetic results, according to the opinion of the surgeon and the family. A total of 8 patients were included in the study. The mean age at surgery was 51months. Congenital adrenal hyperplasia (CAH) was diagnosed in six patients, and gonadal dysgenesis in the other two. The vagina was separated from the urethra, with suitable distance in all cases. No patient had urinary incontinence after surgery. The mean follow-up of patients was. 20months (3-56months). In all cases, surgeons recorded being satisfied with the aesthetic result of post-surgical genitalia. The family was recorded as satisfied with the aesthetic result of the genitalia after surgery. In every case, there was no need for a second surgical procedure. The total mobilization of the urogenital sinus is a feasible and safe technique. The technique permits good cosmetic results, and urinary incontinence is absent. Therapeutic study. Level III. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Total knee arthroplasty in elderly osteoporotic patients. (United States)

    Spinarelli, Antonio; Petrera, Massimo; Vicenti, Giovanni; Pesce, Vito; Patella, Vittorio


    Often in daily practice the choice of a prosthesis does not rise out of considerations about literature evidences, but it seems to be related to the personal experience and "surgical philosophy" of surgeon. The choice of prosthesis in total joint replacement is usually justified by biological and mechanical parameters that the surgeon considers before surgery. Osteoporosis is a disease characterized by a reduced bone mass and a degeneration of the bone tissue; it leads to bone fragility, so to a higher risk of fractures. Bone resistance, as all the changes in the microarchitecture of the bone tissue, is linked to bone density. Because of the bone density variation and/or the changes in the bone micro-architecture, as the bone strength decreases, the risk of fractures increases. It is important to understand all the factors taking part in both normal and abnormal bone remodelling. Osteoporosis does not imply a concrete bone loss, but a change of the bone micro-architecture itself. In these cases the choice of the patient and implant design are very important. In the period between March 1997-July 2002, we implanted 100 consecutive TKA (total knee arthroplasty) Genesis II in 97 subjects (79 female); mean age was 77.1 years old. All TKA were performed because of primary osteoarthritis of the knee. All patients had complete pain relief and excellent knee score. The surgical and medical complications were in accordance with the published literature. We must consider all existing medical conditions, the state of the knee and local needs of the elderly patient. Thus, within these limits, the total knee can improve the ability of patients to manage the activities of daily living and improve their quality of life.

  1. Quantitative taste evaluation of total enteral nutrients. (United States)

    Mukai, Junji; Miyanaga, Yohko; Ishizaka, Toshihiko; Asaka, Kiyokazu; Nakai, Yuka; Tsuji, Eriko; Uchida, Takahiro


    The purpose of this study was to evaluate quantitatively the taste of the various total enteral nutrients marketed in Japan using human gustatory sensation tests and an artificial taste sensor. In the human gustatory sensation test, four basic taste intensities (sweetness, saltiness, sourness, and bitterness), as well as 15 kinds of palatability scales, were evaluated according to the semantic differential (SD) method. Among 15 palatability items, the item; difficult to drink/easy to drink, was adopted as an overall palatability since it shows the highest factor loading by factor analysis. The overall palatability was found to be highly positively correlated with sweetness and sourness, but negatively correlated with bitterness and saltiness. Addition of a flavour to the amino acid-based enteral nutrient AminolebanEN significantly improved its palatability. This effect is presumably due to sour components of the flavour, such as citric acid, which reduce the bitterness intensity of branched-chain amino acids in the product. The sweetness and sourness intensities predicted by the taste sensor showed a high correlation with the results obtained in the human gustatory sensation tests. The taste sensor was able to predict the overall palatability of the total enteral nutrients with high accuracy. The products could be classified into three groups (peptide-based, amino-acid-based, and protein-based) by principal component analysis using sensor output of 8 channels. The products could be also classified into four groups; peptide-based, amino-acid-based, and protein-based and flavor addition group by principal component analysis using sensor output of channels 1, 3, 4 and 7, which are specific to basic tastes. The taste sensor could therefore be useful in predicting the taste or palatability of total enteral nutrients, and could contribute to attempts to improve compliance for such products and for enteral nutrients.

  2. Segmental blood pressure after total hip replacement

    DEFF Research Database (Denmark)

    Gebuhr, Peter Henrik; Soelberg, M; Henriksen, Jens Henrik Sahl


    Twenty-nine patients due to have a total hip replacement had their systemic systolic and segmental blood pressures measured prior to operation and 1 and 6 weeks postoperatively. No patients had signs of ischemia. The segmental blood pressure was measured at the ankle and at the toes. A significant...... drop was found in all pressures 1 week postoperatively. The decrease followed the systemic pressure and was restored to normal after 6 weeks. In a group of six patients with preoperatively decreased ankle pressure, a significant transient further decrease in the ankle-toe gradient pressure was found...

  3. Transanal total mesorectal excision - a systematic review

    DEFF Research Database (Denmark)

    Bjørn, Maya Xania; Perdawood, Sharaf Karim


    of the dissection. We aimed to evaluate the literature on TaTME. METHODS: We performed a systematic search of the literature in the PubMed and Embase databases. Both authors assessed the studies. All publications on TaTME were included with the exception of review articles. RESULTS: A total of 29 studies (336...... patients) were included. Only low-quality evidence is available, and the literature consists of case reports and case series. Studies represent the initial experience of surgeons/centres. No precise indication for TaTME is yet specified other than the presence of mid and low rectal tumours, although...

  4. Total Variation Applications in Computer Vision


    Estrela, Vania V.; Magalhaes, Hermes Aguiar; Saotome, Osamu


    The objectives of this chapter are: (i) to introduce a concise overview of regularization; (ii) to define and to explain the role of a particular type of regularization called total variation norm (TV-norm) in computer vision tasks; (iii) to set up a brief discussion on the mathematical background of TV methods; and (iv) to establish a relationship between models and a few existing methods to solve problems cast as TV-norm. For the most part, image-processing algorithms blur the edges of the ...

  5. Prosthetic rehabilitation of a total laryngectomy patient

    Directory of Open Access Journals (Sweden)

    Pulkit Jain


    Full Text Available The fundamental objective in restoring a defect created after total laryngectomy with a custom made silicone prosthesis is to enable the patient to cope better with the difficult process of rehabilitation after a major surgery has been performed. A cosmetically acceptable prosthesis that reproduces the color and form and allows the patient to return to his/her accustomed lifestyle. A sequence of steps for construction of custom-made laryngeal prosthesis is outlined in this case report using the readily available materials and method which any prosthodontist can readily understand and deliver.


    Directory of Open Access Journals (Sweden)

    Maryamah Maryamah


    Full Text Available AbstractManagement of educational quality improvement is the integration of all function and processes within an educational organization in order to achieve continuous improvement of the quality of school outputs and services. The main objective is the satisfactions of the clients or customers. In the educational or school organization, there are three basic definitions of quality assurance, contract conformance, and customer driven. The application of TQM in the context of educational organizations is based on a framework that educational managers are able to make the process of improvement.   Keywords: Total quality management (TQM, Education

  7. Regularization by truncated total least squares

    DEFF Research Database (Denmark)

    Hansen, Per Christian; Fierro, R.D; Golub, G.H


    The total least squares (TLS) method is a successful method for noise reduction in linear least squares problems in a number of applications. The TLS method is suited to problems in which both the coefficient matrix and the right-hand side are not precisely known. This paper focuses on the use...... matrix. We express our results in terms of the singular value decomposition (SVD) of the coefficient matrix rather than the augmented matrix. This leads to insight into the filtering properties of the truncated TLS method as compared to regularized least squares solutions. In addition, we propose...

  8. Total Hip Arthroplasty in Mucopolysaccharidosis Type IH

    Directory of Open Access Journals (Sweden)

    S. O'hEireamhoin


    Full Text Available Children affected by mucopolysaccharidosis (MPS type IH (Hurler Syndrome, an autosomal recessive metabolic disorder, are known to experience a range of musculoskeletal manifestations including spinal abnormalities, hand abnormalities, generalised joint stiffness, genu valgum, and hip dysplasia and avascular necrosis. Enzyme therapy, in the form of bone marrow transplantation, significantly increases life expectancy but does not prevent the development of the associated musculoskeletal disorders. We present the case of a 23-year-old woman with a diagnosis of Hurler syndrome with a satisfactory result following uncemented total hip arthroplasty.

  9. Total synthesis of (±)-antroquinonol d. (United States)

    Sulake, Rohidas S; Jiang, Yan-Feng; Lin, Hsiao-Han; Chen, Chinpiao


    Total synthesis of (±)-antroquinonol D, which is isolated from very expensive and rarely found Antrodia camphorata and which has potential anticancer properties, was achieved from 4-methoxyphenol. In addition, a Michael addition to dimethoxy cyclohexadienones was studied. The main step involved chelation and substrate-controlled diastereoselective reduction of cyclohexenone and lactonization. Lactone synthesis facilitated the diastereoselective reduction of ketone, which help control the desired stereochemistry at the crucial stereogenic center in the natural product. Other key reactions in the synthesis involved a Michael addition of dimethyl malonate on cyclohexadienone, dihydroxylation, and Wittig olefination. A sesquiterpene side chain was synthesized through coupling with geranyl phenyl sulfide and Bouveault-Blanc reduction.

  10. Total internal reflection tomography of small objects

    International Nuclear Information System (INIS)

    Chen Xudong


    The multiple signal classification (MUSIC) imaging method is applied to determine the locations of a collection of small anisotropic spherical scatterers in the framework of the total internal reflection tomography. Multiple scattering between scatterers is considered and the inverse scattering problem is nonlinear, which, however, is solved by the proposed fast analytical approach where no associated forward problem is iteratively evaluated. The paper also discusses the role of the polarization of incidence waves, the incidence angle, the separation of scatterers from the surface of the substrate, and the level of noise on the resolution of imaging.

  11. First total synthesis of (-)-AL-2. (United States)

    Miyakoshi, Naoki; Mukai, Chisato


    Treatment of the 3,4-dioxygenated-9-hydroxy-1-nonyn-5-one derivative, derived from diethyl l-tartrate, with a palladium catalyst in methanol under a CO atmosphere effected an intramolecular acetalization and a stereoselective construction of the (E)-methoxycarbonylmethylidene functionality resulting in formation of the core framework of the diacetylenic spiroacetal enol ether natural products. Chemical transformations of the 1,6-dioxaspiro[4.5]decane derivative thus formed led to the first total synthesis of (-)-AL-2. [reaction: see text

  12. Prognostic modeling of total global steel production

    Directory of Open Access Journals (Sweden)

    B. Gajdzik


    Full Text Available The objective of this publication was to present the results of prognoses for steel production volume in the world. This work was created on the basis of statistical data. The volume of total steel production in the world from 2000 to 2015 was used in order to create the prognosis. The prognoses were created until 2020 – for a period of 5 years. Econometric methods were used to execute the prognoses. The minimum value of error (square root was assumed as optimisation criterion of the point value of a prognosis. Individual prognoses were grouped according to change scenarios for the studied phenomenon, taking into account the trend nature.

  13. TotalFinaElf Factbook 2002

    International Nuclear Information System (INIS)


    This report presents the activities and results of the Group Total-Fina-Elf for the year 2002. It brings information and economic data on the following topics: the corporate and business; the upstream activities with the reserves, the costs, standardized measure and changes of discounted future net cash flow,oil and gas acreage, drilling, liquefied natural gas, pipelines; downstream activities with refining and marketing maps, refinery, petroleum products, sales, retail gasoline outlets; chemicals with sales and operating income by sector, major applications, base chemicals and polymers, intermediates and performance polymers. (A.L.B.)

  14. Nuclear war would cause total destruction

    International Nuclear Information System (INIS)

    Caldicott, H.


    In this paper, the author urges everyone to become better informed about the nuclear hazard humanity faces and challenges the reader to take action to ensure human survival on Earth. The author explains what would happen in the event of a nuclear war. Population centers would be smashed flat. Firestorms would rage over millions of acres. People near the center of the blast would die immediately. Those who survived would reenter a totally devastated world, lacking the life-support systems on which the human species depends. Epidemics would be rampant. Only if we abolish nuclear weapons and permanently halt the nuclear power industry can we hope to survive

  15. Lattice-Like Total Perfect Codes

    Directory of Open Access Journals (Sweden)

    Araujo Carlos


    Full Text Available A contribution is made to the classification of lattice-like total perfect codes in integer lattices Λn via pairs (G, Φ formed by abelian groups G and homomorphisms Φ: Zn → G. A conjecture is posed that the cited contribution covers all possible cases. A related conjecture on the unfinished work on open problems on lattice-like perfect dominating sets in Λn with induced components that are parallel paths of length > 1 is posed as well.

  16. Total ankle arthroplasty: An imaging overview

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Da Rae; Choi, Yun Sun; Chun, Ka Young; Jung, Yoon Young; Kim, Jin Su; Young, Ki Won [Eulji Hospital, Eulji University, Seoul (Korea, Republic of); Potter, Hollis G.; Li, Angela E. [Dept. of Radiology and Imaging, Hospital for Special Surgery, New York (United States)


    With advances in implant technology, total ankle arthroplasty (TAA) has become an increasingly popular alternative to arthrodesis for the management of end-stage ankle arthritis. However, reports in the literature do not focus on the imaging features of TAA. Through a literature review, we demonstrate basic design features of the current ankle arthroplasty system, and the normal and abnormal postoperative imaging features associated with such devices. Pre- and postoperative evaluations of ankle arthroplasty mainly include radiography; in addition, computed tomography and magnetic resonance imaging provide further characterization of imaging abnormalities. Familiarization with multimodal imaging features of frequent procedural complications at various postoperative intervals is important in radiological practice.

  17. Repeated events and total time on test

    DEFF Research Database (Denmark)

    Kvist, Kajsa; Andersen, Per Kragh; Angst, Jules


    We adopt the total time on test procedure to investigate monotone time trends in the intensity in a repeated event setting. The correct model is assumed to be a proportional hazards model, with a random effect to account for dependence within subjects. The method offers a simple routine for testing...... relevant hypotheses for recurrent event processes, without making distributional assumptions about the frailty. Such assumptions may severely affect conclusions concerning regression coefficients and cause bias in the estimated heterogeneity. The method is illustrated by re-analyzing Danish registry data...


    Directory of Open Access Journals (Sweden)

    Ivica Batinić


    Full Text Available Strong competition in the market has caused the development of a new management approach known as Total Quality Management (TQM. Due to importance that quality plays in achieving competitive advantage, the hotel industry started to apply TQM. During the introduction of these systems, hotel companies may use different approaches to suit their own buseiness requirements. In doing so, 'TQM standards' can be used, or various international standards and models of business excellence Malcolm Balridge National Quality Award and European Quality Award.

  19. Sigma Metrics Across the Total Testing Process. (United States)

    Charuruks, Navapun


    Laboratory quality control has been developed for several decades to ensure patients' safety, from a statistical quality control focus on the analytical phase to total laboratory processes. The sigma concept provides a convenient way to quantify the number of errors in extra-analytical and analytical phases through the defect per million and sigma metric equation. Participation in a sigma verification program can be a convenient way to monitor analytical performance continuous quality improvement. Improvement of sigma-scale performance has been shown from our data. New tools and techniques for integration are needed. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. SMED: El camino a la flexibilidad total

    Directory of Open Access Journals (Sweden)

    Cruz, J.


    Full Text Available Este artículo presentará la metodología de SMED (Cambio de dados en un dígito de minuto como una alternativa hacia la flexibilidad total, la cuál se propone como una herramienta vital de competencia ante las condiciones del mercado existentes. Se explicarán los pasos a seguir para implementar la herramienta y se presentará un caso de estudio en el cuál la herramienta fue aplicada exitosamente, identificándose como la decisión determinante en la reducción del tiempo de ciclo por cambios de modelo, incrementando así la eficiencia del sistema de manufactura. El mercado hoy en día, está caracterizado por elementos determinantes, tales como: la globalización, una desaceleración económica de nuestro vecino y socio comercial, los Estados Unidos de Norteamérica, y una industria Asiática emergente. Estos factores combinados, impactan de manera total la forma de operar de las empresas, debido a que las empresas requieren implementar diferentes estrategias, tales como: 1 disminuir costos de producción, 2 incrementar la calidad, e 3 incrementar la flexibilidad y tiempo de respuesta.

  1. Deformation analysis with Total Least Squares

    Directory of Open Access Journals (Sweden)

    M. Acar


    Full Text Available Deformation analysis is one of the main research fields in geodesy. Deformation analysis process comprises measurement and analysis phases. Measurements can be collected using several techniques. The output of the evaluation of the measurements is mainly point positions. In the deformation analysis phase, the coordinate changes in the point positions are investigated. Several models or approaches can be employed for the analysis. One approach is based on a Helmert or similarity coordinate transformation where the displacements and the respective covariance matrix are transformed into a unique datum. Traditionally a Least Squares (LS technique is used for the transformation procedure. Another approach that could be introduced as an alternative methodology is the Total Least Squares (TLS that is considerably a new approach in geodetic applications. In this study, in order to determine point displacements, 3-D coordinate transformations based on the Helmert transformation model were carried out individually by the Least Squares (LS and the Total Least Squares (TLS, respectively. The data used in this study was collected by GPS technique in a landslide area located nearby Istanbul. The results obtained from these two approaches have been compared.

  2. Total body photography for skin cancer screening. (United States)

    Dengel, Lynn T; Petroni, Gina R; Judge, Joshua; Chen, David; Acton, Scott T; Schroen, Anneke T; Slingluff, Craig L


    Total body photography may aid in melanoma screening but is not widely applied due to time and cost. We hypothesized that a near-simultaneous automated skin photo-acquisition system would be acceptable to patients and could rapidly obtain total body images that enable visualization of pigmented skin lesions. From February to May 2009, a study of 20 volunteers was performed at the University of Virginia to test a prototype 16-camera imaging booth built by the research team and to guide development of special purpose software. For each participant, images were obtained before and after marking 10 lesions (five "easy" and five "difficult"), and images were evaluated to estimate visualization rates. Imaging logistical challenges were scored by the operator, and participant opinion was assessed by questionnaire. Average time for image capture was three minutes (range 2-5). All 55 "easy" lesions were visualized (sensitivity 100%, 90% CI 95-100%), and 54/55 "difficult" lesions were visualized (sensitivity 98%, 90% CI 92-100%). Operators and patients graded the imaging process favorably, with challenges identified regarding lighting and positioning. Rapid-acquisition automated skin photography is feasible with a low-cost system, with excellent lesion visualization and participant acceptance. These data provide a basis for employing this method in clinical melanoma screening. © 2014 The International Society of Dermatology.

