WorldWideScience

Sample records for susceptible cotton gossypium

  1. Transcriptome Analysis of Cotton (Gossypium hirsutum L. Genotypes That Are Susceptible, Resistant, and Hypersensitive to Reniform Nematode (Rotylenchulus reniformis.

    Directory of Open Access Journals (Sweden)

    Ruijuan Li

    Full Text Available Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.. An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747, resistant (BARBREN-713, and hypersensitive (LONREN-1 genotypes of cotton (Gossypium hirsutum L. with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.

  2. Influence of Soil Temperature on Meloidogyne incognita Resistant and Susceptible Cotton, Gossypium hirsutum

    OpenAIRE

    Carter, William W.

    1982-01-01

    The degree of resistance by a cotton plant to Meloidogyne incognita is affected by soil temperature, particularly in moderately resistant cultivars, The total number of nematodes in the resistant and moderately resistant rools at 35 C was equal to, or greater than, the number in susceptible roots at 20, 25, or 30 C. A shift in numbers to developing and egg-bearing forms of nematodes in the susceptible cultivar as tentperature increased indicates development was affected by temperature rather ...

  3. Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

    2015-01-01

    Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

  4. Multiple shoot regeneration of cotton (Gossypium hirsutum L.) via ...

    African Journals Online (AJOL)

    user

    2011-03-14

    Mar 14, 2011 ... Induction of multiple shoots of cotton (Gossypium hirsutum L.) plant in two commercial varieties (Sahel and Varamin) using shoot apex was done. Explants were isolated from 3 - 4 days old seedlings, then they were cultured on a shoot induction media, modified MS nutrient agar with combinations: 1- ...

  5. KUTUN : a morphogenetic model for cotton (Gossypium hirsitum L.)

    NARCIS (Netherlands)

    Mutsaers, H.J.W.

    1982-01-01

    A whole crop model for growth and development of cotton ( Gossypium hirsutum L.) is presented. The model is based on previous extensive studies on plant morphogenesis, growth of fruits and canopy photosynthesis. The crop model basically is a carbohydrate budget, but all

  6. Polyploidization altered gene functions in cotton (Gossypium spp.).

    Science.gov (United States)

    Xu, Zhanyou; Yu, John Z; Cho, Jaemin; Yu, Jing; Kohel, Russell J; Percy, Richard G

    2010-12-16

    Cotton (Gossypium spp.) is an important crop plant that is widely grown to produce both natural textile fibers and cottonseed oil. Cotton fibers, the economically more important product of the cotton plant, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that large numbers of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across At and Dt subgenomes of tetraploid AD cottons. In the present study, the organization and evolution of the fiber development genes were investigated through the construction of an integrated genetic and physical map of fiber development genes whose functions have been verified and confirmed. A total of 535 cotton fiber development genes, including 103 fiber transcription factors, 259 fiber development genes, and 173 SSR-contained fiber ESTs, were analyzed at the subgenome level. A total of 499 fiber related contigs were selected and assembled. Together these contigs covered about 151 Mb in physical length, or about 6.7% of the tetraploid cotton genome. Among the 499 contigs, 397 were anchored onto individual chromosomes. Results from our studies on the distribution patterns of the fiber development genes and transcription factors between the At and Dt subgenomes showed that more transcription factors were from Dt subgenome than At, whereas more fiber development genes were from At subgenome than Dt. Combining our mapping results with previous reports that more fiber QTLs were mapped in Dt subgenome than At subgenome, the results suggested a new functional hypothesis for tetraploid cotton. After the merging of the two diploid Gossypium genomes, the At subgenome has provided most of the genes for fiber development, because it continues to function similar to its fiber producing diploid A genome ancestor. On the other hand, the Dt subgenome, with its non-fiber producing D genome ancestor

  7. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. The draft genome of a diploid cotton Gossypium raimondii

    DEFF Research Database (Denmark)

    Wang, Kunbo; Wang, Zhiwen; Li, Fuguang

    2012-01-01

    We have sequenced and assembled a draft genome of G. raimondii, whose progenitor is the putative contributor of the D subgenome to the economically important fiber-producing cotton species Gossypium hirsutum and Gossypium barbadense. Over 73% of the assembled sequences were anchored on 13 G. raim...

  9. Phosphorus use efficiency in pima cotton (Gossypium barbadense L. genotypes

    Directory of Open Access Journals (Sweden)

    Elcio Santos

    2015-06-01

    Full Text Available In the Brazilian Cerrado, P deficiency restricts cotton production, which requires large amounts of phosphate fertilizer. To improve the yield of cotton crops, genotypes with high P use efficiency must be identified and used. The present study evaluated P uptake and use efficiency of different Gossypium barbadense L. genotypes grown in the Cerrado. The experiment was carried out in a greenhouse with a completely randomized design, 15 x 2 factorial treatment structure (15 genotypes x 2 P levels, and four replicates. The genotypes were MT 69, MT 70, MT 87, MT 91, MT 92, MT 94, MT 101, MT 102, MT 103, MT 105, MT 106, MT 110, MT 112, MT 124, and MT 125; P levels were sufficient (1000 mg pot-1, PS treatment or deficient (PD treatment. Dry matter (DM and P levels were determined in cotton plant parts and used to calculate plant P content and use efficiency. In general, DM and P content were higher in the PS than in the PD treatment, with the exception of root DM and total DM in some genotypes. Genotypes also differed in terms of P uptake and use capacity. In the PS treatment, genotypes MT 92 and MT 102 had the highest response to phosphate fertilization. Genotype MT 69 exhibited the most efficient P uptake in the PD treatment. Genotype MT 124 showed the best shoot physiological efficiency, apparent recovery efficiency, and utilization efficiency, whereas MT 110 exhibited the highest root physiological efficiency.

  10. Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F

    2006-01-01

    Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.

  11. Utilization of bio-waste cotton ( Gossypium hirsutum L.) stalks and ...

    African Journals Online (AJOL)

    ... three-layer particleboard containing different cotton (Gossypium hirsutum L.) stalks and underutilized paulownia (paulownia fortunie) wood particle ratios (30, 50 and 70%) using urea formaldehyde resin. Addition of cotton stalk and paulownia wood in particleboard improved mechanical properties of resulting composites ...

  12. Comparative transmission genetics of introgressed chromatin in Gossypium (cotton) polyploids.

    Science.gov (United States)

    Waghmare, Vijay N; Rong, Junkang; Rogers, Carl J; Bowers, John E; Chee, Peng W; Gannaway, John R; Katageri, Ishwarappa; Paterson, Andrew H

    2016-04-01

    Introgression is widely acknowledged as a potential source of valuable genetic variation, and growing effort is being invested in analysis of interspecific crosses conferring transgressive variation. Experimental backcross populations provide an opportunity to study transmission genetics following interspecific hybridization, identifying opportunities and constraints to introgressive crop improvement. The evolutionary consequences of introgression have been addressed at the theoretical level, however, issues related to levels and patterns of introgression among (plant) species remain inadequately explored, including such factors as polyploidization, subgenome interaction inhabiting a common nucleus, and the genomic distribution and linkage relationships of introgressant alleles. We analyze introgression into the polyploid Gossypium hirsutum (upland cotton) from its sister G. tomentosum and compare the level and pattern with that of G. barbadense representing a different clade tracing to the same polyploidization. Across the genome, recurrent backcrossing to Gossypium hirsutum yielded only one-third of the expected average frequency of the G. tomentosum allele, although one unusual region showed preferential introgression. Although a similar rate of introgression is found in the two subgenomes of polyploid (AtDt) G. hirsutum, a preponderance of multilocus interactions were largely within the Dt subgenome. Skewed G. tomentosum chromatin transmission is polymorphic among two elite G. hirsutum genotypes, which suggests that genetic background may profoundly affect introgression of particular chromosomal regions. Only limited correspondence is found between G. hirsutum chromosomal regions that are intolerant to introgression from the two species, G. barbadense and G. tomentosum, concentrated near possible inversion polymorphisms. Complex transmission of introgressed chromatin highlights the challenges to utilization of exotic germplasm in crop improvement. © 2016

  13. Genome-wide analysis of the MADS-box gene family in polyploid cotton (Gossypium hirsutum) and in its diploid parental species (Gossypium arboreum and Gossypium raimondii).

    Science.gov (United States)

    Nardeli, Sarah Muniz; Artico, Sinara; Aoyagi, Gustavo Mitsunori; de Moura, Stéfanie Menezes; da Franca Silva, Tatiane; Grossi-de-Sa, Maria Fatima; Romanel, Elisson; Alves-Ferreira, Marcio

    2018-06-01

    The MADS-box gene family encodes transcription factors that share a highly conserved domain known to bind to DNA. Members of this family control various processes of development in plants, from root formation to fruit ripening. In this work, a survey of diploid (Gossypium raimondii and Gossypium arboreum) and tetraploid (Gossypium hirsutum) cotton genomes found a total of 147, 133 and 207 MADS-box genes, respectively, distributed in the MIKC, Mα, Mβ, Mγ, and Mδ subclades. A comparative phylogenetic analysis among cotton species, Arabidopsis, poplar and grapevine MADS-box homologous genes allowed us to evaluate the evolution of each MADS-box lineage in cotton plants and identify sequences within well-established subfamilies. Chromosomal localization and phylogenetic analysis revealed that G. raimondii and G. arboreum showed a conserved evolution of the MIKC subclade and a distinct pattern of duplication events in the Mα, Mγ and Mδ subclades. Additionally, G. hirsutum showed a combination of its parental subgenomes followed by a distinct evolutionary history including gene gain and loss in each subclade. qPCR analysis revealed the expression patterns of putative homologs in the AP1, AP3, AGL6, SEP4, AGL15, AG, AGL17, TM8, SVP, SOC and TT16 subfamilies of G. hirsutum. The identification of putative cotton orthologs is discussed in the light of evolution and gene expression data from other plants. This analysis of the MADS-box genes in Gossypium species opens an avenue to understanding the origin and evolution of each gene subfamily within diploid and polyploid species and paves the way for functional studies in cotton species. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  14. Effects of rotation of cotton (Gossypium hirsutum L.) and soybean [Glycine max (L.) Merr.] crops on soil fertility in Elizabeth, Mississippi, USA

    OpenAIRE

    H.A., Reddy, K. and Pettigrew, W.T.

    2018-01-01

    The effects of cotton (Gossypium hirsutum L.): soybean [Glycine max (L.) Merr.] rotation on the soil fertility levels are limited. An irrigated soybean: cotton rotation experiment was conducted from 2012 through 2015 near Elizabeth, Mississippi, USA. The crop rotation sequences were included continuous cotton (CCCC), continuous soybean (SSSS), cotton-soybean-cotton-soybean (CSCS), cotton-soybean-soybean-cotton (CSSC), soybean-cotton-cotton-soybean (SCCS), soybean-cotton-soybean-cotton (SCSC)....

  15. Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance

    International Nuclear Information System (INIS)

    Abro, S.; Khan, M.A.; Sial, M.A.

    2015-01-01

    Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)

  16. Analyses of Fusarium wilt race 3 resistance in Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Abdullaev, Alisher A; Salakhutdinov, Ilkhom B; Egamberdiev, Sharof Sh; Kuryazov, Zarif; Glukhova, Ludmila A; Adilova, Azoda T; Rizaeva, Sofiya M; Ulloa, Mauricio; Abdurakhmonov, Ibrokhim Y

    2015-06-01

    Fusarium wilt [Fusarium oxysporum f.sp. vasinfectum (FOV) Atk. Sny & Hans] represents a serious threat to cotton (Gossypium spp.) production. For the last few decades, the FOV pathogen has become a significant problem in Uzbekistan causing severe wilt disease and yield losses of G. hirsutum L. cultivars. We present the first genetic analyses of FOV race 3 resistance on Uzbek Cotton Germplasm with a series of field and greenhouse artificial inoculation-evaluations and inheritance studies. The field experiments were conducted in two different sites: the experimental station in Zangiota region-Environment (Env) 1 and the Institute of Cotton Breeding (Env-2, Tashkent province). The Env-1 was known to be free of FOV while the Env-2 was known to be a heavily FOV infested soil. In both (Env-1 and Env-2) of these sites, field soil was inoculated with FOV race 3. F2 and an F3 Upland populations ("Mebane B1" × "11970") were observed with a large phenotypic variance for plant survival and FOV disease severity within populations and among control or check Upland accessions. Wilt symptoms among studied F2 individuals and F3 families significantly differed depending on test type and evaluation site. Distribution of Mendelian rations of susceptible (S) and resistant (R) phenotypes were 1S:1R field Env-1 and 3S:1R field Env-2 in the F2 population, and 1S:3R greenhouse site in the F3 population. The different segregation distribution of the Uzbek populations may be explained by differences in FOV inoculum level and environmental conditions during assays. However, genetic analysis indicated a recessive single gene action under high inoculum levels or disease pressure for FOV race 3 resistance. Uzbek germplasm may be more susceptible than expected to FOV race 3, and sources of resistance to FOV may be limited under the FOV inoculum levels present in highly-infested fields making the breeding process more complex.

  17. Genotype and planting density effects on rooting traits and yield in cotton (Gossypium hirsutum L.)

    NARCIS (Netherlands)

    Zhang, L.Z.; Li, B.G.; Yan, G.T.; Werf, van der W.; Spiertz, J.H.J.; Zhang, S.P.

    2006-01-01

    Root density distribution of plants is a major indicator of competition between plants and determines resource capture from the soil. This experiment was conducted in 2005 at Anyang, located in the Yellow River region, Henan Province, China. Three cotton (Gossypium hirsutum L.) cultivars were

  18. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres

    Science.gov (United States)

    Emergent phenotypes are common in polyploids relative to their diploid progenitors, a phenomenon exemplified by spinnable cotton fibers. Following 15-18 fold paleopolyploidy, allopolyploidy 1-2 million years ago reunited divergent Gossypium genomes, imparting new combinatorial complexity that might ...

  19. Genetic transformation of cry1EC gene into cotton ( Gossypium ...

    African Journals Online (AJOL)

    Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...

  20. GhNAC18 , a novel cotton ( Gossypium hirsutum L.) NAC gene, is ...

    African Journals Online (AJOL)

    GhNAC18 is a novel NAC gene that was isolated from cotton (Gossypium hirsutum L.). The full-length cDNA was 1511 bp including an open reading frame of 1260 bp in length and encodes a protein of 419 amino acids. With qRT-PCR analysis, GhNAC18 was downregulated during natural and dark-induced senescence, ...

  1. Problems and achievements of cotton (Gossypium Hirsutum L. weeds control

    Directory of Open Access Journals (Sweden)

    T. Barakova

    2017-09-01

    Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.

  2. Rapid diversification of the cotton genus (Gossypium: Malvaceae) revealed by analysis of sixteen nuclear and chloroplast genes.

    Science.gov (United States)

    Richard C. Cronn; Randall L. Small; Tamara Hanselkorn; Jonathan F. Wendel

    2002-01-01

    Previous molecular phylogenetic studies have failed to resolve the branching order among the major cotton (Gossypium) lineages, and it has been unclear whether this reflects actual history (rapid radiation) or sampling properties of the genes evaluated. In this paper, we reconsider the phylogenetic relationships of diploid cotton genome groups using DNA sequences from...

  3. Effect of nitrates on embryo induction efficiency in cotton (Gossypium ...

    African Journals Online (AJOL)

    Fred

    cotton species (Zhang, 1994b). Somatic embryogenesis and plant regeneration systems have been established from cotton tissue, protoplasts and ovules (Zhang and Li,. 1992; Feng and Zhang, 1994; Zhang, 1995). Regeneration procedures have been used to obtain genetically modified plants after Agrobacterium- ...

  4. Sequencing of a Cultivated Diploid Cotton Genome-Gossypium arboreum

    Institute of Scientific and Technical Information of China (English)

    WILKINS; Thea; A

    2008-01-01

    Sequencing the genomes of crop species and model systems contributes significantly to our understanding of the organization,structure and function of plant genomes.In a `white paper' published in 2007,the cotton community set forth a strategic plan for sequencing the AD genome of cultivated upland cotton that initially targets less complex diploid genomes.This strategy banks on the high degree

  5. Polyploidization altered gene functions in cotton (Gossypium spp.)

    Science.gov (United States)

    Cotton fibers are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that a large set of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across the At and ...

  6. Correlations and Correlated Responses in Upland Cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Echekwu, CA.

    2001-01-01

    Full Text Available Plant breeders must be concerned with the total array of economic characters in their efforts to develop a crop variety acceptable to farmers. Their selection endeavours must therefore take into consideration how changes in one trait affect, simultaneously changes in other economic attributes. The importance of correlations and correlated responses is therefore self evident in plant breeding endeavours. In this study F3 progenies from a cross between two cotton lines SAMCOT-9 x Y422 were evaluated for two years and performance data were used to obtain correlations between nine agronomic and fibre quality traits in upland cotton. The results indicated that plant helght was significantly and positively correlated with seed cotton yield, number of sympodial and monopodial branches, seed index, fibre length and micronaire index. Positive and significant correlations were also obtained between : seed cotton yield, tint percent and fibre strength and fibre length. Significant negative correlations were obtained between : plant height and lint percent ; number of monopodial branches, sympodial branches and lint percent ; fibre length, fibre strength and micronaire index. The correlated responses in the other eight traits when selection was practiced for seed cotton yield in the present study shows that it might be more profitable to practice direct selection for seed cotton yield compared to selecting for seed cotton yield through any of the other traits.

  7. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    Science.gov (United States)

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

  8. Asymmetric evolution and domestication in allotetraploid cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Lei Fang

    2017-04-01

    Full Text Available Polyploidy plays a major role in genome evolution, which corresponds to environmental changes over millions of years. The mechanisms of genome evolution, particularly during the process of domestication, are of broad interest in the fields of plant science and crop breeding. Upland cotton is derived from the hybridization and polyploidization of its ancient A and D diploid ancestors. As a result, cotton is a model for polyploid genome evolution and crop domestication. To explore the genomic mysteries of allopolyploid cotton, we investigated asymmetric evolution and domestication in the A and D subgenomes. Interestingly, more structural rearrangements have been characterized in the A subgenome than in the D subgenome. Correspondingly, more transposable elements, a greater number of lost and disrupted genes, and faster evolution have been identified in the A subgenome. In contrast, the centromeric retroelement (RT-domain related sequence of tetraploid cotton derived from the D subgenome progenitor was found to have invaded the A subgenome centromeres after allotetrapolyploid formation. Although there is no genome-wide expression bias between the subgenomes, as with expression-level alterations, gene expression bias of homoeologous gene pairs is widespread and varies from tissue to tissue. Further, there are more positively selected genes for fiber yield and quality in the A subgenome and more for stress tolerance in the D subgenome, indicating asymmetric domestication. This review highlights the asymmetric subgenomic evolution and domestication of allotetraploid cotton, providing valuable genomic resources for cotton research and enhancing our understanding of the basis of many other allopolyploids.

  9. Methylation-sensitive amplified polymorphism analysis of Verticillium wilt-stressed cotton (Gossypium).

    Science.gov (United States)

    Wang, W; Zhang, M; Chen, H D; Cai, X X; Xu, M L; Lei, K Y; Niu, J H; Deng, L; Liu, J; Ge, Z J; Yu, S X; Wang, B H

    2016-10-06

    In this study, a methylation-sensitive amplification polymorphism analysis system was used to analyze DNA methylation level in three cotton accessions. Two disease-sensitive near-isogenic lines, PD94042 and IL41, and one disease-resistant Gossypium mustelinum accession were exposed to Verticillium wilt, to investigate molecular disease resistance mechanisms in cotton. We observed multiple different DNA methylation types across the three accessions following Verticillium wilt exposure. These included hypomethylation, hypermethylation, and other patterns. In general, the global DNA methylation level was significantly increased in the disease-resistant accession G. mustelinum following disease exposure. In contrast, there was no significant difference in the disease-sensitive accession PD94042, and a significant decrease was observed in IL41. Our results suggest that disease-resistant cotton might employ a mechanism to increase methylation level in response to disease stress. The differing methylation patterns, together with the increase in global DNA methylation level, might play important roles in tolerance to Verticillium wilt in cotton. Through cloning and analysis of differently methylated DNA sequences, we were also able to identify several genes that may contribute to disease resistance in cotton. Our results revealed the effect of DNA methylation on cotton disease resistance, and also identified genes that played important roles, which may shed light on the future cotton disease-resistant molecular breeding.

  10. Critical osmotic, ionic and physiological indicators of salinity tolerance in cotton (gossypium hirsutum l.) for cultivar selection

    International Nuclear Information System (INIS)

    Munis, M.F.H.; Tu, L.; Ziaf, K; Tan, J.; Deng, F.; Zhang, X.

    2010-01-01

    Salinity affects the germination, growth and ultimately the yield of cotton (Gossypium hirsutum L.) which demands reliable traits for the evaluation and selection of salt tolerant cultivars. Here, ten major osmotic, ionic and physiological parameters have been studied to distinguish the effect of salinity in two different cultivars of cotton. Plants were grown in hydroponic system and exposed to different salinity levels of NaCl followed by its recovery under non saline conditions. Data was recorded at three different stages i.e., before stress, after stress and after recovery for comparative study. Recovery assay proved to be very helpful in extracting reliable results. Both cultivars showed significantly different response to Na+ and K+ accumulation and phenotypically salt tolerant cultivar (Coker 312) accumulated less Na+ and more K+ in comparison with susceptible (Simian 3). Decrease in leaf area, seed germination and seedling growth were also conclusive to differentiate these cultivars. We also found other physiological parameters like relative leaf water content (RLWC), plant fresh-weight (PFW), plant dry-weight (PDW), relative growth rate (RGR) and stomatal behavior as good indicators of salinity but could not find their significant role to differentiate two closely relevant cultivars regarding salinity tolerance. Our studies revealed that proline accumulation and chlorophyll concentration are not significant to be used as accurate indicators to characterize the sensitivity of cotton cultivars to salinity. We found post-recovery analysis to be very useful in understanding the role and behavior of different indicators of salinity. (author)

  11. Gene expression in response to Cotton Leaf Curl Virus infection in Gossypium hirsutum under variable environmental conditions

    Directory of Open Access Journals (Sweden)

    Rehman Iqra

    2017-01-01

    Full Text Available Cotton Leaf Curl Disease (CLCuD is one of the threatening constrains of cotton production in Pakistan for which no adequate remedy is available until now. Local variety of Gossypium hirsutum (FH-142 was grown in field and infected naturally by CLCuV under variable range of temperature and humidity. Plants showed thickening of veins in lower leaf surface at 34°C and 60% relative humidity at 15days post infection (dpi and curling of leaf margins at 33°C with 58% relative humidity at 30dpi. Remarkable leaf darkening was observed with reduced boll formation at 45dpi at 26°C and 41% relative humidity. Enation developed, severe thickening and curling of leaves intensified and plants showed dwarf growth at 60dpi at 24°C with 52% relative humidity. PCR amplification of Rep associated gene confirmed the presence of CLCuD-associated begomovirus in the infected samples. Quantitative RT-PCR confirmed the amplification and differential expression of a number of pathogen stress responsive genes at different levels of temperature and humidity. This observation predicts that Cotton Leaf Curl Virus (CLCuV interacts with several host genes that are upregulated to make plants susceptible or suppress other genes to overcome host defense responses.

  12. APPLICATION OF DRIP IRRIGATION ON COTTON PLANT GROWTH (Gossypium sp.

    Directory of Open Access Journals (Sweden)

    Syahruni Thamrin

    2017-12-01

    Full Text Available The condition of cotton planting in South Sulawesi is always constrained in the fulfillment of water. All plant growth stages are not optimal to increase production, so it is necessary to introduce good water management technology, such as through water supply with drip irrigation system. This study aims to analyze the strategy of irrigation management in cotton plants using drip irrigation system. Model of application by designing drip irrigation system and cotton planting on land prepared as demonstration plot. Observations were made in the germination phase and the vegetative phase of the early plants. Based on the result of drip irrigation design, the emitter droplet rate (EDR was 34.266 mm/hour with an operational time of 4.08 min/day. From the observation of cotton growth, it is known that germination time lasted from 6 to 13 days after planting, the average plant height reached 119.66 cm, with the number of leaves averaging 141.93 pieces and the number of bolls averaging 57.16 boll.

  13. Identification of exotic genetic components and DNA methylation pattern analysis of three cotton introgression lines from Gossypium bickii.

    Science.gov (United States)

    He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming

    2011-01-01

    The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.

  14. Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

    2014-11-06

    Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved

  15. Response of Cotton (Gossypium Hirsutum L.) to Nitrogen Phosphorous Fertilizers in Western Kenya

    International Nuclear Information System (INIS)

    Kouko, W.O; Owino, G.

    1999-01-01

    The requirements for nitrogen and phosphorous fertilizers for growing cotton (Gossypium hirsutum L.) in Kenya are 26-kg N ha - 1 and 27 kg P ha - 1, respectively. Calcium ammonium nitrate (CAN) was recommended at the rate of 100 kg ha - 1 for black cotton soils while double superphosphate (DSP) was recommended at the rate of 150 kg ha - 1 on reddish brown clays. However, experiments conducted on a major soil types on which cotton is grown in Kenya showed that, soil colour is not the best indicator of nutrients supply power of the soil. It was found that Verto-eutric planosols of National Fibre Research Centres-Kibos requires application of 13-kg ha - 1 as CAN for optimal yields. Ferralo-eurtric Acrisols of Alupe Agricultural Research Sub-Centre, Busia needed 26-kg N ha - 1 and 9 kg P ha - 1 to give high yields. At Siaya FTC 9 kg P ha - 1 was adequate in providing the highest yields without nitrogen. Strict observation of recommended agronomic practices for growing cotton and good soil management practices for growing cotton and good soil management practices were observed a prerequisite for high response and efficient utilisation of fertilizers

  16. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

    Science.gov (United States)

    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

    2015-05-01

    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  17. Exp2 polymorphisms associated with variation for fiber quality properties in cotton (Gossypium spp.

    Directory of Open Access Journals (Sweden)

    Daohua He

    2014-10-01

    Full Text Available Plant expansins are a group of extracellular proteins thought to affect the quality of cotton fibers. Previous expression profile analysis revealed that six Expansin A genes are present in cotton, of which two (GhExp1 and GhExp2 produce transcripts that are specific to the developing cotton fiber. To identify the phenotypic function of Exp2, and to determine whether nucleotide variation among alleles of Exp2 affects fiber quality, candidate gene association mapping was conducted. Gene-specific primers were designed to amplify the Exp2 gene. By amplicon sequencing, the nucleotide diversity of Exp2 was investigated across 92 accessions (including 7 Gossypium arboreum, 74 Gossypium hirsutum, and 11 Gossypium barbadense accessions with different fiber qualities. Twenty-six SNPs and seven InDels including 14 from the coding region of Exp2 were detected, forming twelve distinct haplotypes in the cotton collection. Among the 14 SNPs in the coding region, five were missense mutations and nine were synonymous nucleotide changes. The average SNP/InDel per nucleotide ratio was 2.61% (one SNP per 39 bp, with 1.81 and 3.87% occurring in coding and non-coding regions, respectively. Nucleotide and haplotype diversity across the entire Exp2 region was 0.00603 (π and 0.844, respectively, and diversity in non-coding regions was higher than that in coding regions. For linkage disequilibrium (LD, the mean r2 value for all polymorphism loci pairs was 0.48, and LD did not decay over 748 bp. Based on 132 simple sequence repeat (SSR loci evenly covering 26 chromosomes, the population structure was estimated, and the accessions were divided into seven groups that agreed well with their genomic origin and evolutionary history. A general linear model was used to calculate the Exp2-wide diversity–trait associations of 5 fiber quality traits, considering population structure (Q. Four SNPs in Exp2 were associated with at least one of the fiber quality traits, but not with

  18. Selectivity and stability of vegetation-applied herbicides in cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    T. Barakova

    2016-06-01

    Full Text Available Abstract. An experiment was carried out during 2013 – 2015 in the experimental field of the Field Crops Institute, Chirpan, with two cotton cultivars − Helius and Darmi (Gossypium hirsutum L.. Herbicides: Goal 2 E, oxyfluorfen (80 ml/da; Linuron 45 SC, linuron (200 ml/da; Wing-P, pendimethalin + dimethenamid (400 ml/da; Merlin 750 WG, isoxaflutol (5 g/da; Bazagran 480 SL, bentazone (150 ml/da were investigated. They were treated separately or combined with growth regulator Amalgerol (500 ml/da or foliar fertilizer Lactofol O (500 ml/da in the budding stage of the cotton. It was established that selectivity is the lowest in the two cotton cultivars with herbicides Linuron 45 CK and Merlin 750 WG. The purpose of this investigation was to establish the selectivity and stability of some herbicides and their tank mixtures on the cotton by influence of different meteorological conditions. It has been found that the highest phytotoxicity on cotton is given the vegetation-applied herbicides Merlin and Linuron. Foliar fertilizer Laktofol O reduces phytotoxicity of herbicides Goal, Wing, Merlin and Bazagran in two cotton cultivars. Herbicides Wing and Bazagran have excellent selectivity for the two cotton cultivars – Helius and Darmi. The highest yield was obtained by vegetation treatment with herbicide Bazagran, followed by herbicides Wing and Goal. Tank mixtures of Goal, Bazagran and Wing with Laktofol, followed by those with Amalgerol are technologically the most valuable. They combine high yield with high stability over the years. Аlone application of herbicides Linuron and Merlin and their tank mixtures with Amalgerol and Laktofol have low estimate.

  19. Phylogeny of the New World diploid cottons (Gossypium L., Malvaceae) based on sequences of three low-copy nuclear genes.

    Science.gov (United States)

    I. Alvarez; R. Cronn; J.F. Wendel

    2005-01-01

    American diploid cottons (Gossypium L., subgenus Houzingenia Fryxell) form a monophyletic group of 13 species distributed mainly in western Mexico, extending into Arizona, Baja California, and with one disjunct species each in the Galapagos Islands and Peru. Prior phylogenetic analyses based on an alcohol dehydrogenase gene (...

  20. Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.

    Science.gov (United States)

    Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F

    2013-10-01

    Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  1. Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

    Science.gov (United States)

    Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

    2018-01-05

    Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Spatial and temporal variation in fungal endophyte communities isolated from cultivated cotton (Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    María J Ek-Ramos

    Full Text Available Studies of fungi in upland cotton (Gossypium hirsutum cultivated in the United States have largely focused on monitoring and controlling plant pathogens. Given increasing interest in asymptomatic fungal endophytes as potential biological control agents, surveys are needed to better characterize their diversity, distribution patterns and possible applications in integrated pest management. We sampled multiple varieties of cotton in Texas, USA and tested for temporal and spatial variation in fungal endophyte diversity and community composition, as well as for differences associated with organic and conventional farming practices. Fungal isolates were identified by morphological and DNA identification methods. We found members of the genera Alternaria, Colletotrichum and Phomopsis, previously isolated as endophytes from other plant species. Other recovered species such as Drechslerella dactyloides (formerly Arthrobotrys dactyloides and Exserohilum rostratum have not, to our knowledge, been previously reported as endophytes in cotton. We also isolated many latent pathogens, but some species such as Alternaria tennuissima, Epicoccum nigrum, Acremonium alternatum, Cladosporium cladosporioides, Chaetomium globosum and Paecilomyces sp., are known to be antagonists against plant pathogens, insects and nematode pests. We found no differences in endophyte species richness or diversity among different cotton varieties, but did detect differences over time and in different plant tissues. No consistent patterns of community similarity associated with variety, region, farming practice, time of the season or tissue type were observed regardless of the ecological community similarity measurements used. Results indicated that local fungal endophyte communities may be affected by both time of the year and plant tissue, but the specific community composition varies across sites. In addition to providing insights into fungal endophyte community structure, our survey

  3. Proteomics profiling of fiber development and domestication in upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Pathak, Dharminder; Chen, Sixue; Wendel, Jonathan F

    2014-12-01

    Comparative proteomic analyses were performed to detail the evolutionary consequences of strong directional selection for enhanced fiber traits in modern upland cotton (Gossypium hirsutum L.). Using two complementary proteomic approaches, 2-DE and iTRAQ LC-MS/MS, fiber proteomes were examined for four representative stages of fiber development. Approximately 1,000 protein features were characterized using each strategy, collectively resulting in the identification and functional categorization of 1,223 proteins. Unequal contributions of homoeologous proteins were detected for over a third of the fiber proteome, but overall expression was balanced with respect to the genome-of-origin in the allopolyploid G. hirsutum. About 30% of the proteins were differentially expressed during fiber development within wild and domesticated cotton. Notably, domestication was accompanied by a doubling of protein developmental dynamics for the period between 10 and 20 days following pollination. Expression levels of 240 iTRAQ proteins and 293 2-DE spots were altered by domestication, collectively representing multiple cellular and metabolic processes, including metabolism, energy, protein synthesis and destination, defense and stress response. Analyses of homoeolog-specific expression indicate that duplicated gene products in cotton fibers can be differently regulated in response to selection. These results demonstrate the power of proteomics for the analysis of crop domestication and phenotypic evolution.

  4. MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    He, Qiuling; Zhu, Shuijin; Zhang, Baohong

    2014-09-01

    MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.

  5. Genetic diversity of sea-island cotton (Gossypium barbadense) revealed by mapped SSRs.

    Science.gov (United States)

    Wang, X Q; Feng, C H; Lin, Z X; Zhang, X L

    2011-12-08

    In order to evaluate the genetic diversity of sea-island cotton (Gossypium barbadense), 237 commonly mapped SSR markers covering the cotton genome were used to genotype 56 sea-island cotton accessions. A total of 218 polymorphic primer pairs (91.98%) amplified 361 loci, with a mean of 1.66 loci. Polymorphism information content values of the SSR primers ranged from 0.035 to 0.862, with a mean of 0.320. The highest mean polymorphism information content value for the SSR motifs was from a compound motif (0.402), and for the chromosomes it was Chr10 (0.589); the highest ratio of polymorphic primers in Xinjiang accessions was from Chr21 (83.33%). Genetic diversity was high in Xinjiang accessions. AMOVA showed that variation was 8 and 92% among populations and within populations, respectively. The 56 sea-island accessions were divided into three groups in the UPGMA dendrogram: Xinhai5 was in the first group; accessions from Xinjiang, except the five main ones, were in the second group, and the other 34 accessions were in the third group. Accessions from the former Soviet Union and Xinjiang main accessions were closely related. Both PCA and UPGMA confirmed that Xinhai5 was distinct from the other accessions, and accessions from Xinjiang were in an independent group. Given the differences between principal components analysis and UPGMA results, it is necessary to combine molecular markers and pedigree information so that genetic diversity can be objectively analyzed.

  6. Study on the Mitochondrial Genome of Sea Island Cotton (Gossypium barbadense) by BAC Library Screening

    Institute of Scientific and Technical Information of China (English)

    SU Ai-guo; LI Shuang-shuang; LIU Guo-zheng; LEI Bin-bin; KANG Ding-ming; LI Zhao-hu; MA Zhi-ying; HUA Jin-ping

    2014-01-01

    The plant mitochondrial genome displays complex features, particularly in terms of cytoplasmic male sterility (CMS). Therefore, research on the cotton mitochondrial genome may provide important information for analyzing genome evolution and exploring the molecular mechanism of CMS. In this paper, we present a preliminary study on the mitochondrial genome of sea island cotton (Gossypium barbadense) based on positive clones from the bacterial artiifcial chromosome (BAC) library. Thirty-ifve primers designed with the conserved sequences of functional genes and exons of mitochondria were used to screen positive clones in the genome library of the sea island cotton variety called Pima 90-53. Ten BAC clones were obtained and veriifed for further study. A contig was obtained based on six overlapping clones and subsequently laid out primarily on the mitochondrial genome. One BAC clone, clone 6 harbored with the inserter of approximate 115 kb mtDNA sequence, in which more than 10 primers fragments could be ampliifed, was sequenced and assembled using the Solexa strategy. Fifteen mitochondrial functional genes were revealed in clone 6 by gene annotation. The characteristics of the syntenic gene/exon of the sequences and RNA editing were preliminarily predicted.

  7. Transcriptome analysis of Gossypium hirsutum flower buds infested by cotton boll weevil (Anthonomus grandis) larvae.

    Science.gov (United States)

    Artico, Sinara; Ribeiro-Alves, Marcelo; Oliveira-Neto, Osmundo Brilhante; de Macedo, Leonardo Lima Pepino; Silveira, Sylvia; Grossi-de-Sa, Maria Fátima; Martinelli, Adriana Pinheiro; Alves-Ferreira, Marcio

    2014-10-04

    Cotton is a major fibre crop grown worldwide that suffers extensive damage from chewing insects, including the cotton boll weevil larvae (Anthonomus grandis). Transcriptome analysis was performed to understand the molecular interactions between Gossypium hirsutum L. and cotton boll weevil larvae. The Illumina HiSeq 2000 platform was used to sequence the transcriptome of cotton flower buds infested with boll weevil larvae. The analysis generated a total of 327,489,418 sequence reads that were aligned to the G. hirsutum reference transcriptome. The total number of expressed genes was over 21,697 per sample with an average length of 1,063 bp. The DEGseq analysis identified 443 differentially expressed genes (DEG) in cotton flower buds infected with boll weevil larvae. Among them, 402 (90.7%) were up-regulated, 41 (9.3%) were down-regulated and 432 (97.5%) were identified as orthologues of A. thaliana genes using Blastx. Mapman analysis of DEG indicated that many genes were involved in the biotic stress response spanning a range of functions, from a gene encoding a receptor-like kinase to genes involved in triggering defensive responses such as MAPK, transcription factors (WRKY and ERF) and signalling by ethylene (ET) and jasmonic acid (JA) hormones. Furthermore, the spatial expression pattern of 32 of the genes responsive to boll weevil larvae feeding was determined by "in situ" qPCR analysis from RNA isolated from two flower structures, the stamen and the carpel, by laser microdissection (LMD). A large number of cotton transcripts were significantly altered upon infestation by larvae. Among the changes in gene expression, we highlighted the transcription of receptors/sensors that recognise chitin or insect oral secretions; the altered regulation of transcripts encoding enzymes related to kinase cascades, transcription factors, Ca2+ influxes, and reactive oxygen species; and the modulation of transcripts encoding enzymes from phytohormone signalling pathways. These

  8. Genetic variation and heritability for cotton seed, fiber and oil traits in gossypium hirsutum

    International Nuclear Information System (INIS)

    Khan, N.U.; Farhatullah; Batool, S.; Makhdoom, K.; Marwat, K.B.; Hassan, G.; Ahmad, W.; Khan, H.U.

    2010-01-01

    The research work pertaining to the study of genetic variability, heritability, genetic gain and correlation for cottonseed, fiber and cottonseed oil % in Gossypium hirsutum cultivars was conducted during 2005 at NWFP Agricultural University Peshawar, Pakistan. Analysis of variance manifested highly significant differences among the genotypes for all the traits except seeds per locule. Genetic potential range of eight cotton cultivars for different parameters was recorded i.e. seeds locule-1 (6.33 to 6.60), seeds boll-1 (26.10 to 28.47), seed index (8.61 to 9.69 g), lint index (5.35 to 6.05 g), lint % (35.17 to 38.13 %), seed cotton yield (1200 to 2450 kg ha/sup -1/) and cottonseed oil % (27.52 to 30.15%). Genetic variances were found almost greater than the environmental variances for all the traits except seeds locule-1 and seed index. High broad sense heritability and selection response were also formulated for seeds boll-1 (0.67, 0.84), seed index (0.77, 0.47 g), lint index (0.96, 0.33 g), lint % (0.96, 1.66 %), seed cotton yield (0.98, 643.16 kg) and cottonseed oil % (0.87, 1.28 %), respectively. Correlation of yield with other traits was found positive for majority of traits except seeds locule-1 and cotton seed oil %. Seed cotton yield is our ultimate goal in growing cotton besides lint %. Highest seed cotton yield was recorded in CIM-499 followed by CIM-473, CIM-496 and CIM-506 and were also found as the second and third top scoring genotypes for seeds per boll, seed index, lint % and cottonseed oil %. Cultivar SLH-279 performed better for lint index, lint % and oil %. This type of correlation is rarely found and ultra desirable by the cotton breeders and a little genetic gain in seed and lint traits, and oil content is a great accomplishment. (author)

  9. Cytomorphological studies in X-ray induced glandless haploids in Gossypium hirsutum L. (cotton)

    Energy Technology Data Exchange (ETDEWEB)

    Mehetre, S.S.; Thombre, M.V. (Mahatma Phule Krishi Vidyapeeth, Rahuri (India))

    1981-08-01

    Six haploid plants were obtained in M/sub 2/ generation of the 25 kr. X-ray irradiated Gossypium hirsutum L. cotton variety H.G. 108. The cytomorphological studies on these plants indicated highly irregular meiosis, giving on an average six bivalents, the range being 0-9. Unequal separation of chromosomes and chromatids at anaphase-1 and II respectively led to formation of abnormal tetrads and pollens with high size variations leading to high pollen sterility. These plants were characterized by miniature stature, shorter stem and internodes, smaller leaves, flowers and stomata with fewer chloroplasts, male and female sterility and halving of chromosomes. The reduction in morphological characters was nearly in the proportion of 1:2 as compared to their diploid counterparts. 31 refs.; 5 tables; 12 figures.

  10. Genetic diversity and structure of elite cotton germplasm (Gossypium hirsutum L.) using genome-wide SNP data.

    Science.gov (United States)

    Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing

    2017-10-01

    Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.

  11. Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton).

    Science.gov (United States)

    Guo, Hui; Wang, Xiyin; Gundlach, Heidrun; Mayer, Klaus F X; Peterson, Daniel G; Scheffler, Brian E; Chee, Peng W; Paterson, Andrew H

    2014-08-01

    Genome duplication is thought to be central to the evolution of morphological complexity, and some polyploids enjoy a variety of capabilities that transgress those of their diploid progenitors. Comparison of genomic sequences from several tetraploid (AtDt) Gossypium species and genotypes with putative diploid A- and D-genome progenitor species revealed that unidirectional DNA exchanges between homeologous chromosomes were the predominant mechanism responsible for allelic differences between the Gossypium tetraploids and their diploid progenitors. Homeologous gene conversion events (HeGCEs) gradually subsided, declining to rates similar to random mutation during radiation of the polyploid into multiple clades and species. Despite occurring in a common nucleus, preservation of HeGCE is asymmetric in the two tetraploid subgenomes. At-to-Dt conversion is far more abundant than the reciprocal, is enriched in heterochromatin, is highly correlated with GC content and transposon distribution, and may silence abundant A-genome-derived retrotransposons. Dt-to-At conversion is abundant in euchromatin and genes, frequently reversing losses of gene function. The long-standing observation that the nonspinnable-fibered D-genome contributes to the superior yield and quality of tetraploid cotton fibers may be explained by accelerated Dt to At conversion during cotton domestication and improvement, increasing dosage of alleles from the spinnable-fibered A-genome. HeGCE may provide an alternative to (rare) reciprocal DNA exchanges between chromosomes in heterochromatin, where genes have approximately five times greater abundance of Dt-to-At conversion than does adjacent intergenic DNA. Spanning exon-to-gene-sized regions, HeGCE is a natural noninvasive means of gene transfer with the precision of transformation, potentially important in genetic improvement of many crop plants. Copyright © 2014 by the Genetics Society of America.

  12. Simple Sequence Repeat (SSR Genetic Linkage Map of D Genome Diploid Cotton Derived from an Interspecific Cross between Gossypium davidsonii and Gossypium klotzschianum

    Directory of Open Access Journals (Sweden)

    Joy Nyangasi Kirungu

    2018-01-01

    Full Text Available The challenge in tetraploid cotton cultivars is the narrow genetic base and therefore, the bottleneck is how to obtain interspecific hybrids and introduce the germplasm directly from wild cotton to elite cultivars. Construction of genetic maps has provided insight into understanding the genome structure, interrelationships between organisms in relation to evolution, and discovery of genes that carry important agronomic traits in plants. In this study, we generated an interspecific hybrid between two wild diploid cottons, Gossypium davidsonii and Gossypium klotzschianum, and genotyped 188 F2:3 populations in order to develop a genetic map. We screened 12,560 SWU Simple Sequence Repeat (SSR primers and obtained 1000 polymorphic markers which accounted for only 8%. A total of 928 polymorphic primers were successfully scored and only 728 were effectively linked across the 13 chromosomes, but with an asymmetrical distribution. The map length was 1480.23 cM, with an average length of 2.182 cM between adjacent markers. A high percentage of the markers on the map developed, and for the physical map of G. raimondii, exhibited highly significant collinearity, with two types of duplication. High level of segregation distortion was observed. A total of 27 key genes were identified with diverse roles in plant hormone signaling, development, and defense reactions. The achievement of developing the F2:3 population and its genetic map constructions may be a landmark in establishing a new tool for the genetic improvement of cultivars from wild plants in cotton. Our map had an increased recombination length compared to other maps developed from other D genome cotton species.

  13. Gene expression in developing fibres of Upland cotton (Gossypium hirsutum L.) was massively altered by domestication.

    Science.gov (United States)

    Rapp, Ryan A; Haigler, Candace H; Flagel, Lex; Hovav, Ran H; Udall, Joshua A; Wendel, Jonathan F

    2010-11-15

    Understanding the evolutionary genetics of modern crop phenotypes has a dual relevance to evolutionary biology and crop improvement. Modern upland cotton (Gossypium hirsutum L.) was developed following thousands of years of artificial selection from a wild form, G. hirsutum var. yucatanense, which bears a shorter, sparser, layer of single-celled, ovular trichomes ('fibre'). In order to gain an insight into the nature of the developmental genetic transformations that accompanied domestication and crop improvement, we studied the transcriptomes of cotton fibres from wild and domesticated accessions over a developmental time course. Fibre cells were harvested between 2 and 25 days post-anthesis and encompassed the primary and secondary wall synthesis stages. Using amplified messenger RNA and a custom microarray platform designed to interrogate expression for 40,430 genes, we determined global patterns of expression during fibre development. The fibre transcriptome of domesticated cotton is far more dynamic than that of wild cotton, with over twice as many genes being differentially expressed during development (12,626 versus 5273). Remarkably, a total of 9465 genes were diagnosed as differentially expressed between wild and domesticated fibres when summed across five key developmental time points. Human selection during the initial domestication and subsequent crop improvement has resulted in a biased upregulation of components of the transcriptional network that are important for agronomically advanced fibre, especially in the early stages of development. About 15% of the differentially expressed genes in wild versus domesticated cotton fibre have no homology to the genes in databases. We show that artificial selection during crop domestication can radically alter the transcriptional developmental network of even a single-celled structure, affecting nearly a quarter of the genes in the genome. Gene expression during fibre development within accessions and expression

  14. Phenotyping Root System Architecture of Cotton (Gossypium barbadense L. Grown Under Salinity

    Directory of Open Access Journals (Sweden)

    Mottaleb Shady A.

    2017-12-01

    Full Text Available Soil salinity causes an annual deep negative impact to the global agricultural economy. In this study, the effects of salinity on early seedling physiology of two Egyptian cotton (Gossypium barbadense L. cultivars differing in their salinity tolerance were examined. Also the potential use of a low cost mini-rhizotron system to measure variation in root system architecture (RSA traits existing in both cultivars was assessed. Salt tolerant cotton cultivar ‘Giza 90’ produced significantly higher root and shoot biomass, accumulated lower Na+/K+ ratio through a higher Na+ exclusion from both roots and leaves as well as synthesized higher proline contents compared to salt sensitive ‘Giza 45’ cultivar. Measuring RSA in mini-rhizotrons containing solid MS nutrient medium as substrate proved to be more precise and efficient than peat moss/sand mixture. We report superior values of main root growth rate, total root system size, main root length, higher number of lateral roots and average lateral root length in ‘Giza 90’ under salinity. Higher lateral root density and length together with higher root tissue tolerance of Na+ ions in ‘Giza 90’ give it an advantage to be used as donor genotype for desirable root traits to other elite cultivars.

  15. Differential expression of genes regulated in response to drought stress in diploid cotton (Gossypium arboreum) (abstract)

    International Nuclear Information System (INIS)

    Hussain, T.; Majeed, A.; Maqbool, A.; Hussain, S.S.; Ali, T.; Riazuddin, S.

    2005-01-01

    Negative effects on the Water status of plants is one of the most common and deleterious stresses experienced by wild and cultivated plants throughout the World. Our project is designed to identify, clone and characterize gene sequences regulated in response to Water stress (e.g., drought). We used the differential-display reverse transcriptase polymerase chain reaction (DD-RT- PCA) methodology to accomplish our Objectives. Structural and functional characterization of environmental stress-induced genes has contributed to a better understanding of how plants respond and adapt to different abiotic stresses. Differential display was used to compare overall difference in gene expression between draught stressed and unstressed (control) plants of diploid Cotton (Gossypium arboreum). DDRT-PCR product from stressed and unstressed samples resolved side by side on 6% PAGE to compare qualitative and quantitative difference in mRNA expression. A total of 81 primer combinations were tested. DDRT -PCR enabled us to identify differentially expressed transcripts between water stressed and non-stressed cotton seedlings. PAGE revealed a total of 347 DNA transcripts in stressed samples (New Transcripts) while 110 down regulated and 209 up regulated DNA transcripts were also recorded. Similarly. 22 DNA transcripts were identified based on the comparative study of PAGE and Agarose gel electrophoresis. These sequences showed various degree homology With draught tolerant genes in the gene bank. (author)

  16. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali

    2010-12-01

    A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

  17. Effect of ecological management of weed control on economical income, yield and yield components of cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    A. Zare Feizabadi

    2016-04-01

    Full Text Available In order to compare of ecological management of weed control on economical income, yield and yield components of cotton (Gossypium hirsutum L., a Randomized Complete Block design with 12 treatments and four replications was conducted in Mahvelat of Khorasan Razavi province, Iran. Treatments consisted of weeding, harrowing, burning, two times weeding, weeding + harrowing, weeding + burning, harrowing + harrowing, harrowing + weeding, harrowing + burning, weeding+ harrowing+ burning, weed free and weedy as a check treatment. Investigated traits were plant height, number of boll in plant, 20 boll weight, 20 boll cotton lint weight, cotton lint yield per plant, cotton yield, number and biomass of weeds, outcome, net and gross income. The result showed that treatments had significant effect (p

  18. Potassium-phosphorus relationships in cotton (gossypium hirsutum L.) as affected by potassium nutrition

    International Nuclear Information System (INIS)

    Makhdum, M.I.; Ashraf, M.

    2007-01-01

    Field studies were undertaken to determine the interrelationship between potassium (K+) concentration in various organs of plant and phosphorus (P) content as influenced by K-nutrition in cotton. The experiment was conducted on Miani soil series silt loam and classified as Calcaric Cambisols, fine silty, mixed Hyperthermic Fluventic Haplocambids. The treatments consisted .of (a) four cotton (Gossypium hirsutum L.) cultivars (CI.M-448, CIM-IIOO, Karishma, S-12); and (b) four potassium fertilizer doses (0, 62.5, 125.0, 250.0 kg K ha-l). The design of experiment was split plot (main: cultivars, sub-plot: K-doses). The plant samples were collected at five stages of growth, i.e., first flower bud., first flower, peak flowering, first boll split and maturity. The various parts of plants were analyzed for phosphorus and potassium concentration at various stages of growth. Phosphorus concentration in leaves, stems, burs, seed and lint decreased with concurrent increase in K-doses. Crop maintained 0.22% phosphorus concentration in leaf tissues at first flower bud and dropped to 0.11% at maturity. Cultivars differed greatly amongst themselves in terms of maintaining P content in their different parts. Averaged across K-doses, cv. CIM-448 maintained the highest P content in all parts than other cultivars. There was a negative and significant correlation co-efficient between K and P concentration in various parts of the plant. The study demonstrated antagonistic interaction between K+ and P in cotton plant under irrigated conditions. (author)

  19. Genome-wide identification of mitogen-activated protein kinase gene family in Gossypium raimondii and the function of their corresponding orthologs in tetraploid cultivated cotton.

    Science.gov (United States)

    Zhang, Xueying; Wang, Liman; Xu, Xiaoyang; Cai, Caiping; Guo, Wangzhen

    2014-12-10

    Mitogen-activated protein kinase (MAPK) cascades play a crucial role in plant growth and development as well as biotic and abiotic stress responses. Knowledge about the MAPK gene family in cotton is limited, and systematic investigation of MAPK family proteins has not been reported. By performing a bioinformatics homology search, we identified 28 putative MAPK genes in the Gossypium raimondii genome. These MAPK members were anchored onto 11 chromosomes in G. raimondii, with uneven distribution. Phylogenetic analysis showed that the MAPK candidates could be classified into the four known A, B, C and D groups, with more MAPKs containing the TEY phosphorylation site (18 members) than the TDY motif (10 members). Furthermore, 21 cDNA sequences of MAPKs with complete open reading frames (ORFs) were identified in G. hirsutum via PCR-based approaches, including 13 novel MAPKs and eight with homologs reported previously in tetraploid cotton. The expression patterns of 23 MAPK genes reveal their important roles in diverse functions in cotton, in both various developmental stages of vegetative and reproductive growth and in the stress response. Using a reverse genetics approach based on tobacco rattle virus-induced gene silencing (TRV-VIGS), we further verified that MPK9, MPK13 and MPK25 confer resistance to defoliating isolates of Verticillium dahliae in cotton. Silencing of MPK9, MPK13 and MPK25 can significantly enhance cotton susceptibility to this pathogen. This study presents a comprehensive identification of 28 mitogen-activated protein kinase genes in G. raimondii. Their phylogenetic relationships, transcript expression patterns and responses to various stressors were verified. This study provides the first systematic analysis of MAPKs in cotton, improving our understanding of defense responses in general and laying the foundation for future crop improvement using MAPKs.

  20. Effects of Different Densities of Cotton (Gossypium Hirsutum and Common Lambsquarter (Chenopodium Album on Some Cotton Growth Characteristics in Birjand Condition

    Directory of Open Access Journals (Sweden)

    M. Velayati

    2011-01-01

    Full Text Available Abstract Weeds are problematic plants in agroecosystems as a competitor for crops. In order to evaluate effects of cotton (Gossypium hirsutum and common lambsquarter (Chenopodium album densities on some crop growth indices, a study was conducted during 2006 in Experimental Station of Faculty of Agriculture, The University of Birjand as factorial experiment based on complete randomized block design with four replications. Three densities of cotton (6, 9 and 12 Pl.m-2 and four weed densities (0, 6, 9 and 12 Pl.m-2 were used to provide different weed interference levels. Indeed, three plots in each replication were intended to cultivation of lambsquarter alone at 6, 9 or 12 Pl.m-2. Results showed that crop growth rate (CGR of cotton was influenced by weed density, and its relative growth rate (RGR and net assimilation rate (NAR indicated a declining trend as weed density increased. Dry matter accumulation of cotton also was affected negatively by weed densities, as interference of lambsquarter at 6, 9 and 12 Pl.m-2 resulted to 35, 42 and 48 percent dry matter reduction, respectively, than weed-free treatment. Increasing of cotton density could partly compensate for negative impact of weed attendance on cotton growth. Thus, it seems higher plant densities can be used as a managing tool against weeds in cotton fields to avoid reduction of yield. Keywords: Cotton, Density, Weed, competition, Growth analysis

  1. Genotypic variations in photosynthetic and physiological adjustment to potassium deficiency in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Wang, Ning; Hua, Hanbai; Eneji, A Egrinya; Li, Zhaohu; Duan, Liusheng; Tian, Xiaoli

    2012-05-02

    A hydroponic culture experiment was conducted to determine genotypic variation in photosynthetic rate and the associated physiological changes in response to potassium (K) deficiency in cotton (Gossypium hirsutum L.) seedlings with contrasting two cotton cultivars in K efficiency. The K-efficient Liaomian18 produced 66.7% more biomass than the K-inefficient NuCOTN99(B) under K deficiency, despite their similar biomass under K sufficiency. Compared with NuCOTN99(B), Liaomian18 showed 19.4% higher net photosynthetic rate (P(n), per unit leaf area) under K deficient solutions and this was associated with higher photochemical efficiency and faster export of soluble sugars from the phloem. The lower net P(n) of NuCOTN99(B) was attributed to higher capacity for nitrate assimilation and lower export of soluble sugars. Furthermore, NuCOTN99(B) showed 38.4% greater ETR/P(n) than Liaomian18 under K deficiency, indicating that more electrons were driven to other sinks. Higher superoxide dismutase (SOD) and lower catalase (CAT) and ascorbate peroxidase (APX) activities resulted in higher levels of reactive oxygen species (ROS; e.g. O(2)(-)and H(2)O(2)) in NuCOTN99(B) relative to Liaomian18. Thus, the K inefficiency of NuCOTN99(B), indicated by lower biomass and net P(n) under K deficiency, was associated with excessively high nitrogen assimilation, lower export of carbon assimilates, and greater ROS accumulation in the leaf. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  2. Genotypic interactions with potassium nutrition on fruit production in cotton (gossypium hirsutum l.) under irrigated conditions

    International Nuclear Information System (INIS)

    Makhdum, M.I.; Pervez, H.; Ashraf, M.

