WorldWideScience

Sample records for susceptibility genes encoding

  1. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin

    OpenAIRE

    Pelegrino,Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz,Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello

    2015-01-01

    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(−) vector and expressed in E. coli TOP10.

  2. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin.

    Science.gov (United States)

    Pelegrino, Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz, Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello

    2015-11-09

    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(-) vector and expressed in E. coli TOP10. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Ocular toxoplasmosis: susceptibility in respect to the genes encoding the KIR receptors and their HLA class I ligands

    Science.gov (United States)

    Ayo, Christiane Maria; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Brandão de Mattos, Cinara de Cássia; Previato, Mariana; Barbosa, Amanda Pires; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos

    2016-01-01

    The objective of this study was to investigate the influence of the genes encoding the KIR receptors and their HLA ligands in the susceptibility of ocular toxoplasmosis. A total of 297 patients serologically-diagnosed with toxoplasmosis were selected and stratified according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping was performed by PCR-SSOP. Statistical analyses were conducted using the Chi-square test, and odds ratio with a 95% confidence interval was also calculated to evaluate the risk association. The activating KIR3DS1 gene was associated with increased susceptibility for ocular toxoplasmosis. The activating KIR together with their HLA ligands (KIR3DS1-Bw4-80Ile and KIR2DS1+/C2++ KIR3DS1+/Bw4-80Ile+) were associated with increased susceptibility for ocular toxoplasmosis and its clinical manifestations. KIR-HLA inhibitory pairs -KIR2DL3/2DL3-C1/C1 and KIR2DL3/2DL3-C1- were associated with decreased susceptibility for ocular toxoplasmosis and its clinical forms, while the KIR3DS1−/KIR3DL1+/Bw4-80Ile+ combination was associated as a protective factor against the development of ocular toxoplasmosis and, in particular, against recurrent manifestations. Our data demonstrate that activating and inhibitory KIR genes may influence the development of ocular toxoplasmosis. PMID:27827450

  4. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  5. Emergence of a daptomycin-non-susceptible Enterococcus faecium strain that encodes mutations in DNA repair genes after high-dose daptomycin therapy.

    Science.gov (United States)

    Matono, Takashi; Hayakawa, Kayoko; Hirai, Risen; Tanimura, Akira; Yamamoto, Kei; Fujiya, Yoshihiro; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Mezaki, Kazuhisa; Ohmagari, Norio; Miyoshi-Akiyama, Tohru

    2016-04-01

    An increasing number of reports have documented the emergence of daptomycin-nonsusceptible Enterococcus in patients during daptomycin therapy. Even though several mechanisms for daptomycin-nonsusceptibility have been suggested, the potential genetic mutations which might contribute to the daptomycin-nonsusceptibility are not fully understood. We isolated a vancomycin-susceptible, daptomycin nonsusceptible Enterococcus faecium strain from a patient with acute lymphocytic leukemia who received high-dose daptomycin therapy for E. faecium endocarditis. Whole-genome sequencing analysis revealed mutations within genes encoding DNA repair proteins MutL and RecJ of the daptomycin-nonsusceptible Enterococcus strain which might have facilitated its emergence. We identified the mutations of DNA mismatch repair genes in a clinical isolate of daptomycin nonsusceptible E. faecium which emerged in spite of high-dose daptomycin therapy. The finding implicates the possible association of DNA repair mechanism and daptomycin resistance. Careful monitoring is necessary to avoid the emergence of daptomycin non-susceptible isolates of E. faecium and particularly in cases of long-term daptomycin use or in immunocompromised patients.

  6. The HADHSC gene encoding short-chain L-3-hydroxyacyl-CoA dehydrogenase (SCHAD) and type 2 diabetes susceptibility

    DEFF Research Database (Denmark)

    van Hove, Els C; Hansen, Torben; Dekker, Jacqueline M

    2006-01-01

    The short-chain l-3-hydroxyacyl-CoA dehydrogenase (SCHAD) protein is involved in the penultimate step of mitochondrial fatty acid oxidation. Previously, it has been shown that mutations in the corresponding gene (HADHSC) are associated with hyperinsulinism in infancy. The presumed function...

  7. Deletion of the genes encoding the MtrA-MtrB two-component system of Corynebacterium glutamicum has a strong influence on cell morphology, antibiotics susceptibility and expression of genes involved in osmoprotection.

    Science.gov (United States)

    Möker, Nina; Brocker, Melanie; Schaffer, Steffen; Krämer, Reinhard; Morbach, Susanne; Bott, Michael

    2004-10-01

    The MtrAB two-component signal transduction system is highly conserved in sequence and genomic organization in Mycobacterium and Corynebacterium species, but its function is completely unknown. Here, the role of MtrAB was studied with C. glutamicum as model organism. In contrast to M. tuberculosis, it was possible to delete the mtrAB genes in C. glutamicum. The mutant cells showed a radically different cell morphology and were more sensitive to penicillin, vancomycin and lysozyme but more resistant to ethambutol. In order to identify the molecular basis for this pleiotropic phenotype, the mRNA profiles of mutant and wild type were compared with DNA microarrays. Three genes showed a more than threefold increased RNA level in the mutant, i.e. mepA (NCgl2411) encoding a putative secreted metalloprotease, ppmA (NCgl2737 ) encoding a putative membrane-bound protease modulator, and lpqB encoding a putative lipoprotein of unknown function. Expression of plasmid-encoded mepA in Escherichia coli led to elongated cells that were hypersensitive to an osmotic downshift, supporting the idea that peptidoglycan is the target of MepA. The mRNA level of two genes was more than fivefold decreased in the mutant, i.e. betP and proP which encode transporters for the uptake of betaine and proline respectively. The microarray results were confirmed by primer extension and RNA dot blot experiments. In the latter, the transcript level of genes involved in osmoprotection was tested before and after an osmotic upshift. The mRNA level of betP, proP and lcoP was strongly reduced or undetectable in the mutant, whereas that of mscL (mechanosensitive channel) was increased. The changes in cell morphology, antibiotics susceptibility and the mRNA levels of betP, proP, lcoP, mscL and mepA could be reversed by expression of plasmid-encoded copies of mtrAB in the DeltamtrAB mutant, confirming that these changes occurred as a consequence of the mtrAB deletion.

  8. A consistent and potentially exploitable response during chondrogenesis of mesenchymal stem cells from osteoarthritis patients to the protein encoded by the susceptibility gene GDF5.

    Science.gov (United States)

    Ratnayake, Madhushika; Tselepi, Maria; Bloxham, Robert; Plöger, Frank; Reynard, Louise N; Loughlin, John

    2017-01-01

    Osteoarthritis (OA) is a common joint disease characterised by the focal loss of the protective cartilage layer at the ends of the bones. It is painful, disabling, multifactorial and polygenic. The growth differentiation factor 5 gene GDF5 was one of the first reported OA susceptibility signals that showed consistent association to OA, with the transcript single nucleotide polymorphism (SNP) rs143383 demonstrating association in Asians and Europeans. The functional effect of the signal is reduced expression of the gene. The GDF5 protein is an extracellular matrix signalling molecule that is active during chondrogenesis and in mature chondrocytes. Due to the functional impact of the susceptibility, we previously assessed the effect of supplementing chondrocytes from OA patients with exogenous GDF5. Their response was highly discordant, precluding the application of GDF5 as a simple means of attenuating the genetic deficit. Since GDF5 is also active during development, we have now assessed the effect of exogenous GDF5 on bone marrow derived mesenchymal stem cells (MSCs) that are undergoing chondrogenesis during cartilage disc formation. MSCs from healthy donors and OA patients were studied and the effect of GDF5 was assessed by measuring the wet mass of the discs, by histological staining, and by monitoring the change in expression of anabolic, catabolic and hypertrophic protein-coding genes. The MSCs expressed the three principal GDF5 receptor genes and responded in a significantly anabolic manner (increase in wet mass, p = 0.0022; Bonferroni corrected p = 0.018) to a variant form of GDF5 that targets the most abundantly expressed receptor, BMPR-IA. GDF5 elicited significant (p < 0.05) changes in the expression of anabolic, catabolic and hypertrophic genes with several consistent effects in healthy donors and in OA patients. Our data implies that, unlike OA chondrocytes, OA MSCs do respond in a predictable, anabolic manner to GDF5, which could therefore provide a

  9. The role genes encoding of killer cell immunoglobulin-like receptors (KIRs) and their ligands in susceptibility to and progression of HIV infection.

    Science.gov (United States)

    Błachowicz, Olga; Zwolińska, Katarzyna

    2016-12-31

    NK cells are a part of the innate antiviral response. Their activity is regulated by signals from the surface receptors. Some of them, known as killer cell immunoglobulin-like receptors (KIRs), determine the quality and intensity of the immunological response, together with their ligands (HLA class I). KIR genes are very polymorphic, and this is reflected in the NK activity modulation. The stimulation of NK cells, especially in the early stages of the infection, can reduce the transmission of HIV or slow down the progression of infection. The varied KIR/HLA repertoire is a limiting factor for the risk of HIV infection and disease progression. Such diversity enables optimal regulation of NK cells and maintenance of the balance between activation to eliminate infected cells and inhibition. The control of NK cell activity via KIR3DL1/3DS1 and HLA-Bw4 (especially Bw4-80I) seems to be very important in the HIV context. With a few exceptions, it leads to a reduction of susceptibility to HIV infection and better viremia control, and slows down depletion of CD4+ T cells. Incompatibility of sexual partners for KIRs and HLA may oblige NK cells from the exposed partner to reject incoming cells from the HIV-positive partner. The presence of the inhibitory KIR, in the absence of its ligand, results in a lower threshold of NK cell activation, which reduces the chance of infection. The presence of an inhibitory receptor with a low affinity to the ligand (KIR2DL3+HLA-C1) is associated with lower susceptibility, and the effective NK cell inhibition (KIR2DL2+HLA-C1) results in increased susceptibility to HIV infection. The advantage of activating KIRs, especially in the presence of their ligands, is associated with higher cytolytic abilities, and thus reduced risk of HIV infection. If the virus is not eliminated in an early stage of infection, massive activation of NK is unfavorable due to the excessive stimulation of the immune system.

  10. Susceptibility Genes in Thyroid Autoimmunity

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ban

    2005-01-01

    Full Text Available The autoimmune thyroid diseases (AITD are complex diseases which are caused by an interaction between susceptibility genes and environmental triggers. Genetic susceptibility in combination with external factors (e.g. dietary iodine is believed to initiate the autoimmune response to thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITD. Various techniques have been employed to identify the genes contributing to the etiology of AITD, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions that are linked with AITD, and in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to Graves' disease (GD and Hashimoto's thyroiditis (HT and some are common to both the diseases, indicating that there is a shared genetic susceptibility to GD and HT. The putative GD and HT susceptibility genes include both immune modifying genes (e.g. HLA, CTLA-4 and thyroid specific genes (e.g. TSHR, Tg. Most likely, these loci interact and their interactions may influence disease phenotype and severity.

  11. The highly conserved serine threonine kinase StkP of Streptococcus pneumoniae contributes to penicillin susceptibility independently from genes encoding penicillin-binding proteins

    Directory of Open Access Journals (Sweden)

    Dias Ricardo

    2009-06-01

    Full Text Available Abstract Background The serine/threonine kinase StkP of Streptococcus pneumoniae is a major virulence factor in the mouse model of infection. StkP is a modular protein with a N-terminal kinase domain a C-terminal PASTA domain carrying the signature of penicillin-binding protein (PBP and prokaryotic serine threonine kinase. In laboratory cultures, one target of StkP is the phosphoglucosamine mutase GlmM involved in the first steps of peptidoglycan biosynthesis. In order to further elucidate the importance of StkP in S. pneumoniae, its role in resistance to β-lactams has been assessed by mutational analysis in laboratory cultures and its genetic conservation has been investigated in isolates from infected sites (virulent, asymptomatic carriers, susceptible and non-susceptible to β-lactams. Results Deletion replacement mutation in stkP conferred hypersensitivity to penicillin G and was epistatic on mutations in PBP2X, PBP2B and PBP1A from the resistant 9V clinical isolate URA1258. Genetic analysis of 55 clinical isolates identified 11 StkP alleles differing from the reference R6 allele. None relevant mutation in the kinase or the PASTA domains were found to account for susceptibility of the isolates. Rather the minimal inhibitory concentration (MIC values of the strains appeared to be determined by their PBP alleles. Conclusion The results of genetic dissection analysis in lab strain Cp1015 reveal that StkP is involved in the bacterial response to penicillin and is epistatic on mutations PBP 2B, 2X and 1A. However analysis of the clinical isolates did not allow us to find the StkP alleles putatively involved in determining the virulence or the resistance level of a given strain, suggesting a strong conservation of StkP in clinical isolates.

  12. Island cotton Enhanced Disease Susceptibility 1 gene encoding a lipase-like protein plays a crucial role in response to Verticillium dahliae by regulating the SA level and H2O2 accumulation

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    2016-12-01

    Full Text Available Cotton is one of the most economically important crops, but most cultivated varieties lack adequate innate immunity or resistance to Verticillium wilt. This results in serious losses to both yield and fiber quality. To identify the genetic resources for innate immunity and understand the pathways for pathogen defenses in this crop, here we focus on orthologs of the central Arabidopsis thaliana defense regulator Enhanced Disease Susceptibility 1 (EDS1. The full-length cDNA of GbEDS1 was obtained by screening the full-length cDNA library of Gossypium barbadense combining with RACE strategy. Its open reading frame is 1848 bp long, encoding 615 amino acid residues. Sequence analysis showed that GbEDS1 contains a conserved N-terminal lipase domain and an EDS1-specific KNEDT motif. Expression profiling indicated that the gene is induced by Verticillium dahliae as well as salicylic acid (SA treatment. Subcellular localization assays revealed that GbEDS1 is located in the cell cytoplasm and nucleus. Overexpression of GbEDS1 in Arabidopsis dramatically up-regulated SA and H2O2 production, resulting in enhanced disease resistance to V. dahliae. Silencing of GbEDS1 in G. barbadense significantly decreased SA and H2O2 acumulation, leading to the cotton more susceptibility. Moreover, combining the gene expression results from transgenic Arabidopsis and silenced-GbEDS1 cotton, it indicated that GbEDS1 could activate GbNDR1 and GbBAK1 expression. These findings not only broaden our knowledge about the biological role of GbEDS1, but also provide new insights into the defense mechanisms of GbEDS1 against V. dahliae in cotton.

  13. Aphid-encoded variability in susceptibility to a parasitoid.

    Science.gov (United States)

    Martinez, Adam J; Ritter, Shannon G; Doremus, Matthew R; Russell, Jacob A; Oliver, Kerry M

    2014-06-10

    Many animals exhibit variation in resistance to specific natural enemies. Such variation may be encoded in their genomes or derived from infection with protective symbionts. The pea aphid, Acyrthosiphon pisum, for example, exhibits tremendous variation in susceptibility to a common natural enemy, the parasitic wasp Aphidius ervi. Pea aphids are often infected with the heritable bacterial symbiont, Hamiltonella defensa, which confers partial to complete resistance against this parasitoid depending on bacterial strain and associated bacteriophages. That previous studies found that pea aphids without H. defensa (or other symbionts) were generally susceptible to parasitism, together with observations of a limited encapsulation response, suggested that pea aphids largely rely on infection with H. defensa for protection against parasitoids. However, the limited number of uninfected clones previously examined, and our recent report of two symbiont-free resistant clones, led us to explicitly examine aphid-encoded variability in resistance to parasitoids. After rigorous screening for known and unknown symbionts, and microsatellite genotyping to confirm clonal identity, we conducted parasitism assays using fifteen clonal pea aphid lines. We recovered significant variability in aphid-encoded resistance, with variation levels comparable to that contributed by H. defensa. Because resistance can be costly, we also measured aphid longevity and cumulative fecundity of the most and least resistant aphid lines under permissive conditions, but found no trade-offs between higher resistance and these fitness parameters. These results indicate that pea aphid resistance to A. ervi is more complex than previously appreciated, and that aphids employ multiple tactics to aid in their defense. While we did not detect a tradeoff, these may become apparent under stressful conditions or when resistant and susceptible aphids are in direct competition. Understanding sources and amounts of

  14. Search for new breast cancer susceptibility genes

    NARCIS (Netherlands)

    Oldenburg, Rogier Abel

    2008-01-01

    This thesis describes the search for new high-risk breast cancer susceptibility genes by linkage analysis. To date 20-25% of familial breast cancer is explained by mutations in the high-risk BRCA1 and BRCA2 breast cancer susceptibility genes. For the remaining families the genetic etiology is

  15. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.

    Science.gov (United States)

    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E

    2014-02-01

    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes.

  16. Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species.

    Science.gov (United States)

    Xiang, Liuxin; Liu, Jinggao; Wu, Chaofeng; Deng, Yushan; Cai, Chaowei; Zhang, Xiao; Cai, Yingfan

    2017-04-12

    . raimondii and G. barbadense were the highest among comparisons between the diploid and allotetraploid genomes, indicating that G. hirsutum inherited more NBS-encoding genes from G. arboreum, while G. barbadense inherited more NBS-encoding genes from G. raimondii. This asymmetric evolution of NBS-encoding genes may help to explain why G. raimondii and G. barbadense are more resistant to Verticillium wilt, whereas G. arboreum and G. hirsutum are more susceptible to Verticillium wilt. The disease resistances of the allotetraploid cotton were related to their NBS-encoding genes especially in regard from which diploid progenitor they were derived, and the TNL genes may have a significant role in disease resistance to Verticillium wilt in G. raimondii and G. barbadense.

  17. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  18. Evaluation of SLE Susceptibility Genes in Malaysians.

    Science.gov (United States)

    Molineros, Julio E; Chua, Kek Heng; Sun, Celi; Lian, Lay Hoong; Motghare, Prasenjeet; Kim-Howard, Xana; Nath, Swapan K

    2014-01-01

    Systemic Lupus Erythematosus (SLE) is a clinically heterogeneous autoimmune disease with strong genetic and environmental components. Our objective was to replicate 25 recently identified SLE susceptibility genes in two distinct populations (Chinese (CH) and Malays (MA)) from Malaysia. We genotyped 347 SLE cases and 356 controls (CH and MA) using the ImmunoChip array and performed an admixture corrected case-control association analysis. Associated genes were grouped into five immune-related pathways. While CH were largely homogenous, MA had three ancestry components (average 82.3% Asian, 14.5% European, and 3.2% African). Ancestry proportions were significantly different between cases and controls in MA. We identified 22 genes with at least one associated SNP (P SLE genes are also associated in the major ethnicities of Malaysia. However, these novel SNPs showed stronger association in these Asian populations than with the SNPs reported in previous studies.

  19. Evaluation of SLE Susceptibility Genes in Malaysians

    Directory of Open Access Journals (Sweden)

    Julio E. Molineros

    2014-01-01

    Full Text Available Systemic Lupus Erythematosus (SLE is a clinically heterogeneous autoimmune disease with strong genetic and environmental components. Our objective was to replicate 25 recently identified SLE susceptibility genes in two distinct populations (Chinese (CH and Malays (MA from Malaysia. We genotyped 347 SLE cases and 356 controls (CH and MA using the ImmunoChip array and performed an admixture corrected case-control association analysis. Associated genes were grouped into five immune-related pathways. While CH were largely homogenous, MA had three ancestry components (average 82.3% Asian, 14.5% European, and 3.2% African. Ancestry proportions were significantly different between cases and controls in MA. We identified 22 genes with at least one associated SNP (P<0.05. The strongest signal was at HLA-DRA (PMeta=9.96×10-9; PCH=6.57×10-8, PMA=6.73×10-3; the strongest non-HLA signal occurred at STAT4 (PMeta=1.67×10-7; PCH=2.88×10-6, PMA=2.99×10-3. Most of these genes were associated with B- and T-cell function and signaling pathways. Our exploratory study using high-density fine-mapping suggests that most of the established SLE genes are also associated in the major ethnicities of Malaysia. However, these novel SNPs showed stronger association in these Asian populations than with the SNPs reported in previous studies.