  3. Diagnosis of infection after total hip arthroplasty

    International Nuclear Information System (INIS)

    Itasaka, Toshio; Kawai, Akira; Sato, Toru; Mitani, Shigeru; Inoue, Hajime


    Forty-eight total hip arthroplasties for which revision surgery was performed were reviewed to determine the accuracy of laboratory tests, plain radiographs, hip aspiration, and technetium-99m MDP and gallium-67 scans in demonstrating the presence or absence of infection of the prosthesis. Six of the 48 hips were diagnosed as having an infection at the revision surgery. The erythrocyte sedimentation rate and the C-reactive protein levels were significantly higher in the patients with infected prostheses. The difference in the white blood cell count was not significant. There was no significant relationship between the presence of infection and the severity of loosening and instability of the implants diagnosed by plain radiographs. The accuracy of hip aspiration in diagnosing the infection was 83%, with a sensitivity of 40% and a specificity of 92%. The accuracy of technetium-99m MDP bone scan was 79%, with a sensitivity of 83%, and a specificity of 79%. Gallium-67 scan had an accuracy of 96%, a sensitivity of 67%, and a specificity of 100%. The findings in the present study indicated that diagnostic tests consisting of laboratory tests and plain radiography, followed by hip aspiration and sequential use of technetium-99m MDP and gallium-67 scintigraphies, are suitable for differentiation between mechanical loosening and infection of total hip arthroplasty. (author)

  4. Diagnosis of infection after total hip arthroplasty

    Energy Technology Data Exchange (ETDEWEB)

    Itasaka, Toshio; Kawai, Akira; Sato, Toru; Mitani, Shigeru; Inoue, Hajime [Okayama Univ. (Japan). School of Medicine


    Forty-eight total hip arthroplasties for which revision surgery was performed were reviewed to determine the accuracy of laboratory tests, plain radiographs, hip aspiration, and technetium-99m MDP and gallium-67 scans in demonstrating the presence or absence of infection of the prosthesis. Six of the 48 hips were diagnosed as having an infection at the revision surgery. The erythrocyte sedimentation rate and the C-reactive protein levels were significantly higher in the patients with infected prostheses. The difference in the white blood cell count was not significant. There was no significant relationship between the presence of infection and the severity of loosening and instability of the implants diagnosed by plain radiographs. The accuracy of hip aspiration in diagnosing the infection was 83%, with a sensitivity of 40% and a specificity of 92%. The accuracy of technetium-99m MDP bone scan was 79%, with a sensitivity of 83%, and a specificity of 79%. Gallium-67 scan had an accuracy of 96%, a sensitivity of 67%, and a specificity of 100%. The findings in the present study indicated that diagnostic tests consisting of laboratory tests and plain radiography, followed by hip aspiration and sequential use of technetium-99m MDP and gallium-67 scintigraphies, are suitable for differentiation between mechanical loosening and infection of total hip arthroplasty. (author)

  5. Imaging of total colonic Hirschsprung disease

    Energy Technology Data Exchange (ETDEWEB)

    Stranzinger, Enno; DiPietro, Michael A.; Strouse, Peter J. [University of Michigan Health System, Section of Pediatric Radiology, Ann Arbor, MI (United States); Teitelbaum, Daniel H. [University of Michigan Health System, Section of Pediatric Surgery, Ann Arbor, MI (United States)


    Hirschsprung disease (HD) is a functional obstruction of the bowel caused by the absence of intrinsic enteric ganglion cells. The diagnosis of total colonic HD (TCHD) based on contrast enemas is difficult in newborns because radiological findings vary. To evaluate the radiographic and contrast enema findings in patients with pathologically proven TCHD. From 1966 to 2007, 17 records from a total of 31 patients with TCHD were retrospectively evaluated for diameter and shape of the colon, diameter of the small bowel, bowel wall contour, ileal reflux, abdominal calcifications, pneumoperitoneum, filling defects, transitional zones and rectosigmoid index. Three colonic patterns of TCHD were found: microcolon, question-mark-shape colon and normal caliber colon. Additional findings included spasmodic colon, ileal reflux, delayed evacuation and abdominal calcifications. Colonic transitional zones were found in eight patients with TCHD. The diagnosis of TCHD is difficult to establish by contrast enema studies. The length of the aganglionic small bowel and the age of the patient can influence the radiological findings in TCHD. The transitional zone and the rectosigmoid index can be false-positive in TCHD. The colon can appear normal. Consider TCHD if the contrast enema study is normal but the patient remains symptomatic and other causes of distal bowel obstruction have been excluded. (orig.)


    Organic matter in soils and sediments is widely distributed over the earth's surface occurring in almost all terrestrial and aquatic environments (Schnitzer, 1978). Soils and sediments contain a large variety of organic materials ranging from simple sugars and carbohydrates to the more complex proteins, fats, waxes, and organic acids. Important characteristics of the organic matter include their ability to: form water-soluble and water- insoluble complexes with metal ions and hydrous oxides; interact with clay minerals and bind particles together; sorb and desorb both naturally-occurring and anthropogenically-introduced organic compounds; absorb and release plant nutrients; and hold water in the soil environment. As a result of these characteristics, the determination of total organic carbon (a measure of one of the chemical components of organic matter that is often used as an indicator of its presence in a soil or sediment) is an essential part of any site characterization since its presence or absence can markedly influence how chemicals will react in the soil or sediment. Soil and sediment total organic carbon (TOC) determinations are typically requested with contaminant analyses as part of an ecological risk assessment data package. TOC contents may be used qualitatively to assess the nature of the sampling location (e.g., was it a depositional area) or may be used to normalize portions of the analytical chemistry data set (e.g., equilibrium partitioning).

  7. Total Site Heat Integration Considering Pressure Drops

    Directory of Open Access Journals (Sweden)

    Kew Hong Chew


    Full Text Available Pressure drop is an important consideration in Total Site Heat Integration (TSHI. This is due to the typically large distances between the different plants and the flow across plant elevations and equipment, including heat exchangers. Failure to consider pressure drop during utility targeting and heat exchanger network (HEN synthesis may, at best, lead to optimistic energy targets, and at worst, an inoperable system if the pumps or compressors cannot overcome the actual pressure drop. Most studies have addressed the pressure drop factor in terms of pumping cost, forbidden matches or allowable pressure drop constraints in the optimisation of HEN. This study looks at the implication of pressure drop in the context of a Total Site. The graphical Pinch-based TSHI methodology is extended to consider the pressure drop factor during the minimum energy requirement (MER targeting stage. The improved methodology provides a more realistic estimation of the MER targets and valuable insights for the implementation of the TSHI design. In the case study, when pressure drop in the steam distribution networks is considered, the heating and cooling duties increase by 14.5% and 4.5%.

  8. Imaging of total colonic Hirschsprung disease

    International Nuclear Information System (INIS)

    Stranzinger, Enno; DiPietro, Michael A.; Strouse, Peter J.; Teitelbaum, Daniel H.


    Hirschsprung disease (HD) is a functional obstruction of the bowel caused by the absence of intrinsic enteric ganglion cells. The diagnosis of total colonic HD (TCHD) based on contrast enemas is difficult in newborns because radiological findings vary. To evaluate the radiographic and contrast enema findings in patients with pathologically proven TCHD. From 1966 to 2007, 17 records from a total of 31 patients with TCHD were retrospectively evaluated for diameter and shape of the colon, diameter of the small bowel, bowel wall contour, ileal reflux, abdominal calcifications, pneumoperitoneum, filling defects, transitional zones and rectosigmoid index. Three colonic patterns of TCHD were found: microcolon, question-mark-shape colon and normal caliber colon. Additional findings included spasmodic colon, ileal reflux, delayed evacuation and abdominal calcifications. Colonic transitional zones were found in eight patients with TCHD. The diagnosis of TCHD is difficult to establish by contrast enema studies. The length of the aganglionic small bowel and the age of the patient can influence the radiological findings in TCHD. The transitional zone and the rectosigmoid index can be false-positive in TCHD. The colon can appear normal. Consider TCHD if the contrast enema study is normal but the patient remains symptomatic and other causes of distal bowel obstruction have been excluded. (orig.)

  9. Kelvin waves in total column ozone (United States)

    Ziemke, J. R.; Stanford, J. L.


    Tropical Kelvin waves have been observed previously in ozone mixing ratio data from the SBUV (Solar Backscatter Ultraviolet) and LIMS (Limb Infrared Monitor of the Stratosphere) instruments on board the Nimbus-7 satellite. The present study investigates Kelvin wave features in total column ozone, using version 6 data from the Total Ozone Mapping Spectrometer (TOMS) instrument (also on Nimbus-7). Results show eastward-propagating zonal waves 1-2 with periods approx. 5-15 days, amplitudes approx. 3-5 Dobson Units (1-2% of the time mean), and latitudinal symmetry typical of Kelvin waves. The analyses and a linear model in this study suggest that the primary source of the perturbations is slow Kelvin waves in the lower-to-middle stratosphere. Maximum Kelvin wave signatures occur in conjunction with westward lower-to-middle stratospheric equatorial zonal winds (a quasi-biennial oscillation (QBO) wind modulation effect). The significance of these results is that the TOMS data are shown to be useful for investigations with global coverage of a major component of tropical stratospheric dynamics, Kelvin waves. The TOMS data set with its excellent coverage and high quality should be useful in validating model studies in the relatively data sparse and dynamically difficult tropical region.

  10. Total quality drives nuclear plant improvements

    International Nuclear Information System (INIS)

    Richey, R.B.


    Total quality (TQ) at Carolina Power and Light (CP and L) is fulfilling a 1985 vision of Sherwood H. Smith, Jr., CP and L's chairman, president, and chief executive officer. The TQ concept has provided a way for employees to align their creative energies toward meeting the business needs of the company. Throughout CP and L, TQ has been recognized as the vehicle for reducing operating costs and improving customer satisfaction. Within the nuclear organization, application of the TQ process has helped to improve communications, resolve challenges, and provide more consistent work practices among CP and L's three nuclear plants. Total quality was introduced from the top down, with initial benefits coming from team interactions. Senior management at CP and L defined the corporate expectations and outlined the training requirements for implementing TQ. Management staffs at each organizational level became steering committees for TQ team activities within their departments. Teams of employees most knowledgeable about a given work area were empowered to solve problems or overcome obstacles related to that work area. Employees learned to become better team players and to appreciate the quality of decisions reached through group consensus. Now, formalized methods that started TQ are becoming part of the day-to-day work ethic

  11. Postoperative Autologous Reinfusion in Total Knee Replacement

    Directory of Open Access Journals (Sweden)

    A. Crescibene


    Full Text Available Surgeries for total knee replacement (TKR are increasing and in this context there is a need to develop new protocols for management and use of blood transfusion therapy. Autologous blood reduces the need for allogeneic blood transfusion and the aim of the present study was to verify the safety and the clinical efficacy. An observational retrospective study has been conducted on 124 patients, undergoing cemented total knee prosthesis replacement. Observed population was stratified into two groups: the first group received reinfusion of autologous blood collected in the postoperative surgery and the second group did not receive autologous blood reinfusion. Analysis of data shows that patients undergoing autologous blood reinfusion received less homologous blood bags (10.6% versus 30%; p=0.08 and reduced days of hospitalization (7.88 ± 0.7 days versus 8.96 ± 2.47 days for the control group; p=0.03. Microbiological tests were negative in all postoperatively salvaged and reinfused units. Our results emphasize the effectiveness of this procedure and have the characteristics of simplicity, low cost (€97.53 versus €103.79; p<0.01, and easy reproducibility. Use of autologous drainage system postoperatively is a procedure that allows reducing transfusion of homologous blood bags in patients undergoing TKR.

  12. Footprint mismatch in lumbar total disc arthroplasty. (United States)

    Gstoettner, Michaela; Michaela, Gstoettner; Heider, Denise; Denise, Heider; Liebensteiner, Michael; Bach, Christian Michael; Michael, Bach Christian


    Lumbar disc arthroplasty has become a popular modality for the treatment of degenerative disc disease. The dimensions of the implants are based on early published geometrical measurements of vertebrae; the majority of these were cadaver studies. The fit of the prosthesis in the intervertebral space is of utmost importance. An undersized implant may lead to subsidence, loosening and biomechanical failure due to an incorrect center of rotation. The aim of the present study was to measure the dimensions of lumbar vertebrae based on CT scans and assess the accuracy of match in currently available lumbar disc prostheses. A total of 240 endplates of 120 vertebrae were included in the study. The sagittal and mediolateral diameter of the upper and lower endplates were measured using a digital measuring system. For the levels L4/L5 and L5/S1, an inappropriate size match was noted in 98.8% (Prodisc L) and 97.6% (Charite) with regard to the anteroposterior diameter. Mismatch in the anterior mediolateral diameter was noted in 79.3% (Prodisc L) and 51.2% (Charite) while mismatch in the posterior mediolateral diameter was observed in 91.5% (Prodisc L) and 78% (Charite) of the endplates. Surgeons and manufacturers should be aware of the size mismatch of currently available lumbar disc prostheses, which may endanger the safety and efficacy of the procedure. Larger footprints of currently available total disc arthroplasties are required.

  13. Phytochemical screening, total phenolic, total flavonoids contents and antioxidant activity of cinchona ledgeriana leaves ethanol extract (United States)

    Sundowo, Andini; Artanti, Nina; Hanafi, M.; Minarti, Primahana, Gian


    C ledgeriana is a medicinal plant that contains alkaloids, especially on the barks for commercial production of quinine as antimalarial. The main alkaloids in this plant are cinchonine, cinchonidine, quinine and quinidine. Besides for antiamalarial this plant is also commonly used to treat whooping cough, influenza and dysentery. Compare to other medicinal plants, nowadays only very few studies were conducted in Cinchona species. Our current study aims to determine the content of phytochemical, total phenol and total flavonoids from C. ledgeriana leaves 70% ethanol extract. The extraction was performed by maceration method using 70% ethanol solvent and then fractionated into hexane, ethylacetate and butanol. Phytochemical screening was performed to determine the content of alkaloids, flavonoids, terpenoids, tannins and saponins. Total phenol and flavonoid contents of the extract were determined by Folin-Ciocalteu and alumunium chloride colorimetric methods using gallic acid and quercetin as standards. The antioxidant activity was determined by using 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity. The results of phytochemical screening showed that the 70% ethanol extract of C. ledgeriana leaves contained alkaloids, flavonoids, terpenoids, tannins and saponins. The total phenol and total flavonoids analysis showed that ethyl acetate fraction had the highest total phenol (40.23%) and total flavonoids (65.34%).

  14. Lung and Diaphragm Damage at Varying Oxygen Levels and Ventilator Modes Pst Hemorrhagic (United States)


    positive end-expiratory pressure = 1 cm H2O, peak inspiratory pressure = 8 cm H2O, and inspired tidal volume = 4.0 mL. Hemodynamics (systolic...intensities are detected and differentiated based on cell type. For example, Q4 is the cell count for 179 neutrophils that have positive fluorescence for...37132007000600008 [pii] Vento, M., Moro, M., Escrig, R., Arruza, L., Villar, G., Izquierdo, I., . . . Asensi, M. A. (2009). Preterm Resuscitation With Low Oxygen


    Directory of Open Access Journals (Sweden)

    Haryo Kuntoro Adi


    Full Text Available The using of Spirulina platensis as Supplement of Single-Celled Protein (SCP to Mice. High protein in Spirulina platensis can be used as a source of Single-Celled Protein. By using mice (Mus musculus as a animal laboratory, the objective of this research is to know the influence of Biomass S. platensis to the increase of body weight of mice. The name of species is Mus musculus, strain is Swiss derivate. Utilized mice were male, 30-50 weighing gram, and 5-7 weeks of age. Treatment group was given by palette and given by biomass of S. Platensis, while control also fed palette but did not give biomass of S. platensis. Yielded biomass was used as food mixed with palette with composition of dry biomass S. platensis with palette was 0%, 10%, 20%, 30%, 40%, and 50%. Data analysis was conducted by using t-tes and analysis of variance. The results showed that by giving of dry biomass of S. platensis affected to the increasement of body weight from the first day until twelfth day of observation, and decrease on the thirteenth and fourteenth day. Pursuant to result of statistic, there is a significant difference (p < 0,05 between before giving and after giving of dry biomass S. platensis during 17 day. By giving dry biomass of S. platensis to mice (Mus musculus at first and second week, it was found the difference of average mice body weight among six concentrations of biomass but did not at the third week. It means that not all concentration of biomass have same effect to the increase of mice body weight as a Single-Celled Protein.

  16. Comparative Effectiveness of Family Problem-Solving Therapy (F-PST) for Adolescent TBI (United States)


    Tbi; Intracranial Edema; Brain Edema; Craniocerebral Trauma; Head Injury; Brain Hemorrhage, Traumatic; Subdural Hematoma; Brain Concussion; Head Injuries, Closed; Epidural Hematoma; Cortical Contusion; Wounds and Injuries; Disorders of Environmental Origin; Trauma, Nervous System; Brain Injuries

  17. Development of a User Interface for the PVT SelfTest (PST) (United States)

    National Aeronautics and Space Administration — The overarching goal of the project is to provide a brief, validated, zero upmass, performance test to provide astronauts with immediate feedback about cognitive...

  18. On the total character of finite groups

    Directory of Open Access Journals (Sweden)

    Sunil Kumar Prajapati


    Full Text Available For a finite group $G$, we study the total character $tau_G$ afforded by the direct sum of all the non-isomorphic irreducible complex representations of $G$. We resolve for several classes of groups (the Camina $p$-groups, the generalized Camina $p$-groups, the groups which admit $(G,Z(G$ as a generalized Camina pair, the problem of existence of a polynomial $f(x in mathbb{Q}[x]$ such that $f(chi = tau_G$ for some irreducible character $chi$ of $G$. As a consequence, we completely determine the $p$-groups of order at most $p^5$ (with $p$ odd which admit such a polynomial. We deduce the characterization that these are the groups $G$ for which $Z(G$ is cyclic and $(G,Z(G$ is a generalized Camina pair and, we conjecture that this holds good for $p$-groups of any order.

  19. Neck after total laryngectomy: CT study

    International Nuclear Information System (INIS)

    DiSantis, D.J.; Balfe, D.M.; Hayden, R.E.; Sagel, S.S.; Sessions, D.; Lee, J.K.T.


    Computed tomographic scans in 23 patients who had undergone total laryngectomy were analyzed retrospectively to determine normal postoperative appearance and to evaluate the role of CT in assessing recurrent neoplasm. Nine patients without clinical evidence of recurrence illustrated the normal postoperative changes: a round or ovoid neopharynx connecting the base of the tongue with the cervical esophagus and intact fat planes surrounding the neopharynx, neurovascular bundles, and sternocleidomastoid muscles. In the 12 patients with recurrent neoplasm, the CT manifestations included masses involving the internal jugular lymph node chain, tracheostomy site, or paratracheal region. CT supplemented physical examination and indirect mirror examination, providing data regarding presence and extent of recurrent tumor and aiding in planning the mode and scope of therapy

  20. Material Science in Cervical Total Disc Replacement. (United States)

    Pham, Martin H; Mehta, Vivek A; Tuchman, Alexander; Hsieh, Patrick C


    Current cervical total disc replacement (TDR) designs incorporate a variety of different biomaterials including polyethylene, stainless steel, titanium (Ti), and cobalt-chrome (CoCr). These materials are most important in their utilization as bearing surfaces which allow for articular motion at the disc space. Long-term biological effects of implanted materials include wear debris, host inflammatory immune reactions, and osteolysis resulting in implant failure. We review here the most common materials used in cervical TDR prosthetic devices, examine their bearing surfaces, describe the construction of the seven current cervical TDR devices that are approved for use in the United States, and discuss known adverse biological effects associated with long-term implantation of these materials. It is important to appreciate and understand the variety of biomaterials available in the design and construction of these prosthetics and the considerations which guide their implementation.

  1. Trunnionosis in total hip arthroplasty: a review. (United States)

    Mistry, Jaydev B; Chughtai, Morad; Elmallah, Randa K; Diedrich, Aloise; Le, Sidney; Thomas, Melbin; Mont, Michael A


    Trunnionosis is defined as wear of the femoral head-neck interface and has recently been acknowledged as a growing cause of total hip arthroplasty failure. Some studies have reported that it accounts for up to 3 % of all revisions. The exact cause of trunnionosis is currently unknown; however, postulated etiologies include modular junction wear, corrosion damage, and metal ion release. Additionally, implant design and trunnion geometries may contribute to the progression of component failure. In order to aid in our understanding of this phenomenon, our aim was to present the current literature on (1) the effect of femoral head size on trunnionosis, (2) the effect of trunnion design on trunnionosis, (3) localized biological reactions associated with trunnionosis, and (4) gross trunnion failures. It is hoped that this will encourage further research and interest aimed at minimizing this complication.

  2. Synchrotron radiation total reflection for rainwater analysis

    International Nuclear Information System (INIS)

    Simabuco, Silvana M.; Matsumoto, Edson


    Total reflection X-ray fluorescence analysis excited with synchrotron radiation (SR-TXRF) has been used for rainwater trace element analysis. The samples were collected in four different sites at Campinas City, SP. Standard solutions with gallium as internal standard were prepared for the calibration system. Rainwater samples of 10 μl were putted onto Perspex reflector disk, dried on vacuum and analyzed for 100 s measuring time. The detection limits obtained for K-shell varied from 29 -1 for sulfur to 1.3 -1 for zinc and copper, while for L-shell the values were 4.5 -1 for mercury and 7.0 -1 for lead. (author)

  3. Material Science in Cervical Total Disc Replacement (United States)

    Pham, Martin H.; Mehta, Vivek A.; Tuchman, Alexander; Hsieh, Patrick C.