    2005-01-01

    A field experiment was conducted using four (Gossypium hirsutum l.) cultivars (OM-448, OM-I00, NIAB-Karishma, 5-12) at four rates of potassium (0, 62, 5, 125, 250 kg K ha-1) and with two sources of potassium (K/sub 2/S0/sub 4/, KCI) to determine the effects of potassium (K) fertilizer on fruit production under irrigated conditions. Cultivars differed significantly amongst themselves in production and retention of fruits per unit land area. The cultivars were categorized as OM-448>OM-1100>Karishma>5-12 in order of fruit production. The number of total fruiting positions increased with concurrent levels of K-fertilizer. The shedding of fruit was significantly reduced by application of 250 kg K ha-1 compared to zero K-rate treatment. The addition of K-fertilizer in the form of K/sub 2/S0/sub 4/ showed an edge over KCI in fruit production. A high degree of correlation (r 0.89**,0.91**, -0.8**) was measured between seed cotton yield and number of total fruiting positions, number of intact fruit and fruit shedding percentage respectively. (author)

  3. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

    2013-03-28

    Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

  4. Silicon (Si) alleviates cotton (Gossypium hirsutum L.) from zinc (Zn) toxicity stress by limiting Zn uptake and oxidative damage.

    Science.gov (United States)

    Anwaar, Shad Ali; Ali, Shafaqat; Ali, Skhawat; Ishaque, Wajid; Farid, Mujahid; Farooq, Muhammad Ahsan; Najeeb, Ullah; Abbas, Farhat; Sharif, Muhammad

    2015-03-01

    Silicon (Si) is as an important fertilizer element, which has been found effective in enhancing plant tolerance to variety of biotic and a-biotic stresses. This study investigates the Si potential to alleviate zinc (Zn) toxicity stress in cotton (Gossypium hirsutum L.). Cotton plants were grown in hydroponics and exposed to different Zn concentration, 0, 25, and 50 μM, alone and/or in combination with 1 mM Si. Incremental Zn concentration in growth media instigated the cellular oxidative damage that was evident from elevated levels of hydrogen peroxide (H2O2), electrolyte leakage, and malondialdehyde (MDA) and consequently inhibited cotton growth, biomass, chlorophyll pigments, and photosynthetic process. Application of Si significantly suppressed Zn accumulation in various plant parts, i.e., roots, stems, and leaves and thus promoted biomass, photosynthetic, growth parameters, and antioxidant enzymes activity of Zn-stressed as well unstressed plants. In addition, Si reduced the MDA and H2O2 production and electrolyte leakage suggesting its role in protecting cotton plants from Zn toxicity-induced oxidative damage. Thus, the study indicated that exogenous Si application could improve growth and development of cotton crop experiencing Zn toxicity stress by limiting Zn bioavailability and oxidative damage.

  5. Overexpression of MIC-3 indicates a direct role for the MIC gene family in mediating Upland cotton (Gossypium hirsutum) resistance to root-knot nematode (Meloidogyne incognita)

    Science.gov (United States)

    Major quantitative trait loci (QTL) have been mapped to Upland cotton (Gossypium hirsutum L.) chromosomes 11 and 14 that govern the highly resistant phenotype in response to infection by root-knot nematode (RKN; Meloidogyne incognita Chitwood & White); however, nearly nothing is known regarding the ...

  6. Elevated CO2, warmer temperatures and soil water deficit affect plant growth, physiology and water use of cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    Changes in temperature, atmospheric [CO2] and precipitation under the scenarios of projected climate change present a challenge to crop production, and may have significant impacts on the physiology, growth and yield of cotton (Gossypium hirsutum L.). A glasshouse experiment explored the early growt...

  7. Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species

    Science.gov (United States)

    To Identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode and fungal disease resistance traits, a series of interspecific cotton (Gossypium spp.) chromosome substitution (CS) lines were used in this study. The CS lines were developed in ...

  8. Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

  9. Genetic regulation of salt stress tolerance revealed by RNA-Seq in cotton diploid wild species, Gossypium davidsonii.

    Science.gov (United States)

    Zhang, Feng; Zhu, Guozhong; Du, Lei; Shang, Xiaoguang; Cheng, Chaoze; Yang, Bing; Hu, Yan; Cai, Caiping; Guo, Wangzhen

    2016-02-03

    Cotton is an economically important crop throughout the world, and is a pioneer crop in salt stress tolerance research. Investigation of the genetic regulation of salinity tolerance will provide information for salt stress-resistant breeding. Here, we employed next-generation RNA-Seq technology to elucidate the salt-tolerant mechanisms in cotton using the diploid cotton species Gossypium davidsonii which has superior stress tolerance. A total of 4744 and 5337 differentially expressed genes (DEGs) were found to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation elucidated salt overly sensitive (SOS) and reactive oxygen species (ROS) signaling pathways. Furthermore, we found that photosynthesis pathways and metabolism play important roles in ion homeostasis and oxidation balance. Moreover, our studies revealed that alternative splicing also contributes to salt-stress responses at the posttranscriptional level, implying its functional role in response to salinity stress. This study not only provides a valuable resource for understanding the genetic control of salt stress in cotton, but also lays a substantial foundation for the genetic improvement of crop resistance to salt stress.

  10. Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

    Directory of Open Access Journals (Sweden)

    Changwei Bi

    2016-01-01

    Full Text Available Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants.

  11. Potassium improves photosynthetic tolerance to and recovery from episodic drought stress in functional leaves of cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Zahoor, Rizwan; Zhao, Wenqing; Dong, Haoran; Snider, John L; Abid, Muhammad; Iqbal, Babar; Zhou, Zhiguo

    2017-10-01

    To investigate whether potassium (K) application enhances the potential of cotton (Gossypium hirsutum L.) plants to maintain physiological functions during drought and recovery, low K-sensitive (Siza 3) and -tolerant (Simian 3) cotton cultivars were exposed to three K rates (0, 150, and 300 K 2 O kg ha -1 ) and either well-watered conditions or severe drought stress followed by a recovery period. Under drought stress, cotton plants showed a substantial decline in leaf water potential, stomatal conductance, photosynthetic rate, and the maximum and actual quantum yield of PSII, resulting in greater non-photochemical quenching and lipid peroxidation as compared to well-watered plants. However, plants under K application not only showed less of a decline in these traits but also displayed greater potential to recover after rewatering as compared to the plants without K application. Plants receiving K application showed lower lipid peroxidation, higher antioxidant enzyme activities, and increased proline accumulation as compared to plants without K application. Significant relationships between rates of photosynthetic recovery and K application were observed. The cultivar Siza 3 exhibited a more positive response to K application than Simian 3. The results suggest that K application enhances the cotton plant's potential to maintain functionality under drought and facilitates recovery after rewatering. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  13. Study of gene flow from GM cotton (Gossypium hirsutum) varieties in El Espinal (Tolima, Colombia)

    International Nuclear Information System (INIS)

    Rache Cardenal, Leidy Yanira; Mora Oberlaender, Julian; Chaparro Giraldo, Alejandro

    2013-01-01

    In 2009, 4088 hectares of genetically modified (GM) cotton were planted in Tolima (Colombia), however there is some uncertainty about containment measures needed to prevent the flow of pollen and seed from regulated GM fields into adjacent fields. In this study, the gene flow from GM cotton varieties to conventional or feral cotton plants via seed and pollen was evaluated. ImmunostripTM, PCR and ELISA assays were used to detect gene flow. Fifty six refuges, 27 fields with conventional cotton and four feral individuals of the enterprise Remolinos Inc. located in El Espinal (Tolima) were analyzed in the first half of 2010. The results indicated seed mediated gene flow in 45 refuges (80.4 %) and 26 fields with conventional cotton (96 %), besides pollen mediated gene flow in one field with conventional cotton and nine refuges. All fields cultivated with conventional cotton showed gene flow from GM cotton. Two refuges and two feral individuals did not reveal gene flow from GM cotton.

  14. Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts.

    Science.gov (United States)

    Hulse-Kemp, Amanda M; Ashrafi, Hamid; Zheng, Xiuting; Wang, Fei; Hoegenauer, Kevin A; Maeda, Andrea B V; Yang, S Samuel; Stoffel, Kevin; Matvienko, Marta; Clemons, Kimberly; Udall, Joshua A; Van Deynze, Allen; Jones, Don C; Stelly, David M

    2014-10-30

    Cotton (Gossypium spp.) is the largest producer of natural fibers for textile and is an important crop worldwide. Crop production is comprised primarily of G. hirsutum L., an allotetraploid. However, elite cultivars express very small amounts of variation due to the species monophyletic origin, domestication and further bottlenecks due to selection. Conversely, wild cotton species harbor extensive genetic diversity of prospective utility to improve many beneficial agronomic traits, fiber characteristics, and resistance to disease and drought. Introgression of traits from wild species can provide a natural way to incorporate advantageous traits through breeding to generate higher-producing cotton cultivars and more sustainable production systems. Interspecific introgression efforts by conventional methods are very time-consuming and costly, but can be expedited using marker-assisted selection. Using transcriptome sequencing we have developed the first gene-associated single nucleotide polymorphism (SNP) markers for wild cotton species G. tomentosum, G. mustelinum, G. armourianum and G. longicalyx. Markers were also developed for a secondary cultivated species G. barbadense cv. 3-79. A total of 62,832 non-redundant SNP markers were developed from the five wild species which can be utilized for interspecific germplasm introgression into cultivated G. hirsutum and are directly associated with genes. Over 500 of the G. barbadense markers have been validated by whole-genome radiation hybrid mapping. Overall 1,060 SNPs from the five different species have been screened and shown to produce acceptable genotyping assays. This large set of 62,832 SNPs relative to cultivated G. hirsutum will allow for the first high-density mapping of genes from five wild species that affect traits of interest, including beneficial agronomic and fiber characteristics. Upon mapping, the markers can be utilized for marker-assisted introgression of new germplasm into cultivated cotton and in

  15. The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

    Directory of Open Access Journals (Sweden)

    Muhammad Sajjad Ali

    2013-07-01

    Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

  16. Salt-induced effects on some key morpho-physiological attributes of cotton (Gossypium hirsutum L. at various growth stages

    Directory of Open Access Journals (Sweden)

    Huma Lubna Shaheen and Muhammad Shahbaz

    2012-11-01

    Full Text Available Salinity is a multidimensional stress affecting crop yield and productivity at various levels of plant organization. To assess salt induced adverse effects on cotton (Gossypium hirsutum L., ten cultivars were grown in sand culture supplemented with full strength Hoagland’s nutrients solutions and different salt concentrations (0, 50, 100 and 200 mM NaCl. Salt stress markedly reduced growth attributes, relative water contents, efficiency of photosystem II, net CO2 assimilation rate (A, transpiration rate (E and stomatal conductance in all cultivars. Reduction was maximum at the highest level of salt stress i.e. 200 mM. However, response of cotton cultivars was variable to various levels of salinity and even at various developmental stages. Cultivars RH-510, BH-118 and MNH-770 were ranked as relatively salt tolerant on the basis of their better growth performance and net CO2 assimilation rate whereas cvs. CIM-496, CIM-473 and FH-901 were relatively salt sensitive. Cultivars RH-510, BH-118 and MNH-770 exhibited high shoot fresh and dry weights, photosynthetic rate (A, and Photosystem II (Fv/Fm efficiency at both seedling and maturity growth stages. Results suggest that selection of plants having high photosynthetic rate and biomass at seedling stage may be a good source of high yield at mature stage of growth.

  17. Effects of GhWUS from upland cotton (Gossypium hirsutum L.) on somatic embryogenesis and shoot regeneration.

    Science.gov (United States)

    Xiao, Yanqing; Chen, Yanli; Ding, Yanpeng; Wu, Jie; Wang, Peng; Yu, Ya; Wei, Xi; Wang, Ye; Zhang, Chaojun; Li, Fuguang; Ge, Xiaoyang

    2018-05-01

    The WUSCHEL (WUS) gene encodes a plant-specific homeodomain-containing transcriptional regulator, which plays important roles during embryogenesis, as well as in the formation of shoot and flower meristems. Here, we isolated two homologues of Arabidopsis thaliana WUS (AtWUS), GhWUS1a_At and GhWUS1b_At, from upland cotton (Gossypium hirsutum). Domain analysis suggested that the two putative GhWUS proteins contained a highly conserved DNA-binding HOX domain and a WUS-box. Expression profile analysis showed that GhWUSs were predominantly expressed during the embryoid stage. Ectopic expression of GhWUSs in Arabidopsis could induce somatic embryo and shoot formation from seedling root tips. Furthermore, in the absence of exogenous hormone, overexpression of GhWUSs in Arabidopsis could promote shoot regeneration from excised roots, and in the presence of exogenous auxin, excised roots expressing GhWUS could be induced to produce somatic embryo. In addition, expression of the chimeric GhWUS repressor in cotton callus inhibited embryogenic callus formation. Our results show that GhWUS is an important regulator of somatic embryogenesis and shoot regeneration. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.

    Directory of Open Access Journals (Sweden)

    Yun Chen

    Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

  19. Interference between Redroot Pigweed (Amaranthus retroflexus L.) and Cotton (Gossypium hirsutum L.): Growth Analysis.

    Science.gov (United States)

    Ma, Xiaoyan; Wu, Hanwen; Jiang, Weili; Ma, Yajie; Ma, Yan

    2015-01-01

    Redroot pigweed is one of the injurious agricultural weeds on a worldwide basis. Understanding of its interference impact in crop field will provide useful information for weed control programs. The effects of redroot pigweed on cotton at densities of 0, 0.125, 0.25, 0.5, 1, 2, 4, and 8 plants m(-1) of row were evaluated in field experiments conducted in 2013 and 2014 at Institute of Cotton Research, CAAS in China. Redroot pigweed remained taller and thicker than cotton and heavily shaded cotton throughout the growing season. Both cotton height and stem diameter reduced with increasing redroot pigweed density. Moreover, the interference of redroot pigweed resulted in a delay in cotton maturity especially at the densities of 1 to 8 weed plants m(-1) of row, and cotton boll weight and seed numbers per boll were reduced. The relationship between redroot pigweed density and seed cotton yield was described by the hyperbolic decay regression model, which estimated that a density of 0.20-0.33 weed plant m(-1) of row would result in a 50% seed cotton yield loss from the maximum yield. Redroot pigweed seed production per plant or per square meter was indicated by logarithmic response. At a density of 1 plant m(-1) of cotton row, redroot pigweed produced about 626,000 seeds m(-2). Intraspecific competition resulted in density-dependent effects on weed biomass per plant, a range of 430-2,250 g dry weight by harvest. Redroot pigweed biomass ha(-1) tended to increase with increasing weed density as indicated by a logarithmic response. Fiber quality was not significantly influenced by weed density when analyzed over two years; however, the fiber length uniformity and micronaire were adversely affected at density of 1 weed plant m(-1) of row in 2014. The adverse impact of redroot pigweed on cotton growth and development identified in this study has indicated the need of effective redroot pigweed management.

  20. Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.

    Science.gov (United States)

    Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

    2014-06-01

    Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.

  1. Identification and characterization of microRNAs in Asiatic cotton (Gossypium arboreum L..

    Directory of Open Access Journals (Sweden)

    Min Wang

    Full Text Available To date, no miRNAs have been identified in the important diploid cotton species although there are several reports on miRNAs in upland cotton. In this study, we identified 73 miRNAs, belonging to 49 families, from Asiatic cotton using a well-developed comparative genome-based homologue search. Several of the predicted miRNAs were validated using quantitative real time PCR (qRT-PCR. The length of miRNAs varied from 18 to 22 nt with an average of 20 nt. The length of miRNA precursors also varied from 46 to 684 nt with an average of 138 ±120 nt. For a majority of Asiatic cotton miRNAs, there is only one member per family; however, multiple members were identified for miRNA 156, 414, 837, 838, 1044, 1533, 2902, 2868, 5021 and 5142 families. Nucleotides A and U were dominant, accounted for 62.95%, in the Asiatic cotton pre-miRNAs. The Asiatic cotton pre-miRNAs had high negative minimal folding free energy (MFE and adjusted MFE (AMFE and high MFE index (MFEI. Many miRNAs identified in Asiatic cotton suggest that miRNAs also play a similar regulatory mechanism in diploid cotton.

  2. Evaluation of haemoglobin (erythrogen): for improved somatic embryogenesis and plant regeneration in cotton (Gossypium hirsutum L. cv. SVPR 2).

    Science.gov (United States)

    Ganesan, M; Jayabalan, N

    2004-10-01

    Somatic embryogenesis in cotton (Gossypium hirsutum L.) is accelerated when the plant regeneration medium is supplemented with haemoglobin (erythrogen). In cotton SVPR 2 lines, a higher frequency of embryoid formation was observed when the medium contained 400 mg/l haemoglobin. Fresh weight of the callus, rate of embryoid induction, number of embryoids formed and the percentage of plant regeneration from somatic embryos were increased. Among the two different cultivars tested, MCU 11 showed no response to the presence of haemoglobin when compared to SVPR 2, and embryogenic callus formation was completely absent in the former. Medium containing MS salts, 100 mg/l myo-inositol , 0.3 mg/l thiamine-HCL, 0.3 mg/l Picloram (PIC), 0.1 mg/l kinetin and 400 mg/l haemoglobin effected a better response with respect to embryogenic callus induction. After 8 weeks of culture, a high frequency of embryoid induction was observed on medium containing MS basal salts, 100 mg/l myo-inositol, 0.3 mg/l PIC , 0.1 mg/l isopentenyl adenine, 1.0 g/l NH4NO3 and 400 mg/l haemoglobin. Plant regeneration was observed in 75.8% of the mature somatic embryos, and whole plant regeneration was achieved within 6-7 months of culture. The regenerated plantlets were fertile and similar to in vivo-grown, seed-derived plants except that they were phenotypically smaller. A positive influence of haemoglobin was observed at concentrations up to 400 mg/l at all stages of somatic embryogenesis. The increase in the levels of antioxidant enzyme activities, for example superoxide dismutase and peroxidase, indicated the presence of excess oxygen uptake and the stressed condition of the plant tissues that arose from haemoglobin supplementation. This increased oxygen uptake and haemoglobin-mediated stress appeared to accelerate somatic embryogenesis in cotton.

  3. Effect of mutagens on the quality characters and disease resistant genes of diploid cotton (Gossypium arboreum L.)

    International Nuclear Information System (INIS)

    Haidar, S.; Khan, I.A.; Mansoor, S.

    2002-01-01

    In both M1 and M2 plant height decreased with the increase in dose for both the mutagens. The 15 Krad and 0.15M EMS doses increased 122.7 and 128.3 gm seed cotton yield as compared to control respectively while all other doses of both mutagens decreased the yield of seed cotton. The EMS dose 0.10 M drastically decreased 184 gm seed cotton yield as compared to control. There was no larger effect of both mutagens on GOT % whereas staple length was slightly increased and micronaire value decreased as compared to control for all the doses of both mutagens. It was observed in M2 that mutation dose 10 Krad increased 165.6 gm seed cotton yield as compared to control but slight reduction in GOT % was observed. In M2 GOT were increased 3.5 % with 15 Krad and 3.6 % with EMS 0.10 M as compared to control. There were no larger effects for both mutagens in case of staple length, micronaire and uniformity ratio for all the doses as compared to control. respectively. In both M1 and M2 no plant was observed susceptible to cotton leaf curl virus and bacterial blight diseases of cotton

  4. Recent long-distance transgene flow into wild populations conforms to historical patterns of gene flow in cotton (Gossypium hirsutum) at its centre of origin.

    Science.gov (United States)

    Wegier, A; Piñeyro-Nelson, A; Alarcón, J; Gálvez-Mariscal, A; Alvarez-Buylla, E R; Piñero, D

    2011-10-01

    Over 95% of the currently cultivated cotton was domesticated from Gossypium hirsutum, which originated and diversified in Mexico. Demographic and genetic studies of this species at its centre of origin and diversification are lacking, although they are critical for cotton conservation and breeding. We investigated the actual and potential distribution of wild cotton populations, as well as the contribution of historical and recent gene flow in shaping cotton genetic diversity and structure. We evaluated historical gene flow using chloroplast microsatellites and recent gene flow through the assessment of transgene presence in wild cotton populations, exploiting the fact that genetically modified cotton has been planted in the North of Mexico since 1996. Assessment of geographic structure through Bayesian spatial analysis, BAPS and Genetic Algorithm for Rule-set Production (GARP), suggests that G. hirsutum seems to conform to a metapopulation scheme, with eight distinct metapopulations. Despite evidence for long-distance gene flow, genetic variation among the metapopulations of G. hirsutum is high (He = 0.894 ± 0.01). We identified 46 different haplotypes, 78% of which are unique to a particular metapopulation, in contrast to a single haplotype detected in cotton cultivars. Recent gene flow was also detected (m = 66/270 = 0.24), with four out of eight metapopulations having transgenes. We discuss the implications of the data presented here with respect to the conservation and future breeding of cotton populations and genetic diversity at its centre of crop origin. © 2011 Blackwell Publishing Ltd.

  5. Genetic analysis of some agronomic traits (gossypium hamster L.) in cotton

    International Nuclear Information System (INIS)

    Zulqarnain, M.; Khan, I.A.; Shakeel, T.; JAfri, J.S.

    1998-01-01

    Four varieties of cotton were crossed in a complete diallel fashion to evaluate the mode of inheritance of different agronomic traits. Height of main stem, number of bolls per plant, boll weight and yield of seed cotton per plant appeared to be controlled by additive with partial dominance type of gene action. While number of seeds per boll was controlled by over dominance type of gene action. Variety MNH-93 possessed dominant genes for height of main stem, number of bolls per plant number of seeds per boll and yield of seed cotton per plant. AMSI-38 carried dominant genes for boll weight and recessive for number of bolls per plant, number of seeds per boll and boll weight. Height of main stem and yield of seed cotton were controlled by recessive genes in Variety AMSI-38. (author)

  6. GhNAC18, a novel cotton (Gossypium hirsutum L.) NAC gene, is ...

    African Journals Online (AJOL)

    EVANS

    especially inhibition of leaf senescence and plant stress responses in cotton. This study provides .... For exogenous application of hormone treatments, leaves of uniformly ...... with incompatible interactions between chili pepper and pathogens.

  7. Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

    Science.gov (United States)

    Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

    2017-12-10

    Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected

  8. Influence of bleach activators on the fabric made from cotton (gossypium hamster l.)

    International Nuclear Information System (INIS)

    Asif, H.M.; Iftikhar, M.; Shahbaz, B.

    2013-01-01

    Raw cotton contains various type of trash and most of the impurities are removed during the spinning process but still the cotton fabric coming from the weaving or knitting process always contains some impurities. Some time cotton fabric gets the oil, stains and coloured materials which affect the quality of dyed fabric. Bleaching is a process that eliminates unwanted coloured matters from the fibres, yarn and fabrics. A bleaching agent is a material that lightens or whitens a substrate through chemical action. Hydrogen peroxide is by far the most commonly used oxidative bleaching agent for cotton and its blends, accounting for more than 90 percent of all the bleaching agents. The use of activators to enhance the bleaching performance of hydrogen peroxide for cellulosic materials has gained popularity now a day. In this context the main objectives of this paper are to study the influence of different bleaching activators on cotton fabric and to give implications for textile extension.The results indicate that the activators with different concentrations, along with different concentrations of hydrogen peroxide (H/sub 2/O/sub 2) have significant influence on the bleaching performance of cotton fabric. (author)

  9. CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

    2017-07-01

    The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

  10. Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species.

    Science.gov (United States)

    Ulloa, M; Wang, C; Saha, S; Hutmacher, R B; Stelly, D M; Jenkins, J N; Burke, J; Roberts, P A

    2016-04-01

    Chromosome substitution (CS) lines in plants are a powerful genetic resource for analyzing the contribution of chromosome segments to phenotypic variance. In this study, a series of interspecific cotton (Gossypium spp.) CS lines were used to identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode or fungal disease resistance traits. The CS lines were developed in the G. hirsutum L. TM-1 background with chromosome or chromosome segment substitutions from G. barbadense L. Pima 3-79 or G. tomentosum. Root-knot nematode (Meloidogyne incognita) and fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) (races 1 and 4) resistance alleles and quantitative trait loci (QTL) previously placed on cotton chromosomes using SSR markers in two interspecific recombinant inbred line populations were chosen for testing. Phenotypic responses of increased resistance or susceptibility in controlled inoculation and infested field assays confirmed the resistance QTLs, based on substitution with the positive or negative allele for resistance. Lines CS-B22Lo, CS-B04, and CS-B18 showed high resistance to nematode root-galling, confirming QTLs on chromosomes 4 and 22 (long arm) with resistance alleles from Pima 3-79. Line CS-B16 had less fusarium race 1-induced vascular root staining and higher percent survival than the TM-1 parent, confirming a major resistance QTL on chromosome 16. Lines CS-B(17-11) and CS-B17 had high fusarium race 4 vascular symptoms and low survival due to susceptible alleles introgressed from Pima 3-79, confirming the localization on chromosome 17 of an identified QTL with resistance alleles from TM1 and other resistant lines. Analyses validated regions on chromosomes 11, 16, and 17 harboring nematode and fusarium wilt resistance genes and demonstrated the value of CS lines as both a germplasm resource for breeding programs and as a powerful genetic analysis tool for determining QTL effects for disease

  11. Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.

    Directory of Open Access Journals (Sweden)

    Kenji Osabe

    Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

  12. Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.

    Science.gov (United States)

    Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W

    2014-01-01

    In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

  13. Mining and Analysis of SNP in Response to Salinity Stress in Upland Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Wang, Xiaoge; Lu, Xuke; Wang, Junjuan; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Ye, Wuwei

    2016-01-01

    Salinity stress is a major abiotic factor that affects crop output, and as a pioneer crop in saline and alkaline land, salt tolerance study of cotton is particularly important. In our experiment, four salt-tolerance varieties with different salt tolerance indexes including CRI35 (65.04%), Kanghuanwei164 (56.19%), Zhong9807 (55.20%) and CRI44 (50.50%), as well as four salt-sensitive cotton varieties including Hengmian3 (48.21%), GK50 (40.20%), Xinyan96-48 (34.90%), ZhongS9612 (24.80%) were used as the materials. These materials were divided into salt-tolerant group (ST) and salt-sensitive group (SS). Illumina Cotton SNP 70K Chip was used to detect SNP in different cotton varieties. SNPv (SNP variation of the same seedling pre- and after- salt stress) in different varieties were screened; polymorphic SNP and SNPr (SNP related to salt tolerance) were obtained. Annotation and analysis of these SNPs showed that (1) the induction efficiency of salinity stress on SNPv of cotton materials with different salt tolerance index was different, in which the induction efficiency on salt-sensitive materials was significantly higher than that on salt-tolerant materials. The induction of salt stress on SNPv was obviously biased. (2) SNPv induced by salt stress may be related to the methylation changes under salt stress. (3) SNPr may influence salt tolerance of plants by affecting the expression of salt-tolerance related genes.

  14. Evaluation of Brevibacillus brevis as a potential plant growth promoting rhizobacteria for cotton (Gossypium hirsutum) crop.

    Science.gov (United States)

    Nehra, Vibha; Saharan, Baljeet Singh; Choudhary, Madhu

    2016-01-01

    The present investigation was undertaken to isolate, screen and evaluate a selected promising PGPR Brevibacillus brevis on cotton crop. Out of 156 bacterial isolates one of the most promising isolate was analyzed for the various PGP traits. A seed germination analysis was conducted with cotton seeds to evaluate the potential of the isolate to promote plant growth. The bacterial isolate was checked for its growth and survival at high temperatures. The isolate was also analyzed for the PGP traits exhibited after the heat treatment. To identify the isolate morphological, biochemical and molecular characterization was performed. The isolate was found positive for many of the PGP attributes like IAA, ARA, anti-fungal activity and ammonia production. Effect of seed bacterization on various plant growth parameters was used as an indicator. The isolate showed significant growth and exhibited various PGP traits at high temperature making it suitable as an inoculant for cotton crop. Isolate was identified as Brevibacillus brevis [SVC(II)14] based on phenotypic as well as genotypic attributes and after conducting this research we propose that the B. brevis which is reported for the first time for its PGP potential in cotton, exerts its beneficial effects on cotton crop through combined modes of actions.

  15. Genetic study of various agronomic traits in cotton (Gossypium hirsutum L.)

    International Nuclear Information System (INIS)

    Ashraf, F.; Khan, I.A.; Ahmed, S.

    2009-01-01

    The use of already existing genetic variability in the breeding material, as well as, the creation of new variability along with the genetic understanding of various agronomic traits is of crucial importance, in order to develop potential sources of cotton. For this purpose, 5 X 6 complete diallel cross experiment was conducted during 2003-04, involving 5 strains i.e. VH-55, MNH-516, ACALA-SJ-4, A-8100 and CRIS-420, to evaluate gene-action, general and specific combining ability for number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant, boll weight and yield of seed cotton. Additive type of gene action, with partial dominance for all the traits studied, was observed. Most dominant genes for boll weight, yield of seed-cotton, and number of sympodial branches were observed in CRIS-420, while maximum dominant genes for number of monopodial branches, plant height were observed in ACALA-SJ-4. Variety VH-55 carried maximum dominant genes for number of bolls per plant. Recessive genes for the number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant and yield of seed-cotton, were exhibited by MNH-516. The variety ACAU-SJ-4 showed harmonius combination for bolls per plant and yield of seed-cotton, whereas CRIS- 420 was found a good general combiner for plant height and number of sympodial branches. (author)

  16. Influence of mutagens on enzymes of germinating seeds of cotton (Gossypium hirsutum L.)

    International Nuclear Information System (INIS)

    Muthusamy, A.; Jayabalan, N.; Juliana, B.

    2000-01-01

    The activities of the enzymes amylases, protease and phosphatases were studied in cotton during germination. The seeds were treated with 100-500 Gy of gamma rays, 10-50 mM of EMS, CA and SA in two cultivated varieties viz.. MCU 5 and MCU 11. Activity pattern of amylases, protease and phosphatases in treated seeds were significantly altered from controls. The alteration were positively correlated with increasing dose/concentration of mutagens up to 300 Gy of gamma rays and 30 mM of EMS, CA and SA. The present study pave the ways to discuss the importance of the enzymes and mutagens in germination of cotton seeds. (author)

  17. Functional Characterization of a Dihydroflavanol 4-Reductase from the Fiber of Upland Cotton (Gossypium hirsutum

    Directory of Open Access Journals (Sweden)

    Le Wang

    2016-01-01

    Full Text Available Dihydroflavanol 4-reductase (DFR is a key later enzyme involved in two polyphenols’ (anthocyanins and proanthocyanidins (PAs biosynthesis, however it is not characterized in cotton yet. In present reports, a DFR cDNA homolog (designated as GhDFR1 was cloned from developing fibers of upland cotton. Silencing GhDFR1 in cotton by virus-induced gene silencing led to significant decrease in accumulation of anthocyanins and PAs. More interestingly, based on LC-MS analysis, two PA monomers, (–-epicatachin and (–-epigallocatachin, remarkably decreased in content in fibers of GhDFR1-silenced plants, but two new monomers, (–-catachin and (–-gallocatachin were present compared to the control plants infected with empty vector. The ectopic expression of GhDFR1 in an Arabidopsis TT3 mutant allowed for reconstruction of PAs biosynthesis pathway and led to accumulation of PAs in seed coat. Taken together, these data demonstrate that GhDFR1 contributes to the biosynthesis of anthocyanins and PAs in cotton.

  18. Modeling cotton (Gossypium spp) leaves and canopy using computer aided geometric design (CAGD)

    Science.gov (United States)

    The goal of this research is to develop a geometrically accurate model of cotton crop canopies for exploring changes in canopy microenvironment and physiological function with leaf structure. We develop an accurate representation of the leaves, including changes in three-dimensional folding and orie...

  19. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  20. Seed protein electrophoresis for identification of fine fibre cotton line in Gossypium hirsutum L

    International Nuclear Information System (INIS)

    Gao Guoqiang; Lv Tiexin; Su Xuehe; Liu Xiaoyong; Wu Defang; Zhu Doubei

    2003-01-01

    Gel electrophoresis was conducted to test seed ethanol resolvable protein in cotton. 13 lines were used, including a fine fibre cotton line (98301) in G. hirsutum L., 4 varieties in G. barbadense L. and 8 varieties in G. hirsutum L.. In results of the 98301 line, Zhongmiansuo 12 and Shiyuan 321, no different protein electro-phoresis band pattern was shown among different seeds belong to the same variety, respectively. In comparison among the 98301 seeds sampled from seven different growth sets in Shandong province, their protein band patterns were the same. On the gel plate, three special bands were distinctive to all the varieties in G. hirsutum L. and other three special bands were distinctive to all the varieties in G. barbadense L.. The three characteristic bands of G. hirsutum L. appeared in the protein band pattern of the 98301 line. It showed that the seed protein composition of the line was inclined to G. hirsutum L. mainly. And, a characteristic band of G. Barbadense L. in the band pattern of the 98301 line proved that the fine fibre cotton line derived from a hybrid between G. barbadense and G. hirsutum L.. The 98301 line was easily distinguished from other varieties in G. hirsutum L. by its distinctive band, i.e. band No.1, and another island cotton band, i.e. band No.10

  1. Influence of foliar application of glycine betaine on gas exchange characteristics of cotton (gossypium Hirsutum L.)

    International Nuclear Information System (INIS)

    Makhdum, M.I.; Din, S.U.

    2007-01-01

    Water is the most limiting factor in cotton production and numerous efforts are being made to improve crop drought tolerance. A field study was conducted with the objectives to determine the effects of different application rates of glycine betaine in field grown cotton at Central Cotton Research Institute, Multan. Four levels of glycine betaine (0.0, 1.0, 3.0 and 6.0 kg ha-1) were applied at three physiological growth stages i.e. at squaring, first flower and peak flowering. Cotton cultivar CIM-448 was used as test crop. Results showed that crop sprayed with glycine betaine at the rate of 6.0 kg ha-1 maintained 120.0, 62.1, 69.7 and 35.5 percent higher net CO/sub 2/ assimilation rate (PN), transpiration rate (E), stomatal resistance (gs) and water use efficiency (PN/E), respectively over that of untreated crop. Crop spayed with glycine betaine at peak flowering stage maintained higher PN, E, gs and PN/E compared to at other stages of growth. (author)

  2. Global gene expression in cotton (Gossypium hirsutum L. leaves to waterlogging stress.

    Directory of Open Access Journals (Sweden)

    Yanjun Zhang

    Full Text Available Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH, but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.

  3. Effect of phosphate solubilizing bacteria on the phosphorus availability and yield of cotton (gossypium)

    International Nuclear Information System (INIS)

    Akhtar, N.; Iqbal, A.; Qureshi, M.A.; Khan, K.H

    2010-01-01

    Phosphate solubilizing bacteria (PSB) and plants have symbiotic relationship, as bacteria provide soluble phosphate for the plants and plants supply root borne carbon compounds which can be metabolized for bacterial growth. PSB solubilize the applied and fixed soil phosphorus resulting in higher crop yield. Intensive cropping has resulted in wide spread deficiency of Phosphorus in our soils and situation is becoming more serious because of a drastic increase in the cost of phosphatic fertilizers. Keeping in view the capabilities of microbes (Bacillus sp.), a field experiment was conducted on cotton at farmer field district Faisalabad in 2008. Effect of PSM (Bacillus spp.) was studied at three phosphorus levels i.e.20, 40 and 60 kg ha-l while N was applied at recommended dose (120 kg ha/sup -1/). Bacillus spp. was applied as seed coating to the cotton crop (Var. BT 121). Recommended plant protection measures were adopted. Results revealed that Bacillus spp. significantly increased the seed cotton yield; number of boll plant-I, boll weight, plant height, GOT (%), staple length, plant P and available P in the soil. Maximum seed cotton yield 4250 kg ha/sup -l/ was obtained with Bacillus inoculation along with 60 kg of P followed by 4162 kg ha/sup -1/ with Bacillus inoculation and 40 kg of P compared with their respective controls i.e.4093 and 3962 kg ha/sup -1/ respectively. Soil P was improved from 8.1 to 9.5 ppm by Bacillus inoculation. Phosphorus in plant matter was also higher (0.39%) as compare with control (0.36%). Rhizosphere soil pH was found slightly decreased (8.12 to 8.0) by Bacillus inoculation compare with control. It is concluded that PSB inoculation not only exerts beneficial effect on crop growth but also enhances the phosphorus concentration in the plant and soil. (author)

  4. Radiation and chemical mutagen induced somaclonal variations through in vitro organogenesis of cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Muthusamy, Annamalai; Jayabalan, Narayanasamy

    2014-12-01

    The purpose of the investigation was to induce somaclonal variations by gamma rays (GR), ethylmethane sulphonate (EMS) and sodium azide (SA) during in vitro organogenesis of cotton. The shoot tip explants were irradiated with 5-50 Gray (Gy) GR (Cobalt 60), 0.5-5.0 mM EMS and SA separately, and inoculated on Murashige and Skoog (MS) medium fortified with plant growth regulator (PGR) for organogenesis. The plantlets with well-developed root systems were acclimatized and transferred into the experimental field to screen the somaclonal variations during growth and development. The number of somaclonal variations was observed in growth of irradiated/treated shoot tips, multiplication, plantlet regeneration and growth in vitro and ex vitro. The lower doses/concentrations of mutagenic treatments showed significant enhancement in selected agronomical characters and they showed decreased trends with increasing doses/concentrations of mutagenic agents. The results of the present study revealed the influence of lower doses/concentrations of mutagenic treatments on in vitro and ex vitro growth of cotton plantlets and their significant improvement in agronomical characters which needs further imperative stability analysis. The present observations showed the platform to use lower doses/concentrations of mutagenic agents to induce variability for enhanced agronomical characters, resistant and tolerant cotton varieties.

  5. Effect of surfactant concentration on the evaporation of droplets on cotton (Gossypium hirsutum L.) leaves.

    Science.gov (United States)

    Zhou, Zhaolu; Cao, Chong; Cao, Lidong; Zheng, Li; Xu, Jun; Li, Fengmin; Huang, Qiliang

    2018-04-05

    The evaporation kinetics of pesticide droplets deposited on a leaf surface can affect their application efficiency. Evaporation of droplets on the hydrophobic leaves has received considerable attention, but little is known about hydrophilic leaf surfaces. In this study, the effect of surfactant concentration on the evaporation of droplets deposited on cotton leaves was investigated. The evaporation time is roughly decreased for concentrations ranging from 0% to 0.01% and increased from 0.01% to 0.10%. Contrary to the widely held belief that pesticide retention on target crops can rapidly be formed only with surfactant concentrations exceeding the CMC (critical micelle concentration), this study demonstrates that, on hydrophilic cotton leaves, fast evaporation of the droplet at surfactant concentrations of 0.01% (CMC) can reduce the volume quickly, lower the loss point and enhance pesticide retention. In addition, the evolution of droplet volume, height and contact angle on the cotton leaf surface were measured to confirm this conclusion. The result presented herein can be used to guide the use of surfactants and pesticides in agriculture. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Selection of Gossypium hirsutum genotypes for interspecific ...

    African Journals Online (AJOL)

    FORRESTER

    ARS), Crop Genetics Research Unit in. Stoneville, Mississippi ... Key words: Cotton, germplasm, immature embryo, tissue culture, wide-hybridization. INTRODUCTION. Tetraploid upland cotton, Gossypium hirsutum L., is comprised of over 90% ...

  7. Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

    Science.gov (United States)

    Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

    2016-09-01

    Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

  8. Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.

    Science.gov (United States)

    Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab

    2015-09-17

    Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.

  9. SSR-based association mapping of salt tolerance in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Zhao, Y L; Wang, H M; Shao, B X; Chen, W; Guo, Z J; Gong, H Y; Sang, X H; Wang, J J; Ye, W W

    2016-05-25

    The identification of simple sequence repeat (SSR) markers associated with salt tolerance in cotton contributes to molecular assisted selection (MAS), which can improve the efficiency of traditional breeding. In this study, 134 samples of upland cotton cultivars were selected. The seedling emergence rates were tested under 0.3% NaCl stress. A total of 74 SSR markers were used to scan the genomes of these samples. To identify SSR markers associated with salt tolerance, an association analysis was performed between salt tolerance and SSR markers using TASSEL 2.1, based on the analysis of genetic structure using Structure 2.3.4. The results showed that the seedling emergence rates of 134 cultivars were significantly different, and 27 salt-sensitive and 10 salt-tolerant cultivars were identified. A total of 148 loci were found in 74 SSR markers involving 246 allelic variations, which ranged from 2 to 7 with an average of 3.32 per SSR marker. The gene diversity ranged from 0.0295 to 0.4959, with the average being 0.2897. The polymorphic information content ranged from0.0290 to 0.3729, with the average being 0.2381. This natural population was classified into two subgroups by Structure 2.3.4, containing 89 and 45 samples, respectively. Finally, eight SSR sites associated with salt tolerance ware found through an association analysis, with the rate of explanation ranging from 2.91 to 7.82% and an average of 4.32%. These results provide reference data for the use MAS for salt tolerance in cotton.

  10. Confamiliar transferability of simple sequence repeat (SSR) markers from cotton (Gossypium hirsutum L.) and jute (Corchorus olitorius L.) to twenty two Malvaceous species.

    Science.gov (United States)

    Satya, Pratik; Paswan, Pramod Kumar; Ghosh, Swagata; Majumdar, Snehalata; Ali, Nasim

    2016-06-01

    Cross-species transferability is a quick and economic method to enrich SSR database, particularly for minor crops where little genomic information is available. However, transferability of SSR markers varies greatly between species, genera and families of plant species. We assessed confamiliar transferability of SSR markers from cotton (Gossypium hirsutum) and jute (Corchorus olitorius) to 22 species distributed in different taxonomic groups of Malvaceae. All the species selected were potential industrial crop species having little or no genomic resources or SSR database. Of the 14 cotton SSR loci tested, 13 (92.86 %) amplified in G. arboreum and 71.43 % exhibited cross-genera transferability. Nine out of 11 jute SSRs (81.81 %) showed cross-transferability across genera. SSRs from both the species exhibited high polymorphism and resolving power in other species. The correlation between transferability of cotton and jute SSRs were highly significant (r = 0.813). The difference in transferability among species was also significant for both the marker groups. High transferability was observed at genus, tribe and subfamily level. At tribe level, transferability of jute SSRs (41.04 %) was higher than that of cotton SSRs (33.74 %). The tribe Byttnerieae exhibited highest SSR transferability (48.7 %). The high level of cross-genera transferability (>50 %) in ten species of Malvaceae, where no SSR resource is available, calls for large scale transferability testing from the enriched SSR databases of cotton and jute.

  11. Gamma ray induced diversity in restorer line of cotton (Gossypium Hirsutum)

    International Nuclear Information System (INIS)

    Mehetre, S.S.; Patil, V.R.; Surana, P.P.

    2000-01-01

    Looking to the limitation of very few restorers available in cotton a diversification of available restorer line was undertaken by gamma irradiation. The four hundred individual plants selected from individual M 2 families were crossed with CMS lines. Out of which 12 plants restored fertility in CMS lines and their F 1 's with CMS produced more heterotic hybrids than their checks (control). The results indicated that sufficient variability can be induced with the help of gamma rays and the diversification of restorers is possible within a short period with simultaneous improvement in either one or two characters. (author)

  12. Meta-analysis of cotton fiber quality QTLs across diverse environments in a Gossypium hirsutum x G. barbadense RIL population

    Directory of Open Access Journals (Sweden)

    Giband Marc

    2010-06-01

    Full Text Available Abstract Background Cotton fibers (produced by Gossypium species are the premier natural fibers for textile production. The two tetraploid species, G. barbadense (Gb and G. hirsutum (Gh, differ significantly in their fiber properties, the former having much longer, finer and stronger fibers that are highly prized. A better understanding of the genetics and underlying biological causes of these differences will aid further improvement of cotton quality through breeding and biotechnology. We evaluated an inter-specific Gh × Gb recombinant inbred line (RIL population for fiber characteristics in 11 independent experiments under field and glasshouse conditions. Sites were located on 4 continents and 5 countries and some locations were analyzed over multiple years. Results The RIL population displayed a large variability for all major fiber traits. QTL analyses were performed on a per-site basis by composite interval mapping. Among the 651 putative QTLs (LOD > 2, 167 had a LOD exceeding permutation based thresholds. Coincidence in QTL location across data sets was assessed for the fiber trait categories strength, elongation, length, length uniformity, fineness/maturity, and color. A meta-analysis of more than a thousand putative QTLs was conducted with MetaQTL software to integrate QTL data from the RIL and 3 backcross populations (from the same parents and to compare them with the literature. Although the global level of congruence across experiments and populations was generally moderate, the QTL clustering was possible for 30 trait x chromosome combinations (5 traits in 19 different chromosomes where an effective co-localization of unidirectional (similar sign of additivity QTLs from at least 5 different data sets was observed. Most consistent meta-clusters were identified for fiber color on chromosomes c6, c8 and c25, fineness on c15, and fiber length on c3. Conclusions Meta-analysis provided a reliable means of integrating phenotypic and

  13. Meta-analysis of cotton fiber quality QTLs across diverse environments in a Gossypium hirsutum x G. barbadense RIL population.

    Science.gov (United States)

    Lacape, Jean-Marc; Llewellyn, Danny; Jacobs, John; Arioli, Tony; Becker, David; Calhoun, Steve; Al-Ghazi, Yves; Liu, Shiming; Palaï, Oumarou; Georges, Sophie; Giband, Marc; de Assunção, Henrique; Barroso, Paulo Augusto Vianna; Claverie, Michel; Gawryziak, Gérard; Jean, Janine; Vialle, Michèle; Viot, Christopher

    2010-06-28

    Cotton fibers (produced by Gossypium species) are the premier natural fibers for textile production. The two tetraploid species, G. barbadense (Gb) and G. hirsutum (Gh), differ significantly in their fiber properties, the former having much longer, finer and stronger fibers that are highly prized. A better understanding of the genetics and underlying biological causes of these differences will aid further improvement of cotton quality through breeding and biotechnology. We evaluated an inter-specific Gh x Gb recombinant inbred line (RIL) population for fiber characteristics in 11 independent experiments under field and glasshouse conditions. Sites were located on 4 continents and 5 countries and some locations were analyzed over multiple years. The RIL population displayed a large variability for all major fiber traits. QTL analyses were performed on a per-site basis by composite interval mapping. Among the 651 putative QTLs (LOD > 2), 167 had a LOD exceeding permutation based thresholds. Coincidence in QTL location across data sets was assessed for the fiber trait categories strength, elongation, length, length uniformity, fineness/maturity, and color. A meta-analysis of more than a thousand putative QTLs was conducted with MetaQTL software to integrate QTL data from the RIL and 3 backcross populations (from the same parents) and to compare them with the literature. Although the global level of congruence across experiments and populations was generally moderate, the QTL clustering was possible for 30 trait x chromosome combinations (5 traits in 19 different chromosomes) where an effective co-localization of unidirectional (similar sign of additivity) QTLs from at least 5 different data sets was observed. Most consistent meta-clusters were identified for fiber color on chromosomes c6, c8 and c25, fineness on c15, and fiber length on c3. Meta-analysis provided a reliable means of integrating phenotypic and genetic mapping data across multiple populations and

  14. Molecular Characterization and Germination Analysis of Cotton (Gossypium hirsutum L. Genotypes under Water Deficit Irrigation

    Directory of Open Access Journals (Sweden)

    Eminur ELÇİ

    2016-09-01

    Full Text Available Cotton is an important crop in terms of economic and strategic impacts. Drought stress is one of the most important environmental stress factors which negatively affects growth and yield of plants in Turkey as occurred in many countries in the world. In this study, 11 different cotton cultivars selected based on their agronomical characters were tested under water deficit irrigation strategies. Thus, it was aimed to select and/or determine appropriate new varieties for breeding new national materials resistant to drought stress, and to characterize with the molecular microsatellite markers. According to the different irrigation levels (25%, 50%, 75% and 100% plants were observed under the stressed conditions at the irrigation levels of 50% and 25%. Among the tested varieties, Tamcot Sphinx, Tamcot 94, Tamcot CamdEs and BA525 varieties were found to be more water stress tolerant than others in terms of germination time and germinated plant. The UPGMA (Unweighted Pair-Group Method Using Arithmetic Averages analysis was carried out using 28 markers with average 0.306 polymorphism information content (PIC for molecular characterization studies. Based on the UPGMA results, the varieties were clustered into two groups. It is expected that the results obtained from this study might provide considerable data for improving new drought tolerant varieties.

  15. Induced variants in cotton (Gossypium Hirsutum L.) by in vitro mutagenesis

    International Nuclear Information System (INIS)

    Muthusamy, A.; Jayabalan, N.

    2000-01-01

    The shoot tips (3-5mm) of cotton were isolated from five day old in vitro grown seedlings and it contained two small unexpanded leaves approximately 1.0 mm along with cotyledons and the cotyledons were removed before the treatment with mutagens. The shoot tip alone was treated with 1-5 kR doses of gamma rays from 60C o source at Sugarcane Breeding Institute (ICAR), Coimbatore, Tamil Nadu and 1-5 mM of ethyl methane sulphonate (EMS) and sodium azide (SA) for 30 min. at pH 6 and 3 respectively. The treated shoot tips were inoculated on MS medium supplemented with 0.1 mg/l KIN, l-inositol 100 mg/l, thiamine HCI 1.0 mg/l, sucrose 30 g/l and agar 8 g/l. During the development of shoots, a number of leaf mutants with narrow, tubular, bilobed and multilobed leaves was observed. The plants also showed the best performance in number of branches, leaf area and yield characters than control. The morphological variants obtained due to mutagenic treatment in the present investigation showed high frequency with increasing doses of mutagens. Compared with somatic cell culture of cotton, shoot and meristem culture is an easier method to obtain regenerative plants. The in vitro induction of mutations has also potential application in the development of disease-resistant plants through tissue culture. (author)

  16. Flooding tolerance in cotton (gossypium hirsutum l.) at early vegetative and reproductive growth stages

    International Nuclear Information System (INIS)

    Hussain, A.

    2014-01-01

    Periodic flooding at any growth stage greatly affects growth and yield of crops. In order to develop flooding tolerant cotton cultivar and to identify the most sensitive growth stage to periodic flooding, a field experiment was conducted in which 60-cultivars/accessions/lines were subjected to two week flooding at seedling/early vegetative, flower and boll formation growth stages. Pre- and post-flooding soil analysis was also carried out. Nitrate-N was greatly reduced due to flooding applied at all growth stages, whereas NH4-N increased significantly. Similarly, Fe and Mn were also increased to many folds in flooded soils. Under hypoxic conditions, depletion of nitrates and toxic effects of accumulated NH4, Fe and Mn caused severe damages to cotton plants and even death of plants. Of the three growth stages, early vegetative growth stage is most sensitive to two week flooding. Flooding imposed at the flowering and boll formation growth stages caused a substantial amount of yield penalty. On the basis of survival percentage, the 60-cultivars/accessions/lines were categorized into tolerant (61%), moderately tolerant (31=60%) and sensitive (31%) to short term flooding. At the seedling or early vegetative growth stage, genotypes DPL-SR-2 followed by 124-F and MNH-427 were most tolerant to flooding, while AET-5, N-KRISHMA, LRA-5166, CEDIX and H-142 were ranked as sensitive to flooding stress. At the flowering stage, the genotype NIAB-92 followed by S-14 and MNH-427 were highly tolerant to flooding. At the boll formation stage, genotypes DPL-70010-N followed by GH-11-9-75 and B-2918-2 were highly tolerant waterlogging. More than 50% of the genotypes maintained the degree of flooding tolerance at three growth stages. However, on the basis of survival percentage at three growth stages, genotypes MNH-564, FH-114, MNH-786 and CIM-573 were included in the tolerant group and the genotypes N-KRISHMA, LRA-5166, CEDIX and H-142 were included in the sensitive group. These

  17. iTRAQ-facilitated proteomic profiling of anthers from a photosensitive male sterile mutant and wild-type cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Liu, Ji; Pang, Chaoyou; Wei, Hengling; Song, Meizhen; Meng, Yanyan; Ma, Jianhui; Fan, Shuli; Yu, Shuxun

    2015-08-03

    Male sterility is a common phenomenon in flowering plants, and it has been successfully developed in several crops by taking advantage of heterosis. Cotton (Gossypium hirsutum L.) is an important economic crop, used mainly for the production of textile fiber. Using a space mutation breeding technique, a novel photosensitive genetic male sterile mutant CCRI9106 was isolated from the wild-type upland cotton cultivar CCRI040029. To use CCRI9106 in cotton hybrid breeding, it is of great importance to study the molecular mechanisms of its male sterility. Here, histological and iTRAQ-facilitated proteomic analyses of anthers were performed to explore male sterility mechanisms of the mutant. Scanning and transmission electron microscopy of the anthers showed that the development of pollen wall in CCRI9106 was severely defective with a lack of exine formation. At the protein level, 6121 high-confidence proteins were identified and 325 of them showed differential expression patterns between mutant and wild-type anthers. The proteins up- or down-regulated in MT anthers were mainly involved in exine formation, protein degradation, calcium ion binding,etc. These findings provide valuable information on the proteins involved in anther and pollen development, and contribute to elucidate the mechanism of male sterility in upland cotton. Copyright © 2015. Published by Elsevier B.V.

  18. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    Directory of Open Access Journals (Sweden)

    Gregory N. Thyssen

    2016-06-01

    Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

  19. A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

    Science.gov (United States)

    Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

    2015-07-01

    Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

  20. The PIN gene family in cotton (Gossypium hirsutum): genome-wide identification and gene expression analyses during root development and abiotic stress responses.

    Science.gov (United States)

    He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui

    2017-07-03

    Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.

  1. (Gossypium barbadense) germplasm resources

    Indian Academy of Sciences (India)

    Navya

    2017-03-28

    Mar 28, 2017 ... Running title: Marker-trait associations in sea-island cotton ... In this study, Gossypium barbadense germplasm accessions with ... origins (n = 123) were used to perform association analysis of fiber traits with 120 polymorphic simple ... Because fiber yield and quality traits are complex quantitative traits, ...

  2. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    Directory of Open Access Journals (Sweden)

    Renesh Bedre

    Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  3. High Resolution Consensus Mapping of Quantitative Trait Loci for Fiber Strength, Length and Micronaire on Chromosome 25 of the Upland Cotton (Gossypium hirsutum L..

    Directory of Open Access Journals (Sweden)

    Zhen Zhang

    Full Text Available Cotton (Gossypium hirsutum L. is an important agricultural crop that provides renewable natural fiber resources for the global textile industry. Technological developments in the textile industry and improvements in human living standards have increased the requirement for supplies and better quality cotton. Upland cotton 0-153 is an elite cultivar harboring strong fiber strength genes. To conduct quantitative trait locus (QTL mapping for fiber quality in 0-153, we developed a population of 196 recombinant inbred lines (RILs from a cross between 0-153 and sGK9708. The fiber quality traits in 11 environments were measured and a genetic linkage map of chromosome 25 comprising 210 loci was constructed using this RIL population, mainly using simple sequence repeat markers and single nucleotide polymorphism markers. QTLs were identified across diverse environments using the composite interval mapping method. A total of 37 QTLs for fiber quality traits were identified on chromosome 25, of which 17 were stably expressed in at least in two environments. A stable fiber strength QTL, qFS-chr25-4, which was detected in seven environments and was located in the marker interval between CRI-SNP120491 and BNL2572, could explain 6.53%-11.83% of the observed phenotypic variations. Meta-analysis also confirmed the above QTLs with previous reports. Application of these QTLs could contribute to improving fiber quality and provide information for marker-assisted selection.

  4. High Resolution Consensus Mapping of Quantitative Trait Loci for Fiber Strength, Length and Micronaire on Chromosome 25 of the Upland Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Zhang, Zhen; Li, Junwen; Muhammad, Jamshed; Cai, Juan; Jia, Fei; Shi, Yuzhen; Gong, Juwu; Shang, Haihong; Liu, Aiying; Chen, Tingting; Ge, Qun; Palanga, Koffi Kibalou; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Li, Wei; Sun, Linyang; Gong, Wankui; Yuan, Youlu

    2015-01-01

    Cotton (Gossypium hirsutum L.) is an important agricultural crop that provides renewable natural fiber resources for the global textile industry. Technological developments in the textile industry and improvements in human living standards have increased the requirement for supplies and better quality cotton. Upland cotton 0-153 is an elite cultivar harboring strong fiber strength genes. To conduct quantitative trait locus (QTL) mapping for fiber quality in 0-153, we developed a population of 196 recombinant inbred lines (RILs) from a cross between 0-153 and sGK9708. The fiber quality traits in 11 environments were measured and a genetic linkage map of chromosome 25 comprising 210 loci was constructed using this RIL population, mainly using simple sequence repeat markers and single nucleotide polymorphism markers. QTLs were identified across diverse environments using the composite interval mapping method. A total of 37 QTLs for fiber quality traits were identified on chromosome 25, of which 17 were stably expressed in at least in two environments. A stable fiber strength QTL, qFS-chr25-4, which was detected in seven environments and was located in the marker interval between CRI-SNP120491 and BNL2572, could explain 6.53%-11.83% of the observed phenotypic variations. Meta-analysis also confirmed the above QTLs with previous reports. Application of these QTLs could contribute to improving fiber quality and provide information for marker-assisted selection.