  20. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  1. Genes encoding giant danio and golden shiner ependymin.

    Science.gov (United States)

    Adams, D S; Kiyokawa, M; Getman, M E; Shashoua, V E

    1996-03-01

    Ependymin (EPN) is a brain glycoprotein that functions as a neurotrophic factor in optic nerve regeneration and long-term memory consolidation in goldfish. To date, true epn genes have been characterized in one order of teleost fish, Cypriniformes. In the study presented here, polymerase chain reactions were used to analyze the complete epn genes, gd (1480 bp), and sh (2071 bp), from Cypriniformes giant danio and shiner, respectively. Southern hybridizations demonstrated the existence of one copy of each gene per corresponding haploid genome. Each gene was found to contain six exons and five introns. Gene gd encodes a predicted 218-amino acid (aa) protein GD 93 percent conserved to goldfish EPN, while sh encodes a predicted 214-aa protein SH 91 percent homologous to goldfish. Evidence is presented classifying proteins previously termed "EPNs" into two major categories: true EPNs and non-EPN cerebrospinal fluid glycoproteins. Proteins GD and SH contain all the hallmark, features of true EPNs.

  2. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...

  3. Human germline antibody gene segments encode polyspecific antibodies.

    Science.gov (United States)

    Willis, Jordan R; Briney, Bryan S; DeLuca, Samuel L; Crowe, James E; Meiler, Jens

    2013-04-01

    Structural flexibility in germline gene-encoded antibodies allows promiscuous binding to diverse antigens. The binding affinity and specificity for a particular epitope typically increase as antibody genes acquire somatic mutations in antigen-stimulated B cells. In this work, we investigated whether germline gene-encoded antibodies are optimal for polyspecificity by determining the basis for recognition of diverse antigens by antibodies encoded by three VH gene segments. Panels of somatically mutated antibodies encoded by a common VH gene, but each binding to a different antigen, were computationally redesigned to predict antibodies that could engage multiple antigens at once. The Rosetta multi-state design process predicted antibody sequences for the entire heavy chain variable region, including framework, CDR1, and CDR2 mutations. The predicted sequences matched the germline gene sequences to a remarkable degree, revealing by computational design the residues that are predicted to enable polyspecificity, i.e., binding of many unrelated antigens with a common sequence. The process thereby reverses antibody maturation in silico. In contrast, when designing antibodies to bind a single antigen, a sequence similar to that of the mature antibody sequence was returned, mimicking natural antibody maturation in silico. We demonstrated that the Rosetta computational design algorithm captures important aspects of antibody/antigen recognition. While the hypervariable region CDR3 often mediates much of the specificity of mature antibodies, we identified key positions in the VH gene encoding CDR1, CDR2, and the immunoglobulin framework that are critical contributors for polyspecificity in germline antibodies. Computational design of antibodies capable of binding multiple antigens may allow the rational design of antibodies that retain polyspecificity for diverse epitope binding.

  4. FGF receptor genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Agarwal, D; Pineda, S; Michailidou, K

    2014-01-01

    Background:Breast cancer is one of the most common malignancies in women. Genome-wide association studies have identified FGFR2 as a breast cancer susceptibility gene. Common variation in other fibroblast growth factor (FGF) receptors might also modify risk. We tested this hypothesis by studying...... genotyped single-nucleotide polymorphisms (SNPs) and imputed SNPs in FGFR1, FGFR3, FGFR4 and FGFRL1 in the Breast Cancer Association Consortium.Methods:Data were combined from 49 studies, including 53 835 cases and 50 156 controls, of which 89 050 (46 450 cases and 42 600 controls) were of European ancestry......, 12 893 (6269 cases and 6624 controls) of Asian and 2048 (1116 cases and 932 controls) of African ancestry. Associations with risk of breast cancer, overall and by disease sub-type, were assessed using unconditional logistic regression.Results:Little evidence of association with breast cancer risk...

  5. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  6. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  7. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    2016-10-26

    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  8. Functional analysis of a gene encoding threonine synthase from rice ...

    African Journals Online (AJOL)

    The predicted amino acid sequence of OsTS is highly homologous to that of Arabidopsis TS and many bacterial TS encoded by thrC gene. The OsTS protein harbors a signature binding motif for pyridoxal- 5' -phosphate at the amino terminus. A thrC mutant strain of Escherichia coli was complemented by OsTS expression.

  9. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  10. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    In the yeast Saccharomyces cerevisiae, sterol. C-14 reductase is encoded by the ERG24 gene and erg24 null mutants are not viable on rich medium but they are viable on synthetic medium (Crowley et al 1996). Both the Neurospora and the yeast mutants have been used previously to test for sterol C-14 reductase function ...

  11. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    http://www.ias.ac.in/article/fulltext/jbsc/027/02/0105-0112. Keywords. Lamin B receptor; sterol reductase. Abstract. The human gene TM7SF2 encodes a polypeptide (SR-1) with high sequence similarity to sterol C-14 reductase, a key sterol biosynthetic enzyme in fungi, plants and mammals. In Neurospora and yeast this ...

  12. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    Science.gov (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  13. Prediction of autism susceptibility genes based on association rules.

    Science.gov (United States)

    Gong, Lejun; Yan, Yunyang; Xie, Jianming; Liu, Hongde; Sun, Xiao

    2012-06-01

    Autism is a complex neuropsychiatric disorder with high heritability and an unclear etiology. The identification of key genes related to autism may elucidate its etiology. The current study provides an approach to predicting autism susceptibility genes. Genes are first extracted from the biomedical literature, and some autism susceptibility genes are then recognized as seeds by the prior knowledge. As candidates, the remaining genes are predicted by creating association rules between the seeds and candidates. In an evaluated data set, 27 autism susceptibility genes (type "Y") are extracted and 43 possible autism susceptibility genes (type "P") are predicted. The sum of "Y" and "P" genes accounts for 93.3% of the data set that are not contained in the typical database of autism susceptibility genes. Our approach can effectively extract and predict autism susceptibility genes from the biomedical literature. These predicted results complement the typical database of autism susceptibility genes. The web portal for the predicted results, which is freely available at http://biolab.hyit.edu.cn/ar, can be a valuable resource in studies of diseases related to genes. Copyright © 2012 Wiley Periodicals, Inc.

  14. Polymyxins: Antibacterial Activity, Susceptibility Testing, and Resistance Mechanisms Encoded by Plasmids or Chromosomes.

    Science.gov (United States)

    Poirel, Laurent; Jayol, Aurélie; Nordmann, Patrice

    2017-04-01

    SUMMARYPolymyxins are well-established antibiotics that have recently regained significant interest as a consequence of the increasing incidence of infections due to multidrug-resistant Gram-negative bacteria. Colistin and polymyxin B are being seriously reconsidered as last-resort antibiotics in many areas where multidrug resistance is observed in clinical medicine. In parallel, the heavy use of polymyxins in veterinary medicine is currently being reconsidered due to increased reports of polymyxin-resistant bacteria. Susceptibility testing is challenging with polymyxins, and currently available techniques are presented here. Genotypic and phenotypic methods that provide relevant information for diagnostic laboratories are presented. This review also presents recent works in relation to recently identified mechanisms of polymyxin resistance, including chromosomally encoded resistance traits as well as the recently identified plasmid-encoded polymyxin resistance determinant MCR-1. Epidemiological features summarizing the current knowledge in that field are presented. Copyright © 2017 American Society for Microbiology.

  15. Breast Cancer Susceptibility Genes in High Risk Women

    National Research Council Canada - National Science Library

    Hamilton, Ann

    2003-01-01

    ...%. It has been hypothesized that susceptibility genes of lower penetrance may also affect breast cancer risk, and a likely group of such genes are those that regulate the production, intracellular...

  16. Breast Cancer Susceptibility Genes in High Risk Women

    National Research Council Canada - National Science Library

    Hamilton, Ann

    2004-01-01

    ...). It has been hypothesized that susceptibility genes of lower penetrance are more prevalent than among the latter, and a likely group of such genes are those that regulate the production, intracellular...

  17. Breast Cancer Susceptibility Genes in High Risk Women

    National Research Council Canada - National Science Library

    Hamilton, Ann

    2002-01-01

    ...%. It has been hypothesized that susceptibility genes of lower penetrance may also affect breast cancer risk, and a likely group of such genes are those that regulate the production, intracellular...

  18. Breast Cancer Susceptibility Genes in High Risk Women

    National Research Council Canada - National Science Library

    Hamilton, Ann

    2001-01-01

    ...%. It has been hypothesized that susceptibility genes of lower penetrance may also affect breast cancer risk, and a likely group of such genes are those that regulate the production, intracellular...

  19. Cloning and sequencing the genes encoding goldfish and carp ependymin.

    Science.gov (United States)

    Adams, D S; Shashoua, V E

    1994-04-20

    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  20. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens.

    Science.gov (United States)

    Charlebois, Audrey; Jalbert, Louis-Alexandre; Harel, Josée; Masson, Luke; Archambault, Marie

    2012-01-01

    Phenotypic bacitracin resistance has been reported in Clostridium perfringens. However, the genes responsible for the resistance have not yet been characterized. Ninety-nine C. perfringens isolates recovered from broilers and turkeys were tested for phenotypic bacitracin resistance. Bacitracin MIC(90) (>256 µg/ml) was identical for both turkey and chicken isolates; whereas MIC(50) was higher in turkey isolates (6 µg/ml) than in chicken isolates (3 µg/ml). Twenty-four of the 99 isolates showed high-level bacitracin resistance (MIC breakpoint >256 µg/ml) and the genes encoding for this resistance were characterized in C. perfringens c1261_A strain using primer walking. Sequence analysis and percentages of amino acid identity revealed putative genes encoding for both an ABC transporter and an overproduced undecaprenol kinase in C. perfringens c1261_A strain. These two mechanisms were shown to be both encoded by the putative bcrABD operon under the control of a regulatory gene, bcrR. Efflux pump inhibitor thioridazine was shown to increase significantly the susceptibility of strain c1261_A to bacitracin. Upstream and downstream from the bcr cluster was an IS1216-like element, which may play a role in the dissemination of this resistance determinant. Pulsed-field gel electrophoresis with prior double digestion with I-CeuI/MluI enzymes followed by hybridization analyses revealed that the bacitracin resistance genes bcrABDR were located on the chromosome. Semi-quantitative RT-PCR demonstrated that this gene cluster is expressed under bacitracin stress. Microarray analysis revealed the presence of these genes in all bacitracin resistant strains. This study reports the discovery of genes encoding for a putative ABC transporter and an overproduced undecaprenol kinase associated with high-level bacitracin resistance in C. perfringens isolates from turkeys and broiler chickens.

  1. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens.

    Directory of Open Access Journals (Sweden)

    Audrey Charlebois

    Full Text Available Phenotypic bacitracin resistance has been reported in Clostridium perfringens. However, the genes responsible for the resistance have not yet been characterized. Ninety-nine C. perfringens isolates recovered from broilers and turkeys were tested for phenotypic bacitracin resistance. Bacitracin MIC(90 (>256 µg/ml was identical for both turkey and chicken isolates; whereas MIC(50 was higher in turkey isolates (6 µg/ml than in chicken isolates (3 µg/ml. Twenty-four of the 99 isolates showed high-level bacitracin resistance (MIC breakpoint >256 µg/ml and the genes encoding for this resistance were characterized in C. perfringens c1261_A strain using primer walking. Sequence analysis and percentages of amino acid identity revealed putative genes encoding for both an ABC transporter and an overproduced undecaprenol kinase in C. perfringens c1261_A strain. These two mechanisms were shown to be both encoded by the putative bcrABD operon under the control of a regulatory gene, bcrR. Efflux pump inhibitor thioridazine was shown to increase significantly the susceptibility of strain c1261_A to bacitracin. Upstream and downstream from the bcr cluster was an IS1216-like element, which may play a role in the dissemination of this resistance determinant. Pulsed-field gel electrophoresis with prior double digestion with I-CeuI/MluI enzymes followed by hybridization analyses revealed that the bacitracin resistance genes bcrABDR were located on the chromosome. Semi-quantitative RT-PCR demonstrated that this gene cluster is expressed under bacitracin stress. Microarray analysis revealed the presence of these genes in all bacitracin resistant strains. This study reports the discovery of genes encoding for a putative ABC transporter and an overproduced undecaprenol kinase associated with high-level bacitracin resistance in C. perfringens isolates from turkeys and broiler chickens.

  2. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.

    2016-12-13

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  3. A genome wide linkage search for breast cancer susceptibility genes

    NARCIS (Netherlands)

    Smith, Paula; McGuffog, Lesley; Easton, Douglas F.; Mann, Graham J.; Pupo, Gulietta M.; Newman, Beth; Chenevix-Trench, Georgia; Szabo, Csilla; Southey, Melissa; Renard, Hélène; Odefrey, Fabrice; Lynch, Henry; Stoppa-Lyonnet, Dominique; Couch, Fergus; Hopper, John L.; Giles, Graham G.; McCredie, Margaret R. E.; Buys, Saundra; Andrulis, Irene; Senie, Ruby; Goldgar, David E.; Oldenburg, Rogier; Kroeze-Jansema, Karin; Kraan, Jaennelle; Meijers-Heijboer, Hanne; Klijn, Jan G. M.; van Asperen, Christi; van Leeuwen, Inge; Vasen, Hans F. A.; Cornelisse, Cees J.; Devilee, Peter; Baskcomb, Linda; Seal, Sheila; Barfoot, Rita; Mangion, Jon; Hall, Anita; Edkins, Sarah; Rapley, Elizabeth; Wooster, Richard; Chang-Claude, Jenny; Eccles, Diana; Evans, D. Gareth; Futreal, P. Andrew; Nathanson, Katherine L.; Weber, Barbara L.; Rahman, Nazneen; Stratton, Michael R.

    2006-01-01

    Mutations in known breast cancer susceptibility genes account for a minority of the familial aggregation of the disease. To search for further breast cancer susceptibility genes, we performed a combined analysis of four genome-wide linkage screens, which included a total of 149 multiple case breast

  4. Wheat Mds-1 encodes a heat-shock protein and governs susceptibility towards the Hessian fly gall midge

    Science.gov (United States)

    Plant pests including insects must manipulate plants in order to utilize the nutrition and environment of the host. Here, we show that the heat-shock protein gene Mayetiola destructor susceptibility gene-1 (Mds-1) is a major susceptibility gene in wheat that allows the gall midge M. destructor, com...

  5. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  6. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    A RING zinc finger ankyrin protein gene, designated AdZFP1, was isolated from drought-tolerant Artemisia desertorum Spreng by mRNA differential display and RACE. Its cDNA was 1723 bp and encoded a putative protein of 445 amino acids with a predicted molecular mass of 47.9 kDa and an isoelectric point (pI) of 7.49.

  7. Identification of β-haemolysin-encoding genes in Streptococcus anginosus.

    Science.gov (United States)

    Asam, D; Mauerer, S; Walheim, E; Spellerberg, B

    2013-08-01

    Streptococcus anginosus is an emerging pathogen, but little is known about its virulence factors. To detect the genes responsible for β-haemolysis we performed genomic mutagenesis of the β-haemolytic S. anginosus type strain ATCC 12395 using the vector pGhost9:ISS1. Integration site analysis of 15 non-haemolytic mutants identified a gene cluster with high homology to the genes of the streptolysin S (SLS) encoding sag gene cluster of S. pyogenes. The gene cluster harbours 10 open reading frames displaying significant similarities to the S. pyogenes genes sagA-sagI, with the identities on protein level ranging from 38 to 87%. Complementation assays of S. anginosus sagB and sagD integration mutants with the respective genes confirmed their importance for β-haemolysin production and suggest the presence of post-translational modifications in S. anginosus SLS similar to SLS of S. pyogenes. Characterization of the S. anginosus haemolysin in comparison to the S. pyogenes SLS showed that the haemolysin is surface bound, but in contrast to S. pyogenes neither fetal calf serum nor RNA was able to stabilize the haemolysin of S. anginosus in culture supernatants. Inhibition of β-haemolysis by polyethylene glycol of different sizes was carried out, giving no evidence of a pore-forming haemolytic mechanism. Analysis of a whole genome shotgun sequence of Streptococcus constellatus, a closely related streptococcal species that belongs to the S. anginosus group, revealed a similar sag gene cluster. Employing a genomic mutagenesis strategy we were able to determine an SLS encoding gene cluster in S. anginosus and demonstrate its importance for β-haemolysin production in S. anginosus. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Prioritization of Disease Susceptibility Genes Using LSM/SVD.

    Science.gov (United States)

    Gong, Lejun; Yang, Ronggen; Yan, Qin; Sun, Xiao

    2013-12-01

    Understanding the role of genetics in diseases is one of the most important tasks in the postgenome era. It is generally too expensive and time consuming to perform experimental validation for all candidate genes related to disease. Computational methods play important roles for prioritizing these candidates. Herein, we propose an approach to prioritize disease genes using latent semantic mapping based on singular value decomposition. Our hypothesis is that similar functional genes are likely to cause similar diseases. Measuring the functional similarity between known disease susceptibility genes and unknown genes is to predict new disease susceptibility genes. Taking autism as an instance, the analysis results of the top ten genes prioritized demonstrate they might be autism susceptibility genes, which also indicates our approach could discover new disease susceptibility genes. The novel approach of disease gene prioritization could discover new disease susceptibility genes, and latent disease-gene relations. The prioritized results could also support the interpretive diversity and experimental views as computational evidence for disease researchers.