    Current cervical total disc replacement (TDR) designs incorporate a variety of different biomaterials including polyethylene, stainless steel, titanium (Ti), and cobalt-chrome (CoCr). These materials are most important in their utilization as bearing surfaces which allow for articular motion at the disc space. Long-term biological effects of implanted materials include wear debris, host inflammatory immune reactions, and osteolysis resulting in implant failure. We review here the most common materials used in cervical TDR prosthetic devices, examine their bearing surfaces, describe the construction of the seven current cervical TDR devices that are approved for use in the United States, and discuss known adverse biological effects associated with long-term implantation of these materials. It is important to appreciate and understand the variety of biomaterials available in the design and construction of these prosthetics and the considerations which guide their implementation. PMID:26523281

  4. Material Science in Cervical Total Disc Replacement

    Directory of Open Access Journals (Sweden)

    Martin H. Pham


    Full Text Available Current cervical total disc replacement (TDR designs incorporate a variety of different biomaterials including polyethylene, stainless steel, titanium (Ti, and cobalt-chrome (CoCr. These materials are most important in their utilization as bearing surfaces which allow for articular motion at the disc space. Long-term biological effects of implanted materials include wear debris, host inflammatory immune reactions, and osteolysis resulting in implant failure. We review here the most common materials used in cervical TDR prosthetic devices, examine their bearing surfaces, describe the construction of the seven current cervical TDR devices that are approved for use in the United States, and discuss known adverse biological effects associated with long-term implantation of these materials. It is important to appreciate and understand the variety of biomaterials available in the design and construction of these prosthetics and the considerations which guide their implementation.

  5. Postoperative pain treatment after total hip arthroplasty

    DEFF Research Database (Denmark)

    Højer Karlsen, Anders Peder; Geisler, Anja; Petersen, Pernille Lykke


    Treatment of postoperative pain should rely on results from randomized controlled trials and meta-analyses of high scientific quality. The efficacy of a particular intervention may depend on the type of surgical procedure, which supports the reporting of "procedure-specific" interventions. The aim...... of this systematic review was to document the procedure-specific evidence for analgesic interventions after total hip arthroplasty (THA). This PRISMA-compliant and PROSPERO-registered review includes randomized placebo-controlled trials (RCTs) of medication-based analgesic interventions after THA. Endpoints were......, and lumbar plexus block reduced nausea and pruritus. The GRADE-rated quality of evidence ranged from low to very low throughout the analyses. This review demonstrated, that some analgesic interventions may have the capacity to reduce mean opioid requirements and/or mean pain intensity compared with controls...

  6. Total energy investment in nuclear power plants

    International Nuclear Information System (INIS)

    Rombough, C.T.


    It is demonstrated that energy analysis is a feasible and practical alternative for evaluating the engineering, economic, and environmental aspects of nuclear power systems. All of these characteristics are synthesized into a common energy baseline. The nuclear reactor types which are evaluated are the Pressurized Water Reactor (PWR), Boiling Water Reactor (BWR), Heavy Water Reactor (HWR), High Temperature Gas Cooled Reactor (HTGR), Gas Cooled Fast Reactor (GCFR), and the Liquid Metal Fast Breeder Reactor (LMFBR). It is determined that the total energy investment required for the PWR is 10.0 percent of its energy output, 9.9 percent for the BWR, 10.5 percent for the HWR, 8.8 percent for the HTGR, 7.1 percent for the GCFR, and 7.6 percent for the LMFBR. (Diss. Abstr. Int., B)

  7. Total least squares for anomalous change detection (United States)

    Theiler, James; Matsekh, Anna M.


    A family of subtraction-based anomalous change detection algorithms is derived from a total least squares (TLSQ) framework. This provides an alternative to the well-known chronochrome algorithm, which is derived from ordinary least squares. In both cases, the most anomalous changes are identified with the pixels that exhibit the largest residuals with respect to the regression of the two images against each other. The family of TLSQbased anomalous change detectors is shown to be equivalent to the subspace RX formulation for straight anomaly detection, but applied to the stacked space. However, this family is not invariant to linear coordinate transforms. On the other hand, whitened TLSQ is coordinate invariant, and special cases of it are equivalent to canonical correlation analysis and optimized covariance equalization. What whitened TLSQ offers is a generalization of these algorithms with the potential for better performance.


    Directory of Open Access Journals (Sweden)

    Hasan SERİN, Alper AYTEKİN


    Full Text Available The approach of Total Quality Management (TQM has been even more common and most recently its use in high education has been discussed. Likewise the enterprises producing various products, universities have also inputs, processes, and outputs. Due to conditions of competition, universities have to improve the qualities of these inputs, processes, and outputs, according to satisfaction, demands, and expectations of internal and external customers. If the TQM has been implemented in the universities with a manner that aims for customer satisfaction (students, lecturers, public and private establishments, and families, supports constant development, ensures participatory approach, and encourages working in groups, it will provide universities with effectiveness, efficiency, dynamics, and economics. In this study, common problems of universities, definitions of quality and TQM in high education, customer concept at universities, and factors affecting the quality of education have been explained. Besides, in order TQM approach to be successfully implemented in the universities, various suggestions have been presented.

  9. Favorable results after total wrist arthroplasty

    DEFF Research Database (Denmark)

    Boeckstyns, Michel E. H.; Herzberg, G.; Merser, Søren


    survival was 0.9 at 5–9 years. Interpretation The clinical results in terms of pain, motion, strength, and function were similar to those in previous reports. The implant survival was 0.9 at 9 years, both in rheumatoid and non-rheumatoid cases, which is an important improvement compared to the earlier......Background and purpose During the past 40 years, several attempts have been made with total wrist arthroplasty to avoid fusion in severely destroyed wrists. The results have often been disappointing. There is only modest clinical documentation due to the small number of patients (especially non......-rheumatoid cases) and short follow-up times. Here we report a multicenter series using a third-generation implant with a minimum follow-up time of 5 years. Methods In 2012, data were retrieved from a registry of consecutive wrist operations at 7 centers with units specialized in hand surgery, between 2003 and 2007...

  10. NASA total quality management 1989 accomplishments report (United States)

    Tai, Betty P. (Editor); Stewart, Lynne M. (Editor)


    NASA and contractor employees achieved many notable improvements in 1989. The highlights of those improvements, described in this seventh annual Accomplishments Report, demonstrate that the people who support NASA's activities are getting more involved in quality and continuous improvement efforts. Their gains solidly support NASA's and this Nation's goal to remain a leader in space exploration and in world-wide market competition, and, when communicated to others through avenues such as this report, foster improvement efforts across government and industry. The principles in practice which led to these process refinements are important cultural elements to any organization's productivity and quality efforts. The categories in this report reflect NASA principles set forth in the 1980's and are more commonly known today as Total Quality Management (TQM): top management leadership and support; strategic planning; focus on the customer; employee training and recognition; employee empowerment and teamwork; measurement and analysis; and quality assurance.

  11. [Sir John Charnley and total hip arthroplasty]. (United States)

    Burgers, Paul T P W; van Gijn, Jan


    Sir John Charnley (1911-1982), pioneer of the total hip prosthesis, saved countless elderly people from immobility. During the Second World War he assisted Dudley Buxton, orthopaedic surgeon to the British armed forces in the Middle East, in developing new instruments and splints. After the war he first studied healing of bone fractures and the role of compression, and then completely dedicated himself to arthroplasty of the hip. Through countless experiments he found the optimal diameter for the head of the stainless steel prosthesis as well as the optimal polymer for the socket; he also advocated tight cementing of the shaft into the femur. Sir John Charnley received the Lasker Award in 1974 and was knighted in 1977.

  12. Changes in total body water during spaceflight (United States)

    Leach, Carolyn S.; Inners, L. D.; Charles, John B.


    Total body water (TBW) changes occurring in humans as a consequence of prolonged exposure to microgravity were measured in five male crewmembers of Space Shuttle missions STS-61C and STS-26. It was found that the inflight mean TBW values were significantly different from the preflight and postflight values, while the preflight TBW values were not significantly different from the postflight values. It was also found that individuals may differ in the rate at which they respond to weightlessness. Of the three crewmen who reported experiencing no symptoms of space motion sickness (SMS), two had not exhibited a decrease of TBW at the time of measurements (24 hrs after launch), while the two crewmen who reported SMS of intermediate severity showed a decrease of several kg by 24 hrs, suggesting that dehydration might be an important factor affecting the rate of TBW decrease.

  13. Total hip arthroplasty: a still evolving technique

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Galia

    Full Text Available ABSTRACT It has been advocated that total hip arthroplasty (THA is probably the most successful surgical intervention performed in Medicine. In the 1960s, Sir John Charnley not only introduced, but also modified and improved the technique of cemented arthroplasties. The concepts on biological , fixation established by Pillar and Galante served as the foundation for the development of uncemented implants that are now used worldwide. Currently, THA is a worldwide widespread surgery performed on millions of people. However, keeping abreast of the large number of information available on these procedures, especially on implant fixation, designs, different tribological pairings, and the long-term results can be challenging at times. This article is a brief update on the main aspects of THA.

  14. Total Synthesis of (-)-Salvinorin A. (United States)

    Line, Nathan J; Burns, Aaron C; Butler, Sean C; Casbohm, Jerry; Forsyth, Craig J


    Salvinorin A (1) is natural hallucinogen that binds the human κ-opioid receptor. A total synthesis has been developed that parlays the stereochemistry of l-(+)-tartaric acid into that of (-)-1 via an unprecedented allylic dithiane intramolecular Diels-Alder reaction to obtain the trans-decalin scaffold. Tsuji allylation set the C9 quaternary center and a late-stage stereoselective chiral ligand-assisted addition of a 3-titanium furan upon a C12 aldehyde/C17 methyl ester established the furanyl lactone moiety. The tartrate diol was finally converted into the C1,C2 keto-acetate. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Total Neutron Cross Section Instrumentation at UML (United States)

    Seo, P.-N.; Egan, J. J.; Kegel, G. H. R.; Mittler, A.; Tedesco, J.


    The UML type CN Van de Graaff accelerator incorporates a terminal pulsing system operating at 5 MHz. Proton bursts are Mobley-compressed to subnanosecond durations. When used with a thick metallic Li target, a pulsed pseudo-white neutron spectrum is produced suitable for neutron total cross section measurements. The spectrum is characterized by its sharp high energy cut-off, e.g. at 500 keV. Precautions are necessary because neutrons of different energies are recorded in the same time bin if their flight times differ by 200 ns. Pulse height discrimination may be used to eliminate lower energy neutrons; this is inefficient because higher energy neutron signals are also eliminated, to some degree. Two-dimensional data acquisition is the preferred approach. We review two systems of this type and we describe the system in use at UML.

  16. Single-incision total laparoscopic hysterectomy

    Directory of Open Access Journals (Sweden)

    Sinha Rakesh


    Full Text Available Single-incision laparoscopic surgery is an alternative to conventional multiport laparoscopy. Single-access laparoscopy using a transumbilical port affords maximum cosmetic benefits because the surgical incision is hidden in the umbilicus. The advantages of single-access laparoscopic surgery may include less bleeding, infection, and hernia formation and better cosmetic outcome and less pain. The disadvantages and limitations include longer surgery time, difficulty in learning the technique, and the need for specialized instruments. Ongoing refinement of the surgical technique and instrumentation is likely to expand its role in gynecologic surgery in the future. We perform single-incision total laparoscopic hysterectomy using three ports in the single transumbilical incision.

  17. Total Chemical Synthesis of Modified Histones. (United States)

    Qi, Yun-Kun; Ai, Hua-Song; Li, Yi-Ming; Yan, Baihui


    In the post-genome era, epigenetics has received increasing attentions in recent years. The post-translational modifications (PTMs) of four core histones play central roles in epigenetic regulation of eukaryotic genome by either directly altering the biophysical properties of nucleosomes or by recruiting other effector proteins. In order to study the biological functions and structural mechanisms of these histone PTMs, an obligatory step is to prepare a sufficient amount of homogeneously modified histones. This task cannot be fully accomplished either by recombinant technology or enzymatic modification. In this context, synthetic chemists have developed novel protein synthetic tools and state-of-the-art chemical ligation strategies for the preparation of homologous modified histones. In this review, we summarize the recent advances in the preparation of modified histones, focusing on the total chemical synthesis strategies. The importance and potential of synthetic chemistry for the study of histone code will be also discussed.


    Directory of Open Access Journals (Sweden)



    Full Text Available Nowadays the industry is one of the main economic sectors, with a major contribution to achieving and maintaining a high rate of economic growth. The processing industry operation to high economic performance requires changes in structural terms, the re-engineering of processes and management. In this regard, one of the main actions taken at the level of companies in the manufacturing industry is the implementation of quality systems. Practicing quality management system not only allows businesses to react to changes taking place in business, but also to inflict them by the controlling of the future. This paper aims to analyze the principles of Total Quality Management – TQM and will highlight the advantages that organizations could obtain by applying each principle separately in the process of management.

  19. Tribology of total hip arthroplasty prostheses (United States)

    Rieker, Claude B.


    Articulating components should minimise the generation of wear particles in order to optimize long-term survival of the prosthesis. A good understanding of tribological properties helps the orthopaedic surgeon to choose the most suitable bearing for each individual patient. Conventional and highly cross-linked polyethylene articulating either with metal or ceramic, ceramic-on-ceramic and metal-on-metal are the most commonly used bearing combinations. All combinations of bearing surface have their advantages and disadvantages. An appraisal of the individual patient’s objectives should be part of the assessment of the best bearing surface. Cite this article: Rieker CB. Tribology of total hip arthroplasty prostheses: what an orthopaedic surgeon should know. EFORT Open Rev 2016;1:52-57. DOI: 10.1302/2058-5241.1.000004. PMID:28461928

  20. Total synthesis of the Daphniphyllum alkaloid daphenylline (United States)

    Lu, Zhaoyong; Li, Yong; Deng, Jun; Li, Ang


    The Daphniphyllum alkaloids are a large class of natural products isolated from a genus of evergreen plants widely used in Chinese herbal medicine. They display a remarkable range of biological activities, including anticancer, antioxidant, and vasorelaxation properties as well as elevation of nerve growth factor. Daphenylline is a structurally unique member among the predominately aliphatic Daphniphyllum alkaloids, and contains a tetrasubstituted arene moiety mounted on a sterically compact hexacyclic scaffold. Herein, we describe the first total synthesis of daphenylline. A gold-catalysed 6-exo-dig cyclization reaction and a subsequent intramolecular Michael addition reaction, inspired by Dixon's seminal work, were exploited to construct the bridged 6,6,5-tricyclic motif of the natural product at an early stage, and the aromatic moiety was forged through a photoinduced olefin isomerization/6π-electrocyclization cascade followed by an oxidative aromatization process.

  1. Infected total knee arthroplasty treatment outcome analysis

    Directory of Open Access Journals (Sweden)

    Radoičić Dragan


    Full Text Available Background/Aim. Infected total knee arthroplasty (TKA is a topic of great importance, because its diagnosing and treatment requires a lot of resources, and often has an unsatisfactory outcome. The aim of this study was to analyze the outcome of the treatment of infection developed following TKA. Methods. This retrospective study of infected TKAs was performed in the period from 1998 to 2008 in the Orthopedics & Traumatology Clinic of the Military Medical Academy (MMA in Belgrade. A total of 654 primary and revised TKAs were performed in the said period. We registered and surgically treated 28 infected TKAs (primary TKAs: MMA - 22, other institutions - 6. The incidence of TKA infection in the MMA was 3.36%. The most common pathogens were: Staphylococcus aureus - 14 (50% cases, and Staph. epidermidis - 3 (10.7% cases. Other isolated pathogens were: Enterococcus faecalis, Klebsiella pneum., Klebsiella spp., Streptoccocus viridans, Seratia spp, Micrococcus luteus and Peptostreptococcus spp. In one case we had mixed anaerobic flora, and in 3 cases cultures were negative. We analyzed diagnostic challenges, risk factors (such as age and previous viscosupplementation and treatment outcomes in our series of infected TKAs. Results. In our series 2 infections healed after iv antibiotics and debridement, 1 patient responded to open debridement with component retention, 4 patients responded fully to one-stage reimplantation, 10 cases responded fully to two-stage reimplantation, 11 patients ended with arthrodesis and we had 1 patient with above knee amputation. Conclusion. Two-stage reimplantation remains gold standard for treatment of infected TKA, and we recommend it as treatment of choice for eradication of infection. The antibiotic loaded spacer prothesis concept in most cases allows infection eradication, good function and high patient satisfaction.

  2. Total hip arthroplasty at the rothman institute. (United States)

    Austin, Matthew S; Higuera, Carlos A; Rothman, Richard H


    Total hip arthroplasty (THA) is one of the most successful surgical interventions devised in modern times. Attempts to change the current THA procedure with unproven innovations bring the risk of increased failure rates while trying to improve the benefit of the surgery. This manuscript examines the evolution of THA at the Rothman Institute illustrating the key elements that lead the success of this procedure at this institution. These key elements include femoral stem design, use of highly crossed-linked polyethylene and use of pain and rehabilitation protocols. We attempted to describe the long-term results regarding safety, effectiveness, and durability of specific THA implant designs used at this institution drawing on reported evidence in the literature. The authors performed a review of peer-reviewed articles related to the Rothman Institute's experience with THA. Total hip arthroplasty is an efficient, safe, and durable procedure. It is a highly successful operation to restore function and improve pain. The survivorship of THA procedures at the Rothman Institute is higher than 99% at 10 years based on mechanical failure. The use of collarless, tapered wedge femoral stem, highly crossed-linked polyethylene, and improved pain rehabilitation protocols have contributed to this success. There is a well-documented long-term survivorship after THA. Future innovation in THA should address new challenges with younger and more demanding patients, rather than change current methods that have a proven good survivorship. This innovation depends mainly upon improvements in the bearing surfaces and advances in pain control and rehabilitation.

  3. The total cost of father desertion. (United States)

    Winking, Jeffrey; Gurven, Michael


    The benefits of paternal investment have long been explored by assessing the impact of father's presence on child wellbeing. Previous studies, however, have only examined the average effect of father's presence on child survivorship. Here we assess the total fitness cost to men of deserting (or the benefit of staying), by considering effects on the entire progeny. We estimate the total number of children that a deserting father can expect to lose due to reduced survivorship over the life course in five populations, and compare this loss to the benefit gains from remarrying a younger wife. We compiled the observed impacts of father's absence, as well as mortality and fertility schedules, for five foraging or foraging/horticultural populations. We calculate how many additional children a man can expect to lose due to father's absence throughout a marriage. We then calculate the minimum age difference between a first and second spouse that would be necessary to overcome this cost. Because child mortality rates drop so rapidly, the costs that men experience from desertion due to augmented child mortality are modest throughout marriage. Even hypothetically inflated father effects can be overcome with modest age differences between first and second spouses. Returns to paternal investment in terms of increased child survival are not substantial compared to those received by successfully practicing a serial mating strategy. This suggests that factors other than the ability to enhance child survival, such as female choice, are important to the evolutionary history and continued adaptive functioning of men's unique reproductive strategies. Copyright © 2011 Wiley-Liss, Inc.

  4. Prediction of permanent hypoparathyroidism after total thyroidectomy. (United States)

    Almquist, M; Hallgrimsson, P; Nordenström, E; Bergenfelz, A


    Hypoparathyroidism is a common complication with thyroid surgery. The ability to predict a high risk of permanent hypoparathyroidism is important for individual prognosis and follow-up. Permanent hypoparathyroidism, defined as continuing need for vitamin D medication at 1-year post-operatively, was investigated in patients after total thyroidectomy. Blood levels of calcium and parathyroid hormone (PTH) were measured intra-operatively, the day after surgery and at 1 month post-operatively. Logistic regression analysis was performed to investigate the risk of vitamin D treatment at last follow-up, calculated as odds ratios (ORs) with 95 % confidence intervals (CIs). Patients were followed until cessation of vitamin D and/or calcium medication, until death, loss to follow-up, or end of follow-up, whichever came first. A total of 519 patients were included. The median (range) follow-up in patients unable to cease vitamin D was 2.7 (1.2-10.3) years. The rate of permanent hypoparathyroidism was 10/519, 1.9 %. Parathyroid auto-transplantation was performed in 90/519 (17.3 %) patients. None of these developed permanent hypoparathyroidism, nor did any patient with normal PTH day 1 (>1.6 pmol/l or 15 pg/ml). The adjusted risk (OR, 95 % CI) for permanent hypoparathyroidism for log PTH on day 1 was 0.25 (0.13-0.50). In patients not auto-transplanted and with unmeasurable PTH day 1 (hypoparathyroidism. Auto-transplantation protects against permanent hypoparathyroidism, whereas low PTH day 1 is associated with high risk.