  5. Estimation of best parents parents and superior cross combinations for yield and fiber quality related traits in upland cotton (gossypium hirsutum L.)

    International Nuclear Information System (INIS)

    Shaukat, S.; Khan, T.M.; Ijaz, S.

    2013-01-01

    Combining ability was studied for identification of potential cultivars and hybrids in upland cotton (Gossypium hirsutum L.) in a 6x6 set of diallel crosses among six genotypes of cotton, i.e., VH-232, CRS-2007, SB-149, GR-156, FH-207, and MARVI carried out on fiber length, fiber fineness, fiber elongation, fiber strength, ginning out tern (GOT) and seed cotton yield. Analysis of variance revealed highly significant (p < 0.01) differences among the genotypes for all traits. Combining ability studies showed that the mean squares, due to general combining ability (GCA), specific combining ability (SCA) and reciprocal effects were highly significant in F1 generation. Genetic components, due to GCA and SCA, revealed that traits, such as, fiber length, strength and fineness, showed high proportion of additive type of gene action in F1 generation because of greater GCA variances were greater than SCA variance. GR-156 was the best combiner for lint percentage and fiber length. FH-207 was the best combiner for fiber fineness. FH-207, MARVI and SB-149 were the best general combiners for fiber character and were suggested to be used in future breeding programme to improve fiber quality traits. CRS-2007 x GR-156, CRS-2007 x MARVI, SB-149 x MARVI and VH-232 x SB-149 had higher specific combining ability and reciprocal effects and they can be used for future breeding programme to improve fiber quality. (author)

  6. SELETIVIDADE DE INSETICIDAS AO COMPLEXO DE INIMIGOS NATURAIS NA CULTURA DO ALGODÃO (Gossypium hirsutum L. SELECTIVITY OF INSECTICIDES ON THE COMPLEX OF NATURAL ENEMIES IN COTTON CROP (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Fábio Shigeo Takatsuka

    2007-09-01

    ="justify">The selectivity of insecticides was evaluated in the complex of natural enemies of the cotton (Gossypium hirsutum L. crop. The cultivar Deltapine was used in a randomized block experimental design, with seven treatments and four replications. The treatments, all in their commercial formulation, were: control; thiamethoxam (300 g.ha-1; lufenuron (300 mL.ha-1; betacyflutrin (800 mL.ha-1; imidacloprid (70g.ha-1; diflubenzuron (6,0 g.ha-1; and endosulfan (1500 mL.ha-1. The insecticides were sprayed at 45 days after germination. Besides the initial evaluation, other evaluations were performed three and seven days after insecticide application. Each plot was sampled by the fabric beating method, with two random beatings per plot. Natural enemies were identified and counted. Three days after application, the insecticides thiamethoxam (300 g.ha-1, lufenuron (300 mL.ha-1, and diflubenzuron (60 g.ha-1 did not showed negative effect on the complex of predators present in the cotton. However, seven days after application, only the lufenuron treatment maintained the selective effect over predator complex.

    KEY-WORDS: Insecticide; biological control; Gossypium.

  7. The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres

    Science.gov (United States)

    Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

    2015-01-01

    Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818

  8. STUDY OF GENE FLOW FROM GM COTTON (Gossypium hirsutum VARIETIES IN “EL ESPINAL” (TOLIMA, COLOMBIA.

    Directory of Open Access Journals (Sweden)

    Alejandro Chaparro Giraldo

    2013-09-01

    Full Text Available In 2009, 4088 hectares of genetically modified (GM cotton were planted in Tolima (Colombia, however there is some uncertainty about containment measures needed to prevent the flow of pollen and seed from regulated GM fields into adjacent fields. In this study, the gene flow from GM cotton varieties to conventional or feral cotton plants via seed and pollen was evaluated. ImmunostripTM, PCR and ELISA assays were used to detect gene flow. Fifty six refuges, 27 fields with conventional cotton and four feral individuals of the enterprise “Remolinos Inc.” located in El Espinal (Tolima were analyzed in the first half of 2010. The results indicated seeds mediated gene flow in 45 refuges (80,4 % and 26 fields with conventional cotton (96 %, besides a pollen mediated gene flow in one field with conventional cotton and nine refuges. All fields cultivated with conventional cotton showed gene flow from GM cotton. Two refuges and two feral individuals did not reveal gene flow from GM cotton.

  9. Evolution of insect pest and disease resistant, high-yielding and improved quality varieties of cotton by use of ionizing radiation. Part of a coordinated programme on the use of induced mutations for disease resistance in crop plants

    International Nuclear Information System (INIS)

    Vasti, S.M.

    1981-06-01

    Disease resistant, high yielding and higher quality cotton varieties were developed. 42 interspecific hybrid progenies of earlier crosses between Gossypium barbadense and Gossypium tomentosum or Gossypium barbadense and Gossypium hirsutum were included. Out of these, 22 progenies in F 3 generation were irradiated by gamma radiation doses of 20 and 25 kR. A list is given of interspecific hybrid progenies, as are the lists of boll rot susceptible and resistant plants in the irradiated and non-irradiated populations and/or successful crosses made between 1977 and 1978

  10. Relay cropping of wheat (Triticum aestivum L.) in cotton (Gossypium hirsutum L.) improves the profitability of cotton-wheat cropping system in Punjab, Pakistan.

    Science.gov (United States)

    Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad

    2018-01-01

    Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net

  11. Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) shoot apex with a fungal phytase gene improves phosphorus acquisition.

    Science.gov (United States)

    Ma, Zhiying; Liu, Jianfeng; Wang, Xingfen

    2013-01-01

    Cotton is an important world economic crop plant. It is considered that cotton is recalcitrant to in vitro proliferation. Somatic embryogenesis and plant regeneration has been successful by using hypocotyl, whereas it is highly genotype dependent. Here, a genotype-independent cotton regeneration protocol from shoot apices is presented. Shoot apices from 3- to 5-day-old seedlings of cotton are infected with an Agrobacterium strain, EHA105, carrying the binary vector pC-KSA contained phytase gene (phyA) and the marker gene neomycin phosphotransferase (NPTII), and directly regenerated as shoots in vitro. Rooted shoots can be obtained within 6-8 weeks. Plants that survived by leaf painting kanamycin (kan) were -further analyzed by DNA and RNA blottings. The transgenic plants with increased the phosphorus (P) acquisition efficiency were obtained following the transformation method.

  12. Cadmium (Cd) Localization in Tissues of Cotton (Gossypium hirsutum L.), and Its Phytoremediation Potential for Cd-Contaminated Soils.

    Science.gov (United States)

    Chen, Zhifan; Zhao, Ye; Fan, Lidong; Xing, Liteng; Yang, Yujie

    2015-12-01

    Phytoremediation using economically valuable, large biomass, non-edible plants is a promising method for metal-contaminated soils. This study investigated cotton's tolerance for Cd and remediation potential through analyzing Cd bioaccumulation and localization in plant organs under different soil Cd levels. Results showed cotton presents good tolerance when soil Cd concentration ≤20.26 mg kg(-1). Cotton had good Cd accumulation ability under low soil Cd levels (soil Cd, while roots and stems were the main compartments of Cd storage. Cd complexation to other organic constituents in root and stem cell sap could be a primary detoxifying strategy. Therefore, cotton is a potential candidate for phytoremediation of Cd-contaminated soils.

  13. Genome-wide identification of differentially expressed genes under water deficit stress in upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Park, Wonkeun; Scheffler, Brian E; Bauer, Philip J; Campbell, B Todd

    2012-06-15

    Cotton is the world's primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional/biological distribution, and

  14. Investigating Genetic Diversity Among Cotton Genotypes Available in the Iranian Gene Bank (Gossypium sp. Using ISSR Molecular Marker

    Directory of Open Access Journals (Sweden)

    F Shahriari Ahmadi

    2013-04-01

    Full Text Available Cotton is one of the most important world crops and is considered as a major cash crop in the North East of Iran. All selections in plant breeding are based on diversity and an increase in genetic diversity determines the range of selection. In the present study, 24 cultivars of cotton available at the research station for cotton in the East of Iran -Kashmar- were studied using the ISSR marker. A total number of 13 primers, with repeated simple sequences, were used for the amplification of genomic DNA. Overall, 128 bands were obtained, 109 of which showed polymorphism. To evaluate genetic similarity between cultivars, cluster analysis accompanied by the similarity coefficient developed by Jaccard and Nee (1972, were applied using the UPGMA method. Dendrogram analysis showed a high diversity in the cotton cultivars and two main groups with 70 percent genetic similarity dividing the cotton cultivars into two main groups; namely, tetraploid and diploid. The highest polymorphism percentage was related to 5' (CT8RC3' (100% and the lowest belonged to 5' (AG8YA3' and 5' (TC8G3' (25% primers. Based on the similarity matrix, the highest genetic similarity was found in Varamin and Khordad and the lowest in Avangard and Bakhtegan cultivars. Based on the obtained results, ISSR markers can be efficiently used for the investigation of genetic diversity among cotton cultivars.

  15. Global alteration of microRNAs and transposon-derived small RNAs in cotton (Gossypium hirsutum) during Cotton leafroll dwarf polerovirus (CLRDV) infection.

    Science.gov (United States)

    Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S

    2012-11-01

    Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.

  16. Seed cotton yield, ionic and quality attributes of two cotton (Gossypium hirsutum L. varieties as influenced by various rates of K and Na under field conditions

    Directory of Open Access Journals (Sweden)

    Muhammad Sohail

    2011-11-01

    Full Text Available Cotton is more sensitive to low K availability than most other major field crops, and often shows symptoms of K deficiency in soils not considered K deficient. Field investigation was conducted at Sahiwal to study the effect of different rates of K and Na application on seed cotton yield, ionic ratio and quality characteristics of two cotton varieties. Ten soil K: Na ratios were developed after considering indigenous K, Na status in soil. The treatments of K+Na in kg ha-1 to give K:Na ratios were as: 210+ 60 (3.5:1 i.e. control, 225 + 60 (3.75:1, 240 + 60 (4:1, 255 + 60 (4.25:1, 270 + 60 (4.5:1, 210 + 75 (2.8:1, 225 + 75 (3:1, 240 + 75 (3.2:1, 255 + 75 (3.4:1 and 270 + 75 (3.6:1. Control treatment represented indigenous K, Na status of soil. The experiment continued until maturity. Maximum seed cotton yield of NIBGE-2 was observed at K: Na ratio of 3.6:1. Variety NIBGE-2 manifested greater seed cotton yield than MNH-786. Leaf K: Na ratio of two cotton varieties differed significantly (p < 0.01 due to varieties, rates of K and Na and their interaction. Variety NIBGE-2 maintained higher K: Na ratio than MNH-786 and manifested good fiber quality. There was significant relationship (R2 = 0.55, n = 10 between K: Na ratio and fiber length and significant relationship (R2 = 0.65, n = 10 between K concentration and fiber length for NIBGE-2. There was also significant relationship (R2 = 0.91, 0.78, n = 10 between boll number and seed cotton yield for both varieties. The increase in yield was attributed to increased boll weight.

  17. Changes in activities of both photosystems and the regulatory effect of cyclic electron flow in field-grown cotton (Gossypium hirsutum L) under water deficit.

    Science.gov (United States)

    Yi, Xiao-Ping; Zhang, Ya-Li; Yao, He-Sheng; Han, Ji-Mei; Chow, Wah Soon; Fan, Da-Yong; Zhang, Wang-Feng

    2018-01-01

    To clarify the influence of water deficit on the functionality of the photosynthetic apparatus of cotton plants, leaf gas exchange, chlorophyll a fluorescence, and P700 redox state were examined in field-grown cotton Gossypium hirsutum L. cv. Xinluzao 45. In addition, we measured changes in the P515 signal and analyzed the activity of ATP synthase and the trans-thylakoid proton gradient (ΔpH). With increasing water deficit, the net CO 2 assimilation rate (A N ) and stomatal conductance (g s ) significantly decreased, but the maximum quantum efficiency of PSII photochemistry (F v /F m ) did not change. The photochemical activity of photosystem II (PSII) was reflected by the photochemical quenching coefficient (qP), quantum efficiency of photosystem II [Y(II)], and electron transport rate through PSII [ETR(II)], while the activity of photosystem I (PSI) was reflected by the quantum efficiency of photosystem I [Y(I)] and the electron transport rate through PSI [ETR(I)]. Both activities were maintained under mild water deficit, but were slightly decreased under moderate water deficit. Under moderate water deficit, cyclic electron flow (CEF), the fraction of absorbed light dissipated thermally via the ΔpH- and xanthophyll-regulated process [Y(NPQ)], and the fraction of P700 oxidized under a given set of conditions [Y(ND)] increased. Our results suggest that the activities of both photosystems are stable under mild water deficit and decrease only slightly under moderate water deficit. Moderate water deficit stimulates CEF, and the stimulation of CEF is essential for protecting PSI and PSII against photoinhibition. Copyright © 2017 Elsevier GmbH. All rights reserved.

  18. Azotobacter chroococcum as a potentially useful bacterial biofertilizer for cotton (Gossypium hirsutum): Effect in reducing N fertilization.

    Science.gov (United States)

    Romero-Perdomo, Felipe; Abril, Jorge; Camelo, Mauricio; Moreno-Galván, Andrés; Pastrana, Iván; Rojas-Tapias, Daniel; Bonilla, Ruth

    The aim of this research was to evaluate whether the application of two plant growth-promoting (rhizo)bacteria might reduce nitrogen fertilization doses in cotton. We used strains Azotobacter chroococcum AC1 and AC10 for their proven ability to promote seed germination and cotton growth. These microorganisms were characterized by their plant growth-promoting activities. Then, we conducted a glasshouse study to evaluate the plant growth promoting ability of these strains with reduced doses of urea fertilization in cotton. Results revealed that both strains are capable of fixing nitrogen, solubilizing phosphorus, synthesizing indole compounds and producing hydrolytic enzymes. After 12 weeks, the glasshouse experiment showed that cotton growth was positively influenced due to bacterial inoculation with respect to chemical fertilization. Notably, we observed that microbial inoculation further influenced plant biomass (p<0.05) than nitrogen content. Co-inoculation, interestingly, exhibited a greater beneficial effect on plant growth parameters compared to single inoculation. Moreover, similar results without significant statistical differences were observed among bacterial co-inoculation plus 50% urea and 100% fertilization. These findings suggest that co-inoculation of A. chroococcum strains allow to reduce nitrogen fertilization doses up to 50% on cotton growth. Our results showed that inoculation with AC1 and AC10 represents a viable alternative to improve cotton growth while decreasing the N fertilizer dose and allows to alleviate the environmental deterioration related to N pollution. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    Cotton is a world’s leading crop important to the world’s textile and energy industries, and a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction and extensive analysis of a binary bacterial artificial chromosome (BI...

  20. Survey of cotton (Gossypium sp.) for non-polar, extractable hydrocarbons for use as petrochemicals and liquid fuels

    Science.gov (United States)

    An ontogenetic study of a commercial cotton cultivar (FiberMax 1320), grown dryland, revealed that the dry weight (DW) of leaves reached a maximum at the 1st flower stage, and then declined as bolls opened. However, % pentane soluble hydrocarbon (HC) yield continued to increase throughout the growi...

  1. Endogenous Ethylene Concentration Is Not a Major Determinant of Fruit Abscission in Heat-Stressed Cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Ullah Najeeb

    2017-09-01

    Full Text Available We investigated the role of ethylene in the response of cotton to high temperature using cotton genotypes with genetically interrupted ethylene metabolism. In the first experiment, Sicot 71BRF and 5B (a lintless variant with compromised ethylene metabolism were exposed to 45°C, either by instantaneous heat shock or by ramping temperatures by 3°C daily for 1 week. One day prior to the start of heat treatment, half the plants were sprayed with 0.8 mM of the ethylene synthesis inhibitor, aminoethoxyvinylglycine (AVG. In a subsequent experiment, Sicot 71BRF and a putatively heat-tolerant line, CIM 448, were exposed to 36 or 45°C for 1 week, and half the plants were sprayed with 20 μM of the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid, (ACC. High temperature exposure of plants in both experiments was performed at the peak reproductive phase (65–68 days after sowing. Elevated temperature (heat shock or ramping to 45°C significantly reduced production and retention of fruits in all cotton lines used in this study. At the termination of heat treatment, cotton plants exposed to 45°C had at least 50% fewer fruits than plants under optimum temperature in all three genotypes, while plants at 36°C remained unaffected. Heat-stressed plants continued producing new squares (fruiting buds after termination of heat stress but these squares did not turn into cotton bolls due to pollen infertility. In vitro inhibition of pollen germination by high temperatures supported this observation. Leaf photosynthesis (Pn of heat-stressed plants (45°C measured at the end of heat treatments remained significantly inhibited, despite an increased leaf stomatal conductance (gs, suggesting that high temperature impairs Pn independently of stomatal behavior. Metabolic injury was supported by high relative cellular injury and low photosystem II yield of the heat-stressed plants, indicating that high temperature impaired photosynthetic electron transport. Both

  2. microRNAs involved in auxin signalling modulate male sterility under high-temperature stress in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Ding, Yuanhao; Ma, Yizan; Liu, Nian; Xu, Jiao; Hu, Qin; Li, Yaoyao; Wu, Yuanlong; Xie, Sai; Zhu, Longfu; Min, Ling; Zhang, Xianlong

    2017-09-01

    Male sterility caused by long-term high-temperature (HT) stress occurs widely in crops. MicroRNAs (miRNAs), a class of endogenous non-coding small RNAs, play an important role in the plant response to various abiotic stresses. To dissect the working principle of miRNAs in male sterility under HT stress in cotton, a total of 112 known miRNAs, 270 novel miRNAs and 347 target genes were identified from anthers of HT-insensitive (84021) and HT-sensitive (H05) cotton cultivars under normal-temperature and HT conditions through small RNA and degradome sequencing. Quantitative reverse transcriptase-polymerase chain reaction and 5'-RNA ligase-mediated rapid amplification of cDNA ends experiments were used to validate the sequencing data. The results show that miR156 was suppressed by HT stress in both 84021 and H05; miR160 was suppressed in 84021 but induced in H05. Correspondingly, SPLs (target genes of miR156) were induced both in 84021 and H05; ARF10 and ARF17 (target genes of miR160) were induced in 84021 but suppressed in H05. Overexpressing miR160 increased cotton sensitivity to HT stress seen as anther indehiscence, associated with the suppression of ARF10 and ARF17 expression, thereby activating the auxin response that leads to anther indehiscence. Supporting this role for auxin, exogenous Indole-3-acetic acid (IAA) leads to a stronger male sterility phenotype both in 84021 and H05 under HT stress. Cotton plants overexpressing miR157 suppressed the auxin signal, and also showed enhanced sensitivity to HT stress, with microspore abortion and anther indehiscence. Thus, we propose that the auxin signal, mediated by miRNAs, is essential for cotton anther fertility under HT stress. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  3. A Long-Read Transcriptome Assembly of Cotton (Gossypium hirsutum L. and Intraspecific Single Nucleotide Polymorphism Discovery

    Directory of Open Access Journals (Sweden)

    Hamid Ashrafi

    2015-07-01

    Full Text Available Upland cotton ( L. has a narrow germplasm base, which constrains marker development and hampers intraspecific breeding. A pressing need exists for high-throughput single nucleotide polymorphism (SNP markers that can be readily applied to germplasm in breeding and breeding-related research programs. Despite progress made in developing new sequencing technologies during the past decade, the cost of sequencing remains substantial when one is dealing with numerous samples and large genomes. Several strategies have been proposed to lower the cost of sequencing for multiple genotypes of large-genome species like cotton, such as transcriptome sequencing and reduced-representation DNA sequencing. This paper reports the development of a transcriptome assembly of the inbred line Texas Marker-1 (TM-1, a genetic standard for cotton, its usefulness as a reference for RNA sequencing (RNA-seq-based SNP identification, and the availability of transcriptome sequences of four other cotton cultivars. An assembly of TM-1 was made using Roche 454 transcriptome reads combined with an assembly of all available public expressed sequence tag (EST sequences of TM-1. The TM-1 assembly consists of 72,450 contigs with a total of 70 million bp. Functional predictions of the transcripts were estimated by alignment to selected protein databases. Transcriptome sequences of the five lines, including TM-1, were obtained using an Illumina Genome Analyzer-II, and the short reads were mapped to the TM-1 assembly to discover SNPs among the five lines. We identified >14,000 unfiltered allelic SNPs, of which ∼3,700 SNPs were retained for assay development after applying several rigorous filters. This paper reports availability of the reference transcriptome assembly and shows its utility in developing intraspecific SNP markers in upland cotton.

  4. Characterization of expressed sequence tags from developing fibers of Gossypium barbadense and evaluation of insertion-deletion variation in tetraploid cultivated cotton species.

    Science.gov (United States)

    Lv, Yuanda; Zhao, Liang; Xu, Xiaoyang; Wang, Lei; Wang, Cheng; Zhang, Tianzhen; Guo, Wangzhen

    2013-03-13

    Cotton is the leading fiber crop worldwide. Gossypium barbadense is an important species of cotton because of its extra-long staple fibers with superior luster and silkiness. However, a systematic analysis and utilization of cDNA sequences from G. barbadense fiber development remains understudied. A total of 21,079 high quality sequences were generated from two non-normalized cDNA libraries prepared by using a mixture of G. barbadense Hai7124 fibers and ovules. After assembly processing, a set of 8,653 unigenes were obtained. Of those, 7,786 were matched to known proteins and 7,316 were assigned to functional categories. The molecular functions of these unigenes were mostly related to binding and catalytic activity, and carbohydrate, amino acid, and energy metabolisms were major contributors among the subsets of metabolism. Sequences comparison between G. barbadense and G. hirsutum revealed that 8,245 unigenes from G. barbadense were detected the similarity with those released publicly in G. hirsutum, however, the remaining 408 sequences had no hits against G. hirsutum unigenes database. Furthermore, 13,275 putative ESTs InDels loci involved in the orthologous and/or homoeologous differences between/within G. barbadense and G. hirsutum were discovered by in silico analyses, and 2,160 InDel markers were developed by ESTs with more than five insertions or deletions. By gel electrophoresis combined with sequencing verification, 71.11% candidate InDel loci were reconfirmed orthologous and/or homoeologous loci polymorphisms using G. hirsutum acc TM-1 and G. barbadense cv Hai7124. Blastx result showed among 2,160 InDel loci, 81 with significant function similarity with known genes associated with secondary wall synthesis process, indicating the important roles in fiber quality in tetraploid cultivated cotton species. Sequence comparisons and InDel markers development will lay the groundwork for promoting the identification of genes related to superior agronomic traits

  5. Title: Potassium application regulates nitrogen metabolism and osmotic adjustment in cotton (Gossypium hirsutum L.) functional leaf under drought stress.

    Science.gov (United States)

    Zahoor, Rizwan; Zhao, Wenqing; Abid, Muhammad; Dong, Haoran; Zhou, Zhiguo

    2017-08-01

    To evaluate the role of potassium (K) in maintaining nitrogen metabolism and osmotic adjustment development of cotton functional leaves to sustain growth under soil drought and rewatering conditions, the plants of two cotton cultivars Siza 3 (low-K sensitive) and Simian 3 (low-K tolerant), were grown under three different K rates (K0, K1, and K2; 0, 150, and 300kgK 2 Oha -1 , respectively) and exposed to drought stress with 40±5% soil relative water content (SRWC). The drought stress was applied at flowering stage by withholding water for eight days followed by rewatering to a well-watered level (75±5% SRWC). The results showed that drought-stressed plants of both cultivars showed a decrease in leaf relative water content (RWC) and osmotic potential in the functional leaves and developed osmotic adjustment with an increase in the contents of free amino acids, soluble sugars, inorganic K, and nitrate as compared to well-watered plants. In drought-stressed plants, nitrogen-metabolizing enzyme activities of nitrogen reductase (NR), glutamine synthetase (GS), and glutamate synthase (GOGAT) were diminished significantly (P≤0.05) along with decreased chlorophyll content and soluble proteins. However, drought-stressed plants under K application not only exhibited higher osmotic adjustment with greater accumulation of osmolytes but also regulated nitrogen metabolism by maintaining higher enzyme activities, soluble proteins, and chlorophyll content in functional leaves as compared to the plants without K application. Siza 3 showed better stability in enzyme activities and resulted in 89% higher seed cotton yield under K2 as compared to K0 in drought-stressed plants, whereas this increase was 53% in the case of Simian 3. The results of the study suggested that K application enhances cotton plants' potential for sustaining high nitrogen-metabolizing enzyme activities and related components to supplement osmotic adjustment under soil drought conditions. Copyright © 2017

  6. Relationship Between Piercing-Sucking Insect Control and Internal Lint and Seed Rot in Southeastern Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Medrano, Enrique G; Bell, Alois A; Greene, Jeremy K; Roberts, Phillip M; Bacheler, Jack S; Marois, James J; Wright, David L; Esquivel, Jesus F; Nichols, Robert L; Duke, Sara

    2015-08-01

    In 1999, crop consultants scouting for stink bugs (Hemiptera spp.) in South Carolina discovered a formerly unobserved seed rot of cotton that caused yield losses ranging from 10 to 15% in certain fields. The disease has subsequently been reported in fields throughout the southeastern Cotton Belt. Externally, diseased bolls appeared undamaged; internally, green fruit contain pink to dark brown, damp, deformed lint, and necrotic seeds. In greenhouse experiments, we demonstrated transmission of the opportunistic bacterium Pantoea agglomerans by the southern green stink bug, Nezara viridula (L.). Here, green bolls were sampled from stink bug management plots (insecticide protected or nontreated) from four South Atlantic coast states (North Carolina, South Carolina, Georgia, and Florida) to determine disease incidence in the field and its association with piercing-sucking insects feeding. A logistic regression analysis of the boll damage data revealed that disease was 24 times more likely to occur (P = 0.004) in bolls collected from plots in Florida, where evidence of pest pressure was highest, than in bolls harvested in NC with the lowest detected insect pressure. Fruit from plots treated with insecticide, a treatment which reduced transmission agent numbers, were 4 times less likely to be diseased than bolls from unprotected sites (P = 0.002). Overall, punctured bolls were 125 times more likely to also have disease symptoms than nonpunctured bolls, irrespective of whether or not plots were protected with insecticides (P = 0.0001). Much of the damage to cotton bolls that is commonly attributed to stink bug feeding is likely the resulting effect of vectored pathogens. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  7. Variations in seed protein content of cotton (Gossypium hirsutum L.) mutant lines by in vivo and in vitro mutagenesis.

    Science.gov (United States)

    Muthusamy, Annamalai; Jayabalan, Narayanasamy

    2013-01-01

    The present work describes the influence of gamma irradiation (GR), ethyl methane sulphonate (EMS) and sodium azide (SA) treatment on yield and protein content of selected mutant lines of cotton. Seeds of MCU 5 and MCU 11 were exposed to gamma rays (GR), ethyl methane sulphonate (EMS) and sodium azide (SA). Lower dose of gamma irradiation (100-500 Gy), 10-50 mM EMS and SA at lower concentration effectively influences in improving the yield and protein content. Significant increase in yield (258.9 g plant(-1)) and protein content (18.63 mg g(-1) d. wt.) as compared to parental lines was noted in M2 generations. During the subsequent field trials, number of mutant lines varied morphologically in terms of yield as well as biochemical characters such as protein. The selected mutant lines were bred true to their characters in M3 and M4 generations. The significant increase in protein content and profiles of the mutant lines with range of 10.21-18.63 mg g(-1). The SDS-PAGE analysis of mutant lines revealed 9 distinct bands of different intensities with range of 26-81 kDa. The difference in intensity of bands was more (41, 50 and 58 kDa) in the mutant lines obtained from in vitro mutation than in vivo mutation. Significance of such stimulation in protein content correlated with yielding ability of the mutant lines of cotton in terms of seed weight per plant. The results confirm that in cotton it is possible to enhance the both yield and biochemical characters by in vivo and in vitro mutagenic treatments.

  8. Estimates of genetic parameters from line x tester mating design for some quantitative traits in upload cotton, gossypium hirsutum L

    International Nuclear Information System (INIS)

    Baloch, M.H.; Kumbher, M.B.; Jatoi, W.A.

    2008-01-01

    Combining abilities of cotton varieties were evaluated using a line x tester design with eight lines and 4 testers. Good performance combination was found between the varieties CRIS-134 and BH-147. The former was a good candidate for fibre length improvement and the latter, a good parent for yield improvement. The specific combining ability suggested that both additive and dominant genes controlled the characters. Hybrid performance per se may be used to predict the parental performance for specific combining ability and thus for hybrid crop development. (author)

  9. Screening of post emergence herbicides for weed control in cotton (GOSSYPIUM HIRSUTUM) and their effect on yield and yield components

    International Nuclear Information System (INIS)

    Hussain, N.; Khan, M.B.; Khan, M.A.; Hameed, R.A.

    2005-01-01

    Response of varying herbicides at different levels: round up 490 G/L at the rate of 4.7 L ha/sup -1/ and 1.5 L ha/sup -1/ (Glyphosat) and Gramaxone 20 EC (Paraquat) at the rate of 2.5 L ha/sup -1/ against untreated (control, were investigated to cotton cultivar CIM-473 under field conditions during Kharif 2002 at Agronomic Research Area. Central Cotton Research Institute, Multan. Significant control of weeds and increase in yield and yield contributing factors were observed. It was indicated that maximum yield and weed control were obtained by using Round up (Glyphosate) at the rate of 4.7 L ha/sup -1/ as compared to other treatments including untreated (control). Average boll weight was not significant among treatments but significant against control. Maximum net profit was obtained from Round up 490 G/L when treated at the rate of 4.7 L ha/sup -1/ than all other treatments. (author)

  10. Fine mapping and candidate gene analysis of the virescent gene v 1 in Upland cotton (Gossypium hirsutum).

    Science.gov (United States)

    Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun

    2018-02-01

    The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the

  11. Effect of Phosphorus Fertilizer and Water Stress on Protein and Phenolic Contents in Cotton (Gossypium Hirsutum L.)

    International Nuclear Information System (INIS)

    Abbas, Z.; Muhammad, S.; Murtaza, G.; Ahmad, I.; Shakeel, A.; Islam, M.; Ahmad, M.; Abdullah, M.

    2015-01-01

    Crop quality and production are affected by various fertilizers and water stress. In present research, the response of cotton variety CIM-496 to water stress and phosphorus fertilizer was investigated. Samples were collected after 90 days of planting. Kjeldahl method and thin layer chromatography (TLC) were used for the quantitative and qualitative analysis of total protein and phenolic compounds, respectively. Proteins were greatly affected by fertilizer treatment and water stress, but phenolic compounds remained unchanged upon fertilizer treatment. However, they were greatly affected by irrigation and water stress. Crop treated with 100 kg ha/sup -1/ P/sub 2/O/sub 5/ under water stress maintained high protein content as compared to unfertilized and no water stress treatments. However, phenolic compounds were found higher in fully irrigated plants as compared to water stress ones. Fertilizer treatments had no considerable effect on phenolic compounds. (author)

  12. Identification and application of biocontrol agents against Cotton leaf curl virus disease in Gossypium hirsutum under greenhouse conditions

    Directory of Open Access Journals (Sweden)

    Memoona Ramzan

    2016-05-01

    Full Text Available Biological control is a novel approach in crop protection. Bacteria, such as Bacillus spp. and Pseudomonas spp., are reported for this purpose and some of their products are already commercially available. In this study, the rhizosphere and phyllosphere of healthy cotton plants were used as a source of bacterial isolates with properties of potential biocontrol agents. The isolates were screened for phosphate solubilization activity, indole acetic acid (IAA production and antifungal activity. Two isolates, S1HL3 and S1HL4, showed phosphate solubilization and IAA production simultaneously, while another two, JS2HR4 and JS3HR2, demonstrated potential to inhibit fungal pathogens. These bacteria were identified as Pseudomonas aeruginosa (S1HL3, Burkholderia sp. (S1HL4 and Bacillus sp. (JS2HR4 and JS3HR2 based on biochemical and molecular characteristics. The isolates were tested against Cotton leaf curl virus (CLCuV in greenhouse conditions, both as individual bacterial isolates and consortia. Treated plants were healthy as compared to control plants, where up to 74% of the plants were symptomatic for CLCuV infection. Maximum inhibition of CLCuV was observed in the plants treated with a mixture of bacterial isolates: the viral load in the treated plants was only 0.4% vs. up to 74% in controls. This treatment consortium included P. aeruginosa S1HL3, Burkholderia sp. S1HL4 and Bacillus spp. isolates, JS2HR4 and JS3HR2. The principal-component biplot showed a highly significant correlation between the viral load percentage and the disease incidence.

  13. Controle de plantas daninhas com cyanazine aplicado em mistura com outros herbicidas, na cultura do algodão (Gossypium hirsutum L. Weed control in cotton (Gossypium hirsutum L. with cyanazine and other herbicides

    Directory of Open Access Journals (Sweden)

    Julio Pedro Laca-Buendia

    1985-12-01

    Full Text Available Com a finalidade de estudar a mistura de tanque mais eficiente com cyanazine em aplicação de pré-emergência na cultura algodoeira (Gossypium hirsutum L. , foram estudados os seguintes tratamentos: cyanazine + diuron nas doses de 0,8 + 0,8 kg i.a/ha e 1,0 + 1,0 kg i.a/ha; cyanazine+ oryzalin , nas do sés de 1,2 + 0,8 kg i.a/ha e 1,6 + 1,2 kg i.a/h a; cyanazyne + metol a chlor, nas doses de 1,4 + 2,0 kg i.a/ha e 1,75 + 2,52 kg i.a/ ha;cianazine na dose de 1,75 kg i.a /ha; oryzalin na dose de 1,12 kg i.a/ha; metol achlor na dose de 2,52 kg i.a /ha e diuron na dose de 1,6 kg i.a /ha. Para efeito de comparação, utilizou-se uma testemunha sem capina e outra com capina manual. Nenhum tratamento apresentou injúria para as plantas de algodão e não houve diferenças significativas para o "stand" inicial. Já no "stand" final, a testemunha sem capina apresentou o menor número de plantas, sendo que não houve diferenças significativas dos outros tratamentos com a testemunha capinada. Para o rendimento, a mistura cyanazine + metolachior em ambas as doses estudadas, não apresentaram diferenças significativas da testemunha capinada. Quanto à altura da planta, peso de 100 sementes, porcentagem e índice de fibras não houve diferenças significativas entre os tratamentos estudados, somente o peso do capulho foi afetado pelo oryzalin. Pela avaliação visual (EWRC 1 a 9*, os herbicidas apres entaram um controle satisfatório somente até os 30 dias após aplicação, sendo que a mistura cyanazine + metolachlor foi efici ente quanto a testemunha capinada. No controle da Portulaca oleracea , a mistura cyanazine + oryzalin na maior dose e oryzalin apresentaram 71,4% de controle ate os 30 dias e 79,4% e 82,4%, respectivamente, até 45 dias da aplicação. Para Amaranthus sp., à exceção da cyanazine e cyanazine + diuron nas doses menores, não apresentaram nenhum controle, sendo que os outros herbicidas controlaram com eficiência superior a 70

  14. Improvement of growth and productivity of cotton (Gossypium hirsutum L. through foliar applications of naphthalene acetic acid

    Directory of Open Access Journals (Sweden)

    Shazia Parveen

    2017-05-01

    Full Text Available Plant growth regulators like naphthalene acetic acid (NAA positively affect the growth and yield of crop plants. An experiment was conducted to check the foliar application of NAA on growth and yield components of cotton variety Bt.121 under field condition at research area of agriculture farm near Cholistan Institute of Desert Studies (CIDS, The Islamia University of Bahawalpur, Pakistan. The experiment was comprised of foliar application of NAA (1% viz. T0 (control, T1 (One spray of NAA, T2 (Two sprays of NAA, T3 (Three sprays of NAA, T4 (Four sprays of NAA. The first foliar spray was applied at 45 days after sowing (DAS and later on it was continued with 15 days interval with skilled labour by hand pump sprayer. The experiment was laid out in randomized complete block design and each treatment was replicated three times. Data recorded on growth, chlorophyll contents, yield and yield components showed a significant increase with the application of NAA. Furthermore, earliness index, mean maturity date and production rate index were also influenced with foliar application of NAA. On the basis of growth and yield parameters it can be concluded that four spray of NAA (1% can be applied commercially under field conditions.

  15. Dynamics of soil diazotrophic community structure, diversity, and functioning during the cropping period of cotton (Gossypium hirsutum).

    Science.gov (United States)

    Rai, Sandhya; Singh, Dileep Kumar; Annapurna, Kannepalli

    2015-01-01

    The soil sampled at different growth stages along the cropping period of cotton were analyzed using various molecular tools: restriction fragment length polymorphism (RFLP), terminal restriction length polymorphism (T-RFLP), and cloning-sequencing. The cluster analysis of the diazotrophic community structure of early sampled soil (0, 15, and 30 days) was found to be more closely related to each other than the later sampled one. Phylogenetic and diversity analysis of sequences obtained from the first (0 Day; C0) and last soil sample (180 day; C180) confirmed the data. The phylogenetic analysis revealed that C0 was having more unique sequences than C180 (presence of γ-Proteobacteria exclusively in C0). A relatively higher richness of diazotrophic community sequences was observed in C0 (S(ACE) : 30.76; S(Chao1) : 20.94) than C180 (S(ACE) : 18.00; S(Chao1) : 18.00) while the evenness component of Shannon diversity index increased from C0 (0.97) to C180 (1.15). The impact of routine agricultural activities was more evident based on diazotrophic activity (measured by acetylene reduction assay) than its structure and diversity. The nitrogenase activity of C0 (1264.85 ± 35.7 ηmol of ethylene production g(-1) dry soil h(-1) ) was statistically higher when compared to all other values (p structure/diversity and N2 fixation rates. Thus, considerable functional redundancy of nifH was concluded to be existing at the experimental site. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Transcriptomic analysis of fiber strength in upland cotton chromosome introgression lines carrying different Gossypium barbadense chromosomal segments.

    Directory of Open Access Journals (Sweden)

    Lei Fang

    Full Text Available Fiber strength is the key trait that determines fiber quality in cotton, and it is closely related to secondary cell wall synthesis. To understand the mechanism underlying fiber strength, we compared fiber transcriptomes from different G. barbadense chromosome introgression lines (CSILs that had higher fiber strengths than their recipient, G. hirsutum acc. TM-1. A total of 18,288 differentially expressed genes (DEGs were detected between CSIL-35431 and CSIL-31010, two CSILs with stronger fiber and TM-1 during secondary cell wall synthesis. Functional classification and enrichment analysis revealed that these DEGs were enriched for secondary cell wall biogenesis, glucuronoxylan biosynthesis, cellulose biosynthesis, sugar-mediated signaling pathways, and fatty acid biosynthesis. Pathway analysis showed that these DEGs participated in starch and sucrose metabolism (328 genes, glycolysis/gluconeogenesis (122 genes, phenylpropanoid biosynthesis (101 genes, and oxidative phosphorylation (87 genes, etc. Moreover, the expression of MYB- and NAC-type transcription factor genes were also dramatically different between the CSILs and TM-1. Being different to those of CSIL-31134, CSIL-35431 and CSIL-31010, there were many genes for fatty acid degradation and biosynthesis, and also for carbohydrate metabolism that were down-regulated in CSIL-35368. Metabolic pathway analysis in the CSILs showed that different pathways were changed, and some changes at the same developmental stage in some pathways. Our results extended our understanding that carbonhydrate metabolic pathway and secondary cell wall biosynthesis can affect the fiber strength and suggested more genes and/or pathways be related to complex fiber strength formation process.

  17. Carbon source dependent somatic embryogenesis and plant regeneration in cotton, Gossypium hirsutum L. cv. SVPR2 through suspension cultures.

    Science.gov (United States)

    Ganesan, M; Jayabalan, N

    2005-10-01

    Highly reproducible and simple protocol for cotton somatic embryogenesis is described here by using different concentrations of maltose, glucose, sucrose and fructose. Maltose (30 g/l) is the best carbon source for embryogenic callus induction and glucose (30 g/l) was suitable for induction, maturation of embryoids and plant regeneration. Creamy white embryogenic calli of hypocotyl explants were formed on medium containing MS basal salts, myo-inositol (100 mg/l), thiamine HCI (0.3 mg/l), picloram (0.3 mg/l), Kin (0.1 mg/l) and maltose (30 g/l). During embryo induction and maturation, accelerated growth was observed in liquid medium containing NH3NO4 (1 g/l), picloram (2.0 mg/l), 2 ip (0.2 mg/l), Kin (0.1 mg/l) and glucose (30 g/l). Before embryoid induction, large clumps of embryogenic tissue were formed. These tissues only produced viable embryoids. Completely matured somatic embryos were germinated successfully on the medium fortified with MS salts, myo-inositol (50 mg/l), thiamine HCl (0.2 mg/l), GA3 (0.2 mg/l), BA (1.0 mg/l) and glucose (30 g/l). Compared with earlier reports, 65% of somatic embryo germination was observed. The abnormal embryo formation was highly reduced by using glucose (30 g/l) compared to other carbon sources. The regenerated plantlets were fertile but smaller in height than the seed derived control plants.

  18. Influence of cytokinins, auxins and polyamines on in vitro mass multiplication of cotton (Gossypium hirsutum L. cv. SVPR2).

    Science.gov (United States)

    Ganesan, M; Jayabalan, N

    2006-06-01

    In the present investigation, the influence of different forms of cytokinins, auxins and polyamines were tested for mass multiplication and regeneration of cotton. Initially, for the identification of effective concentration for multiple shoot induction, various concentrations of BAP, Kin and 2iP along with IAA and NAA were tested. Among tested concentrations, media fortified with MS salts; B5 vitamins; 30 g/l, glucose; 2.0 mg/l, 2iP; 2.0 mg/l, IAA and 0.7 % agar showed best response for multiplication of shoot tip explants (20 shoots per shoot tip explants). In nodal explants, maximum of 18.6 shoots were obtained in the media fortified with MS salts, B5 vitamins, 30 g/l, glucose, 2.0 mg/l, 2iP, 1.0 mg/l, NAA and 0.7 % agar. Effect of different concentrations of polyamines like spermidine and putrescine were also tested along with the above said multiplication media. Among the various treatments, 20 mg/l of putrescine showed best response and the multiple of shoots were increased to 26.5 shoots per shoot tip explants and 24.5 shoots per nodal explants. Elongation of shoots was achieved on multiple shoot induction medium. Significant number of roots were initiated in the medium supplemented with MS salts, vitamin B5 and IBA (2.0 mg/l). The frequency of root induction was increased by addition of, PVP (10 mg/l) along with root induction medium and after 2 weeks, the roots reached the maximum length of 22 cm. Further, these plantlets were hardened by using sand, soil and vermiculate in 1:1:1 ratio. The hardened plants were transferred to the environmental growth chamber for proper acclimatization. The hardened plants were then transferred to field for boll yielding and they exhibited 100% survival.

  19. Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

    Science.gov (United States)

    Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

    2017-03-01

    An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

  20. A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

    Science.gov (United States)

    Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

  1. Propriedades físicas e sensoriais da carne de cordeiros Santa Inês terminados em dietas com diferentes níveis de caroço de algodão integral (Gossypium hirsutum Physical and sensorial properties of Santa Ines lamb meat terminated in diets with increasing levels of whole cotton seed (Gossypium hirsutum

    Directory of Open Access Journals (Sweden)

    Thereza Raquel de Lucena Vieira

    2010-06-01

    Full Text Available Esta pesquisa teve como objetivo avaliar o efeito de dietas de terminação contendo diferentes níveis (0, 20, 30 e 40% de caroço de algodão integral (Gossypium hirsutum sobre os parâmetros físicos e sensoriais da carne de vinte e quatro cordeiros da raça Santa Inês. Foram avaliados os parâmetros de pH, capacidade de retenção de água (CRA, perda de peso por cocção (PPC, textura e cor, além dos parâmetros sensoriais de sabor, aroma, cor e textura. Apenas o parâmetro cor da carne ovina sofreu influência significativa da adição do caroço de algodão integral, observando-se variações para as coordenadas b* e L* (antes da cocção. Verificou-se também que os tratamentos apresentaram influência (p The objective of this research was to evaluate the effect of termination diets containing increasing levels (0, 20, 30, and 40% of whole cotton seed (Gossypium hirsutum on the physical (pH, water holding capacity, cooking losses, texture, colour and sensory parameters (flavour, odour, colour, texture of the lamb meat of twenty four Santa Ines sheep. Only the b* and L* colour parameters of the lamb meat were significantly affected by the addition of different levels of whole cotton seed to the diet. The inclusion of the whole cotton seed in the diet of the Santa Ines sheep also influenced sensory attributes such as natural colour, odour, and characteristic flavour. Based on these observations, considering the physical and sensory attributes of the lamb meat, the use of whole cotton seed at a 40% level for sheep in termination for short periods, i.e., up to 90 days, is recommended.

  2. (Gossypium hirsutum L.) CONTRE LA FUSARIOSE EFFECT ...

    African Journals Online (AJOL)

    EFFECT OFOLIGOSACCHARIDE FRACTION OF Fusarium oxysporum f. sp. vasinfectum ON COTTON PROTECTION (Gossypium hirsutum L.) AGAINST FUSARIUM WILT. R. A. N'GORAN épse BLA1,2, H. T. KOUAKOU2, F. K. Y. KONAN2, B. CAMARA1,. N. K. KOUASSI3 et D. KONE1. 1Laboratoire de Physiologie Végétale, ...

  3. Regulation of auxin on secondary cell wall cellulose biosynthesis in developing cotton fibers

    Science.gov (United States)

    Cotton (Gossypium hirsutum L.) fibers are unicellular trichomes that differentiate from epidermal cells of developing cotton ovules. Mature fibers exhibit thickened secondary walls composed of nearly pure cellulose. Cotton fiber development is divided into four overlapping phases, 1) initiation sta...

  4. Resistance and Resistant Reaction of Gossypium arboreum to the Reniform, Nematode, Rotylenchulus reniformis

    Science.gov (United States)

    Carter, William W.

    1981-01-01

    Gossypium arboreum 'Nanking CB 1402' possessed a high level of resistance to Rotylenchulus reniformis. Within 16 h, the nematode penetrated roots of resistant and susceptible cottons equally. After 36 h, significantly fewer nematodes were found in resistant roots. Larvae fed in either an endodermal or pericyclic cell and had no specificity for root tissue of a particular age. In roots of resistant G. arboreum '1402,' wall breakdown of pericyclic cells was evident after 3 d, endodermal and cortical cells collapsed, and the hypertrophied pericyclic cells disintegrated within 12 d. Cell walls immediately adjacent to the nematode's head were thickened and more safranin positive in resistant than in susceptible cotton cultivars. Several other cultivars of G. arboreum were also resistant to R. reniformis, based on nematode fecundity and percent egg reduction. PMID:19300777

  5. Determination of Attributes in Cotton (Gossypium hirsutum L. Genotypes in Corn-Soybean Rotation Associated with Acid Amended Soils in the Colombian Eastern Plains

    Directory of Open Access Journals (Sweden)

    Luis Fernando Campuzano Duque

    2015-07-01

    Full Text Available For the last 15 years, Colombia has developed a research process leading to the expansion of its agricultural frontier at the flat well drained savannas of the Eastern Plains, by improving predominantly acid soils with liming to increase base saturation with depth, vertical liming —as its referred locally—, crop rotation with rice, corn, soybeans, and with the potential to include other crops like cotton in the rotation system. To achieve this, a pioneering research in Colombia was conducted to determine the adaptation of cotton in the acid conditions of the high plains improved sheets. An Agronomic evaluation test was developed using five elite genotypes of cotton in a design of a randomized complete block at four locations in soils with base saturation above 80 %. The results identified a genotype (LC-156, which presented an adaptation to the high plains, associated with an average yield of 2.2 t/ha of cottonseed, 1.5 t/ha of cotton fiber type medium-long, a percentage of fiber extraction above 36.0 %. The comparative advantage of this region for sustainable cotton production is given by the yield of cotton fiber —which ishigher than the national average—, to the 33.2 % reduction in production costs, the quality of long/medium-fiber destined for export and the absence of the pest insect of greatest economic impact in Colombia: the weevil (Anthonomus grandis Boheman.

  6. CORRELACIONES Y ANÁLISIS DE SENDERO EN ALGODÓN (Gossypium hirsutum L. EN EL CARIBE COLOMBIANO CORRELATIONS AND PATH ANALYSIS IN COTTON (Gossypium hirsutum L. IN THE COLOMBIAN CARIBBEAN

    Directory of Open Access Journals (Sweden)

    Miguel Mariano Espitia Camacho

    2008-06-01

    Full Text Available El cultivo del algodón es la principal actividad agrícola en la economía del Caribe colombiano en el segundo semestre del año y el principal abastecedor de fibra a la industria nacional desde hace aproximadamente 60 años. El objetivo de este trabajo fue estimar las correlaciones fenotípicas, genéticas y ambientales, entre 11 caracteres agronómicos y realizar un análisis de sendero para rendimiento de fibra. Se utilizaron los datos de la evaluación agronómica de 10 genotipos de algodón en ocho ambientes del Caribe colombiano. En cada ambiente se utilizó un diseño experimental de bloques completos al azar con cuatro repeticiones. Los resultados indicaron que las correlaciones genéticas fueron superiores a las fenotípicas y ambientales. El rendimiento de fibra (REF presentó las mayores correlaciones fenotípicas, genéticas y fenotipicas parciales con el porcentaje de fibra (PFI, el rendimiento de algodón - semilla (RAS y el peso de mota (PMO, con valores de r > 0,43 (PThe cotton crop is the main agricultural activity in the economy of the colombian Caribbean in the second semester of the year and the main supplier of fibre to national industry for about 60 years. The objective of this work was to estimate the phenotypic, genetic and environmental correlations, between 11 agronomic characters and to make a path analysis for fibre yield. Data of agronomic evaluation of 10 genotypes of cotton in eight environments of the colombian Caribbean were used. In each environment experimental design at random complete blocks with four repetitions were used. The results indicated that genetic correlations were superior to phenotypic and environmental correlations. Fibre yield (FIY presented the highest phenotypic, genetic and partial phenotypic correlations with ginning percentage (GP, seed-cotton yield (SCY and boll weight (BOW with values of r > 0,43 (P<0,01. The FIP (0,810 was the cause variable that showed the greatest direct effect on

  7. Evaluation of different carbon sources for high frequency callus culture with reduced phenolic secretion in cotton (Gossypium hirsutum L. cv. SVPR-2

    Directory of Open Access Journals (Sweden)

    G. Prem Kumar

    2015-09-01

    Full Text Available An efficient protocol was developed to control excessive phenolic compound secretion during callus culture of cotton. As cotton is naturally rich in phenolic compounds factors influencing the phenolic compound secretion, callus induction and proliferation were optimized for getting high frequency callus culture. Different carbon sources such as fructose, glucose, sucrose and maltose were tested at various concentrations to control phenolic secretion in callus culture. Among them, 3% maltose was found to be the best carbon source for effectively controlling phenolic secretion in callus induction medium. High frequency of callus induction was obtained on MSB5 medium supplemented with 3% Maltose, 2,4-D (0.90 μM and Kinetin (4.60 μM from both cotyledon and hypocotyl explants. The best result of callus induction was obtained with hypocotyl explant (94.90% followed by cotyledon explant (85.20%. MSB5 medium supplemented with 2,4-D (0.45 μM along with 2iP (2.95 μM gave tremendous proliferation of callus with high percentage of response. Varying degrees of colors and textures of callus were observed under different hormone treatments. The present study offers a solution for controlling phenolic secretion in cotton callus culture by adjusting carbon sources without adding any additives and evaluates the manipulation of plant growth regulators for efficient callus culture of SVPR-2 cotton cultivar.

  8. Overexpression of a cotton (Gossypium hirsutum) WRKY gene, GhWRKY34, in Arabidopsis enhances salt-tolerance of the transgenic plants.

    Science.gov (United States)

    Zhou, Li; Wang, Na-Na; Gong, Si-Ying; Lu, Rui; Li, Yang; Li, Xue-Bao

    2015-11-01

    Soil salinity is one of the most serious threats in world agriculture, and often influences cotton growth and development, resulting in a significant loss in cotton crop yield. WRKY transcription factors are involved in plant response to high salinity stress, but little is known about the role of WRKY transcription factors in cotton so far. In this study, a member (GhWRKY34) of cotton WRKY family was functionally characterized. This protein containing a WRKY domain and a zinc-finger motif belongs to group III of cotton WRKY family. Subcellular localization assay indicated that GhWRKY34 is localized to the cell nucleus. Overexpression of GhWRKY34 in Arabidopsis enhanced the transgenic plant tolerance to salt stress. Several parameters (such as seed germination, green cotyledons, root length and chlorophyll content) in the GhWRKY34 transgenic lines were significantly higher than those in wild type under NaCl treatment. On the contrary, the GhWRKY34 transgenic plants exhibited a substantially lower ratio of Na(+)/K(+) in leaves and roots dealing with salt stress, compared with wild type. Growth status of the GhWRKY34 transgenic plants was much better than that of wild type under salt stress. Expressions of the stress-related genes were remarkably up-regulated in the transgenic plants under salt stress, compared with those in wild type. Based on the data presented in this study, we hypothesize that GhWRKY34 as a positive transcription regulator may function in plant response to high salinity stress through maintaining the Na(+)/K(+) homeostasis as well as activating the salt stress-related genes in cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Molecular Evolution and Phylogenetic Analysis of Eight COL Superfamily Genes in Group I Related to Photoperiodic Regulation of Flowering Time in Wild and Domesticated Cotton (Gossypium) Species

    Science.gov (United States)

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson’s correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  10. ptxD gene in combination with phosphite serves as a highly effective selection system to generate transgenic cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Pandeya, Devendra; Campbell, LeAnne M; Nunes, Eugenia; Lopez-Arredondo, Damar L; Janga, Madhusudhana R; Herrera-Estrella, Luis; Rathore, Keerti S

    2017-12-01

    This report demonstrates the usefulness of ptxD/phosphite as a selection system that not only provides a highly efficient and simple means to generate transgenic cotton plants, but also helps address many of the concerns related to the use of antibiotic and herbicide resistance genes in the production of transgenic crops. Two of the most popular dominant selectable marker systems for plant transformation are based on either antibiotic or herbicide resistance genes. Due to concerns regarding their safety and in order to stack multiple traits in a single plant, there is a need for alternative selectable marker genes. The ptxD gene, derived from Pseudomonas stutzeri WM88, that confers to cells the ability to convert phosphite (Phi) into orthophosphate (Pi) offers an alternative selectable marker gene as demonstrated for tobacco and maize. Here, we show that the ptxD gene in combination with a protocol based on selection medium containing Phi, as the sole source of phosphorus (P), can serve as an effective and efficient system to select for transformed cells and generate transgenic cotton plants. Fluorescence microscopy examination of the cultures under selection and molecular analyses on the regenerated plants demonstrate the efficacy of the system in recovering cotton transformants following Agrobacterium-mediated transformation. Under the ptxD/Phi selection, an average of 3.43 transgenic events per 100 infected explants were recovered as opposed to only 0.41% recovery when bar/phosphinothricin (PPT) selection was used. The event recovery rates for nptII/kanamycin and hpt/hygromycin systems were 2.88 and 2.47%, respectively. Molecular analysis on regenerated events showed a selection efficiency of ~ 97% under the ptxD/Phi system. Thus, ptxD/Phi has proven to be a very efficient, positive selection system for the generation of transgenic cotton plants with equal or higher transformation efficiencies compared to the commonly used, negative selection systems.