  9. Genes encoding proteoglycans are associated with the risk of anterior cruciate ligament ruptures.

    Science.gov (United States)

    Mannion, Sasha; Mtintsilana, Asanda; Posthumus, Michael; van der Merwe, Willem; Hobbs, Hayden; Collins, Malcolm; September, Alison V

    2014-12-01

    Genetic variants within genes involved in fibrillogenesis have previously been implicated in anterior cruciate ligament (ACL) injury susceptibility. Proteoglycans also have important functions in fibrillogenesis and maintaining the structural integrity of ligaments. Genes encoding proteoglycans are plausible candidates to be investigated for associations with ACL injury susceptibility; polymorphisms within genes encoding the proteoglycans aggrecan (ACAN), biglycan (BGN), decorin (DCN), fibromodulin (FMOD) and lumican (LUM) were examined. A case-control genetic association study was conducted. 227 participants with surgically diagnosed ACL ruptures (ACL group) and 234 controls without any history of ACL injury were genotyped for 10 polymorphisms in 5 proteoglycan genes. Inferred haplotypes were constructed for specific regions. The G allele of ACAN rs1516797 was significantly under-represented in the controls (p=0.024; OR=0.72; 95% CI 0.55 to 0.96) compared with the ACL group. For DCN rs516115, the GG genotype was significantly over-represented in female controls (p=0.015; OR=9.231; 95%CI 1.16 to 73.01) compared with the ACL group and the AA genotype was significantly under-represented in controls (p=0.013; OR=0.33; 95% CI 0.14 to 0.78) compared with the female non-contact ACL injury subgroup. Haplotype analyses implicated regions overlapping ACAN (rs2351491 C>T-rs1042631 T>C-rs1516797 T>G), BGN (rs1126499 C>T-rs1042103 G>A) and LUM-DCN (rs2268578 T>C-rs13312816 A>T-rs516115 A>G) in ACL injury susceptibility. These independent associations and haplotype analyses suggest that regions within ACAN, BGN, DCN and a region spanning LUM-DCN are associated with ACL injury susceptibility. Taking into account the functions of these genes, it is reasonable to propose that genetic sequence variability within the genes encoding proteoglycans may potentially modulate the ligament fibril properties. Published by the BMJ Publishing Group Limited. For permission to use (where not

  10. Systems properties of proteins encoded by imprinted genes.

    Science.gov (United States)

    Sandhu, Kuljeet Singh

    2010-10-01

    Genomically imprinted genes show parentally fixed mono-allelic expression and are important for the mammalian development. Dysregulation of genomic imprinting leads to several complex pathological conditions. Though the genetic and epigenetic regulation of imprinted genes has been well studied, their protein aspects are largely ignored. Here, we systematically studied a sub-network centered on proteins encoded by imprinted genes within human interactome. Using concepts of network biology, we uncover a highly connected, transitive and central network module of imprinted gene-products and their interacting partners (IGPN). The network is enriched in development, metabolism and cell cycle related functions and its malfunctioning ascribes error intolerance to human interactome network. Further, detailed analysis revealed that its higher centrality is determined by 'date' interactions among the proteins belonging to different functional classes than the 'party' interactions within the same functional class. Interestingly, a significant proportion of this network genetically associates with disease phenotypes. Moreover, the network comprises of gene-sets that are upregulated in leukemia, psychosis, obesity/diabetes and downregulated in autism. We conclude that imprinted gene-products are part of a functionally and topologically important module of human interactome and errors in this sub-network are intolerant to, otherwise robust, human interactome. The findings might also shed light on how imprinted genes, which are rather very few, coordinate at protein level to pleiotropically regulate growth and metabolism during embryonic and post-natal development.

  11. Comparative analysis of resistance gene analogues encoding NBS-LRR domains in cotton.

    Science.gov (United States)

    Khan, Abdul Manan; Khan, Asif Ali; Azhar, Muhammad Tehseen; Amrao, Luqman; Cheema, Hafiza Masooma Naseer

    2016-01-30

    Plant production is severely affected by biotic and abiotic stresses R-genes exhibit resistance against a range of diseases and pathogens in plants. The nucleotide binding site and leucine rich repeat (NBS-LRR) class of R-genes is the most comprehensively studied in terms of sequence evolution and genome distribution. The differential response for resistance against biotic and abiotic stress has been observed in cultivated and wild relatives of the genus Gossypium. Efforts have been made to address the recent evolution of NBS-LRR sequences within Gossypium hirsutum and resistance gene analogue (RGA) sequences derived from G. arboreum and G. raimondii. The % identity and phylogenetic analysis of NBS-LRR-encoded RGAs from tetraploid New World cotton and its diploid ancestors G. raimondii and G. arboreum suggest that the evolution of NBS-LRR-encoding sequences in G. hirsutum occurred by gradual accumulation of mutants that led to positive selection and a slow rate of divergence within distinct R-gene families. The allotetraploid genome of cotton, after separating from its diploid parents, experienced polyploidisation, natural and artificial selection, hybrid necrosis, duplication and recombination which became the reason to shed off and evolve new genes for its survival. These driving forces influenced the development of genomic architecture that make it susceptible to diseases and pathogens as compared to donor parents. © 2015 Society of Chemical Industry.

  12. Genes encoding longevity: from model organisms to humans.

    Science.gov (United States)

    Kuningas, Maris; Mooijaart, Simon P; van Heemst, Diana; Zwaan, Bas J; Slagboom, P Eline; Westendorp, Rudi G J

    2008-03-01

    Ample evidence from model organisms has indicated that subtle variation in genes can dramatically influence lifespan. The key genes and molecular pathways that have been identified so far encode for metabolism, maintenance and repair mechanisms that minimize age-related accumulation of permanent damage. Here, we describe the evolutionary conserved genes that are involved in lifespan regulation of model organisms and humans, and explore the reasons of discrepancies that exist between the results found in the various species. In general, the accumulated data have revealed that when moving up the evolutionary ladder, together with an increase of genome complexity, the impact of candidate genes on lifespan becomes smaller. The presence of genetic networks makes it more likely to expect impact of variation in several interacting genes to affect lifespan in humans. Extrapolation of findings from experimental models to humans is further complicated as phenotypes are critically dependent on the setting in which genes are expressed, while laboratory conditions and modern environments are markedly dissimilar. Finally, currently used methodologies may have only little power and validity to reveal genetic variation in the population. In conclusion, although the study of model organisms has revealed potential candidate genetic mechanisms determining aging and lifespan, to what extent they explain variation in human populations is still uncertain.

  13. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.

    Science.gov (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes

    2015-11-01

    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  14. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for

  15. Gene family encoding the major toxins of lethal Amanita mushrooms.

    Science.gov (United States)

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D

    2007-11-27

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  16. Gene family encoding the major toxins of lethal Amanita mushrooms

    Science.gov (United States)

    Hallen, Heather E.; Luo, Hong; Scott-Craig, John S.; Walton, Jonathan D.

    2007-01-01

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode α-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. α-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable “toxin” region capable of encoding a wide variety of peptides of 7–10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes. PMID:18025465

  17. Beyond BRCA: new hereditary breast cancer susceptibility genes.

    Science.gov (United States)

    Economopoulou, P; Dimitriadis, G; Psyrri, A

    2015-01-01

    Approximately 5-10% of breast cancer cases might be inheritable, up to 30% of which are due to BRCA1/2 mutations. During the past few years and thanks to technology evolution, we have been witnesses of an intensive search of additional genes with similar characteristics, under the premise that successful gene discovery will provide substantial opportunities for primary and secondary prevention of breast cancer. Consequently, new genes have emerged as breast cancer susceptibility genes, including rare germline mutations in high penetrant genes, such as TP53 and PTEN, and more frequent mutations in moderate penetrant genes, such as CHEK2, ATM and PALB2. This review will summarize current data on new findings in breast cancer susceptibility genes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Identifying rheumatoid arthritis susceptibility genes using high-dimensional methods

    OpenAIRE

    Liang Xueying; Gao Ying; Lam Tram K; Li Qizhai; Falk Cathy; Yang Xiaohong R; Goldstein Alisa M; Goldin Lynn R

    2009-01-01

    Abstract Although several genes (including a strong effect in the human leukocyte antigen (HLA) region) and some environmental factors have been implicated to cause susceptibility to rheumatoid arthritis (RA), the etiology of the disease is not completely understood. The ability to screen the entire genome for association to complex diseases has great potential for identifying gene effects. However, the efficiency of gene detection in this situation may be improved by methods specifically des...

  19. Antioxidant Defense Enzyme Genes and Asthma Susceptibility: Gender-Specific Effects and Heterogeneity in Gene-Gene Interactions between Pathogenetic Variants of the Disease

    Science.gov (United States)

    Polonikov, Alexey V.; Ivanov, Vladimir P.; Bogomazov, Alexey D.; Freidin, Maxim B.; Illig, Thomas; Solodilova, Maria A.

    2014-01-01

    Oxidative stress resulting from an increased amount of reactive oxygen species and an imbalance between oxidants and antioxidants plays an important role in the pathogenesis of asthma. The present study tested the hypothesis that genetic susceptibility to allergic and nonallergic variants of asthma is determined by complex interactions between genes encoding antioxidant defense enzymes (ADE). We carried out a comprehensive analysis of the associations between adult asthma and 46 single nucleotide polymorphisms of 34 ADE genes and 12 other candidate genes of asthma in Russian population using set association analysis and multifactor dimensionality reduction approaches. We found for the first time epistatic interactions between ADE genes underlying asthma susceptibility and the genetic heterogeneity between allergic and nonallergic variants of the disease. We identified GSR (glutathione reductase) and PON2 (paraoxonase 2) as novel candidate genes for asthma susceptibility. We observed gender-specific effects of ADE genes on the risk of asthma. The results of the study demonstrate complexity and diversity of interactions between genes involved in oxidative stress underlying susceptibility to allergic and nonallergic asthma. PMID:24895604

  20. Antioxidant Defense Enzyme Genes and Asthma Susceptibility: Gender-Specific Effects and Heterogeneity in Gene-Gene Interactions between Pathogenetic Variants of the Disease

    Directory of Open Access Journals (Sweden)

    Alexey V. Polonikov

    2014-01-01

    Full Text Available Oxidative stress resulting from an increased amount of reactive oxygen species and an imbalance between oxidants and antioxidants plays an important role in the pathogenesis of asthma. The present study tested the hypothesis that genetic susceptibility to allergic and nonallergic variants of asthma is determined by complex interactions between genes encoding antioxidant defense enzymes (ADE. We carried out a comprehensive analysis of the associations between adult asthma and 46 single nucleotide polymorphisms of 34 ADE genes and 12 other candidate genes of asthma in Russian population using set association analysis and multifactor dimensionality reduction approaches. We found for the first time epistatic interactions between ADE genes underlying asthma susceptibility and the genetic heterogeneity between allergic and nonallergic variants of the disease. We identified GSR (glutathione reductase and PON2 (paraoxonase 2 as novel candidate genes for asthma susceptibility. We observed gender-specific effects of ADE genes on the risk of asthma. The results of the study demonstrate complexity and diversity of interactions between genes involved in oxidative stress underlying susceptibility to allergic and nonallergic asthma.

  1. Apolipoprotein gene variants and susceptibility to essential ...

    African Journals Online (AJOL)

    Objective: To investigate the relationship between Apo ɛ gene polymorphisms and EH in the Bantu ethnic group of Cameroon. Design: Cross sectional study. Setting: Bantu ethnic group of South West Cameroon. Results: Whereas advanced age, SBP, DBP, lack of exercise and family history constituted risk factors of EH, ...

  2. Hereditary breast cancer: the era of new susceptibility genes.

    Science.gov (United States)

    Apostolou, Paraskevi; Fostira, Florentia

    2013-01-01

    Breast cancer is the most common malignancy among females. 5%-10% of breast cancer cases are hereditary and are caused by pathogenic mutations in the considered reference BRCA1 and BRCA2 genes. As sequencing technologies evolve, more susceptible genes have been discovered and BRCA1 and BRCA2 predisposition seems to be only a part of the story. These new findings include rare germline mutations in other high penetrant genes, the most important of which include TP53 mutations in Li-Fraumeni syndrome, STK11 mutations in Peutz-Jeghers syndrome, and PTEN mutations in Cowden syndrome. Furthermore, more frequent, but less penetrant, mutations have been identified in families with breast cancer clustering, in moderate or low penetrant genes, such as CHEK2, ATM, PALB2, and BRIP1. This paper will summarize all current data on new findings in breast cancer susceptibility genes.

  3. Hereditary Breast Cancer: The Era of New Susceptibility Genes

    Directory of Open Access Journals (Sweden)

    Paraskevi Apostolou

    2013-01-01

    Full Text Available Breast cancer is the most common malignancy among females. 5%–10% of breast cancer cases are hereditary and are caused by pathogenic mutations in the considered reference BRCA1 and BRCA2 genes. As sequencing technologies evolve, more susceptible genes have been discovered and BRCA1 and BRCA2 predisposition seems to be only a part of the story. These new findings include rare germline mutations in other high penetrant genes, the most important of which include TP53 mutations in Li-Fraumeni syndrome, STK11 mutations in Peutz-Jeghers syndrome, and PTEN mutations in Cowden syndrome. Furthermore, more frequent, but less penetrant, mutations have been identified in families with breast cancer clustering, in moderate or low penetrant genes, such as CHEK2, ATM, PALB2, and BRIP1. This paper will summarize all current data on new findings in breast cancer susceptibility genes.

  4. CYP2D6 gene variants and their association with breast cancer susceptibility.

    Science.gov (United States)

    Abraham, Jean E; Maranian, Mel J; Driver, Kristy E; Platte, Radka; Kalmyrzaev, Bolot; Baynes, Caroline; Luccarini, Craig; Earl, Helena M; Dunning, Alison M; Pharoah, Paul D P; Caldas, Carlos

    2011-06-01

    The gene encoding the phase I enzyme cytochrome P4502D6 (CYP2D6) has been previously investigated for its potential predictive role in the efficacy of breast cancer treatments such as tamoxifen, but its role in breast cancer susceptibility is unclear. This study aims to evaluate the association between germ line variations in CYP2D6 and breast cancer susceptibility. DNA samples from 13,472 cases and controls were genotyped for seven known functional variants [minor allele frequency (MAF) ≥ 0.01] and five single nucleotide polymorphisms (SNP) that tag common genetic variation (MAF > 0.05) in CYP2D6. One relatively rare functional variant, CYP2D6*6, (MAF = 0.01) showed a modest increased association with breast cancer susceptibility (P(trend) = 0.02; OR = 1.32; 95% CI = 1.04-1.68). All other functional and tagSNPs showed no association with breast cancer susceptibility. Common variants of CYP2D6 do not play a significant role in breast cancer susceptibility. However, this study raises questions regarding the role of rare variants, such as CYP2D6*6, in breast cancer susceptibility which merit further investigation. This large case-control study, involving 13,472 women, found no evidence of any association between common CYP2D6 gene variants and breast cancer susceptibility. However, one relatively rare functional variant CYP2D6*6 showed a modest association with breast cancer susceptibility, indicating that the role of rare CYP2D6 variants in breast cancer risk is unclear and requires further investigation in an adequately powered study. ©2011 AACR.

  5. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci

    Directory of Open Access Journals (Sweden)

    N Perumal

    2016-01-01

    Full Text Available The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs and staphylococcal cassette chromosome mec (SCCmec elements among clinical isolates of methicillin-resistant staphylococci (MRS. Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6′-Ie-aph (2′′, aph (3′-IIIa and ant (4′-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6′-Ie-aph (2′′ (55.4% followed by aph (3′-IIIa (32.3% and ant (4′-Ia gene (9%. SCCmec type I (34% was predominant in this study. In conclusion, the aac (6′-Ie-aph (2′′ was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  6. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans

    NARCIS (Netherlands)

    de Boer, A P; van der Oost, J.; Reijnders, W N; Westerhoff, H V; Stouthamer, A.H.; van Spanning, R J

    1996-01-01

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N.,

  7. Effects of disruption of heat shock genes on susceptibility of Escherichia coli to fluoroquinolones

    Directory of Open Access Journals (Sweden)

    Morioka Mizue

    2003-08-01

    Full Text Available Abstract Background It is well known that expression of certain bacterial genes responds rapidly to such stimuli as exposure to toxic chemicals and physical agents. It is generally believed that the proteins encoded in these genes are important for successful survival of the organism under the hostile conditions. Analogously, the proteins induced in bacterial cells exposed to antibiotics are believed to affect the organisms' susceptibility to these agents. Results We demonstrated that Escherichia coli cells exposed to levofloxacin (LVFX, a fluoroquinolone (FQ, induce the syntheses of heat shock proteins and RecA. To examine whether the heat shock proteins affect the bactericidal action of FQs, we constructed E. coli strains with mutations in various heat shock genes and tested their susceptibility to FQs. Mutations in dnaK, groEL, and lon increased this susceptibility; the lon mutant exhibited the greatest effects. The increased susceptibility of the lon mutant was corroborated by experiments in which the gene encoding the cell division inhibitor, SulA, was subsequently disrupted. SulA is induced by the SOS response and degraded by the Lon protease. The findings suggest that the hypersusceptibility of the lon mutant to FQs could be due to abnormally high levels of SulA protein resulting from the depletion of Lon and the continuous induction of the SOS response in the presence of FQs. Conclusion The present results show that the bactericidal action of FQs is moderately affected by the DnaK and GroEL chaperones and strongly affected by the Lon protease. FQs have contributed successfully to the treatment of various bacterial infections, but their widespread use and often misuse, coupled with emerging resistance, have gradually compromised their utility. Our results suggest that agents capable of inhibiting the Lon protease have potential for combination therapy with FQs.

  8. The IFN-gamma +874T/A gene polymorphism is associated with retinochoroiditis toxoplasmosis susceptibility.

    Science.gov (United States)

    Albuquerque, Maíra Cavalcanti de; Aleixo, Ana Luisa Quintella do Couto; Benchimol, Eliezer Israel; Leandro, Ana Cristina Câmara S; das Neves, Leandro Batista; Vicente, Regiane Trigueiro; Bonecini-Almeida, Maria da Glória; Amendoeira, Maria Regina Reis

    2009-05-01

    Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-gamma plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-gamma (+874T/A) among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group) and 134 without ocular lesions (control group). The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.

  9. The IFN-³+874T/A gene polymorphism is associated with retinochoroiditis toxoplasmosis susceptibility

    Directory of Open Access Journals (Sweden)

    Maíra Cavalcanti de Albuquerque

    2009-05-01

    Full Text Available Toxoplasmosis is a worldwide zoonosis that generally produces an asymptomatic infection. In some cases, however, toxoplasmosis infection can lead to ocular damage. The immune system has a crucial role in both the course of the infection and in the evolution of toxoplasmosis disease. In particular, IFN-³ plays an important role in resistance to toxoplasmosis. Polymorphisms in genes encoding cytokines have been shown to have an association with susceptibility to parasitic diseases. The aim of this work was to analyse the occurrence of polymorphisms in the gene encoding IFN-³ (+874T/A among Toxoplasma gondii seropositive individuals, including those with ocular lesions caused by the parasite, from a rural population of Santa Rita de Cássia, Barra Mansa, state of Rio de Janeiro, Brazil. Further, we verified which of these polymorphisms could be related to susceptibility to the development of ocular toxoplasmosis. This study included 34 individuals with ocular toxoplasmosis (ocular group and 134 without ocular lesions (control group. The differences between A and T allele distributions were not statistically significant between the two groups. However, we observed that a higher frequency of individuals from the ocular group possessed the A/A genotype, when compared with the control group, suggesting that homozygocity for the A allele could enhance susceptibility to ocular toxoplasmosis in T. gondii infection.

  10. Gene susceptibility in Iranian asthmatic patients: a narrative review ...

    African Journals Online (AJOL)

    Hence, we carried out a systematic review to assess the susceptible genes for asthma in Iranian population. We conducted a literature search by using the electronic database PubMed, Biological Abstracts Web of Science, Current Contents Connect, Cinahl, ScienceDirect, Scopus, IranMedex, and Scientific Information ...

  11. Distribution of CBP genes in Streptococcus pneumoniae isolates in relation to vaccine types, penicillin susceptibility and clinical site.

    Science.gov (United States)

    Desa, M N; Sekaran, S D; Vadivelu, J; Parasakthi, N

    2008-07-01

    Choline-binding proteins (CBP) have been associated with the pathogenesis of Streptococcus pneumoniae. We screened, using PCR, for the presence of genes (cbpA, D, E, G) encoding these proteins in 34 isolates of pneumococci of known serotypes and penicillin susceptibility from invasive and non-invasive disease. All isolates harboured cbpD and cbpE whereas cbpA and cbpG were found in 47% and 59% respectively; the latter were more frequent in vaccine-associated types and together accounted for 77% of these isolates. No association was observed with penicillin susceptibility but 85% of non-invasive isolates were positive for these genes.

  12. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob

    2007-01-01

    for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...

  13. Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease

    OpenAIRE

    Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L.; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A.; Naj, Adam C.; Sims, Rebecca

    2014-01-01

    PUBLISHED BACKGROUND: Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over...