  5. Minimally invasive total hip arthroplasty: in opposition. (United States)

    Hungerford, David S


    At the Knee Society Winter Meeting in 2003, Seth Greenwald and I debated about whether there should be new standards (ie, regulations) applied to the release of information to the public on "new developments." I argued for the public's "right to know" prior to the publication of peer-reviewed literature. He argued for regulatory constraint or "proving by peer-reviewed publication" before alerting the public. It is not a contradiction for me to currently argue against the public advertising of minimally invasive (MIS) total hip arthroplasty as not yet being in the best interest of the public. It is hard to remember a concept that has so captured both the public's and the surgical community's fancy as MIS. Patients are "demanding" MIS without knowing why. Surgeons are offering it as the next best, greatest thing without having developed the skill and experience to avoid the surgery's risks. If you put "minimally invasive hip replacement" into the Google search engine (, you get 5,170 matches. If you put the same words in PubMed (, referencing the National Library of Medicine database, you get SEVENTEEN; none is really a peer-reviewed article. Most are 1 page papers in orthopedics from medical education meetings. On the other hand, there are over 6,000 peer-reviewed articles on total hip arthroplasty. Dr. Thomas Sculco, my couterpart in this debate, wrote an insightful editorial in the American Journal of Orthopedic Surgery in which he stated: "Although these procedures have generated incredible interest and enthusiasm, I am concerned that they may be performed to the detriment of our patients." I couldn't agree with him more. Smaller is not necessarily better and, when it is worse, it will be the "smaller" that is held accountable.

  6. Total Mercury in Lake Neusiedl, Austria

    Directory of Open Access Journals (Sweden)

    Jirsa F.


    Full Text Available Between May and September 2011 a total of 361 samples from water, sediment, macrophytes and fish tissues from the shallow, slightly alkaline Lake Neusiedl were measured for their total mercury content with cold vapour atomic absorption spectroscopy (CV-AAS. Hg content of surface water was below the LOD of 0.1 μg/L and the sediments displayed contents between 0.025 and 0.113 μg/g dw, significantly correlated with the proportion of organic components (fig 1. Although these results do not point to an anthropogenic pollution of the lake, considerable amounts of mercury could be measured in fish samples and macrophytes. Both investigated submerged plant species, namely Potamogeton pectinatus and Myriophyllum spicatum show a high potential for bioaccumulation of Hg, presenting mean values of 0.245 ± 0.152 and 0.298 ± 0.115 μg/g dw respectively. Compared to freshwater fish from other unpolluted sites high amounts of Hg could be measured (fig. 2. Biomagnification and significant differences could be observed when comparing muscle samples of the planctivorous fish species rudd Scardinus erythrophthalmus (n = 10, mean = 0.084 μg/g ww with the piscivorous perch Perca fluviatilis (n = 21, mean = 0.184 μg/g ww or pike-perch Sander lucioperca (n=9, mean = 0.205 μg/g ww respectively. Significantly lower values were measured in the muscle of the piscivorous pike Esox lucius (n = 25, mean = 0.135 μg/g ww in which a strong correlation between fish age and Hg content did not occur. In addition the muscle/liver ratio of Hg in pike was significantly lower compared to the other fish species, which points to a different Hg metabolism in pike, maybe under the specific saline alkaline conditions of this lake.

  7. Total sleep time severely drops during adolescence.

    Directory of Open Access Journals (Sweden)

    Damien Leger

    Full Text Available UNLABELLED: Restricted sleep duration among young adults and adolescents has been shown to increase the risk of morbidities such as obesity, diabetes or accidents. However there are few epidemiological studies on normal total sleep time (TST in representative groups of teen-agers which allow to get normative data. PURPOSE: To explore perceived total sleep time on schooldays (TSTS and non schooldays (TSTN and the prevalence of sleep initiating insomnia among a nationally representative sample of teenagers. METHODS: Data from 9,251 children aged 11 to 15 years-old, 50.7% of which were boys, as part of the cross-national study 2011 HBSC were analyzed. Self-completion questionnaires were administered in classrooms. An estimate of TSTS and TSTN (week-ends and vacations was calculated based on specifically designed sleep habits report. Sleep deprivation was estimated by a TSTN - TSTS difference >2 hours. Sleep initiating nsomnia was assessed according to International classification of sleep disorders (ICSD 2. Children who reported sleeping 7 hours or less per night were considered as short sleepers. RESULTS: A serious drop of TST was observed between 11 yo and 15 yo, both during the schooldays (9 hours 26 minutes vs. 7 h 55 min.; p<0.001 and at a lesser extent during week-ends (10 h 17 min. vs. 9 h 44 min.; p<0.001. Sleep deprivation concerned 16.0% of chidren aged of 11 yo vs. 40.5% of those of 15 yo (p<0.001. Too short sleep was reported by 2.6% of the 11 yo vs. 24.6% of the 15 yo (p<0.001. CONCLUSION: Despite the obvious need for sleep in adolescence, TST drastically decreases with age among children from 11 to 15 yo which creates significant sleep debt increasing with age.

  8. Development of a totally implantable artificial heart. (United States)

    Rowles, J R; Khanwilkar, P S; Diegel, P D; Hansen, A C; Bearnson, G B; Smith, K D; Tatsumi, E; Olsen, D B


    The first generation of an integrated, totally implantable electrohydraulic total artificial heart was designed for long-term cardiac replacement. The system consists of an elliptical blood pump with an interatrial shunt, Medtronic-Hall 27 mm and 25 mm inflow and outflow valves, respectively, an energy converter consisting of an axial-flow, hydraulic pump driven by a brushless DC motor, and an electronics system with transcutaneous energy transmission and telemetry. Energy is supplied by internal nickel-cadmium rechargeable batteries that supply power for 20 min and external silver-zinc batteries that are designed to supply energy to run the system for 5 hr. The blood pump consists of a single layer diaphragm cast from Biolon, with joined right and left ventricles sharing a common base. The dynamic stroke volume is 84 ml, and maximum cardiac output is 9.2 L/min at a heart rate of 110 beats/min on the mock circulation. A 4.3 mm diameter interatrial shunt is used to balance the volumetrically coupled ventricles. The energy converter pumps hydraulic fluid alternately between ventricles, with controlled, active filling in one ventricle during the systolic phase of the other ventricle. Internal or external controllers adjust the heart rate and motor speed to maintain normal atrial filling pressures and full stroke. Electromagnetic induction is used to transfer energy through the skin and a bidirectional infrared data link incorporated within the transcutaneous energy transmission coils is used to transmit information. The entire system is being assembled and refined for long-term animal implant studies.

  9. Calculation of the total and total ionization cross sections for positron scattering on atomic hydrogen

    International Nuclear Information System (INIS)

    Bray, I.; Stelbovics, A.T.


    The total and total ionization cross sections for positron scattering on atomic hydrogen are calculated by applying the Convergent Close-Coupling (CCC) method to the model where positronium formation channels are omitted. This model accurately describes the physics of the scattering whenever the positronium formation cross section is negligible, in particular, above 100 eV for this system. The total ionization cross section results in this energy region are in excellent agreement with the recent measurements of Jones et al., and so lie below the earlier measurements of Spicher et al., and the recent calculations of Acacia et al.. The total cross section is in very good agreement with the recent measurements of Zhou et al. down to 30 eV. 12 refs., 2 figs

  10. Total femoral allograft with simultaneous revision total hip and knee arthroplasty: 18 year follow-up

    Directory of Open Access Journals (Sweden)

    Ryan N. Harris, DO


    Full Text Available Massive allograft can be a useful option in revision total joint arthroplasty for treatment of significant bone loss. In rare cases, revision hip and knee arthroplasty procedures can be performed simultaneously using massive allograft-prosthetic composites. We present an 18 year follow up of a patient who received a simultaneous revision hip and knee total femoral allograft and discuss recent literature as it relates to this case.

  11. Pelvic floor functional outcomes after total abdominal vs total laparoscopic hysterectomy for endometrial cancer. (United States)

    Higgs, Peta; Janda, Monika; Asher, Rebecca; Gebski, Val; Forder, Peta; Obermair, Andreas


    Pelvic floor functioning is an important concern for women requiring a hysterectomy for endometrial cancer. The incidence of pelvic floor symptoms has not been reported in women who have undergone a hysterectomy for early-stage endometrial cancer. We sought to evaluate pelvic floor function in women who have had surgical treatment for early-stage endometrial cancer as part of the multinational Laparoscopic Approach to Cancer of the Endometrium trial and to compare patients' outcomes who had total abdominal vs total laparoscopic hysterectomy. A multinational, phase III, randomized noninferiority trial compared disease-free survival of patients who had total abdominal hysterectomy vs total laparoscopic hysterectomy. This substudy analyzes the results from a self-administered validated questionnaire on pelvic floor symptoms (Pelvic Floor Distress Inventory) administered preoperatively, and at follow-up visits 6, 18, 30, 42, and 54 months postoperatively. Overall, 381 patients with endometrial cancer were included in the analysis (total abdominal hysterectomy, n = 195; total laparoscopic hysterectomy, n = 186). At 6 months postsurgery both groups experienced an improvement in Pelvic Floor Distress Inventory scores compared to presurgical pelvic floor well-being (total abdominal hysterectomy: mean change -11.17; 95% confidence interval, -17.11 to -5.24; total laparoscopic hysterectomy: mean change -10.25; 95% confidence interval, -16.31 to -4.19). The magnitude of change from baseline in pelvic floor symptoms did not differ between both treatment groups up to 54 months postsurgery. These findings suggest that pelvic floor function in terms of urinary, bowel, and prolapse symptoms are unlikely to deteriorate following abdominal or laparoscopic hysterectomy and are reassuring for women undergoing hysterectomy for early-stage endometrial cancer. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  12. Total curvature and total torsion of knotted random polygons in confinement (United States)

    Diao, Yuanan; Ernst, Claus; Rawdon, Eric J.; Ziegler, Uta


    Knots in nature are typically confined spatially. The confinement affects the possible configurations, which in turn affects the spectrum of possible knot types as well as the geometry of the configurations within each knot type. The goal of this paper is to determine how confinement, length, and knotting affect the total curvature and total torsion of random polygons. Previously published papers have investigated these effects in the unconstrained case. In particular, we analyze how the total curvature and total torsion are affected by (1) varying the length of polygons within a fixed confinement radius and (2) varying the confinement radius of polygons with a fixed length. We also compare the total curvature and total torsion of groups of knots with similar complexity (measured as crossing number). While some of our results fall in line with what has been observed in the studies of the unconfined random polygons, a few surprising results emerge from our study, showing some properties that are unique due to the effect of knotting in confinement.

  13. Changes in total carbohydrate and total antioxidant activity induced by gamma irradiation of wheat flour

    International Nuclear Information System (INIS)

    Manupriya, B.R.; Shenoy, K. Bhasker; Patil, Shrikant L.; Somashekarappa, H.M.


    Wheat is a staple food grain in India after rice and occupies number one position in the world. The wheat crop not only gives food grains but also gives fodder for animals. Among many preservation methods irradiation is a current technique used to overcome infestation, contamination and spoilage of stored grains. The present study is aimed to check the changes in composition of irradiated wheat flour. Wheat flour was exposed to five different irradiation doses (0.25 KGy, 0.5KGy, 1KGy, 5KGy and 10 KGy) by using 60 Co gamma-irradiation chamber. Irradiated flour was stored in air sealed polyethylene pouch and plastic container at room temperature for different time intervals (0 th day, 1 month and 3 months). The stored flour was checked for total antioxidant activity by phosphomolybdate method and total carbohydrates concentration by phenol-sulphuric acid method. On 0 th day total antioxidant activity and total carbohydrate concentration was found to be increased at 0.5KGy (0.113 mg/ml and 0.045 mg/ml respectively) when compared to control (0.79 mg/ml and 39.5 mg/ml). Similarly for 1 month stored samples of air sealed polyethylene pouch total antioxidant activity and total carbohydrate concentration was observed to be increased at 0.5KGy (0.117 mg/ml and 0.045mg/ml respectively) when compared to control (0.096 mg/ml and 0.035 mg/ml). But in case of stored samples of plastic container total antioxidant activity increased at 0.25KGy (0.060 mg/ml) and total carbohydrate increased at 5KGy (0.051 mg/ml). Increased and decreased values were found in both factors for 3 months stored samples of air sealed polyethylene pouch and plastic container. Total antioxidant activity increased at 5KGy (0.072 mg/ml) for polyethylene bag samples and at 0.5KGy (0.137 mg/ml) for plastic container sample. Same way total carbohydrate concentration increased at 0.25KGy (0.046 mg/ml) and at 1KGy (0.045 mg/ml) respectively. This increase is due to affects of γ-irradiation on biomolecules by

  14. Coronal Dynamics at Recent Total Solar Eclipses (United States)

    Pasachoff, J. M.; Lu, M.; Davis, A. B.; Demianski, M.; Rusin, V.; Saniga, M.; Seaton, D. B.; Lucas, R.; Babcock, B. A.; Dantowitz, R.; Gaintatzis, P.; Seeger, C. H.; Malamut, C.; Steele, A.


    Our composite images of the solar corona based on extensive imaging at the total solar eclipses of 2010 (Easter Island), 2012 (Australia), and 2013 (Gabon) reveal several coronal mass ejections and other changes in coronal streamers and in polar plumes. Our resultant spatial resolution is finer than that available in imaging from spacecraft, including that from SOHO/LASCO or STEREO. We trace the eruptions back to their footpoints on the sun using imaging from SDO and SWAP, and follow them upwards through the corona, measuring velocities. The high-resolution computer compositing by Miloslav Druckmüller and Hana Druckmüllerová (2010 and 2013) and Pavlos Gaintatzis (2012) allows comparison of our images with those taken at intervals of minutes or hours along the totality path. Williams College's 2013 eclipse expedition was supported in part by grant 9327-13 from National Geographic Society/Committee for Research and Exploration. Our work on the 2012 eclipse is supported in part by grant AGS-1047726 from Solar Terrestrial Research/NSF AGS. V.R. and M.S. were partially supported by the VEGA grant agency project 2/0098/10 and 2/0003/13 (Slovak Academy of Sciences) and Grant 0139-12 from NG/CRE, and Hana Druckmüllerová by grant 205/09/1469 of the Czech Science Foundation. M.L. was supported by Sigma Xi. C.M. was a Keck Northeast Astronomy Consortium Summer Fellow, supported at Williams College by REU/NSF grant AST-1005024. Partial support was provided by U.S. Department of Defense's ASSURE program. J.M.P. thanks Caltech's Planetary Sciences Department for hospitality. Support for D.B.S. and SWAP came from PRODEX grant C90345 managed by ESA in collaboration with the Belgian Federal Science Policy Office (BELSPO) in support of the PROBA2/SWAP mission, and from the EC's Seventh Framework Programme (FP7/2007-2013) under grant 218816 (SOTERIA project, SWAP is a project of the Centre Spatial de Liège and the Royal Observatory of Belgium funded by

  15. Gait during hydrokinesitherapy following total hip arthroplasty. (United States)

    Giaquinto, Salvatore; Ciotola, Elena; Margutti, Ferdinando; Valentini, Fabio


    To obtain gait parameters during hydrotherapy (HT) in patients who were referred for rehabilitation after total hip arthroprostheses. The study had a cohort prospective design. Patients who underwent primary total hip arthroplasty (THA) followed a HT rehabilitation program. Twenty-one consecutive patients were enrolled. Five of them dropped out for various reasons, independently of HT. Therefore 16 patients could be evaluated (5 men and 11 women). Sixteen age-matched healthy volunteers were the control subjects. Nine patients had a right THA and 7 a left THA. On average HT duration was 15.7 days (SD 3.8). The patients presented with a mean speed of 749 meters per hour (SD 146) at the baseline. At the last session the mean speed was 1175 meters per hour (SD 396). The mean stance duration was 1.59 s (SD 0.28) on the operated side and 1.67 (SD 0.27) on the non-operated side. By contrast, the mean swing duration was 1.02 s (SD 0.20) on the operated side and 0.95 s (SD 0.16) on the non-operated side. The differences in balance were statistically significant. The step duration was the same on both sides. At the beginning of HT the stance/swing ratio was 1.62 (SD 0.40) on the operated side, whereas it was 1.74 (SD 0.42) on the non-operated side. In the controls the ratio was 1.45. During HT both values fluctuated but the trend was toward a better coherence over time. At the beginning the mean stride length was 0.484 meters (SD 0.116) and the value became 0.628 (SD 0.131) after 15 training sessions. At the individual level, recovery occurred in a non-linear fashion, but the mean regression line had a coefficient of 27.1 and the intercept was at 560.3. The study design permits accurate definition of stride parameters during rehabilitation which allows optimization of the programme. Increase in speed and regain of balance are monitored on a daily basis and they appear as the targets of a HT programme.

  16. Cemented total hip arthroplasty following acetabular fracture. (United States)

    Scott, C E H; MacDonald, D; Moran, M; White, T O; Patton, J T; Keating, J F


    To evaluate the outcomes of cemented total hip arthroplasty (THA) following a fracture of the acetabulum, with evaluation of risk factors and comparison with a patient group with no history of fracture. Between 1992 and 2016, 49 patients (33 male) with mean age of 57 years (25 to 87) underwent cemented THA at a mean of 6.5 years (0.1 to 25) following acetabular fracture. A total of 38 had undergone surgical fixation and 11 had been treated non-operatively; 13 patients died at a mean of 10.2 years after THA (0.6 to 19). Patients were assessed pre-operatively, at one year and at final follow-up (mean 9.1 years, 0.5 to 23) using the Oxford Hip Score (OHS). Implant survivorship was assessed. An age and gender-matched cohort of THAs performed for non-traumatic osteoarthritis (OA) or avascular necrosis (AVN) (n = 98) were used to compare complications and patient-reported outcome measures (PROMs). The mean time from fracture to THA was significantly shorter for patients with AVN (2.2 years) or protrusio (2.2 years) than those with post-traumatic OA (9.4 years) or infection (8.0 years) (p = 0.03). Nine contained and four uncontained defects were managed with autograft (n = 11), bulk allograft (n = 1), or trabecular metal augment (n = 1). Initial fracture management (open reduction and internal fixation or non-operative), timing of THA (>// 10 mm) were significantly higher following acetabular fracture compared with atraumatic OA/AVN and OHSs were inferior: one-year OHS (35.7 v ersus 40.2, p = 0.026); and final follow-up OHS (33.6 v ersus 40.9, p = 0.008). Cemented THA is a reasonable option for the sequelae of acetabular fracture. Higher complication rates and poorer PROMs, compared with patients undergoing THA for atraumatic causes, reflects the complex nature of these cases. Cite this article: Bone Joint J 2017;99-B:1399-1408. ©2017 The British Editorial Society of Bone & Joint Surgery.

  17. Halogen-specific total organic halogen analysis: Assessment by recovery of total bromine. (United States)

    Langsa, Markus; Allard, Sebastien; Kristiana, Ina; Heitz, Anna; Joll, Cynthia A


    Determination of halogen-specific total organic halogen (TOX) is vital for studies of disinfection of waters containing bromide, since total organic bromine (TOBr) is likely to be more problematic than total organic chlorine. Here, we present further halogen-specific TOX method optimisation and validation, focusing on measurement of TOBr. The optimised halogen-specific TOX method was validated based on the recovery of model compounds covering different classes of disinfection by-products (haloacetic acids, haloacetonitriles, halophenols and halogenated benzenes) and the recovery of total bromine (mass balance of TOBr and bromide concentrations) during disinfection of waters containing dissolved organic matter and bromide. The validation of a halogen-specific TOX method based on the mass balance of total bromine has not previously been reported. Very good recoveries of organic halogen from all model compounds were obtained, indicating high or complete conversion of all organic halogen in the model compound solution through to halide in the absorber solution for ion chromatography analysis. The method was also successfully applied to monitor conversion of bromide to TOBr in a groundwater treatment plant. An excellent recovery (101%) of total bromine was observed from the raw water to the post-chlorination stage. Excellent recoveries of total bromine (92%-95%) were also obtained from chlorination of a synthetic water containing dissolved organic matter and bromide, demonstrating the validity of the halogen-specific TOX method for TOBr measurement. The halogen-specific TOX method is an important tool to monitor and better understand the formation of halogenated organic compounds, in particular brominated organic compounds, in drinking water systems. Copyright © 2017. Published by Elsevier B.V.