  11. Efeitos de misturas de dinitramine e diuron em pré-plantio incorporado na cultura do algodão (Gossypium hirsutum L. Effects of dinitramine and diuron mixtures applied pre-planting incorporated on cotton (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    R. Victoria Filho

    1982-06-01

    dinitramine and diuron mixtures on weed control in cotton at two experiments at Casa Branca - SP on a clay soil (3 ,6% organic matter and Jaboticabal - SP on a clay loam (2,3% organic matter. The cotton variety sowed was IAC-13 -1 at Casa Branca (nov, 05, 1975 and RM-4A at Jaboticabal (dec. 3, 1975. The experiment had a design of randomized blocks with the treatments dinitramine at 0.25 kg; 0.40 kg; 0.50 kg/ha; diuron at 1.20 kg; 1.50 kg; 1.80 kg/ha and ali dinitramine + diuron mixture s with this rates; one treatment with trifluralin + diuron at 1.00 + 1.20 kg/ha, and one hoeded treatment. The best weed control results on the clay soil were obta ined by the mixtures when compared with the dinitramine and diuron appl ication on large crabgrass (Digitaria sanguinallis (L. Scop., go ose gras s (Eleusine indica (L . Gaertn., Paraguay starbur (Acanthospermum australe ( Loef. O. Kuntze, Borreria alata (Aubl. D.C., Brasil callalily (Richardia brasiliensis Gomez and sidas (Sida spp. but on the clay loam soil were the most important weeds we re la r ge c rabg ras s , s outhe rn s andbur (Cenchrus echinatus L. , West Indies pennisetum (Pennisetum setosum (L. Rich. Pers, Paraguay sandbur, Brasil callalily and sidas the be st weed control results were obtained with trifluralin + diuron and with dinitramine at 0.25 kg; 0.40 kg; 0.50 kg in mixture with diuron at 1.80 kg/ha. The treatments used didn't present any phyto toxicity to cotton at the initial development and there wasn't significant difference in the total yield.

  12. Responses of reniform nematode and browntop millet to tillage, cover crop, and herbicides in cotton

    Science.gov (United States)

    Cropping practices that reduce competition from reniform nematode (Rotylenchulus reniformis) and browntop millet (Urochlora ramosum) may help minimize losses in cotton (Gossypium hirsutum). The impacts of tillage, rye cover crop, and preemergence and postemergence herbicides on cotton yields, renifo...

  13. Cottonseed protein, oil, and mineral status in near-isogenic Gossypium hirsutum cotton lines expressing fuzzy/linted and fuzzless/linted seed phenotypes under field conditions

    Directory of Open Access Journals (Sweden)

    Nacer eBellaloui

    2015-03-01

    Full Text Available Cotton is an important crop in the world and is a major source of oil for human consumption and cotton meal for livestock. Cottonseed nutrition (seed composition: protein, oil, and minerals determine the quality of seeds. Therefore, maintaining optimum levels of cottonseed nutrition is critical. Physiological and genetic mechanisms controlling the levels of these constituents in cottonseed are still largely unknown. Our previous research conducted under greenhouse conditions showed that seed and leaf nutrition differed between fuzzless and fuzzy seed isolines. Therefore, the objective of this research was to investigate the seed fuzz phenotype (trait effects on seed protein, oil, N, C, S, and minerals in five sets of near-isogenic mutant cotton lines for seed fuzz in a two-year experiment under field condition to evaluate the stability of the effect of the trait on seed nutrition. The isolines (genotypes in each set differ for the seed fuzz trait (fuzzless/linted seed line, N lines, and fuzzy/linted seed line, F lines. Results showed that seed protein was higher in the fuzzy genotype in all sets, but seed oil was higher in fuzzless genotype in all sets. The concentrations of seed Ca and C were higher in all fuzzless genotypes, but N, S, B, Fe, and Zn were higher in most of the fuzzy genotypes. Generally, minerals were higher in leaves of F lines, suggesting the translocation of minerals from leaves to seeds was limited. The research demonstrated that fiber development could be involved in cottonseed composition. This may be due to the involvement of fiber development in carbon and nitrogen metabolism, and the mobility of nutrients from leaves (source to seed (sink. This information is beneficial to breeders to consider fuzzless cottonseed for potential protein and oil use and select for higher oil or higher protein content, and to physiologists to further understand the mobility of minerals to increase the quality of cottonseed nutrition for

  14. High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

    Directory of Open Access Journals (Sweden)

    Amarjeet Kumar Singh

    Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

  15. EPIDEMIOLOGICAL ASPECTS OF COTTON RAMULOSIS (Colletotrichum gossypii SOUTH. Var. cephalosporioides COSTA ASPECTOS EPIDEMIOLÓGICOS DA RAMULOSE (Colletotrichum gossypii South. var. cephalosporioides Costa DO ALGODOEIRO (Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Fuad Calil

    2007-09-01

    Full Text Available

    These experiments deal with the effects of outbreak of early, medium and late developing ramulosis on the IAC-13.l variety of cotton, which was seeded at three different intervals in Itauçu (Goiás—Brazil. The effects of the ramulosis on the height and weight of the plants, on the number of bolls, and on the weight of the cotton seeds and lints, were studied. The experiments were installed in a flat area of red latosoil. The experimental design was one of random blocks with six repetitions and the plants were classified, at the end of their vegetative growth, into the following categories: healthy, early ramulosis, medium ramulosis and late developing ramulosis. The early and medium ramulosis affected more significantly the studied parameters, and it was observed that varieties of cotton which were moderately resistant in relation to ramulosis, can be severely affected during growing seasons of heavy rains such as the 1975/76 season.

    Estudaram-se os efeitos da incidência precoce, mediana e tardia de ramulose sobre o peso e altura das plantas, número de capulhos, peso das sementes e da pluma de algodoeiro do cultivar IAC-l3.l em três épocas de semeadura (21/10/75, 21/11/75 e 23/12/75 no município de Itauçu (GO. O experimento foi instalado em região plana com latossolo vermelho. Foram utilizados blocos casualizados com seis repetições e plantas no final do ciclo vegetativo foram classificadas em quatro tipos: sadias, com ramulose precoce, com ramulose mediana ou com ramulose tardia. Concluiu-se que a forma precoce e também a mediana foram as que afetaram mais significativamente os parâmetros aferidos, e que cultivares tidos como de razoável comportamento em relação à ramulose, podem ser severamente afetados em anos agrícolas muito chuvosos como foi o de 1975/76.

  16. Assesment of economic benefits of foliarly applied osmoprotectants in alleviating the adverse effects of water stress on growth and yield of cotton (gossypium hirsutum L.)

    International Nuclear Information System (INIS)

    Zafar, Z. U.; Hussain, K.; Athar, H. U. R.

    2015-01-01

    Water stress reduces crop growth and productivity by affecting various physiological and biochemical processes. Although foliar application of osmoprotectants alleviates the detrimental effects of drought stress growth and productivity of crops, its economic benefits on large scale has not been explored yet. The studies were carried out to quantify the interactive effects of some osmoprotectantsand various watering regimes on cotton crop. The treatments consisted of water stress and osmoprotectant applications ((a) two watering regimes (well watered, 2689m /sup 3/ water; drought stressed, 2078m /sup 3/), and (b) three osmoprotectants (untreated check; water spray containing 0.1 percentage Tween-80; salicylic acid (100 mg L /sup -1/); proline (100 mg L /sup -1/); glycine betaine (100 mg L /sup -1/)) in split plot design. The crop was subjected to drought stress at day 45 after sowing, i.e. at the flowering stage. The solutions of osmoprotectants were foliarly applied after two weeks of imposition of water stress (at the peak flowering stage). The results showed that imposition of water stress caused substantial reduction in plant growth, biological yield, fruit production, and fiber characteristics as compared to fully irrigated cotton crop. However, the application of osmoprotectants was found effective in off-setting the negative impacts of drought stress. The exogenous application of salicylic acid (100 mgL /sup -1/) caused improvement by 47.9 percentage, 36.5 percentage, 17.4 percentage, 4.86 percentage and 9.9 percentage in main stem height, biological yield, fruit production, fiber length and seed cotton yield over an untreated check, respectively. The efficiency of various osmoprotectants was in order of salicylic acid > glycinebetaine > proline in alleviating the harmful effects of drought stress. The usage of osmoprotectants was also found most cost-effective and the value for money. The cost-benefit ratio was 1:9.1, 1:3.9 and 1:1.7 by spraying of salicylic

  17. Association mapping of resistance to Verticillium wilt in Gossypium ...

    African Journals Online (AJOL)

    Verticillium wilt is a major disease affecting the growth of cotton. For screening the resistant genes, 320 Gossypium hirsutum germplasms were evaluated in Verticillium nursery, and association mapping was used to detect the markers associated with the Verticillium wilt resistance. 106 microsatellite marker primer pairs ...

  18. Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.

    Science.gov (United States)

    Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang

    2018-03-08

    The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.

  19. Determinação do poder germinativo de sementes de variedades paulistas de algodoeiro (Gossypium hirsutum L. Studies on germination of cotton seeds

    Directory of Open Access Journals (Sweden)

    Eduardo Zink

    1969-01-01

    Full Text Available São relatados os resultados das determinações do poder germinativo de sementes de sete variedades paulistas de algodoeiro, provenientes de ensaios de competição de variedades instalados nos Estados de São Paulo e Paraná, no ano agrícola de 1966/67. Os testes de germinação foram efetuados simultaneamente no Laboratório de Sementes, do Instituto Agronômico do Estado de São Paulo, e no Laboratório Central, da Divisão de Sementes e Mudas, da Secretaria da Agricultura do Estado de São Paulo. Com referência a plântulas normais e plântulas anormais B (infetadas verificaram-se, conforme o caso, diferenças significativas entre localidades, entre variedades, entre laboratórios e entre substratos, bem como diversas interações envolvendo as variáveis mencionadas.Seeds of seven varieties of cotton produced at different regions of the States of São Paulo and Paraná (Brazil were submitted to germination tests at two laboratories: Instituto Agronômico de Campinas (IAC at 20 - 30°C and Divisão de Sementes e Mudas (DSM at 30°C. The substrata used for the tests were cotton towels desinfected differently at each laboratory. The statistical analysis for numbers of normal and abnormal plants (infected showed significant differences between regions, varieties, laboratories and substrata. Several significant interactions including these variables were also detected.

  20. Genetics of the ovule fuzzless trait in Gossypium arboreum germplasm line PI 615737

    Science.gov (United States)

    The diploid cotton species Gossypium arboreum possesses many favorable agronomic traits such as drought tolerance and disease resistance, which can be utilized in the development of improved upland cotton cultivars. The USDA National Plant Germplasm System maintains more than 1,600 G. arboreum acces...

  1. Weed flora, yield losses and weed control in cotton crop

    OpenAIRE

    Jabran, Khawar

    2016-01-01

    Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....

  2. Enriching an intraspecific genetic map and identifying QTL for fiber quality and yield component traits across multiple environments in Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Liu, Xueying; Teng, Zhonghua; Wang, Jinxia; Wu, Tiantian; Zhang, Zhiqin; Deng, Xianping; Fang, Xiaomei; Tan, Zhaoyun; Ali, Iftikhar; Liu, Dexin; Zhang, Jian; Liu, Dajun; Liu, Fang; Zhang, Zhengsheng

    2017-12-01

    Cotton is a significant commercial crop that plays an indispensable role in many domains. Constructing high-density genetic maps and identifying stable quantitative trait locus (QTL) controlling agronomic traits are necessary prerequisites for marker-assisted selection (MAS). A total of 14,899 SSR primer pairs designed from the genome sequence of G. raimondii were screened for polymorphic markers between mapping parents CCRI 35 and Yumian 1, and 712 SSR markers showing polymorphism were used to genotype 180 lines from a (CCRI 35 × Yumian 1) recombinant inbred line (RIL) population. Genetic linkage analysis was conducted on 726 loci obtained from the 712 polymorphic SSR markers, along with 1379 SSR loci obtained in our previous study, and a high-density genetic map with 2051 loci was constructed, which spanned 3508.29 cM with an average distance of 1.71 cM between adjacent markers. Marker orders on the linkage map are highly consistent with the corresponding physical orders on a G. hirsutum genome sequence. Based on fiber quality and yield component trait data collected from six environments, 113 QTLs were identified through two analytical methods. Among these 113 QTLs, 50 were considered stable (detected in multiple environments or for which phenotypic variance explained by additive effect was greater than environment effect), and 18 of these 50 were identified with stability by both methods. These 18 QTLs, including eleven for fiber quality and seven for yield component traits, could be priorities for MAS.

  3. Ionic and water relations of cotton (Gossypium hirsutum L. as influenced by various rates of K and Na in soil culture

    Directory of Open Access Journals (Sweden)

    L. Ali

    2009-05-01

    Full Text Available A pot study was conducted to investigate the growth response, ionic and water relations of two cotton varieties. Four levels of K and Na were developed after considering indigenous K, Na status in soil. The treatments of K + Na in mg kg-1 were adjusted as: 105 + 37.5, 135 + 30, 135 + 37.5 and 105 + 30 (control. Control treatment represented indigenous K and Na status of soil. Higher but non significant relative water contents were observed in treatments of135 + 30 mg kg-1 followed by 135 + 37.5 mg kg-1. The beneficial effects of Na with K application were observed greater in NIBGE-2 than in MNH-786. Both varieties varied non-significantly with respect to K:Na ratio in leaf, water potential and total chlorophyll contents. Significant relationship (R2=0.51, n= 4, average of four replicates was found between total dry weight and relative water contents in NIBGE-2.

  4. Insecticide use and practices among cotton farmers in northern ...

    African Journals Online (AJOL)

    Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...

  5. Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China : a simulation study

    NARCIS (Netherlands)

    Xia, J.

    1997-01-01

    Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on

  6. Environmental interaction, additive and non-additive genetic variability is involved in the expression of tissue and whole-plant heat tolerance in upland cotton (Gossypium hirsutum. L

    Directory of Open Access Journals (Sweden)

    Hafeez-ur-Rahman

    2006-01-01

    Full Text Available Heat tolerance is measured at tissue level by cellular membrane thermostability (CMT and at the whole plant level by the heat tolerance index (HTI. Eight upland cotton cultivars and 15 crosses were used to determine the type and extent of genetic variability associated with the expression of these traits between and within environments. Heat stress and non-stress conditions were used as the CMT environments and years for HTI. The wide variation in heterotic expression and combining ability effects observed for CMT and HTI suggest multigenic inheritance of these traits. Significant genetic variability across environments was evident but the traits were not highly heritable because of substantial environmental interaction. The available genetic variability included both additive and non-additive components, but the proportion of additive genetic variability was high for HTI. The parental cultivars CRIS-19 and CIM-448 were good donor parents for high CMT under heat-stressed conditions, and MNH-552 and N-Karishma under non-stressed conditions. Cultivar FH-634 was a good donor parent for HTI. The results show two types of general combining ability (GCA inheritance among high CMT parents: positive GCA inheritance expressed by CRIS-19 in the presence of heat stress and MNH-552 and N-Karishma in the absence of heat stress; and negative GCA inheritance expressed by FH-900 in the presence of heat stress. It was also evident that genes controlling high CMT in cultivar CRIS-19 were different from those present in the MNH-552, N-Karishma and FH-900 cultivars. Similarly, among high HTI parents, FH-634 showed positive and CIM-443 negative GCA inheritance. No significant relationship due to genetic causes existed between tissue and whole plant heat tolerance, diminishing the likelihood of simultaneous improvement and selection of the two traits.

  7. Genomics-enabled analysis of the emergent disease cotton bacterial blight.

    Directory of Open Access Journals (Sweden)

    Anne Z Phillips

    2017-09-01

    Full Text Available Cotton bacterial blight (CBB, an important disease of (Gossypium hirsutum in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars.

  8. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    Science.gov (United States)

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  9. Genome-wide divergence, haplotype distribution and population demographic histories for Gossypium hirsutum and Gossypium barbadense as revealed by genome-anchored SNPs

    Science.gov (United States)

    Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we exami...

  10. Molecular and Biochemical Characterization of Cotton Epicuticular Wax in Defense Against Cotton Leaf Curl Disease.

    Science.gov (United States)

    Khan, Muhammad Azmat Ullah; Shahid, Ahmad Ali; Rao, Abdul Qayyum; Bajwa, Kamran Shehzad; Samiullah, Tahir Rehman; Muzaffar, Adnan; Nasir, Idrees Ahmad; Husnain, Tayyab

    2015-12-01

    Gossypium arboreumis resistant to Cotton leaf curl Burewala virus and its cognate Cotton leaf curl Multan beta satellite ( CLCuBuV and CLCuMB ). However, the G. arboreum wax deficient mutant (GaWM3) is susceptible to CLCuV . Therefore, epicuticular wax was characterized both quantitatively and qualitatively for its role as physical barrier against whitefly mediated viral transmission and co-related with the titer of each viral component (DNA-A, alphasatellite and betasatellite) in plants. The hypothesis was the CLCuV titer in cotton is dependent on the amount of wax laid down on plant surface and the wax composition. Analysis of the presence of viral genes, namely alphasatellite, betasatellite and DNA-A, via real-time PCR in cotton species indicated that these genes are detectable in G. hirsutum , G. harknessii and GaWM3, whereas no particle was detected in G. arboreum . Quantitative wax analysis revealed that G. arboreum contained 183 μg.cm -2 as compared to GaWM3 with only 95 μg.cm -2 . G. hirsutum and G. harknessii had 130 μg.cm -2 and 146 μg.cm -2 , respectively. The GCMS results depicted that Lanceol, cis was 45% in G. harknessii . Heptadecanoic acid was dominant in G. arboreum with 25.6%. GaWM3 had 18% 1,2,-Benenedicarboxylic acid. G. hirsutum contained 25% diisooctyl ester. The whitefly feeding assay with Nile Blue dye showed no color in whiteflies gut fed on G. arboreum . In contrast, color was observed in the rest of whiteflies. From results, it was concluded that reduced quantity as well as absence of (1) 3-trifluoroacetoxytetradecane, (2) 2-piperidinone,n-|4-bromo-n-butyl|, (3) 4-heptafluorobutyroxypentadecane, (4) Silane, trichlorodocosyl-, (5) 6- Octadecenoic acid, methyl ester, and (6) Heptadecanoicacid,16-methyl-,methyl ester in wax could make plants susceptible to CLCuV , infested by whiteflies.

  11. Spectral discrimination of two pigweeds from cotton with different leaf colors

    Science.gov (United States)

    To implement strategies to control Palmer amaranth (Amaranthus palmeri S. Wats.) and redroot pigweed (Amaranthus retroflexus L.) infestations in cotton (Gossypium hirsutum L.) production systems, managers need effective techniques to identify the weeds. Leaf light reflectance measurements have shown...

  12. Reproduction and pathogenicity of endemic populations of Rotylenchulus reniformis on cotton

    Science.gov (United States)

    The reniform nematode (Rotylenchulus reniformis) is the predominant parasitic nematode of upland cotton (Gossypium hirsutum) in the southern United States. Little is known about variability in geographic isolates of reniform nematode. In order to evaluate the comparative reproduction and pathogenici...

  13. Screening cotton genotypes for seedling drought tolerance

    Directory of Open Access Journals (Sweden)

    Penna Julio C. Viglioni

    1998-01-01

    Full Text Available The objectives of this study were to adapt a screening method previously used to assess seedling drought tolerance in cereals for use in cotton (Gossypium hirsutum L. and to identify tolerant accessions among a wide range of genotypes. Ninety genotypes were screened in seven growth chamber experiments. Fifteen-day-old seedlings were subjected to four 4-day drought cycles, and plant survival was evaluated after each cycle. Three cycles are probably the minimum required in cotton work. Significant differences (at the 0.05 level or lower among entries were obtained in four of the seven experiments. A "confirmation test" with entries previously evaluated as "tolerant" (high survival and "susceptible" (low survival was run. A number of entries duplicated their earlier performance, but others did not, which indicates the need to reevaluate selections. Germplasms considered tolerant included: `IAC-13-1', `IAC-RM4-SM5', `Minas Sertaneja', `Acala 1517E-1' and `4521'. In general, the technique is simple, though time-consuming, with practical value for screening a large number of genotypes. Results from the screening tests generally agreed with field information. The screening procedure is suitable to select tolerant accessions from among a large number of entries in germplasm collections as a preliminary step in breeding for drought tolerance. This research also demonstrated the need to characterize the internal lack of uniformity in growth chambers to allow for adequate designs of experiments.

  14. Development of a core set of SSR markers for the characterization of Gossypium germplasm

    Science.gov (United States)

    Molecular markers such as simple sequence repeats (SSR) are a useful tool for characterizing genetic diversity of Gossypium germplasm collections. Genetic profiles by DNA fingerprinting of cotton accessions can only be compared among different collections if a common set of molecular markers are us...

  15. Evaluating cotton seed gland initiation by microscopy

    Science.gov (United States)

    Gossypol is a terpenoid aldehyde found in cotton (Gossypium hirsutum L.) glands and helps protect the seed from pests and pathogens. However, gossypol is toxic to many animals, so the seed is used mainly in cattle feed, as ruminants are tolerant to the effects of gossypol. In order to develop strat...

  16. Airborne multispectral detection of regrowth cotton fields

    Science.gov (United States)

    Regrowth of cotton, Gossypium hirsutum L., can provide boll weevils, Anthonomus grandis Boheman, with an extended opportunity to feed and reproduce beyond the production season. Effective methods for timely areawide detection of these potential host plants are critically needed to achieve eradicati...

  17. Genetic basis of some yield components in gossypium hirsutum l

    International Nuclear Information System (INIS)

    Javed, A.; Azhar, F.M.; Khan, I.A.; Rana, S.A.

    2014-01-01

    A 5 * 5 diallel analysis was conducted to study the inheritance of seed cotton yield, number of bolls and boll weight in Gossypium hirsutum L. using combining ability technique. The analysis of the data revealed that variance due to specific combining ability was significant for all the three traits signifying the importance of non additive gene action. The comparison of the parents showed that NF-801-2-37 was the best general combiner for seed cotton yield, number of bolls and boll weight followed by Acala-63-75. Best hybrid combinations identified were Acala-63-75 * NF-801-2-37 for seed cotton yield and DPL-61 * NF-801-2-37 for number of bolls and boll weight. Higher proportion of dominance variance in all three traits suggested delayed selection or use of heterosis breeding in crop improvement programs. (author)

  18. Comparison of growth, yield and fiber quality of the obsolete SA30 yellow leaf with four sets of modern yellow and green leaf near isogenic cotton (Gossypium hirsutum L.) lines

    Science.gov (United States)

    The Virescent Yellow leaf cotton line Seed Accession 30 (SA30) was crossed with four modern parental lines (DP5690, DES119, SG747 and MD51ne) to develop four sets of near isogenic lines (NILs) segregating for green and yellow leaves. Comparisons of these lines were made in the field in a two year re...

  19. The effect of herbivory on temporal and spatial dynamics of foliar nectar production in cotton and castor

    NARCIS (Netherlands)

    Wäckers, F.L.; Zuber, D.; Wunderlin, R.; Keller, F.

    2001-01-01

    The effects of feeding Spodoptera a littoralis (Boisd.) (Lepidoptera: Noctuidae) larvae on the quantity and distribution of extrafloral nectar production by leaves of castor ((Ricinus communis) and cotton (Gossypium herbaceum) were investigated. Following larval feeding, the total volume of nectar

  20. The effect of herbivory on temporal and spatial dynamics of foliar nectar production in cotton and castor

    NARCIS (Netherlands)

    Wäckers, F.L.; Zuber, D.; Wunderlin, R.; Keller, F.

    2001-01-01

    The effects of feeding Spodoptera littoralis(Boisd.) (Lepidoptera: Noctuidae) larvae on the quantity and distribution of extrafloral nectar production by leaves of castor (Ricinus communis) and cotton (Gossypium herbaceum) were investigated. Following larval feeding, the total volume of nectar

  1. Gossypium hirsutum L.

    Indian Academy of Sciences (India)

    dell

    Improvement of cotton fiber yield and quality is challenging due to the narrow ... The polymorphic information content (PIC) values ranged from 0.371 to ... Several DNA marker systems have been developed and applied to assess the genetic.

  2. (Gossypium barbadense) germplasm resources

    Indian Academy of Sciences (India)

    QI MA

    and JILIAN LI1∗. 1Cotton Research Institute, Xinjiang Academy of Agricultural and Reclamation ... respectively, are the two main methods used for studying ... ized plot design with a single-row plot and 80 individuals .... The mixed linear model.

  3. Effects of 1,1-Dimethylpiperidinium Chloride on the Pests and Allelochemicals of Cotton and Pecan.

    Science.gov (United States)

    P. A. Hedin; J. N. Jenkins; J. C. McCarty; J. E. Mulrooney; W. L. Parrott; A. Borazjani; C. H. Graves; T. H. Filer

    1984-01-01

    The growth regulator, PIX (mepiquat chloride - 1,1-dimethyl-piperdinium chloride), when applied to cotton (Gossypium hirsutum L.) and pecan (Carya illinoensis Koch), caused internode shortening. PIX did not elicit an increase in resistance in cotton to the tobacco budworm (Heliothis virescens (Fab.)], or in pecan...

  4. Population structure and genetic diversity of the boll weevil, Anthonomus grandis (Coleoptera: Curculionidae), on Gossypium in North America

    Science.gov (United States)

    While the boll weevil, Anthonomus grandis, has been identified as one of the most devastating pests in U.S. history, its origin and activity in Mexico, both on wild and cultivated cotton hosts (genus Gossypium), is poorly understood. Three forms (geographical or host-associated races) of A. grandis ...

  5. Using cotton plant residue to produce briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility

    2000-07-01

    In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)

  6. Efeito da época de plantio na produção e na ocorrência de pragas em culturas do algodoeiro (Gossypium hirsutum = Effect of planting date on the production and the occurrence of pests in the cotton (Gossypium hirsutum

    Directory of Open Access Journals (Sweden)

    José Janduí Soares

    2006-07-01

    Full Text Available O objetivo deste trabalho foi verificar o efeito da época de plantio na produção e ocorrência de pragas em culturas do algodoeiro. Foi analisada a influência da época de plantio no rendimento e na ocorrência de pragas nos cultivares de algodoeiro CNPA 7H e DeltapineAcala 90, em Formosa do Rio Preto, São Desidério e Luiz Eduardo Magalhães, no estado da Bahia, nos campos experimentais da Embrapa, instalados nas fazendas Independência, Mizote e Poletto, respectivamente. Quatro épocas foram avaliadas e os plantios foram feitos nos meses de novembro, dezembro e janeiro, safras 1998/1999 e 1999/2000, com intervalos de 15 dias entre cada plantio. Os dados foram submetidos à análise da variância e as médias comparadas pelo teste de Tukey a 5% de probabilidade. Realizou-se levantamentos semanais de 5 insetos-praga e pulverizações para manter a infestação abaixo dos níveis de controle. Por meio dos resultados obtidos, pode-se inferir que: a a época de plantio tem uma marcante influência na produção do algodoeiro; b a época de plantio do algodoeiro influencia a ocorrência de insetos-praga com reflexos em sua produtividade.The aim of this research was to determine the effect of planting date and the occurrence of pests on the cotton crop. The influence of the planting date on the output of the cotton CNPA 7H and Deltapine Acala 90, at Formosa do Rio Preto, São Desidério and Luiz Eduardo Magalhães, in the experimental fields of the Embrapa, in the state of Bahia, was analyzed. Four planting dates were evaluated. The plantings were in November, December and January, 1998/1999 and 1999/2000 crops, with intervals of 15 days between each planting. The data were submitted to analysis of variance and the averages compared by Tukey’s test at 5% probability. According to the results, the following conclusions can be inferred: a The planting date has a significant influence on the cotton production; b The cotton planting date

  7. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  8. Reproduction of Meloidogyne incognita on Winter Cover Crops Used in Cotton Production.

    Science.gov (United States)

    Timper, Patricia; Davis, Richard F; Tillman, P Glynn

    2006-03-01

    Substantial reproduction of Meloidogyne incognita on winter cover crops may lead to damaging populations in a subsequent cotton (Gossypium hirsutum) crop. The amount of population increase during the winter depends on soil temperature and the host status of the cover crop. Our objectives were to quantify M. incognita race 3 reproduction on rye (Secale cereale) and several leguminous cover crops and to determine if these cover crops increase population densities of M. incognita and subsequent damage to cotton. The cover crops tested were 'Bigbee' berseem clover (Trifolium alexandrinum), 'Paradana' balansa clover (T. balansae), 'AU Sunrise' and 'Dixie' crimson clover (T. incarnatum), 'Cherokee' red clover (T. pratense), common and 'AU Early Cover' hairy vetch (Vicia villosa), 'Cahaba White' vetch (V. sativa), and 'Wrens Abruzzi' rye. In the greenhouse tests, egg production was greatest on berseem clover, Dixie crimson clover, AU Early Cover hairy vetch, and common hairy vetch; intermediate on Balansa clover and AU Sunrise crimson clover; and least on rye, Cahaba White vetch, and Cherokee red clover. In both 2002 and 2003 field tests, enough heat units were accumulated between 1 January and 20 May for the nematode to complete two generations. Both AU Early Cover and common hairy vetch led to greater root galling than fallow in the subsequent cotton crop; they also supported high reproduction of M. incognita in the greenhouse. Rye and Cahaba White vetch did not increase root galling on cotton and were relatively poor hosts for M. incognita. Only those legumes that increased populations of M. incognita reduced cotton yield. In the southern US, M. incognita can complete one to two generations on a susceptible winter cover crop, so cover crops that support high nematode reproduction may lead to damage and yield losses in the following cotton crop. Planting rye or Meloidogyne-resistant legumes as winter cover crops will lower the risk of increased nematode populations

  9. Detecting cotton boll rot with an electronic nose

    Science.gov (United States)

    South Carolina Boll Rot is an emerging disease of cotton, Gossypium hirsutum L., caused by the opportunistic bacteria, Pantoea agglomerans (Ewing and Fife). Unlike typical fungal diseases, bolls infected with P. agglomerans continue to appear normal externally, complicating early and rapid detectio...

  10. Review: Genetic diversity and population structure of cotton ...

    African Journals Online (AJOL)

    Cotton (Gossypium spp.) is the world's leading natural fiber crop and is cultivated in diverse temperate and tropical areas. In this sense, molecular markers are important tools for polymorphism identification in genetic diversity analyses. The objective of this study was to evaluate genetic diversity and population structure in ...

  11. Profitability of cover crops for single and twin row cotton

    Science.gov (United States)

    With the increased interest in cover crops, the impact of adoption on profitability of cash crops is a common question from producers. The objective of this study was to evaluate the profitability of cover crops for single and twin row cotton (Gossypium hirsutum L.) in Alabama. This experiment inclu...

  12. Effect of nitrates on embryo induction efficiency in cotton ...

    African Journals Online (AJOL)

    Cotton (Gossypium hirsutum L.) cv Coker-312 callus culture was assessed in terms of its usefulness as a system for investigating the effect of nitrates from different chemical compounds of nitrogen on embryo induction percentage in calli as the plant growth and cell differentiation mainly based on nitrogen. Both sources and ...

  13. Identification of resistance to Aspergillus flavus infection in cotton germplasm

    Science.gov (United States)

    Natural resistance of in cottonseed to Aspergillus flavus infection has not been explored to date. A green fluorescent protein (GFP) expressing -70 strain was used to assess the resistance of seed from thirty five35 cotton varieties including representatives from Gossypium arboreum, G. barbadense, a...

  14. Sugar alcohols-induced oxidative metabolism in cotton callus culture

    African Journals Online (AJOL)

    Sugar alcohols (mannitol and sorbitol) may cause oxidative damage in plants if used in higher concentration. Our present experiment was undertaken to study physiological and metabolic responses in cotton (Gossypium hirsutum L.) callus against mannitol and sorbitol higher doses. Both markedly declined mean values of ...

  15. Using Winter Annual Cover Crops in a Virginia No-till Cotton Production System

    OpenAIRE

    Daniel, James B. II

    1997-01-01

    Cotton (Gossypium hirsutum L.) is a low residue crop, that may not provide sufficient surface residue to reduce erosion and protect the soil. A winter annual cover crop could alleviate erosion between cotton crops. Field experiments were conducted to evaluate selected winter annual cover crops for biomass production, ground cover, and N assimilation. The cover crop treatments were monitored under no-till and conventional tillage systems for the effects on soil moisture, cotton yield and qu...

  16. SENSIBILIDADE DE Rhizoctonia solani Kuhn, A FUNGICIDAS “IN VITRO” E EM PLÂNTULAS DE ALGODOEIRO (Gossypium hirsutum L., EM CONDIÇÕES DE CASA DE VEGETAÇÃO SENSIBILITY OF Rhizoctonia solani Kuhn TO FUNGICIDES “IN VITRO” AND IN COTTON PLANTULES (Gossypium hirsutum L AT GREENHOUSE CONDITIONS

    Directory of Open Access Journals (Sweden)

    Wilson Ferreira de Oliveira

    2007-09-01

    Full Text Available

    Foram instalados nas dependências do Departamento Fitossanitário da Escola de Agronomia - UFG, ensaio “in vitro”, em BDA2 e a nível de Casa de Vegetação, objetivando testar a eficiência de diferentes dosagens de Iprodione + Thiran (Rovrin em comparação com PCNB (Brassicol 75 BR, TMTD (Rhodiauran 70 e Captan + Pencycuron (Monceren para o controle de Rhizoctonia solani Kuhn, na cultura do algodoeiro, através do tratamento de sementes. Os resultados obtidos, nas condições de realização dos ensaios, permitem concluir que os fungicidas Rovrin - 320 g.i.a., Monceren - 210 g.i.a., Rovrin - 240 g.i.a., Rovrin - 200 g.i.a., PCNB - 450 g.i.a./100 litros de água ou 100 kg de sementes mostraram-se eficientes e não diferiram estatisticamente entre si no controle de R. solani, enquanto que o produto TMTD (Rhodiauran 70 na dosagem de 280 g.i.a./100 litros de água ou 100 kg de sementes de algodoeiro não se mostrou eficiente no controle deste agente causal.

    Aiming to test the efficiency of different dosages of Iprodione + Thiram (Rovrin in comparison with PCNB (Brassicol 75 BR, TMTD (Rhodiauran 70 and Captan + Pencycuron (Monceren for controlling Rhizoctonia solani Kuhn, in cotton plantation, through seeds treatment, was mounted essays “in vitro” at greenhouse level and BDA, in the Phytosanitary Department annexes of School of Agronomy-UFG. The results obtained, at essays conditions, permit to conclude that fungicides Rovrin - 320 g.i.a., Monceren - 210 g.i.a., Rovrin - 240 g.i.a., Rovrin - 200 g.i.a., PCNB - 450 g.i.a./l00 liters of water or 100kg of seeds, were efficient and statistically had no variation among them, in controlling R. solani, while chemical product TMTD (Rhodiauran 70, at dosage of 280 g.i.a./100 liters of water or 100 kg of cotton seeds, was not efficient in controlling this causal

  17. Construction of a complete set of alien chromosome addition lines from Gossypium australe in Gossypium hirsutum: morphological, cytological, and genotypic characterization.

    Science.gov (United States)

    Chen, Yu; Wang, Yingying; Wang, Kai; Zhu, Xiefei; Guo, Wangzhen; Zhang, Tianzhen; Zhou, Baoliang

    2014-05-01

    We report the first complete set of alien addition lines of G. hirsutum . The characterized lines can be used to introduce valuable traits from G. australe into cultivated cotton. Gossypium australe is a diploid wild cotton species (2n = 26, GG) native to Australia that possesses valuable characteristics unavailable in the cultivated cotton gene pool, such as delayed pigment gland morphogenesis in the seed and resistances to pests and diseases. However, it is very difficult to directly transfer favorable traits into cultivated cotton through conventional gene recombination due to the absence of pairing and crossover between chromosomes of G. australe and Gossypium hirsutum (2n = 52, AADD). To enhance the transfer of favorable genes from wild species into cultivated cotton, we developed a set of hirsutum-australe monosomic alien chromosome addition lines (MAAL) using a combination of morphological survey, microsatellite marker-assisted selection, and molecular cytogenetic analysis. The amphidiploid (2n = 78, AADDGG) of G. australe and G. hirsutum was consecutively backcrossed with upland cotton to develop alien addition lines of individual G. australe chromosomes in G. hirsutum. From these backcross progeny, we generated the first complete set of chromosome addition lines in cotton; 11 of 13 lines are monosomic additions, and chromosomes 7G(a) and 13G(a) are multiple additions. MAALs of 1G(a) and 11G(a) were the first to be isolated. The chromosome addition lines can be employed as bridges for the transfer of desired genes from G. australe into G. hirsutum, as well as for gene assignment, isolation of chromosome-specific probes, flow sorting and microdissection of chromosome, development of chromosome-specific ''paints'' for fluorochrome-labeled DNA fragments, physical mapping, and selective isolation and mapping of cDNAs for a particular G. australe chromosome.

  18. Assessing the Economic Impact of inversion tillage, cover crops, and herbicide regimes in palmer amaranth (Amaranthus palmeri) infested cotton

    Science.gov (United States)

    Cotton (Gossypium hirsutum L.) producers in Alabama and across the Cotton Belt are faced with a rapidly expanding problem that decreases yields and increases production costs: herbicide-resistant weeds. Producers are increasingly relying on production methods that raise production costs, such as add...

  19. Remote sensing techniques for monitoring the Rio Grande Valley cotton stalk destruction program

    Energy Technology Data Exchange (ETDEWEB)

    Richardson, A.J.; Gerbermann, A.H.; Summy, K.R.; Anderson, G.L. (Department of Agriculture, Weslaco, TX (United States))

    1993-09-01

    Post harvest cotton (Gossypium hirsutum L.) stalk destruction is a cultural practice used in the Rio Grande Valley to suppress over wintering populations of boll weevils (Anthonomus grandis Boheman) without using chemicals. Consistent application of this practice could substantially reduce insecticide usage, thereby minimizing environmental hazards and increasing cotton production profits. Satellite imagery registered within a geographic information system was used to monitor the cotton stalk destruction program in the Rio Grande Valley. We found that cotton stalk screening procedures based on standard multispectral classification techniques could not reliably distinguish cotton from sorghum. Greenness screening for cotton plant stalks after the stalk destruction deadline was possible only where ground observations locating cotton fields were available. These findings indicate that a successful cotton stalk destruction monitoring program will require satellite images and earth referenced data bases showing cotton field locations.

  20. CRITICAL COMPETITION PERIOD BETWEEN COTTON AND (Gossypium hirsutum L. HARMFUL WEED COMMUNITIES IN THE GOIÁS STATE PERÍODO CRÍTICO DE COMPETIÇÃO ENTRE COMUNIDADES DE PLANTAS DANINHAS E O ALGODOEIRO (Gossypium hirsutum L. NO ESTADO DE GOIÁS

    Directory of Open Access Journals (Sweden)

    Armando M. Macêdo

    2007-09-01

    Full Text Available

    In order to study the critical time that weeds compete with the cotton plant, five trial experiments were conducted from 1978-1981. Two of the trials were carried out in a dark red latosoil with 4.70% organic matter and 10.73% clay, at the Rio Verde Agricultural School in the state of Goiás, during the 1978—79 and 1979—80 planting seasons. The other three were carried out in dark red latosoil, with a loam clay texture, moderate acidity and a low proportion of organic matter, at the Experimental station in Goiânia, Goiás during the 1978—79, 1979—80 and 1980—81 planting seasons. The treatments designed were: weeding up to 2, 4, 6, 8 first weeks, and weeding during the whole cycle ,and weeding after the 2, 4, 6, 8 first weeks and no weeding at all during the cycle. The results showed that weed competition , when not controlled, determined a yield loss of 88.75% in Goiânia and 90.65% in Rio Verde. Regarding the group control, which was maintained without weed competition, the best yield was obtained when the cotton was maintained without competition during eight weeks after the emergence in Rio Verde and during 4, 6, 8 weeks in Goiânia. The critical competition period occurred between the fourth and sixth weeks after the emergence in Rio Verde and in the fourth week after the emergence in Goiânia.

    Com a finalidade de estudar as épocas críticas de competição de plantas daninhas com o algodoeiro (Gossipium hirsutum L. , foram instalados cinco ensaios em área do Colégio Agrícola de Rio Verde — Goiás, no período de 1978 a 1981, sendo dois ensaios nos anos agrícolas de 1978/79 e 1979/80 em latossolo vermelho—escuro com 4,71% de matéria orgânica e 10,73% de argila. Os outros três ensaios foram instalados nos anos agrícolas 1978/79, 1979/80 e 1980/81, em área da Estação Experimental de

  1. Avaliação da eficiência de controle de plantas daninhas gramíneas do herbicida clethodim em algodoeiro herbáceo (Gossypium hirsutum var. latifolium Hutch. Evaluation of the efficiency on the control of gramineous weeds by the herbicide clethodim in a herbaceous cotton crop (Gossypium hirsutum var. latifolium Hutch.

    Directory of Open Access Journals (Sweden)

    J.P. Laca-Buendia

    1992-01-01

    sethoxydim + óleo mineral, com 83% de controle, até 45 dias após a aplicação.An experiment in the Porteirinha region, north of Minas Gerais state, Brazil, was performed with the cotton cultivar IAC-20 to find out the efficiency of clethodim 0.84, 0,96 and 0,108 kg/ha plus 0.5% mineral oil v/v, in comparison to sethoxidim 0.23 kg/ha plus 0.5% mineral oil v/v, all those treatments in post emergence; other treatments were in preplanting time and incorporated to the soil alachlor 2,4 kg/ha and trifluralin 0.89 kg/ha; as check were used no weeded plots and hoed plots. The weeds involved were Cenchrus echinatus L., Eleusine indica (L. Gaertn. And Brachiaria plantaginea (Link. Hitch. None of the tested herbicides were noxious to the cotton plants. The highest production in cotton was obtained from the check hoed plots (828 kg/ha; in the second place the clethodim 0.108 kh/ha gave 528 kg/ha, the only treatments statistically different from the no weeded plots wich gave 330 kg/ha. Clethodim gave good control of Cenchrus echinatus and Eleusine indica, with all doses. Brachiaria plantaginea was efficiently controlled (86% and more by clethodim. Clethodim followed by sethoxydim gave in general 83% and 85% control of all the grasses.

  2. Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

    Directory of Open Access Journals (Sweden)

    Iftikhar Ali Khan

    2016-02-01

    Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

  3. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  4. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  5. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  6. Induced mutations for improvement of desi cotton

    International Nuclear Information System (INIS)

    Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.

    2000-01-01

    Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology

  7. Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity

    Directory of Open Access Journals (Sweden)

    F. Ducamp

    2012-01-01

    Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.

  8. Yield and fiber quality properties of cotton (Gossypium hirsutum L ...

    African Journals Online (AJOL)

    Jane

    2011-10-03

    Oct 3, 2011 ... The experiment was laid out as a randomized split block design (RSBD) with four replications. ... classified as a drought tolerant crop as some other plants species such ..... character for textile industry and spinning technology,.

  9. Genetic transformation of cry1EC gene into cotton (Gossypium ...

    African Journals Online (AJOL)

    welcome

    2013-04-10

    Apr 10, 2013 ... Full Length Research Paper. Genetic ... This research work was carried out to transform ... were maintained on the same medium till somatic embryos matured. ... of secondary pests, as well as risk to human health and.

  10. An evaluation of some mutant cotton (Gossypium hirsutum L ...

    African Journals Online (AJOL)

    user1

    2013-08-14

    Aug 14, 2013 ... to the high percentage of the seed oil and protein. ... Yield, yield components and fiber technological traits in .... L.) genotypes during the main growing season, from ... interaction was highly significant, indicating differential .... Combined analysis of variance of the varieties tested for yield,yield components, ...

  11. Polyploidization effect in two diploid cotton (Gossypium herbaceum ...

    African Journals Online (AJOL)

    SERVER

    2008-01-18

    Jan 18, 2008 ... 2Department of Biology, Gorgan University of Agricultural Sciences and Natural ... examined the effects of different doses of colchicine on polyploidy ... number of stomata are generally increased in the poly- ... species; one comprising the New World (D-genome ... used for preparation of microscopic slides.

  12. Characterization of the late embryogenesis abundant (LEA) proteins family and their role in drought stress tolerance in upland cotton.

    Science.gov (United States)

    Magwanga, Richard Odongo; Lu, Pu; Kirungu, Joy Nyangasi; Lu, Hejun; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Zhang, Zhenmei; Salih, Haron; Wang, Kunbo; Liu, Fang

    2018-01-15

    Late embryogenesis abundant (LEA) proteins are large groups of hydrophilic proteins with major role in drought and other abiotic stresses tolerance in plants. In-depth study and characterization of LEA protein families have been carried out in other plants, but not in upland cotton. The main aim of this research work was to characterize the late embryogenesis abundant (LEA) protein families and to carry out gene expression analysis to determine their potential role in drought stress tolerance in upland cotton. Increased cotton production in the face of declining precipitation and availability of fresh water for agriculture use is the focus for breeders, cotton being the backbone of textile industries and a cash crop for many countries globally. In this work, a total of 242, 136 and 142 LEA genes were identified in G. hirsutum, G. arboreum and G. raimondii respectively. The identified genes were classified into eight groups based on their conserved domain and phylogenetic tree analysis. LEA 2 were the most abundant, this could be attributed to their hydrophobic character. Upland cotton LEA genes have fewer introns and are distributed in all chromosomes. Majority of the duplicated LEA genes were segmental. Syntenic analysis showed that greater percentages of LEA genes are conserved. Segmental gene duplication played a key role in the expansion of LEA genes. Sixty three miRNAs were found to target 89 genes, such as miR164, ghr-miR394 among others. Gene ontology analysis revealed that LEA genes are involved in desiccation and defense responses. Almost all the LEA genes in their promoters contained ABRE, MBS, W-Box and TAC-elements, functionally known to be involved in drought stress and other stress responses. Majority of the LEA genes were involved in secretory pathways. Expression profile analysis indicated that most of the LEA genes were highly expressed in drought tolerant cultivars Gossypium tomentosum as opposed to drought susceptible, G. hirsutum. The tolerant

  13. Non-destructive measurements of cottonseed nutritional trait diversity in the US National Cotton Germplasm Collection

    Science.gov (United States)

    Recent studies have suggested that cottonseed (Gossypium spp.) has the potential to contribute to the effort against world hunger, particularly by providing a high-quality protein source. This report analyzed the diversity in protein content and other seed quality factors in the U.S. National Cotton...

  14. Alleles conferring improved fiber quality from EMS mutagenesis of elite cotton genotypes

    Science.gov (United States)

    The elite gene pool of cotton (Gossypium spp.) has less diversity than those of most other major crops, making identification of novel alleles important to ongoing crop improvement. A total of 3,164 M5 lines resulting from ethyl methanesulfonate mutagenesis of two G. hirsutum breeding lines, TAM 94L...

  15. A comparison of soda and soda-AQ pulps from cotton stalks | Akgül ...

    African Journals Online (AJOL)

    In this study, cotton stalks (Gossypium hirsutum L.) were cooked using soda and soda-anthraquinone (AQ) process. Nine soda cooks were conducted by changing cooking conditions including active alkali charge and pulping time. Soda-AQ cooks were obtained by adding 0.075, 0.10, 0.15, 0.2% AQ (based on o.d stalks) to ...

  16. Genetic diversity, virulence, and Meloidogyne incognita interactions of Fusarium oxysporum isolates causing cotton wilt in Georgia

    Science.gov (United States)

    Locally severe outbreaks of Fusarium wilt of cotton (Gossypium spp.) in South Georgia raised concerns about the genotypes of the causal pathogen, Fusarium oxysporum f. sp. vasinfectum. Vegetative complementation tests and DNA sequence analysis were used to determine genetic diversity among 492 F. ox...

  17. Cotton Flowers: Pollen and Petal Humidity Sensitivities Determine Reproductive Competitiveness in Diverse Environments

    Science.gov (United States)

    Genetic diversity in reproductive abiotic stress tolerance has been reported for cotton [Gossypium hirsutum (L.)] based upon the percentage of anther dehiscence of mature pollen in adverse environments. This study investigated the abiotic stress tolerance of mature pollen and identified genetic vari...

  18. Water quality of surface runoff and lint yield in cotton under furrow irrigation in Northeast Arkansas

    Science.gov (United States)

    Use of furrow irrigation in row crop production is a common practice through much of the Midsouth US and yet, nutrients can be transported off-site through surface runoff. A field study with cotton (Gossypium hirsutum, L.) was conducted to understand the impact of furrow tillage practices and nitrog...

  19. Physiological response of wheat, maize and cotton to gamma irradiation

    International Nuclear Information System (INIS)

    Sharabash, M.T.M.; Gaweesh, S.S.M.; Orabi, I.O.A.; Hammad, A.H.A.

    1988-01-01

    Grains of wheat triticum aestivum vulgare cv. Giza 155, maize Zea mays cv. double hybrid strain 17 S and cotton seeds Gossypium barbadence cv. Giza 67 were irradiated with successive doses of gamma rays from 0 to 64 Krad. Irradiating wheat grains with 1 Krad, maize grains with 0.5 Krad and cotton seeds with 4 Krad stimulated their germination and enhanced the growth of seedlings and their chlorophyll content. Also, these doses activated Alpha- and Beta-Amylase in the seeds. Higher doses had suppression effects. Peroxidase value in the seedlings of the three species was accelerated progressively in concomitant with the increase in the dosage

  20. Susceptibility of Anthonomus grandis (cotton boll weevil) and Spodoptera frugiperda (fall armyworm) to a cry1ia-type toxin from a Brazilian Bacillus thuringiensis strain.

    Science.gov (United States)

    Grossi-de-Sa, Maria Fatima; Quezado de Magalhaes, Mariana; Silva, Marilia Santos; Silva, Shirley Margareth Buffon; Dias, Simoni Campos; Nakasu, Erich Yukio Tempel; Brunetta, Patricia Sanglard Felipe; Oliveira, Gustavo Ramos; Neto, Osmundo Brilhante de Oliveira; Sampaio de Oliveira, Raquel; Soares, Luis Henrique Barros; Ayub, Marco Antonio Zachia; Siqueira, Herbert Alvaro Abreu; Figueira, Edson L Z

    2007-09-30

    Different isolates of the soil bacterium Bacillus thuringiensis produce multiple crystal (Cry) proteins toxic to a variety of insects, nematodes and protozoans. These insecticidal Cry toxins are known to be active against specific insect orders, being harmless to mammals, birds, amphibians, and reptiles. Due to these characteristics, genes encoding several Cry toxins have been engineered in order to be expressed by a variety of crop plants to control insectpests. The cotton boll weevil, Anthonomus grandis, and the fall armyworm, Spodoptera frugiperda, are the major economically devastating pests of cotton crop in Brazil, causing severe losses, mainly due to their endophytic habit, which results in damages to the cotton boll and floral bud structures. A cry1Ia-type gene, designated cry1Ia12, was isolated and cloned from the Bt S811 strain. Nucleotide sequencing of the cry1Ia12 gene revealed an open reading frame of 2160 bp, encoding a protein of 719 amino acid residues in length, with a predicted molecular mass of 81 kDa. The amino acid sequence of Cry1Ia12 is 99% identical to the known Cry1Ia proteins and differs from them only in one or two amino acid residues positioned along the three domains involved in the insecticidal activity of the toxin. The recombinant Cry1Ia12 protein, corresponding to the cry1Ia12 gene expressed in Escherichia coli cells, showed moderate toxicity towards first instar larvae of both cotton boll weevil and fall armyworm. The highest concentration of the recombinant Cry1Ia12 tested to achieve the maximum toxicities against cotton boll weevil larvae and fall armyworm larvae were 230 microg/mL and 5 microg/mL, respectively. The herein demonstrated insecticidal activity of the recombinant Cry1Ia12 toxin against cotton boll weevil and fall armyworm larvae opens promising perspectives for the genetic engineering of cotton crop resistant to both these devastating pests in Brazil.

  1. Structural analysis of Gossypium hirsutum fibers grown under greenhouse and hydroponic conditions.

    Science.gov (United States)

    Natalio, Filipe; Tahir, Muhammad Nawaz; Friedrich, Norman; Köck, Margret; Fritz-Popovski, Gerhard; Paris, Oskar; Paschke, Reinhard

    2016-06-01

    Cotton is the one of the world's most important crops. Like any other crop, cotton growth/development and fiber quality is highly dependent on environmental factors. Increasing global weather instability has been negatively impacting its economy. Cotton is a crop that exerts an intensive pressure over natural resources (land and water) and demands an overuse of pesticides. Thus, the search for alternative cotton culture methods that are pesticide-free (biocotton) and enable customized standard fiber quality should be encouraged. Here we describe a culture of Gossypium hirsutum ("Upland" Cotton) utilizing a greenhouse and hydroponics in which the fibers are morphological similar to conventional cultures and structurally fit into the classical two-phase cellulose I model with 4.19nm crystalline domains surrounded by amorphous regions. These fibers exhibit a single crystalline form of cellulose I-Iß, monoclinic unit cell. Fiber quality bulk analysis shows an improved length, strength, whiteness when compared with soil-based cultures. Finally, we show that our fibers can be spun, used for production of non-woven fabrics and indigo-vat stained demonstrating its potential in industrial and commercial applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Transcriptome Sequencing and Differential Gene Expression Analysis of Delayed Gland Morphogenesis in Gossypium australe during Seed Germination

    Science.gov (United States)

    Tao, Tao; Zhao, Liang; Lv, Yuanda; Chen, Jiedan; Hu, Yan; Zhang, Tianzhen; Zhou, Baoliang

    2013-01-01

    The genus Gossypium is a globally important crop that is used to produce textiles, oil and protein. However, gossypol, which is found in cultivated cottonseed, is toxic to humans and non-ruminant animals. Efforts have been made to breed improved cultivated cotton with lower gossypol content. The delayed gland morphogenesis trait possessed by some Australian wild cotton species may enable the widespread, direct usage of cottonseed. However, the mechanisms about the delayed gland morphogenesis are still unknown. Here, we sequenced the first Australian wild cotton species ( Gossypium australe ) and a diploid cotton species ( Gossypium arboreum ) using the Illumina Hiseq 2000 RNA-seq platform to help elucidate the mechanisms underlying gossypol synthesis and gland development. Paired-end Illumina short reads were de novo assembled into 226,184, 213,257 and 275,434 transcripts, clustering into 61,048, 47,908 and 72,985 individual clusters with N50 lengths of 1,710 bp, 1544 BP and 1,743 bp, respectively. The clustered Unigenes were searched against three public protein databases (TrEMBL, SwissProt and RefSeq) and the nucleotide and protein sequences of Gossypium raimondii using BLASTx and BLASTn. A total of 21,987, 17,209 and 25,325 Unigenes were annotated. Of these, 18,766 (85.4%), 14,552 (84.6%) and 21,374 (84.4%) Unigenes could be assigned to GO-term classifications. We identified and analyzed 13,884 differentially expressed Unigenes by clustering and functional enrichment. Terpenoid-related biosynthesis pathways showed differentially regulated expression patterns between the two cotton species. Phylogenetic analysis of the terpene synthases family was also carried out to clarify the classifications of TPSs. RNA-seq data from two distinct cotton species provide comprehensive transcriptome annotation resources and global gene expression profiles during seed germination and gland and gossypol formation. These data may be used to further elucidate various mechanisms and

  3. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

    Science.gov (United States)

    Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

  4. Characterization of the damage of Spodoptera eridania (Cramer) and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) to structures of cotton plants

    OpenAIRE

    Santos, Karen B dos; Meneguim, Ana M; Santos, Walter J dos; Neves, Pedro M O J; Santos, Rachel B dos

    2010-01-01

    The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud;...

  5. Linkage and association mapping reveals the genetic basis of brown fibre (Gossypium hirsutum).

    Science.gov (United States)

    Wen, Tianwang; Wu, Mi; Shen, Chao; Gao, Bin; Zhu, De; Zhang, Xianlong; You, Chunyuan; Lin, Zhongxu

    2018-02-24

    Brown fibre cotton is an environmental-friendly resource that plays a key role in the textile industry. However, the fibre quality and yield of natural brown cotton are poor, and fundamental research on brown cotton is relatively scarce. To understand the genetic basis of brown fibre cotton, we constructed linkage and association populations to systematically examine brown fibre accessions. We fine-mapped the brown fibre region, Lc 1 , and dissected it into 2 loci, qBF-A07-1 and qBF-A07-2. The qBF-A07-1 locus mediates the initiation of brown fibre production, whereas the shade of the brown fibre is affected by the interaction between qBF-A07-1 and qBF-A07-2. Gh_A07G2341 and Gh_A07G0100 were identified as candidate genes for qBF-A07-1 and qBF-A07-2, respectively. Haploid analysis of the signals significantly associated with these two loci showed that most tetraploid modern brown cotton accessions exhibit the introgression signature of Gossypium barbadense. We identified 10 quantitative trait loci (QTLs) for fibre yield and 19 QTLs for fibre quality through a genome-wide association study (GWAS) and found that qBF-A07-2 negatively affects fibre yield and quality through an epistatic interaction with qBF-A07-1. This study sheds light on the genetics of fibre colour and lint-related traits in brown fibre cotton, which will guide the elite cultivars breeding of brown fibre cotton. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Water use, canopy temperature, lint yield, and fiber quality response of six upland cotton cultivars to water stress

    Science.gov (United States)

    The declining saturated thickness of the Ogallala Aquifer combined with the unpredictability of precipitation during the growing season in the Southern High Plains has resulted in elevated production risks associated with short-term crop water deficits. Cotton (Gossypium spp.) cultivars that can use...