  14. Genetic Susceptibility to Vitiligo: GWAS Approaches for Identifying Vitiligo Susceptibility Genes and Loci

    Science.gov (United States)

    Shen, Changbing; Gao, Jing; Sheng, Yujun; Dou, Jinfa; Zhou, Fusheng; Zheng, Xiaodong; Ko, Randy; Tang, Xianfa; Zhu, Caihong; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Zhang, Xuejun

    2016-01-01

    Vitiligo is an autoimmune disease with a strong genetic component, characterized by areas of depigmented skin resulting from loss of epidermal melanocytes. Genetic factors are known to play key roles in vitiligo through discoveries in association studies and family studies. Previously, vitiligo susceptibility genes were mainly revealed through linkage analysis and candidate gene studies. Recently, our understanding of the genetic basis of vitiligo has been rapidly advancing through genome-wide association study (GWAS). More than 40 robust susceptible loci have been identified and confirmed to be associated with vitiligo by using GWAS. Most of these associated genes participate in important pathways involved in the pathogenesis of vitiligo. Many susceptible loci with unknown functions in the pathogenesis of vitiligo have also been identified, indicating that additional molecular mechanisms may contribute to the risk of developing vitiligo. In this review, we summarize the key loci that are of genome-wide significance, which have been shown to influence vitiligo risk. These genetic loci may help build the foundation for genetic diagnosis and personalize treatment for patients with vitiligo in the future. However, substantial additional studies, including gene-targeted and functional studies, are required to confirm the causality of the genetic variants and their biological relevance in the development of vitiligo. PMID:26870082

  15. Network Analysis of Human Genes Influencing Susceptibility to Mycobacterial Infections.

    Directory of Open Access Journals (Sweden)

    Ettie M Lipner

    Full Text Available Tuberculosis and nontuberculous mycobacterial infections constitute a high burden of pulmonary disease in humans, resulting in over 1.5 million deaths per year. Building on the premise that genetic factors influence the instance, progression, and defense of infectious disease, we undertook a systems biology approach to investigate relationships among genetic factors that may play a role in increased susceptibility or control of mycobacterial infections. We combined literature and database mining with network analysis and pathway enrichment analysis to examine genes, pathways, and networks, involved in the human response to Mycobacterium tuberculosis and nontuberculous mycobacterial infections. This approach allowed us to examine functional relationships among reported genes, and to identify novel genes and enriched pathways that may play a role in mycobacterial susceptibility or control. Our findings suggest that the primary pathways and genes influencing mycobacterial infection control involve an interplay between innate and adaptive immune proteins and pathways. Signaling pathways involved in autoimmune disease were significantly enriched as revealed in our networks. Mycobacterial disease susceptibility networks were also examined within the context of gene-chemical relationships, in order to identify putative drugs and nutrients with potential beneficial immunomodulatory or anti-mycobacterial effects.

  16. Identification of candidate genes for dyslexia susceptibility on chromosome 18.

    Directory of Open Access Journals (Sweden)

    Thomas S Scerri

    2010-10-01

    Full Text Available Six independent studies have identified linkage to chromosome 18 for developmental dyslexia or general reading ability. Until now, no candidate genes have been identified to explain this linkage. Here, we set out to identify the gene(s conferring susceptibility by a two stage strategy of linkage and association analysis.Linkage analysis: 264 UK families and 155 US families each containing at least one child diagnosed with dyslexia were genotyped with a dense set of microsatellite markers on chromosome 18. Association analysis: Using a discovery sample of 187 UK families, nearly 3000 SNPs were genotyped across the chromosome 18 dyslexia susceptibility candidate region. Following association analysis, the top ranking SNPs were then genotyped in the remaining samples. The linkage analysis revealed a broad signal that spans approximately 40 Mb from 18p11.2 to 18q12.2. Following the association analysis and subsequent replication attempts, we observed consistent association with the same SNPs in three genes; melanocortin 5 receptor (MC5R, dymeclin (DYM and neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L.Along with already published biological evidence, MC5R, DYM and NEDD4L make attractive candidates for dyslexia susceptibility genes. However, further replication and functional studies are still required.

  17. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced,...

  18. Prioritisation and network analysis of Crohn's disease susceptibility genes.

    Directory of Open Access Journals (Sweden)

    Daniele Muraro

    Full Text Available Recent Genome-Wide Association Studies (GWAS have revealed numerous Crohn's disease susceptibility genes and a key challenge now is in understanding how risk polymorphisms in associated genes might contribute to development of this disease. For a gene to contribute to disease phenotype, its risk variant will likely adversely communicate with a variety of other gene products to result in dysregulation of common signaling pathways. A vital challenge is to elucidate pathways of potentially greatest influence on pathological behaviour, in a manner recognizing how multiple relevant genes may yield integrative effect. In this work we apply mathematical analysis of networks involving the list of recently described Crohn's susceptibility genes, to prioritise pathways in relation to their potential development of this disease. Prioritisation was performed by applying a text mining and a diffusion based method (GRAIL, GPEC. Prospective biological significance of the resulting prioritised list of proteins is highlighted by changes in their gene expression levels in Crohn's patients intestinal tissue in comparison with healthy donors.

  19. Prioritisation and network analysis of Crohn's disease susceptibility genes.

    Science.gov (United States)

    Muraro, Daniele; Lauffenburger, Douglas A; Simmons, Alison

    2014-01-01

    Recent Genome-Wide Association Studies (GWAS) have revealed numerous Crohn's disease susceptibility genes and a key challenge now is in understanding how risk polymorphisms in associated genes might contribute to development of this disease. For a gene to contribute to disease phenotype, its risk variant will likely adversely communicate with a variety of other gene products to result in dysregulation of common signaling pathways. A vital challenge is to elucidate pathways of potentially greatest influence on pathological behaviour, in a manner recognizing how multiple relevant genes may yield integrative effect. In this work we apply mathematical analysis of networks involving the list of recently described Crohn's susceptibility genes, to prioritise pathways in relation to their potential development of this disease. Prioritisation was performed by applying a text mining and a diffusion based method (GRAIL, GPEC). Prospective biological significance of the resulting prioritised list of proteins is highlighted by changes in their gene expression levels in Crohn's patients intestinal tissue in comparison with healthy donors.

  20. Metazoan Ribosome Inactivating Protein encoding genes acquired by Horizontal Gene Transfer.

    Science.gov (United States)

    Lapadula, Walter J; Marcet, Paula L; Mascotti, María L; Sanchez-Puerta, M Virginia; Juri Ayub, Maximiliano

    2017-05-12

    Ribosome inactivating proteins (RIPs) are RNA N-glycosidases that depurinate a specific adenine residue in the conserved sarcin/ricin loop of 28S rRNA. These enzymes are widely distributed among plants and their presence has also been confirmed in several bacterial species. Recently, we reported for the first time in silico evidence of RIP encoding genes in metazoans, in two closely related species of insects: Aedes aegypti and Culex quinquefasciatus. Here, we have experimentally confirmed the presence of these genes in mosquitoes and attempted to unveil their evolutionary history. A detailed study was conducted, including evaluation of taxonomic distribution, phylogenetic inferences and microsynteny analyses, indicating that mosquito RIP genes derived from a single Horizontal Gene Transfer (HGT) event, probably from a cyanobacterial donor species. Moreover, evolutionary analyses show that, after the HGT event, these genes evolved under purifying selection, strongly suggesting they play functional roles in these organisms.

  1. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  2. DNA variants within the 5'-flanking region of milk-protein-encoding genes II. The β-lactoglobulin-encoding gene.

    Science.gov (United States)

    Wagner, V A; Schild, T A; Geldermann, H

    1994-09-01

    For the detection of polymorphisms within the 5'-flanking region of the β-lactoglobulin (-LG) -encoding gene a nucleotide sequence containing 795 bp of the promoter and 59 bp of exon I was cloned and sequenced. After comparing the sequence from the DNA of 11 diverse cows (different breeds and milk-protein yields), 14 singlebp substitutions were identified within the 5'-flanking region and two in the 5'-untranslated region (5'-UTR) of exon I. Some of the variants are located in potential binding sites for trans-acting factors or in the 5'-UTR. A PCR-based RFLP analysis was performed, and the genotypes of an additional 60 cows were identified at five variable 5'-flanking sites. The results reveal three frequent combinations between the A and B alleles of the protein-coding region and the novel 5'-flanking DNA variants. This finding may explain the differences of the protein-variant-dependent β-LG synthesis (A>B) observed in vivo. A sequence comparison of the bovine and ovine promoters reveals an homology of 92.8% and shows a higher degree of conservation between positions -600 and -300.

  3. Antimicrobial susceptibility and presence of resistance genes in staphylococci from poultry

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Agersø, Yvonne; Ahrens, Peter

    2000-01-01

    The species distribution, susceptibility to 19 antimicrobial agents and presence of selected genes encoding resistance to macrolides, streptogramins and tetracyclines were examined among 118 staphylococcal isolates from infections of poultry in Denmark. Isolates were identified using a combination...... of conventional biochemical testing and 16S rDNA sequencing. The most common species were Staphylococcus aureus (83), Staphylococcus hyicus (11), Staphylococcus xylosus (9) and Staphylococcus cohnii (6). The isolates were susceptible to most antimicrobials tested. A high frequency of S. aureus (30%) was resistant...... to ciprofloxacin. Only six (7%) S. aureus isolates and one Staphylococcus saprophyticus were penicillin resistant. Resistance to sulphamethoxazole was observed among 16 (19%) of S. aureus isolates and two coagulase negative staphylococci (CNS). Twenty (24%) of the S. aureus isolates were resistant to erythromycin...

  4. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  5. Identification of maize genes associated with host plant resistance or susceptibility to Aspergillus flavus infection and aflatoxin accumulation.

    Directory of Open Access Journals (Sweden)

    Rowena Y Kelley

    Full Text Available BACKGROUND: Aspergillus flavus infection and aflatoxin contamination of maize pose negative impacts in agriculture and health. Commercial maize hybrids are generally susceptible to this fungus. Significant levels of host plant resistance have been observed in certain maize inbred lines. This study was conducted to identify maize genes associated with host plant resistance or susceptibility to A. flavus infection and aflatoxin accumulation. RESULTS: Genome wide gene expression levels with or without A. flavus inoculation were compared in two resistant maize inbred lines (Mp313E and Mp04:86 in contrast to two susceptible maize inbred lines (Va35 and B73 by microarray analysis. Principal component analysis (PCA was used to find genes contributing to the larger variances associated with the resistant or susceptible maize inbred lines. The significance levels of gene expression were determined by using SAS and LIMMA programs. Fifty candidate genes were selected and further investigated by quantitative RT-PCR (qRT-PCR in a time-course study on Mp313E and Va35. Sixteen of the candidate genes were found to be highly expressed in Mp313E and fifteen in Va35. Out of the 31 highly expressed genes, eight were mapped to seven previously identified quantitative trait locus (QTL regions. A gene encoding glycine-rich RNA binding protein 2 was found to be associated with the host hypersensitivity and susceptibility in Va35. A nuclear pore complex protein YUP85-like gene was found to be involved in the host resistance in Mp313E. CONCLUSION: Maize genes associated with host plant resistance or susceptibility were identified by a combination of microarray analysis, qRT-PCR analysis, and QTL mapping methods. Our findings suggest that multiple mechanisms are involved in maize host plant defense systems in response to Aspergillus flavus infection and aflatoxin accumulation. These findings will be important in identification of DNA markers for breeding maize lines

  6. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  7. The Phytophthora infestans avirulence gene Avr4 encodes an RXLR-dEER effector

    NARCIS (Netherlands)

    Poppel, van P.M.J.A.; Jun Guo, J.; Vondervoort, van de P.J.I.; Jung, M.W.M.; Birch, P.R.J.; Whisson, S.C.; Govers, F.

    2008-01-01

    Resistance in potato against the oomycete Phytophthora infestans is conditioned by resistance (R) genes that are introgressed from wild Solanum spp. into cultivated potato. According to the gene-for-gene model, proteins encoded by R genes recognize race-specific effectors resulting in a

  8. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    OpenAIRE

    Baiquan Ma; Liao Liao; Hongyu Zheng; Jie Chen; Benhong Wu; Collins Ogutu; Shaohua Li; Korban, Schuyler S.; Yuepeng Han

    2015-01-01

    A gene encoding aluminum-activated malate transporter (ALMT) was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.). In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated wi...

  9. Examination of AVPR1a as an autism susceptibility gene.

    Science.gov (United States)

    Wassink, T H; Piven, J; Vieland, V J; Pietila, J; Goedken, R J; Folstein, S E; Sheffield, V C

    2004-10-01

    Impaired reciprocal social interaction is one of the core features of autism. While its determinants are complex, one biomolecular pathway that clearly influences social behavior is the arginine-vasopressin (AVP) system. The behavioral effects of AVP are mediated through the AVP receptor 1a (AVPR1a), making the AVPR1a gene a reasonable candidate for autism susceptibility. We tested the gene's contribution to autism by screening its exons in 125 independent autistic probands and genotyping two promoter polymorphisms in 65 autism affected sibling pair (ASP) families. While we found no nonconservative coding sequence changes, we did identify evidence of linkage and of linkage disequilibrium. These results were most pronounced in a subset of the ASP families with relatively less severe impairment of language. Thus, though we did not demonstrate a disease-causing variant in the coding sequence, numerous nontraditional disease-causing genetic abnormalities are known to exist that would escape detection by traditional gene screening methods. Given the emerging biological, animal model, and now genetic data, AVPR1a and genes in the AVP system remain strong candidates for involvement in autism susceptibility and deserve continued scrutiny.

  10. Evaluation of the BRCA1 interacting genes RAP80 and CCDC98 in familial breast cancer susceptibility.

    Science.gov (United States)

    Osorio, Ana; Barroso, Alicia; García, Maria J; Martínez-Delgado, Beatriz; Urioste, Miguel; Benítez, Javier

    2009-01-01

    RAP80 and CCDC98 have arisen as new candidate breast cancer susceptibility genes, since they encode for two very recently identified BRCA1 interacting proteins. In this study we have performed the first mutational analysis of both genes in 168 multiple-case breast/ovarian cancer families, negative for mutations in BRCA1 or BRCA2. We have not found truncating mutations in any of the genes and only two missense variants, p.Tyr564His in RAP80, and p.Met299Ile in CCDC98 were found that could be suspected to have a pathogenic effect, although further analyses suggested that they were probably non deleterious. Our analysis suggests that RAP80 and CCDC98 do not play an important role as high penetrance breast cancer susceptibility genes.

  11. Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

    Science.gov (United States)

    Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

    2017-08-01

    The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  12. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... data demonstrated that AhLPAT4 had 1631 nucleotides, encoding a putative 43.8 kDa protein with 383 amino acid residues. The deduced protein ... senting the major components of vegetable oils. It is an efficient ... are then transported to endoplasmic reticulum (ER) or cyto- plasm to form acyl-CoA ...

  13. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... 1Department of Entomology, China Agricultural University, Beijing 100193, China. 2Plant Protection Institute of Hebei Academy of Agricultural and Forestry Sciences, Baoding 071000, China. ... cDNA from Bemisia tabaci encoding a CSP (GU250808), denoted BtabCSP was cloned by RT-PCR and.

  14. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim was to...

  15. Differential Expression of Two Paralogous Genes of Bacillus subtilis Encoding Single-Stranded DNA Binding Protein

    NARCIS (Netherlands)

    Lindner, Cordula; Nijland, Reindert; Hartskamp, Mariska van; Bron, Sierd; Hamoen, Leendert W.; Kuipers, Oscar P.

    The Bacillus subtilis genome comprises two paralogous single-stranded DNA binding protein (SSB) genes, ssb and ywpH, which show distinct expression patterns. The main ssb gene is strongly expressed during exponential growth and is coregulated with genes encoding the ribosomal proteins S6 and S18.

  16. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  17. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    Science.gov (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  18. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F

    2000-01-01

    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  19. Gene expression profiling in the lungs of pigs with different susceptibilities to Glässer's disease

    Directory of Open Access Journals (Sweden)

    Sargent Carole A

    2010-07-01

    Full Text Available Abstract Background Haemophilus parasuis is the causative agent of Glässer's disease in pigs. Currently, little is known about the molecular mechanisms that contribute to disease susceptibility. This study used a porcine oligonucleotide microarray to identify genes that were differentially expressed (DE in the lungs of colostrum-deprived animals previously characterized as being either 'Fully Resistant' (FR or 'Susceptible' to infection by H. parasuis in a bacterial challenge experiment. Results Gene expression profiles of 'FR' and 'Susceptible' animals were obtained by the identification of genes that were differentially expressed between each of these groups and mock-inoculated 'Control' animals. At 24 hours post-inoculation, a total of 21 and 58 DE genes were identified in 'FR' and 'Susceptible' animals respectively. At 72 hours, the numbers of genes were 20 and 347 respectively. 'FR' animals at 24 hours exhibited an increased expression of genes encoding extracellular matrix and TGF-β signalling components, possibly indicative of tissue repair following the successful early resolution of infection. The gene expression profile of 'FR' animals at 72 hours supported the hypothesis that higher levels of antibacterial activity were responsible for the 'FR' phenotype, possibly due to an increase in natural immunoglobulin A and decrease in signalling by the immunoregulatory transcription factor peroxisome proliferator-activated receptor gamma (PPAR-γ. The expression profile of 'Susceptible' animals at both time-points was characterized by an imbalance in signalling between pro and anti-inflammatory cytokines and an increased expression of genes involved in biological processes associated with inflammation. These include the pro-inflammatory cytokine genes resistin (RETN and interleukin 1-beta (IL1B. At 72 hours, a reduction in the expression of genes involved in antigen presentation by both MHC class I and II molecules was observed, which could

  20. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Sequencing and structural analyses of the full length cDNA indicated that BtabCSP is 381 bp in length, encoding 126 amino acid residues of which a 22 amino acid residue coded for a signal peptide. The predicted molecular weight of BtabCSP is 14.17 kDa. The BtabCSP amino acid residues deduced from the respective ...

  1. Cancer Susceptibility Gene Mutations in Individuals With Colorectal Cancer.

    Science.gov (United States)

    Yurgelun, Matthew B; Kulke, Matthew H; Fuchs, Charles S; Allen, Brian A; Uno, Hajime; Hornick, Jason L; Ukaegbu, Chinedu I; Brais, Lauren K; McNamara, Philip G; Mayer, Robert J; Schrag, Deborah; Meyerhardt, Jeffrey A; Ng, Kimmie; Kidd, John; Singh, Nanda; Hartman, Anne-Renee; Wenstrup, Richard J; Syngal, Sapna

    2017-04-01

    Purpose Hereditary factors play an important role in colorectal cancer (CRC) risk, yet the prevalence of germline cancer susceptibility gene mutations in patients with CRC unselected for high-risk features (eg, early age at diagnosis, personal/family history of cancer or polyps, tumor microsatellite instability [MSI], mismatch repair [MMR] deficiency) is unknown. Patients and Methods We recruited 1,058 participants who received CRC care in a clinic-based setting without preselection for age at diagnosis, personal/family history, or MSI/MMR results. All participants underwent germline testing for mutations in 25 genes associated with inherited cancer risk. Each gene was categorized as high penetrance or moderate penetrance on the basis of published estimates of the lifetime cancer risks conferred by pathogenic germline mutations in that gene. Results One hundred five (9.9%; 95% CI, 8.2% to 11.9%) of 1,058 participants carried one or more pathogenic mutations, including 33 (3.1%) with Lynch syndrome (LS). Twenty-eight (96.6%) of 29 available LS CRCs demonstrated abnormal MSI/MMR results. Seventy-four (7.0%) of 1,058 participants carried non-LS gene mutations, including 23 (2.2%) with mutations in high-penetrance genes (five APC, three biallelic MUTYH, 11 BRCA1/2, two PALB2, one CDKN2A, and one TP53), 15 of whom lacked clinical histories suggestive of their underlying mutation. Thirty-eight (3.6%) participants had moderate-penetrance CRC risk gene mutations (19 monoallelic MUTYH, 17 APC*I1307K, two CHEK2). Neither proband age at CRC diagnosis, family history of CRC, nor personal history of other cancers significantly predicted the presence of pathogenic mutations in non-LS genes. Conclusion Germline cancer susceptibility gene mutations are carried by 9.9% of patients with CRC. MSI/MMR testing reliably identifies LS probands, although 7.0% of patients with CRC carry non-LS mutations, including 1.0% with BRCA1/2 mutations.