  18. The effects of probiotics on total cholesterol (United States)

    Wang, Lang; Guo, Mao-Juan; Gao, Qing; Yang, Jin-Feng; Yang, Lin; Pang, Xiao-Li; Jiang, Xi-Juan


    Abstract Background: Probiotics supplements provide a new nonpharmacological alternative to reduce cardiovascular risk factors. The impact of probiotics on the reduction of total cholesterol (TC) remains controversial. We conducted a meta-analysis to showcase the most updated and comprehensive evaluation of the studies. Methods: Randomized controlled trials (RCTs) were searched from electronic databases, including PubMed, Embase, Cochrane Central Register of Controlled Trials, Chinese Biomedical Literature Database, China National Knowledge Infrastructure, Wanfang database dating from January 2007 to January 2017. The curative effects of probiotics on the reduction of TC were assessed using mean difference (MD), as well as their 95% confidence interval (CI). RevMan software (version 5.3) was used to carry out this meta-analysis. Results: Thirty-two RCTs including 1971 patients met the inclusion criteria. Results of this analysis showed that compared with the control group serum TC was significantly reduced in probiotics group [MD = −13.27, 95% CI (−16.74 to 9.80), P  6 weeks: [MD = −22.18, 95% CI (−28.73, −15.63), P probiotics forms and intervention duration might have a significant impact on the results. However, strains and doses of probiotics had no significant influence on curative effects. Conclusion: Available evidence indicates that probiotics supplements can significantly reduce serum TC. Furthermore, higher baseline TC, longer intervention time, and probiotics in capsules form might contribute to a better curative effect. PMID:29384846

  19. Separation surgery for total vertical craniopagus twins. (United States)

    Goh, Keith Y C


    A pair of conjoined twins aged 11 months underwent investigations, followed by surgical separation in Singapore General Hospital in April 2001. They were joined at the skull vertex and facing in opposite directions. Radiological investigations including cerebral angiography, magnetic resonance imaging and computerized tomographic scans were performed, leading to the diagnosis of total vertical craniopagus. There were two separate brains, with separate arterial circulations, but with a common superior sagittal sinus. Tissue expanders were inserted in the subgaleal space for 6 months of scalp expansion prior to surgery. Pre-operative planning involved the use of virtual reality equipment and life-sized polymer models of the conjoined skulls and brains. Surgical separation of the twins was achieved after approximately 100 h of operating time, using intraoperative image guidance, microsurgical techniques and intraoperative neurophysiologic monitoring. Reconstruction of the dura, calvarium and scalp was performed with artificial dura, absorbable plates and split skin grafts. Postoperative complications included focal cortical infarction, meningitis, and hydrocephalus. Despite these complications, the twins recovered satisfactorily and were discharged to their home country within 6 months. The 3-month outcome was minor disability in one twin and severe developmental delays in the other. Separation surgery is possible for complex cranially-conjoined twins but requires detailed planning and extensive surgical management.


    Directory of Open Access Journals (Sweden)

    Dana GÂRDU


    Full Text Available The high performing East Asian development model sparked controversies in the academia: its success was ascribed alternatively to nation-states, markets, and sociocultural factors. This paper undertakes a comparative assessment of the last two generations of submodels, i.e. ASEAN-4 and China, by quantifying and interpreting their total factor productivity (TFP using the Solow Model. Results show that capital accumulation was their major growth driver before the beginning of the millennium. Subsequently growth is led by technical change in ASEAN-32, and capital inputs respectively in late industrialising economies, i.e., China and the Philippines. The main differences between the two submodels consist in levels in growth rates and technical progress contributions, which are strongly sped up in China by transition and integration in global production networks. For ASEAN-4 average null or negligible TFP values in the 1990s point to structural vulnerabilities that surface during the Asian financial crisis. ASEAN-3’s recovery is led by technical change though.

  1. Effectiveness of total worker health interventions. (United States)

    Anger, W Kent; Elliot, Diane L; Bodner, Todd; Olson, Ryan; Rohlman, Diane S; Truxillo, Donald M; Kuehl, Kerry S; Hammer, Leslie B; Montgomery, Dede


    Total Worker Health (TWH) was introduced and the term was trademarked in 2011 by the National Institute for Occupational Safety and Health (NIOSH) to formally signal the expansion of traditional occupational safety and health (OSH) to include wellness and well-being. We searched PubMed, PsycINFO, and other databases using keywords TWH, health promotion, health protection, and variants for articles meeting the criteria of (a) employing both occupational safety and/or health (OSH, or health protection) and wellness and/or well-being (health promotion, or HP) in the same intervention study, and (b) reporting both OSH and HP outcomes. Only 17 published studies met these criteria. All but 1 of the 17 TWH interventions improved risk factors for injuries and/or chronic illnesses, and 4 improved 10 or more risk factors. Several TWH interventions reported sustained improvements for over a year, although only 1 is readily available for dissemination. These results suggest that TWH interventions that address both injuries and chronic diseases can improve workforce health effectively and more rapidly than the alternative of separately employing more narrowly focused programs to change the same outcomes in serial fashion. These 17 articles provide useful examples of how TWH interventions can be structured. The promise of simultaneous improvements in safety, health, and well-being leads to the call to pursue TWH research to identify and disseminate best practices. (c) 2015 APA, all rights reserved).

  2. Seasonal total methane depletion in limestone caves. (United States)

    Waring, Chris L; Hankin, Stuart I; Griffith, David W T; Kertesz, Michael A; Kobylski, Victoria; Wilson, Neil L; Coleman, Nicholas V; Kettlewell, Graham; Zlot, Robert; Bosse, Michael; Bell, Graham


    Methane concentration in caves is commonly much lower than the external atmosphere, yet the cave CH 4 depletion causal mechanism is contested and dynamic links to external diurnal and seasonal temperature cycles unknown. Here, we report a continuous 3-year record of cave methane and other trace gases in Jenolan Caves, Australia which shows a seasonal cycle of extreme CH 4 depletion, from ambient ~1,775 ppb to near zero during summer and to ~800 ppb in winter. Methanotrophic bacteria, some newly-discovered, rapidly consume methane on cave surfaces and in external karst soils with lifetimes in the cave of a few hours. Extreme bacterial selection due to the absence of alternate carbon sources for growth in the cave environment has resulted in an extremely high proportion 2-12% of methanotrophs in the total bacteria present. Unexpected seasonal bias in our cave CH 4 depletion record is explained by a three-step process involving methanotrophy in aerobic karst soil above the cave, summer transport of soil-gas into the cave through epikarst, followed by further cave CH 4 depletion. Disentangling cause and effect of cave gas variations by tracing sources and sinks has identified seasonal speleothem growth bias, with implied palaeo-climate record bias.

  3. Total adult cardiovascular risk in Central America

    Directory of Open Access Journals (Sweden)

    A. Barceló

    Full Text Available OBJECTIVE:To evaluate prevalence of cardiovascular risk among adults 40 years and older using population-based samples from six Central American countries. METHODS: Risk factors were derived from a multi-national cross-sectional survey implemented in 2003-2006, which included a sample of 4 202 participants aged 40 years and older. Charts produced by the World Health Organization and the International Society of Hypertension for the Region of the Americas sub-region B were used to predict risk on the basis of factors including age, sex, blood pressure, total serum cholesterol, smoking status, and diabetes status. RESULTS: Overall, 85.9% of the population was classified as having 20% risk. More than 75% of those with a 30-40% risk had previously been identified by health services, and an additional 23% were identified during the study, suggesting they could be diagnosed by opportunistic screening for diabetes, hypertension and hypercholesterolemia. Results of bivariate analysis showed that respondents who were male, older, obese and/or less educated had higher risk for cardiovascular events, but a multivariate analysis including education indicated highest risks for older, obese, and less educated females. CONCLUSIONS: Measuring cardiovascular disease risk identifies most cases of (or at risk for diabetes, hypertension and hypercholesterolemia among adults 40 years and older. This strategy can facilitate implementation of control programs and decrease disabilities and premature mortality.

  4. Total parenteral nutrition in diabetic rats

    International Nuclear Information System (INIS)

    Norcross, E.D.; Stein, T.P.


    Parenteral Nutrition with hypertonic glucose is frequently given to diabetic patients. Large amounts of insulin can be required. The purpose of this investigation was to develop a totally parenterally nourished diabetic rat model. 200 g Female Sprague Dawley rats were made diabetic by i.v. injection of streptozotocin (50 mg/kg). Rats were then allowed to recover for at least 1 week before undergoing surgical insertion of a central venous catheter for parenteral feeding. TPN was begun 3 days after surgery. Prior to this they were allowed unlimited access to food and water. Control (non-streptozotocin treated) rats were run at the same time. Protein turnover was investigated by using 15 N glycine. Preliminary results: diabetic rats given mostly fat as a calorie source survived well in the absence of exogenous insulin whereas those that were given glucose only as their non-protein calorie source showed poor survival even with exogenous insulin. N balance and protein turnover in the lipid treated diabetic rats were comparable to the non-diabetic control rats

  5. The Road to Total Earthquake Safety (United States)

    Frohlich, Cliff

    Cinna Lomnitz is possibly the most distinguished earthquake seismologist in all of Central and South America. Among many other credentials, Lomnitz has personally experienced the shaking and devastation that accompanied no fewer than five major earthquakes—Chile, 1939; Kern County, California, 1952; Chile, 1960; Caracas,Venezuela, 1967; and Mexico City, 1985. Thus he clearly has much to teach someone like myself, who has never even actually felt a real earthquake.What is this slim book? The Road to Total Earthquake Safety summarizes Lomnitz's May 1999 presentation at the Seventh Mallet-Milne Lecture, sponsored by the Society for Earthquake and Civil Engineering Dynamics. His arguments are motivated by the damage that occurred in three earthquakes—Mexico City, 1985; Loma Prieta, California, 1989; and Kobe, Japan, 1995. All three quakes occurred in regions where earthquakes are common. Yet in all three some of the worst damage occurred in structures located a significant distance from the epicenter and engineered specifically to resist earthquakes. Some of the damage also indicated that the structures failed because they had experienced considerable rotational or twisting motion. Clearly, Lomnitz argues, there must be fundamental flaws in the usually accepted models explaining how earthquakes generate strong motions, and how we should design resistant structures.

  6. Process optimized minimally invasive total hip replacement

    Directory of Open Access Journals (Sweden)

    Philipp Gebel


    Full Text Available The purpose of this study was to analyse a new concept of using the the minimally invasive direct anterior approach (DAA in total hip replacement (THR in combination with the leg positioner (Rotex- Table and a modified retractor system (Condor. We evaluated retrospectively the first 100 primary THR operated with the new concept between 2009 and 2010, regarding operation data, radiological and clinical outcome (HOOS. All surgeries were perfomed in a standardized operation technique including navigation. The average age of the patients was 68 years (37 to 92 years, with a mean BMI of 26.5 (17 to 43. The mean time of surgery was 80 min. (55 to 130 min. The blood loss showed an average of 511.5 mL (200 to 1000 mL. No intra-operative complications occurred. The postoperative complication rate was 6%. The HOOS increased from 43 points pre-operatively to 90 (max 100 points 3 months after surgery. The radiological analysis showed an average cup inclination of 43° and a leg length discrepancy in a range of +/- 5 mm in 99%. The presented technique led to excellent clinic results, showed low complication rates and allowed correct implant positions although manpower was saved.

  7. Early Feeding After a Total Abdominal Hysterectomy

    Directory of Open Access Journals (Sweden)

    Mary Flesher


    Full Text Available Background: Oral fluids and food are traditionally introduced slowly after total abdominal hysterectomy (TAH. This descriptive study examined the effect and tolerance of early oral intake following this surgery. Methods: A retrospective chart review was conducted on 164 patients who had been on a clinical pathway following TAH. Comparisons in initiation of fluids and foods, and gastrointestinal effects were made between the early fed group (n=82 and the traditionally fed group (n=82. Results: Both groups had the similar gastrointestinal symptoms postoperatively, but the early fed group had an earlier bowel movement. The early fed group had a statistically significant shorter length of stay. Similar usage of anti-nausea medication and pain medication usage was noted between the two groups, except for a lower usage of Tylenol #3 (acetaminophen with codeine in the early fed group. Conclusions: This study found that early feeding could be tolerated well in TAH patients, with statistically significant improvements in usage of some pain medication and length of stay were noted in the early fed group.

  8. Total least squares for anomalous change detection

    Energy Technology Data Exchange (ETDEWEB)

    Theiler, James P [Los Alamos National Laboratory; Matsekh, Anna M [Los Alamos National Laboratory


    A family of difference-based anomalous change detection algorithms is derived from a total least squares (TLSQ) framework. This provides an alternative to the well-known chronochrome algorithm, which is derived from ordinary least squares. In both cases, the most anomalous changes are identified with the pixels that exhibit the largest residuals with respect to the regression of the two images against each other. The family of TLSQ-based anomalous change detectors is shown to be equivalent to the subspace RX formulation for straight anomaly detection, but applied to the stacked space. However, this family is not invariant to linear coordinate transforms. On the other hand, whitened TLSQ is coordinate invariant, and furthermore it is shown to be equivalent to the optimized covariance equalization algorithm. What whitened TLSQ offers, in addition to connecting with a common language the derivations of two of the most popular anomalous change detection algorithms - chronochrome and covariance equalization - is a generalization of these algorithms with the potential for better performance.

  9. Total intravenous anesthesia: advantages for intracranial surgery. (United States)

    Cole, Chad D; Gottfried, Oren N; Gupta, Dhanesh K; Couldwell, William T


    Although volatile anesthetics have been widely accepted in anesthetic management for neurosurgery, they reduce vascular resistance, resulting in increased cerebral blood flow and increased intracranial pressure (ICP). In patients with elevated ICP who undergo craniotomy, the increase in ICP during surgery from inhaled anesthetics can make the surgery more difficult, thereby increasing the risk of ischemic cerebral insults. Total intravenous anesthesia (TIVA) using propofol and analgesic drugs (remifentanil or fentanyl) and excluding simultaneous administration of any inhaled drugs is being used in patients undergoing craniotomy because of its potential to reduce ICP and ease access to the operative site. We reviewed the literature and describe our experience with TIVA, with emphasis on hemodynamic stability, effects on ICP, emergence from anesthesia, extubation times, and return of cognitive function in patients undergoing craniotomy for space-occupying lesions. TIVA with propofol is similar to inhaled anesthetics with regard to hemodynamic stability, emergence times, extubation times, early cognitive function, and adverse events. In several prospective, randomized clinical trials, evidence suggests that ICP is decreased and cerebral perfusion pressure is increased in patients receiving TIVA when compared with those receiving volatile anesthetics during elective craniotomy procedures. The impact of TIVA on ICP, brain swelling, and access to the operative site in patients with severely elevated ICP has yet to be evaluated and is the subject of a future study at our institution.

  10. Surgical approaches for total hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Vincent M Moretti


    Full Text Available Total hip arthroplasty (THA has become one of the most reliable and patient-requested surgical interventions in all medicine. The procedure can be performed using a variety of surgical approaches, but the posterior approach, direct lateral approach, and direct anterior approach are by far the most common across the globe. This article highlights the history and technique for each of these common approaches. A review of outcomes and complications for each approach are also provided. Each approach has its own unique advantages and disadvantages, but all can be safely and successful utilized for THA. Strong, convincing, high-quality studies comparing the different approaches are lacking at this time. Surgeons are therefore recommended to choose whichever approach they are most comfortable and experienced using. Though not described here, THA can also be done using the anterolateral approach (also known as the Watson Jones approach as well as the two-incision approach. In addition, recently, some surgeons are utilizing the so-called direct superior approach for THA. While these approaches are far less commonly utilized, they are recognized as viable alternatives to traditional approaches.

  11. Total body irradiation: technical and clinical aspects

    International Nuclear Information System (INIS)

    Belkacemi, Y.; Touboul, E.; Rio, B.


    Total-body irradiation (TBI) has an established role in many preparative regimens used before marrow transplantation (BMT) in the treatment of hematological malignancies in children and adults. Better choice in TBI techniques and dosimetry have permitted better homogeneity of dose, and therefore a significant sparing of critical tissues. Advances in treatments over the past 20 years have greatly improved survival; therefore, the evaluation of early and late complications with a sufficient follow-up, according to different conditioning regimens is important. In this article, we review and compare different TBI techniques and dosimetry, and their influence on the distribution and homogeneity of dose, and the possible relationship to the risk of complications. We also describe the acute and late effects of TBI in children and adults appearing in the first month post-BMT as veno-occlusive disease, interstitial pneumonitis, or after 3 months, i.e., endocrinal late effects and growth in children, cataracts, neurological and bone or other complications, secondary tumors and alteration in the quality of life. The responsibility of TBI in the increased rate of certain complications is difficult to assess from chemotherapy or allograft side effects (chronic graft vs. host disease) or from other associated medical treatments, such as long term steroid therapy. (authors)

  12. Esophagojejunostomy reconstruction using a robot-sewing technique during totally robotic total gastrectomy for gastric cancer. (United States)

    Jiang, Zhi-Wei; Liu, Jiang; Wang, Gang; Zhao, Kun; Zhang, Shu; Li, Ning; Li, Jie-Shou


    The aim of this study was to report on the feasibility of esophagojejunostomy reconstruction using a robot-sewing technique during a completely robotic total gastrectomy for gastric cancer. Between May 2011 and July 2012, 65 patients in whom gastric adenocarcinoma was diagnosed underwent a completely robotic total gastrectomy, including a robot-sewing esophagojejunal anastomosis. We demonstrated the surgical techniques with analysis of clinicopathologic data and short-term surgical outcomes. All robotic surgeries were successfully performed without conversion. Among the 65 patients, 46 were men and 19 were women. The mean age (± SD) was 57.8 ± 6.5 y. The mean total operative time (± SD), EJ anastomosis time (± SD), and blood loss (± SD) were 245 ± 53 min, 45 ± 26 min, and 75 ± 50 ml, respectively. The mean (± SD) post-operative hospital stay was 5.4 ± 2.5 d. One patient was readmitted for an intestinal obstruction and underwent re-operation 14 d post-operatively; he recovered uneventfully and was discharged 10 d post- operatively. During the follow-up, no patients developed an esophgojejunostomy stricture. A robot-sewing anastomosis for esophagojejunostomy reconstruction during robotic total gastrectomy for gastric cancer is feasible. Indeed, a robot-sewing anastomosis for esophagojejunostomy reconstruction may become a standard surgical technique during completely robotic total gastrectomy for gastric cancer.

  13. Total and available metal contents in sediments by synchrotron radiation total reflection X-ray fluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Silvana; Sobrinho, Gilmar A. [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Civil]. E-mail:; Vives, Ana Elisa S. de [Universidade Metodista de Piracicaba (UNIMEP), SP (Brazil); Jesus, Edgar F.O. de; Lopes, Ricardo T. [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia


    In this work the total and available contents of Al, Si, Cl, K, Mn, Fe, Co, Ni, Cu, Zn, Sr, Zr, Ba, Ce and Pb in sediments from river Atibaia were determined by Synchrotron Radiation Total Reflection X-Ray Fluorescence technique. The detection limits for K series varies from 200 ng.mL{sup -1} for Al to 2 ng.mL{sup -1} for Zn while for L series the value varies from 20 ng.mL{sup -1} for Ba to 10 ng.mL{sup -1} for Pb. The samples were submitted to two different processes, in order to obtain the total and biological available metal contents. The information about metal content is a important parameter for a correct evaluation about the hydrologic cycle in Piracicaba basin. All the measure were carried out at the National Synchrotron Light Laboratory, Campinas, SP, Brazil, using a white beam for excitation. (author)

  14. Total gas pressure and biological response

    International Nuclear Information System (INIS)

    Powell, C.; Prince, A.