  7. Genome-wide identification and comparative analysis of squamosa-promoter binding proteins (sbp) transcription factor family in gossypium raimondii and arabidopsis thaliana

    International Nuclear Information System (INIS)

    Ali, M.A.; Alia, K.B.; Atif, R.M.; Rasulj, I.; Nadeem, H.U.; Shahid, A.; Azeem, F

    2017-01-01

    SQUAMOSA-Promoter Binding Proteins (SBP) are class of transcription factors that play vital role in regulation of plant tissue growth and development. The genes encoding these proteins have not yet been identified in diploid cotton. Thus here, a comprehensive genome wide analysis of SBP genes/proteins was carried out to identify the genes encoding SBP proteins in Gossypium raimondii and Arabidopsis thaliana. We identified 17 SBP genes from Arabidopsis thaliana genome and 30 SBP genes from Gossypium raimondii. Chromosome localization studies revealed the uneven distribution of SBP encoding genes both in the genomes of A. thaliana and G. raimondii. In cotton, five SBP genes were located on chromosome no. 2, while no gene was found on chromosome 9. In A. thaliana, maximum seven SBP genes were identified on chromosome 9, while chromosome 4 did not have any SBP gene. Thus, the SBP gene family might have expanded as a result of segmental as well as tandem duplications in these species. The comparative phylogenetic analysis of Arabidopsis and cotton SBPs revealed the presence of eight groups. The gene structure analysis of SBP encoding genes revealed the presence of one to eleven inrons in both Arabidopsis and G. raimondii. The proteins sharing the same phyletic group mostly demonstrated the similar intron-exon occurrence pattern; and share the common conserved domains. The SBP DNA-binding domain shared 24 absolutely conserved residues in Arabidopsis. The present study can serve as a base for the functional characterization of SBP gene family in Gossypium raimondii. (author)

  8. Genome-Wide Identification and Expression Analysis of the Biotin Carboxyl Carrier Subunits of Heteromeric Acetyl-CoA Carboxylase in Gossypium

    Directory of Open Access Journals (Sweden)

    Jinping Hua

    2017-05-01

    Full Text Available Acetyl-CoA carboxylase is an important enzyme, which catalyzes acetyl-CoA’s carboxylation to produce malonyl-CoA and to serve as a committed step for de novo fatty acid biosynthesis in plastids. In this study, 24 putative cotton BCCP genes were identified based on the lately published genome data in Gossypium. Among them, 4, 4, 8, and 8 BCCP homologs were identified in Gossypium raimondii, G. arboreum, G. hirsutum, and G. barbadense, respectively. These genes were divided into two classes based on a phylogenetic analysis. In each class, these homologs were relatively conserved in gene structure and motifs. The chromosomal distribution pattern revealed that all the BCCP genes were distributed equally on corresponding chromosomes or scaffold in the four cotton species. Segmental duplication was a predominant duplication event in both of G. hirsutum and G. barbadense. The analysis of the expression profile showed that 8 GhBCCP genes expressed in all the tested tissues with changed expression levels, and GhBCCP genes belonging to class II were predominantly expressed in developing ovules. Meanwhile, the expression analysis for the 16 cotton BCCP genes from G. raimondii, G. arboreum and G. hirsutum showed that they were induced or suppressed by cold or salt stress, and their expression patterns varied among different tissues. These findings will help to determine the functional and evolutionary characteristics of the BCCP genes in Gossypium species.

  9. Genetic divergence and association among polygenic characters in gossypium hirsutum L

    International Nuclear Information System (INIS)

    BiBi, M.; Khan, N.U.; Mohammad, F.; Gul, R.

    2011-01-01

    Development of promising cotton populations with improved agronomic performance is primary objective of the cotton breeders. Genetic potential and variability in 8 X 8 F/sub 1/diallel hybrids versus their parental lines, traits correlation and heritability estimates were studied in Gossypium hirsutum L., during 2008-09 at Khyber Pakhtunkhwa Agricultural University, Peshawar, Pakistan. Highly significant variations were observed among the parental cultivars and their F/sub 1/ hybrids for all traits. Results indicated that F/sub 1/ hybrids CIM-506 X CIM-554, CIM-473 X CIM-554, CIM-446 X CIM-554 and CIM-446 X CIM-496 (its reciprocal) produced significantly higher seed cotton yield, bolls per sympodia, boll weight and seeds per boll. Most of the F/sub 1/ populations involving CIM-554 as maternal plant also revealed early maturity. Yield related traits revealed significant positive correlations with seed cotton yield. Heritability (broad sense) was high in magnitude for all traits. Results revealed that traits with high heritability and wide range of genetic variability in breeding material can work as a base population, and their significant contribution towards high yield can help in early segregating generations. (author)

  10. Characterization of eleven monosomic alien addition lines added from Gossypium anomalum to Gossypium hirsutum using improved GISH and SSR markers.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Yingying; Wang, Chen; Chen, Yu; Chen, Yu; Feng, Shouli; Zhao, Ting; Zhou, Baoliang

    2016-10-07

    Gossypium anomalum (BB genome) possesses the desirable characteristics of drought tolerance, resistance to diseases and insect pests, and the potential for high quality fibers. However, it is difficult to transfer the genes associated with these desirable traits into cultivated cotton (G. hirsutum, AADD genome). Monosomic alien addition lines (MAALs) can be used as a bridge to transfer desired genes from wild species into G. hirsutum. In cotton, however, the high number and smaller size of the chromosomes has resulted in difficulties in discriminating chromosomes from wild species in cultivated cotton background, the development of cotton MAALs has lagged far behind many other crops. To date, no set of G. hirsutum-G. anomalum MAALs was reported. Here the amphiploid (AADDBB genome) derived from G. hirsutum × G. anomalum was used to generate a set of G. hirsutum-G. anomalum MAALs through a combination of consecutive backcrossing, genomic in situ hybridization (GISH), morphological survey and microsatellite marker identification. We improved the GISH technique used in our previous research by using a mixture of two probes from G. anomalum and G. herbaceum (AA genome). The results indicate that a ratio of 4:3 (G. anomalum : G. herbaceum) is the most suitable for discrimination of chromosomes from G. anomalum and the At-subgenome of G. hirsutum. Using this improved GISH technique, 108 MAAL individuals were isolated. Next, 170 G. hirsutum- and G. anomalum-specific codominant markers were obtained and employed for characterization of these MAAL individuals. Finally, eleven out of 13 MAALs were identified. Unfortunately, we were unable to isolate Chrs. 1B a and 5B a due to their very low incidences in backcrossing generation, as these remained in a condition of multiple additions. The characterized lines can be employed as bridges for the transfer of desired genes from G. anomalum into G. hirsutum, as well as for gene assignment, isolation of chromosome

  11. Comprehensive cytological characterization of the Gossypium hirsutum genome based on the development of a set of chromosome cytological markers

    Directory of Open Access Journals (Sweden)

    Wenbo Shan

    2016-08-01

    Full Text Available Cotton is the world's most important natural fiber crop. It is also a model system for studying polyploidization, genomic organization, and genome-size variation. Integrating the cytological characterization of cotton with its genetic map will be essential for understanding its genome structure and evolution, as well as for performing further genetic-map based mapping and cloning. In this study, we isolated a complete set of bacterial artificial chromosome clones anchored to each of the 52 chromosome arms of the tetraploid cotton Gossypium hirsutum. Combining these with telomere and centromere markers, we constructed a standard karyotype for the G. hirsutum inbred line TM-1. We dissected the chromosome arm localizations of the 45S and 5S rDNA and suggest a centromere repositioning event in the homoeologous chromosomes AT09 and DT09. By integrating a systematic karyotype analysis with the genetic linkage map, we observed different genome sizes and chromosomal structures between the subgenomes of the tetraploid cotton and those of its diploid ancestors. Using evidence of conserved coding sequences, we suggest that the different evolutionary paths of non-coding retrotransposons account for most of the variation in size between the subgenomes of tetraploid cotton and its diploid ancestors. These results provide insights into the cotton genome and will facilitate further genome studies in G. hirsutum.

  12. Comprehensive cytological characterization of the Gossypium hirsutum genome based on the development of a set of chromosome cytological markers

    Institute of Scientific and Technical Information of China (English)

    Wenbo; Shan; Yanqin; Jiang; Jinlei; Han; Kai; Wang

    2016-01-01

    Cotton is the world’s most important natural fiber crop. It is also a model system for studying polyploidization, genomic organization, and genome-size variation. Integrating the cytological characterization of cotton with its genetic map will be essential for understanding its genome structure and evolution, as well as for performing further genetic-map based mapping and cloning. In this study, we isolated a complete set of bacterial artificial chromosome clones anchored to each of the 52 chromosome arms of the tetraploid cotton Gossypium hirsutum. Combining these with telomere and centromere markers, we constructed a standard karyotype for the G. hirsutum inbred line TM-1. We dissected the chromosome arm localizations of the 45 S and 5S r DNA and suggest a centromere repositioning event in the homoeologous chromosomes AT09 and DT09. By integrating a systematic karyotype analysis with the genetic linkage map, we observed different genome sizes and chromosomal structures between the subgenomes of the tetraploid cotton and those of its diploid ancestors. Using evidence of conserved coding sequences, we suggest that the different evolutionary paths of non-coding retrotransposons account for most of the variation in size between the subgenomes of tetraploid cotton and its diploid ancestors. These results provide insights into the cotton genome and will facilitate further genome studies in G. hirsutum.

  13. Leaf tissue assay for lepidopteran pests of Bt cotton

    Science.gov (United States)

    Laboratory measurements of susceptibility to Bt toxins can be a poor indicator of the ability of an insect to survive on transgenic crops. We investigated the potential of using cotton leaf tissue for evaluating heliothine susceptibilities to two dual-gene Bt cottons. A preliminary study was conduct...

  14. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

    Directory of Open Access Journals (Sweden)

    Qian Yan

    Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

  15. Cotton contamination

    CSIR Research Space (South Africa)

    Van der Sluijs, MHJ

    2018-05-01

    Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...

  16. Usability of Particle Film Technology and Water Holding Materials to Improve Drought Tolerance in Gossypium hirsutum L. Plants

    Science.gov (United States)

    Roy, K.; Zwieniecki, M.

    2017-12-01

    Cotton (Gossypium hirsutum L.) is relatively drought resistant and thus is planted widely in many semi-arid and arid parts of the world, many of which are usually deprived of modern water management technologies. Since the productivity of cotton plants depends on water availability, we carried out the present research aiming at testing two different low cost and arid-environment friendly water efficient techniques: application of particle film technology on leaves to reduce the transpiration rate (kaolin dust), and use of organic material to improve the soil water holding capacity (cotton wool). In details, kaolin (3% and 5%; weight:volume) mixed in water was sprayed on the upper surface of the leaves of young plants, and small amounts of cotton wool (0.1%, 0.3% and 0.5%; weight:weight) were mixed into the soils. The study showed that kaolin spray was useful as a transpiration reducing agent only if plants have adequate water in the soil (well irrigated) but not under water stress conditions. In addition, mixing a small amount of cotton wool into the soil can significantly increase the amount of water available to the plants, and extend the benefit of kaolin application on plants.

  17. Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

    NARCIS (Netherlands)

    Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

    2011-01-01

    Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

  18. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  19. Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

    Science.gov (United States)

    Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

    2016-07-20

    Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Effects of nematicides on cotton root mycobiota.

    Science.gov (United States)

    Baird, R E; Carling, D E; Watson, C E; Scruggs, M L; Hightower, P

    2004-02-01

    Baseline information on the diversity and population densities of fungi collected from soil debris and cotton (Gossypium hirsutum L.) roots was determined. Samples were collected from Tifton, GA, and Starkville, MS containing cotton field soil treated with the nematicides 1,3-dichloroproprene (fumigant) and aldicarb (granules). A total of 10,550 and 13,450 fungal isolates were collected from these two study sites, respectively. Of this total, 34 genera of plant pathogenic or saprophytic species were identified. Pathogenic root fungi included Fusarium spp. (40% of all isolations), Macrophomina, Pythium, Rhizoctonia, and Sclerotium. Fusarium and Rhizoctonia were the most common fungal species identified and included F. oxysporum, F. verticillioides and F. solani, the three Fusarium species pathogenic on cotton plants. Population densities of Fusarium were not significantly different among locations or tissue types sampled. Macrophomina was isolated at greater numbers near the end of the growing seasons. Anastomosis groups of R. solani isolated from roots and soil debris included AG-3, -4, -7, 2-2, and -13 and anastomosis groups of binucleate Rhizoctonia included CAG-2, -3, and -5. Occurrences and frequency of isolations among sampling dates were not consistent. Fluctuations in the frequency of isolation of Rhizoctonia did not correspond with changes in frequency of isolation of the biological control fungus, Trichoderma. When individual or pooled frequencies of the mycobiota were compared to nematicide treatments, no specific trends occurred between treatments, application methods or rates. Results from this study show that use of 1,3-D and aldicarb in cotton fields does not significantly impact plant pathogenic fungi or saprophytic fungal populations. Thus cotton producers need not adjust seedling disease control measures when these two nematicides are used.

  1. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    Science.gov (United States)

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  2. Advanced Backcross QTL Analysis of Fiber Strength and Fineness in a Cross between Gossypium hirsutum and G. mustelinum

    Directory of Open Access Journals (Sweden)

    Baohua Wang

    2017-10-01

    Full Text Available The molecular genetic basis of cotton fiber strength and fineness in crosses between Gossypium mustelinum and Gossypium hirsutum (Upland cotton was dissected using 21 BC3F2 and 12 corresponding BC3F2:3 and BC3F2:4 families. The BC3F2 families were genotyped with simple sequence repeat markers from a G. hirsutum by G. mustelinum linkage map, and the three generations of BC3-derived families were phenotyped for fiber strength (STR and fineness (Micronaire, MIC. A total of 42 quantitative trait loci (QTLs were identified through one-way analysis of variance, including 15 QTLs for STR and 27 for MIC, with the percentage of variance explained by individual loci averaging 13.86 and 14.06%, respectively. Eighteen of the 42 QTLs were detected at least twice near the same markers in different generations/families or near linked markers in the same family, and 28 of the 42 QTLs were identified in both mixed model-based composite interval mapping and one-way variance analyses. Alleles from G. mustelinum increased STR for eight of 15 and reduced MIC for 15 of 27 QTLs. Significant among-family genotypic effects (P < 0.001 were detected in 13 and 10 loci for STR and MIC respectively, and five loci showed significant (P < 0.001 genotype × family interaction for MIC. These results support the hypothesis that fiber quality improvement for Upland cotton could be realized by introgressing G. mustelinum alleles although complexities due to the different effects of genetic background on introgressed chromatin might be faced. Building on prior work with G. barbadense, G. tomentosum, and G. darwinii, QTL mapping involving introgression of G. mustelinum alleles offers new allelic variation to Upland cotton germplasm.

  3. Effects of ionizing radiation on the hypocotyl-root axis of three species of gossypium

    International Nuclear Information System (INIS)

    Reed, J.P.

    1977-01-01

    The hypocotyl-root axis of cotton seedlings grown from irradiated and non-irradiated seeds was investigated using light microscopy and histological techniques. Special emphasis was placed on the pattern of vascular transition. Two patterns of vascular transition in non-irradiated seedlings were found. In Gossypium hirsutum and G. barbadense there are prominent metaxylem bands between the vascular bundles in the hypocotyl. In G. gossypioides there are no bands. The presence or absence of the bands was easily detected using polarized light. The most outstanding effects of radiation were inhibition of lateral root development and alteration of the pattern of vascular transition in seedlings grown from irradiated seeds. The findings suggest that the root apical meristem determines the vascular pattern

  4. The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

    Science.gov (United States)

    Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

    2013-01-01

    Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

  5. Construction of microsatellite-based linkage map and mapping of nectarilessness and hairiness genes in Gossypium tomentosum.

    Science.gov (United States)

    Hou, Meiying; Cai, Caiping; Zhang, Shuwen; Guo, Wangzhen; Zhang, Tianzhen; Zhou, Baoliang

    2013-12-01

    Gossypium tomentosum, a wild tetraploid cotton species with AD genomes, possesses genes conferring strong fibers and high heat tolerance. To effectively transfer these genes into Gossypium hirsutum, an entire microsatellite (simple sequence repeat, SSR)-based genetic map was constructed using the interspecific cross of G. hirsutum x G. tomentosum (HT). We detected 1800 loci from 1347 pairs of polymorphic primers. Of these, 1204 loci were grouped into 35 linkage groups at LOD ≥ 4. The map covers 3320.8 cM, with a mean density of 2.76 cM per locus. We detected 420 common loci (186 in the At subgenome and 234 in Dt) between the HT map and the map of TM-1 (G. hirsutum) and Hai 7124 (G. barbadense; HB map). The linkage groups were assigned chromosome numbers based on location of common loci and the HB map as reference. A comparison of common markers revealed that no significant chromosomal rearrangement exist between G. tomentosum and G. barbadense. Interestingly, however, we detected numerous (33.7%) segregation loci deviating from 3:1 ratio (P constructed in this study will be useful for further genetic studies on cotton breeding, including mapping loci controlling quantitative traits associated with fiber quality, stress tolerance and developing chromosome segment specific introgression lines from G. tomentosum into G. hirsutum using marker-assisted selection.

  6. Analysis of [Gossypium capitis-viridis × (G.hirsutum × G.australe2] Trispecific Hybrid and Selected Characteristics.

    Directory of Open Access Journals (Sweden)

    Di Chen

    Full Text Available Speciation is always a contentious and challenging issue following with the presence of gene flow. In Gossypium, there are many valuable resources and wild diploid cotton especially C and B genome species possess some excellent traits which cultivated cotton always lacks. In order to explore character transferring rule from wild cotton to upland tetraploid cotton, the [G. capitis-viridis × (G. hirsutum × G. australe2] triple hybrid was synthesized by interspecies hybridization and chromosome doubling. Morphology comparisons were measured among this hybrid and its parents. It showed that trispecific hybrid F1 had some intermediate morphological characters like leaf style between its parents and some different characters from its parents, like crawl growth characteristics and two kind flower color. It is highly resistant to insects comparing with other cotton species by four year field investigation. By cytogenetic analysis, triple hybrid was further confirmed by meiosis behavior of pollen mother cells. Comparing with regular meiosis of its three parents, it was distinguished by the occurrence of polyads with various numbers of unbalanced microspores and finally generating various abnormal pollen grains. All this phenomenon results in the sterility of this hybrid. This hybrid was further identified by SSR marker from DNA molecular level. It showed that 98 selected polymorphism primers amplified effective bands in this hybrids and its parents. The genetic proportion of three parents in this hybrid is 47.8% from G. hirsutum, 14.3% from G. australe, 7.0% from G. capitis-viridis, and 30.9% recombination bands respectively. It was testified that wild genetic material has been transferred into cultivated cotton and this new germplasm can be incorporated into cotton breeding program.

  7. Isolation and characterization of gene sequences expressed in cotton fiber

    Directory of Open Access Journals (Sweden)

    Taciana de Carvalho Coutinho

    2016-06-01

    Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

  8. Carbon contributions from roots in cotton based rotations

    Science.gov (United States)

    Tan, D. K. Y.; Hulugalle, N. R.

    2012-04-01

    Most research on the decline in soil organic carbon (SOC) stocks in Australian cotton farming systems has focussed on the inputs from above-ground crop residues, with contribution from roots being less studied. This paper aims to outline the contribution of cotton roots and roots of other crops to soil carbon stocks in furrow-irrigated Vertisols in several cotton (Gossypium hirsutum L.)-based rotations. Data was collected from cotton-based rotation systems: cotton monoculture, cotton-vetch (Vicia benghalensis) Roth.), cotton-wheat (Triticum aestivum L.), cotton-wheat-vetch, cotton-corn, corn-corn, cotton-sorghum (Sorghum bicolor L.) and from BollgardTM II (Bt) and non-Bt cotton. Land management systems were permanent beds, with or without standing stubble, and conventional tillage. Root growth in the surface 0.10 m was measured with the core-break method, and that in the 0.10 to 1.0 m depth with a minirhizotron and I-CAP image capture system. These measurements were used to derive root C added to soil through intra-seasonal root death (Clost), C in roots remaining at the end of season (Croot), and total root C added to soil (Ctotal = Croot + Clost). Ctotal in non-Bt cotton (Sicot 80RRF, 0.9 t C/ha/year) was higher than in Bt cotton (Sicot 80RRF, 0.6 t C/ha/year). Overall, Ctotal from cotton roots ranges between 0.5 to 5 t C/ha/year, with Clost contributing 25-70%. Ctotal was greater with vetch than with wheat and was in the order of vetch in cotton-wheat-vetch (5.1 t C/ha/year) > vetch in cotton-vetch (1.9 t C/ha/year) > wheat in cotton-wheat (1.6 t C/ha/year) = wheat in cotton-wheat-vetch (1.7 t C/ha/year). Intra-seasonal root mortality accounted for 12% of total root carbon in vetch and 36% in wheat. Average corn Ctotal with monoculture was 9.3 t/ha and with cotton-corn 5.0 t/ha. Ctotal averaged between both treatments was, thus, of the order of 7.7 t C/ha/year and average Clost 0.04 t/ha/yr. Sorghum roots contributed less carbon with conventional tillage (8.2 t

  9. The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae as a new menace to cotton in Egypt and its chemical control

    Directory of Open Access Journals (Sweden)

    El-Zahi El-Zahi Saber

    2016-04-01

    Full Text Available The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae is a polyphagous sap sucking insect with a wide geographical and host range causing severe losses in economically important crops. This study represents the first record of P. solenopsis as a new insect attacking cotton plants (Gossypium barbadense var. Giza 86 in Kafr El-Sheikh governorate, Egypt. The insect was noticed on cotton plants for the first time during its growing season of 2014. The mealybug specimens were collected from infested cotton plants and identified as P. solenopsis. In an attempt to control this pest, eight toxic materials viz., imidacloprid, thiamethoxam, flonicamid, emamectin-benzoate, chlorpyrifos, methomyl, deltamethrin and mineral oil (KZ-oil, belonging to different chemical groups, were tested for their influence against P. solenopsis on cotton under field conditions. Methomyl, imidacloprid, thiamethoxam and chlorpyrifos showed the highest efficacy against P. solenopsis recording 92.3 to 80.4% reduction of the insect population. Flonicamid, emamectin-benzoate and KZ-oil failed to exhibit sufficient P. solenopsis control.

  10. Asymmetric Evolution and Expansion of the NAC Transcription Factor in Polyploidized Cotton

    Directory of Open Access Journals (Sweden)

    Kai Fan

    2018-01-01

    Full Text Available Polyploidy in Gossypium hirsutum conferred different properties from its diploid ancestors under the regulation of transcription factors. The NAC transcription factor is a plant-specific family that can be related to plant growth and development. So far, little is known about the NAC family in cotton. This study identified 495 NAC genes in three cotton species and investigated the evolution and expansion of different genome-derived NAC genes in cotton. We revealed 15 distinct NAC subfamilies in cotton. Different subfamilies had different gene proportions, expansion rate, gene loss rate, and orthologous exchange rate. Paleohexaploidization (35% and cotton-specific decaploidy (32% might have primarily led to the expansion of the NAC family in cotton. Half of duplication events in G. hirsutum were inherited from its diploid ancestor, and others might have occurred after interspecific hybridization. In addition, NAC genes in the At and Dt subgenomes displayed asymmetric molecular evolution, as evidenced by their different gene loss rates, orthologous exchange, evolutionary rates, and expression levels. The dominant duplication event was different during the cotton evolutionary history. Different genome-derived NACs might have interacted with each other, which ultimately resulted in morphogenetic evolution. This study delineated the expansion and evolutionary history of the NAC family in cotton and illustrated the different fates of NAC genes during polyploidization.

  11. Case Study: Trap Crop with Pheromone Traps for Suppressing Euschistus servus (Heteroptera: Pentatomidae in Cotton

    Directory of Open Access Journals (Sweden)

    P. G. Tillman

    2012-01-01

    Full Text Available The brown stink bug, Euschistus servus (Say, can disperse from source habitats, including corn, Zea mays L., and peanut, Arachis hypogaea L., into cotton, Gossypium hirsutum L. Therefore, a 2-year on-farm experiment was conducted to determine the effectiveness of a sorghum (Sorghum bicolor (L. Moench spp. bicolor trap crop, with or without Euschistus spp. pheromone traps, to suppress dispersal of this pest to cotton. In 2004, density of E. servus was lower in cotton fields with sorghum trap crops (with or without pheromone traps compared to control cotton fields. Similarly, in 2006, density of E. servus was lower in cotton fields with sorghum trap crops and pheromone traps compared to control cotton fields. Thus, the combination of the sorghum trap crop and pheromone traps effectively suppressed dispersal of E. servus into cotton. Inclusion of pheromone traps with trap crops potentially offers additional benefits, including: (1 reducing the density of E. servus adults in a trap crop, especially females, to possibly decrease the local population over time and reduce the overwintering population, (2 reducing dispersal of E. servus adults from the trap crop into cotton, and (3 potentially attracting more dispersing E. servus adults into a trap crop during a period of time when preferred food is not prevalent in the landscape.

  12. Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

    Directory of Open Access Journals (Sweden)

    Waqas Malik

    2014-01-01

    Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

  13. Role of secondary metabolites biosynthesis in resistance to cotton ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.

  14. Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

    Science.gov (United States)

    Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

    2015-01-01

    COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

  15. Elargissement de la base génétique de la principale espèce de cotonnier cultivé Gossypium hirsutum L. par la création et l'exploitation de lignées monosomiques d'addition

    Directory of Open Access Journals (Sweden)

    Sarr D.

    2009-01-01

    Full Text Available Genetic broadening of the main cultivated cotton species Gossypium hirsutum L. by creation and exploitation of monosomic alien addition lines. The genus Gossypium is composed of about forty wild diploïd species that constitute an important reservoir of interesting genes for the genetic improvement of Gossypium hirsutum L., the main cultivated cotton species. Creation of monosomic alien addition lines (MAAL, made up of plants having in addition to the chromosome set of the cultivated species one wild species' supernumerary chromosome, is an interesting way to exploit this diversity. Numerous constraints limit the creation of MAAL, among them the most important is doubtless the production of first generation derivatives from pentaploids obtained by backcrossing G. hirsutum with bispecific hexaploid hybrids made of the cultivated species tetraploid genome and the genome of a donor diploid species. Raising this impediment by appropriate techniques allows to develop MAAL offering the possibility to introgress finely traits of interest from diploid species and to better understand genomic relationships between species in the genus Gossypium. Identification and exploitation of these MAAL have been for a long time based on not very reliable morphological characteristics and on the use of classical cytogenetic techniques, very heavy to implement. Nowadays, the exploitation of MAAL benefits from the great advances registered in molecular biology through the development of DNA markers and molecular cytogenetics. These progresses make of MAAL a promising way for the genetic improvement of the main cultivated cotton species.

  16. Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

    Directory of Open Access Journals (Sweden)

    Haonan Zhang

    Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

  17. Coupling of MIC-3 overexpression with the chromosome 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton...

    Science.gov (United States)

    High levels of resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. We had previously determined that MIC-3 expression played a direct role in suppressing RKN egg...

  18. Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

    Science.gov (United States)

    A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

  19. A Gly65Val substitution in an actin, GhACT_LI1, disrupts cell polarity and membrane anchoring of F-actin resulting in dwarf, lintless Li1 cotton plants

    Science.gov (United States)

    • Actin polymerizes to form the cytoskeleton and organize polar growth in all eukaryotic cells. Species with numerous actin genes are especially useful for the dissection of actin molecular function due to redundancy and neofunctionalization. Here, we investigated the role of a cotton (Gossypium hi...

  20. Submission to GenBank of the Plasma membrane intrinsic protein (PIP) Subfamily in Cotton – GenBank Accession No. GU998827-GU998830 and GenBank Accession TPA;inferential No. BK007045-BK007052

    Science.gov (United States)

    The plasma membrane intrinsic proteins (PIP) are one of the five aquaporin protein subfamilies. Aquaporin proteins are known to facilitate water transport through biological membranes. In order to identify NIP aquaporin gene candidates in cotton (Gossypium hirsutum L.), in silico and molecular clon...

  1. Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

    Science.gov (United States)

    Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-08-01

    Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

    Science.gov (United States)

    Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

    2016-12-01

    Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

  3. Aplicação de misturas de diuron com MSMA, e com paraquat, no controle de plantas daninhas de folhas largas em cultura de algodão (Gossypium hirsutum L. Mixture of diuron whit MSMA and with paraquat for broadleaved weeds control in cotton

    Directory of Open Access Journals (Sweden)

    L. S. P. Cruz

    1978-01-01

    Full Text Available Em ensaio de campo conduzido em 1975/76 procurou-se avaliar a ação de misturas de MSMA com diuron e de paraquat com diuron, aplicadas em pós-emergência, em jato dirigido, em duas épocas diferentes, no controle de algumas plantas daninhas de folhas largas em algodão: carrapicho- do-campo (Acanthospermum australe (Loef O. Kuntze , falsa-poaia (Borreria ala ta (Aubl DC, poaia-branca (Richardia brasiliensis Gomez e guanxuma (Sida spp . A vegetação natural da área do ensaio era formada ainda pela gramínea capim-de-colchão (Digitaria sanguinalis (L. Scop . Os resultados mostraram que as misturas de 2,00 kg e 2,70 kg/ha de MSMA com, respectivamente 0,30 kg e 0,40 kg/ha de diuron, e a mistura de 0.60 kg/ha de paraquat com 0,60 kg/ ha de diuron, foram eficientes no co ntro le daquelas dicotiledôneas, e também no da gramínea. Todos os tratamentos provocaram leves sintomas de fitotoxicidade nos algodoeiros, mas desapareceram depois e não prejudicaram o desenvolvimento vegetativo das plantas, assim como a produção de algodão em caroço.In a field trial carried out in 1975/76, a diuron mixtu re with MSMA and another with paraquat was tested on broadleaved weeds in cotton crops. The applications were done in postemergence, directed-spray, in two different periods. The broadleaved weeds observed in the trial were Acanthospermum australe , Borreria alata, Richardia brasiliensis, and Sida spp, also the grass Digitaria sanguinalis. Best results were obtained with the mixture of 0,60 kg/ha of paraquat with 0,60 kg/ha of diuron, and 2,70 kg/ha of MSMA with 0,40 kg/ ha of diuron, or 2,00 kg/ha of MSMA with 0,30 kg/ha of diuron. All the treatments caused sl ight symptons of toxic ity in cotton, which disappeared later and did not damage the production.

  4. Density and Seasonal Dynamics of Bemisia tabaci (Gennadius) Mediterranean on Common Crops and Weeds around Cotton Fields in Northern China

    DEFF Research Database (Denmark)

    Zhang, Xiao-ming; Yang, Nian-wan; Wan, Fang-hao

    2014-01-01

    theophrasti Medicus), sunflower (Helianthus annuus L.), sweet potato (Ipomoea batatas L.), soybean (Glycine max L.), and maize (Zea mays L.). The whitefly species identity was repeatedly tested and confirmed; seasonal dynamics on the various host plants was standardized by the quartile method. B. tabaci MED......The density seasonal dynamics of Bemisia tabaci MED were evaluated over two-years in a cotton-growing area in Langfang, Hebei Province, northern China on cotton (Gossypium hirsutum L.) and six other, co-occurring common plants: common ragweed (Ambrosia artemisiifolia L.), piemarker (Abutilon...

  5. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

    Science.gov (United States)

    2012-01-01

    Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource

  6. Variation in water-use efficiency and its relation to carbon isotope ratio in cotton

    International Nuclear Information System (INIS)

    Saranga, Y.; Flash, I.; Yakir, D.

    1998-01-01

    Cotton (Gossypium spp.) is often exposed to drought, which adversely affects both yield and quality. Improved water-use efficiency (WUE = total dry matter produced or yield harvested / water used) is expected to reduce these adverse effects. Genetic variability in WUE and its association with photosynthetic rate and carbon isotope ratio (13C/12C) in cotton are reported in this paper. WUE of six cotton cultivars--G. hirsutum L., G. barbadense L., and an interspecific F1 hybrid (G. hirsutum x G. barbadense, ISH), was examined under two irrigation regimes in two field trials. The greatest WUE was obtained by two G. hirsutum cultivars (2.55 g dry matter or 1.12 g seed-cotton L-1 H2O) the ISH obtained similar or somewhat lower values, and that G. barbadense cultivars and one G. hirsutum cultivar exhibited the lowest values (2.1 g dry matter or 0.8 to 0.85 g seed-cotton L-1 H2O). These results indicate that different cotton cultivars may have evolved different environmental adaptations that affect their WUE. Photosynthetic rate was correlated with WUE in only a few cases emphasizing the limitation of this parameter as a basis for estimating crop WUE. Under both trials WUE was positively correlated with carbon isotope ratio, indicating the potential of this technique as a selection criterion for improving cotton WUE

  7. Effect of Gamma Irradiation Doses on Some Chemical Characteristics of Cotton Seed Oil

    International Nuclear Information System (INIS)

    Saleh, O.I.

    2011-01-01

    Cotton Seeds c.v. Giza 85 (Gossypium hirsutum L.) were exposed to gamma irradiation doses of 0.5, 1.0 and 1.5 kGy to improve some chemical characteristics of cotton seed oil i.e. saturated and unsaturated fatty acids, gossypol and βsitosterol that were bound oil. The presented study showed that, the saturated fatty acids; lauric, palmitic and stearic increased when the cotton seeds were exposed to gamma irradiation doses of 0.5 up to 1.5 kGy, On the other hand, arachidic acid content decreased in all the irradiated treatments compared with untreated cotton seed. The unsaturated fatty acid oleic was increased in irradiated cotton seed samples compared with untreated one, while linoleic, the major unsaturated fatty acid decreased in irradiated cotton seed oil than untreated seeds. Gossypol and βsitosterol, bound oil, in irradiated cotton seeds increased gradually with gamma irradiated doses compared with untreated control samples

  8. Effect of ionization radiation (γ-rays 60Co) on germination of cotton

    International Nuclear Information System (INIS)

    Lall, S.B.; Bhute, M.G.

    1974-01-01

    Effect of ionization radiation (γ-rays 60 Co) on germination of cotton varieties viz. AK 235 and 197/3, also B 147 and B 296-7 belonging to Gossypium arboreum and Gossypium hirsutum respectively under field and laboratory conditions were studied. Materials under study were tried in two radiation doses i.e. 10,000 r and 20,000 r in two (R1 and R2) generations. In laboratory and field condition, both doses (10,000r and 20,000r) depressed the germination percentage in R1 generation of radiation to greater degree in almost all the varieties of cotton. Maximum depression was noted under field condition in both the varieties belonging to Gossypium arboreum species in R1 generation under 20,000 r. In R2 generation, depressing effect on germination capacity of seed is reduced to much extent in field condition in almost of all the varieties. The germination percentage has increased over control in R2 generation in both doses in laboratory conditions in all the varieties used in this experiment. (author)

  9. Flavonoid biosynthesis controls fiber color in naturally colored cotton

    Directory of Open Access Journals (Sweden)

    Hai-Feng Liu

    2018-04-01

    Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

  10. Confirmation and quantification of strigolactones, germination stimulants for root parasitic plants Striga and Orobanche, produced by cotton.

    Science.gov (United States)

    Sato, Daisuke; Awad, Ayman A; Takeuchi, Yasutomo; Yoneyama, Koichi

    2005-01-01

    The germination stimulants for root parasitic plants Striga and Orobanche produced by cotton (Gossypium hirsutum L.) were examined in detail. Seeds of cotton were germinated and grown on glass wool wetted with sterile distilled water in sterile filter units. The root exudate was collected daily and extracted with ethyl acetate. Each of these ethyl acetate extracts was analyzed directly by high-performance liquid chromatography linked with tandem mass spectrometry (LC/MS/MS). The results demonstrate that cotton roots exuded strigol and strigyl acetate, but no other known strigolactones such as orobanchol and alectrol. The production of strigol was detected even in the root exudate collected during the first 24 h of incubation and reached a maximum 5-7 days later. The average exudation of strigol and strigyl acetate during the incubation period was ca. 15 and 2 pg/plant/day, respectively, indicating that strigol mainly contributed to germination stimulation by the cotton root exudate.

  11. Characterization of indigenous gossypium arboreum L. genotypes for various fiber quality traits

    International Nuclear Information System (INIS)

    Iqbal, M. A.; Abbas, A.; Zafar, Y.

    2015-01-01

    Diploid cotton (Gossypium arboreum L.) being an Old World cultivated cotton species, evolved in Indo-Pak subcontinent, has been known for conferring resistance to biotic and abiotic stresses. To the extent of our knowledge, there is no comprehensive report available on the characterization of G. arboreum germplasm. Hence, the present study was conducted to characterize 26 G. arboreum genotypes by deploying univariate and multivariate analysis in 2010 at NIBGE, Faisalabad. All these genotypes were characterized for boll weight, GOT percentage, micronaire value, staple length, fiber bundle strength and uniformity index. Genotypic variation was significant (p<0.01) for all the analyzed traits except boll weight. Maximum boll weight (2.47g) was observed for genotype 23718. GOT ranged from 18.75% (Haroonabad) to 36.94 percentage (DC-116).The finest fiber was obtained from synthetic (4.37 micro g/inch) and this genotype also exhibited the higher values for staple length (23.81 mm) and fiber bundle strength (27.37 g/tex). Range for uniformity index was observed from 76.19 percentage (Garohill) to 77.98 percentage (212). Principal component analysis (PCA) exhibited that first five components accounted for >63 percentage of the total variability. Cluster analysis identified four groups based on their agronomic properties. Significant relationships among different traits can be useful to select best genotypes having good fiber quality traits. These genotypes may prove a valuable resource to fuel the breeding efforts for not only broadening the genetic base of the newly developed material but can also add synergy to various cotton genomic projects. (author)

  12. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  13. Dictionary of Cotton

    Science.gov (United States)

    The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

  14. Genome-Wide Identification of R2R3-MYB Genes and Expression Analyses During Abiotic Stress in Gossypium raimondii

    Science.gov (United States)

    He, Qiuling; Jones, Don C.; Li, Wei; Xie, Fuliang; Ma, Jun; Sun, Runrun; Wang, Qinglian; Zhu, Shuijin; Zhang, Baohong

    2016-01-01

    The R2R3-MYB is one of the largest families of transcription factors, which have been implicated in multiple biological processes. There is great diversity in the number of R2R3-MYB genes in different plants. However, there is no report on genome-wide characterization of this gene family in cotton. In the present study, a total of 205 putative R2R3-MYB genes were identified in cotton D genome (Gossypium raimondii), that are much larger than that found in other cash crops with fully sequenced genomes. These GrMYBs were classified into 13 groups with the R2R3-MYB genes from Arabidopsis and rice. The amino acid motifs and phylogenetic tree were predicted and analyzed. The sequences of GrMYBs were distributed across 13 chromosomes at various densities. The results showed that the expansion of the G. Raimondii R2R3-MYB family was mainly attributable to whole genome duplication and segmental duplication. Moreover, the expression pattern of 52 selected GrMYBs and 46 GaMYBs were tested in roots and leaves under different abiotic stress conditions. The results revealed that the MYB genes in cotton were differentially expressed under salt and drought stress treatment. Our results will be useful for determining the precise role of the MYB genes during stress responses with crop improvement. PMID:27009386

  15. Gossypium barbadense genome sequence provides insight into the evolution of extra-long staple fiber and specialized metabolites.

    Science.gov (United States)

    Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya

    2015-09-30

    Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.

  16. Toxicity of seven foliar insecticides to four insect parasitoids attacking citrus and cotton pests.

    Science.gov (United States)

    Prabhaker, Nilima; Morse, J G; Castle, S J; Naranjo, S E; Henneberry, T J; Toscano, N C

    2007-08-01

    Laboratory studies were carried out to compare the toxicity of seven foliar insecticides to four species of adult beneficial insects representing two families of Hymenoptera: Aphelinidae (Aphytis melinus Debach, Eretmocerus eremicus Rose & Zolnerowich, and Encarsiaformosa Gahan) and Mymaridae (Gonatocerus ashmeadi Girault) that attack California red scale, Aonidiella aurantii (Maskell); sweetpotato whitefly, Bemisia tabaci (Gennadius) (both E. eremicus and E. formosa); and glassy-winged sharpshooter, Homalodisca vitripennis (Germar), respectively. Insecticides from four pesticide classes were evaluated using a petri dish bioassay technique across a range of concentrations to develop dosage-mortality regressions. Insecticides tested included acetamiprid (neonicotinoid); chlorpyrifos (organophosphate); bifenthrin, cyfluthrin, and fenpropathrin (pyrethroids); and buprofezin and pyriproxyfen (insect growth regulators [IGRs]). Chlorpyrifos was consistently the most toxic pesticide to all four species of beneficial insects tested based on LC50 values recorded 24 h posttreatment compared with 48-h LC50 values with the neonicotinoid and pyrethroids or 96 h with the IGRs. Among the three pyrethroids, fenpropathrin was usually less toxic (except similar toxicity to A. melinus) than was cyfluthrin, and it was normally less toxic (except similar toxicity with E. formosa) than was bifenthrin. Acetamiprid was generally less toxic than bifenthrin (except similar toxicity with G. ashmeadi). The IGRs buprofezin and pyriproxyfen were usually less toxic than the contact pesticides, but we did not test for possible impacts on female fecundity. For all seven pesticides tested, A. melinus was the most susceptible parasitoid of the four test species. The data presented here will provide pest managers with specific information on the compatibility of select insecticides with natural enemies attacking citrus and cotton, Gossypium hirsutum L., pests.

  17. Comportamento do algodoeiro herbáceo (Gossypium hirsutum latifolium Hutch. e controle de plantas daninhas com o uso dos herbicidas diuron e sethoxydim The behavior of upland-type cotton (G. hirsutum latifolium Hutch. and the control of weeds after the use of diuron and sethoxydim herbicides

    Directory of Open Access Journals (Sweden)

    N.E. de M. Beltrão

    1983-06-01

    agressividade.To verify the behavior of the c. IAC -17, as well as, the control of weeds and competitive aspects of the infesting floristic complexes over the cotton culture under the presence of the herbicides, diuron and sethoxydium, atrial was contucted in Viçosa, Minas Gerais. The soil at the experimental site, Podzolic Red-yellow, had a clay texture wi th 1,38% of organic carbon an low natural fertility. Diuron was applied at pre -emergence time at the rates of 0, 0; 0, 8; 1,6 and 2,4 kg a.i. /ha and sethoxyd im at post-emergence at the rates of 0, 150, 300, 450 and 600 g a.i./ha. The trial was setup in a randomized blocks design with 2 1 treament sunder a factorial scheme (x 5 + 1 . Out of them, 20 composed all the combinations with different dosis of the two herbicides under study plus a relative control weeded with the aind of a mattock. Several traits concerning growth and plant development were evaluated, such as leaf area, leaf area in dex, seed -cotton yield, plant height, stem diameter. By means of syn ecological methods, th e population density, hydrated epigeous phytomase of dominant weed species, and the total of all species were evaluated. Diuron exerted a high control overlati foliates such as Galinsoga parviflora Cav . and Bidens pilosa L., at the rates of 1, 6 an d 2,4 kg a. i. /ha, seth oxydim, even using the lowvest tested rate (150 g. a. i. /h a fully controled Brachiaria plantaginea (Link. Hitch. None of th e herbicides was able to control Emilia sonchifolia DC. Th is species although being considered an important weed did not affect the normal crop development because of its low competition ability. The weeds showing highes trates of competition were G. parviflora (due to high population density an d B. plantaginea, because of its greater aggresivity.

  18. Cotton proteomics for deciphering the mechanism of environment stress response and fiber development.

    Science.gov (United States)

    Zhou, Meiliang; Sun, Guoqing; Sun, Zhanmin; Tang, Yixiong; Wu, Yanmin

    2014-06-13

    Cotton fiber is considered as the backbone of the textile industry. The productivity of cotton crop is severely hampered by the occurrence of pathogens, pests, and various environmental factors. Nevertheless, cotton plant has developed sophisticated mechanisms to respond to environment stresses to avoid detrimental effects on its growth and development. Therefore, understanding the mechanisms of cotton fiber development and environment stress response is of considerable interest for designing agriculture breeding strategies to ensure sustainable productivity. The application of proteomics technologies to advance our knowledge in cotton fiber development and abiotic/biotic stress tolerance has increased dramatically in the last 5years as evidenced by the large amount of publications in this area. This review summarizes the work which has been reported for cotton proteomics and evaluates the findings in context of the approaches that are widely employed with the aim to generate novel insight useful for cotton improvement. Cotton (Gossypium spp.) is considered as the foremost commercially important fiber crop grown all over the world and is deemed as the backbone of the textile industry. Cotton is also an important source of edible oil seed and a nutrient-rich food crop as cottonseed contains high-quality protein and oil. The growth and productivity of cotton crop are often hampered by various biotic stress factors, such as insect pests and pathogens. In addition, cotton plants are frequently subjected to unavoidable environmental factors that cause abiotic stress, such as salt, heat and drought. Proteomic techniques provide one of the best options for understanding the gene function and phenotypic changes during cotton fiber development and stress response. This review first summarizes the work which has been reported for cotton proteomics about cotton fiber development and abiotic/biotic stress tolerance, and also evaluates the findings in context of the approaches

  19. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    Directory of Open Access Journals (Sweden)

    Liping Ke

    Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  20. Expression of genes associated with carbohydrate metabolism in cotton stems and roots

    Directory of Open Access Journals (Sweden)

    Scheffler Jodi

    2009-01-01

    Full Text Available Abstract Background Cotton (Gossypium hirsutum L is an important crop worldwide that provides fiber for the textile industry. Cotton is a perennial plant that stores starch in stems and roots to provide carbohydrates for growth in subsequent seasons. Domesticated cotton makes these reserves available to developing seeds which impacts seed yield. The goals of these analyses were to identify genes and physiological pathways that establish cotton stems and roots as physiological sinks and investigate the role these pathways play in cotton development during seed set. Results Analysis of field-grown cotton plants indicated that starch levels peaked about the time of first anthesis and then declined similar to reports in greenhouse-grown cotton plants. Starch accumulated along the length of the stem and the shape and size of the starch grains from stems were easily distinguished from transient starch. Microarray analyses compared gene expression in tissues containing low levels of starch with tissues rapidly accumulating starch. Statistical analysis of differentially expressed genes indicated increased expression among genes associated with starch synthesis, starch degradation, hexose metabolism, raffinose synthesis and trehalose synthesis. The anticipated changes in these sugars were largely confirmed by measuring soluble sugars in selected tissues. Conclusion In domesticated cotton starch stored prior to flowering was available to support seed production. Starch accumulation observed in young field-grown plants was not observed in greenhouse grown plants. A suite of genes associated with starch biosynthesis was identified. The pathway for starch utilization after flowering was associated with an increase in expression of a glucan water dikinase gene as has been implicated in utilization of transient starch. Changes in raffinose levels and levels of expression of genes controlling trehalose and raffinose biosynthesis were also observed in vegetative

  1. Transcriptome-wide identification of salt-responsive members of the WRKY gene family in Gossypium aridum.

    Science.gov (United States)

    Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian

    2015-01-01

    WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.

  2. Transcriptome-wide identification of salt-responsive members of the WRKY gene family in Gossypium aridum.

    Directory of Open Access Journals (Sweden)

    Xinqi Fan

    Full Text Available WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III, as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.

  3. [Characterization of the damage of Spodoptera eridania (Cramer) and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) to structures of cotton plants].

    Science.gov (United States)

    Santos, Karen B Dos; Meneguim, Ana M; Santos, Walter J Dos; Neves, Pedro M O J; Santos, Rachel B Dos

    2010-01-01

    The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud; leaf and boll; flower bud or boll; and leaf, flower bud and boll. The survival of S. cosmioides and S. eridania was greater than 80% and 70% for larvae fed on cotton plant parts offered separately or together, respectively. One larva of S. eridania damaged 1.7 flower buds, but did not damage bolls, while one larva of S. cosmioides damaged 5.2 flower buds and 3.0 cotton bolls. Spodoptera eridania and S. cosmioides can be considered species with potential to cause economic damage to cotton plants because they can occur throughout cotton developmental stages causing defoliation and losses of reproductive structures. Therefore, the results validate field observations that these two species of Spodoptera are potential pests for cotton.

  4. Nature Relation Between Climatic Variables and Cotton Production

    Directory of Open Access Journals (Sweden)

    Zakaria M. Sawan

    2014-08-01

    Full Text Available This study investigated the effect of climatic variables on flower and boll production and retention in cotton (Gossypium barbadense. Also, this study investigated the relationship between climatic factors and production of flowers and bolls obtained during the development periods of the flowering and boll stage, and to determine the most representative period corresponding to the overall crop pattern. Evaporation, sunshine duration, relative humidity, surface soil temperature at 1800 h, and maximum air temperature, are the important climatic factors that significantly affect flower and boll production. The least important variables were found to be surface soil temperature at 0600 h and minimum temperature. There was a negative correlation between flower and boll production and either evaporation or sunshine duration, while that correlation with minimum relative humidity was positive. Higher minimum relative humidity, short period of sunshine duration, and low temperatures enhanced flower and boll formation.

  5. Phosphorus application to cotton enhances growth, yield, and quality characteristics on a sandy loam soil

    International Nuclear Information System (INIS)

    Ahmad, M.; Ranjha, A.M.

    2009-01-01

    Phosphorus (P) is the second most limiting nutrient in cotton (Gossypium hirsutum L.) production after nitrogen. Under wheat-cotton cropping system of Pakistan most of the farmers apply P fertilizer only to wheat crop. A field experiment was conducted to evaluate the effect of fertilizer P on the growth, yield and fibre quality of cotton on a sandy loam calcareous soil at farmer's field in cotton growing area of district Khanewal, Punjab. Five levels of P (0, 17, 26, 34 and 43 kg P ha /sup -1/) along with 120 kg N and 53 kg K ha/sup -1/ were applied. The response of cotton growth parameters was greater than quality components to P addition in calcareous soil. There was significant increase in the growth and yield parameters with each additional rate of P. The response of number of bolls per plant, boll weight and seed cotton yield was to the tune of 88.23, 16.82 and 42%, respectively at P application rate of 34 kg ha/sup -1/. Cotton quality components (lint %age, fiber length and fiber strength) improved from 2 to 5% where 43 kg P ha/sup -1/ was added. The lint and seed P concentration was little affected by P application as compared to stem and leaves showing its essentiality for cell division and development of meristematic tissue. Phosphorus use, thus not only valuable for wheat crop but also its application to cotton crop is of vital importance in improving both lint yield and quality. (author)

  6. Nitrogen nutrition in cotton and control strategies for greenhouse gas emissions: a review.

    Science.gov (United States)

    Khan, Aziz; Tan, Daniel Kean Yuen; Munsif, Fazal; Afridi, Muhammad Zahir; Shah, Farooq; Wei, Fan; Fahad, Shah; Zhou, Ruiyang

    2017-10-01

    Cotton (Gossypium hirustum L.) is grown globally as a major source of natural fiber. Nitrogen (N) management is cumbersome in cotton production systems; it has more impacts on yield, maturity, and lint quality of a cotton crop than other primary plant nutrient. Application and production of N fertilizers consume large amounts of energy, and excess application can cause environmental concerns, i.e., nitrate in ground water, and the production of nitrous oxide a highly potent greenhouse gas (GHG) to the atmosphere, which is a global concern. Therefore, improving nitrogen use efficiency (NUE) of cotton plant is critical in this context. Slow-release fertilizers (e.g., polymer-coated urea) have the potential to increase cotton yield and reduce environmental pollution due to more efficient use of nutrients. Limited literature is available on the mitigation of GHG emissions for cotton production. Therefore, this review focuses on the role of N fertilization, in cotton growth and GHG emission management strategies, and will assess, justify, and organize the researchable priorities. Nitrate and ammonium nitrogen are essential nutrients for successful crop production. Ammonia (NH 3 ) is a central intermediate in plant N metabolism. NH 3 is assimilated in cotton by the mediation of glutamine synthetase, glutamine (z-) oxoglutarate amino-transferase enzyme systems in two steps: the first step requires adenosine triphosphate (ATP) to add NH 3 to glutamate to form glutamine (Gln), and the second step transfers the NH 3 from glutamine (Gln) to α-ketoglutarate to form two glutamates. Once NH 3 has been incorporated into glutamate, it can be transferred to other carbon skeletons by various transaminases to form additional amino acids. The glutamate and glutamine formed can rapidly be used for the synthesis of low-molecular-weight organic N compounds (LMWONCs) such as amides, amino acids, ureides, amines, and peptides that are further synthesized into high-molecular-weight organic

  7. Living Mulch Performance in a Tropical Cotton System and Impact on Yield and Weed Control

    Directory of Open Access Journals (Sweden)

    Vinay Bhaskar

    2018-01-01

    Full Text Available Cotton (Gossypium hirsutum L. is a major crop in the Vidarbha region of central India. The vertisol soils on which much of the cotton is grown have been severely degraded by the tropical climate, excessive tillage and depletion of organic matter. Living mulches have the ability to mitigate these problems but they can cause crop losses through direct competition with the cotton crop and unreliable weed control. Field experiments were conducted in 2012 and 2013 at four locations in Vidarbha to study the potential for growing living mulches in mono-cropped cotton. Living mulch species evaluated included gliricidia [Gliricidia sepium (Jacq. Kunth ex Walp.], sesbania [Sesbania sesban (L. Merr.], sorghum sudan grass [Sorghum bicolor (L. Moench × Sorghum bicolor (L. Moench ssp. Drummondii (Nees ex Steud. de Wet & Harlan] and sunnhemp (Crotalaria juncea L.. Living mulch height was controlled through mowing and herbicides were not used. Living mulches generated 1 to 13 tons ha−1 of dry matter across sites and years. Weed cover was negatively correlated with both living mulch biomass and cover. Where living mulches were vigorous and established quickly, weed cover was as low as 7%, without the use of herbicides, or inter-row tillage. In a dry year, living mulch growth had a negative impact on cotton yield; however, in a year when soil moisture was not limiting, there was a positive relationship between cotton yield and living mulch biomass. Use of living mulches in cotton production in the Vidarbha region of India is feasible and can lead to both effective weed suppression and acceptable cotton yields.

  8. Pollen- and seed-mediated transgene flow in commercial cotton seed production fields.

    Directory of Open Access Journals (Sweden)

    Shannon Heuberger

    Full Text Available BACKGROUND: Characterizing the spatial patterns of gene flow from transgenic crops is challenging, making it difficult to design containment strategies for markets that regulate the adventitious presence of transgenes. Insecticidal Bacillus thuringiensis (Bt cotton is planted on millions of hectares annually and is a potential source of transgene flow. METHODOLOGY/PRINCIPAL FINDINGS: Here we monitored 15 non-Bt cotton (Gossypium hirsutum, L. seed production fields (some transgenic for herbicide resistance, some not for gene flow of the Bt cotton cry1Ac transgene. We investigated seed-mediated gene flow, which yields adventitious Bt cotton plants, and pollen-mediated gene flow, which generates outcrossed seeds. A spatially-explicit statistical analysis was used to quantify the effects of nearby Bt and non-Bt cotton fields at various spatial scales, along with the effects of pollinator abundance and adventitious Bt plants in fields, on pollen-mediated gene flow. Adventitious Bt cotton plants, resulting from seed bags and planting error, comprised over 15% of plants sampled from the edges of three seed production fields. In contrast, pollen-mediated gene flow affected less than 1% of the seed sampled from field edges. Variation in outcrossing was better explained by the area of Bt cotton fields within 750 m of the seed production fields than by the area of Bt cotton within larger or smaller spatial scales. Variation in outcrossing was also positively associated with the abundance of honey bees. CONCLUSIONS/SIGNIFICANCE: A comparison of statistical methods showed that our spatially-explicit analysis was more powerful for understanding the effects of surrounding fields than customary models based on distance. Given the low rates of pollen-mediated gene flow observed in this study, we conclude that careful planting and screening of seeds could be more important than field spacing for limiting gene flow.

  9. Density responses and spatial distribution of cotton yield and yield components in jujube (Zizyphus jujube)/cotton (Gossypium hirsutum) agroforestry

    NARCIS (Netherlands)

    Wang, Qi; Han, Shuo; Zhang, Lizhen; Zhang, Dongsheng; Werf, van der Wopke; Evers, Jochem B.; Sun, Hongquan; Su, Zhicheng; Zhang, Siping

    2016-01-01

    Trees are the dominant species in agroforestry systems, profoundly affecting the performance of understory crops. Proximity to trees is a key factor in crop performance, but rather little information is available on the spatial distribution of yield and yield components of crop species under the

  10. Ethyl ester purpurine-18 from Gossypium mustelinum (Malvaceae)

    International Nuclear Information System (INIS)

    Silva, Tania Maria Sarmento; Camara, Celso Amorim; Barbosa-Filho, Jose Maria; Giulietti, Ana Maria

    2010-01-01

    The phaeophorbide ethyl ester named Purpurine-18 and the flavonoids quercetin and kaempferol were obtained by chromatographic procedures from the chloroform fraction of aerial parts of Gossypium mustelinum. The structure of these compound was determined by NMR, IR and mass spectra data analysis. This is the first occurrence of this compound in Angiosperm. (author)

  11. Superoleophobic cotton textiles

    NARCIS (Netherlands)

    Leng, B.; Shao, Z.; With, de G.; Ming, W.