  2. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding......, and galactomannan. The method is a fermentation process performed under strict anaerobic conditions....

  3. Vitiligo susceptibility and catalase gene (CAT) polymorphisms in sicilian population.

    Science.gov (United States)

    Caputo, Valentina; Niceta, Marcello; Fiorella, Santi; La Vecchia, Marco; Bastonini, Emanuela; Bongiorno, Maria R; Pistone, Giuseppe

    2017-02-15

    Catalase gene (CAT) polymorphisms were analyzed as responsible for the deficiency of catalase enzyme activity and concomitant accumulation of excessive hydrogen peroxide in Vitiligo patients. Catalase is a well known oxidative stress regulator that could play an important role in the pathogenesis of Vitiligo. This study was conducted to evaluate three CAT gene polymorphisms (-89A/T, 389C/T, 419C/T) and their association with Vitiligo susceptibility in Sicilian population. 60 out of 73 Sicilian patients with Vitiligo were enrolled and submitted to CAT gene analysis. Contrary to the Northern part of Europe but likewise to the Mediterranean area, the frequency of the CAT genotypes in Sicily is equally distributed. Out of all CAT genotypes, only CAT -89 T/T frequency was found to be significantly higher amongst Vitiligo patients than controls. Despite the involvement of the CAT enzyme in the pathogenesis of Vitiligo, the biological significance of CAT gene polymorphisms is still controversial. With the only exception for CAT variant -89A/T, the other studied CAT gene polymorphisms (389C/T and 419C/T) might not to be associated with Vitiligo in Sicilian population.

  4. Th17-related genes and celiac disease susceptibility.

    Directory of Open Access Journals (Sweden)

    Luz María Medrano

    Full Text Available Th17 cells are known to be involved in several autoimmune or inflammatory diseases. In celiac disease (CD, recent studies suggest an implication of those cells in disease pathogenesis. We aimed at studying the role of genes relevant for the Th17 immune response in CD susceptibility. A total of 101 single nucleotide polymorphisms (SNPs, mainly selected to cover most of the variability present in 16 Th17-related genes (IL23R, RORC, IL6R, IL17A, IL17F, CCR6, IL6, JAK2, TNFSF15, IL23A, IL22, STAT3, TBX21, SOCS3, IL12RB1 and IL17RA, were genotyped in 735 CD patients and 549 ethnically matched healthy controls. Case-control comparisons for each SNP and for the haplotypes resulting from the SNPs studied in each gene were performed using chi-square tests. Gene-gene interactions were also evaluated following different methodological approaches. No significant results emerged after performing the appropriate statistical corrections. Our results seem to discard a relevant role of Th17 cells on CD risk.

  5. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  6. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification is pro...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  7. Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

    Science.gov (United States)

    Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

    2016-12-01

    Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

  8. Assessment of PALB2 as a candidate melanoma susceptibility gene.

    Directory of Open Access Journals (Sweden)

    Lauren G Aoude

    Full Text Available Partner and localizer of BRCA2 (PALB2 interacts with BRCA2 to enable double strand break repair through homologous recombination. Similar to BRCA2, germline mutations in PALB2 have been shown to predispose to Fanconi anaemia as well as pancreatic and breast cancer. The PALB2/BRCA2 protein interaction, as well as the increased melanoma risk observed in families harbouring BRCA2 mutations, makes PALB2 a candidate for melanoma susceptibility. In order to assess PALB2 as a melanoma predisposition gene, we sequenced the entire protein-coding sequence of PALB2 in probands from 182 melanoma families lacking pathogenic mutations in known high penetrance melanoma susceptibility genes: CDKN2A, CDK4, and BAP1. In addition, we interrogated whole-genome and exome data from another 19 kindreds with a strong family history of melanoma for deleterious mutations in PALB2. Here we report a rare known deleterious PALB2 mutation (rs118203998 causing a premature truncation of the protein (p.Y1183X in an individual who had developed four different cancer types, including melanoma. Three other family members affected with melanoma did not carry the variant. Overall our data do not support a case for PALB2 being associated with melanoma predisposition.

  9. Trends in antimicrobial susceptibility in relation to antimicrobial usage and presence of resistance genes in Staphylococcus hyicus isolated from exudative epidermitis in pigs

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Jensen, Lars Bogø

    2002-01-01

    From 1996 to 2001 a total of 467 Staphylococcus hyicus isolates from exudative epidermitis (EE) in pigs in Denmark were examined for susceptibility to 13 different antimicrobial agents. The presence of selected genes encoding macrolide (erm(A), erm(B) and erm(C)), penicillin (blaZ), streptogramin...

  10. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  11. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A

    2009-10-01

    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  12. Functional characterization of the powdery mildew susceptibility gene SmMLO1 in eggplant (Solanum melongena L.).

    Science.gov (United States)

    Bracuto, Valentina; Appiano, Michela; Ricciardi, Luigi; Göl, Deniz; Visser, Richard G F; Bai, Yuling; Pavan, Stefano

    2017-06-01

    Eggplant (Solanum melongena L.) is one of the most important vegetables among the Solanaceae and can be a host to fungal species causing powdery mildew (PM) disease. Specific homologs of the plant Mildew Locus O (MLO) gene family are PM susceptibility factors, as their loss of function results in a recessive form of resistance known as mlo resistance. In a previous work, we isolated the eggplant MLO homolog SmMLO1. SmMLO1 is closely related to MLO susceptibility genes characterized in other plant species. However, it displays a peculiar non-synonymous substitution that leads to a T → M amino acid change at protein position 422, in correspondence of the MLO calmodulin-binding domain. In this study, we performed the functional characterization of SmMLO1. Transgenic overexpression of SmMLO1 in a tomato mlo mutant compromised resistance to the tomato PM pathogen Oidium neolycopersici, thus indicating that SmMLO1 is a PM susceptibility factor in eggplant. PM susceptibility was also restored by the transgenic expression of a synthetic gene, named s-SmMLO1, encoding a protein identical to SmMLO1, except for the presence of T at position 422. This indicates that the T → M polymorphism does not affect the protein role as PM susceptibility factor. Overall, the results of this work are of interest for the functional characterization of MLO proteins and the introduction of PM resistance in eggplant using reverse genetics.

  13. Variation of genes encoding GGPLs syntheses among Mycoplasma fermentans strains.

    Science.gov (United States)

    Fujihara, Masatoshi; Ishida, Noriko; Asano, Kozo; Matsuda, Kazuhiro; Nomura, Nobuo; Nishida, Yoshihiro; Harasawa, Ryô

    2010-06-01

    The information of the biosynthesis pathways of Mycoplasma fermentans specific major lipid-antigen, named glycoglycerophospholipids (GGPLs), is expected to be some of help to understand the virulence of M. fermentans. We examined primary structure of cholinephosphotransferase (mf1) and glucosyltransferase (mf3) genes, which engage GGPL-I and GGPL-III synthesis, in 20 strains, and found four types of variations in the mf1 gene but the mf3 gene in two strains was not detected by PCR. These results may have important implications in virulence factor of M. fermentans.

  14. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  15. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2017-10-11

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  16. Designing of a single gene encoding four functional proteins.

    Science.gov (United States)

    Inouye, Masayori; Ishida, Yojiro; Inouye, Keiko

    2017-04-21

    In the genomes of some organisms such as bacteriophages and bacteria, a DNA sequence is able to encode two different proteins, indicating that genetic information is compacted in DNA twice denser than in usual DNA. In theory, a DNA sequence has a maximal capacity to produce six different mRNAs, however, it is an intriguing question how many of these mRNAs are able to synthesize functional proteins. Here, we design a DNA sequence encoding four collagen-like proteins, two, (Gly-Arg-Pro)n and (Gly-Ala-Pro)n, from a sense mRNA and the other two, also (Gly-Arg-Pro)n and (Gly-Ala-Pro)n from its antisense mRNA, all of which are expected to form triple-helical structures unique to collagens. Other designs such as the combination of (Gly-Arg-Pro)n, (Gly-Val-Pro)n, (Gly-Thr-Pro)n and (Gly-Arg-Pro)n are also possible. The proposed DNA sequence is considered to contain the most compact genetic information ever created. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Putative ACP phosphodiesterase gene (acpD) encodes an azoreductase.

    Science.gov (United States)

    Nakanishi, M; Yatome, C; Ishida, N; Kitade, Y

    2001-12-07

    An FMN-dependent NADH-azoreductase of Escherichia coli was purified and analyzed for identification of the gene responsible for azo reduction by microorganisms. The N-terminal sequence of the azoreductase conformed to that of the acpD gene product, acyl carrier protein phosphodiesterase. Overexpression of the acpD gene provided the E. coli with a large amount of the 23-kDa protein and more than 800 times higher azoreductase activity. The purified gene product exhibited activity corresponding to that of the native azoreductase. The reaction followed a ping-pong mechanism requiring 2 mol of NADH to reduce 1 mol of methyl red (4'-dimethylaminoazobenzene-2-carboxylic acid) into 2-aminobenzoic acid and N,N'-dimethyl-p-phenylenediamine. On the other hand, the gene product could not convert holo-acyl carrier protein into the apo form under either in vitro or in vivo conditions. These data indicate that the acpD gene product is not acyl carrier protein phosphodiesterase but an azoreductase.

  18. Polymorphisms in autophagy genes and susceptibility to tuberculosis.

    Directory of Open Access Journals (Sweden)

    Mario Songane

    Full Text Available Recent data suggest that autophagy is important for intracellular killing of Mycobacterium tuberculosis, and polymorphisms in the autophagy gene IRGM have been linked with susceptibility to tuberculosis (TB among African-Americans, and with TB caused by particular M. tuberculosis genotypes in Ghana. We compared 22 polymorphisms of 14 autophagy genes between 1022 Indonesian TB patients and 952 matched controls, and between patients infected with different M. tuberculosis genotypes, as determined by spoligotyping. The same autophagy polymorphisms were studied in correlation with ex-vivo production of TNF, IL-1β, IL-6, IL-8, IFN-γ and IL-17 in healthy volunteers. No association was found between TB and polymorphisms in the genes ATG10, ATG16L2, ATG2B, ATG5, ATG9B, IRGM, LAMP1, LAMP3, P2RX7, WIPI1, MTOR and ATG4C. Associations were found between polymorphisms in LAMP1 (p = 0.02 and MTOR (p = 0.02 and infection with the successful M. tuberculosis Beijing genotype. The polymorphisms examined were not associated with M. tuberculosis induced cytokines, except for a polymorphism in ATG10, which was linked with IL-8 production (p = 0.04. All associations found lost statistical significance after correction for multiple testing. This first examination of a broad set of polymorphisms in autophagy genes fails to show a clear association with TB, with M. tuberculosis Beijing genotype infection or with ex-vivo pro-inflammatory cytokine production.

  19. Involvement of MTHFR and TPMT genes in susceptibility to childhood acute lymphoblastic leukemia (ALL) in Mexicans.

    Science.gov (United States)

    Gutiérrez-Álvarez, Ossyneidee; Lares-Asseff, Ismael; Galaviz-Hernández, Carlos; Reyes-Espinoza, Elio-Aarón; Almanza-Reyes, Horacio; Sosa-Macías, Martha; Chairez Hernández, Isaías; Salas-Pacheco, José-Manuel; Bailón-Soto, Claudia E

    2016-03-01

    Folate metabolism plays an essential role in the processes of DNA synthesis and methylation. Deviations in the folate flux resulting from single-nucleotide polymorphisms in genes encoding folate-dependent enzymes may affect the susceptibility to leukemia. This case-control study aimed to assess associations among MTHFR (C677T, A1298C) and TPMT (*2, *3A) mutations as well as to evaluate the synergistic effects of combined genotypes for both genes. Therefore, these genetic variants may lead to childhood acute lymphoblastic leukemia (ALL) susceptibility, in a Mexican population study. DNA samples obtained from 70 children with ALL and 152 age-matched controls (range, 1-15 years) were analyzed by real-time reverse transcription polymerase chain reaction (RT-qPCR) to detect MTHFR C677T and A1298C and TPMT*2 and TPMT*3A genotypes. The frequency of the MTHFR A1298C CC genotype was statistically significant (odds ratio [OR], 6.48; 95% 95% confidence intervals [CI], 1.26-33.2; p=0.025). In addition, the combined 677CC+1298AC genotype exhibited a statistically significant result (OR, 0.23; 95% CI, 0.06-0.82; p=0.023). No significant results were obtained from the MTHFR (C677T CT, C677T TT) or TPMT (*2, *3A) genotypes. More importantly, no association between the synergistic effects of either gene (MTHFR and/or TPMT) and susceptibility to ALL was found. The MTHFR A1298C CC genotype was associated with an increased risk of developing childhood ALL. However, a decreased risk to ALL with the combination of MTHFR 677CC+1298AC genotypes was found.

  20. The transferome of metabolic genes explored: analysis of the horizontal transfer of enzyme encoding genes in unicellular eukaryotes.

    Science.gov (United States)

    Whitaker, John W; McConkey, Glenn A; Westhead, David R

    2009-01-01

    Metabolic networks are responsible for many essential cellular processes, and exhibit a high level of evolutionary conservation from bacteria to eukaryotes. If genes encoding metabolic enzymes are horizontally transferred and are advantageous, they are likely to become fixed. Horizontal gene transfer (HGT) has played a key role in prokaryotic evolution and its importance in eukaryotes is increasingly evident. High levels of endosymbiotic gene transfer (EGT) accompanied the establishment of plastids and mitochondria, and more recent events have allowed further acquisition of bacterial genes. Here, we present the first comprehensive multi-species analysis of E/HGT of genes encoding metabolic enzymes from bacteria to unicellular eukaryotes. The phylogenetic trees of 2,257 metabolic enzymes were used to make E/HGT assertions in ten groups of unicellular eukaryotes, revealing the sources and metabolic processes of the transferred genes. Analyses revealed a preference for enzymes encoded by genes gained through horizontal and endosymbiotic transfers to be connected in the metabolic network. Enrichment in particular functional classes was particularly revealing: alongside plastid related processes and carbohydrate metabolism, this highlighted a number of pathways in eukaryotic parasites that are rich in enzymes encoded by transferred genes, and potentially key to pathogenicity. The plant parasites Phytophthora were discovered to have a potential pathway for lipopolysaccharide biosynthesis of E/HGT origin not seen before in eukaryotes outside the Plantae. The number of enzymes encoded by genes gained through E/HGT has been established, providing insight into functional gain during the evolution of unicellular eukaryotes. In eukaryotic parasites, genes encoding enzymes that have been gained through horizontal transfer may be attractive drug targets if they are part of processes not present in the host, or are significantly diverged from equivalent host enzymes.

  1. Identification of genes differentially expressed during interaction of resistant and susceptible apple cultivars (Malus x domestica) with Erwinia amylovora.

    Science.gov (United States)

    Baldo, Angela; Norelli, Jay L; Farrell, Robert E; Bassett, Carole L; Aldwinckle, Herb S; Malnoy, Malnoy

    2010-01-04

    The necrogenic enterobacterium, Erwinia amylovora is the causal agent of the fire blight (FB) disease in many Rosaceae species, including apple and pear. During the infection process, the bacteria induce an oxidative stress response with kinetics similar to those induced in an incompatible bacteria-plant interaction. No resistance mechanism to E. amylovora in host plants has yet been characterized, recent work has identified some molecular events which occur in resistant and/or susceptible host interaction with E. amylovora: In order to understand the mechanisms that characterize responses to FB, differentially expressed genes were identified by cDNA-AFLP analysis in resistant and susceptible apple genotypes after inoculation with E. amylovora. cDNA were isolated from M.26 (susceptible) and G.41 (resistant) apple tissues collected 2 h and 48 h after challenge with a virulent E. amylovora strain or mock (buffer) inoculated. To identify differentially expressed transcripts, electrophoretic banding patterns were obtained from cDNAs. In the AFLP experiments, M.26 and G.41 showed different patterns of expression, including genes specifically induced, not induced, or repressed by E. amylovora. In total, 190 ESTs differentially expressed between M.26 and G.41 were identified using 42 pairs of AFLP primers. cDNA-AFLP analysis of global EST expression in a resistant and a susceptible apple genotype identified different major classes of genes. EST sequencing data showed that genes linked to resistance, encoding proteins involved in recognition, signaling, defense and apoptosis, were modulated by E. amylovora in its host plant. The expression time course of some of these ESTs selected via a bioinformatic analysis has been characterized. These data are being used to develop hypotheses of resistance or susceptibility mechanisms in Malus to E. amylovora and provide an initial categorization of genes possibly involved in recognition events, early signaling responses the

  2. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  3. Chromosomal location of the gene encoding phosphoribosylpyrophosphate synthetase in Escherichia coli

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    1983-01-01

    by conjugation. Transductional analysis of the prs region established the gene order as purB-fadR-dadR-tre-pth-prs-hemA-trp. Two additional mutations were identified in the mutant: one in gsk, the gene encoding guanosine kinase, and one in lon, conferring a mucoid colony morphology. The contribution of each...

  4. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.

    1990-01-01

    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  5. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  6. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12.

    Science.gov (United States)

    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A

    1987-06-01

    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  7. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12.

    OpenAIRE

    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A

    1987-01-01

    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  8. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Eric U Selker

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  9. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  10. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  11. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... It is a branch point enzyme, which regulates coordination with the other prenyltransferases (GDP and FDP synthase respectively) of the precursor flux towards mono-, sesqui-, and diterpenoids ... branch point enzyme in terpenoid biosynthesis, and that ..... complementation of the gene cluster for carotenoid.

  12. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Common wheat Hanxuan 10, a drought-tolerant cultivar, was used as the plant material. Seeds were germinated and grown in a growth chamber (20°±1°C, ..... References. Bechtold N, Ellis J and Pelletier G 1993 In planta Agrobacterium- mediated gene transfer by infiltration of Arabidopsis thaliana plants; C. R. Acad. Sci.

  13. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    In this study, a full-length AhLPAT4 gene was isolated via cDNA library screening and rapid amplification of cDNA ends (RACE); our data demonstrated that AhLPAT4 ... Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of ...

  14. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  15. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    The National Key Facility for Crop Gene Resources and Genetic Improvement, Key Laboratory of Crop Germplasm & Biotechnology, Ministry of Agriculture, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China; Biotechnology Research Institute, Chinese Academy of Agricultural ...