    The total gas pressure (TGP) is a possible threat to fish populations, having a potentially lethal effect on them, but if they dive below certain depths they can avoid these effects. The spatial and temporal depth distribution of adult rainbow trout in the Columbia River below the Hugh Keenleyside (HLK) Dam was monitored, and twenty one adult rainbow trout had depth sensitive electronic tags attached to them to allow their spatial and temporal depth behavior to be tracked and recorded. Nineteen of the fish were consistently relocated after release into the Columbia River, and fish were monitored during the numerous day and night 12 hour observation periods to provide a cross section of fish behavior. With a depth benchmark determined, an experiment was carried out to manipulate TGP production levels from the HLK dam and monitor the fish behavior. TGP levels were manipulated while keeping flows downstream of the dam constant. Two groups of fish were monitored and each group of fish was monitored continuously during the specific 12 hour observation periods within each experimental session. The first session recorded fish behavior when TGP was less than 110%, the second session when TGP was elevated to over 110%, and finally, when the TGP levels were lowered back below 110%. Neither temporal nor spatial fish behavior patterns of the rainbow trout monitored appeared to be influenced by the changes in TGP, compared to that of the benchmark observations. Fish continued to hold at and feed at, or within, a 5 m depth of the surface regardless of the TGP

  15. Measurement of total body radioactivity in man

    International Nuclear Information System (INIS)

    Naversten, Y.


    Techniques for the determination of whole-body radioactivity in man using uncollimated NaI(Tl) detectors have been studied. Geometrical effects and photon attenuation effects due to the different shapes of humans as well as due to varying in-vivo radioactivity distributions have been evaluated particularly for scanning-bed geometries and the chair geometry. Theoretically it is shown that the attenuation effects are generally dominating, for full-energy-peak pulse-range methods. For the application in radiation protection a cheap and simple chair-geometry unit has been constructed and used at various places distantly from the home-laboratory, for studies of body activity of Cs-137 in northern Sweden. High body activities were found particularly in reindeer-breeding Lapps. The elimination rate of Cs-137 in man was studied in the stationary whole-body counter in Lund as well as with the field-system. For the study of the performances at low and high photon energies clinical applications of methods for gastro-intestinal absorption of vitamin B12 (Co-57; 122 keV) and total body potassium determination (K-40; 1.46 MeV, K-42; 1.52 MeV) have been evaluated. Theoretical and experimental results as well as experiences of applications in radiation protection and medicine show that the scanning-bed geometry effectively evens out redistributional effects. For optimum results, however, scatter-energy pulse-ranges rather than full-energy-peak ranges should be used. (Auth.)

  16. Countrywise results of total hip replacement (United States)


    Background and purpose An earlier Nordic Arthroplasty Register Association (NARA) report on 280,201 total hip replacements (THRs) based on data from 1995–2006, from Sweden, Norway, and Denmark, was published in 2009. The present study assessed THR survival according to country, based on the NARA database with the Finnish data included. Material and methods 438,733 THRs performed during the period 1995–2011 in Sweden, Denmark, Norway, and Finland were included. Kaplan-Meier survival analysis was used to calculate survival probabilities with 95% confidence interval (CI). Cox multiple regression, with adjustment for age, sex, and diagnosis, was used to analyze implant survival with revision for any reason as endpoint. Results The 15-year survival, with any revision as an endpoint, for all THRs was 86% (CI: 85.7–86.9) in Denmark, 88% (CI: 87.6–88.3) in Sweden, 87% (CI: 86.4–87.4) in Norway, and 84% (CI: 82.9–84.1) in Finland. Revision risk for all THRs was less in Sweden than in the 3 other countries during the first 5 years. However, revision risk for uncemented THR was less in Denmark than in Sweden during the sixth (HR = 0.53, CI: 0.34–0.82), seventh (HR = 0.60, CI: 0.37–0.97), and ninth (HR = 0.59, CI: 0.36–0.98) year of follow-up. Interpretation The differences in THR survival rates were considerable, with inferior results in Finland. Brand-level comparison of THRs in Nordic countries will be required. PMID:24650019


    Directory of Open Access Journals (Sweden)

    Shireesh A Deshpande


    Full Text Available Transmission of knowledge has been defined as “bringing the right knowledge by the right route at the right time to the right places.” In this context there is need to analyze the various pedagogical shifts associated with the decisive process of transmission and transaction of knowledge in design studio. Critical understanding of the importance of tangential knowledge and its integration within the design studio, leading to a comprehensive whole, is a significant aspect to be properly evolved and nourished in the studio. It can be argued that knowledge is not a substitute for architectural imagination but inadequate knowledge would handicap the general level of design. Being satisfied to manipulate formal configurations does not provide insights into the human experience. If the different types of knowledge that architecture requires are ignored, the profession will lose its credibility in the eyes of society. With the body of knowledge expanding diversely with the escalating wants of the user, and to further sustain the built environment with further progression, it’s quite certain to have an innovative design process that has a feel of antecedents yet is nourished by rationalism. Architectural Design is to an extent the yield of a creative process brought out through a refined approach, skill, and dexterity to suit the purpose. The assessors, the jury, or the teacher has created an aura of mystique around good design, without much explaining what good design is. Architectural education involves application of a theory of knowledge – what is known and how it is to be known. Nothing is taught unless it is learnt (Bono. Does the key to these issues lie in shifting from conventional mode to Total Integration Mode of Education?

  18. Footprint mismatch in total cervical disc arthroplasty. (United States)

    Thaler, Martin; Hartmann, Sebastian; Gstöttner, Michaela; Lechner, Ricarda; Gabl, Michael; Bach, Christian


    Cervical disc arthroplasty has become a commonplace surgery for the treatment of cervical radiculopathy and myelopathy. Most manufacturers derive their implant dimensions from early published cadaver studies. Ideal footprint match of the prosthesis is essential for good surgical outcome. We measured the dimensions of cervical vertebrae from computed tomography (CT) scans and to assess the accuracy of match achieved with the most common cervical disc prostheses [Bryan (Medtronic), Prestige LP (Medtronic), Discover (DePuy) Prodisc-C (Synthes)]. A total of 192 endplates in 24 patients (56.3 years) were assessed. The anterior-posterior and mediolateral diameters of the superior and inferior endplates were measured with a digital measuring system. Overall, 53.5 % of the largest device footprints were smaller in the anterior-posterior diameter and 51.1 % in the mediolateral diameter were smaller than cervical endplate diameters. For levels C5/C6 and C6/C7 an inappropriate size match was noted in 61.9 % as calculated from the anteroposterior diameter. Mismatch at the center mediolateral diameter was noted in 56.8 %. Of the endplates in the current study up to 58.1 % of C5/C6 and C6/C7, and up to 45.3 % of C3/C4 and C4/C5 were larger than the most frequently implanted cervical disc devices. Surgeons and manufacturers should be aware of the size mismatch in currently available cervical disc prostheses, which may endanger the safety and efficacy of the procedure. Undersizing the prosthetic device may lead to subsidence, loosening, heterotopic ossification and biomechanical failure caused by an incorrect center of rotation and load distribution, affecting the facet joints.

  19. Comportamiento de la enfermedad respiratoria de niños entre 5 y 14 años en la ciudad de Santa Marta en el primer trimestre de 2008 y 2009

    Directory of Open Access Journals (Sweden)

    Enis Alejandra Cuao


    Full Text Available Title: Respiratory disease in children ages 6 to 14 years in Santa Marta city in the first quarter of years 2008 and 2009.ResumenLas partículas totales suspendidas (PST o material particulado, específicamente PM10, se encuentran en la atmosfera. Estas partículas pueden penetrar en el sistema respiratorio bloqueando el paso del aire y ocasionando enfermedades. La contaminación por material particulado en la ciudad de Santa Marta requiere ser estudiada para comprender el daño que produce sobre la salud de la población, en concreto en la población infantil y adulta mayor. El transporte y almacenamiento de carbón, además del clima, son los causantes del esparcimiento de partículas PM10, que afectan principalmente las vías respiratorias altas. Para conocer lo que está pasando con la salud respiratoria se realizó un estudio descriptivo que incluyó como población a todos los niños entre 6 y 14 años de base hospitalaria. La información se depuró dejando únicamente los diagnósticos de vías respiratorias superiores. Estos diagnósticos, organizados por fecha, se compararon con la concentración de material particulado en el ambiente para los tres primeros meses de los años 2008 y 2009. El análisis muestra que los niños de 9 años o menos son los más afectados por enfermedades respiratorias en vías superiores. La Comuna con las concentraciones más altas de PM10 fue la 8. Sin embargo, las que más diagnóstico de enfermedad respiratoria presentaron fueron la 5 y la 4. (DUAZARY 2012 No. 1, 33 - 41

  20. Perioperative blood saving measures in total hip and knee arthroplasty

    NARCIS (Netherlands)

    Horstmann, W.G.


    This dissertation explores and discusses different aspects of blood loss and blood-saving measures in total hip and knee arthroplasty. Background: Worldwide, approximately 1 million total hip and 1 million total knee prostheses are implanted each year. Total hip arthroplasty and total

  1. Solar total irradiance in cycle 23 (United States)

    Krivova, N. A.; Solanki, S. K.; Schmutz, W.


    Context. The most recent minimum of solar activity was deeper and longer than the previous two minima as indicated by different proxies of solar activity. This is also true for the total solar irradiance (TSI) according to the PMOD composite. Aims: The apparently unusual behaviour of the TSI has been interpreted as evidence against solar surface magnetism as the main driver of the secular change in the TSI. We test claims that the evolution of the solar surface magnetic field does not reproduce the observed TSI in cycle 23. Methods: We use sensitive, 60-min averaged MDI magnetograms and quasi-simultaneous continuum images as an input to our SATIRE-S model and calculate the TSI variation over cycle 23, sampled roughly every two weeks. The computed TSI is then compared with the PMOD composite of TSI measurements and with the data from two individual instruments, SORCE/TIM and UARS/ACRIM II, that monitored the TSI during the declining phase of cycle 23 and over the previous minimum in 1996, respectively. Results: Excellent agreement is found between the trends shown by the model and almost all sets of measurements. The only exception is the early, i.e. 1996 to 1998, PMOD data. Whereas the agreement between the model and the PMOD composite over the period 1999-2009 is almost perfect, the modelled TSI shows a steeper increase between 1996 and 1999 than implied by the PMOD composite. On the other hand, the steeper trend in the model agrees remarkably well with the ACRIM II data. A closer look at the VIRGO data, which are the basis of the PMOD composite after 1996, reveals that only one of the two VIRGO instruments, the PMO6V, shows the shallower trend present in the composite, whereas the DIARAD measurements indicate a steeper trend. Conclusions: Based on these results, we conclude that (1) the sensitivity changes of the PMO6V radiometers within VIRGO during the first two years have very likely not been correctly evaluated; and that (2) the TSI variations over cycle 23

  2. Gait during hydrokinesitherapy following total knee arthroplasty. (United States)

    Giaquinto, Salvatore; Ciotola, Elena; Margutti, Ferdinando


    To obtain gait parameters during hydrotherapy (HT) in patients who were referred for rehabilitation after primary total knee arthroplasty (TKA). The study had a cohort prospective design. Patients who had undergone TKA followed a HT rehabilitation programme. Twenty-two consecutive patients were enrolled. Four of them dropped out for various reasons, independently of HT. Therefore 18 patients could be evaluated (5 men and 13 women). Eighteen age-matched healthy volunteers were the control subjects. Nine patients had a right TKA and nine a left TKA. On the average HT duration was 18.4 days (SD 1.4). The patients presented with a mean speed of 912 (SD 275) meters per hour (m/h) at the baseline. At the last session the mean speed was 1330 (SD 416) m/h. The mean stance duration was 1.75 s (SD 0.34) on the operated side and 1.83 s (SD 0.41) on the non-operated side. By contrast, the mean swing duration was 1.10 s (SD 0.25) on the operated side and 1.13 s (SD 0.34) on the non-operated side. The step duration was the same on both sides. At the beginning of HT the mean stance/swing ratio was 1.94 on the operated side, whereas it was 1.77 on the non-operated side. In the controls the ratio was 1.46. At the beginning the mean stride length was 0.526 m (SD 0.147) and the value became 0.556 (SD 0.138) after 18 training sessions. At the individual level, recovery occurred in a non-linear fashion (Best Fitting, 7th-grade Fourier finite series). The study design permits accurate definition of stride parameters during rehabilitation which allows optimization of the programme. Increase in speed and regain of balance are the main targets of a HT programme and are monitored on a daily basis.

  3. Total exploitation of an ornamental granite quarry

    Directory of Open Access Journals (Sweden)

    Taboada, J.


    Full Text Available In this paper we propose a methodology to estimate the recovery percentage for each of the products which can be obtained from the exploitation of an ornamental granite quarry: block, semiblock, masonry-transverse stone, and the smaller materials that can be used to obtain construction aggregates. This methodology ensures that quarry exploitation is exhaustive, thereby minimising the production of spoils and the consequent negative impact on the environment. The analysis is based on a detailed and exhaustive compilation of discontinuity data from the research fronts, which are then interpreted statistically and projected over the three weakness planes that are a particular feature of ornamental granite deposits. Using this information, and bearing in mind the minimum commercially viable sizes for each kind of granite, the corresponding recovery rates are calculated for each material in each plane. The results are then integrated using spatial techniques, and the result is an evaluation of quarry contents with a view to total exploitation. This methodology was applied to a quarry in the opening phase in order to carry out an a priori assessment of the economic feasibility of the quarry.

    En este trabajo se propone una metodología para estimar el porcentaje de recuperación de cada uno de los productos que se pueden obtener en la explotación de una cantera de granito ornamental: bloque, semibloque, manpostería y per piaños, y material restante destinado a la obtención de áridos. De esta manera se logra un aprovechamiento integral de la cantera, evitándose la generación de estériles y el subsiguiente impacto ambiental producido por éstos. La metodología de análisis se basa en la recopilación detallada y exhaustiva de datos de discontinuidades en los frentes de investigación, que se interpretan estadísticamente y se proyectan sobre los tres planos de debilidad propios del granito ornamental. Con esta información, y las

  4. Total Internal Reflections - Dr. Kapolka Explains Frustrated Total Internal Reflection [video


    Naval Postgraduate School Physics


    NPS Physics In-class Physics Demonstrations This is a demo about frustrated total internal reflection. This is a general phenomenon that applies to any kind of wave phenomenon including quantum mechanical waves. Dr. Kapolka is physics professor at the Naval Postgraduate school.

  5. Evaluation of total aboveground biomass and total merchantable biomass in Missouri (United States)

    Michael E. Goerndt; David R. Larsen; Charles D. Keating


    In recent years, the state of Missouri has been converting to biomass weight rather than volume as the standard measurement of wood for buying and selling sawtimber. Therefore, there is a need to identify accurate and precise methods of estimating whole tree biomass and merchantable biomass of harvested trees as well as total standing biomass of live timber for...

  6. SORCE Level 3 Total Solar Irradiance Daily Means V017 (United States)

    National Aeronautics and Space Administration — The Total Solar Irradiance (TSI) data set SOR3TSID contains the total solar irradiance (a.k.a solar constant) data collected by the Total Irradiance Monitor (TIM)...

  7. SORCE Level 3 Total Solar Irradiance Daily Average V016 (United States)

    National Aeronautics and Space Administration — The Total Solar Irradiance (TSI) data set SOR3TSID contains the total solar irradiance (a.k.a solar constant) data collected by the Total Irradiance Monitor (TIM)...

  8. Acute complications of percutaneous transluminal coronary angioplasty for total occlusion

    NARCIS (Netherlands)

    S. Plante (Sylvain); G-J. Laarman (GertJan); P.J. de Feyter (Pim); M. Samson; B.J.W.M. Rensing (Benno); V.A.W.M. Umans (Victor); H. Suryapranata (Harry); M.J.B.M. van den Brand (Marcel); P.W.J.C. Serruys (Patrick)


    markdownabstractAbstract The incidence of major complications after percutaneous coronary angioplasty (PTCA) of a totally occluded artery was assessed retrospectively. A total of 1649 PTCA procedures were analyzed. After exclusion of procedures for acute myocardial infarction or total occlusion

  9. Development of meteorological parameters and total ozone during the total solar eclipse of August 11, 1999

    Directory of Open Access Journals (Sweden)

    Peter Winkler


    Full Text Available During the total eclipse of August 11, 1999 frequent showers occurred due to a unstable stratification of the air mass. At different observation sites, meteorological effects from the eclipse (99.4% coverage at Hohenpeißenberg and from showers were superimposed making it partly difficult to unambiguously interpret the observations. The weather radar at Hohenpeißenberg observatory provided a general overview of the distribution of clouds and precipitation in this area (200 km diameter. From the Garching site in the zone of totality (100% temperature and wind data taken on a 50 m mast were evaluated. By selecting periods with relatively low cloud cover it was possible to approximately follow the development of the vertical temperature and wind profiles during the eclipse. The minimum temperature at Hohenpeißenberg (about 450 m above the altitude of Garching during the eclipse was comparable to that during the previous night, the corresponding value measured at Garching remained about 2 K above the minimum observed during clear sky conditions in the previous night. Showers before, during or after the eclipse may have induced vertical exchange of air parcels. Temperatures during a shower change towards the same direction at all altitudes, thus no inversion forms. Additionally, air parcels with relatively lower concentrations of trace constituents were transported down from aloft for time periods of 10–15 minutes. These mixing processes significantly determined the temporal variations of various trace substances measured during the eclipse. Total ozone measurements at Hohenpeißenberg were performed with both DOBSON and BREWER spectrophotometers and at another site within the zone of totality by using a portable Microtops II filter instrument. Different results were obtained for both sites. These differences can be to a large extend, but not exclusively, attributed to eclipse induced shifts (limb darkening and straylight effects in the atmosphere

  10. Totally Contact Umbilical Lightlike Hypersurfaces of Indefinite -Manifolds

    Directory of Open Access Journals (Sweden)

    Rachna Rani


    Full Text Available We study totally contact umbilical lightlike hypersurfaces of indefinite -manifolds and prove the nonexistence of totally contact umbilical lightlike hypersurface in indefinite -space form.