    2009-01-01

    Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we

  12. Cotton trends in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...

  13. The "Cotton Problem"

    OpenAIRE

    Baffes, John

    2005-01-01

    Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...

  14. Flight attraction of Spodoptera littoralis (Lepidoptera, Noctuidae to cotton headspace and synthetic volatile blends

    Directory of Open Access Journals (Sweden)

    Felipe eBorrero-Echeverry

    2015-06-01

    Full Text Available The insect olfactory system discriminates odor signals of different biological relevance, which drive innate behavior. Identification of stimuli that trigger upwind flight attraction towards host plants is a current challenge, and is essential in developing new, sustainable plant protection methods, and for furthering our understanding of plant-insect interactions. Using behavioral, analytical and electrophysiological studies, we here show that both females and males of the Egyptian cotton leafworm, Spodoptera littoralis (Lepidoptera, Noctuidae, use blends of volatile compounds to locate their host plant, cotton, Gossypium hirsutum (Malvales, Malvaceae. Female S. littoralis were engaged in upwind orientation flight in a wind tunnel when headspace collected from cotton plants was delivered through a piezoelectric sprayer. Although males took off towards cotton headspace significantly fewer males than females flew upwind towards the sprayed headspace. Subsequent assays with antennally active synthetic compounds revealed that a blend of nonanal, (Z-3 hexenyl acetate, (E-β-ocimene, and (R-(+-limonene was as attractive as cotton headspace to females and more attractive to males. DMNT and (R-(--linalool, both known plant defense compounds may have reduced the flight attraction of both females and males; more moths were attracted to blends without these two compounds. Our findings provide a platform for further investigations on host plant signals mediating innate behavior, and for the development of novel insect plant protection strategies against S. littoralis.

  15. Carbohydrate production and transport in cotton cultivars grown under boron deficiency

    Directory of Open Access Journals (Sweden)

    Julio Cesar Bogiani

    2013-12-01

    Full Text Available An adequate supply of boron (B is required for the optimal growth and development of cotton (Gossypium hirsutum L. plants, but the low phloem mobility of B limits the possibilities of correcting B deficiency. There are indications that different cotton cultivars could have different responses to B deficiency. The differences in responses of cotton cultivars to B regarding photoassimilate production and transport were studied in a greenhouse experiment with nutrient solution. Treatments consisted of three cotton cultivars (FMT 701, DP 604BG and FMX 993 and five concentrations of B (0.0, 2.5, 5.0, 10.0 and 20.0 µmol L−1. Sampling began at the phenological stage B1 (first square and continued for four weeks. The leaf area and the number of reproductive branches and structures decreased due to B deficiency. A higher level of abortion of reproductive structures was observed under B deficiency. Boron deficiency increased the internal CO2 concentration but decreased the transpiration rate, stomatal conductance and photosynthesis. Despite the decrease in photosynthesis, nonstructural carbohydrates accumulated in the leaves due to decreased export to bolls in B-deficient plants. The response to B deficiency is similar among cotton cultivars, which shows that the variability for this trait is low even for cultivars with different genetic backgrounds.

  16. Efeito da mucuna e amendoim em rotação com algodoeiro A study on crop rotation for cotton using velvet bean and peanut

    Directory of Open Access Journals (Sweden)

    Carlos A. M. Ferraz

    1977-01-01

    Full Text Available O efeito da rotação de mucuna (Stizolobium atterrimum Piper & Tracy e amendoim (Arachis hypogaea L. e de duas variedades comerciais de algodoeiro, IAC RM3 e IAC 12-2 (Gossypium hirsutum L. foi estudado nos anos agrícolas de 1967/68 a 1972/73. Foram instalados dois ensaios, um em Presidente Bernardes, com fusariose, em solo podzolizado de Lins e Marília var. Lins naturalmente infectado por Fusarium oxysporumf. vasinfectum e o nematóide causador de galhas Meloidogyne incognita (Kofoid & White Chitwood, e outro em Presidente Venceslau, sem fusariose, em latossolo vermelho-escuro f. arenosa não infectado. A variedade comercial IAC RM3 é resistente e a IAC 12-2 é suscetível à fusariose. Para a análise estatística dos dados adotou-se o esquema de parcelas subdivididas, com seis repetições, tendo sido consideradas como parcelas as variedades de algodoeiro IAC RM3 e IAC 12-2, plantadas em 1968/69, 1970/71, 1971/72 e 1972/73, e como subparcelas as culturas em rotação, mucuna, amendoim e as variedades de algodoeiro IAC RM3 e IAC 12-2, plantadas nos anos-agrícolas de 1967/68 e 1969/70. Em solos com fusariose, em 1968/69, e em solos sem fusariose, no ano agrícola de 1970/71, destacou-se o efeito da rotação com mucuna, seguida da rotação com amendoim. Depois do plantio consecutivo de algodoeiro durante três anos (1970/71 a 1972/73, cessaram praticamente os efeitos da rotação para os dois casos. Houve aumento do teor de potássio após o primeiro ano de rotação, sendo maior para a mucuna.The effect of rotation of velvet bean (Stizolobium atterrimum Piper & Tracy, and peanut (Arachis hypogaea L. with two comercial varieties of cotton IAC RM3 and IAC 12-2 (Gossypium hirsutum L. was studied during 1967/68 to 1972/73. One experiment was conducted in a soil naturally infected by Fusarium oxysporum f. vasinfectum (Atk. Snyder & Hansen and by Meloidogyne incognita (Kofoid & White Chitwood, (President Bernardes, State of São Paulo, in

  17. Dictionary of cotton: Picking & ginning

    Science.gov (United States)

    Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

  18. The multi-year effects of repeatedly growing cotton with moderate resistance to Meloidogyne incognita

    Science.gov (United States)

    Kemerait, Robert C.

    2009-01-01

    Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787

  19. Ethyl ester purpurine-18 from Gossypium mustelinum (Malvaceae);Feoforbideo (etoxi-purpurina-18) isolado de Gossypium mustelinum (Malvaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Tania Maria Sarmento; Camara, Celso Amorim, E-mail: taniasarmento@dq.ufrpe.b [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Quimica; Barbosa-Filho, Jose Maria [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Lab. de Tecnologia Farmaceutica; Giulietti, Ana Maria [Universidade Estadual de Feira de Santana, BA (Brazil). Dept. de Ciencias Biologicas

    2010-07-01

    The phaeophorbide ethyl ester named Purpurine-18 and the flavonoids quercetin and kaempferol were obtained by chromatographic procedures from the chloroform fraction of aerial parts of Gossypium mustelinum. The structure of these compound was determined by NMR, IR and mass spectra data analysis. This is the first occurrence of this compound in Angiosperm. (author)

  20. Ten alien chromosome additions of Gossypium hirsutum-Gossypium bickii developed by integrative uses of GISH and species-specific SSR markers.

    Science.gov (United States)

    Tang, Dong; Feng, Shouli; Li, Sai; Chen, Yu; Zhou, Baoliang

    2018-03-27

    Gossypium bickii: (2n = 26, G 1 G 1 ), a wild diploid cotton, carries many favourable traits. However, these favourable traits cannot be directly transferred into G. hirsutum (2n = 52, AADD) cultivars due to the differences in genomes. Monosomic alien addition lines (MAALs) are considered an invaluable tool for the introgression of genes of interest from wild relatives into cultivated crops. In this study, the G. hirsutum-G. bickii amphidiploid (2n = 78, AADDG 1 G 1 ) was backcrossed with G. hirsutum to develop alien additions containing individual G. bickii chromosomes in a G. hirsutum background. Genomic in situ hybridization was employed to detect the number of alien chromosomes added to the backcross progenies. A total of 183 G. bickii-specific DNA markers were developed to discriminate the identities of the G. bickii chromosomes added to G. hirsutum and assess the alien chromosome transmissibility. Chromosomes 4G b and 13G b showed the highest transmissibility, while chromosomes 1G b , 7G b and 11G b showed the lowest. Ten of the 13 possible G. hirsutum-G. bickii MAALs were isolated and characterized, which will lay the foundation for transferring resistance genes of G. bickii into G. hirsutum, as well as for gene assignment, physical mapping, and selective isolation and mapping of cDNAs for particular G. bickii chromosomes. The strategies of how to use MAALs to develop varieties with the trait of interest from wild species (such as glanded plant-glandless seed) were proposed and discussed.

  1. Feeding habits of Carabidae (Coleoptera associated with herbaceous plants and the phenology of coloured cotton

    Directory of Open Access Journals (Sweden)

    Danilo Henrique da Matta

    2017-04-01

    Full Text Available The carabids (Coleoptera: Carabidae are recognized as polyphagous predators and important natural enemies of insect pests. However, little is known about the feeding habits of these beetles. In this work, we determine the types of food content in the digestive tracts of nine species of Carabidae associated with herbaceous plants and different growth stages of coloured cotton. The food contents were evaluated for beetles associated with the coloured cotton cv. BRS verde, Gossypium hirsutum L. latifolium Hutch., adjacent to weed plants and the flowering herbaceous plants (FHPs Lobularia maritima (L., Tagetes erecta L., and Fagopyrum esculentum Moench. The digestive tract analysis indicated various types of diets and related arthropods for Abaris basistriata, Galerita brasiliensis, Scarites sp., Selenophorus alternans, Selenophorus discopunctatus and Tetracha brasiliensis. The carabids were considered to be polyphagous predators, feeding on different types of prey.

  2. Influence of cover crops on insect pests and predators in conservation tillage cotton.

    Science.gov (United States)

    Tillman, Glynn; Schomberg, Harry; Phatak, Sharad; Mullinix, Benjamin; Lachnicht, Sharon; Timper, Patricia; Olson, Dawn

    2004-08-01

    In fall 2000, an on-farm sustainable agricultural research project was established for cotton, Gossypium hirsutum L., in Tift County, Georgia. The objective of our 2-yr research project was to determine the impact of several cover crops on pest and predator insects in cotton. The five cover crop treatments included 1) cereal rye, Secale cereale L., a standard grass cover crop; 2) crimson clover, Trifolium incarnatum L., a standard legume cover crop; 3) a legume mixture of balansa clover, Trifolium michelianum Savi; crimson clover; and hairy vetch, Vicia villosa Roth; 4) a legume mixture + rye combination; and 5) no cover crop in conventionally tilled fields. Three main groups or species of pests were collected in cover crops and cotton: 1) the heliothines Heliothis virescens (F.) and Helicoverpa zea (Boddie); 2) the tarnished plant bug, Lygus lineolaris (Palisot de Beauvois); and 3) stink bugs. The main stink bugs collected were the southern green stink bug, Nezara viridula (L.); the brown stink bug, Euschistus servus (Say); and the green stink bug, Acrosternum hilare (Say). Cotton aphids, Aphis gossypii Glover, were collected only on cotton. For both years of the study, the heliothines were the only pests that exceeded their economic threshold in cotton, and the number of times this threshold was exceeded in cotton was higher in control cotton than in crimson clover and rye cotton. Heliothine predators and aphidophagous lady beetles occurred in cover crops and cotton during both years of the experiment. Geocoris punctipes (Say), Orius insidiosus (Say), and red imported fire ant, Solenopsis invicta Buren were relatively the most abundant heliothine predators observed. Lady beetles included the convergent lady beetle, Hippodamia convergens Guérin-Méneville; the sevenspotted lady beetle, Coccinella septempunctata L.; spotted lady beetle, Coleomegilla maculata (DeGeer); and the multicolored Asian lady beetle, Harmonia axyridis (Pallas). Density of G. punctipes was

  3. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  4. Monitoring cotton (Gossypium hirsutum L.) germination using ultrahigh-resolution UAS images

    Science.gov (United States)

    Examination of seed germination rate is of great importance for growers early in the season to determine the necessity for replanting their fields. The objective of this study was to explore the potential of using unmanned aircraft system (UAS)-based visible-band images to monitor and quantify the c...

  5. The Complexity of Posttranscriptional Small RNA Regulatory Networks Revealed by In Silico Analysis of Gossypium arboreum L. Leaf, Flower and Boll Small Regulatory RNAs.

    Directory of Open Access Journals (Sweden)

    Hongtao Hu

    Full Text Available MicroRNAs (miRNAs and secondary small interfering RNAs (principally phased siRNAs or trans-acting siRNAs are two distinct subfamilies of small RNAs (sRNAs that are emerging as key regulators of posttranscriptional gene expression in plants. Both miRNAs and secondary-siRNAs (sec-siRNAs are processed from longer RNA precursors by DICER-LIKE proteins (DCLs. Gossypium arboreum L., also known as tree cotton or Asian cotton, is a diploid, possibly ancestral relative of tetraploid Gossypium hirsutum L., the predominant type of commercially grown cotton worldwide known as upland cotton. To understand the biological significance of these gene regulators in G. arboreum, a bioinformatics analysis was performed on G. arboreum small RNAs produced from G. arboreum leaf, flower, and boll tissues. Consequently, 263 miRNAs derived from 353 precursors, including 155 conserved miRNAs (cs-miRNAs and 108 novel lineage-specific miRNAs (ls-miRNAs. Along with miRNAs, 2,033 miRNA variants (isomiRNAs were identified as well. Those isomiRNAs with variation at the 3'-miRNA end were expressed at the highest levels, compared to other types of variants. In addition, 755 pha-siRNAs derived 319 pha-siRNA gene transcripts (PGTs were identified, and the potential pha-siRNA initiators were predicted. Also, 2,251 non-phased siRNAs were found as well, of which 1,088 appeared to be produced by so-called cis- or trans-cleavage of the PGTs observed at positions differing from pha-siRNAs. Of those sRNAs, 148 miRNAs/isomiRNAs and 274 phased/non-phased siRNAs were differentially expressed in one or more pairs of tissues examined. Target analysis revealed that target genes for both miRNAs and pha-siRNAs are involved a broad range of metabolic and enzymatic activities. We demonstrate that secondary siRNA production could result from initial cleavage of precursors by both miRNAs or isomiRNAs, and that subsequently produced phased and unphased siRNAs could result that also serve as triggers

  6. The Complexity of Posttranscriptional Small RNA Regulatory Networks Revealed by In Silico Analysis of Gossypium arboreum L. Leaf, Flower and Boll Small Regulatory RNAs.

    Science.gov (United States)

    Hu, Hongtao; Rashotte, Aaron M; Singh, Narendra K; Weaver, David B; Goertzen, Leslie R; Singh, Shree R; Locy, Robert D

    2015-01-01

    MicroRNAs (miRNAs) and secondary small interfering RNAs (principally phased siRNAs or trans-acting siRNAs) are two distinct subfamilies of small RNAs (sRNAs) that are emerging as key regulators of posttranscriptional gene expression in plants. Both miRNAs and secondary-siRNAs (sec-siRNAs) are processed from longer RNA precursors by DICER-LIKE proteins (DCLs). Gossypium arboreum L., also known as tree cotton or Asian cotton, is a diploid, possibly ancestral relative of tetraploid Gossypium hirsutum L., the predominant type of commercially grown cotton worldwide known as upland cotton. To understand the biological significance of these gene regulators in G. arboreum, a bioinformatics analysis was performed on G. arboreum small RNAs produced from G. arboreum leaf, flower, and boll tissues. Consequently, 263 miRNAs derived from 353 precursors, including 155 conserved miRNAs (cs-miRNAs) and 108 novel lineage-specific miRNAs (ls-miRNAs). Along with miRNAs, 2,033 miRNA variants (isomiRNAs) were identified as well. Those isomiRNAs with variation at the 3'-miRNA end were expressed at the highest levels, compared to other types of variants. In addition, 755 pha-siRNAs derived 319 pha-siRNA gene transcripts (PGTs) were identified, and the potential pha-siRNA initiators were predicted. Also, 2,251 non-phased siRNAs were found as well, of which 1,088 appeared to be produced by so-called cis- or trans-cleavage of the PGTs observed at positions differing from pha-siRNAs. Of those sRNAs, 148 miRNAs/isomiRNAs and 274 phased/non-phased siRNAs were differentially expressed in one or more pairs of tissues examined. Target analysis revealed that target genes for both miRNAs and pha-siRNAs are involved a broad range of metabolic and enzymatic activities. We demonstrate that secondary siRNA production could result from initial cleavage of precursors by both miRNAs or isomiRNAs, and that subsequently produced phased and unphased siRNAs could result that also serve as triggers of a second

  7. Captures of Boll Weevils (Coleoptera: Curculionidae) in Relation to Trap Distance From Cotton Fields.

    Science.gov (United States)

    Spurgeon, Dale W

    2016-12-01

    The boll weevil (Anthonomus grandis grandis Boheman) has been eradicated from much of the United States, but remains an important pest of cotton (Gossypium spp.) in other parts of the Americas. Where the weevil occurs, the pheromone trap is a key tool for population monitoring or detection. Traditional monitoring programs have placed traps in or near the outermost cotton rows where damage by farm equipment can cause loss of trapping data. Recently, some programs have adopted a trap placement adjacent to but outside monitored fields. The effects of these changes have not been previously reported. Captures of early-season boll weevils by traps near (≤1 m) or far (7-10 m) from the outermost cotton row were evaluated. In 2005, during renewed efforts to eradicate the boll weevil from the Lower Rio Grande Valley of Texas, far traps consistently captured more weevils than traps near cotton. Traps at both placements indicated similar patterns of early-season weevil captures, which were consistent with those previously reported. In 2006, no distinction between trap placements was detected. Early-season patterns of captures in 2006 were again similar for both trap placements, but captures were much lower and less regular compared with those observed in 2005. These results suggest magnitude and likelihood of weevil capture in traps placed away from cotton are at least as high as for traps adjacent to cotton. Therefore, relocation of traps away from the outer rows of cotton should not negatively impact ability to monitor or detect the boll weevil. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by a US Government employee and is in the public domain in the US.

  8. Determination of Tolerance Levels of Cotton Genotypes Obtained from F6-F7 Generation against Verticillium Wilt Disease Caused by Verticillium dahliae Kleb.

    OpenAIRE

    Oktay EROĞAN; Emine KARADEMIR; Çetin KARADEMIR; Aydın UNAY

    2013-01-01

    The susceptibility of cotton genotypes obtained from F6 and F7 generations to Verticillium wilt (VW) disease (Verticillium dahliae Kleb.), was studied under artificial and natural infestation during 2009 and 2010 growing seasons at the Cotton Research Institute’s, Nazilli, Aydın, Turkey. In this study, fifteen cotton breeding lines and two control varieties were used as plant material. During the cotton growing season, foliar disease index (FDI), vascular disease index (VDI) and pot disease i...

  9. Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Raquel Sampaio Oliveira

    2016-02-01

    Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  10. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

    Science.gov (United States)

    de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

  11. Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

    Science.gov (United States)

    de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2016-01-01

    Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

  12. Genome-wide analysis of the HD-ZIP IV transcription factor family in Gossypium arboreum and GaHDG11 involved in osmotic tolerance in transgenic Arabidopsis.

    Science.gov (United States)

    Chen, Eryong; Zhang, Xueyan; Yang, Zhaoen; Wang, Xiaoqian; Yang, Zuoren; Zhang, Chaojun; Wu, Zhixia; Kong, Depei; Liu, Zhao; Zhao, Ge; Butt, Hamama Islam; Zhang, Xianlong; Li, Fuguang

    2017-06-01

    HD-ZIP IV proteins belong to the homeodomain-leucine zipper (HD-ZIP) transcription factor family and are involved in trichome development and drought stress in plants. Although some functions of the HD-ZIP IV group are well understood in Arabidopsis, little is known about their function in cotton. In this study, HD-ZIP genes were identified from three Gossypium species (G. arboreum, G. raimondii and G. hirsutum) and clustered into four families (HD-ZIP I, II, III and IV) to separate HD-ZIP IV from the other three families. Systematic analyses of phylogeny, gene structure, conserved domains, and expression profiles in different plant tissues and the expression patterns under osmotic stress in leaves were further conducted in G. arboreum. More importantly, ectopic overexpression of GaHDG11, a representative of the HD-ZIP IV family, confers enhanced osmotic tolerance in transgenic Arabidopsis plants, possibly due to elongated primary root length, lower water loss rates, high osmoprotectant proline levels, significant levels of antioxidants CAT, and/or SOD enzyme activity with reduced levels of MDA. Taken together, these observations may lay the foundation for future functional analysis of cotton HD-ZIP IV genes to unravel their biological roles in cotton.

  13. The entomopathogenic fungal endophytes Purpureocillium lilacinum (formerly Paecilomyces lilacinus) and Beauveria bassiana negatively affect cotton aphid reproduction under both greenhouse and field conditions.

    Science.gov (United States)

    Castillo Lopez, Diana; Zhu-Salzman, Keyan; Ek-Ramos, Maria Julissa; Sword, Gregory A

    2014-01-01

    The effects of two entomopathogenic fungal endophytes, Beauveria bassiana and Purpureocillium lilacinum (formerly Paecilomyces lilacinus), were assessed on the reproduction of cotton aphid, Aphis gossypii Glover (Homoptera:Aphididae), through in planta feeding trials. In replicate greenhouse and field trials, cotton plants (Gossypium hirsutum) were inoculated as seed treatments with two concentrations of B. bassiana or P. lilacinum conidia. Positive colonization of cotton by the endophytes was confirmed through potato dextrose agar (PDA) media plating and PCR analysis. Inoculation and colonization of cotton by either B. bassiana or P. lilacinum negatively affected aphid reproduction over periods of seven and 14 days in a series of greenhouse trials. Field trials were conducted in the summers of 2012 and 2013 in which cotton plants inoculated as seed treatments with B. bassiana and P. lilacinum were exposed to cotton aphids for 14 days. There was a significant overall effect of endophyte treatment on the number of cotton aphids per plant. Plants inoculated with B. bassiana had significantly lower numbers of aphids across both years. The number of aphids on plants inoculated with P. lilacinum exhibited a similar, but non-significant, reduction in numbers relative to control plants. We also tested the pathogenicity of both P. lilacinum and B. bassiana strains used in the experiments against cotton aphids in a survival experiment where 60% and 57% of treated aphids, respectively, died from infection over seven days versus 10% mortality among control insects. Our results demonstrate (i) the successful establishment of P. lilacinum and B. bassiana as endophytes in cotton via seed inoculation, (ii) subsequent negative effects of the presence of both target endophytes on cotton aphid reproduction using whole plant assays, and (iii) that the P. lilacinum strain used is both endophytic and pathogenic to cotton aphids. Our results illustrate the potential of using these

  14. The entomopathogenic fungal endophytes Purpureocillium lilacinum (formerly Paecilomyces lilacinus and Beauveria bassiana negatively affect cotton aphid reproduction under both greenhouse and field conditions.

    Directory of Open Access Journals (Sweden)

    Diana Castillo Lopez

    Full Text Available The effects of two entomopathogenic fungal endophytes, Beauveria bassiana and Purpureocillium lilacinum (formerly Paecilomyces lilacinus, were assessed on the reproduction of cotton aphid, Aphis gossypii Glover (Homoptera:Aphididae, through in planta feeding trials. In replicate greenhouse and field trials, cotton plants (Gossypium hirsutum were inoculated as seed treatments with two concentrations of B. bassiana or P. lilacinum conidia. Positive colonization of cotton by the endophytes was confirmed through potato dextrose agar (PDA media plating and PCR analysis. Inoculation and colonization of cotton by either B. bassiana or P. lilacinum negatively affected aphid reproduction over periods of seven and 14 days in a series of greenhouse trials. Field trials were conducted in the summers of 2012 and 2013 in which cotton plants inoculated as seed treatments with B. bassiana and P. lilacinum were exposed to cotton aphids for 14 days. There was a significant overall effect of endophyte treatment on the number of cotton aphids per plant. Plants inoculated with B. bassiana had significantly lower numbers of aphids across both years. The number of aphids on plants inoculated with P. lilacinum exhibited a similar, but non-significant, reduction in numbers relative to control plants. We also tested the pathogenicity of both P. lilacinum and B. bassiana strains used in the experiments against cotton aphids in a survival experiment where 60% and 57% of treated aphids, respectively, died from infection over seven days versus 10% mortality among control insects. Our results demonstrate (i the successful establishment of P. lilacinum and B. bassiana as endophytes in cotton via seed inoculation, (ii subsequent negative effects of the presence of both target endophytes on cotton aphid reproduction using whole plant assays, and (iii that the P. lilacinum strain used is both endophytic and pathogenic to cotton aphids. Our results illustrate the potential of

  15. Estimating cotton canopy ground cover from remotely sensed scene reflectance

    International Nuclear Information System (INIS)

    Maas, S.J.

    1998-01-01

    Many agricultural applications require spatially distributed information on growth-related crop characteristics that could be supplied through aircraft or satellite remote sensing. A study was conducted to develop and test a methodology for estimating plant canopy ground cover for cotton (Gossypium hirsutum L.) from scene reflectance. Previous studies indicated that a relatively simple relationship between ground cover and scene reflectance could be developed based on linear mixture modeling. Theoretical analysis indicated that the effects of shadows in the scene could be compensated for by averaging the results obtained using scene reflectance in the red and near-infrared wavelengths. The methodology was tested using field data collected over several years from cotton test plots in Texas and California. Results of the study appear to verify the utility of this approach. Since the methodology relies on information that can be obtained solely through remote sensing, it would be particularly useful in applications where other field information, such as plant size, row spacing, and row orientation, is unavailable

  16. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  17. Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.

    Science.gov (United States)

    He, S P; Sun, J L; Du, X M

    2011-10-03

    Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.

  18. Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.

    Directory of Open Access Journals (Sweden)

    Hongjie Feng

    Full Text Available BACKGROUND: As a result of changing consumer preferences, cotton (Gossypium Hirsutum L. from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. EXPERIMENTAL DESIGN: Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. RESULT: The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL. The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. CONCLUSIONS: Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.

  19. Field-acclimated Gossypium hirsutum cultivars exhibit genotypic and seasonal differences in photosystem II thermostability.

    Science.gov (United States)

    Snider, John L; Oosterhuis, Derrick M; Collins, Guy D; Pilon, Cristiane; Fitzsimons, Toby R

    2013-03-15

    Previous investigations have demonstrated that photosystem II (PSII) thermostability acclimates to prior exposure to heat and drought, but contrasting results have been reported for cotton (Gossypium hirsutum). We hypothesized that PSII thermotolerance in G. hirsutum would acclimate to environmental conditions during the growing season and that there would be differences in PSII thermotolerance between commercially-available U.S. cultivars. To this end, three cotton cultivars were grown under dryland conditions in Tifton Georgia, and two under irrigated conditions in Marianna Arkansas. At Tifton, measurements included PSII thermotolerance (T15, the temperature causing a 15% decline in maximum quantum yield), leaf temperatures, air temperatures, midday (1200 to 1400h) leaf water potentials (ΨMD), leaf-air vapor pressure deficit (VPD), actual quantum yield (ΦPSII) and electron transport rate through PSII (ETR) on three sample dates. At Marianna, T15 was measured on two sample dates. Optimal air and leaf temperatures were observed on all sample dates in Tifton, but PSII thermotolerance increased with water deficit conditions (ΨMD=-3.1MPa), and ETR was either unaffected or increased under water-stress. Additionally, T15 for PHY 499 was ∼5°C higher than for the other cultivars examined (DP 0912 and DP 1050). The Marianna site experienced more extreme high temperature conditions (20-30 days Tmax≥35°C), and showed an increase in T15 with higher average Tmax. When average T15 values for each location and sample date were plotted versus average daily Tmax, strong, positive relationships (r(2) from .954 to .714) were observed between Tmax and T15. For all locations T15 was substantially higher than actual field temperature conditions. We conclude that PSII thermostability in G. hirsutum acclimates to pre-existing environmental conditions; PSII is extremely tolerant to high temperature and water-deficit stress; and differences in PSII thermotolerance exist between

  20. Optimal Cotton Insecticide Application Termination Timing: A Meta-Analysis.

    Science.gov (United States)

    Griffin, T W; Zapata, S D

    2016-08-01

    The concept of insecticide termination timing is generally accepted among cotton (Gossypium hirsutum) researchers; however, exact timings are often disputed. Specifically, there is uncertainty regarding the last economic insecticide application to control fruit-feeding pests including tarnished plant bug (Lygus lineolaris (Palisot de Beauvois)), boll weevil (Anthonomus grandis), bollworm (Helicoverpa zea), tobacco budworm (Heliothis virescens), and cotton fleahopper (Pseudatomoscelis seriatus). A systematic review of prior studies was conducted within a meta-analytic framework. Nine publicly available articles were amalgamated to develop an optimal timing principle. These prior studies reported 53 independent multiple means comparison field experiments for a total of 247 trial observations. Stochastic plateau theory integrated with econometric meta-analysis methodology was applied to the meta-database to determine the shape of the functional form of both the agronomic optimal insecticide termination timing and corresponding yield potential. Results indicated that current university insecticide termination timing recommendations are later than overall estimated timing suggested. The estimated 159 heat units (HU) after the fifth position above white flower (NAWF5) was found to be statistically different than the 194 HU termination used as the status quo recommended termination timing. Insecticides applied after 159 HU may have been applied in excess, resulting in unnecessary economic and environmental costs. Empirical results also suggested that extending the insecticide termination time by one unit resulted in a cotton lint yield increase of 0.27 kilograms per hectare up to the timing where the plateau began. Based on economic analyses, profit-maximizing producers may cease application as soon as 124 HU after NAWF5. These results provided insights useful to improve production systems by applying inputs only when benefits were expected to be in excess of the

  1. Temperature effects on early season cotton growth and development

    International Nuclear Information System (INIS)

    Reddy, K.R.; Hodges, H.F.; Reddy, V.R.

    1992-01-01

    Temperature is a primary environmental factor controlling growth and developmental rates of plants, yet little specific information is available regarding cotton (Gossypium hisutum L.) responses to temperature. Information covering a wide range of temperatures would be useful for predicting both developmental and growth rates in cotton. Therefore, an experiment was conducted in naturally lit, temperature- and CO 2 -controlled cabinets from soon after emergence until 56 d after emergence (DAE). The cabinets were maintained at 20/12, 25/17, 30/22, 35/27, and 40/32C day/night cycles. Plant heights, number of nodes, and leaf areas were determined weekly throughout the experiment, and dry weight measurements were obtained at three intervals. Mainstem elongation, leaf area growth, and biomass accumulation rates were very sensitive to temperature about 3 wk after emergence. Prior to that time, they were relatively insensitive to temperature. The temperature optimum for stem elongation, leaf area expansion, and biomass accumulation was 30/22 C. Developmental rates, as depicted by number of mainstem nodes produced, number of fruiting branches, and fruiting branch nodes, were not as sensitive to temperatures above 30/22 C as were growth rates. Four times as many fruiting branches were produced at 30/22 C as at 20/12 C; whereas more vegetative branches were produced at low temperatures. All flower buds abscised from plants grown at 40/32 C. Essentially, all bolls and squares were retained at 30/22 C while a 10% boll and square loss was observed at 35/27 C during the early reproductive period. Less time was required for this cultivar to produce squares at any temperature, suitable for growing cotton, than was suggested by previous experiments

  2. Diurnal fluctuations in cotton leaf carbon export, carbohydrate content, and sucrose synthesizing enzymes.

    Science.gov (United States)

    Hendrix, D L; Huber, S C

    1986-06-01

    In fully expanded leaves of greenhouse-grown cotton (Gossypium hirsutum L., cv Coker 100) plants, carbon export, starch accumulation rate, and carbon exchange rate exhibited different behavior during the light period. Starch accumulation rates were relatively constant during the light period, whereas carbon export rate was greater in the afternoon than in the morning even though the carbon exchange rate peaked about noon. Sucrose levels increased throughout the light period and dropped sharply with the onset of darkness; hexose levels were relatively constant except for a slight peak in the early morning. Sucrose synthase, usually thought to be a degradative enzyme, was found in unusually high activities in cotton leaf. Both sucrose synthase and sucrose phosphate synthetase activities were found to fluctuate diurnally in cotton leaves but with different rhythms. Diurnal fluctuations in the rate of sucrose export were generally aligned with sucrose phosphate synthase activity during the light period but not with sucrose synthase activity; neither enzyme activity correlated with carbon export during the dark. Cotton leaf sucrose phosphate synthase activity was sufficient to account for the observed carbon export rates; there is no need to invoke sucrose synthase as a synthetic enzyme in mature cotton leaves. During the dark a significant correlation was found between starch degradation rate and leaf carbon export. These results indicate that carbon partitioning in cotton leaf is somewhat independent of the carbon exchange rate and that leaf carbon export rate may be linked to sucrose formation and content during the light period and to starch breakdown in the dark.

  3. Comparative genomic analysis of the PKS genes in five species and expression analysis in upland cotton

    Directory of Open Access Journals (Sweden)

    Xueqiang Su

    2017-10-01

    Full Text Available Plant type III polyketide synthase (PKS can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV. The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber.

  4. Response of cotton, alfalfa, and cantaloupe to foliar-deposited salt in an arid environment

    International Nuclear Information System (INIS)

    Hofmann, W.C.; Karpiscak, M.M.; Bartels, P.G.

    1987-01-01

    The cooling towers at the Palo Verde Nuclear Generating Station (PVNGS), located 80 km west of Phoenix, AZ, will release as estimated 2.1 Mg/d of particulates (primarily salts) into the atmosphere when the station is in full operation. The saline drift will disperse and settle onto agricultural fields surrounding the station. Field studies were conducted in 1983 to investigate the influence of foliar-applied saline aerosol on crop growth, foliar injury, and tissue elemental concentration on cotton (Gossypium hirsutum L.), alfalfa (medicago sativa L.), and cantaloupe (Cucumis melo L.) in an arid environment. The treatment aerosol solutions simulated treated wastewater effluent and included all essential plant nutrients and other elements, including trace concentrations of heavy metals. The treatments included unsprayed plots, and plots sprayed with salt solutions at 0 (distilled water), 8, 83, and 415 kg/(ha yr). The alfalfa received an additional 829 kg/(ha yr) treatment. The species were evaluated in separate experiments on Mohave clay loam and Sonoita sandy loam soils (Typic Haplargid) near Marana, AZ. Cotton treated with 415 kg/(ha yr) had significantly less chlorosis and tended to be slightly taller than the cotton in the unsprayed plots. The alfalfa treated at a rate of 829 kg/(ha yr) showed significantly more leaf margin necrosis than did the unsprayed alfalfa. In the cantaloupe, there were no visually apparent differences among salt treatments. Hand-harvested cotton plots had a significant reduction is seed cotton yield at the 415 kg/(ha yr) treatment. A similar though nonsignificant, trend towards reduced yield with increased salt treatment was observed in machine-harvested cotton plots

  5. A New Synthetic Amphiploid (AADDAA) between Gossypium hirsutum and G. arboreum Lays the Foundation for Transferring Resistances to Verticillium and Drought

    Science.gov (United States)

    Chen, Yu; Wang, Yingying; Zhao, Ting; Yang, Jianwei; Feng, Shouli; Nazeer, Wajad; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium arboreum, a cultivated cotton species (2n = 26, AA) native to Asia, possesses invaluable characteristics unavailable in the tetraploid cultivated cotton gene pool, such as resistance to pests and diseases and tolerance to abiotic stresses. However, it is quite difficult to transfer favorable traits into Upland cotton through conventional methods due to the cross-incompatibility of G. hirsutum (2n = 52, AADD) and G. arboreum. Here, we improved an embryo rescue technique to overcome the cross-incompatibility between these two parents for transferring favorable genes from G. arboreum into G. hirsutum. Our results indicate that MSB2K supplemented with 0.5 mgl-1 kinetin and 250 mg-1 casein hydrolysate is an efficient initial medium for rescuing early (3 d after pollination) hybrid embryos. Eight putative hybrids were successfully obtained, which were further verified and characterized by cytology, molecular markers and morphological analysis. The putative hybrids were subsequently treated with different concentrations of colchicine solution to double their chromosomes. The results demonstrate that four putative hybrid plants were successfully chromosome-doubled by treatment with 0.1% colchicine for 24 h and become amphiploid, which were confirmed by cytological observation, self-fertilization and backcrossing. Preliminary assessments of resistance at seedling stage indicate that the synthetic amphiploid showed highly resistant to Verticillium and drought. The synthetic amphiploid between G. hirsutum × G. arboreum would lay the foundation for developing G. arboreum-introgressed lines with the uniform genetic background of G. hirsutum acc TM-1, which would greatly enhance and simplify the mining, isolation, characterization, cloning and use of G. arboreum-specific desirable genes in future cotton breeding programs. PMID:26061996

  6. Verde plant bug (Hemiptera: Miridae) feeding injury to cotton bolls characterized by boll age, size, and damage ratings.

    Science.gov (United States)

    Armstrong, J Scott; Brewer, Michael J; Parker, Roy D; Adamczyk, J J

    2013-02-01

    The verde plant bug, Creontiades signatus (Distant), has been present in south Texas for several years but has more recently been documented as an economic threat to cultivated cotton, (Gossypium hirsutum L. Our studies over 2 yr (2009 and 2010) and two locations (Weslaco and Corpus Christi, TX) investigated feeding-injury of the verde plant bug to a range of cotton boll age classes defined by boll diameter and accumulated degree-days (anthesis to the time of infesting) for first-position cotton bolls infested with the plant bugs. The most detrimental damage to younger cotton holls from verde plant bug feeding was boll abscission. Cotton bolls verde plant bug injured bolls compared with the controls up to 162 ACDD or a mean boll diameter 2.0 cm. Cotton seed weights were significantly reduced up to 179 ACDD or a boll diameter of 2.0 cm at Weslaco in 2009, and up to 317 ACDD or boll diameter 2.6 cm for Weslaco in 2010 when compared with the noninfested controls. Lint weight per cotton boll for infested and noninfested bolls was significantly reduced up to 262 ACDD or boll diameter 2.5 for Corpus Christi in 2010 and up to 288 ACCD or boll diameter 2.6 cm for Weslaco, TX, in 2010. Damage ratings (dependant variable) regressed against infested and noninfested seed-cotton weights showed that in every instance, the infested cotton bolls had a strong and significant relationship with damage ratings for all age classes of bolls. Damage ratings for the infested cotton bolls that did not abscise by harvest showed visual signs of verde plant bug feeding injury and the subsequent development ofboll rot; however, these two forms of injury causing lint and seed mass loss are hard to differentiate from open or boll-locked cotton bolls. Based on the results of both lint and seed loss over 2 yr and four studies cotton bolls should be protected up to approximately 300 ACDD or a boll diameter of 2.5 cm. This equilibrates to bolls that are 12-14 d of age dependent upon daily maximum

  7. cotton fabric 51

    African Journals Online (AJOL)

    DR. AMINU

    1Department of Chemistry, Federal College of Education, Kano – Nigeria. 2Department of ... its versatility were examined taken into consideration, the molecular structure. ... hemicelluloses, pectin, coloring matter and ash ... temperature for a fixed period of time. These processes rendered the cotton 99% cellulose in nature.

  8. Cotton, Prof. Frank Albert

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Fellowship. Fellow Profile. Elected: 1985 Honorary. Cotton, Prof. Frank Albert. Date of birth: 9 April 1930. Date of death: 20 February 2007. Last known address: Department of Chemistry, Texas A & M University, College Station, TX 77843, U.S.A..

  9. Cotton regeneration in vitro

    Science.gov (United States)

    H. F. Sakhanokho and K. Rajasekaran Over the years, plant breeders have improved cotton via conventional breeding methods, but these methods are time-consuming. To complement classical breeding and, at times, reduce the time necessary for new cultivar development, breeders have turned to in vitro ...

  10. Vulnerabilities and Adapting Irrigated and Rainfed Cotton to Climate Change in the Lower Mississippi Delta Region

    Directory of Open Access Journals (Sweden)

    Saseendran S. Anapalli

    2016-10-01

    Full Text Available Anthropogenic activities continue to emit potential greenhouse gases (GHG into the atmosphere leading to a warmer climate over the earth. Predicting the impacts of climate change (CC on food and fiber production systems in the future is essential for devising adaptations to sustain production and environmental quality. We used the CSM-CROPGRO-cotton v4.6 module within the RZWQM2 model for predicting the possible impacts of CC on cotton (Gossypium hirsutum production systems in the lower Mississippi Delta (MS Delta region of the USA. The CC scenarios were based on an ensemble of climate projections of multiple GCMs (Global Climate Models/General Circulation Models for climate change under the CMIP5 (Climate Model Inter-comparison and Improvement Program 5 program, that were bias-corrected and spatially downscaled (BCSD at Stoneville location in the MS Delta for the years 2050 and 2080. Four Representative Concentration Pathways (RCP drove these CC projections: 2.6, 4.5, 6.0, and 8.5 (these numbers refer to radiative forcing levels in the atmosphere of 2.6, 4.5, 6.0, and 8.5 W·m−2, representing the increasing levels of the greenhouse gas (GHG emission scenarios for the future, as used in the Intergovernmental Panel on Climate Change-Fifth Assessment Report (IPCC-AR5. The cotton model within RZWQM2, calibrated and validated for simulating cotton production at Stoneville, was used for simulating production under these CC scenarios. Under irrigated conditions, cotton yields increased significantly under the CC scenarios driven by the low to moderate emission levels of RCP 2.6, 4.5, and 6.0 in years 2050 and 2080, but under the highest emission scenario of RCP 8.5, the cotton yield increased in 2050 but declined significantly in year 2080. Under rainfed conditions, the yield declined in both 2050 and 2080 under all four RCP scenarios; however, the yield still increased when enough rainfall was received to meet the water requirements of the crop (in

  11. Steam explosion distinctively enhances biomass enzymatic saccharification of cotton stalks by largely reducing cellulose polymerization degree in G. barbadense and G. hirsutum.

    Science.gov (United States)

    Huang, Yu; Wei, Xiaoyang; Zhou, Shiguang; Liu, Mingyong; Tu, Yuanyuan; Li, Ao; Chen, Peng; Wang, Yanting; Zhang, Xuewen; Tai, Hongzhong; Peng, Liangcai; Xia, Tao

    2015-04-01

    In this study, steam explosion pretreatment was performed in cotton stalks, leading to 5-6 folds enhancements on biomass enzymatic saccharification distinctive in Gossypium barbadense and Gossypium hirsutum species. Sequential 1% H2SO4 pretreatment could further increase biomass digestibility of the steam-exploded stalks, and also cause the highest sugar-ethanol conversion rates probably by releasing less inhibitor to yeast fermentation. By comparison, extremely high concentration alkali (16% NaOH) pretreatment with raw stalks resulted in the highest hexoses yields, but it had the lowest sugar-ethanol conversion rates. Characterization of wall polymer features indicated that biomass saccharification was enhanced with steam explosion by largely reducing cellulose DP and extracting hemicelluloses. It also showed that cellulose crystallinity and arabinose substitution degree of xylans were the major factors on biomass digestibility in cotton stalks. Hence, this study has provided the insights into cell wall modification and biomass process technology in cotton stalks and beyond. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Phosphorus use efficiency by cotton measured through 32P isotope technique

    Science.gov (United States)

    Marcante, N. C.; Muraoka, T.; Camacho, M. A.; César, F. R. C. F.; Bruno, I. P.

    2012-04-01

    Deficiency of phosphorus (P) is the major limitation to agricultural production in the Brazilian Savannah (Cerrado), which is naturally poor in this nutrient. Most of the P applied by fertilizer in Cerrado soils are converted into low solubility forms and can not be easily absorbed by plants. This occurs for characteristics of adsorption, conditioned by the predominance of low pH and aluminum and iron oxides in the clay fraction. The development of genotypes and cultivars with greater capacity to grow up in soils with low P availability ('phosphorus efficiency') is interesting to improve the agriculture in these areas in a sustainable way. Cotton (Gossypium spp.) is the main product for the fibers used nationally and globally in the textile chain. This study aim was to evaluate the efficiency of absorption and utilization of P by cotton cultivars/genotypes grown in Cerrado soil by the isotopic dilution technique. The soil classified as Ultisols, was labeled with the radioisotope 32P.The experiment was conducted in a greenhouse in a completely randomized design factorial 2 x 17. Factors were considered two levels of P (insufficient = 20 mg kg-1 and sufficient = 120 mg kg-1) and 17 genetic materials of cotton recommended for Cerrado region. Phosphorus levels influenced significantly the shoots dry matter production, the P content and accumulation, the 32P specific activity, the L value and L value less seed cotton P by cultivars and genotypes. The hierarchical clustering analysis used to verify the similarities between the cultivars and genotypes of cotton, classified them into internally homogeneous groups and heterogeneous between different groups. Cultivars FMT 523, FM 910 and CNPA GO 2043 were the most responsive to phosphate fertilizer in sufficient level of P, while the genotype Barbadense 01 and cultivars FM 966LL, IPR Jataí, BRS Aroeira and BRS Buriti were most efficient absorbing P in soils with insufficient level.

  13. Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.

    Science.gov (United States)

    de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L

    2005-02-01

    Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.

  14. Sustainable cotton production and water economy through different planting methods and mulching techniques

    International Nuclear Information System (INIS)

    Nasrullah, H.M.; Khan, M.B.; Ahmad, R.; Ahmad, S.; Hanif, M.; Nazeer, W

    2011-01-01

    Planting methods and mulching techniques are important factors which affect crop growth, development and yield by conserving soil and plant moisture. A multifactorial experiment was conducted to study the water economy involving different planting methods and mulching techniques in cotton (Gossypium hirsutum L.) for two consecutive years (2004 and 2005) at the Agronomic Research Station, Khanewal. Two moisture stress tolerant cotton varieties (CIM-473 and CIM-499) were planted using four different planting methods i.e. 70c m spaced single row planting, 105 cm spaced double row strip planting, 70 cm spaced ridge planting and 140 cm spaced furrow beds (or bed and furrows) along four mulching practices i.e. cultural, straw, sheet and chemical for their individual and interactive effects on various parameters including water use efficiency. Positive interactive effects of furrow bed planting method (140 cm spaced) with plastic sheet/film mulching were observed for all the parameters i.e., highest seed cotton yield (3009 and 3332 kg ha/sup -1/), maximum water saving (up to 25.62% and 26.53%), highest water use efficiency up to 5.04 and 4.79 [macro mol (CO/sub 2/)/mmol (H/sub 2/O)], highest net income (Rs. 27224.2 and 50927.7 ha/sup -1/) with a cost-benefit ratio of 1.64 and 2.20 followed by maximum net income (Rs. 27382.2 and 47244.5 ha/sup -1/) with 1.64 and 2.10 cost-benefit ratio in case of plastic mulch and 2814 and 3007 kg ha/sup -1/ in ridge planting method during 2004 and 2005, respectively. It is concluded that cotton crop can be grown using bed and furrow planting method with plastic sheet/film mulching technique for sustainable cotton production and better water economy. (author)

  15. Genetic disparity and relationship among quantitatively inherited yield related traits in diallel crosses of upland cotton

    International Nuclear Information System (INIS)

    Bibi, M.; Khan, N.U.; Mohammad, F.; Gul, R.; Idrees, M.; Sayal, O.U.; Khakwani, A.A.; Khan, I.A.

    2011-01-01

    In quantitative genetics, development of high yielding genotypes from parental cultivars of same ancestry is some what confusing as compared to genetically diverse parents. However, sufficient recombinations through allelic variations in mating of closely-related populations result in superior agronomic performance. Development of improved cotton genotypes is one of the prime objectives of any cotton breeding programmes. Genetic divergence and yield potential of parental cotton genotypes versus their diallel hybrids, relationship of yield with various morpho-yield traits and their heritability were studied in 8 X 8 F/sub 1/ diallel hybrids and their parental cultivars in Gossypium hirsutum L. during 2008-09 at Khyber Pakhtunkhwa Agricultural University, Peshawar, Pakistan. Highly significant (p less than or equal to 0.01) differences were observed among parental genotypes and F/sub 1/ populations for all the traits. Results revealed that F/sub 1/ hybrids i.e., CIM-506 X CIM-554, CIM-473 X CIM-554, CIM-446 X CIM-496 and CIM-446 X CIM-554 produced significantly higher number of sympodia, bolls per populations showed incredible performance for plant height, locules per boll and seeds plant and seed cotton yield. Some F/sub 1/ per locule. Seed cotton yield manifested positive association with morpho-yield traits which also accounted for greater genetic variations to yield being dependent trait. Heritabilities (broad sense) were moderate to high in magnitude for all populations with larger genetic potential, positive relationship between yield and yield traits. Results revealed that F1 contributing traits and moderate to high heritability can guide intensive selection and improvement per se in segregating populations. (author)

  16. Cotton Water Use Efficiency under Two Different Deficit Irrigation Scheduling Methods

    Directory of Open Access Journals (Sweden)

    Jeffrey T. Baker

    2015-08-01

    Full Text Available Declines in Ogallala aquifer levels used for irrigation has prompted research to identify methods for optimizing water use efficiency (WUE of cotton (Gossypium hirsutum L. In this experiment, conducted at Lubbock, TX, USA in 2014, our objective was to test two canopy temperature based stress indices, each at two different irrigation trigger set points: the Stress Time (ST method with irrigation triggers set at 5.5 (ST_5.5 and 8.5 h (ST_8.5 and the Crop Water Stress Index (CWSI method with irrigation triggers set at 0.3 (CWSI_0.3 and 0.6 (CWSI_0.6. When these irrigation triggers were exceeded on a given day, the crop was deficit irrigated with 5 mm of water via subsurface drip tape. Also included in the experimental design were a well-watered (WW control irrigated at 110% of potential evapotranspiration and a dry land (DL treatment that relied on rainfall only. Seasonal crop water use ranged from 353 to 625 mm across these six treatments. As expected, cotton lint yield increased with increasing crop water use but lint yield WUE displayed asignificant (p ≤ 0.05 peak near 3.6 to 3.7 kg ha−1 mm−1 for the ST_5.5 and CWSI_0.3 treatments, respectively. Our results suggest that WUE may be optimized in cotton with less water than that needed for maximum lint yield.

  17. Evaluation of cotton stalks destroyers

    OpenAIRE

    Bianchini, Aloisio; Borges, Pedro H. de M.

    2013-01-01

    The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...

  18. A synthetic auxin (NAA) suppresses secondary wall cellulose synthesis and enhances elongation in cultured cotton fiber.

    Science.gov (United States)

    Singh, Bir; Cheek, Hannah D; Haigler, Candace H

    2009-07-01

    Use of a synthetic auxin (naphthalene-1-acetic acid, NAA) to start (Gossypium hirsutum) ovule/fiber cultures hindered fiber secondary wall cellulose synthesis compared with natural auxin (indole-3-acetic acid, IAA). In contrast, NAA promoted fiber elongation and ovule weight gain, which resulted in larger ovule/fiber units. To reach these conclusions, fiber and ovule growth parameters were measured and cell wall characteristics were examined microscopically. The differences in fiber from NAA and IAA culture were underpinned by changes in the expression patterns of marker genes for three fiber developmental stages (elongation, the transition stage, and secondary wall deposition), and these gene expression patterns were also analyzed quantitatively in plant-grown fiber. The results demonstrate that secondary wall cellulose synthesis: (1) is under strong transcriptional control that is influenced by auxin; and (2) must be specifically characterized in the cotton ovule/fiber culture system given the many protocol variables employed in different laboratories.

  19. Dissecting Genetic Network of Fruit Branch Traits in Upland Cotton by Association Mapping Using SSR Markers.

    Directory of Open Access Journals (Sweden)

    Yongjun Mei

    Full Text Available Genetic architecture of branch traits has large influences on the morphological structure, photosynthetic capacity, planting density, and yield of Upland cotton (Gossypium hirsutum L.. This research aims to reveal the genetic effects of six branch traits, including bottom fruit branch node number (BFBNN, bottom fruit branch length (BFBL, middle fruit branch node number (MFBNN, middle fruit branch length (MFBL, upper fruit branch node number (UFBNN, and upper fruit branch length (UFBL. Association mapping was conducted for these traits of 39 lines and their 178 F1 hybrids in three environments. There were 20 highly significant Quantitative Trait SSRs (QTSs detected by mixed linear model approach analyzing a full genetic model with genetic effects of additive, dominance, epistasis and their environment interaction. The phenotypic variation explained by genetic effects ranged from 32.64 ~ 91.61%, suggesting these branch traits largely influenced by genetic factors.

  20. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  1. Fruiting branch K+ level affects cotton fibre elongation through osmoregulation

    Directory of Open Access Journals (Sweden)

    Jiashuo eYang

    2016-01-01

    Full Text Available Potassium (K deficiency in cotton plants results in reduced fibre length. As one of the primary osmotica, K+ contributes to an increase in cell turgor pressure during fibre elongation. Therefore, it is hypothesized that fibre length is affected by K deficiency through an osmotic pathway, so in 2012 and 2013, an experiment was conducted to test this hypothesis by imposing three potassium supply regimes (0, 125, 250 kg K ha-1 on a low-K-sensitive cultivar, Siza 3, and a low-K-tolerant cultivar, Simian 3. We found that fibres were longer in the later season bolls than in the earlier ones in cotton plants grown under normal growth conditions, but later season bolls showed a greater sensitivity to low-K stress, especially the low-K sensitive genotype. We also found that the maximum velocity of fibre elongation (Vmax is the parameter that best reflects the change in fibre elongation under K deficiency. This parameter mostly depends on cell turgor, so the content of the osmotically active solutes was analysed accordingly. Statistical analysis showed that K+ was the major osmotic factor affecting fibre length, and malate was likely facilitating K+ accumulation into fibres, which enabled the low-K-tolerant genotype to cope with low-K stress. Moreover, the low-K-tolerant genotype tended to have greater K+ absorptive capacities in the upper fruiting branches. Based on our findings, we suggest a fertilization scheme for Gossypium hirsutum that adds extra potash fertilizer or distributes it during the development of late season bolls to mitigate K deficiency in the second half of the growth season and to enhance fibre length in late season bolls.

  2. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    Science.gov (United States)

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

  3. mRNA-seq analysis of the Gossypium arboreum transcriptome reveals tissue selective signaling in response to water stress during seedling stage.

    Directory of Open Access Journals (Sweden)

    Xueyan Zhang

    Full Text Available The cotton diploid species, Gossypium arboreum, shows important properties of stress tolerance and good genetic stability. In this study, through mRNA-seq, we de novo assembled the unigenes of multiple samples with 3h H(2O, NaCl, or PEG treatments in leaf, stem and root tissues and successfully obtained 123,579 transcripts of G. arboreum, 89,128 of which were with hits through BLAST against known cotton ESTs and draft genome of G. raimondii. About 36,961 transcripts (including 1,958 possible transcription factor members were identified with differential expression under water stresses. Principal component analysis of differential expression levels in multiple samples suggested tissue selective signalling responding to water stresses. Venn diagram analysis showed the specificity and intersection of transcripts' response to NaCl and PEG treatments in different tissues. Self-organized mapping and hierarchical cluster analysis of the data also revealed strong tissue selectivity of transcripts under salt and osmotic stresses. In addition, the enriched gene ontology (GO terms for the selected tissue groups were differed, including some unique enriched GO terms such as photosynthesis and tetrapyrrole binding only in leaf tissues, while the stem-specific genes showed unique GO terms related to plant-type cell wall biogenesis, and root-specific genes showed unique GO terms such as monooxygenase activity. Furthermore, there were multiple hormone cross-talks in response to osmotic and salt stress. In summary, our multidimensional mRNA sequencing revealed tissue selective signalling and hormone crosstalk in response to salt and osmotic stresses in G. arboreum. To our knowledge, this is the first such report of spatial resolution of transcriptome analysis in G. arboreum. Our study will potentially advance understanding of possible transcriptional networks associated with water stress in cotton and other crop species.

  4. Comparative genomic study of ALDH gene superfamily in Gossypium: A focus on Gossypium hirsutum under salt stress.

    Directory of Open Access Journals (Sweden)

    Yating Dong

    Full Text Available Aldehyde dehydrogenases (ALDHs are a superfamily of enzymes which play important role in the scavenging of active aldehydes molecules. In present work, a comprehensive whole-genomic study of ALDH gene superfamily was carried out for an allotetraploid cultivated cotton species, G. hirsutum, as well as in parallel relative to their diploid progenitors, G. arboreum and G. raimondii. Totally, 30 and 58 ALDH gene sequences belong to 10 families were identified from diploid and allotetraploid cotton species, respectively. The gene structures among the members from same families were highly conserved. Whole-genome duplication and segmental duplication might be the major driver for the expansion of ALDH gene superfamily in G. hirsutum. In addition, the expression patterns of GhALDH genes were diverse across tissues. Most GhALDH genes were induced or repressed by salt stress in upland cotton. Our observation shed lights on the molecular evolutionary properties of ALDH genes in diploid cottons and their alloallotetraploid derivatives. It may be useful to mine key genes for improvement of cotton response to salt stress.