  16. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  17. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    Jane

    2011-04-06

    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  18. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  19. HLA genes and other candidate genes involved in susceptibility for (pre)neoplastic cervical disease

    NARCIS (Netherlands)

    Zoodsma, M; Nolte, IM; Meerman, GJT; De Vries, EGE; Van Der Zee, AGJ

    This review focuses on common and genetic risk factors such as HLA and other genes that may be involved in susceptibility for (pre)neoplastic cervical disease. The goal of this review is the evaluation of polymorphisms that are either associated with cervical intraepithelial neoplasia (CIN) and/or

  20. Prioritization of Susceptibility Genes for Ectopic Pregnancy by Gene Network Analysis.

    Science.gov (United States)

    Liu, Ji-Long; Zhao, Miao

    2016-02-01

    Ectopic pregnancy is a very dangerous complication of pregnancy, affecting 1%-2% of all reported pregnancies. Due to ethical constraints on human biopsies and the lack of suitable animal models, there has been little success in identifying functionally important genes in the pathogenesis of ectopic pregnancy. In the present study, we developed a random walk-based computational method named TM-rank to prioritize ectopic pregnancy-related genes based on text mining data and gene network information. Using a defined threshold value, we identified five top-ranked genes: VEGFA (vascular endothelial growth factor A), IL8 (interleukin 8), IL6 (interleukin 6), ESR1 (estrogen receptor 1) and EGFR (epidermal growth factor receptor). These genes are promising candidate genes that can serve as useful diagnostic biomarkers and therapeutic targets. Our approach represents a novel strategy for prioritizing disease susceptibility genes.

  1. Multidrug-Resistant Escherichia albertii: Co-occurrence of β-Lactamase and MCR-1 Encoding Genes

    Directory of Open Access Journals (Sweden)

    Qun Li

    2018-02-01

    Full Text Available Escherichia albertii is an emerging member of the Enterobacteriaceae causing human and animal enteric infections. Antimicrobial resistance among enteropathogens has been reported to be increasing in the past years. The purpose of this study was to investigate antibiotic resistance and resistance genes in E. albertii isolated from Zigong city, Sichuan province, China. The susceptibility to 21 antimicrobial agents was determined by Kirby–Bauer disk diffusion method. The highest prevalence was tetracycline resistance with a rate of 62.7%, followed by resistance to nalidixic acid and streptomycin with a rate of 56.9 and 51.0%, respectively. All isolates were sensitive or intermediate susceptible to imipenem, meropenem, amoxicillin–clavulanic acid, and levofloxacin. Among 51 E. albertii isolates, 15 were extended-spectrum β-lactamase-producing as confirmed by the double disk test. The main β-lactamase gene groups, i.e., blaTEM, blaSHV, and blaCTX-M, were detected in17, 20, and 22 isolates, respectively. Furthermore, four colistin-resistant isolates with minimum inhibitory concentrations of 8 mg/L were identified. The colistin-resistant isolates all harbored mcr-1 and blaCTX-M-55. Genome sequencing showed that E. albertii strain SP140150 carried mcr-1 and blaCTX-M-55 in two different plasmids. This study provided significant information regarding antibiotic resistance profiles and identified the co-occurrence of β-lactamase and MCR-1 encoding genes in E. albertii isolates.

  2. Susceptibility genes and pharmacogenetics in ocular inflammatory disorders.

    Science.gov (United States)

    Liu, Baoying; Sen, H Nida; Nussenblatt, Robert

    2012-10-01

    Ocular inflammatory disorders encompass uveitis, scleritis, keratitis, and other ocular diseases where inflammation may play a role. Although age-related macular degeneration (AMD) is clinically characterized by degenerative changes in the macula, accumulating evidence suggests that inflammation plays an important role in its pathogenesis. Pharmacogenetics is the study of the influence of genetic variation and its effects on drug efficacy or toxicity. There are no pharmacogenetic studies in uveitis and very few in AMD therapies. In this review, the authors describe the susceptibility genes related to uveitis and AMD and the important advances in pharmacogenetic research in relation to AMD and uveitis therapy. They propose polygenic and composite models of treatment responses to fulfill individualized drug therapy in intraocular inflammatory disorders.

  3. Absence of repellents in Ustilago maydis induces genes encoding small secreted proteins.

    Science.gov (United States)

    Teertstra, Wieke R; Krijgsheld, Pauline; Wösten, Han A B

    2011-08-01

    The rep1 gene of the maize pathogen Ustilago maydis encodes a pre-pro-protein that is processed in the secretory pathway into 11 peptides. These so-called repellents form amphipathic amyloid fibrils at the surface of aerial hyphae. A SG200 strain in which the rep1 gene is inactivated (∆rep1 strain) is affected in aerial hyphae formation. We here assessed changes in global gene expression as a consequence of the inactivation of the rep1 gene. Microarray analysis revealed that only 31 genes in the ∆rep1 SG200 strain had a fold change in expression of ≥2. Twenty-two of these genes were up-regulated and half of them encode small secreted proteins (SSPs) with unknown functions. Seven of the SSP genes and two other genes that are over-expressed in the ∆rep1 SG200 strain encode proteins that can be classified as secreted cysteine-rich proteins (SCRPs). Interestingly, most of the SCRPs are predicted to form amyloids. The SCRP gene um00792 showed the highest up-regulation in the ∆rep1 strain. Using GFP as a reporter, it was shown that this gene is over-expressed in the layer of hyphae at the medium-air interface. Taken together, it is concluded that inactivation of rep1 hardly affects the expression profile of U. maydis, despite the fact that the mutant strain has a strong reduced ability to form aerial hyphae.

  4. What is a gene, post-ENCODE? History and updated definition.

    Science.gov (United States)

    Gerstein, Mark B; Bruce, Can; Rozowsky, Joel S; Zheng, Deyou; Du, Jiang; Korbel, Jan O; Emanuelsson, Olof; Zhang, Zhengdong D; Weissman, Sherman; Snyder, Michael

    2007-06-01

    While sequencing of the human genome surprised us with how many protein-coding genes there are, it did not fundamentally change our perspective on what a gene is. In contrast, the complex patterns of dispersed regulation and pervasive transcription uncovered by the ENCODE project, together with non-genic conservation and the abundance of noncoding RNA genes, have challenged the notion of the gene. To illustrate this, we review the evolution of operational definitions of a gene over the past century--from the abstract elements of heredity of Mendel and Morgan to the present-day ORFs enumerated in the sequence databanks. We then summarize the current ENCODE findings and provide a computational metaphor for the complexity. Finally, we propose a tentative update to the definition of a gene: A gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products. Our definition side-steps the complexities of regulation and transcription by removing the former altogether from the definition and arguing that final, functional gene products (rather than intermediate transcripts) should be used to group together entities associated with a single gene. It also manifests how integral the concept of biological function is in defining genes.

  5. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    induced by exogenous abscisic acid (ABA) and also by salinity, cold and heat to some extent. Overexpression of the. AdZFP1 gene in ... For heat treatment, plants were incubated in sealed flasks at 37ºC for 1, 3, 6, 12 and 24 .... After drying in an oven, the samples were weighed again. The percentage of moisture in the soil ...

  6. Asthma susceptible genes in Chinese population: A meta-analysis

    Directory of Open Access Journals (Sweden)

    He Chao

    2010-09-01

    Full Text Available Abstract Background Published data regarding the associations between genetic variants and asthma risk in Chinese population were inconclusive. The aim of this study was to investigate asthma susceptible genes in Chinese population. Methods The authors conducted 18 meta-analyzes for 18 polymorphisms in 13 genes from eighty-two publications. Results Seven polymorphisms were found being associated with risk of asthma, namely: A Disintegrin and Metalloprotease 33 (ADAM33 T1-C/T (odds ratio [OR] = 6.07, 95% confidence interval [CI]: 2.69-13.73, Angiotensin-Converting Enzyme (ACE D/I (OR = 3.85, 95%CI: 2.49-5.94, High-affinity IgE receptor β chain (FcεRIβ -6843G/A (OR = 1.49, 95%CI: 1.01-2.22, Interleukin 13(IL-13 -1923C/T (OR = 2.99, 95%CI: 2.12-4.24, IL-13 -2044A/G (OR = 1.49, 95%CI: 1.07-2.08, Regulated upon Activation, Normal T cell Expressed and Secreted (RANTES -28C/G (OR = 1.64, 95%CI: 1.09-2.46, Tumor Necrosis Factor-α (TNF-α -308G/A(OR = 1.42, 95%CI: 1.09, 1.85. After subgroup analysis by age, the ACE D/I, β2-Adrenergic Receptor (β2-AR -79G/C, TNF-α -308G/A, Interleukin 4 receptor(IL-4R -1902G/A and IL-13 -1923C/T polymorphisms were found significantly associated with asthma risk in Chinese children. In addition, the ACE D/I, FcεRIβ -6843G/A, TNF-α -308G/A, IL-13 -1923C/T and IL-13 -2044A/G polymorphisms were associated with asthma risk in Chinese adults. Conclusion ADAM33, FcεRIβ, RANTES, TNF-α, ACE, β2-AR, IL-4R and IL-13 genes could be proposed as asthma susceptible genes in Chinese population. Given the limited number of studies, more data are required to validate these associations.

  7. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque...... strains harboring the rpiA gene in a multicopy plasmid contained up to 42-fold as much ribose phosphate isomerase A activity as the haploid strain....

  8. Genetic and Functional Evidence Supports LPAR1 as a Susceptibility Gene for Hypertension.

    Science.gov (United States)

    Xu, Ke; Ma, Lu; Li, Yang; Wang, Fang; Zheng, Gu-Yan; Sun, Zhijun; Jiang, Feng; Chen, Yundai; Liu, Huirong; Dang, Aimin; Chen, Xi; Chun, Jerold; Tian, Xiao-Li

    2015-09-01

    Essential hypertension is a complex disease affected by genetic and environmental factors and serves as a major risk factor for cardiovascular diseases. Serum lysophosphatidic acid correlates with an elevated blood pressure in rats, and lysophosphatidic acid interacts with 6 subtypes of receptors. In this study, we assessed the genetic association of lysophosphatidic acid receptors with essential hypertension by genotyping 28 single-nucleotide polymorphisms from genes encoding for lysophosphatidic acid receptors, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, and LPAR6 and their flanking sequences, in 3 Han Chinese cohorts consisting of 2630 patients and 3171 controls in total. We identified a single-nucleotide polymorphism, rs531003 in the 3'-flanking genomic region of LPAR1, associated with hypertension (the Bonferroni corrected P=1.09×10(-5), odds ratio [95% confidence interval]=1.23 [1.13-1.33]). The risk allele C of rs531003 is associated with the increased expression of LPAR1 and the susceptibility of hypertension, particularly in those with a shortage of sleep (P=4.73×10(-5), odds ratio [95% confidence interval]=1.75 [1.34-2.28]). We further demonstrated that blood pressure elevation caused by sleep deprivation and phenylephrine-induced vasoconstriction was both diminished in LPAR1-deficient mice. Together, we show that LPAR1 is a novel susceptibility gene for human essential hypertension and that stress, such as shortage of sleep, increases the susceptibility of patients with risk allele to essential hypertension. © 2015 American Heart Association, Inc.

  9. Evaluation of biofilm production and characterization of genes encoding type III secretion system among Pseudomonas aeruginosa isolated from burn patients.

    Science.gov (United States)

    Jabalameli, Fereshteh; Mirsalehian, Akbar; Khoramian, Babak; Aligholi, Marzieh; Khoramrooz, Seyed Sajjad; Asadollahi, Parisa; Taherikalani, Morovat; Emaneini, Mohammad

    2012-12-01

    Pseudomonas aeruginosa is one of the common pathogenic causes of serious infections in burn patients throughout the world. Type III secretion toxins are thought to promote the dissemination of P. aeruginosa from the site of infection, the bacterial evasion of the host immune response and inhibition of DNA synthesis leading to host cell death. A total of 96 isolates of P. aeruginosa were collected from wound infections of burn patients, from April to July 2010. Antimicrobial susceptibility of the isolates were determined by disk agar diffusion method. Polymerase chain reaction (PCR)-based method was used for targeting the genes encoding the type III secretion toxins. The quantitative determination of biofilm-forming capacity was determined by a colorimetric microtiter plate assay. All the isolates were resistant to cefixime and ceftriaxone. More than 90% of the isolates were resistant to amikacin, carbenicillin, cefepime, cefotaxime, cefpodoxime, gatifloxacin, gentamicin, piperacillin/tazobactam, ticarcillin and tobramycin. All the isolates carried the exoT gene, 95% carried exoY, 64.5% carried exoU and 29% carried the exoS gene. Most of the isolates (58%) carried both exoY and exoU genes while 24% showed the concomitant presence of exoS and exoY and 1% carried both exoS and exoU. Coexistence of exoS, exoY and exoU was seen in 4% of the isolates. Biofilm formation was seen in more than 96% of the isolates among which 47% were strong biofilm producers, 26% were moderate and 22.9% were weak biofilm formers. In conclusion, the findings of this study show that the genes, particularly the exoU gene, encoding the type III secretion toxins, are commonly disseminated among the P. aeruginosa strains isolated from burn patients. Copyright © 2012 Elsevier Ltd and ISBI. All rights reserved.

  10. Hereditary breast and ovarian cancer susceptibility genes (review).

    Science.gov (United States)

    Kobayashi, Hiroshi; Ohno, Sumire; Sasaki, Yoshikazu; Matsuura, Miyuki

    2013-09-01

    Women with hereditary breast and ovarian cancer (HBOC) syndrome represent a unique group who are diagnosed at a younger age and result in an increased lifetime risk for developing breast, ovarian and other cancers. This review integrates recent progress and insights into the molecular basis that underlie the HBOC syndrome. A review of English language literature was performed by searching MEDLINE published between January 1994 and October 2012. Mutations and common sequence variants in the BRCA1 and BRCA2 (BRCA) genes are responsible for the majority of HBOC syndrome. Lifetime cancer risks in BRCA mutation carriers are 60-80% for breast cancer and 20-40% for ovarian cancer. Mutations in BRCA genes cannot account for all cases of HBOC, indicating that the remaining cases can be attributed to the involvement of constitutive epimutations or other cancer susceptibility genes, which include Fanconi anemia (FA) cluster (FANCD2, FANCA and FANCC), mismatch repair (MMR) cluster (MLH1, MSH2, PMS1, PMS2 and MSH6), DNA repair cluster (ATM, ATR and CHK1/2), and tumor suppressor cluster (TP53, SKT11 and PTEN). Sporadic breast cancers with TP53 mutations or epigenetic silencing (hypermethylation), ER- and PgR-negative status, an earlier age of onset and high tumor grade resemble phenotypically BRCA1 mutated cancers termed 'BRCAness', those with no BRCA mutations but with a dysfunction of the DNA repair system. In conclusion, genetic or epigenetic loss-of-function mutations of genes that are known to be involved in the repair of DNA damage may lead to increased risk of developing a broad spectrum of breast and ovarian cancers.

  11. Gene-Wide Analysis Detects Two New Susceptibility Genes for Alzheimer's Disease

    Science.gov (United States)

    Harold, Denise; Jones, Lesley; Holmans, Peter; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L.; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A.; Naj, Adam C.; Sims, Rebecca; Jun, Gyungah; Bis, Joshua C.; Beecham, Gary W.; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A.; Denning, Nicola; Smith, Albert V.; Chouraki, Vincent; Thomas, Charlene; Ikram, M. Arfan; Zelenika, Diana; Vardarajan, Badri N.; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L.; Vronskaya, Maria; Johnson, Andrew D.; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L.; Buxbaum, Joseph D.; Campion, Dominique; Crane, Paul K.; Baldwin, Clinton; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L.; De Jager, Philip L.; Deramecourt, Vincent; Johnston, Janet A.; Evans, Denis; Lovestone, Simon; Letenneur, Luc; Hernández, Isabel; Rubinsztein, David C.; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M.; Fiévet, Nathalie; Huentelman, Matthew J.; Gill, Michael; Brown, Kristelle; Kamboh, M. Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B.; Myers, Amanda J.; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleo, Alberto; Bayer, Anthony; Tsuang, Debby W.; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick C.; Hardy, John; Naranjo, Maria Candida Deniz; Bosco, Paolo; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Scarpini, Elio; Bonuccelli, Ubaldo; Mancuso, Michelangelo; Siciliano, Gabriele; Moebus, Susanne; Mecocci, Patrizia; Zompo, Maria Del; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Frank-García, Ana; Panza, Francesco; Solfrizzi, Vincenzo; Caffarra, Paolo; Nacmias, Benedetta; Perry, William; Mayhaus, Manuel; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M.; Ingelsson, Martin; Beekly, Duane; Alvarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G.; Coto, Eliecer; Hamilton-Nelson, Kara L.; Gu, Wei; Razquin, Cristina; Pastor, Pau; Mateo, Ignacio; Owen, Michael J.; Faber, Kelley M.; Jonsson, Palmi V.; Combarros, Onofre; O'Donovan, Michael C.; Cantwell, Laura B.; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H.; Bennett, David A.; Harris, Tamara B.; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee F. A. G.; Passmore, Peter; Montine, Thomas J.; Bettens, Karolien; Rotter, Jerome I.; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M.; Kukull, Walter A.; Hannequin, Didier; Powell, John F.; Nalls, Michael A.; Ritchie, Karen; Lunetta, Kathryn L.; Kauwe, John S. K.; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R.; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M.; Graff, Caroline; Psaty, Bruce M.; Haines, Jonathan L.; Lathrop, Mark; Pericak-Vance, Margaret A.; Launer, Lenore J.; Van Broeckhoven, Christine; Farrer, Lindsay A.; van Duijn, Cornelia M.; Ramirez, Alfredo

    2014-01-01

    Background Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls. Principal Findings In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10−6) and 14 (IGHV1-67 p = 7.9×10−8) which indexed novel susceptibility loci. Significance The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease. PMID:24922517

  12. Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Valentina Escott-Price

    Full Text Available Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls.In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6 and 14 (IGHV1-67 p = 7.9×10-8 which indexed novel susceptibility loci.The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

  13. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  14. Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

    Directory of Open Access Journals (Sweden)

    Paula Stewart

    Full Text Available Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE during the bovine spongiform encephalopathy (BSE epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD remains an open question. Variation in the host-encoded prion protein (PrP(C largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo and pine marten (Martes martes were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus and mountain lion (Puma concolor from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

  15. Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

    Science.gov (United States)

    Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A; Arnemo, Jon M; Tryland, Morten; Girling, Simon; Miller, Michael W; Tranulis, Michael A; Goldmann, Wilfred

    2012-01-01

    Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrP(C)) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C) protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

  16. Gene-network analysis identifies susceptibility genes related to glycobiology in autism.

    Directory of Open Access Journals (Sweden)

    Bert van der Zwaag

    Full Text Available The recent identification of copy-number variation in the human genome has opened up new avenues for the discovery of positional candidate genes underlying complex genetic disorders, especially in the field of psychiatric disease. One major challenge that remains is pinpointing the susceptibility genes in the multitude of disease-associated loci. This challenge may be tackled by reconstruction of functional gene-networks from the genes residing in these loci. We applied this approach to autism spectrum disorder (ASD, and identified the copy-number changes in the DNA of 105 ASD patients and 267 healthy individuals with Illumina Humanhap300 Beadchips. Subsequently, we used a human reconstructed gene-network, Prioritizer, to rank candidate genes in the segmental gains and losses in our autism cohort. This analysis highlighted several candidate genes already known to be mutated in cognitive and neuropsychiatric disorders, including RAI1, BRD1, and LARGE. In addition, the LARGE gene was part of a sub-network of seven genes functioning in glycobiology, present in seven copy-number changes specifically identified in autism patients with limited co-morbidity. Three of these seven copy-number changes were de novo in the patients. In autism patients with a complex phenotype and healthy controls no such sub-network was identified. An independent systematic analysis of 13 published autism susceptibility loci supports the involvement of genes related to glycobiology as we also identified the same or similar genes from those loci. Our findings suggest that the occurrence of genomic gains and losses of genes associated with glycobiology are important contributors to the development of ASD.

  17. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    Science.gov (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  18. Characterization of genes encoding poly(A polymerases in plants: evidence for duplication and functional specialization.