  11. Decreased arylesterase activity and increased total Decreased arylesterase activity and increased total oxidative status in rosacea

    Directory of Open Access Journals (Sweden)

    Sertac Sener


    Full Text Available Background: Rosacea is an inflammatory skin disease of face. In recent years, it is revealed that imbalance is significant in oxidant/antioxidant system in pathophysiology. Objective: In this study, the role of oxidative stress on rosacea was investigated. Methods: 34 rosacea patients and 33 healthy control cases between 18 and 70 years old are included in the study. In all the cases, serum lipids, Paraoxonase1(PON1, stimulated Paraoxonase1(stPON1, Arylesterase(ARES, Total Oxidant Status (TOS and Total Antioxidant Status (TAS levels are measured. Results: ARES levels were significantly lower and TOS levels were significantly higher in the patient group (p<0,001. Oxidative Stress Index(OSI was found to be shifted towards the oxidative side in the patient group (p<0,001. Conclusion: This situation shows that oxidative stress may have a role in the rosacea pathophysiology

  12. Microstructure of water emulsions in heavy fuel oil and its effect in the combustion; Microestructura de emulsiones agua en combustoleo pesado y su efecto en la combustion

    Energy Technology Data Exchange (ETDEWEB)

    Mendez Aranda, Angel Alberto


    largest (around 60{mu}m) and they had the major unburned carbon (67.7% by weight); the smx-1 emulsion produced the smallest cenospheres with 29.2% of carbon. The total incident heat flux of the base line test was 406 kw m{sup -2}, but it was increased 4% with the smx-1 emulsion, 5% with both smx-2 and 3 emulsions, and 6% with the smx-4 emulsion. The increase of both wall temperature and heat flux in the combustion chamber and the decrease of the unburned carbon of emulsions cenospheres, are believed to be due a physical effect (secondary atomisation) of water in the HFO. The results in this research showed that the most notable benefits of the distribution and size of water drops took place in the size range from 2 to 5{mu}m. As the volume of water distributed in drops of this range was increased, both the PST emission level and its particle size were further reduced. [Spanish] En este trabajo se investigo el efecto de la distribucion de tamano de gota de agua (DTGA) de emulsiones agua en combustoleo, en la reduccion de la emision y distribucion de tamano de Particulas Suspendidas Totales (PST). Para ello se prepararon cuatro emulsiones en linea con diferentes mezcladores estaticos (smx- 1, 2, 3 y 4) y 6.8{+-}0.5% de agua. Estas se quemaron en un horno experimental con un flujo de combustoleo de 32 kg h{sup -1} y un exceso de oxigeno en los gases de combustion de 0.37%. La emision de PST se midio siguiendo el metodo 5 de la Agencia de Proteccion del Ambiente de EUA (EPA por sus siglas en ingles), y la distribucion de tamano de particulas (DTP) se establecio mediante un impacto de cascada adaptando el procedimiento establecido en el metodo 17 de la misma agencia. Las emulsiones se examinaron con un microscopio optico de luz transmitida y un sistema de analisis de imagen para determinar la DTGA de acuerdo a la norma Britanica BS-3604. El contenido de carbono no quemado de las particulas se determino con un analizador elemental LECO CHN-600 empleando el metodo ASTM-D 5373

  13. Quantification of total element concentrations in soils using total X-ray fluorescence spectroscopy (TXRF). (United States)

    Towett, Erick K; Shepherd, Keith D; Cadisch, Georg


    Total X-ray fluorescence spectroscopy (TXRF) determines concentrations of major and trace elements in multiple media. We developed and tested a method for the use of TXRF for direct quantification of total element concentrations in soils using an S2 PICOFOX™ spectrometer (Bruker AXS Microanalysis GmbH, Germany). We selected 15 contrasting soil samples from across sub-Saharan Africa for element analysis to calibrate the instrument against concentrations determined using the inductively coupled plasma-mass spectroscopy (ICP-MS) standard method. A consistent underestimation of element concentrations using TXRF compared to ICP-MS reference analysis occurred, indicating that spectrometer recalibration was required. Single-element recalibration improved the TXRF spectrometer's sensitivity curve. Subsequent analysis revealed that TXRF determined total element concentrations of Al, K, Ti, V, Cr, Mn, Fe, Ni, Cu, Zn, and Ga accurately (model efficacy/slope close to 1:1 line, and R(2)>0.80) over a wide range of soil samples. Other elements that could be estimated with an acceptable precision (R(2)>0.60) compared with ICP-MS although generally somewhat under- or overestimated were P, Ca, As, Rb, Sr, Y, Pr, Ta and Pb. Even after recalibration, compared to ICP-MS the TXRF spectrometer produced underestimations for elements Na, Mg, Ba, Ce, Hf, La, Nd, W and Sm and overestimations for elements Bi, Tl and Zr. We validated the degree of accuracy of the TXRF analytical method after recalibration using an independent set of 20 soil samples. We also tested the accuracy of the analysis using 2 multi-element standards as well as the method repeatability on replicate samples. The resulting total element concentration repeatability for all elements analyzed were within 10% coefficient of variability after the instrument recalibration except for Cd and Tl. Our findings demonstrate that TXRF could be used as a rapid screening tool for total element concentrations in soils assuming that

  14. 38 CFR 8.18 - Total disability-speech. (United States)


    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Total disability-speech... SERVICE LIFE INSURANCE Premium Waivers and Total Disability § 8.18 Total disability—speech. The organic loss of speech shall be deemed to be total disability under National Service Life Insurance. [67 FR...

  15. A quantitative approach to total wrist arthroplasty: development of a "precentered" total wrist prosthesis. (United States)

    Hamas, R S


    The major problem with total wrist arthroplasty has been "imbalance" resulting from a lack of information on where to position the axes of motion of the prosthesis. This paper presents a precise method for determining the optimal location for the axes of motion of the prosthesis in any patient's wrist. It is based on a study of the normal biomechanics and was tested clinically in ten patients. The resultant "balance" and range of motion were excellent. A new prosthesis design evolved from this work which should simplify the operative procedure and make the results more reliable. Copyright 2013, SLACK Incorporated.

  16. Deep vein thrombosis prophylaxis: a comprehensive approach for total hip and total knee arthroplasty patient populations. (United States)

    Miric, A; Lombardi, P; Sculco, T P


    One of the most catastrophic complications after total joint arthroplasty is a fatal pulmonary embolism. Thromboembolic disease is particularly a problem in lower extremity joint arthroplasty secondary to the development of deep vein thrombosis (DVT) and proximal propagation of the thrombus. The environment created during total hip and knee arthroplasty fulfills the criteria for DVT formation: vessel wall damage, venous stasis, and a hypercoagulable state. Evidence that suggests the insult and primary event in thrombogenesis occurs during surgery. Until recently, however, the main thrust of DVT prophylaxis has concentrated on the immediate postoperative period. A more global approach to patient care during the 6-week period beginning with surgery may result in more effective DVT prophylaxis. Operative interventions that have proven to be effective include hypotensive epidural anesthesia and intravenous administration of heparin. Postoperative pharmaceutical interventions range from standard doses of aspirin or warfarin to recently studied dosing regimens of low-molecular-weight heparins, antiplatelet agents, and antithrombotic agents. Mechanical prophylaxis has also proved to be a valuable adjunct in DVT prophylaxis during these periods. It is hoped that a more comprehensive approach incorporating several of the aforementioned treatments into a strategy that encompasses the intraoperative and early and late postoperative periods will maximize the effectiveness of DVT prophylaxis.

  17. Renoprotective Effects of Total Glucosides from Paeony against Nephrotoxicity Induced by Total Alkaloids from Semen Strychni

    Directory of Open Access Journals (Sweden)

    Mingming Lv


    Full Text Available Semen Strychni have been shown to have therapeutic effect in improving blood circulation, relieving rheumatic pain, and treating cancer. However, Semen Strychni could cause severe nephrotoxicity. The present study was designed to evaluate whether treatment with total glucosides from paeony (TGP has renoprotective effect against nephrotoxicity induced by total alkaloids from Semen Strychni (TAS. The levels of blood urea nitrogen (BUN and creatinine (Cr were determined and histopathological changes were also examined to evaluate renal injury. Moreover, a HPLC-MS method was developed and validated to investigate the comparative toxicokinetics of strychnine and brucine in rats plasma after oral administration of TAS and pretreatment with TGP. Results demonstrated that the levels of BUN and Cr were significantly increased (p<0.05 in TAS group, together with tubule epithelium cloudy swelling, degeneration, and glomerular atrophy in rats’ kidneys. The TAS-induced kidney damage was alleviated after pretreatment with TGP. Besides, Tmax of strychnine and brucine were increased and T1/2 of strychnine and brucine were decreased after pretreatment with TGP. The toxicokinetics study showed that pretreatment with TGP could attenuate the absorption of strychnine and brucine, as well as accelerate their elimination. These results suggest that TGP possesses renoprotective effects.

  18. Total antioxidant capacity, total phenolic content and mineral elements in the fruit peel of Myrciaria cauliflora

    Directory of Open Access Journals (Sweden)

    Clináscia Rodrigues Rocha Araújo


    Full Text Available The in vitro antioxidant capacity, total phenolic content and mineral elements of the fruit peel of Myrciaria cauliflora were investigated. The antioxidant capacity was analyzed by the diphenylpicrylhydrazyl (DPPH, 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, ferric reducing antioxidant power (FRAP and β-carotene methods. The assays based on the DPPH (EC50 = 3.18 g sample/g DPPH, ABTS•+ (1017 μmol Trolox/g sample, FRAP (1676 µM Fe2SO4/g sample and β-carotene/linoleic acid (70% of oxidation inhibition methods indicated a high antioxidant capacity of the fruit peel extract of the plant. The Folin-Denis method was more efficient in determining the total phenolic compound contents in the different solvents than the Folin-Ciocalteu one. Extractions made with 4:1 methanol-water, 4:1 ethanol-water, 3:2 ethanol-water and 3:2 acetone-water solutions using the Folin-Denis method exhibited high contents of phenolic compounds (18.95, 14.06, 12.93 and 11.99 mg GAE/g, respectively. Potassium was the major element found in the fruit peel, followed by phosphorus, calcium, magnesium and iron, in that order. As a result, the fruit peel of M. cauliflora can be considered as an important source of natural antioxidants and essential elements of easy access for the population and for application in the food industry.

  19. 20 CFR 718.204 - Total disability and disability causation defined; criteria for determining total disability and... (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Total disability and disability causation defined; criteria for determining total disability and total disability due to pneumoconiosis. 718.204... MINE HEALTH AND SAFETY ACT OF 1969, AS AMENDED STANDARDS FOR DETERMINING COAL MINERS' TOTAL DISABILITY...

  20. Total Site Integration and paper machine technologies; Total site integration ja paperikoneteknologia - PMST 02

    Energy Technology Data Exchange (ETDEWEB)

    Puumalainen, T.; Kaijaluoto, S.; Tervonen, P.; Edelmann, K. [VTT Energy, Jyvaeskylae (Finland)


    During the last 30 years the production capacity of a paper machine has tripled. The fastest machines of today run over about 1600 m/min, the web width being around 10 m. The desire to further increase the production capacity is leading to more expensive paper machines and to larger buildings, if current pressing and drying techniques are used. New pressing and drying techniques will decrease the need of thermal energy. Closed water cycles reduce the need of secondary heat abundantly available from the dryer section based on cylinder drying. Total Site Integration studies are required when the effect of new process concepts are to be evaluated against energy efficiency and environmental impacts. A proto type tool has been developed and the effect of new paper machine concepts on energy consumption have been analysed. The utilisation possibilities of the surplus energy will be studied later in the course of this project. (orig.)

  1. Total abdominal colectomy vs. restorative total proctocolectomy as the initial approach to medically refractory ulcerative colitis. (United States)

    Gu, Jinyu; Stocchi, Luca; Ashburn, Jeanie; Remzi, Feza H


    There is scant data assessing the consequences of staging restorative proctocolectomy for ulcerative colitis. The aim of the study is to compare outcomes of initial vs. staged restorative proctocolectomy. Patients completing restorative proctocolectomy, including ileostomy reversal, during 2006-2012 were identified from an IRB-approved database. Demographics, treatment variables, and perioperative outcomes were assessed. Out of 521 patients, 322 (62%) underwent initial total abdominal colectomy before restorative proctectomy. This group was associated with more common preoperative anemia, leukocytosis, hypoalbuminemia, severe colitis, steroids and biologics use, decreased proximal ileostomy rate at the time of completion restorative proctectomy (92.5 vs 97.5%, p = 0.023), shorter hospital stay (6.6 vs 7.8, p restorative proctocolectomy. However, they also required longer combined postoperative hospital stays (17 vs 12 days, p restorative proctocolectomy.

  2. Antioxidant activity, total phenolic, and total flavonoid of extracts from stems of Jasminum nervosum Lour

    Directory of Open Access Journals (Sweden)

    Wei, Xiangyong


    Full Text Available Guangxi traditional Chinese Medical University Universidad de Medicina Tradicional China de Guangxi This study evaluated the antioxidant activities of the extracts of Jasminum nervosum Lour. stems along with the effects of different extract solvents on total phenolics (TP, total flavonoids (TF, and antioxidant potential. The antioxidant activity of the extracts was assessed using the following methods: DPPH, ABTS+ both free radicals scavenging assays, and reducing assays. TP and TF were detected by spectrophotometric and HPLC methods. In former methods, the highest amount of TP content was ethy lacetate extract (EAE, expressed as gallic acid equivalents. The greatest TF content was in the n-butanol extract (BE, expressed as lutin equivalents. No significant difference was observed in the TP/TF content between these two extracts. The antioxidant activity and TP/TF content of three extracts seemed to follow the same trend. This implied that there is a good correlation between antioxidant activities and TP/TF content. But in HPLC methods, EAE contained the highest content of lutin and gallic acid, which decreased in the same order of EAE > BE > PE, the rank order of TP/TF content of EAE and BE were different according to antioxidant ability. The overall results showed that the EAE and BE were richer in phenolics and flavonoids than petroleum ether extract (PE, and may represent a good source of antioxidants.Este estudio evaluó las actividades antioxidantes de extractos de tallos de Jasminum nervosum Lour., y el efecto de diferentes disolventes de extracción en los fenoles totales (TP y flavonoides totales (TF, y su potencial antioxidante. La actividad antioxidante de los extractos fue evaluada usando los siguientes métodos: DPPH, ABTS+ y ensayos reductores. TP y TF fueron detectados por métodos espectroscópicos y por HPLC. Con el primer método, el contenido más alto de TP se obtuvo en el extracto con acetato de etilo (EAE, expresado como

  3. Systematic review: Do patient expectations influence treatment outcomes in total knee and total hip arthroplasty?

    Directory of Open Access Journals (Sweden)

    Haanstra Tsjitske M


    Full Text Available Abstract Objective This systematic review aims to summarise all the available evidence related to the association between pre-operative patient expectations (outcome expectations, process expectations and self efficacy expectations and 5 different treatment outcomes (overall improvement, pain, function, stiffness and satisfaction in patients with total knee or total hip arthroplasty at three different follow-op periods (>6 weeks; >6 weeks- ≤6 months; >6 months. Methods English and Dutch language articles were identified through PubMed,, PsycINFO, CINAHL and The Cochrane Library from inception to September 2012. Articles assessing the association between pre-operative patient expectations and treatment outcomes for TKA/THA in either adjusted or unadjusted analysis were included. Two reviewers, working independently, determined eligibility, rated methodological quality and extracted data on study design, population, expectation measurements, outcome measurements and strength of the associations. Methodological quality was rated by the same reviewers on a 19 item scale. The scores on the quality assessment were taken into account when drawing final conclusions. Results The search strategy generated 2252 unique references, 18 articles met inclusion criteria. Scores on the methodological quality assessment ranged between 6% and 79%. Great variety was seen in definitions and measurement methods of expectations. No significant associations were found between patient expectations and overall improvement, satisfaction and stiffness. Both significant positive and non-significant associations were found for the association between expectations and pain and function. Conclusions There was no consistency in the association between patients’ pre-operative expectations and treatment outcomes for TKA and THA indentified in this systematic review. There exists a need for a sound theoretical framework underlying the construct of

  4. Total nitrogen and total phosphorus removal from brackish aquaculture wastewater using effective microorganism (United States)

    Mohamad, K. A.; Mohd, S. Y.; Sarah, R. S.; Mohd, H. Z.; Rasyidah, A.


    Aquaculture is one of dominant food based industry in the world with 8.3% annual growth rate and its development had led to adverse effect on the environment. High nutrient production in form of nitrogenous compound and phosphorus contributed to environmental deterioration such as eutrophication and toxicity to the industry. Usage of Effective Microorganism (EM), one of the biological approaches to remove Total Nitrogen (TN) and Total Phosphorus (TP) in aquaculture pond was proposed. Samples were obtained from the Sea Bass intensive brackish aquaculture wastewater (AW) from fish farm at Juru, Penang and the parameters used to measure the removal of nitrogenous compounds include, pH, EM dosage, shaking, contact time and optimum variable conditions. From the study, for effective contact time, day 6 is the optimum contact time for both TN and TP with 99.74% and 62.78% removal respectively while in terms of optimum pH, the highest TN removal was at pH 7 with 66.89 %. The optimum dosage of EM is 1.5 ml with ratio 1:166 for 81.5 % TN removal was also found appropriate during the experiment. At varied optimum conditions of EM, the removal efficiency of TN and TP were 81.53% and 38.94% respectively while the removal mechanism of TN was highly dependent on the decomposition rate of specific bacteria such as Nitrobacter bacteria, Yeast and Bacillus Subtilis sp. The study has established the efficacy of EM's ability to treat excessive nutrient of TN and TP from AW.


    National Aeronautics and Space Administration — The GPM Ground Validation Total Sky Imager NASA ACHIEVE IPHEx dataset includes data from the Yankee Scientific TSI880 Total Sky Imager instrument, part of the NASA...

  6. Population: Census Bureau Total Estimates (2010-2012) (United States)

    Earth Data Analysis Center, University of New Mexico — Total population estimates are estimates of the total number of residents living in an area on July 1 of each year. The Census Bureau’s Population Division produces...

  7. TCTE Level 3 Total Solar Irradiance Daily Means V002 (United States)

    National Aeronautics and Space Administration — The Total Solar Irradiance (TSI) Calibration Transfer Experiment (TCTE) data set TCTE3TSID contains daily averaged total solar irradiance (a.k.a solar constant) data...

  8. Revised Total Coliform Rule Assessments and Corrective Actions (United States)

    EPA has developed the Revised Total Coliform Rule Assessment and Corrective Actions Guidance Manual for public water systems (e.g., owners and operators) to assist in complying with the requirements of the Revised Total Coliform Rule.

  9. Comparative evaluation of organic and inorganic fertilizers on total ...

    African Journals Online (AJOL)

    Ciocalteu assay and aluminium chloride colorimetric method, respectively. The fertilizer sources and varieties were found to have significant effect on phytochemical compounds. Fertilizer and variety interaction was significant in total phenolics, total ...

  10. Navegação na artroplastia total do joelho Navigation in total knee arthroplasty

    Directory of Open Access Journals (Sweden)

    Roberto Freire da Mota e Albuquerque


    Full Text Available A navegação foi o avanço mais significativo na instrumentação da artroplastia total do joelho na última década. Confere ao cirurgião uma ferramenta de precisão na execução da operação, a possibilidade de simulação intraoperatória e o controle objetivo de vários parâmetros e referências anatômicas e cirúrgicas. Desde os primeiros sistemas que controlavam basicamente o alinhamento dos cortes ósseo em referência ao eixo mecânico do membro inferior, vários outros passos foram sendo incorporados, como a rotação dos componentes, o balanço ligamentar e a simetria dos espaços de flexão e extensão, entre outros. Sua eficácia como instrumento de precisão com capacidade efetiva de promover um melhor alinhamento do eixo do membro inferior está amplamente comprovada na literatura; entretanto, o real valor do alinhamento otimizado e o impacto da navegação sobre os resultados clínicos e a longevidade da artroplastia ainda estão por serem estabelecidos.Navigation was the most significant advance in instrumentation for total knee arthroplasty over the last decade. It provides surgeons with a precision tool for carrying out surgery, with the possibility of intraoperative simulation and objective control over various anatomical and surgical parameters and references. Since the first systems, which were basically used to control the alignment of bone cutting referenced to the mechanical axis of the lower limb, many other surgical steps have been incorporated, such as component rotation, ligament balancing and arranging the symmetry of flexion and extension spaces, among others. Its efficacy as a precision tool with an effective capacity for promoting better alignment of the lower-limb axis has been widely proven in the literature, but the real value of optimized alignment and the impact of navigation on clinical results and the longevity of arthroplasty have yet to be established.

  11. Screening for total and abdominal obesity among University of ...

    African Journals Online (AJOL)

    The importance of total body fat and distribution has been stressed as a major risk factor for both adults and children. There is paucity of information concerning total and abdominal obesity among university students in South Africa. The purpose of this study was to screen for total and abdominal obesity among university of ...

  12. Place du dosage des immunoglobulines e totales en pratique ...

    African Journals Online (AJOL)

    Mots clés: Immunoglobulines E, allergie, Togo. English Abstract. Place of total immunoglobulin E dosage in common practice in Togo. Objective: to determine the place of total immunoglobulin E (IgE) dosage in common practice in Togo. Material and methods: 650 total IgE dosages performed during 4 years (2008 to 2011) ...

  13. Total lipid profile with aqueous fruit extract of Solanum macrocarpum ...

    African Journals Online (AJOL)

    Abstract. Studies were undertaken to investigate the effects of the aqueous fruit extract of Solanum macrocarpum Linn. on the total lipid profile: total cholesterol, triglycerides, high density lipoprotein-cholesterol (HDL-C) and low density lipoprotein-cholesterol (LDL-C) on hypercholesterolaemic rats. Total serum cholesterol ...

  14. 20 CFR 10.400 - What is total disability? (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false What is total disability? 10.400 Section 10... AMENDED Compensation and Related Benefits Compensation for Disability and Impairment § 10.400 What is total disability? (a) Permanent total disability is presumed to result from the loss of use of both...

  15. 29 CFR 4022.6 - Annuity payable for total disability. (United States)


    ... 29 Labor 9 2010-07-01 2010-07-01 false Annuity payable for total disability. 4022.6 Section 4022.6... § 4022.6 Annuity payable for total disability. (a) Except as provided in paragraph (b) of this section... terms of a plan on account of the total and permanent disability of a participant which is expected to...

  16. Total Lightning as an Indicator of Mesocyclone Behavior (United States)

    Stough, Sarah M.; Carey, Lawrence D.; Schultz, Christopher J.