  5. Intensidade da ramulose sob semeadura convencional e direta do algodoeiro Ramulosis intensity under conventional and no-tillage cotton crop systems

    Directory of Open Access Journals (Sweden)

    Daniela Kubiak de Salvatierra

    2009-01-01

    Full Text Available Foram realizados em Piracicaba (SP, em 2004/05 e 2005/06, experimentos com o algodoeiro (Gossypium hirsutum L. var. latifolium Hutch, sob preparo do solo e semeadura convencional; e ausência de preparo do solo com semeadura sobre palhada de milheto, com o objetivo de avaliar as modificações microclimáticas (temperatura e duração do período de molhamento-DPM, decorrentes da utilização da palhada de milheto, no desenvolvimento da ramulose (Colletotrichum gossypii South. var. cephalosporioides Costa do algodoeiro. Foi utilizado também um índice de favorabilidade temperatura-molhamento (IF-tm para a ramulose do algodoeiro, para avaliar o desenvolvimento da doença nos dois sistemas de semeadura. Os dados climáticos foram medidos por uma plataforma de aquisição de dados sob o dossel das plantas e na região central da área experimental. A ramulose foi avaliada por escala de notas (1 a 5 e as médias das notas analisadas estatisticamente. Alterações no progresso da doença foram observadas, com ocorrência mais severa no sistema convencional de semeadura, porém não podendo ser atribuídas às variações na temperatura e DPM, consideradas isoladamente, mas decorrente de interações entre estas e a precipitação pluvial. O IF-tm teve boa relação com o aumento da severidade da doença, e a diferença, observada em maior proporção no sistema convencional de semeadura, ocorreu em períodos cujos valores de IF-tm foram altos, associados a períodos com chuvas e fase de maior suscetibilidade das plantas ao patógeno. Com IF-tm menores que 0,500 não se observa aumento efetivo da severidade da ramulose em quaisquer sistema de semeadura.During the years of 2004/05 and 2005/06, in Piracicaba, State of São Paulo, experiments were carried out with cotton crop under conventional tillage seeding and no-tillage. The seeding was performed over the mulching of millet, with the objective to evaluate if such mulching could interfere on

  6. Carbon partitioning and export from mature cotton leaves

    International Nuclear Information System (INIS)

    Hendrix, D.L.; Grange, R.I.

    1991-01-01

    The partitioning of carbon in intact, mature cotton (Gossypium hirsutum L.) leaves was examined by steady-state 14 CO 2 labeling. Plants were exposed to dark periods of varying lengths, followed by similar illuminated labeling periods. These treatments produced leaves with a range of starch and soluble sugar contents, carbon exchange, and carbon export rates. Export during the illuminated periods was neither highly correlated with photosynthesis nor was export during the illuminated periods significantly different among the treatments. In contrast, the rate of subsequent nocturnal carbon export from these leaves varied widely and was found to be highly correlated with leaf starch content at the end of the illumination period and with nocturnal leaf respiration. Leaves which had accumulated the highest levels of starch (about 275 micrograms per square centimeter) by the end of the illumination period exhibited nocturnal export rates very similar to those during the daylight hours. Leaves which accumulated starch to only 50 to 75 micrograms per square centimeter virtually ceased nocturnal carbon export. For leaves with starch accumulations of between 50 and 275 micrograms per square centimeter, nocturnal export was directly proportional to leaf starch at the end of the illumination period. After the nocturnal export rate was established, it continued at a constant rate throughout the night even though leaf starch and sucrose contents declined

  7. Directional reflectance factor distributions of a cotton row crop

    Science.gov (United States)

    Kimes, D. S.; Newcomb, W. W.; Schutt, J. B.; Pinter, P. J., Jr.; Jackson, R. D.

    1984-01-01

    The directional reflectance factor distribution spanning the entire exitance hemisphere was measured for a cotton row crop (Gossypium barbadense L.) with 39 percent ground cover. Spectral directional radiances were taken in NOAA satellite 7 AVHRR bands 1 and 2 using a three-band radiometer with restricted 12 deg full angle field of view at half peak power points. Polar co-ordinate system plots of directional reflectance factor distributions and three-dimensional computer graphic plots of scattered flux were used to study the dynamics of the directional reflectance factor distribution as a function of spectral band, geometric structure of the scene, solar zenith and azimuth angles, and optical properties of the leaves and soil. The factor distribution of the incomplete row crops was highly polymodal relative to that for complete vegetation canopies. Besides the enhanced reflectance for the antisolar point, a reflectance minimum was observed towards the forwardscatter direction in the principle plane of the sun. Knowledge of the mechanics of the observed dynamics of the data may be used to provide rigorous validation for two- or three-dimensional radiative transfer models, and is important in interpreting aircraft and satellite data where the solar angle varies widely.

  8. Carbon partitioning and export from mature cotton leaves.

    Science.gov (United States)

    Hendrix, D L; Grange, R I

    1991-01-01

    The partitioning of carbon in intact, mature cotton (Gossypium hirsutum L.) leaves was examined by steady-state (14)CO(2) labeling. Plants were exposed to dark periods of varying lengths, followed by similar illuminated labeling periods. These treatments produced leaves with a range of starch and soluble sugar contents, carbon exchange, and carbon export rates. Export during the illuminated periods was neither highly correlated with photosynthesis nor was export during the illuminated periods significantly different among the treatments. In contrast, the rate of subsequent nocturnal carbon export from these leaves varied widely and was found to be highly correlated with leaf starch content at the end of the illumination period (r = 0.934) and with nocturnal leaf respiration (r = 0.954). Leaves which had accumulated the highest levels of starch (about 275 micrograms per square centimeter) by the end of the illumination period exhibited nocturnal export rates very similar to those during the daylight hours. Leaves which accumulated starch to only 50 to 75 micrograms per square centimeter virtually ceased nocturnal carbon export. For leaves with starch accumulations of between 50 and 275 micrograms per square centimeter, nocturnal export was directly proportional to leaf starch at the end of the illumination period. After the nocturnal export rate was established, it continued at a constant rate throughout the night even though leaf starch and sucrose contents declined.

  9. Superhydrophobic cotton by fluorosilane modification

    CSIR Research Space (South Africa)

    Erasmus, E

    2009-12-01

    Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...

  10. Genetic diversity and relationship analysis of Gossypium arboreum accessions.

    Science.gov (United States)

    Liu, F; Zhou, Z L; Wang, C Y; Wang, Y H; Cai, X Y; Wang, X X; Zhang, Z S; Wang, K B

    2015-11-19

    Simple sequence repeat techniques were used to identify the genetic diversity of 101 Gossypium arboreum accessions collected from India, Vietnam, and the southwest of China (Guizhou, Guangxi, and Yunnan provinces). Twenty-six pairs of SSR primers produced a total of 103 polymorphic loci with an average of 3.96 polymorphic loci per primer. The average of the effective number of alleles, Nei's gene diversity, and Shannon's information index were 0.59, 0.2835, and 0.4361, respectively. The diversity varied among different geographic regions. The result of principal component analysis was consistent with that of unweighted pair group method with arithmetic mean clustering analysis. The 101 G. arboreum accessions were clustered into 2 groups.

  11. Variations and Transmission of QTL Alleles for Yield and Fiber Qualities in Upland Cotton Cultivars Developed in China

    Science.gov (United States)

    Zhang, Tianzhen; Qian, Neng; Zhu, Xiefei; Chen, Hong; Wang, Sen; Mei, Hongxian; Zhang, Yuanming

    2013-01-01

    Cotton is the world’s leading cash crop, and genetic improvement of fiber yield and quality is the primary objective of cotton breeding program. In this study, we used various approaches to identify QTLs related to fiber yield and quality. Firstly, we constructed a four-way cross (4WC) mapping population with four base core cultivars, Stoneville 2B, Foster 6, Deltapine 15 and Zhongmiansuo No.7 (CRI 7), as parents in Chinese cotton breeding history and identified 83 QTLs for 11 agronomic and fiber quality traits. Secondly, association mapping of agronomical and fiber quality traits was based on 121 simple sequence repeat (SSR) markers using a general linear model (GLM). For this, 81 Gossypium hirsutum L. accessions including the four core parents and their derived cultivars were grown in seven diverse environments. Using these approaches, we successfully identified 180 QTLs significantly associated with agronomic and fiber quality traits. Among them were 66 QTLs that were identified via linkage disequilibrium (LD) and 4WC family-based linkage (FBL) mapping and by previously published family-based linkage (FBL) mapping in modern Chinese cotton cultivars. Twenty eight and 44 consistent QTLs were identified by 4WC and LD mapping, and by FBL and LD mapping methods, respectively. Furthermore, transmission and variation of QTL-alleles mapped by LD association in the three breeding periods revealed that some could be detected in almost all Chinese cotton cultivars, suggesting their stable transmission and some identified only in the four base cultivars and not in the modern cultivars, suggesting they were missed in conventional breeding. These results will be useful to conduct genomics-assisted breeding effectively using these existing and novel QTL alleles to improve yield and fiber qualities in cotton. PMID:23468939

  12. Identification of candidate genes from the SAD gene family in cotton for determination of cottonseed oil composition.

    Science.gov (United States)

    Shang, Xiaoguang; Cheng, Chaoze; Ding, Jian; Guo, Wangzhen

    2017-02-01

    Cotton is an economically important crop grown for natural fiber and seed oil production. Cottonseed oil ranks third after soybean oil and colza oil in terms of edible oilseed tonnage worldwide. The fatty acid composition of cottonseed oil determines its industrial application and nutritional values. However, little progress has been made in understanding cottonseed oil biogenesis. Stearoyl-acyl carrier protein desaturase (SAD), the only known enzyme to convert saturated fatty acids into unsaturated fatty acids in plants, plays key roles in determining the fatty acid composition of cottonseed oil. In this study, we identified 9, 9, 18 and 19 SAD genes in the genomes of four sequenced cotton species: diploid Gossypium raimondii (D 5 ), G. arboreum (A 2 ), tetraploid G. hirsutum acc. TM-1 (AD 1 ) and G. barbadense cv. Xinhai21 (AD 2 ), respectively. Bioinformatic and phylogenetic analyses revealed that cotton SADs can be classified into two classes. Expression patterns showed developmental and spatial regulation of SADs in cotton. GhSAD2 and GhSAD4 were preferentially expressed in developing ovules 20-35 days post-anthesis, and significantly different expression patterns were found between high-oil and low-oil cotton cultivars, implying these two genes could be involved in cottonseed oil biogenesis. Association analysis further confirmed that GhSAD4-At expression was closely related to the oleic acid (O) content, linoleic acid (L) content and O/L value in cottonseed, implying GhSAD4 plays an important role in cottonseed oil composition. This study brings new perspectives for integrated genome-wide identification of SADs in cotton and provides references for the genetic improvement of cottonseed oil.

  13. Interspecific Associations between Cycloneda sanguinea and Two Aphid Species (Aphis gossypii and Hyadaphis foeniculi) in Sole-Crop and Fennel-Cotton Intercropping Systems.

    Science.gov (United States)

    Fernandes, Francisco S; Ramalho, Francisco S; Malaquias, José B; Godoy, Wesley A C; Santos, Bárbara Davis B

    2015-01-01

    Aphids cause significant damage to crop plants. Studies regarding predator-prey relationships in fennel (Foeniculum vulgare Mill.) and cotton (Gossypium hirsutum L.) crops are important for understanding essential ecological interactions in the context of intercropping and for establishing pest management programs for aphids. This study evaluated the association among Hyadaphis foeniculi (Passerini) (Hemiptera: Aphididae), Aphis gossypii Glover (Hemiptera: Aphididae) and Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) in cotton with coloured fibres, fennel and cotton intercropped with fennel. Association analysis was used to investigate whether the presence or absence of prey and predator species can indicate possible interactions between aphids and ladybugs. Significant associations among both apterous and alate H. foeniculi and C. sanguinea were observed in both the fennel and fennel-cotton intercropping systems. The similarity analysis showed that the presence of aphids and ladybugs in the same system is significantly dependent on the type of crop. A substantial amount of evidence indicates that the presence of the ladybug C. sanguinea, is associated with apterous or alate A. gossypii and H. foeniculi in fennel-cotton intercropping system. We recommend that future research vising integrated aphid management taking into account these associations for take decisions.

  14. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  15. ADAPTABILIDADE E ESTABILIDADE FENOTÍPICA DE CULTIVARES DE ALGODOEIRO NO ESTADO DO MATO GROSSO, BRASIL PHENOTYPIC ADAPTABILITY AND STABILITY OF COTTON CULTIVARS IN THE MATO GROSSO STATE, BRAZIL

    Directory of Open Access Journals (Sweden)

    Cristina Schetino Bastos

    2007-09-01

    Full Text Available

    O objetivo deste trabalho foi o de avaliar a adaptabilidade e a estabilidade de cultivares de algodão (Gossypium hirsutum L., utilizando a metodologia proposta por Eberhart & Russell (1966. Para tanto, onze variedades de algodão foram avaliadas em sete locais do Estado do Mato Grosso, Brasil, em dois anos agrícolas (2002/2003 e 2003/2004. O delineamento experimental empregado foi o de blocos casualizados com quatro repetições e as características avaliadas foram a produtividade de algodão em caroço e a porcentagem de fibra. Com relação à produção de algodão em caroço, as cultivares BRS Aroeira, BRS Ipê, BRS Cedro, BRS Jatobá e Delta Opal demonstraram ampla adaptabilidade e estabilidade para as regiões produtoras do Estado. Entretanto, considerando a porcentagem de fibra, não foram encontradas cultivares de algodão com ampla adaptabilidade e estabilidade nos ambientes estudados.

    PALAVRAS-CHAVE: Gossypium hirsutum; fibra; estabilidade.

    The objective of this work was to evaluate the stability and adaptability of cotton (Gossypium hirsutum L. cultivars using the method of Eberhart & Russell (1966. Eleven varieties of cotton were tested at seven locations in Mato Grosso State, Brazil, in two growing seasons (2002/2003 and 2003/2004. The experimental design was the randomized complete blocks with four replications and the evaluated traits were lint percentage and seed cotton yield. For seed cotton yield, BRS Aroeira, BRS Ipê, BRS Cedro, BRS Jatobá and Delta Opal showed broad adaptability and stability in Mato Grosso State. However, for lint percentage there were not found cotton cultivars with both broad adaptability and stability for the studied environments.

  16. Effect of late planting and shading on cellulose synthesis during cotton fiber secondary wall development.

    Directory of Open Access Journals (Sweden)

    Ji Chen

    Full Text Available Cotton-rapeseed or cotton-wheat double cropping systems are popular in the Yangtze River Valley and Yellow River Valley of China. Due to the competition of temperature and light resources during the growing season of double cropping system, cotton is generally late-germinating and late-maturing and has to suffer from the coupling of declining temperature and low light especially in the late growth stage. In this study, late planting (LP and shading were used to fit the coupling stress, and the coupling effect on fiber cellulose synthesis was investigated. Two cotton (Gossypium hirsutum L. cultivars were grown in the field in 2010 and 2011 at three planting dates (25 April, 25 May and 10 June each with three shading levels (normal light, declined 20% and 40% PAR. Mean daily minimum temperature was the primary environmental factor affected by LP. The coupling of LP and shading (decreased cellulose content by 7.8%-25.5% produced more severe impacts on cellulose synthesis than either stress alone, and the effect of LP (decreased cellulose content by 6.7%-20.9% was greater than shading (decreased cellulose content by 0.7%-5.6%. The coupling of LP and shading hindered the flux from sucrose to cellulose by affecting the activities of related cellulose synthesis enzymes. Fiber cellulose synthase genes expression were delayed under not only LP but shading, and the coupling of LP and shading markedly postponed and even restrained its expression. The decline of sucrose-phosphate synthase activity and its peak delay may cause cellulose synthesis being more sensitive to the coupling stress during the later stage of fiber secondary wall development (38-45 days post-anthesis. The sensitive difference of cellulose synthesis between two cultivars in response to the coupling of LP and shading may be mainly determined by the sensitiveness of invertase, sucrose-phosphate synthase and cellulose synthase.

  17. Feoforbídeo (etoxi-purpurina-18 isolado de Gossypium mustelinum (Malvaceae Ethyl ester putpurin-18 from Gossypium mustelinum (Malvaceae

    Directory of Open Access Journals (Sweden)

    Tania Maria Sarmento Silva

    2010-01-01

    Full Text Available The phaeophorbide ethyl ester named Purpurin-18 and the flavonoids quercetin and kaempferol were obtained by chromatographic procedures from the chloroform fraction of aerial parts of Gossypium mustelinum. The structure of these compound was determined by NMR, IR and mass spectra data analysis. This is the first occurrence of this compound in Angiosperm.

  18. Impact of Bollgard cotton on Indian cotton production and Income of ...

    Indian Academy of Sciences (India)

    Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.

  19. Drought tolerance studies through WSSI and stomata in upland cotton

    International Nuclear Information System (INIS)

    Baloch, M.J.; Jatoi, W.A.; Soomro, Z.A.; Khan, N.U.; Hassan, G.; Khakwani, A.A.; Veesar, N.F.

    2011-01-01

    Water stress susceptibility index (WSSI) and stomatal conductance were used to determine the stress tolerance of 10 upland cotton cultivars during 2009 at Sindh Agriculture University, Tandojam, Pakistan. The experiment was conducted in spilt plot design with irrigations as main plots and cultivars as sub-plots. Two irrigation treatments were used i.e. one has two irrigations (water stress) and other has eight irrigations (non-stress). Analysis of variance revealed significant genotypic differences about WSSI for all the traits. Non-significant interaction between irrigations and cultivars for seed cotton yield and boll weight exhibited varietals stability over irrigation regimes, whereas significant interactions between above parameters for plant height and bolls per plant suggested genotypic instability over irrigation treatments for these traits. Overall, cultivars mean performance for all the traits in stress conditions was poor as compared to non-stress conditions, nevertheless some cultivars exhibited nonsignificant mean differences in both irrigation regimes, thus showing higher stress tolerance. The WSSI values of seed cotton yield as displayed in bi plot revealed that cultivars CRIS-477, CRIS-483 and CRIS-486 were found highly susceptible to water stress. Cultivars CRIS-476, CRIS-482, CRIS-487 and NIAB-78 were characterized as highly susceptible with minimum production even under optimum irrigation conditions. Cultivar CRIS-9 was moderately tolerant as produced low production. However, cultivars CRIS-485 and CRIS-484 were found highly stress tolerant because of minimum WSSI value and lower stomatal conductance. Negative correlations between water stress and WSSI for seed cotton yield and plant height revealed that any increase in the degree of stress caused a corresponding decrease in WSSI. (author)

  20. Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease

    Directory of Open Access Journals (Sweden)

    Silvie P

    2008-10-01

    Full Text Available Abstract Background Cotton blue disease (CBD, an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp, and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

  1. Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease.

    Science.gov (United States)

    Silva, T F; Corrêa, R L; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, M F S

    2008-10-20

    Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004-2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

  2. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  3. A novel VIGS method by agroinoculation of cotton seeds and application for elucidating functions of GhBI-1 in salt-stress response.

    Science.gov (United States)

    Zhang, Jingxia; Wang, Furong; Zhang, Chuanyun; Zhang, Junhao; Chen, Yu; Liu, Guodong; Zhao, Yanxiu; Hao, Fushun; Zhang, Jun

    2018-06-04

    A VIGS method by agroinoculation of cotton seeds was developed for gene silencing in young seedlings and roots, and applied in functional analysis of GhBI-1 in response to salt stress. Virus-induced gene silencing (VIGS) has been widely used to investigate the functions of genes expressed in mature leaves, but not yet in young seedlings or roots of cotton (Gossypium hirsutum L.). Here, we developed a simple and effective VIGS method for silencing genes in young cotton seedlings and roots by soaking naked seeds in Agrobacterium cultures carrying tobacco rattle virus (TRV)-VIGS vectors. When the naked seeds were soaked in Agrobacterium cultures with an OD600 of 1.5 for 90 min, it was optimal for silencing genes effectively in young seedlings as clear photo-bleaching phenotype in the newly emerging leaves of pTRV:GhCLA1 seedlings were observed at 12-14 days post inoculation. Silencing of GhPGF (cotton pigment gland formation) by this method resulted in a 90% decrease in transcript abundances of the gene in roots at the early development stage. We further used the tool to investigate function of GhBI-1 (cotton Bax inhibitor-1) gene in response to salt stress and demonstrated that GhBI-1 might play a protective role under salt stress by suppressing stress-induced cell death in cotton. Our results showed that the newly established VIGS method is a powerful tool for elucidating functions of genes in cotton, especially the genes expressed in young seedlings and roots.

  4. Biomass Accumulation, Photosynthetic Traits and Root Development of Cotton as Affected by Irrigation and Nitrogen-Fertilization

    Directory of Open Access Journals (Sweden)

    Zongkui Chen

    2018-02-01

    Full Text Available Limitations of soil water and nitrogen (N are factors which cause a substantial reduction in cotton (Gossypium hirsutum L. yield, especially in an arid environment. Suitable management decisions like irrigation method and nitrogen fertilization are the key yield improvement technologies in cotton production systems. Therefore, we hypothesized that optimal water-N supply can increase cotton plant biomass accumulation by maintaining leaf photosynthetic capacity and improving root growth. An outdoor polyvinyl chloride (PVC tube study was conducted to investigate the effects of two water-N application depths, i.e., 20 cm (H20 or 40 cm (H40 from soil surface and four water-N combinations [deficit irrigation (W55 and no N (N0 (W55N0, W55 and moderate N (N1 (W55N1, moderate irrigation (W75 and N0 (W75N0, W75N1] on the roots growth, leaf photosynthetic traits and dry mass accumulation of cotton crops. H20W55N1 combination increased total dry mass production by 29–82% and reproductive organs biomass by 47–101% compared with other counterparts. Root protective enzyme and nitrate reductase (NR activity, potential quantum yield of photosystem (PS II (Fv/Fm, PSII quantum yield in the light [Y(II] and electron transport rate of PSII were significantly higher in H20W55N1 prior to 82 days after emergence. Root NR activity and protective enzyme were significantly correlated with chlorophyll, Fv/Fm, Y(II and stomatal conductance. Hence, shallow irrigation (20 cm with moderate irrigation and N-fertilization application could increase cotton root NR activity and protective enzyme leading to enhance light capture and photochemical energy conversion of PSII before the full flowering stage. This enhanced photoassimilate to reproductive organs.

  5. Upland cotton gene GhFPF1 confers promotion of flowering time and shade-avoidance responses in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Wang

    Full Text Available Extensive studies on floral transition in model species have revealed a network of regulatory interactions between proteins that transduce and integrate developmental and environmental signals to promote or inhibit the transition to flowering. Previous studies indicated FLOWERING PROMOTING FACTOR 1 (FPF1 gene was involved in the promotion of flowering, but the molecular mechanism was still unclear. Here, FPF1 homologous sequences were screened from diploid Gossypium raimondii L. (D-genome, n = 13 and Gossypium arboreum L. genome (A-genome, n = 13 databases. Orthologous genes from the two species were compared, suggesting that distinctions at nucleic acid and amino acid levels were not equivalent because of codon degeneracy. Six FPF1 homologous genes were identified from the cultivated allotetraploid Gossypium hirsutum L. (AD-genome, n = 26. Analysis of relative transcripts of the six genes in different tissues revealed that this gene family displayed strong tissue-specific expression. GhFPF1, encoding a 12.0-kDa protein (Accession No: KC832319 exerted more transcripts in floral apices of short-season cotton, hinting that it could be involved in floral regulation. Significantly activated APETALA 1 and suppressed FLOWERING LOCUS C expression were induced by over-expression of GhFPF1 in the Arabidopsis Columbia-0 ecotype. In addition, transgenic Arabidopsis displayed a constitutive shade-avoiding phenotype that is characterized by long hypocotyls and petioles, reduced chlorophyll content, and early flowering. We propose that GhFPF1 may be involved in flowering time control and shade-avoidance responses.

  6. A receptor-like kinase gene (GbRLK) from Gossypium barbadense enhances salinity and drought-stress tolerance in Arabidopsis.

    Science.gov (United States)

    Zhao, Jun; Gao, Yulong; Zhang, Zhiyuan; Chen, Tianzi; Guo, Wangzhen; Zhang, Tianzhen

    2013-08-06

    Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5' region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). GbRLK is involved in the drought and high salinity stresses pathway by activating or participating in the ABA signaling

  7. Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

    Directory of Open Access Journals (Sweden)

    Zainul A Khan

    Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

  8. Genome Editing in Cotton with the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Wei Gao

    2017-08-01

    Full Text Available Genome editing is an important tool for gene functional studies as well as crop improvement. The recent development of the CRISPR/Cas9 system using single guide RNA molecules (sgRNAs to direct precise double strand breaks in the genome has the potential to revolutionize agriculture. Unfortunately, not all sgRNAs are equally efficient and it is difficult to predict their efficiency by bioinformatics. In crops such as cotton (Gossypium hirsutum L., with labor-intensive and lengthy transformation procedures, it is essential to minimize the risk of using an ineffective sgRNA that could result in the production of transgenic plants without the desired CRISPR-induced mutations. In this study, we have developed a fast and efficient method to validate the functionality of sgRNAs in cotton using a transient expression system. We have used this method to validate target sites for three different genes GhPDS, GhCLA1, and GhEF1 and analyzed the nature of the CRISPR/Cas9-induced mutations. In our experiments, the most frequent type of mutations observed in cotton cotyledons were deletions (∼64%. We prove that the CRISPR/Cas9 system can effectively produce mutations in homeologous cotton genes, an important requisite in this allotetraploid crop. We also show that multiple gene targeting can be achieved in cotton with the simultaneous expression of several sgRNAs and have generated mutations in GhPDS and GhEF1 at two target sites. Additionally, we have used the CRISPR/Cas9 system to produce targeted gene fragment deletions in the GhPDS locus. Finally, we obtained transgenic cotton plants containing CRISPR/Cas9-induced gene editing mutations in the GhCLA1 gene. The mutation efficiency was very high, with 80.6% of the transgenic lines containing mutations in the GhCLA1 target site resulting in an intense albino phenotype due to interference with chloroplast biogenesis.

  9. Proteomic responses of drought-tolerant and drought-sensitive cotton varieties to drought stress.

    Science.gov (United States)

    Zhang, Haiyan; Ni, Zhiyong; Chen, Quanjia; Guo, Zhongjun; Gao, Wenwei; Su, Xiujuan; Qu, Yanying

    2016-06-01

    Drought, one of the most widespread factors reducing agricultural crop productivity, affects biological processes such as development, architecture, flowering and senescence. Although protein analysis techniques and genome sequencing have made facilitated the proteomic study of cotton, information on genetic differences associated with proteomic changes in response to drought between different cotton genotypes is lacking. To determine the effects of drought stress on cotton seedlings, we used two-dimensional polyacrylamide gel electrophoresis (2-DE) and matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry to comparatively analyze proteome of drought-responsive proteins during the seedling stage in two cotton (Gossypium hirsutum L.) cultivars, drought-tolerant KK1543 and drought-sensitive Xinluzao26. A total of 110 protein spots were detected on 2-DE maps, of which 56 were identified by MALDI-TOF and MALDI-TOF/TOF mass spectrometry. The identified proteins were mainly associated with metabolism (46.4 %), antioxidants (14.2 %), and transport and cellular structure (23.2 %). Some key proteins had significantly different expression patterns between the two genotypes. In particular, 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase, UDP-D-glucose pyrophosphorylase and ascorbate peroxidase were up-regulated in KK1543 compared with Xinluzao26. Under drought stress conditions, the vacuolar H(+)-ATPase catalytic subunit, a 14-3-3g protein, translation initiation factor 5A and pathogenesis-related protein 10 were up-regulated in KK1543, whereas ribosomal protein S12, actin, cytosolic copper/zinc superoxide dismutase, protein disulfide isomerase, S-adenosylmethionine synthase and cysteine synthase were down-regulated in Xinluzao26. This work represents the first characterization of proteomic changes that occur in response to drought in roots of cotton plants. These differentially expressed proteins may be related to

  10. The use of different clustering methods in the evaluation of genetic diversity in upland cotton

    Directory of Open Access Journals (Sweden)

    Laíse Ferreira de Araújo

    Full Text Available The continuous development and evaluation of new genotypes through crop breeding is essential in order to obtain new cultivars. The objective of this work was to evaluate the genetic divergences between cultivars of upland cotton (Gossypium hirsutum L. using the agronomic and technological characteristics of the fibre, in order to select superior parent plants. The experiment was set up during 2010 at the Federal University of Ceará in Fortaleza, Ceará, Brazil. Eleven cultivars of upland cotton were used in an experimental design of randomised blocks with three replications. In order to evaluate the genetic diversity among cultivars, the generalised Mahalanobis distance matrix was calculated, with cluster analysis then being applied, employing various methods: single linkage, Ward, complete linkage, median, average linkage within a cluster and average linkage between clusters. Genetic variability exists among the evaluated genotypes. The most consistant clustering method was that employing average linkage between clusters. Among the characteristics assessed, mean boll weight presented the highest contribution to genetic diversity, followed by elongation at rupture. Employing the method of mean linkage between clusters, the cultivars with greater genetic divergence were BRS Acacia and LD Frego; those of greater similarity were BRS Itaúba and BRS Araripe.

  11. Inoculant of arbuscular mycorrhizal fungi (Rhizophagus clarus increase yield of soybean and cotton under field conditions

    Directory of Open Access Journals (Sweden)

    Martha Viviana Torres Cely

    2016-05-01

    Full Text Available Nutrient availability is an important factor in crop production, and regular addition of chemical fertilizers is the most common practice to improve yield in agrosystems for intensive crop production. The use of some groups of microorganisms that have specific activity providing nutrients to plants is a good alternative, and arbuscular mycorrhizal fungi (AMF enhance plant nutrition by providing especially phosphorus (P, improving plant growth and increasing crop production. Unfortunately, the use of AMF as an inoculant on a large scale is not yet widely used, because of several limitations in obtaining a large amount of inoculum due to several factors, such as low growth, the few species domesticated under in vitro conditions, and high competition with native AMF. The objective of this work was to test the infectivity of a Rhizophagus clarus inoculum and its effectiveness as an alternative for P supply in soybean (Glycine max L. and cotton (Gossypium hirsutum L.. The experiments were carried out in plots and the treatments were: Fertilizer; AMF, AMF + Fertilizer and AMF + ½ Fertilizer; non-inoculated and non-fertilized plants were considered the control. The parameters evaluated were AMF root colonization and effect of inoculation on plant growth and yield under a field conditions. The results showed that AMF inoculation increased the effect of fertilizer application in soybean, and that in cotton R. clarus was more effective than chemical fertilizer

  12. Intracellular localization of phosphatidylcholine and phosphatidylethanolamine synthesis in cotyledons of cotton seedlings

    International Nuclear Information System (INIS)

    Chapman, K.D.; Trelease, R.N.

    1991-01-01

    Subfractionation of clarified cotyledon homogenates of cotton (Gossypium hirsutum L.) seedlings on sucrose gradients revealed a single coincident peak of cholinephosphotransferase (CPT) and ethanolaminephosphotransferase (EPT) activities, which equilibrated with the main peak of Anti-mycin A-insensitive NADH: cytochrome c reductase (CCR) activity. The small percentage of CPT and EPT activities in glyoxysome-enriched pellets equilibrated with cytochrome c oxidase activity, not with catalase activity. Preincubation of microsomes in 0.2 millimolar MgCl 2 followed by subfractionation on sucrose gradients resulted in peak CPT and EPT activities equilibrating with peak CCR activity at 24% (w/w) sucrose. Preincubation of microsomes with 14 C-CCP choline (or 14 C-CDPethanolamine) resulted in synthesis and incorporation of 14 C-phosphatidylcholine (PC) (or 14 C-phosphatidylethanolamine, PE) into membranes at the same density. Increasing the Mg 2+ concentration to 2.0 millimolar facilitated binding of ribosomes and caused a concomitant shift in density (to 34% w/w sucrose) of peak CPT, EPT, and CCR activities. under these conditions, newly synthesized and incorporated 14 C-PC (or PE) was recovered in these membranes. These results indicate that Er in cotyledons of germinated cotton seedlings is the primary subcellular site of PC and PE synthesis. This is similar to the situation in endosperm tissue but distinctly different from root and hypocotyl tissue where Golgi are a major subcellular site of PC and PE synthesis

  13. Investigating the Antioxidant and Acetylcholinesterase Inhibition Activities of Gossypium herbaceam

    Directory of Open Access Journals (Sweden)

    Haji Akber Aisa

    2013-01-01

    Full Text Available Our previous research showed that standardized extract from the flowers of the Gossypium herbaceam labeled GHE had been used in clinical trials for its beneficial effects on brain functions, particularly in connection with age-related dementia and Alzheimer’s disease (AD. The aim of this work was to determine the components of this herb and the individual constituents of GHE. In order to better understand this herb for AD treatment, we investigated the acetylcholinesterase (AChE inhibition and antioxidant activity of GHE as well as the protective effects to PC12 cells against cytotoxicity induced by tertiary butyl hydroperoxide (tBHP using in vitro assays. The antioxidant activities were assessed by measuring their capabilities for scavenging 1,1-diphenyl-2-picylhydrazyl (DPPH and 2-2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid (ABTS free radical as well as in inhibiting lipid peroxidation. Our data showed that GHE exhibited certain activities against AChE and also is an efficient free radical scavenger, which may be helpful in preventing or alleviating patients suffering from AD.

  14. Performance of cotton crop grown under surface irrigation and drip fertigation. I. seed cotton yield, dry matter production, and lint properties

    International Nuclear Information System (INIS)

    Janat, M.; Somi, G.

    2002-01-01

    Drip fertigation is a key factor in modern irrigated agriculture, where water and fertilizers are the most expensive inputs for this irrigation method. Drip fertigation experiments were carried out a Hama, north of Syria (Tezeen's Irrigation Research Station), for four consecutive years 1995 - 1998. Cotton (Gossypium hirsutim L.) variety Aleppo 33/1 was planted after unfertilized maize in order to deplete as much as possible the available N and reduce the field variability on the corresponding experimental units and irrigated thereafter. Treatments consisted of two irrigation methods (Surface irrigation and drip fertigation) and five N rates within drip fertigated cotton, including the control (N 0 = 0, N 1 = 60, N 2 = 120, N 3 = 180, N 4 240 kg N ha -1 ). The N fertilizer treatment for surface irrigated cotton was 180 kg N ha -1 in accordance with the recommended rate of ministry of Agriculture and Agrarian Reform. The experimental design was randomized block design with six replicates. Fertigation resulted in large water saving, and highly improved field water-use efficiency. Further, increasing N application rates under drip fertigation increased dry matter yield. The principal benefit of drip fertigation was the achievement of higher field water-use efficiencies, which were increased more than three-fold for both dry matter and seed cotton yield, relative to surface irrigation. The highest water-use efficiencies were obtained with the addition of 180 and 240 kg N ha -1 in 1995 and 1996 and 120 kg N ha -1 in 1997 and 1998. Dry matter production and partitioning among different plant parts at physiological maturity stage varied due to N input and irrigation methods. The overall dry matter distribution among different plant structures for drip fertigated-treatments was: Stems, 20.3 - 21.3%; leaves 26.3 - 28.7%; and fruiting forms, 50 - 53.2%. For the surface-irrigated treatment, the partitioning was stems, 23.1%; leaves, 28.3%; and fruiting form, 48.6%. The

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  16. A Gossypium hirsutum GDSL lipase/hydrolase gene (GhGLIP) appears to be involved in promoting seed growth in Arabidopsis.

    Science.gov (United States)

    Ma, Rendi; Yuan, Hali; An, Jing; Hao, Xiaoyun; Li, Hongbin

    2018-01-01

    GDSL lipase (GLIP) plays a pivotal role in plant cell growth as a multifunctional hydrolytic enzyme. Herein, a cotton (Gossypium hirsutum L. cv Xuzhou 142) GDSL lipase gene (GhGLIP) was obtained from developing ovules and fibers. The GhGLIP cDNA contained an open reading frame (ORF) of 1,143 base pairs (bp) and encodes a putative polypeptide of 380 amino acid residues. Sequence alignment indicated that GhGLIP includes four enzyme catalytic amino acid residue sites of Ser (S), Gly (G), Asn (N) and His (H), located in four conserved blocks. Phylogenetic tree analysis showed that GhGLIP belongs to the typical class IV lipase family with potential functions in plant secondary metabolism. Subcellular distribution analysis demonstrated that GhGLIP localized to the nucleus, cytoplasm and plasma membrane. GhGLIP was expressed predominantly at 5-15 day post anthesis (dpa) in developing ovules and elongating fibers, measured as mRNA levels and enzyme activity. Ectopic overexpression of GhGLIP in Arabidopsis plants resulted in enhanced seed development, including length and fresh weight. Meanwhile, there was increased soluble sugar and protein storage in transgenic Arabidopsis plants, coupled with the promotion of lipase activity. Moreover, the expression of cotton GhGLIP is induced by ethylene (ETH) treatment in vitro. A 1,954-bp GhGLIP promoter was isolated and expressed high activity in driving green fluorescence protein (GFP) expression in tobacco leaves. Cis-acting element analysis of the GhGLIP promoter (pGhGLIP) indicated the presence of an ethylene-responsive element (ERE), and transgenic tobacco leaves with ectopic expression of pGhGLIP::GFP-GUS showed increased GUS activity after ETH treatment. In summary, these results suggest that GhGLIP is a functional enzyme involved in ovule and fiber development and performs significant roles in seed development.

  17. Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

    Science.gov (United States)

    Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

  18. Impact of efficient refuge policies for Bt cotton in India on world cotton trade

    OpenAIRE

    Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.

    2010-01-01

    India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...

  19. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali; Tuttle, John Richard; Robertson, Dominique Niki; Haigler, Candace H.; Brown, Judith K.

    2010-01-01

    inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor

  20. Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

    Directory of Open Access Journals (Sweden)

    Md. Mizanur Rahman

    2015-01-01

    Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

  1. Cotton : Market setting, trade policies, and issues

    OpenAIRE

    Baffes, John

    2004-01-01

    The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...

  2. Produtividade do algodoeiro herbáceo em plantio direto no Cerrado com rotação de culturas Herbaceous cotton yield in no-till system in rainfed Savannah conditions with crop rotation

    Directory of Open Access Journals (Sweden)

    José Carlos Corrêa

    2004-01-01

    Full Text Available O experimento, instalado em um Latossolo Vermelho-Amarelo muito argiloso, teve o objetivo de avaliar o efeito da rotação de culturas na produtividade do algodoeiro herbáceo (Gossypium hirsutum L. r. latifolium Hutch em plantio direto sob condições de sequeiro no Cerrado. O delineamento experimental foi de blocos casualizados com cinco tratamentos e quatro repetições. Os tratamentos consistiram das rotações soja-milheto-soja-milheto-algodoeiro; soja-amaranto-soja-nabo forrageiro-soja-algodoeiro; soja-sorgo granífero-soja-sorgo granífero-algodoeiro; soja-aveia preta-soja-aveia preta-algodoeiro e soja-soja-algodoeiro. A maior produtividade do algodoeiro foi obtida com a rotação de soja e milheto, em que houve melhor controle de plantas daninhas.The experiment was carried out in a heavy red yellow latosol and aimed at evaluating crop rotation on herbaceous cotton yields in no-till system under rainfed Savannah conditions. The experimental design used was a completely randomised blocks with five treatments: soybean-millet-soybean-millet-cotton; soybean-amaranth-soybean-forage radish-soybean-cotton; soybean-grain sorghum-soybean-grain sorghum-cotton; soybean-black rye-soybean-black rye-cotton and soybean-soybean-cotton and four replications. The highest cotton seed yield was obtained in the sequence soybean-millet-soybean-millet-cotton, in which best weed control also occurred.

  3. Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

    Science.gov (United States)

    The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

  4. The water footprint of cotton consumption

    NARCIS (Netherlands)

    Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

    2005-01-01

    The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

  5. Sub-soil microbial activity under rotational cotton crops in Australia

    Science.gov (United States)

    Polain, Katherine; Knox, Oliver; Wilson, Brian; Pereg, Lily

    2016-04-01

    Soil microbial communities contribute significantly to soil organic matter formation, stabilisation and destabilisation, through nutrient cycling and biodegradation. The majority of soil microbial research examines the processes occurring in the top 0 cm to 30 cm of the soil, where organic nutrients are easily accessible. In soils such as Vertosols, the high clay content causes swelling and cracking. When soil cracking is coupled with rain or an irrigation event, a flush of organic nutrients can move down the soil profile, becoming available for subsoil microbial community use and potentially making a significant contribution to nutrient cycling and biodegradation in soils. At present, the mechanisms and rates of soil nutrient turnover (such as carbon and nitrogen) at depth under cotton rotations are mostly speculative and the process-response relationships remain unclear, although they are undoubtedly underpinned by microbial activity. Our research aims to determine the contribution and role of soil microbiota to the accumulation, cycling and mineralisation of carbon and nitrogen through the whole root profile under continuous cotton (Gossypium hirsutum) and cotton-maize rotations in regional New South Wales, Australia. Through seasonal work, we have established both baseline and potential microbial activity rates from 0 cm to 100 cm down the Vertosol profile, using respiration and colourimetric methods. Further whole soil profile analyses will include determination of microbial biomass and isotopic carbon signatures using phospholipid fatty acid (PLFA) methodology, identification of microbial communities (sequencing) and novel experiments to investigate potential rates of nitrogen mineralisation and quantification of associated genes. Our preliminary observations and the hypotheses tested in this three-year study will be presented.

  6. Genome-wide recombination rate variation in a recombination map of cotton.

    Science.gov (United States)

    Shen, Chao; Li, Ximei; Zhang, Ruiting; Lin, Zhongxu

    2017-01-01

    Recombination is crucial for genetic evolution, which not only provides new allele combinations but also influences the biological evolution and efficacy of natural selection. However, recombination variation is not well understood outside of the complex species' genomes, and it is particularly unclear in Gossypium. Cotton is the most important natural fibre crop and the second largest oil-seed crop. Here, we found that the genetic and physical maps distances did not have a simple linear relationship. Recombination rates were unevenly distributed throughout the cotton genome, which showed marked changes along the chromosome lengths and recombination was completely suppressed in the centromeric regions. Recombination rates significantly varied between A-subgenome (At) (range = 1.60 to 3.26 centimorgan/megabase [cM/Mb]) and D-subgenome (Dt) (range = 2.17 to 4.97 cM/Mb), which explained why the genetic maps of At and Dt are similar but the physical map of Dt is only half that of At. The translocation regions between A02 and A03 and between A04 and A05, and the inversion regions on A10, D10, A07 and D07 indicated relatively high recombination rates in the distal regions of the chromosomes. Recombination rates were positively correlated with the densities of genes, markers and the distance from the centromere, and negatively correlated with transposable elements (TEs). The gene ontology (GO) categories showed that genes in high recombination regions may tend to response to environmental stimuli, and genes in low recombination regions are related to mitosis and meiosis, which suggested that they may provide the primary driving force in adaptive evolution and assure the stability of basic cell cycle in a rapidly changing environment. Global knowledge of recombination rates will facilitate genetics and breeding in cotton.

  7. Mechanism of phytohormone involvement in feedback regulation of cotton leaf senescence induced by potassium deficiency.

    Science.gov (United States)

    Wang, Ye; Li, Bo; Du, Mingwei; Eneji, A Egrinya; Wang, Baomin; Duan, Liusheng; Li, Zhaohu; Tian, Xiaoli

    2012-10-01

    To elucidate the phytohormonal basis of the feedback regulation of leaf senescence induced by potassium (K) deficiency in cotton (Gossypium hirsutum L.), two cultivars contrasting in sensitivity to K deficiency were self- and reciprocally grafted hypocotyl-to-hypocotyl, using standard grafting (one scion grafted onto one rootstock), Y grafting (two scions grafted onto one rootstock), and inverted Y grafting (one scion grafted onto two rootstocks) at the seedling stage. K deficiency (0.03mM for standard and Y grafting, and 0.01mM for inverted Y grafting) increased the root abscisic acid (ABA) concentration by 1.6- to 3.1-fold and xylem ABA delivery rates by 1.8- to 4.6-fold. The K deficiency also decreased the delivery rates of xylem cytokinins [CKs; including the zeatin riboside (ZR) and isopentenyl adenosine (iPA) type] by 29-65% and leaf CK concentration by 16-57%. The leaf ABA concentration and xylem ABA deliveries were consistently greater in CCRI41 (more sensitive to K deficiency) than in SCRC22 (less sensitive to K deficiency) scions under K deficiency, and ZR- and iPA-type levels were consistently lower in the former than in the latter, irrespective of rootstock cultivar or grafting type, indicating that cotton shoot influences the levels of ABA and CKs in leaves and xylem sap. Because the scions had little influence on phytohormone levels in the roots (rootstocks) of all three types of grafts and rootstock xylem sap (collected below the graft union) of Y and inverted Y grafts, it appears that the site for basipetal feedback signal(s) involved in the regulation of xylem phytohormones is the hypocotyl of cotton seedlings. Also, the target of this feedback signal(s) is more likely to be the changes in xylem phytohormones within tissues of the hypocotyl rather than the export of phytohormones from the roots.

  8. Simulating endosulfan transport in runoff from cotton fields in Australia with the GLEAMS model.

    Science.gov (United States)

    Connolly, R D; Kennedy, I R; Silburn, D M; Simpson, B W; Freebairn, D M

    2001-01-01

    Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,4,3-benzodioxathiepin 3-oxide), a pesticide that is highly toxic to aquatic organisms, is widely used in the cotton (Gossypium hirsutum L.) industry in Australia and is a risk to the downstream riverine environment. We used the GLEAMS model to evaluate the effectiveness of a range of management scenarios aimed at minimizing endosulfan transport in runoff at the field scale. The field management scenarios simulated were (i) Conventional, bare soil at the beginning of the cotton season and seven irrigations per season; (ii) Improved Irrigation, irrigation amounts reduced and frequency increased to reduce runoff from excess irrigation; (iii) Dryland, no irrigation; (iv) Stubble Retained, increased soil cover created by retaining residue from the previous crop or a specially planted winter cover crop; and (v) Reduced Sprays, a fewer number of sprays. Stubble Retained was the most effective scenario for minimizing endosulfan transport because infiltration was increased and erosion reduced, and the stubble intercepted and neutralized a proportion of the applied endosulfan. Reducing excess irrigation reduced annual export rates by 80 to 90%, but transport in larger storm events was still high. Reducing the number of pesticide applications only reduced transport when three or fewer sprays were applied. We conclude that endosulfan transport from cotton farms can be minimized with a combination of field management practices that reduce excess irrigation and concentration of pesticide on the soil at any point in time; however, discharges, probably with endosulfan concentrations exceeding guideline values, will still occur in storm events.

  9. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  10. Nitrogen, potassium and plant growth retardant effects on oil content and quality of cotton seed

    Directory of Open Access Journals (Sweden)

    Alkassas, A. R.

    2007-09-01

    Full Text Available The aim of this field experiment was to investigate the effect of nitrogen, potassium and a plant growth retardant (PGR on seed yield and protein and oil content of an Egyptian cotton cultivar (Gossypium barbadense Giza 86. Treatments consisted of: soil application of N (95 and 143 kg N ha-1 in the form ammonium nitrate, foliar application of potassium (0, 319, 638 or 957 g K ha-1 as potassium sulfate and foliar application of mepiquat chloride (MC (0 and 48 + 24 g active ingredient ha-1 on seed, protein and oil yields and oil properties of Egyptian cotton cultivar “Giza 86” (Gossypium barbadense. After applying the higher N-rate, foliar application of potassium and plant growth retardant MC significantly increased seed yield and the content of seed protein and oil, seed oil refractive index, unsaponifiable matter and total unsaturated fatty acids (oleic and linoleic. In contrast, oil acid and saponification value as well as total saturated fatty acids were decreased by foliar application of potassium and MC. The seed oil content was decreased with soil application of N.El objetivo de los experimentos de campo fue investigar el efecto del nitrogeno, potasio y retardantes del crecimiento de plantas sobre el contenido en proteínas y aceite de una semilla de algodón cultivada en Egipto (Gossypium barbadense Giza 86. Los tratamientos consistieron en la aplicación en suelo de N (95 and 143 kg N ha-1 en forma de nitrato amónico, aplicación foliar de K (0, 319, 638 or 957 g K ha-1 como sulfato potásico y aplicación foliar de cloruro de m mepiquat (MC (0 and 48 + 24 g de ingrediente activo ha-1 sobre un cultivar de algodón «Giza 86» (Gossypium barbadense. La aplicación de la cantidad más elevada de N, unida a la aplicación de potasio y del retardador MC, aumentó significativamente el rendimiento en semilla, así como el contenido en proteinas y en aceite. Respecto al aceite, aumentó el índice de refracción, la fracci

  11. Performance of some transgenic cotton cultivars against insect pest complex, virus incidence and yield

    International Nuclear Information System (INIS)

    Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.

    2013-01-01

    Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)

  12. Thwarting one of cotton's nemeses

    International Nuclear Information System (INIS)

    Senft, D.

    1991-01-01

    There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

  13. Identification of miRNAs and Their Targets in Cotton Inoculated with Verticillium dahliae by High-Throughput Sequencing and Degradome Analysis

    Directory of Open Access Journals (Sweden)

    Yujuan Zhang

    2015-06-01

    Full Text Available MicroRNAs (miRNAs are a group of endogenous small non-coding RNAs that play important roles in plant growth, development, and stress response processes. Verticillium wilt is a vascular disease in plants mainly caused by Verticillium dahliae Kleb., the soil-borne fungal pathogen. However, the role of miRNAs in the regulation of Verticillium defense responses is mostly unknown. This study aimed to identify new miRNAs and their potential targets that are involved in the regulation of Verticillium defense responses. Four small RNA libraries and two degradome libraries from mock-infected and infected roots of cotton (both Gossypium hirsutum L. and Gossypium barbadense L. were constructed for deep sequencing. A total of 140 known miRNAs and 58 novel miRNAs were identified. Among the identified miRNAs, many were differentially expressed between libraries. Degradome analysis showed that a total of 83 and 24 genes were the targets of 31 known and 14 novel miRNA families, respectively. Gene Ontology analysis indicated that many of the identified miRNA targets may function in controlling root development and the regulation of Verticillium defense responses in cotton. Our findings provide an overview of potential miRNAs involved in the regulation of Verticillium defense responses in cotton and the interactions between miRNAs and their corresponding targets. The profiling of these miRNAs lays the foundation for further understanding of the function of small RNAs in regulating plant response to fungal infection and Verticillium wilt in particular.

  14. Competitive release and outbreaks of non-target pests associated with transgenic Bt cotton.

    Science.gov (United States)

    Zeilinger, Adam R; Olson, Dawn M; Andow, David A

    2016-06-01

    The adoption of transgenic Bt cotton has, in some cases, led to environmental and economic benefits through reduced insecticide use. However, the distribution of these benefits and associated risks among cotton growers and cotton-growing regions has been uneven due in part to outbreaks of non-target or secondary pests, thereby requiring the continued use of synthetic insecticides. In the southeastern USA, Bt cotton adoption has resulted in increased abundance of and damage from stink bug pests, Euschistus servus and Nezara viridula (Heteroptera: Pentatomidae). While the impact of increased stink bug abundance has been well-documented, the causes have remained unclear. We hypothesize that release from competition with Bt-susceptible target pests may drive stink bug outbreaks in Bt cotton. We first examined the evidence for competitive release of stink bugs through meta-analysis of previous studies. We then experimentally tested if herbivory by Bt-susceptible Helicoverpa zea increases stink bug leaving rates and deters oviposition on non-Bt cotton. Consistent with previous studies, we found differences in leaving rates only for E servus, but we found that both species strongly avoided ovipositing on H. zea-damaged plants. Considering all available evidence, competitive release of stink bug populations in Bt cotton likely contributes to outbreaks, though the relative importance of competitive release remains an open question. Ecological risk assessments of Bt crops and other transgenic insecticidal crops would benefit from greater understanding of the ecological mechanisms underlying non-target pest outbreaks and greater attention to indirect ecological effects more broadly.

  15. Functional characterization of AGAMOUS-subfamily members from cotton during reproductive development and in response to plant hormones.

    Science.gov (United States)

    de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio

    2017-03-01

    Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum

  16. Influence of Crop Management and Environmental Factors on Wolf Spider Assemblages (Araneae: Lycosidae) in an Australian Cotton Cropping System.

    Science.gov (United States)

    Rendon, Dalila; Whitehouse, Mary E A; Hulugalle, Nilantha R; Taylor, Phillip W

    2015-02-01

    Wolf spiders (Lycosidae) are the most abundant ground-hunting spiders in the Australian cotton (Gossypium hirsutum L.) agroecosystems. These spiders have potential in controlling pest bollworms, Helicoverpa spp. (Lepidoptera: Noctuidae) in minimum-tilled fields. A study was carried out during a wet growing season (2011-2012) in Narrabri, New South Wales, Australia, to determine how different crop rotations and tillage affect wolf spider assemblages in cotton fields. Spider abundance and species richness did not differ significantly between simple plots (no winter crop) and complex plots (cotton-wheat Triticum aestivum L.-vetch Vicia benghalensis L. rotation). However, the wolf spider biodiversity, as expressed by the Shannon-Weaver and Simpson's indices, was significantly higher in complex plots. Higher biodiversity reflected a more even distribution of the most dominant species (Venatrix konei Berland, Hogna crispipes Koch, and Tasmanicosa leuckartii Thorell) and the presence of more rare species in complex plots. T. leuckartii was more abundant in complex plots and appears to be sensitive to farming disturbances, whereas V. konei and H. crispipes were similarly abundant in the two plot types, suggesting higher resilience or recolonizing abilities. The demographic structure of these three species varied through the season, but not between plot types. Environmental variables had a significant effect on spider assemblage, but effects of environment and plot treatment were overshadowed by the seasonal progression of cotton stages. Maintaining a high density and even distribution of wolf spiders that prey on Helicoverpa spp. should be considered as a conservation biological control element when implementing agronomic and pest management strategies. © The Author 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Construction and Identification of Bacterial Artificial Chromosome Library for 0-613-2R in Upland Cotton

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    A bacterial artificial chromosome (BAC) library containing a large genomic DNA insert is an important tool for genome physical mapping, map-based cloning, and genome sequencing. To isolate genes via a map-based cloning strategy and to perform physical mapping of the cotton genome, a high-quality BAC library containing large cotton DNA inserts is needed. We have developed a BAC library of the restoring line 0-613-2R for isolating the fertility restorer (Rf1) gene and genomic research in cotton (Gossypium hirsutum L.). The BAC library contains 97 825 clones stored in 255 pieces of a 384-well microtiter plate. Random samples of BACs digested with the Notl enzyme indicated that the average insert size is approximately 130 kb, with a range of 80-275 kb,and 95.7% of the BAC clones in the library have an average insert size larger than 100 kb. Based on a cotton genome size of 2 250 Mb, library coverage is 5.7 x haploid genome equivalents. Four clones were selected randomly from the library to determine the stability of the BAC clones. There were no different fingerprints for 0 and 100 generations of each clone digested with Notl and Hindlll enzymes. Thus, the stability of a single BAC clone can be sustained at least for 100 generations. Eight simple sequence repeat (SSR) markers flanking the Rf1 gene were chosen to screen the BAC library by pool using PCR method and 25 positive clones were identified with 3.1 positive clones per SSR marker.

  18. Growth analysis of cotton crops infested with spider mites. I. Light interception and radiation-use efficiency

    International Nuclear Information System (INIS)

    Sadras, V.O.; Wilson, L.J.

    1997-01-01

    Two-spotted spider mites (Tetranychus urticae Koch) are important pests of cotton (Gossypium hirsutum L.). The effects of mites on cotton photosynthesis have been investigated at the leaf and cytological level but not at the canopy level. Our objective was to quantify the effects of timing and intensity of infestation by mites on cotton radiation-use efficiency (RUE). Leaf area, light interception, RUE, canopy temperature, and leaf nitrogen concentration (LNC) were assessed during two growing seasons in crops artificially infested with mites between 59 and 127 d after sowing. Normal and okra-leaf cultivars were compared. A mite index (MI = natural log of the area under the curve of mite number vs thermal time) was used to quantify the cumulative effects of mites on RUE, LNC, and canopy temperature. Crop growth reduction due to mites was greater in early- than in late-infested crops Growth reduction was primarily due to reductions in RUE, but in the more severe treatments accelerated leaf senescence and, hence. reduced light interception also contributed to reductions in crop growth. At a given date, infested okra-leaf crops usually had greater RUE than their normal-leaf counterparts. Both plant types, however. responded similarly to a given level of mite infestation. The ability of the okra-leaf cultivar to maintain greater RUE levels can be attributed. therefore, to its relative inhospitality for the development of mite colonies rather than to an intrinsically greater capacity to maintain photosynthesis under mite damage. Canopy temperature, LNC, and RUE showed a similar, biphasic pattern of response to Ml. In the first phase, response variables were almost unaffected by mites. In the second phase, there was a marked decline in RUE and LNC and a marked increase in canopy temperature with increasing MI. These results suggest (i) some degree of compensatory photosynthesis at low to moderate levels of mite infestation, and (ii) reductions in RUE of mite

  19. China's Cotton Policy and the Impact of China's WTO Accession and Bt Cotton Adoption on the Chinese and U.S. Cotton Sectors

    OpenAIRE

    Cheng Fang; Bruce A. Babcock

    2003-01-01

    In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...