    Directory of Open Access Journals (Sweden)

    Lisa R Meeks

    Full Text Available BACKGROUND: Poly(A polymerase is a key enzyme in the machinery that mediates mRNA 3' end formation in eukaryotes. In plants, poly(A polymerases are encoded by modest gene families. To better understand this multiplicity of genes, poly(A polymerase-encoding genes from several other plants, as well as from Selaginella, Physcomitrella, and Chlamydomonas, were studied. METHODOLOGY/PRINCIPAL FINDINGS: Using bioinformatics tools, poly(A polymerase-encoding genes were identified in the genomes of eight species in the plant lineage. Whereas Chlamydomonas reinhardtii was found to possess a single poly(A polymerase gene, other species possessed between two and six possible poly(A polymerase genes. With the exception of four intron-lacking genes, all of the plant poly(A polymerase genes (but not the C. reinhardtii gene possessed almost identical intron positions within the poly(A polymerase coding sequences, suggesting that all plant poly(A polymerase genes derive from a single ancestral gene. The four Arabidopsis poly(A polymerase genes were found to be essential, based on genetic analysis of T-DNA insertion mutants. GFP fusion proteins containing three of the four Arabidopsis poly(A polymerases localized to the nucleus, while one such fusion protein was localized in the cytoplasm. The fact that this latter protein is largely pollen-specific suggests that it has important roles in male gametogenesis. CONCLUSIONS/SIGNIFICANCE: Our results indicate that poly(A polymerase genes have expanded from a single ancestral gene by a series of duplication events during the evolution of higher plants, and that individual members have undergone sorts of functional specialization so as to render them essential for plant growth and development. Perhaps the most interesting of the plant poly(A polymerases is a novel cytoplasmic poly(A polymerase that is expressed in pollen in Arabidopsis; this is reminiscent of spermatocyte-specific cytoplasmic poly(A polymerases in

  19. Identification and characterization of MFA1, the gene encoding Candida albicans a-factor pheromone.

    Science.gov (United States)

    Dignard, Daniel; El-Naggar, Ahmed L; Logue, Mary E; Butler, Geraldine; Whiteway, Malcolm

    2007-03-01

    In the opaque state, MTLa and MTLalpha strains of Candida albicans are able to mate, and this mating is directed by a pheromone-mediated signaling process. We have used comparisons of genome sequences to identify a C. albicans gene encoding a candidate a-specific mating factor. This gene is conserved in Candida dubliniensis and is similar to a three-gene family in the related fungus Candida parapsilosis but has extremely limited similarity to the Saccharomyces cerevisiae MFA1 (ScMFA1) and ScMFA2 genes. All these genes encode C-terminal CAAX box motifs characteristic of prenylated proteins. The C. albicans gene, designated CaMFA1, is found on chromosome 2 between ORF19.2165 and ORF19.2219. MFA1 encodes an open reading frame of 42 amino acids that is predicted to be processed to a 14-amino-acid prenylated mature pheromone. Microarray analysis shows that MFA1 is poorly expressed in opaque MTLa cells but is induced when the cells are treated with alpha-factor. Disruption of this C. albicans gene blocks the mating of MTLa cells but not MTLalpha cells, while the reintegration of the gene suppresses this cell-type-specific mating defect.

  20. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  1. Candidate chromosome 1 disease susceptibility genes for Sjogren’s syndrome xerostomia are narrowed by novel NOD.B10 congenic mice

    Science.gov (United States)

    Mongini, Patricia K. A.; Kramer, Jill M.; Ishikawa, Tomo-o; Herschman, Harvey; Esposito, Donna

    2014-01-01

    Sjogren’s syndrome (SS) is characterized by salivary gland leukocytic infiltrates and impaired salivation (xerostomia). Cox-2 (Ptgs2) is located on chromosome 1 within the span of the Aec2 region. In an attempt to demonstrate that COX-2 drives antibody-dependent hyposalivation, NOD.B10 congenic mice bearing a Cox-2flox gene were generated. A congenic line with non-NOD alleles in Cox-2-flanking genes failed manifest xerostomia. Further backcrossing yielded disease-susceptible NOD.B10 Cox-2flox lines; fine genetic mapping determined that critical Aec2 genes lie within a 1.56 to 2.17 Mb span of DNA downstream of Cox-2. Bioinformatics analysis revealed that susceptible and non-susceptible lines exhibit non-synonymous coding SNPs in 8 protein-encoding genes of this region, thereby better delineating candidate Aec2 alleles needed for SS xerostomia. PMID:24685748

  2. PREVALENCE OF TOXIN ENCODING GENES IN ESCHERICHIACOLI ISOLATES FROM URINARY TRACT INFECTIONS INSLOVENIA

    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec

    2008-06-01

    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  3. Susceptibility genes for osteoporotic fracture in postmenopausal Chinese women.

    Science.gov (United States)

    Wang, Chun; Zhang, Zeng; Zhang, Hao; He, Jin-Wei; Gu, Jie-Mei; Hu, Wei-Wei; Hu, Yun-Qiu; Li, Miao; Liu, Yu-Juan; Fu, Wen-Zhen; Yue, Hua; Ke, Yao-Hua; Zhang, Zhen-Lin

    2012-12-01

    To identify the susceptibility genes for osteoporotic fracture in postmenopausal Chinese women, a two-stage case-control association study using joint analysis was conducted in 1046 patients with nontraumatic vertebra, hip, or distal radius fractures and 2303 healthy controls. First, 113 single-nucleotide polymorphisms (SNPs) in 16 potential osteoporosis candidate genes reported in recent genomewide association studies, meta-analyses studies, large-scale association studies, and functional studies were genotyped in a small-sample-size subgroup consisting of 541 patients with osteoporotic fractures and 554 healthy controls. Variants and haplotypes in SPTBN1, TNFRSF11B, CNR2, LRP4, and ESR1 that have been identified as being associated with osteoporotic fractures were further reanalyzed in the entire case-control group. We identified one SNP in TNFRSF11B (rs3102734), three SNPs in ESR1 (rs9397448, rs2234693, and rs1643821), two SNPs in LRP4 (rs17790156 and rs898604), and four SNPs in SPTBN1 (rs2971886, rs2941583, rs2941584, and rs12475342) were associated with all of the broadly defined osteoporotic fractures. The most significant polymorphism was rs3102734, with increased risk of osteoporotic fractures (odds ratio, 1.35; 95% confidence interval [CI], 1.17-1.55, Bonferroni p = 2.6 × 10(-4) ). Furthermore, rs3102734, rs2941584, rs12475342, rs9397448, rs2234693, and rs898604 exhibited significant allelic, genotypic, and/or haplotypic associations with vertebral fractures. SNPs rs12475342, rs9397448, and rs2234693 showed significant genotypic associations with hip fractures, whereas rs3102734, rs2073617, rs1643821, rs12475342, and rs2971886 exhibited significant genotypic and/or haplotypic associations with distal radius fractures. Accordingly, we suggest that in addition to the clinical risk factors, the variants in TNFRSF11B, SPTBN1, ESR1, and LRP4 are susceptibility genetic loci for osteoporotic fracture in postmenopausal Chinese women. Copyright © 2012

  4. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    Science.gov (United States)

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran

    2011-01-01

    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  5. Allele variations in the OCA2 gene (pink-eyed-dilution locus) are associated with genetic susceptibility to melanoma.

    Science.gov (United States)

    Jannot, Anne-Sophie; Meziani, Roubila; Bertrand, Guylene; Gérard, Benedicte; Descamps, Vincent; Archimbaud, Alain; Picard, Catherine; Ollivaud, Laurence; Basset-Seguin, Nicole; Kerob, Delphine; Lanternier, Guy; Lebbe, Celeste; Saiag, P; Crickx, Beatrice; Clerget-Darpoux, Françoise; Grandchamp, Bernard; Soufir, Nadem; Melan-Cohort

    2005-08-01

    The occuloalbinism 2 (OCA2) gene, localized at 15q11, encodes a melanosomal transmembrane protein that is involved in the most common form of human occulo-cutaneous albinism, a human genetic disorder characterized by fair pigmentation and susceptibility to skin cancer. We wondered whether allele variations at this locus could influence susceptibility to malignant melanoma (MM). In all, 10 intragenic single-nucleotide polymorphisms (SNPs) were genotyped in 113 patients with melanomas and in 105 Caucasian control subjects with no personal or family history of skin cancer. By comparing allelic distribution between cases and controls, we show that MM and OCA2 are associated (p value=0.030 after correction for multiple testing). Then, a recently developed strategy, the 'combination test' enabled us to show that a combination formed by two SNPs was most strongly associated to MM, suggesting a possible interaction between intragenic SNPs. In addition, the role of OCA2 on MM risk was also detected using a logistic model taking into account the presence of variants of the melanocortin 1 receptor gene (MC1R, a key pigmentation gene) and all pigmentation characteristics as melanoma risk factors. Our data demonstrate that a second pigmentation gene, in addition to MC1R, is involved in genetic susceptibility to melanoma.

  6. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    Full Text Available BACKGROUND: The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression. METHODOLOGY/PRINCIPAL FINDINGS: Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6. CONCLUSIONS: Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  7. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information.

    Science.gov (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang

    2017-01-01

    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  8. The rnhB gene encoding RNase HII of Streptococcus pneumoniae and evidence of conserved motifs in eucaryotic genes.

    Science.gov (United States)

    Zhang, Y B; Ayalew, S; Lacks, S A

    1997-06-01

    A single RNase H enzyme was detected in extracts of Streptococcus pneumoniae. The gene encoding this enzyme was cloned and expressed in Escherichia coli, as demonstrated by its ability to complement a double-mutant rnhA recC strain. Sequence analysis of the cloned DNA revealed an open reading frame of 290 codons that encodes a polypeptide of 31.9 kDa. The predicted protein exhibits a low level of homology (19% identity of amino acid residues) to RNase HII encoded by rnhB of E. coli. Identification of the S. pneumoniae RNase HII translation start site by amino-terminal sequencing of the protein and of mRNA start sites by primer extension with reverse transcriptase showed that the major transcript encoding rnhB begins at the protein start site. Comparison of the S. pneumoniae and E. coli RNase HII sequences and sequences of other, putative bacterial rnhB gene products surmised from sequencing data revealed three conserved motifs. Use of these motifs to search for homologous genes in eucaryotes demonstrated the presence of rnhB genes in a yeast and a roundworm. Partial rnhB gene sequences were detected among expressed sequences of mouse and human cells. From these data, it appears that RNase HII is universally present in living cells.

  9. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  10. DNA Immunization with the Gene Encoding P4 Nuclease of Leishmania amazonensis Protects Mice against Cutaneous Leishmaniasis

    Science.gov (United States)

    Campbell, Kimberly; Diao, Hong; Ji, Jiaxiang; Soong, Lynn

    2003-01-01

    Infection with the protozoan parasite Leishmania amazonensis can cause diverse clinical forms of leishmaniasis. Immunization with purified P4 nuclease protein has been shown to elicit a protective response in mice challenged with L. amazonensis and L. pifanoi. To explore the potential of a DNA-based vaccine, we tested the L. amazonensis gene encoding P4 nuclease as well as adjuvant constructs encoding murine interleukin-12 (IL-12) and L. amazonensis HSP70. Susceptible BALB/c mice were immunized with the DNA encoding P4 alone, P4/IL-12, or P4/HSP70 prior to challenge with L. amazonensis promastigotes. Mice given P4/IL-12 exhibited no lesion development and had a 3- to 4-log reduction in tissue parasite burdens compared to controls. This protection corresponded to significant increases in gamma interferon and tumor necrosis factor alpha production and a reduction in parasite-specific immunoglobulin G1, suggesting an enhancement in Th1 responses. Moreover, we immunized mice with the L. amazonensis vaccines to determine if this vaccine regimen could provide cross-protection against a genetically diverse species, L. major. While the P4/HSP70 vaccine led to self-healing lesions, the P4/IL-12 vaccine provided negligible protection against L. major infection. This is the first report of successful use of a DNA vaccine to induce protection against L. amazonensis infection. Additionally, our results indicate that different vaccine combinations, including DNA encoding P4, HSP70, or IL-12, can provide significant protection against both Old World and New World cutaneous leishmaniasis. PMID:14573646

  11. NAT gene polymorphisms and susceptibility to Alzheimer's disease: identification of a novel NAT1 allelic variant

    Directory of Open Access Journals (Sweden)

    Budge Marc

    2004-03-01

    Full Text Available Abstract Background Alzheimer's disease is multifactorial, having environmental, toxicological and genetic risk factors. Impaired folate and homocysteine metabolism has been hypothesised to increase risk. In addition to its xenobiotic-metabolising capacity, human arylamine N-acetyltransferase type-1 (NAT1 acetylates the folate catabolite para-aminobenzoylglutamate and is implicated in folate metabolism. The purpose of this study was to determine whether polymorphisms in the human NAT genes influence susceptibility to Alzheimer's disease. Methods Elderly individuals with and without Alzheimer's disease were genotyped at the polymorphic NAT1 (147 cases; 111 controls and NAT2 (45 cases; 63 controls loci by polymerase chain reaction-restriction fragment length polymorphism, and the genotype and allele frequencies were compared using the chi-squared test. Results Although a trend towards fast NAT2 acetylator-associated Alzheimer's disease susceptibility was indicated and the NAT1*10/1*10 genotype was observed only in cases of Alzheimer's disease (6/147, 4.1%, no significant difference in the frequency of NAT2 (p = 0.835 or NAT1 (p = 0.371 genotypes was observed between cases and controls. In addition, a novel NAT1 variant, NAT1*11B, was identified. Conclusions These results suggest that genetic polymorphisms in NAT1 and NAT2 do not influence susceptibility to Alzheimer's disease, although the increase in frequency of the NAT1*10 allele in Alzheimer's disease is worthy of further investigation. Due to its similarity with the NAT1*11A allele, NAT1*11B is likely to encode an enzyme with reduced NAT1 activity.

  12. CELSR2 is a candidate susceptibility gene in idiopathic scoliosis.

    Science.gov (United States)

    Einarsdottir, Elisabet; Grauers, Anna; Wang, Jingwen; Jiao, Hong; Escher, Stefan A; Danielsson, Aina; Simony, Ane; Andersen, Mikkel; Christensen, Steen Bach; Åkesson, Kristina; Kou, Ikuyo; Khanshour, Anas M; Ohlin, Acke; Wise, Carol; Ikegawa, Shiro; Kere, Juha; Gerdhem, Paul

    2017-01-01

    A Swedish pedigree with an autosomal dominant inheritance of idiopathic scoliosis was initially studied by genetic linkage analysis, prioritising genomic regions for further analysis. This revealed a locus on chromosome 1 with a putative risk haplotype shared by all affected individuals. Two affected individuals were subsequently exome-sequenced, identifying a rare, non-synonymous variant in the CELSR2 gene. This variant is rs141489111, a c.G6859A change in exon 21 (NM_001408), leading to a predicted p.V2287I (NP_001399.1) change. This variant was found in all affected members of the pedigree, but showed reduced penetrance. Analysis of tagging variants in CELSR1-3 in a set of 1739 Swedish-Danish scoliosis cases and 1812 controls revealed significant association (p = 0.0001) to rs2281894, a common synonymous variant in CELSR2. This association was not replicated in case-control cohorts from Japan and the US. No association was found to variants in CELSR1 or CELSR3. Our findings suggest a rare variant in CELSR2 as causative for idiopathic scoliosis in a family with dominant segregation and further highlight common variation in CELSR2 in general susceptibility to idiopathic scoliosis in the Swedish-Danish population. Both variants are located in the highly conserved GAIN protein domain, which is necessary for the auto-proteolysis of CELSR2, suggesting its functional importance.

  13. The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis

    DEFF Research Database (Denmark)

    Schwientek, Tilo; Keck, Birgit; Levery, Steven B

    2002-01-01

    The Drosophila genes fringe and brainiac exhibit sequence similarities to glycosyltransferases. Drosophila and mammalian fringe homologs encode UDP-N-acetylglucosamine:fucose-O-Ser beta1,3-N-acetylglucosaminyltransferases that modulate the function of Notch family receptors. The biological functi...

  14. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-o...... glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica....

  15. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Spleen lymphocytes of rats were transfected with the lentiviral vector system encoding FasL gene and 5 days later were induced by doxycycline for 24 h, followed by detection of FasL mRNA. The apoptosis index of Th1 cells was measured through both Annexin V-FITC flow cytometry and TUNEL. Additionally flow cytometry ...

  16. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    1990-01-01

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  17. Mutations in genes encoding subunits of RNA polymerases I and III cause Treacher Collins syndrome.

    NARCIS (Netherlands)

    Dauwerse, J.G.; Dixon, J.; Seland, S.; Ruivenkamp, C.A.; Haeringen, A. van; Hoefsloot, L.H.; Peters, D.J.; Boers, A.C.; Daumer-Haas, C.; Maiwald, R.; Zweier, C.; Kerr, B.; Cobo, A.M.; Toral, J.F.; Hoogeboom, A.J.M.; Lohmann, D.R.; Hehr, U.; Dixon, M.J.; Breuning, M.H.; Wieczorek, D.

    2011-01-01

    We identified a deletion of a gene encoding a subunit of RNA polymerases I and III, POLR1D, in an individual with Treacher Collins syndrome (TCS). Subsequently, we detected 20 additional heterozygous mutations of POLR1D in 252 individuals with TCS. Furthermore, we discovered mutations in both

  18. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.

    2012-01-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  19. Erratum Genomewide analysis of NBS-encoding genes in kiwi fruit ...

    Indian Academy of Sciences (India)

    c Indian Academy of Sciences. Erratum. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia chinensis). Yingjun Li, Yan Zhong, Kaihui Huang and Zong-Ming Cheng. J. Genet. 95, 997–1001. The following statement in the footnote of the first page is missing in the published version of the above article.

  20. Phenotypical Manifestations of Mutations in the Genes Encoding Subunits of the Cardiac Sodium Channel

    NARCIS (Netherlands)

    Wilde, Arthur A. M.; Brugada, Ramon

    2011-01-01

    Variations in the gene encoding for the major sodium channel (Na(v)1.5) in the heart, SCN5A, has been shown to cause a number of arrhythmia syndromes (with or without structural changes in the myocardium), including the long-QT syndrome (type 3), Brugada syndrome, (progressive) cardiac conduction

  1. Characterization of the BMR1 gene encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae.

    Science.gov (United States)

    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Tanaka, Chihiro; Ueno, Makoto; Arase, Sakae

    2008-04-01

    We isolated and characterized Bipolaris melanin regulation 1 gene (BMR1) encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. Sequence analysis showed that the BMR1 gene encodes a putative protein of 1012 amino acids that has 99% sequence similarity to transcription factor Cmr1 of Cochliobolus heterostrophus. The predicted B. oryzae Bmr1 protein has two DNA-binding motifs, two Cys2His2 zinc finger domains, and a Zn(II)2Cys6 binuclear cluster domain at the N-terminal region of Bmr1. Targeted disruption of the BMR1 gene showed that BMR1 is essential for melanin biosynthesis in B. oryzae. The overexpression of the BMR1 gene led to more dark colonies than in the wild-type strain under dark conditions. Real-time PCR analysis showed that the BMR1 expression of the overexpression transformant was about 10-fold that of the wild type under dark conditions and of the expression of three melanin biosynthesis genes. These results indicated that BMR1 encodes the transcription factor of melanin biosynthesis genes in B. oryzae.