    Apparent relationship between total lightning (in-cloud and cloud to ground) and severe weather suggests its operational utility. Goal of fusion of total lightning with proven tools (i.e., radar lightning algorithms. Preliminary work here investigates circulation from Weather Suveilance Radar- 1988 Doppler (WSR-88D) coupled with total lightning data from Lightning Mapping Arrays.

  17. Estimation of Total Tree Height from Renewable Resources Evaluation Data (United States)

    Charles E. Thomas


    Many ecological, biological, and genetic studies use the measurement of total tree height. Until recently, the Southern Forest Experiment Station's inventory procedures through Renewable Resources Evaluation (RRE) have not included total height measurements. This note provides equations to estimate total height based on other RRE measurements.

  18. A note on neighborhood total domination in graphs

    Indian Academy of Sciences (India)

    The minimum cardinality of a NTDS of is called the neighborhood total domination number of and is denoted by nt(). In this paper, we obtain sharp bounds for the neighborhood total domination number of a tree. We also prove that the neighborhood total domination number is equal to the domination number in ...

  19. Diagnostic value of lipids, total antioxidants, and trace metals in ...

    African Journals Online (AJOL)

    Materials and Methods: Anthropometric characteristics, total prostate specific antigen (tPSA), serum lipids (total cholesterol, LDL cholesterol, HDL cholesterol, and triglycerides), Vit. E, total antioxidant status (TAS), and trace metals (Se, Cu, Fe, Zn, and Mn) were determined in 40 patients with histopathological diagnosis of ...

  20. A transition from total domination in graphs to transversals in ...

    African Journals Online (AJOL)

    A set S of vertices in a graph G without isolated vertices is a total dominating set of G if every vertex of G is adjacent to a vertex in S. The total domination number of G is the minimum cardinality of a total dominating set in G. The transversal number of a hypergraph is the minimum number of vertices meeting every edge.

  1. A method comparison of total and HMW adiponectin: HMW/total adiponectin ratio varies versus total adiponectin, independent of clinical condition. (United States)

    van Andel, Merel; Drent, Madeleine L; van Herwaarden, Antonius E; Ackermans, Mariëtte T; Heijboer, Annemieke C


    Total and high-molecular-weight (HMW) adiponectin have been associated with endocrine and cardiovascular pathology. As no gold standard is available, the discussion about biological relevance of isoforms is complicated. In our study we perform a method comparison between two commercially available assays measuring HMW and total adiponectin, in various patient groups, thus contributing further to this discussion. We determined levels of HMW and total adiponectin using assays by Lumipulse® and Millipore® respectively, in 126 patients with different clinical characteristics (n=29 healthy volunteers, n=22 dialysis patients, n=25 elderly with body mass index (BMI) LUMIPULSE ∗0.5-0.9=total adiponectin MILLIPORE , albeit with significant deviation from linearity (p<0.001). Pearson's correlation was R=0.987 (p=0.000). No significant differences between patient groups were observed (p=0.190). The HMW/total adiponectin ratio varies with total adiponectin concentration independent of clinical conditions studied. Our results imply that total and HMW adiponectin have similar utility when assessing adiponectin levels in blood, as the ratio is independent of clinical condition. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Fonoterapia em glossectomia total: estudo de caso Speech therapy in total glossectomy: case study

    Directory of Open Access Journals (Sweden)

    Camila Alves Vieira


    Full Text Available A cirurgia curativa do câncer de língua ocasiona sequelas que prejudicam o bom funcionamento das funções estomatognáticas. O objetivo do trabalho é descrever, por meio de estudo de caso, os achados da avaliação e a evolução da reabilitação fonoaudiológica das funções de deglutição e fala de um indivíduo de 58 anos, gênero masculino, submetido à glossectomia total em junho de 2009. Após a avaliação diagnosticou-se disfagia orofaríngea mecânica severa e alteração na articulação da fala. Na reabilitação fonoaudiológica foram utilizadas, como formas de atuação, as terapias direta e indireta. Na terapia indireta trabalhou-se controle motor oral, sensibilidade, mobilidade, motricidade, tônus e postura das estruturas adjacentes da língua resseccionada. Na terapia direta empregou-se a manobra de postura de cabeça para trás para auxiliar na ejeção de alimentos para a faringe. O paciente passou a alimentar-se exclusivamente por via oral, com a restrição de sólidos, após dez meses em tratamento. No que se refere à fala, foram utilizados exercícios de sobrearticulação, velocidade e ritmo para melhorar a sua inteligibilidade. Dessa forma, considerou-se os resultados da intervenção fonoaudiológica positivos e o paciente recebeu alta após um ano em tratamento. Conclui-se que as ressecções de língua apresentam sequelas significativas nas funções de deglutição e fala, assim sendo, é imprescindível a atuação fonoaudiológica para modificar e adaptar essas funções, além de proporcionar melhor qualidade de vida ao paciente.Curative surgery for tongue cancer results in sequelae that harm the good functioning of the stomatognathic system. The aim of the present study is to describe a case study, reporting the evaluation and evolution findings of the speech-language pathology rehabilitation of the swallowing and speech functions of a 58-year-old man submitted to total glossectomy in June 2009. After

  3. Fraturas periprotéticas em artroplastia total de joelho Periprosthetic fractures in total knee arthroplasty

    Directory of Open Access Journals (Sweden)

    Paulo Gilberto Cimbalista de Alencar


    Full Text Available A associação do maior número de artroplastias totais de joelho com a maior expectativa de vida da população tem levado a mais complicações de longo prazo, que se somam à baixa qualidade óssea dos pacientes mais idosos e culminam, muitas vezes, em fraturas periprotéticas. Este complexo problema ortopédico tem apresentação clínica muito variável, podendo acometer quaisquer dos ossos do joelho e levar a resultados desastrosos, em virtude de sua difícil solução. O seu tratamento exige do ortopedista amplo conhecimento tanto de técnicas de artroplastia como de osteossíntese, além de elaborado arsenal terapêutico como, por exemplo, acesso a banco de ossos.The increasing number of total knee arthroplasties, in combination with the population's longer life expectancy, has led to a greater number of long-term complications. These complications are also correlated with poor bone quality in the elderly and often result in periprosthetic fractures. This complex orthopedic problem has very diverse clinical presentation, possibly afflicting periprosthetic fracture may happen in any bone that constitutes the knee and, due to the difficulty of finding a solution, may lead to disastrous outcomes. The treatment demands broad knowledge from the orthopedic surgeon, not only regarding arthroplasty techniques, but also osteosynthesis, as well as an elaborate therapeutic including, for example, access to a bone bank.

  4. On the signed total domatic numbers of directed graphs

    Directory of Open Access Journals (Sweden)

    S.M. Sheikholeslami


    Full Text Available Let D = (V,A be a finite simple directed graph (shortly digraph in which d_D^{-}(vge 1 for all v in V . A function f : V ightarrow {-1,1} is called a signed total dominating function if sumlimits_{uin N_{-}^{v}{f(u}} ge 1 for each vertex vin V . A set {f_1,f_2, ..., f_g} of signed total dominating functions on D with the property that sumlimits_{i=1}^d{f_i(v}le 1 for each vin V(D, is called a signed total dominating family (of functions on D. The maximum number of functions in a signed total dominating family on D is the signed total domatic number of D, denoted by d_{st}(D. In this paper we present some bounds on the signed total domatic number and we determine the signed total domatic number of some classes of digraphs.

  5. Midterm outcomes of total cervical total disc replacement with Bryan prosthesis. (United States)

    Zhang, Zhenxiang; Zhu, Wei; Zhu, Lixian; Du, Yaqing


    Short-term results have indicated that the Bryan cervical total disc replacement (TDR) favorably compares to anterior cervical decompression and fusion, while it is associated with fewer complications and higher levels of satisfaction. The aim of the present work was to assess the safety and efficacy of the device in the treatment for cervical degenerative disc disease, at 6-year follow-up. Fifty-eighty patients have performed their 6-year follow-up visit and have been analyzed clinically and radiologically. Clinical evaluation was based on neck disability index (NDI), visual analog scale (VAS), SF-36, and range of motion (ROM) at index levels. Each measurement was taken preoperatively and at 3 months, 6 months, 1 year, 3 years, and 6 years postoperatively. Complications and re-operations were also investigated. Occurrences of heterotopic ossifications (HO) and of adjacent level degeneration were detected by radiographs at 6-year follow-up. The mean NDI and VAS scores for arm and neck were significantly reduced for all postoperative periods compared with the average preoperative values. Motion was preserved at index levels (mean ROM = 8.6° ± 0.2° at 6 years), and 81.3 % of the segments were mobile at 6 years. HO was evident in 12/64 operated segments and not restricting the movement of the prosthesis in any case at 6-year follow-up. Six of sixty-four upper adjacent levels and 4/64 lower adjacent levels showed a slight degradation. There was 2 case of posterior migration of the prosthesis, which did not cause any clinical symptoms. No case showed evidence of subsidence, wear of the implant. At a 6-year follow-up, the cervical TDR using Bryan prosthesis displayed satisfactory clinical and radiographic outcomes without any significant complication. However, future efforts need to be directed toward the evaluation of a larger number of patients with longer follow-up.

  6. AMECM/DCB scaffold prompts successful total meniscus reconstruction in a rabbit total meniscectomy model. (United States)

    Yuan, Zhiguo; Liu, Shuyun; Hao, Chunxiang; Guo, Weimin; Gao, Shuang; Wang, Mingjie; Chen, Mingxue; Sun, Zhen; Xu, Yichi; Wang, Yu; Peng, Jiang; Yuan, Mei; Guo, Quan-Yi


    Tissue-engineered meniscus regeneration is a very promising treatment strategy for meniscus lesions. However, generating the scaffold presents a huge challenge for meniscus engineering as this has to meet particular biomechanical and biocompatibility requirements. In this study, we utilized acellular meniscus extracellular matrix (AMECM) and demineralized cancellous bone (DCB) to construct three different types of three-dimensional porous meniscus scaffold: AMECM, DCB, and AMECM/DCB, respectively. We tested the scaffolds' physicochemical characteristics and observed their interactions with meniscus fibrochondrocytes to evaluate their cytocompatibility. We implanted the three different types of scaffold into the medial knee menisci of New Zealand rabbits that had undergone total meniscectomy; negative control rabbits received no implants. The reconstructed menisci and corresponding femoral condyle and tibial plateau cartilage were all evaluated at 3 and 6 months (n = 8). The in vitro study demonstrated that the AMECM/DCB scaffold had the most suitable biomechanical properties, as this produced the greatest compressive and tensile strength scores. The AMECM/DCB and AMECM scaffolds facilitated fibrochondrocyte proliferation and the secretion of collagen and glycosaminoglycans (GAGs) more effectively than did the DCB scaffold. The in vivo experiments demonstrated that both the AMECM/DCB and DCB groups had generated neomeniscus at both 3 and 6 months post-implantation, but there was no obvious meniscus regeneration in the AMECM or control groups, so the neomeniscus analysis could not perform on AMECM and control group. At both 3 and 6 months, histological scores were better for regenerated menisci in the AMECM/DCB than in the DCB group, and significantly better for articular cartilage in the AMECM/DCB group compared with the other three groups. Knee MRI scores (Whole-Organ Magnetic Resonance Imaging Scores (WORMS)) were better in the AMECM/DCB group than in the

  7. The Association between Diabetic Retinopathy and Levels of Ischemia-Modified Albumin, Total Thiol, Total Antioxidant Capacity, and Total Oxidative Stress in Serum and Aqueous Humor

    Directory of Open Access Journals (Sweden)

    Kadir Kirboga


    Full Text Available Purpose. To investigate the oxidant and antioxidant status of patients with type 2 diabetes mellitus and nonproliferative diabetic retinopathy (DRP. Methods. Forty-four patients who had cataract surgery were enrolled in the study. We included 22 patients with DRP in one group and 22 patients in the control group. Samples of aqueous humor and serum were taken from all patients. Serum and aqueous ischemia-modified albumin (IMA, total thiol, total antioxidant capacity (TAC, and total oxidative stress (TOS levels were compared in two groups. Results. Median serum IMA levels were 44.80 absorbance units in the DRP group and 40.15 absorbance units in the control group (P=0.031. Median serum total thiol levels in the DRP group were significantly less than those in the control group (3051.13 and 3910.12, resp., P=0.004. Mean TOS levels in the serum were 2.93 ± 0.19 in the DRP group and 2.61 ± 0.26 in the control group (P=0.039. The differences in mean total thiol, TAC, and TOS levels in the aqueous humor and mean TAC levels in the serum were not statistically significant. Conclusion. IMA, total thiol, and TOS levels in the serum might be useful markers in monitoring the risk of DRP development.

  8. Carl Schmitt's attitude towards total war and total enemy on the eve of the outbreak of WWII

    Directory of Open Access Journals (Sweden)

    Molnar Aleksandar


    Full Text Available Carl Schmitt is usually perceived as the theorist of total state, total war and total hostility. In the article, the author however tries to show that from 1937 to 1944, Schmitt was arguing that total war and total hostility were dangerous for Germany (as well as for the rest of Europe and warned against perpetuation of all efforts to totalize enemy that started in 1914. In his theoretical endeavors in this period there was place for the total state only - and especially for the total state strong enough to resist temptation of declaring total war on total enemy. The total state he recommended Hitler and his Nazi comrades was German Reich, as a part of Europe ordered and divided in the huge spaces (Grossraumordnung. Positioned in the centre of Europe, between the rest of the powers (France, Italy, USSR as well as the Scandinavian states, Germany should be careful enough to wage war only against its Eastern enemies (Poland and maybe USSR and only in order to achieve 'just' borders. Occupying in this way its huge space Germany should devote itself to the task of exploitation of various peoples such as Poles, Chechs and Slovaks, which were perceived as incapable of having their states and doomed to serve the master race - the Germans.

  9. Antibiotic impregnated total femur spacers: a technical tip

    Directory of Open Access Journals (Sweden)

    Colin D. Canham, MD


    Full Text Available Simultaneous prosthetic joint infection of ipsilateral hip and knee arthroplasties is often accompanied by significant bone loss and presents a challenging reconstructive problem. Two-stage reconstruction is favored and requires the placement of a total femur spacer, which is not a commercially available device. We describe a surgical technique, reporting on 2 cases in which a customized total femur antibiotic impregnated spacer was created by combining an articulating knee spacer and an articulating hip spacer with a reinforced cement dowel construct connecting the 2 spacers. Custom total femoral spacers are useful in the management of infected femoral megaprostheses and cases with ipsilateral injected hip and knee arthroplasties and severe femoral bone loss. Keywords: total femur spacer, revision arthroplasty, total hip arthroplasty, total knee arthroplasty, prosthetic joint infection



    Özdemir K; Berber İ; Öğün E; Atalan M


    Present study has been conducted for finding out the total protein profile of bacterial strain Streptomyces sps by sodium dodecyl sulphate polyacrylamide gelelectrophoresis. Total 139 isolates of Streptomyces have been isolated from the soil. Amongst all isolated strain, total 20 isolates were used for getting protein profile by SDS PAGE. Amongst all isolates, 20 isolates were selected for protein profiling and these were divided in two groups. Two strains of Streptomyces i.e. S. violaceus...

  11. Total magnetic reconnection during a tokamak major disruption

    International Nuclear Information System (INIS)

    Goetz, J.A.; Dexter, R.N.; Prager, S.C.


    The safety factor within a tokamak plasma has been measured during a major disruption. During the disruption, the central safety factor jumps from below one to above one, while the total current is unchanged. This implies that total reconnection has occurred. This observation is in contract to the absence of total reconnection observed during a sawtooth oscillation in the same device. 11 refs., 6 figs

  12. Total upper and lower eyelid reconstruction using deltopectoral flap


    Gujjalanavar, Rajendra Suresh; Girish, A. C


    Total upper and lower eyelid unilateral full thickness reconstruction is a surgical challenge. A case of right orbital haemangioma with unilateral complete defect of total upper and lower eyelids with right orbital exenteration is reported, together with the surgical technique of reconstruction. Patient was a 24-year-old female who underwent right orbital exenteration with total upper and lower eyelid excision for orbital haemangioma presented after 3 weeks of the above procedure. In the firs...

  13. The use of adaptive equipment following total knee replacement


    McNaught, Jamie; Paul, Lorna


    Introduction: This study evaluates the need for adaptive equipment following total knee replacement. There are no recent studies to guide occupational therapists in the optimum time adaptive equipment is required following total knee replacement.\\ud \\ud Method: A non-experimental, concurrent mixed methods approach was used. The study population was patients attending for total knee replacement at a large general hospital. Outcome measures were the Oxford Knee Score, the United Kingdom Functio...

  14. Refractometric total protein concentrations in icteric serum from dogs. (United States)

    Gupta, Aradhana; Stockham, Steven L


    To determine whether high serum bilirubin concentrations interfere with the measurement of serum total protein concentration by refractometry and to assess potential biases among refractometer measurements. Evaluation study. Sera from 2 healthy Greyhounds. Bilirubin was dissolved in 0.1M NaOH, and the resulting solution was mixed with sera from 2 dogs from which food had been withheld to achieve various bilirubin concentrations up to 40 mg/dL. Refractometric total protein concentrations were estimated with 3 clinical refractometers. A biochemical analyzer was used to measure biuret assay-based total protein and bilirubin concentrations with spectrophotometric assays. No interference with refractometric measurement of total protein concentrations was detected with bilirubin concentrations up to 41.5 mg/dL. Biases in refractometric total protein concentrations were detected and were related to the conversion of refractive index values to total protein concentrations. Hyperbilirubinemia did not interfere with the refractometric estimation of serum total protein concentration. The agreement among total protein concentrations estimated by 3 refractometers was dependent on the method of conversion of refractive index to total protein concentration and was independent of hyperbilirubinemia.

  15. Comparison of serum leptin, glucose, total cholesterol and total protein levels in fertile and repeat breeder cows

    Directory of Open Access Journals (Sweden)

    Saime Guzel


    Full Text Available In the present study we measured serum glucose, leptin, total cholesterol and total protein concentrations in repeat breeder cows and compared them with fertile cows. For this aim, 20 repeat breeder cows and 20 fertile cows were used as material. Repeat breeder cows were found to have lower levels of leptin and glucose as compared with fertile ones. No significant differences in total cholesterol and total protein levels were observed between the two groups. No significant correlation of leptin with glucose, total cholesterol and total protein was observed in fertile and repeat breeder cows. Low concentrations of glucose and leptin can have some effects on reproductive problems as repeat breeder and help to understand potential mechanisms impairing fertility in repeat breeder cows.

  16. determination of nitrite, nitrate and total nitrogen in vegetable samples

    African Journals Online (AJOL)

    The above colour reaction system has been applied successfully for the determination of nitrite, nitrate and total nitrogen in vegetable samples. Unreduced samples give direct measure for nitrite whilst reduction of samples by copperized-cadmium column gives total nitrogen content and their difference shows nitrate content ...

  17. Total phenols, flavonoids, anthocyanins, ascorbic acid contents and ...

    African Journals Online (AJOL)



    Mar 5, 2014 ... The antioxidant capability, total phenol, total flavonoid, anthocyanins, ascorbic acid contents, and reducing power contents of polar and non-polar extracts for flower and leaves in two stages of growth for Rhamnus kurdica Boiss in flowering were evaluated in this work. The polar extraction of flower of R.

  18. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Purpose: To optimize extraction of total triterpene acids from loquat leaf and evaluate their in vitro antioxidant activities. Methods: The independent variables were ethanol concentration, extraction time, and solvent ratio, while the dependent variable was content of total triterpene acids. Composite design and response.

  19. Application of total reflection X-ray fluorescence spectrometry for ...

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics; Volume 76; Issue 2. Application of total reflection X-ray fluorescence ... Applicability of total reflection X-ray fluorescence (TXRF) spectrometry for trace elemental analysis of rainwater samples was studied. The study was used to develop these samples as rainwater standards ...

  20. Blood Loss and Influencing Factors in Primary Total Hip Arthroplasties

    African Journals Online (AJOL)

    Introduction: Orthopaedic surgery results in significant blood loss. There are no studies that can aid the surgeon in the African region estimate the expected blood loss after total hip replacement. We conducted a study to quantify the blood loss following total hip arthroplasty and to determine the factors associated with this ...