  20. Cocoa/Cotton Comparative Genomics

    Science.gov (United States)

    With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

  1. Fungal diversity associated with verticillium wilt of cotton

    International Nuclear Information System (INIS)

    Khaskheli, M.I.; Sun, J.L.; Li, F.

    2014-01-01

    The association of fungal diversity with Verticillium wilt is rarely known, which is important to know for the control of this detrimental disease. Our study is the preliminary attempt to find the associations of fungal diversity with Verticillium wilt and provides the baseline information for biological control. About 30 different fungi from soil and 23 from cotton plants were isolated and confirmed through molecular characterization. The colony forming unit (CFU)/g dry soil of fungi before and after planting cotton showed significant variation among all the fungi. The overall frequency of all fungi for soil after sowing was significantly higher than before sowing. A. alternata, F. equiseti, F. concentricum, A. flavus, F. proliferatum, and Chaetomium sp. associated with high resistance (Arcot-1) to Verticillium wilt, whereas, V. dahliae, A.niger and Paecilomyces sp., with high susceptible (Arcot-438) germplasm. However, T. basicola, C. ramotenellum and G. intermedia were isolated from both. Soil plating was comparatively easiest than soil dilution method for the determination of frequency percentage, however, later method is useful for the screening of single spore isolation. Most of the antagonistic species were screened from soil; nevertheless, Paecilomyces and Chaetomium spp. were screened from plant and soil. In vitro test of T. longibrachiatum. T. atroviride, Paecilomyces and T. viride showed the strongest efficacy against V. dahliae. These efficient bio-agents can be used as an effective tool for other future studies regarding to Verticillium wilt of cotton. (author)

  2. Genetic diversity/impurity estimation in sources of natural resistance against cotton leaf curl disease in pakistan

    International Nuclear Information System (INIS)

    Sarwar, G.

    2007-01-01

    Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)

  3. Cotton fiber quality determined by fruit position, temperature and management

    OpenAIRE

    Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.

    2013-01-01

    CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.

  4. 7 CFR 1205.319 - Cotton-producing region.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

  5. Susceptibility Testing

    Science.gov (United States)

    ... Marker Bicarbonate (Total CO2) Bilirubin Blood Culture Blood Gases Blood Ketones Blood Smear Blood Typing Blood Urea ... hours depending on the method used. There are commercial tests available that offer rapid susceptibility testing and ...

  6. Crystal Structure of (+)-[delta]-Cadinene Synthase from Gossypium arboreum and Evolutionary Divergence of Metal Binding Motifs for Catalysis

    Energy Technology Data Exchange (ETDEWEB)

    Gennadios, Heather A.; Gonzalez, Veronica; Di Costanzo, Luigi; Li, Amang; Yu, Fanglei; Miller, David J.; Allemann, Rudolf K.; Christianson, David W.; (UPENN); (Cardiff); (UC)

    2009-09-11

    (+)-{delta}-Cadinene synthase (DCS) from Gossypium arboreum (tree cotton) is a sesquiterpene cyclase that catalyzes the cyclization of farnesyl diphosphate in the first committed step of the biosynthesis of gossypol, a phytoalexin that defends the plant from bacterial and fungal pathogens. Here, we report the X-ray crystal structure of unliganded DCS at 2.4 {angstrom} resolution and the structure of its complex with three putative Mg{sup 2+} ions and the substrate analogue inhibitor 2-fluorofarnesyl diphosphate (2F-FPP) at 2.75 {angstrom} resolution. These structures illuminate unusual features that accommodate the trinuclear metal cluster required for substrate binding and catalysis. Like other terpenoid cyclases, DCS contains a characteristic aspartate-rich D{sup 307}DTYD{sup 311} motif on helix D that interacts with Mg{sub A}{sup 2+} and Mg{sub C}{sup 2+}. However, DCS appears to be unique among terpenoid cyclases in that it does not contain the 'NSE/DTE' motif on helix H that specifically chelates Mg{sub B}{sup 2+}, which is usually found as the signature sequence (N,D)D(L,I,V)X(S,T)XXXE (boldface indicates Mg{sub B}{sup 2+} ligands). Instead, DCS contains a second aspartate-rich motif, D{sup 451}DVAE{sup 455}, that interacts with Mg{sub B}{sup 2+}. In this regard, DCS is more similar to the isoprenoid chain elongation enzyme farnesyl diphosphate synthase, which also contains two aspartate-rich motifs, rather than the greater family of terpenoid cyclases. Nevertheless, the structure of the DCS-2F-FPP complex shows that the structure of the trinuclear magnesium cluster is generally similar to that of other terpenoid cyclases despite the alternative Mg{sub B}{sup 2+} binding motif. Analyses of DCS mutants with alanine substitutions in the D{sup 307}DTYD{sup 311} and D{sup 451}DVAE{sup 455} segments reveal the contributions of these segments to catalysis.

  7. Genome wide SSR high density genetic map construction from an interspecific cross of Gossypium hirsutum × Gossypium tomentosum

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif Riaz eKhan

    2016-04-01

    Full Text Available A high density genetic map was constructed using F2 population derived from an interspecific cross of G. hirsutum x G. tomentosum. The map consisted of 3,093 marker loci distributed across all the 26 chromosomes and covered 4,365.3 cM of cotton genome with an average inter-marker distance of 1.48 cM. The maximum length of chromosome was 218.38 cM and the minimum was 122.09 cM with an average length of 167.90 cM. A sub-genome covers more genetic distance (2,189.01 cM with an average inter loci distance of 1.53 cM than D sub-genome which covers a length of 2,176.29 cM with an average distance of 1.43 cM. There were 716 distorted loci in the map accounting for 23.14% and most distorted loci were distributed on D sub-genome (25.06%, which were more than on A sub-genome (21.23%. In our map 49 segregation hotspots (SDR were distributed across the genome with more on D sub-genome as compared to A genome. Two post-polyploidization reciprocal translocations of A2/A3 and A4/A5 were suggested by 7 pairs of duplicate loci. The map constructed through these studies is one of the three densest genetic maps in cotton however; this is the first dense genome wide SSR interspecific genetic map between G. hirsutum and G. tomentosum.

  8. Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues

    Directory of Open Access Journals (Sweden)

    Viana Antonio AB

    2011-11-01

    Full Text Available Abstract Background Cotton (Gossypium spp. is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2 family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2 and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2 and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

  9. Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues.

    Science.gov (United States)

    Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F

    2011-11-24

    Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

  10. A SURVEY OF SIZES AND WEIGHTS OF BEMISIA TABACI(HOMOPTERA: ALEYRODIDAE)B BIOTYPE LIFE STAGES FROM FIELD GROWN COTTON AND CANTALOUPES

    Institute of Scientific and Technical Information of China (English)

    Chang-chiChu; JamesS.Buckner; KamilKarut; ThomasP.Freeman; DennisR.Nelson; ThomasJ.Henneberryl

    2003-01-01

    Size and weight measurements were made for all the life stages of Bemisia tabaci (Gennadius) B biotype from field grown cotton ( Gossypium hirsutum L. ) and cantaloupe ( Cucumis melo L., var. cantalupensis )in Phoenix, AZ and Fargo, ND, USA in 2000 and 2001. Nymphal volumes were derived from the measurements.The average nymphal volume increase for settled 1 st to the late 4th instar was exponential. The greatest increase in body volume occurred during development from the 3rd to early 4th instar. Nymphs on cotton leaves were wider,but not longer compared with those on cantaloupe. Ventral and dorsal depth ratios of nymphal bodies from 1st tolate 4th instars from cantaloupe leaves were significantly greater compared with those from cotton leaves. During nymphal development from 1st to 4th instar, the average (from the two host species) ventral body half volume in-creased by nearly 51 times compared with an increase of 28 times for the dorsal body half volume. Adult female and male average lengths, from heads to wing tips, were 1 126 μm and 953 μm, respectively. Average adult fe-male and male weights were 39 and 17 μg, respectively. Average widths, lengths, and weights of eggs from cottonand cantaloupe were, 99 μm, 197 μm, and 0.8 μg, respectively. Average widths, lengths, and weights for exu-viae of non-parasitized nymphs from both cotton and cantaloupe were 492 μm, 673 μm, and 1.20 μg, respective-ly; and widths, lengths, and weights of parasitized nymph exuviae were 452 μm, 665 μm, and 3.62 μg, respec-tively. Both exuviae from non-parasitized and parasitized nymphs from cotton leaves were wider, longer, and heavier than those from cantaloupe leaves.

  11. Anther response to high-temperature stress during development and pollen thermotolerance heterosis as revealed by pollen tube growth and in vitro pollen vigor analysis in upland cotton.

    Science.gov (United States)

    Song, Guicheng; Wang, Miaomiao; Zeng, Bin; Zhang, Jing; Jiang, Chenliang; Hu, Qirui; Geng, Guangtao; Tang, Canming

    2015-05-01

    Pollen tube growth in styles was strongly inhibited by temperature above 35 °C, and the yield of cotton decreased because of the adverse effect of high temperatures during square development. High-temperature stress during flowering influences the square development of upland cotton (Gossypium hirsutum L.) and cotton yield. Although it is well known that square development is sensitive to high temperature, high-temperature sensitive stages of square development and the effects of high temperature on pollen tube growth in the styles are unknown. The effect of high temperature on anther development corresponding to pollen vigor is unknown during anther development. The objectives of this study were to identify the stages of square development that are sensitive to high temperatures (37/30 and 40/34 °C), to determine whether the abnormal development of squares influenced by high temperature is responsible for the variation in the in vitro germination percent of pollen grains at anthesis, to identify the effect of high temperature on pollen germination in the styles, and to determine pollen thermotolerance heterosis. Our results show that the stages from the sporogenous cell to tetrad stage (square length styles was strongly inhibited by temperature above 35 °C, and the yield of cotton decreased because of the effect of high temperature during square development. The thermotolerance of hybrid F1 pollen showed heterosis, and pollen viability could be used as a criterion for screening for high-temperature tolerance cultivars. These results can be used in breeding to develop new cotton cultivars that can withstand high-temperature conditions, particularly in a future warmer climate.

  12. Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

    African Journals Online (AJOL)

    Assessment of Bollgard II cotton pollen mediated transgenes flow to conventional cotton in the farming conditions of Burkina ... This has led to experiment on Bt cotton from 2003 to 2007. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  13. Alterações anatômicas em plantas de algodoeiro com sintomas de murchamento avermelhado Anatomical alterations in cotton plants with reddish withering symptoms

    Directory of Open Access Journals (Sweden)

    Rachel Benetti Queiroz-Voltan

    1995-01-01

    Full Text Available Estudaram-se as alterações anatômicas em plantas de algodoeiro com sintomas de murchamento avermelhado em dezembro de 1993-fevereiro de 94. Analisaram-se amostras de raiz, caule e folha de Gossypium hirsutum L. 'IAC 20' provenientes de áreas de ocorrência do sintoma. Estimou-se o número de glândulas secretoras das folhas dos cultivares IAC 20 e CNPA ITA 90 (que se tem mostrado resistente. Observou-se que as células parenquimáticas apresentavam, no interior, substâncias insolúveis em água, cuja concentração aumentava à medida do grau do sintoma. As folhas apresentaram uma concentração maior dessas substâncias em relação ao restante do corpo vegetal. Os núcleos das células do parênquima paliçádico encontravam-se aumentados e os cloroplastos do mesofilo, parcialmente destruídos. As plantas com alto grau de sintoma apresentavam também um número maior de glândulas secretoras nas folhas.Anatomical alterations in cotton plants (Gossypium hirsutum L. with reddish withering symptons observated between December/93 to February/94 were studied. Samples of root, stem and leaf of Gossypium hirsutum L. 'IAC 20' collected in several sites with symptoms occurrence were analised. The number of secretory glands in the leaves of cultivar IAC 20, and for the resistent cultivar CNPA ITA 90 was estimated. The parenchyma cells included insoluble substances, and these concentrations increased with the crescent symptoms. The leaves presented higher concentration of these substances than the remaining plant body. The nucleus of palisade parenchyma cells was increased and the chloroplasts partially destroyed. The leave secretory glands number increases proportionally to the advance of the symptoms.

  14. An experiment using neutron activation analysis and a rare earth element to mark cotton plants and two insects that feed on them

    Energy Technology Data Exchange (ETDEWEB)

    Showler, Allan T. [USDA-ARS IFNRRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States)]. E-mail: ashowler@weslaco.ars.usda.gov; James, William D. [Elemental Analysis Laboratory, 3144 Texas A and M University, College Station, TX 77843-3144 (United States); Armstrong, John S. [USDA-ARS BIRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States); Westbrook, John K. [USDA-ARS APMRU, 2771 F and B Road, College Station, TX 77845-4966 (United States)

    2006-08-15

    Studies on insect dispersal and other behaviors can benefit from using markers that will not alter flight and fitness. Rare earth elements, such as samarium (Sm), have been used as ingested markers of some insects and detected using neutron activation analysis (NAA). In this study, samarium nitrate hexahydrate was mixed into artificial diet for boll weevils, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), at different dosages and in water used to irrigate cotton, Gossypium hirsutum L. Samarium was detected in adult boll weevils fed on the samarium-labeled diet, but not after 5 or 10 days of being switched to non-labeled diet, even if the insects were given labeled diet for as long as 7 consecutive days. Introduced in irrigation water, 1% samarium (m/m) was detectable in cotton squares and leaf tissue. However, boll weevil adults fed samarium-labeled squares did not retain detectable levels of samarium, nor did boll weevil adults reared to adulthood from samarium-labeled squares. Fourth instar beet armyworms, Spodoptera exigua (Huebner) (Noctuidae: Lepidoptera), fed on samarium-labeled cotton leaves obtained enough samarium for NAA detection, but adult moths reared from them did not have detectable amounts of samarium. Although samarium can be useful as a marker when insects are presented with a continuous pulse of the label, elements that are assimilated by the insect would be more useful if a continuous infusion of the marker cannot be provided.

  15. Estimation of Heterosis and Combining Ability in F1 Hybrids of Upland Cotton for Yield and Fiber Traits

    International Nuclear Information System (INIS)

    Arain, B.T.; Baloch, M.J.; Bughio, Q.U.A.; Sial, P.; Arain, M.A.; Baloch, A.

    2015-01-01

    The experimental research was conducted so as to determine the general combining ability (GCA) and specific combining ability (SCA) estimates and heterotic effects for seed cotton yield and fibre traits in 5 x 5 half diallel crosses of upland cotton (Gossypium hirsutum L.). The parental genotypes studied were; CRIS-134, IR-3701, IR-1524, FH-113 and MG-6. The characters such as bolls/plant, sympodial branches/plant, boll weight (g), plant height (cm), fibre length (mm), seed cotton yield/plant (g), seed index (g) and ginning out turn percentage were studied. The experiment was laid-out in a randomized complete block design with four replications at experimental field of the Department of Plant Breeding and Genetics, Sindh Agriculture University Tandojam, Pakistan during 2013. The results revealed that, parents and hybrids differed significantly for their mean performance regarding all the traits studied. The importance of heterotic effects was evident from the significance of parents vs. hybrids performance. The variances due to GCA and SCA were significant for all the traits except that GCA was non-significant for boll weight only whereas, SCA was non-significant for boll weight, seed index and ginning out turn percentage. The significance of GCA indicated the importance of additive genes advocating the traits while, the involvement of non-additive genes was evident from the significance of SCA variances. The GCA variances were greater than SCA for bolls per plant, plant height, seed cotton yield and lint percentage while, SCA variances were higher than GCA for sympodial branches/plant and fibre length. Parents IR-3701, FH-113 and MG-6 displayed higher positive GCA effects for bolls/plant, sympodial branches/plant, fibre length, seed cotton yield, seed index and ginning out turn percentage. The per se performance of these three parents was exactly reflected in their GCA effects and such happenings are exceptional. Such results suggested that, all three parents were

  16. Aqueous supercapacitors on conductive cotton

    KAUST Repository

    Pasta, Mauro; La Mantia, Fabio; Hu, Liangbing; Deshazer, Heather Dawn; Cui, Yi

    2010-01-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

  17. Aqueous supercapacitors on conductive cotton

    KAUST Repository

    Pasta, Mauro

    2010-06-01

    Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

  18. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  19. Cotton transformation via pollen tube pathway.

    Science.gov (United States)

    Wang, Min; Zhang, Baohong; Wang, Qinglian

    2013-01-01

    Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

  20. Biomembrane stabilization and antiulcerogenic properties of aqueous leaf extract of Gossypium barbadense L. (Malvaceae

    Directory of Open Access Journals (Sweden)

    S. Sabiu

    2017-12-01

    Full Text Available Gossypium spp. belong to a class of botanicals with global therapeutic applications against a number of disorders including ulcers. This study evaluated the membrane stabilization and detoxification potential of aqueous leaf extract of Gossypium barbadense L. (Malvaceae in indomethacin-induced oxidative gastric ulceration in Wistar rats. The ulcerated rats were orally pretreated with the extract and esomeprazole for 4 weeks. Gastric function and antioxidative parameters were thereafter evaluated. The indomethacin-mediated significant elevations in the ulcer index, gastric volume, pepsin activity and mucosal level of malondialdehyde were dosedependently attenuated in the extract-treated animals. The extract also significantly modulated and improved the pH, mucin content, glutathione (reduced as well as gastric activities of superoxide dismutase and catalase in the ulcerated rats. These improvements may be ascribed to the antioxidant and membrane stabilization activities of the extract which are attributable to its active metabolites as revealed by the analytical chromatogram. The observed effects compared favorably with that of esomeprazole and are suggestive of the capability of the extract to prevent mucosal damage and preserve gastric functions as evidently supported by the macroscopical appearance of the stomachs and the % ulcer inhibitory values. Conclusively, the overall data from the present findings suggest that the aqueous leaf extract of G. barbadense could prevent indomethacin-mediated oxidative gastric ulceration via fortification of antioxidant defense mechanisms. Keywords: Esomeprazole, Gossypium barbadense, Indomethacin, Mucosal damage, Oxidative stress

  1. Monitoring nitrogen nutrition in cotton Monitoramento da nutrição nitrogenada do algodoeiro

    Directory of Open Access Journals (Sweden)

    Ciro Antonio Rosolem

    2010-10-01

    Full Text Available Both N excess and deficiency may affect cotton yield and quality. It would therefore be useful to base the N management fertilization on the monitoring of the nutritional status. This study investigated the correlations among the following determination methods of the N nutritional status of cotton (Gossypium hirsutum L., var. Latifolia: chlorophyll readings (SPAD-502®, Minolta, specific-ion nitrate meter (Nitrate Meter C-141, Horiba-Cardy®, and laboratory analysis (conventional foliar diagnosis. Samples were taken weekly from two weeks before flowering to the fifth week after the first flower. The experiment was conducted on the Fazenda Santa Tereza, Itapeva, State of São Paulo, Brazil. The crop was fertilized with 40 kg ha-1 N at planting and 0, 30, 60, 90, and 120 kg ha-1 of side-dressed N. The range of leaf N contents reported as adequate for samples taken 80-90 days after plant emergence (traditional foliar diagnosis may be used as reference from the beginning of flowering when the plant is not stressed. Specific-ion nitrate meter readings can be used as a nutritional indicator of cotton nutrition from one week after pinhead until the third week of flowering. In this case, plants are well-nourished when readings exceed 8,000 mg L-1 NO3-. The chlorophyll meter can also be used to estimate the nutritional status of cotton from the third week of flowering. In this case the readings should be above 48 in well-nourished plants.Tanto o excesso como a deficiência de N podem levar a decréscimos na produção e qualidade do algodão. Assim, o monitoramento do estado nutricional da planta pode ajudar no manejo da adubação nitrogenada. Um experimento foi realizado para estudar as correlações entre métodos de determinação do estado nutricional do algodoeiro (Gossypium hirsutum L., var. Latifolia. Os métodos usados foram um medidor de clorofila (SPAD-502®, Minolta, um medidor específico de ions para nitrato (Nitrate Meter C-141, Horiba

  2. Diversity of aging of the immune system classified in the cotton rat (Sigmodon hispidus) model of human infectious diseases.

    NARCIS (Netherlands)

    Guichelaar, Teun; van Erp, Elisabeth A; Hoeboer, Jeroen; Smits, Noortje A M; van Els, Cécile A C M; Pieren, Daan K J; Luytjes, Willem

    2018-01-01

    Susceptibility and declined resistance to human pathogens like respiratory syncytial virus (RSV) at old age is well represented in the cotton rat (Sigmodon hispidus). Despite providing a preferred model of human infectious diseases, little is known about aging of its adaptive immune system. We aimed

  3. Inheritance of the ovule fuzzless trait for Gossypium arboreum germplasm line PI 529708

    Science.gov (United States)

    Background: Cotton is the most important fiber crop and understanding the genetic mechanisms controlling fiber production on cotton seeds can aid in the development of improved varieties with higher lint yields and improved fiber quality. Lint and fuzz are the two types of fiber produced on the cott...

  4. Impacts of Ridge-Furrow Planting on Salt Stress and Cotton Yield under Drip Irrigation

    Directory of Open Access Journals (Sweden)

    Chitao Sun

    2017-01-01

    Full Text Available Flat (F, mini-ditch (MD, and ridge-furrow (RF are three conventional cotton planting patterns that are usually adopted around the world, yet soil and crop responses to these three patterns are poorly studied, as is their suitability for increasing yield for coastal areas in Eastern China. The effects of three planting methods on water and salt dynamics as well as on growth and lint yield of cotton (Gossypium hirsutum L. were investigated in a saline field in Bohai Rim, China, to select the best planting pattern for cultivating coastal saline fields of Eastern China. Soil moisture in the root zone with RF was 11.9% and 12.1% higher than with F and MD, whereas the electrical conductivity of a saturated soil extract (ECe in the root zone with RF was 18.0% and 13.8% lower than with MD and F, respectively, during the growth period, which indicated that RF could efficiently collect rainfall and leach salt in the root zone. After drip irrigation, the infiltration and salt-leaching depth with RF were both deeper than that with F and MD. The stand establishment of MD was the highest (80.3% due to the greenhouse effect from film mulching, and was 12.8% and 4.6% higher than that with F and RF, respectively. Growth indicators and lint yield demonstrated that RF was superior to F and MD because of the higher soil moisture and lower ECe. The lint yield was significantly higher in RF, suggesting that RF can be an optimal planting pattern for agricultural reclamation in similar saline-alkaline areas around the world.

  5. Relationships of abscised cotton fruit to boll weevil (Coleoptera: Curculionidae) feeding, oviposition, and development.

    Science.gov (United States)

    Showler, Allan T

    2008-02-01

    Abscised cotton, Gossypium hirsutum L., fruit in field plots planted at different times were examined to assess adult boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), use of squares and bolls during 2002 and 2003 in the Lower Rio Grande Valley of Texas. Although boll abscission is not necessarily related to infestation, generally more bolls abscised than squares and abundances of fallen bolls were not related to the planting date treatments. During 2003, fallen squares were most abundant in the late-planted treatment. Although large squares (5.5-8-mm-diameter) on the plant are preferred for boll weevil oviposition, diameter of abscised squares is not a reliable measurement because of shrinkage resulting from desiccation and larval feeding. Fallen feeding-punctured squares and bolls were most abundant in late plantings but differences between fallen feeding-punctured squares versus fallen feeding-punctured bolls were found in only one treatment in 2003. During the same year, fallen oviposition-punctured squares were more numerous in the late-planted treatment than in the earlier treatments. Treatment effects were not found on numbers of oviposition-punctured bolls, but fallen oviposition-punctured squares were more common than bolls in the late-planted treatment compared with earlier treatments each year. Dead weevil eggs, larvae, and pupae inside fallen fruit were few and planting date treatment effects were not detected. Living third instars and pupae were more abundant in fallen squares of the late-planted treatment than in the earlier treatments and bolls of all three treatments. This study shows that fallen squares in late-planted cotton contribute more to adult boll weevil populations than bolls, or squares of earlier plantings.

  6. Stability of Spatial Distributions of Stink Bugs, Boll Injury, and NDVI in Cotton.

    Science.gov (United States)

    Reay-Jones, Francis P F; Greene, Jeremy K; Bauer, Philip J

    2016-10-01

    A 3-yr study was conducted to determine the degree of aggregation of stink bugs and boll injury in cotton, Gossypium hirsutum L., and their spatial association with a multispectral vegetation index (normalized difference vegetation index [NDVI]). Using the spatial analysis by distance indices analyses, stink bugs were less frequently aggregated (17% for adults and 4% for nymphs) than boll injury (36%). NDVI values were also significantly aggregated within fields in 19 of 48 analyses (40%), with the majority of significant indices occurring in July and August. Paired NDVI datasets from different sampling dates were frequently associated (86.5% for weekly intervals among datasets). Spatial distributions of both stink bugs and boll injury were less stable than for NDVI, with positive associations varying from 12.5 to 25% for adult stink bugs for weekly intervals, depending on species. Spatial distributions of boll injury from stink bug feeding were more stable than stink bugs, with 46% positive associations among paired datasets with weekly intervals. NDVI values were positively associated with boll injury from stink bug feeding in 11 out of 22 analyses, with no significant negative associations. This indicates that NDVI has potential as a component of site-specific management. Future work should continue to examine the value of remote sensing for insect management in cotton, with an aim to develop tools such as risk assessment maps that will help growers to reduce insecticide inputs. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  7. Off-site movement of endosulfan from irrigated cotton in New South Wales.

    Science.gov (United States)

    Kennedy, I R; Sánchez-Bayo, F; Kimber, S W; Hugo, L; Ahmad, N

    2001-01-01

    The fate and transport of endosulfan (6,7,8,9,10,10-hexachloro-1,5, 5a,6,9,9a-hexahydro-6,9-methano-2,4,3-benzodioxathiepin 3-oxide) applied to cotton (Gossypium hirsutum L.) fields were studied throughout three consecutive years on two selected locations in New South Wales (Australia). Rates of dissipation from foliage and soil, volatilization from the field, and transport of residues in irrigation and/or storm runoff waters were measured in order to estimate a total field balance. Dissipation of endosulfan from both foliage and soil is best explained by a two-phase process rather than by a first-order decay. Half-lives of total endosulfan toxic residues (alpha- and beta-endosulfan and the sulfate product) in the first phase were 1.6 d in foliage and 7.1 d in soil, and could be explained by the rapid volatilization of the parent isomers in the first 5 d (up to 70% of endosulfan volatilizes). In the second phase, half-lives were 9.5 d in foliage and 82 d in soil, mostly due to the persistence of the sulfate product. Concentration of endosulfan residues in runoff water varied from 45 to 2.5 microg L(-1) depending on the residue levels present on field soil at the time of the irrigation or storm events. These in turn are related to the total amounts applied, the cotton canopy cover at application, and the time since last spraying. Most of the endosulfan in runoff was found in the water phase (80%), suggesting it was bound to colloidal matter. Total endosulfan residues in runoff for a whole season accounted for no more than 2% of the pesticide applied on-field.

  8. Fluometuron and pendimethalin runoff from strip and conventionally tilled cotton in the southern atlantic coastal plain.

    Science.gov (United States)

    Potter, Thomas L; Truman, Clint C; Bosch, David D; Bednarz, Craig

    2004-01-01

    In the Atlantic Coastal Plain region of southern Georgia (USA), cotton (Gossypium hirsutum L.) acreage increased threefold in the past decade. To more effectively protect water quality in the region, best management practices are needed that reduce pesticide runoff from fields in cotton production. This study compared runoff of two herbicides, fluometuron [N,N-dimethyl-N'-[3-(trifluoromethyl)-phenyl]-urea] and pendimethalin [N-(1-ethylpropyl)-3,4-dimethyl-2,6-dinitro-benzenamine], from plots in strip-tillage (ST) and conventional-tillage (CT) management near Tifton, GA. Rainfall simulations were conducted one day after preemergence herbicide applications to 0.0006-ha plots and runoff from 0.15-ha plots due to natural rainfall following preemergence pendimethalin and fluometuron and postemergence fluometuron use was monitored. Pendimethalin runoff was greater under CT than ST due to strong pendimethalin soil sorption and higher erosion and runoff under CT. The highest losses, 1.3% of applied in CT and 0.22% of applied in ST, were observed during rainfall simulations conducted 1 DAT. Fluometuron runoff from natural rainfall was substantially lower from ST than from CT plots but the trend was reversed in rainfall simulations. In all studies, fluometuron runoff was also relatively low (<1% of applied), and on plots under natural rainfall, desmethylfluometuron (DMF) represented about 50% of total fluometuron runoff. Fluometuron's relatively low runoff rate appeared linked to its rapid leaching, and high DMF detection rates in runoff support DMF inclusion in fluometuron risk assessments. Results showed that ST has the potential to reduce runoff of both herbicides, but fluometuron leaching may be a ground water quality concern.

  9. Differential potassium influx influences growth of two cotton varieties in hydroponics

    International Nuclear Information System (INIS)

    Ali, L.; Maqsood, M.A.; Kanwal, S.; Aziz, T.

    2010-01-01

    Potassium uptake rate of two cotton (Gossypium hirsutum L.) varieties viz., NIBGE-2 and MNH-786 was investigated in nutrient solution culture having deficient K at the rate 0.3 mM and deficient K+ Na at the rate 0.3 +2.7 mM. Depletion of K from solution was monitored over a period of 24 h at regular time intervals after 0, 0.5, 1.0, 1.5, 2, 3, 4, 5, 6, 8, 10, 12 and 24 h to estimate K uptake kinetics of the roots i.e. maximum influx, I/sub max/ and the Michaelis-Menten constant, Km. NIBGE-2 had about 2-fold higher (2.0 mg g rdw-1 hr-1) I/sub max/ value for K uptake rate at deficient K+Na than that (1.207 mg g rdw-1 hr-1) for MNH-786. Higher, Michaelis-Menten constant, Km (12.82 ppm) for K uptake rate was observed in both cultivars NIBGE-2 and MNH-786 at deficient K+Na than that at deficient K. Main effects of treatments and varieties had significant (p< 0.05) effect on shoot dry matter, root dry matter, total dry matter and leaf area per plant. Maximum K influx in NIBGE-2 at deficient K and deficient K +Na was attributed to enhanced growth response as compared to that in MNH-786. (author)

  10. Response of cotton varieties to different environments: flowering behavior and fiber quality

    International Nuclear Information System (INIS)

    Jawdat, D.; Ayyoub, Z.; Elias, R.

    2012-01-01

    Flowering behavior and fiber quality traits were analyzed of six Gossypium hirsutum L. varieties and one G. barbadense variety that were cultivated in two environmentally different locations. Records of days after planting (DAP) at first floral bud emergence, DAP at first floral opening, plant height at first flower and nodes above white flower (NAWF) were analyzed statistically to study flowering behavior in both locations. Fiber traits were tested and records of micronaire, fiber length, strength, cohesion, elongation, ginning percentage, and weight of seed cotton were statistically analyzed to look for significant differences and correlations. Earliness and a decline in fiber strength, and fiber cohesion were obtained in varieties cultivated in Soujeh accompanied with an increase in ginning percentages. Uniquely, fiber elongation showed no significant differences in varieties between the two environments in both seasons. Our results indicated that stability in some fiber traits such as, micronaire, fiber length, strength and cohesion was a variety specific. Evidently, fiber elongation in our work was not affected by cultivation managements and environmental conditions which suggest the solid genetic bases that control this trait. (author)

  11. De novo biosynthesis of volatiles induced by insect herbivory in cotton plants

    International Nuclear Information System (INIS)

    Pare, P.W.; Tumlinson, J.H.

    1997-01-01

    In response to insect feeding on the leaves, cotton (Gossypium hirsutum L.) plants release elevated levels of volatiles, which can serve as a chemical signal that attracts natural enemies of the herbivore to the damaged plant. Pulse-labeling experiments with [13C]CO2 demonstrated that many of the volatiles released, including the acyclic terpenes (E,E)-alpha-farnesene, (E)-beta-farnesene, (E)-beta-ocimene, linalool,(E)-4,8-dimethyl-1,3,7-nonatriene, and (E,E)-4,8,12-trimethyl-1,3,7,11-tridecatetrane, as well as the shikimate pathway product indole, are biosynthesized de novo following insect damage. However, other volatile constituents, including several cyclic terpenes, butyrates, and green leaf volatiles of the lipoxygenase pathway are released from storage or synthesized from stored intermediates. Analysis of volatiles from artificially damaged plants, with and without beet armyworm (Spodoptera exigua Hubner) oral secretions exogenously applied to the leaves, as well as volatiles from beet armyworm-damaged and -undamaged control plants, demonstrated that the application of caterpillar oral secretions increased both the production and release of several volatiles that are synthesized de novo in response to insect feeding. These results establish that the plant plays an active and dynamic role in mediating the interaction between herbivores and natural enemies of herbivores

  12. Carbon Accumulation during Photosynthesis in Leaves of Nitrogen- and Phosphorus-Stressed Cotton.

    Science.gov (United States)

    Radin, J W; Eidenbock, M P

    1986-11-01

    Leaves of cotton (Gossypium hirsutum L.) accumulate considerable dry mass per unit area during photosynthesis. The percentage of C in that accumulated dry mass was estimated as the regression coefficient (slope) of a linear regression relating C per unit area to total dry mass per unit area. Plants were grown on full nutrients or on N- or P-deficient nutrient solutions. In the fully nourished controls, the mass that accumulated over a 9-hour interval beginning at dawn contained 38.6% C. N and P stress increased the C concentration of accumulated mass to 49.7% and 45.1%, respectively. Nutrient stress also increased the starch concentration of accumulated mass, but starch alone could not account for the differences in C concentration. P stress decreased the estimated rate of C export from source leaves, calculated as the difference between C assimilation and C accumulation. The effect of P stress on apparent export was very sensitive to the C concentration used in the calculation, and would not have been revealed with an assumption of unchanged C concentration in the accumulated mass.

  13. Targeted introgression of cotton fibre quality quantitative trait loci using molecular markers

    International Nuclear Information System (INIS)

    Lacape, J.M.; Trung-Bieu Nguyen; Hau, B.; Giband, M.

    2007-01-01

    Within the framework of a cotton breeding programme, molecular markers are used to improve the efficiency of the introgression of fibre quality traits of Gossypium barbadense into G. hirsutum. A saturated genetic map was developed based on genotyping data obtained from the BC 1 (75 plants) and BC 2 (200 plants) generations. Phenotypic measurements conducted over three generations (BC 1 , BC 2 and BC 2 S 1 ) allowed 80 quantitative trait loci (QTL) to be detected for fibre length, uniformity, strength, elongation, fineness and colour. Positive QTL, i.e. those for which favourable alleles came from the G. barbadense parent, were harboured by 19 QTL-rich regions on 15 'carrier' chromosomes. In subsequent generations (BC 3 and BC 4 ), markers framing the QTL-rich regions were used to select about 10 percent of over 400 plants analysed in each generation. Although BC plants selected through the marker-assisted selection (MAS) process show promising fibre quality, only their full field evaluation will allow validation of the procedure. (author)

  14. Response of cotton varieties to different environments flowering behavior and fiber quality

    International Nuclear Information System (INIS)

    Jawdat, D.; Ayyoubi, Z.; Al-Safadi, B.

    2015-01-01

    The flowering behavior and fiber quality traits were analyzed of six Gossypium hirsutum L. varieties and one G. barbadense variety that were cultivated in two environmentally different locations. Records of days after planting (DAP) at first floral bud emergence, DAP at first floral opening, plant height at first flower and nodes above white flower (NAWF) were analyzed statistically to study flowering behavior in both locations. Fiber traits were tested and records of micronaire, fiber length, strength, cohesion, elongation, ginning percentage, and weight of seed cotton were statistically analyzed to look for significant differences and correlations. Earliness and a decline in fiber strength, and fiber cohesion were obtained in varieties cultivated in Soujeh accompanied with an increase in ginning percentages. Uniquely, fiber elongation showed no significant differences in varieties between the two environments in both seasons. Our results indicated that stability in some fiber traits such as, micronaire, fiber length, strength and cohesion was a variety specific. Evidently, fiber elongation in our work was not affected by cultivation managements and environmental conditions which suggest the solid genetic bases that control this trait.(author)

  15. Influence of Aphelenchus avenae on Vesicular-arbuscular Endomycorrhizal Growth Response in Cotton.

    Science.gov (United States)

    Hussey, R S; Roncadori, R W

    1981-01-01

    The influence of Aphelenchus avenae on the relationship between cotton (Gossypium hirsutum 'Stoneville 213') and Gigaspora margarita or Glomus etunicatus was assessed by its effect on the mycorrhizal stimulation of plant growth and microorganism reproduction. The mycophagous nematode usually did not suppress stimulation of shoot growth resulting from mycorrhizae (G. margarita) at inoculum levels of 3,000 or 6,000 nematodes per pot, but retarded root growth at 6,000 per pot. When the nematode inoculum was increased to 10, 40, or 80 thousand, G. margarita stimulation of shoot or root growth was retarded at the two higher rates. Shoot growth enhancement by G. etunicatus was suppressed by 10 thousand A. avenae but not by 40 or 80 thousand. A. avenae reproduced better when the nematode was added 3 wk after G. margarita than with simultaneous inoculations. Sporulation of both fungi was affected little by the mycophagous nematode. The high numbers of A. avenae required for an antagonistic effect probably precludes the occurrence of any significant interaction between these two organisms under field conditions.

  16. Passive and active protection of cotton textiles

    NARCIS (Netherlands)

    Bochove, C. van

    1967-01-01

    In rotproofing of cotton a distinction is made between passive and active protection. In passive protection, the structure of the cotton fibre is modified in such a way that the fibre can longer be attacked. This modification of structure can be effected on different levels: microscopical,

  17. Fiber quality challenges facing the cotton industry

    Science.gov (United States)

    The cotton industry is in the midst of an exciting time with increased domestic consumption, but also facing pressure from other crops and the global marketplace. In order to ensure the US cotton crop remains the fiber of choice for the world it is important to keep an eye on the challenges to fibe...

  18. Within canopy distribution of cotton seed N

    Science.gov (United States)

    Whole cotton seeds can be an important component of dairy rations. Nitrogen content of the seed is an important determinant of the feed value of the seed. Efforts to increase the seed value as feed will be enhanced with knowledge of the range and distribution of seed N within the cotton crop. This s...

  19. Milkweed, stink bugs, and Georgia cotton

    Science.gov (United States)

    In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

  20. Cotton in Benin: governance and pest management

    NARCIS (Netherlands)

    Togbe, C.E.

    2013-01-01

    Key words: cotton, synthetic pesticides, neem oil (Azadirachta indica), Beauveria bassiana,

    Bacillus thuringiensis, field experiment, farmers’ participation

    Pests are one of the main factors limiting cotton production worldwide. Most of the pest

    control

  1. Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Nan-Yang Li

    2018-02-01

    Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

  2. Cotton for removal of aquatic oil spills

    International Nuclear Information System (INIS)

    Parker, H.W.; Fedler, C.B.; Heintz, C.E.; Nash, P.T.; Carr, D.L.; Lu, M.

    1992-01-01

    Raw cotton has considerable potential for selective removal of spilled oil and oil products from surface waters, since the natural waxes on the raw cotton make it preferentially oil wet. This potential was recognized in the early seventies at Texas Tech University. More recently other research workers have considered cotton as an adsorbent for spilled oil. The adsorbent market is now dominated by synthetic materials, such as air-blown polypropylene fiber, inorganic clays, and recycled paper and paper products. This paper further examines the potential of cotton in relation to these other adsorbents. Emphasis is placed on the potential for complete biodegradation of oil-soaked cotton adsorbents as a means avoiding the expense for incineration and/or the long-term environmental risk associated with placing the used adsorbents in landfills

  3. Superamphiphobic cotton fabrics with enhanced stability

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

    2015-11-30

    Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

  4. 7 CFR 27.21 - Preparation of samples of cotton.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...

  5. Minimization of operational impacts on spectrophotometer color measurements for cotton

    Science.gov (United States)

    A key cotton quality and processing property that is gaining increasing importance is the color of the cotton. Cotton fiber in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), using the parameters Rd and +b. Rd and +b are specific to cotton fiber and are not typical ...

  6. Inheritance and segregation of exogenous genes in transgenic cotton

    Indian Academy of Sciences (India)

    Three transgenic cotton varieties (lines) were chosen for the study of inheritance and segregation of foreign Bt (Bacillus thuringiensis toxin) and tfdA genes in cotton. The transformed cotton varieties CCRI 30 and NewCott 33B expressing the Bt cryIA gene, and cotton line TFD expressing the tfdA gene were crossed with ...

  7. Increasing cotton stand establishment in soils prone to soil crusting

    Science.gov (United States)

    Many factors can contribute to poor cotton stand establishment, and cotton is notorious for its weak seedling vigor. Soil crusting can be a major factor hindering cotton seedling emergence in many of the cotton production regions of the US and the world. Crusting is mainly an issue in silty soils ...

  8. (Pleurotus pulmonarius) grown on cotton waste and cassava peel

    African Journals Online (AJOL)

    This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

  9. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

    Science.gov (United States)

    Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

    2018-04-12

    Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

  10. A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Pu Lu

    2018-04-01

    Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

  11. Separation and recycling of cotton from cotton/PET blends by depolymerization of PET catalyzed by bases and ionic liquids

    NARCIS (Netherlands)

    Bouwhuis, G.H. (Gerrit); Brinks, G.J. (Ger); Groeneveld, R.A.J. (Richard); Oelerich, J. (Jens)

    2014-01-01

    The recycling of post consumer cotton textile waste is highly requested, due to the high environmental impact of cotton production. Often cotton is mixed in blends with polyethylene terephthalate (PET). For the generation of high value products from recycled cotton, it essential that PET is

  12. Determination of actual crop evapotranspiration (ETc) and dual crop coefficients (Kc) for cotton, wheat and maize in Fergana Valley: integration of the FAO-56 approach and BUDGET

    Science.gov (United States)

    Kenjabaev, Shavkat; Dernedde, Yvonne; Frede, Hans-Georg; Stulina, Galina

    2014-05-01

    Determination of the actual crop evapotranspiration (ETc) during the growing period is important for accurate irrigation scheduling in arid and semi-arid regions. Development of a crop coefficient (Kc) can enhance ETc estimations in relation to specific crop phenological development. This research was conducted to determine daily and growth-stage-specific Kc and ETc values for cotton (Gossypium hirsutum L.), winter wheat (Triticum aestivum L.) and maize (Zea mays L.) for silage at fields in Fergana Valley (Uzbekistan). The soil water balance model - Budget with integration of the dual crop procedure of the FAO-56 was used to estimate the ETc and separate it into evaporation (Ec) and transpiration (Tc) components. An empirical equation was developed to determine the daily Kc values based on the estimated Ec and Tc. The ETc, Kc determination and comparison to existing FAO Kc values were performed based on 10, 5 and 6 study cases for cotton, wheat and maize, respectively. Mean seasonal amounts of crop water consumption in terms of ETc were 560±50, 509±27 and 243±39 mm for cotton, wheat and maize, respectively. The growth-stage-specific Kc for cotton, wheat and maize was 0.15, 0.27 and 0.11 at initial; 1.15, 1.03 and 0.56 at mid; and 0.45, 0.89 and 0.53 at late season stages. These values correspond to those reported by the FAO-56. Development of site specific Kc helps tremendously in irrigation management and furthermore provides precise water applications in the region. The developed simple approach to estimate daily Kc for the three main crops grown in the Fergana region was a first attempt to meet this issue. Keywords: Actual crop evapotranspiration, evaporation and transpiration, crop coefficient, model BUDGET, Fergana Valley.

  13. Single and multiple in-season measurements as indicators of at-harvest cotton boll damage caused by verde plant bug (Hemiptera: Miridae).

    Science.gov (United States)

    Brewer, Michael J; Armstrong, J Scott; Parker, Roy D

    2013-06-01

    The ability to monitor verde plant bug, Creontiades signatus Distant (Hemiptera: Miridae), and the progression of cotton, Gossypium hirsutum L., boll responses to feeding and associated cotton boll rot provided opportunity to assess if single in-season measurements had value in evaluating at-harvest damage to bolls and if multiple in-season measurements enhanced their combined use. One in-season verde plant bug density measurement, three in-season plant injury measurements, and two at-harvest damage measurements were taken in 15 cotton fields in South Texas, 2010. Linear regression selected two measurements as potentially useful indicators of at-harvest damage: verde plant bug density (adjusted r2 = 0.68; P = 0.0004) and internal boll injury of the carpel wall (adjusted r2 = 0.72; P = 0.004). Considering use of multiple measurements, a stepwise multiple regression of the four in-season measurements selected a univariate model (verde plant bug density) using a 0.15 selection criterion (adjusted r2 = 0.74; P = 0.0002) and a bivariate model (verde plant bug density-internal boll injury) using a 0.25 selection criterion (adjusted r2 = 0.76; P = 0.0007) as indicators of at-harvest damage. In a validation using cultivar and water regime treatments experiencing low verde plant bug pressure in 2011 and 2012, the bivariate model performed better than models using verde plant bug density or internal boll injury separately. Overall, verde plant bug damaging cotton bolls exemplified the benefits of using multiple in-season measurements in pest monitoring programs, under the challenging situation when at-harvest damage results from a sequence of plant responses initiated by in-season insect feeding.

  14. The Effect of Rate and Application Method of Potassium on Yield and Yield Components of Cotton in Saline Condition

    Directory of Open Access Journals (Sweden)

    A Ardakani

    2016-12-01

    Full Text Available Introduction Salinity is a major abiotic stress that affects approximately 7% of the world’s total land area. Cotton (Gossypium barbadense L. is considered as one of the most important cash crops which is widely used for agricultural and industrial purposes. Although, cotton is classified as one of the most salt-tolerant major crops but its growth and development are adversely affected by soil or water salinity. Understanding salinity and fertilizer interaction can mitigate salinity stress and improving crop yield. Potassium (K is an essential nutrient that affects most of the biochemical and physiological processes that are involved in plant resistance to biotic and abiotic stresses. Proper management of K fertilizer is especially important in saline soils where K application might reduce the adverse effects of salinity on plant growth and yield. There is a little information about rate and application method of K on yield and yield component of cotton in saline condition. The objective of this study was to determine the effects of rate and application method of K on yield and yield component of cotton in soil and water saline condition. Materials and Methods The experiment was carried out at Sabzevar Agriculture and Natural Resources Research center (Haresabad, 30km southwest of Sabzevar (32◦32N, 51◦23E and 1630 above mean sea level,in 2014.This experiment was conducted as split plot design based on randomized complete block design with three replications. Factors were: K rate (75 and 150kg ha-1 Solopotash (containing 50% K2O and 18% S comprising the main plot and application method (25%at planting+25% at first flowering and 50%at early boll development (25P+25F+50B, 25%at planting+50% at first flowering and 25%at early boll development (25P+50F+25B, 25%at planting+25% at vegetative stage (5-8 leaves stage, 25% at first flowering and 25% at early boll development (25P+25V+25F+50B, 25% at planting+25% at vegetative stage and 50% at first

  15. Energy usage for cotton ginning in Australia

    Energy Technology Data Exchange (ETDEWEB)

    Ismail, S.A. [MARA Univ. of Technology, Shah Alam (Malaysia). Faculty of Applied Sciences; Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture; Chen, G.; Baillie, C.; Symes, T. [Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture

    2010-07-01

    This paper reported on a study that evaluated the energy consumption of cotton gins used in Australia. The average electricity use is 52.3 kWh per bale. In practicality, the electricity consumption for different gins is correlated linearly with the bale numbers produced. The cost of electricity is therefore important in cotton ginning operations. The power factor in all the gins monitored in this study was greater than 0.85. The study showed that the use of gas dryers was highly influenced by the cotton moisture and regulated drying temperature. In general, electricity and gas consumption comprised 61 and 39 per cent of total energy use respectively. The study showed that 60.38 kg of carbon dioxide are emitted for ginning each bale of cotton. This paper described a newly developed method for monitoring the energy performance in cotton gins. Detailed monitoring and analysis carried out at 2 gin sites revealed that electricity consumption is not influenced much by changes in trash content in the module, degree of moisture and lint quality. However, the cotton variety influences the energy consumption. Cotton handling constituted nearly 50 per cent of the power used in both gins.

  16. Examining cotton in rotation with rice and cotton in rotation with other crops using natural experiment

    Science.gov (United States)

    Sun, Ling; Zhu, Zesheng

    2017-08-01

    This paper is to show the ability of remote sensing image analysis combined with statistical analysis to characterize the environmental risk assessment of cotton in rotation with rice and cotton in rotation with other crops in two ways: (1) description of rotation period of cotton in rotation with rice and cotton in rotation with other crops by the observational study or natural experiment; (2) analysis of rotation period calculation of cotton in rotation with rice and cotton in rotation with other crops. Natural experimental results show that this new method is very promising for determining crop rotation period for estimating regional averages of environmental risk. When it is applied to determining crop rotation period, two requested remote sensing images of regional crop are required at least.

  17. Upland cotton growth and yield response to timing the initial postplant irrigation

    International Nuclear Information System (INIS)

    Steger, A.J.; Silvertooth, J.C.; Brown, P.W.

    1998-01-01

    Cotton (Gossypium spp.) production in arid and semiarid regions depends on well-managed irrigation systems for optimum yield and production efficiency. Water deficit stress early in the growing season can affect the subsequent growth and development of short-season cotton. A 2-yr field study was conducted in southern Arizona to determine the optimum timing of the initial postplant irrigation for a short-season upland cotton variety based on midday leaf water potential (LWP) measurements, and to evaluate the season-long effects of delayed irrigation on subsequent plant growth patterns. In both years, the short-season upland variety, DPL 20, was planted into a Pima clay loam soil [fine-silty, mixed (calcareous), thermic Typic Torrifluvent] that had received a preplant irrigation of 152 (1993) or 254 mm (1994) approximately 3 wk prior to planting. Treatments, designated T1, T2, and T3, received the initial postplant irrigation when the average midday LWP of the uppermost, fully expanded leaf measured −1.5, −1.9, and −2.3 MPa, respectively. Daily midday LWP measurements were taken using the pressure chamber technique. Soil water was measured at 25-cm depth increments using neutron attenuation. Plant height, number of mainstem nodes, nodes above white flower (NAWF), and canopy closure were measured at weekly intervals. All treatments reached maturity, as measured by NAWF ≤ 5, at approximately the same time during the growing season. Complete canopy closure was delayed in the T3 plots resulting in reduced interception and utilization of available solar radiation early in the growing season. When treatments were initiated, approximately 84% (T1), 62% (T2), and 32% (T3) of the total plant-available water (field capacity less permanent wilting point) was present in the upper 1.5 of the soil profile. Yields were 1263, 1244, and 1110 kg lint ha−1 in 1993 and 1229, 1176, and 1095 kg lint ha −1 in 1994 for T1, T2, and T3, respectively. Lint yields were significantly

  18. U.S. Cotton Prices and the World Cotton Market: Forecasting and Structural Change

    OpenAIRE

    Isengildina-Massa, Olga; MacDonald, Stephen

    2009-01-01

    The purpose of this study was to analyze structural changes that took place in the cotton industry in recent years and develop a statistical model that reflects the current drivers of U.S. cotton prices. Legislative changes authorized the U.S. Department of Agriculture to resume publishing cotton price forecasts for the first time in 79 years. In addition, systematic problems have become apparent in the forecasting models used by USDA and elsewhere, highlighting the need for an updated review...

  19. Suppressing Resistance to Bt Cotton with Sterile Insect Releases

    Energy Technology Data Exchange (ETDEWEB)

    Tabashnik, B E [Department of Entomology, University of Arizona, Tucson, AZ (United States); Sisterson, M S [USDA-ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA (United States); Ellsworth, P C [Department of Entomology, University of Arizona, Maricopa Agricultural Center, Maricopa, AZ (United States)

    2011-01-15

    Genetically engineered crops that produce insecticidal toxins from Bacillus thuringiensis (Bt) are grown widely for pest control. However, insect adaptation can reduce the toxins' efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to provide susceptible insects to mate with resistant insects. Variable farmer compliance is one of the limitations of this approach. Here we report the benefits of an alternative strategy where sterile insects are released to mate with resistant insects and refuges are scarce or absent. Computer simulations show that this approach works in principle against pests with recessive or dominant inheritance of resistance. During a largescale, four-year field deployment of this strategy in Arizona, resistance of pink bollworm (Pectinophora gossypiella) to Bt cotton did not increase. A multitactic eradication program that included the release of sterile moths reduced pink bollworm abundance by >99%, while eliminating insecticide sprays against this key invasive pest. (author)

  20. Inheritance of resistance to Colletotrichum gossypii var. cephalosporioides in cotton

    Directory of Open Access Journals (Sweden)

    Mansuêmia Alves Couto de Oliveira

    2010-01-01

    Full Text Available The objective of this study was to analyze the inheritance of the resistance to cotton ramulosis. For thispurpose, two groups of lines with contrasting performance for the evaluated trait were crossed. The disease-susceptibleparents were Delta Opal, CNPA 999 and CNPA 2161, and those with resistance BRS Facual, CNPA 2043 and CNPA 2984,resulting in nine crosses, always of one resistant and one susceptible parent, totalizing 42 treatments. The experiment was setup in a randomized complete block design with three replications. It was verified that the genetic control of ramulosisresistance is predominantly oligogenic, and the number of genes involved depends on the parents that participate in eachcross, due to the possibility of differential loci fixation. Evidence of partial dominance in the sense of increasing diseaseresistance was found, but there were also indications that dominance is not unidirectional.

  1. Mutagenesis in naturally coloured cotton

    International Nuclear Information System (INIS)

    Khatod, J.P.; Meshram, L.D.; Jain, P.P.

    2000-01-01

    The seeds of naturally coloured cotton were treated with 15 kR, 20 kR doses of gamma rays and 0.5% Ethyl Methane Sulphonate (EMS) and their combinations. The M 1 and M 2 generations were studied for mutagenic effectiveness and efficiency in inducing the useful mutants, spectrum of mutation and their effects on bract characters. Results obtained revealed that 15 kR and 20 kR doses were more effective in inducing the mutations. In G. hirsutum, significant differences were found for bract size and dry weight of bract was noted in 20 kR dose and low in 0.5% EMS in M 1 . In the M 2 generation increased ratio of bract surface area to lint weight per boll was noted in 20 kR + 0.5% EMS. (author)

  2. Efeito de subdoses de 2,4-D na produtividade do algodão e suscetibilidade da cultura em função de seu estádio de desenvolvimento Effect of sub-lethal dosages of 2,4-D on cotton yield and crop susceptibility as a function of its development stage

    Directory of Open Access Journals (Sweden)

    Jamil Constantin

    2007-01-01

    Full Text Available O objetivo deste trabalho foi avaliar o efeito de subdoses de 2,4-D no desenvolvimento e produtividade da cultura do algodoeiro. Dois experimentos foram conduzidos utilizando-se da variedade IAPAR-95 e o sistema de avaliação por meio de testemunhas duplas. No primeiro experimento, as aplicações foram realizadas no estádio F1 (início do florescimento, aplicando-se dosagens de 0,84; 1,68; 3,36; 6,72; 13,44 e 26,88 g de equivalente ácido (e.a. por hectare, equivalentes a derivas de 0,125; 0,25; 0,5; 1,0; 2,0 e 4,0% da dose de 670 g e.a. ha-1. No segundo experimento, os tratamentos foram constituídos pela combinação em esquema fatorial de duas doses (6,72 e 13,44 g e.a. ha-1 e três épocas de aplicação (C1, C3/C4 e C6, visando a avaliar a variação da sensibilidade do algodão ao 2,4-D em função de seu estádio de desenvolvimento. Os resultados evidenciaram que doses maiores que 3,36 g e.a. ha-1 (0,50% aplicadas na fase de florescimento afetaram de forma significativa a produtividade, que a queda dos botões florais foi o sintoma mais importante para a redução da produtividade. No segundo experimento, observou-se que a sensibilidade do algodão caiu drasticamente em função do estádio de desenvolvimento. O único tratamento que provocou queda significativa de produtividade foi a dose de 13,44 g e.a. ha-1 (2,0% aplicada no estádio C1. Dessa forma, a partir do momento em que as maçãs começam a se formar, a sensibilidade da cultura cai substancialmente.This research was aimed at evaluating the effects of sublethal rates of 2,4-D on cotton development and yield. Two field experiments were carried out with cv. IAPAR-95, using two fold-checks. For the first trial, applications were accomplished at the beginning of cotton flowering (stage F1, by spraying rates of 0.84; 1.68; 3.36; 6.72; 13.44 and 26.88 g of acid equivalent (a.e. per hectare, equivalent to drifts of 0.125; 0.25; 0.5; 1.0; 2.0 and 4.0% of a 670 g of a.e. ha-1 rate. In

  3. Diversity of aging of the immune system classified in the cotton rat (Sigmodon hispidus) model of human infectious diseases.

    S