  2. High Frequency of Interactions between Lung Cancer Susceptibility Genes in the Mouse : Mapping of Sluc5 to Sluc14

    NARCIS (Netherlands)

    Fijneman, Remond J.A.; Jansen, Ritsert C.; Valk, Martin A. van der; Demant, Peter

    1998-01-01

    Although several genes that cause monogenic familial cancer syndromes have been identified, susceptibility to sporadic cancer remains unresolved. Animal experiments have demonstrated multigenic control of tumor susceptibility. Recently, we described four mouse lung cancer susceptibility (Sluc) loci,

  3. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  4. Distribution of cphA or related carbapenemase-encoding genes and production of carbapenemase activity in members of the genus Aeromonas.

    Science.gov (United States)

    Rossolini, G M; Zanchi, A; Chiesurin, A; Amicosante, G; Satta, G; Guglielmetti, P

    1995-02-01

    The prevalence of the cphA gene or related carbapenemase-encoding genes was investigated in 114 Aeromonas strains belonging to the six species of major clinical interest. A species-related distribution of cphA-related sequences was observed. Similar sequences were found in A. hydrophila, A. veronii bv. sobria, A. veronii bv. veronii, and A. jandaei, but not in A. caviae, A. trota, or A. schubertii. However, a single A. caviae strain (of 62 tested) was found carrying cphA-related sequences, suggesting the possibility of the horizontal transfer of this gene to species which normally do not carry it. Production of carbapenemase activity was detectable in 83% of the hybridization-positive strains but in none of the hybridization-negative ones. When it was present, carbapenemase activity was always inhibitable by EDTA. Either carbapenemase-producing or not, Aeromonas strains appeared to be susceptible to imipenem when in vitro susceptibility testing was performed with inocula of conventional size (10(5) CFU), for which MICs were always or = 4 micrograms/ml, being usually higher than the breakpoint for susceptibility. The present results indicate that the production of metallocarbapenemase activity, apparently encoded by cphA homologs, is widespread among some of the Aeromonas species of clinical interest (A. hydrophila, A. veronii bv. sobria, A. veronii bv. veronii, and A. jandaei) and that imipenem MICs for carbapenemase-producing strains are subjected to a relevant inoculum size effect.

  5. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...... at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes......IP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression...

  6. The Circadian Rhythm Gene Arntl2 Is a Metastasis Susceptibility Gene for Estrogen Receptor-Negative Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Ngoc-Han Ha

    2016-09-01

    Full Text Available Breast cancer mortality is primarily due to metastasis rather than primary tumors, yet relatively little is understood regarding the etiology of metastatic breast cancer. Previously, using a mouse genetics approach, we demonstrated that inherited germline polymorphisms contribute to metastatic disease, and that these single nucleotide polymorphisms (SNPs could be used to predict outcome in breast cancer patients. In this study, a backcross between a highly metastatic (FVB/NJ and low metastatic (MOLF/EiJ mouse strain identified Arntl2, a gene encoding a circadian rhythm transcription factor, as a metastasis susceptibility gene associated with progression, specifically in estrogen receptor-negative breast cancer patients. Integrated whole genome sequence analysis with DNase hypersensitivity sites reveals SNPs in the predicted promoter of Arntl2. Using CRISPR/Cas9-mediated substitution of the MOLF promoter, we demonstrate that the SNPs regulate Arntl2 transcription and affect metastatic burden. Finally, analysis of SNPs associated with ARNTL2 expression in human breast cancer patients revealed reproducible associations of ARNTL2 expression quantitative trait loci (eQTL SNPs with disease-free survival, consistent with the mouse studies.

  7. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  8. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  9. Structure and expression of the murine retinoblastoma gene and characterization of its encoded protein

    NARCIS (Netherlands)

    Bernards, R.A.; Schackleford, G.M.; Gerber, M.R.; Horowitz, J.M.; Friend, S.H.; Schartl, M.; Bogenmann, E.; Rapaport, J.M.; McGee, T.; Dryja, T.; Weinberg, R.A.

    1989-01-01

    We have isolated a cDNA clone of the murine homologue of the human retinoblastoma (Rb) susceptibility gene. DNA sequence analysis reveals a high degree of conservation with the human Rb sequence, both in the coding and in the noncoding regions. The predicted amino acid sequence of the mouse Rb

  10. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf...

  11. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  12. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  13. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev

    2014-01-01

    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  14. Nucleotide sequence and characterization of a Bacillus subtilis gene encoding a flagellar switch protein.

    OpenAIRE

    Zuberi, A R; Bischoff, D S; Ordal, G W

    1991-01-01

    The nucleotide sequence of the Bacillus subtilis fliM gene has been determined. This gene encodes a 38-kDa protein that is homologous to the FliM flagellar switch proteins of Escherichia coli and Salmonella typhimurium. Expression of this gene in Che+ cells of E. coli and B. subtilis interferes with normal chemotaxis. The nature of the chemotaxis defect is dependent upon the host used. In B. subtilis, overproduction of FliM generates mostly nonmotile cells. Those cells that are motile switch ...

  15. Comparative study of genes expressed from rice fungus-resistant and susceptible lines during interactions with Magnaporthe oryzae.

    Science.gov (United States)

    Shi, Bu-Jun; Wang, Guo-Liang

    2008-12-31

    Rice blast disease caused by Magnaporthe oryzae is the most important fungal disease of rice. To understand the molecular basis of interaction between the fungus and rice, we constructed a cDNA library from a rice-resistant line inoculated with M. oryzae. One hundred and fifty-three cDNA clones were sequence analyzed, of which 129 exhibited significant nucleotide sequence homology to known genes, 21 were homologous to unknown genes, while three clones did not match to any database. However, these three unmatched clones showed sequence homology at protein level in the protein databases and one of them encoded a disease resistance-related protein kinase and was abundant in the EST collection. Northern analysis showed that this disease resistance-related protein kinase gene was induced by inoculation and only expressed in the rice-resistant, but not susceptible, lines. Southern analysis showed that this gene was present in a single copy in the rice genome and co-segregated with the M. oryzae resistance in the cross of the resistant and susceptible lines. This study illustrates that sequencing of ESTs from inoculated resistant plants can reveal genes responsive to pathogen infection, which could help understand plant defense mechanisms.

  16. Gene expression analysis of endometrium reveals progesterone resistance and candidate susceptibility genes in women with endometriosis.

    Science.gov (United States)

    Burney, Richard O; Talbi, Said; Hamilton, Amy E; Vo, Kim Chi; Nyegaard, Mette; Nezhat, Camran R; Lessey, Bruce A; Giudice, Linda C

    2007-08-01

    The identification of molecular differences in the endometrium of women with endometriosis is an important step toward understanding the pathogenesis of this condition and toward developing novel strategies for the treatment of associated infertility and pain. In this study, we conducted global gene expression analysis of endometrium from women with and without moderate/severe stage endometriosis and compared the gene expression signatures across various phases of the menstrual cycle. The transcriptome analysis revealed molecular dysregulation of the proliferative-to-secretory transition in endometrium of women with endometriosis. Paralleled gene expression analysis of endometrial specimens obtained during the early secretory phase demonstrated a signature of enhanced cellular survival and persistent expression of genes involved in DNA synthesis and cellular mitosis in the setting of endometriosis. Comparative gene expression analysis of progesterone-regulated genes in secretory phase endometrium confirmed the observation of attenuated progesterone response. Additionally, interesting candidate susceptibility genes were identified that may be associated with this disorder, including FOXO1A, MIG6, and CYP26A1. Collectively these findings provide a framework for further investigations on causality and mechanisms underlying attenuated progesterone response in endometrium of women with endometriosis.

  17. Isolation and molecular characterisation of the gene encoding eburicol 14α-demethylase (CYP51) from Penicillium italicum

    NARCIS (Netherlands)

    Nistelrooy, J.G.M. van; Brink, J.M. van den; Kan, J.A.L. van; Gorcom, R.F.M. van; Waard, M.A. de

    1996-01-01

    The CYP51 gene encoding eburicol 14α-demethylase (P450(14DM)) was cloned from a genomic library of the filamentous fungal plant pathogen Penicillium italicum, by heterologous hybridisation with the corresponding gene encoding lanosterol 14α-demethylase from the yeast Candida tropicalis. The

  18. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown to b...

  19. Differential susceptibility to maternal expressed emotion in children with ADHD and their siblings? Investigating plasticity genes, prosocial and antisocial behaviour

    NARCIS (Netherlands)

    Richards, Jennifer S; Hartman, Catharina A; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Arias Vásquez, Alejandro; Buitelaar, Jan K

    The differential susceptibility theory states that children differ in their susceptibility towards environmental experiences, partially due to plasticity genes. Individuals carrying specific variants in such genes will be more disadvantaged in negative but, conversely, more advantaged in positive

  20. Variants within the 5'-flanking regions of bovine milk protein genes: I. κ-casein-encoding gene.

    Science.gov (United States)

    Schild, T A; Wagner, V; Geldermann, H

    1994-09-01

    In order to identify DNA variants within the 5'-flanking region of the bovine κ-casein (κCn)-encoding gene, this area of the gene from 13 cows belonging to seven breeds (Holstein Friesian, Brown Swiss, German Simmental, Jersey, Galloway, Scottish Highland and Ceylon Dwarf Zebu) was analysed. For each individual, about 1 kb of the 5'-flanking region including exon I was amplified by polymerase chain reaction (PCR). The biotinylated PCR product was immobilized on magnetic beads followed by direct bidirectional sequencing using an automated DNA sequencer. Fifteen DNA variants were identified, some of which are located within potential regulatory sites and possibly involved in the expression of the κ-casein encoding gene.

  1. Identification and characterization of the genes encoding carbon monoxide dehydrogenase in Terrabacter carboxydivorans.

    Science.gov (United States)

    Lee, Jae Ho; Park, Sae Woong; Kim, Young Min; Oh, Jeong-Il

    2017-06-01

    Terrabacter carboxydivorans is able to grow aerobically at low concentrations of carbon monoxide (CO) as a sole source of carbon and energy. The genes for carbon monoxide dehydrogenase (CO-DH) were cloned from T. carboxydivorans and analyzed. The operon encoding T. carboxydivorans CO-DH was composed of three structural genes with the transcriptional order of cutB, cutC and cutA, as well as an additional accessory gene (orf4). Phylogenetic analysis of CutA revealed that T. carboxydivorans CO-DH was classified into a group distinct from previously characterized CO-DHs. Expression of antisense RNA for the cutB or cutA gene in T. carboxydivorans led to a decrease in CO-DH activity, confirming that cutBCA genes are the functional genes encoding CO-DH. The CO-DH operon was expressed even in the absence of CO and further inducible by CO. In addition, CO-DH synthesis was increased in the stationary phase compared to the exponential phase during heterotrophic growth on glucose and glycerol. Point mutations of a partially inverted repeat sequence (TCGGA-N6-GCCCA) in the upstream region of the cutB gene almost abolished expression of the CO-DH operon, indicating that the inverted-repeat sequence might be a cis-acting regulatory site for the positive regulation of the CO-DH operon. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  2. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce.

    Science.gov (United States)

    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka

    2011-07-15

    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein

    Energy Technology Data Exchange (ETDEWEB)

    Hickey, E.; Brandon, S.E.; Weber, L.A.; Lloyd, D.

    1989-06-01

    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89/alpha/ and hspio/beta/) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89/alpha/, is induced by the adenovirus E1A gene product. The authors have isolated a human hsp89/alpha/ gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression n a /beta/-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89/alpha/ protein sequence differed from the human hsp89/beta/ sequence reported elsewhere in at least 99 out of the 732 amino acids. Transcription of the hsp89/alpha/ gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycles. hsp89/alpha/ mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells.

  4. [The SNPs analysis of encoding sequence of interacting factor gene in Chinese population].

    Science.gov (United States)

    Li, Jiang; Zhang, Qing-jiong; Xiao, Xue-shan; Li, Jia-zhang; Zhang, Feng-sheng; Li, Shi-qiang; Li, Wei; Li, Tuo; Jia, Xiao-yun; Guo, Li; Guo, Xiang-ming

    2003-10-01

    To screen the variations of TG interacting factor(TGIF) gene in encoding sequence in Chinese high myopia patients and normal controls and to analyze the SNPs of TGIF gene encoding sequence in Chinese population. Genomic DNA was collected from 204 probands with high myopia and 112 unrelated persons without high myopia. The coding sequences of TGIF gene in 316 subjects were analyzed by using exon-by-exon PCR heteroduplex-SSCP analysis and sequencing. There were 3 types of SNP and one single nucleotide mutation in the coding sequence of TGIF gene: IVS-2 nt350 G --> T(36/204), codon140 CCA --> CCG; Pro140Pro codon163 CCG --> CTG;Pro163Leu and codon126 GTG --> GCG; Val126Ala(1/204). The SNPs of codon140 CCA --> CCG and codon163 CCG --> CTG were composed of 3 alleles and 5 genotypes in Chinese population which abide by Hardy-Weinberg law. There was no evidence to prove that mutations in the TGIF gene are responsible for the high myopia in Chinese. Three SNPs of coding sequence TGIF gene in Chinese population abide by Hardy-Weinberg law.

  5. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  6. Organization and expression of the Paramecium caudatum gene encoding nucleosome assembly protein 1.

    Science.gov (United States)

    Nishiyama, N; Sawatsubashi, S; Ishida, M; Yamauchi, K

    2001-12-12

    The complete genomic and partial complementary DNAs encoding the ciliate Paramecium caudatum nucleosome assembly protein 1 (NAP1) have been sequenced. The nap1 gene is situated 1.2 kbp from the hemoglobin (hb) gene, with the 3' end of both genes facing each other. The nap1 gene contains no introns, and encodes a protein of 369 amino acid residues with a calculated molecular weight of 42,627. The P. caudatum NAP1 amino acid sequence shares only 23-27% identity with NAP1 amino acid sequences from other eukaryotes. Although the nap1 transcript was detected in the P. caudatum cells at both the logarithmic and stationary phases, its level increased during the stationary phase. Southern blot analysis and polymerase chain reaction amplification revealed that the P. caudatum macronucleus has a heterogeneous composition at genomic regions around the nap1 gene. The present studies indicate the nap1 and hb genes are closely arranged in the macronucleus with the intergenic region between their sequences heterogeneously composed.

  7. The NCAN gene: schizophrenia susceptibility and cognitive dysfunction

    Directory of Open Access Journals (Sweden)

    Wang P

    2016-11-01

    Full Text Available Peirong Wang,1 Jun Cai,2 Jianliang Ni,1 Jiangtao Zhang,1 Wei Tang,3 Chen Zhang2 1Department of Psychiatry, Tongde Hospital of Zhejiang Province, Hangzhou, Zhejiang, 2Schizophrenia Program, Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine, Shanghai, 3Wenzhou Kangning Hospital, Wenzhou, Zhejiang, People’s Republic of China Background: Cognitive dysfunction has been recognized as a cardinal feature of schizophrenia. Elucidating the neurobiological substrates of cognitive dysfunction in schizophrenia would help identify the underlying mechanism of this disorder. The rs1064395 single nucleotide polymorphism, within the gene encoding neurocan (NCAN, is reported to be associated with schizophrenia in European populations and may influence brain structure in patients with schizophrenia.Methods: In this study, we aimed to explore whether NCAN rs1064395 confers some risk for schizophrenia and cognitive dysfunction in Han Chinese. We recruited 681 patients with schizophrenia and 699 healthy subjects. Two hundred and fifty-four patients were evaluated according to Repeatable Battery for the Assessment of Neuropsychological Status (RBANS.Results: There were no significant differences in genotype or allele distributions of the rs1064395 polymorphism between the schizophrenia and control groups. Patients showed significantly poorer performance than controls on immediate memory, visuospatial skill, language, attention, delayed memory, and total RBANS score. Patients with the A/A or A/G genotype of rs1064395 had lower scores of immediate memory, visuospatial skill, attention, and total RBANS score than those with the G/G genotype. We performed an expression quantitative trait loci analysis and observed a significant association between rs1064395 and NCAN expression in the frontal (P=0.0022, P=0.022 after Bonferroni correction and cerebellar cortex (P=0.0032, P=0.032 after Bonferroni correction.Conclusion: Our findings indicate

  8. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  9. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  10. Identification of Novel Candidate Genes for Early-Onset Colorectal Cancer Susceptibility.

    Directory of Open Access Journals (Sweden)

    Richarda M de Voer

    2016-02-01

    Full Text Available Approximately 25-30% of colorectal cancer (CRC cases are expected to result from a genetic predisposition, but in only 5-10% of these cases highly penetrant germline mutations are found. The remaining CRC heritability is still unexplained, and may be caused by a hitherto-undefined set of rare variants with a moderately penetrant risk. Here we aimed to identify novel risk factors for early-onset CRC using whole-exome sequencing, which was performed on a cohort of CRC individuals (n = 55 with a disease onset before 45 years of age. We searched for genes that were recurrently affected by rare variants (minor allele frequency ≤ 0.001 with potentially damaging effects and, subsequently, re-sequenced the candidate genes in a replication cohort of 174 early-onset or familial CRC individuals. Two functionally relevant genes with low frequency variants with potentially damaging effects, PTPN12 and LRP6, were found in at least three individuals. The protein tyrosine phosphatase PTP-PEST, encoded by PTPN12, is a regulator of cell motility and LRP6 is a component of the WNT-FZD-LRP5-LRP6 complex that triggers WNT signaling. All variants in LRP6 were identified in individuals with an extremely early-onset of the disease (≤30 years of age, and two of the three variants showed increased WNT signaling activity in vitro. In conclusion, we present PTPN12 and LRP6 as novel candidates contributing to the heterogeneous susceptibility to CRC.

  11. Molecular evolution and expression profile of the chemerine encoding gene RARRES2 in baboon and chimpanzee

    OpenAIRE

    González Alvarez, Rafael; Garza Rodríguez, María; DELGADO ENCISO, IVÁN; Treviño Alvarado, Víctor M.; Canales del Castillo, Ricardo.; Martínez De Villarreal, Laura E.; Lugo Trampe, Ángel; Tejero, María E.; Schlabritz Loutsevitch, Natalia E.; Rocha Pizaña, María; Cole, Shelley A.; Reséndez Pérez, Diana; Moises Alvarez, Mario; Comuzzie, Anthony G.; Barrera Saldaña, Hugo A.

    2015-01-01

    Abstract Background Chemerin, encoded by the retinoic acid receptor responder 2 (RARRES2) gene is an adipocytesecreted protein with autocrine/paracrine functions in adipose tissue, metabolism and inflammation with a recently described function in vascular tone regulation, liver, steatosis, etc. This molecule is believed to represent a critical endocrine signal linking obesity to diabetes. There are no data available regarding evolution of RARRES2 in non-human primates and great apes. Expressi...

  12. Identification of genes differentially expressed during interaction of resistant and susceptible apple cultivars (Malus × domestica) with Erwinia amylovora

    Science.gov (United States)

    2010-01-01

    Background The necrogenic enterobacterium, Erwinia amylovora is the causal agent of the fire blight (FB) disease in many Rosaceaespecies, including apple and pear. During the infection process, the bacteria induce an oxidative stress response with kinetics similar to those induced in an incompatible bacteria-plant interaction. No resistance mechanism to E. amylovora in host plants has yet been characterized, recent work has identified some molecular events which occur in resistant and/or susceptible host interaction with E. amylovora: In order to understand the mechanisms that characterize responses to FB, differentially expressed genes were identified by cDNA-AFLP analysis in resistant and susceptible apple genotypes after inoculation with E. amylovora. Results cDNA were isolated from M.26 (susceptible) and G.41 (resistant) apple tissues collected 2 h and 48 h after challenge with a virulent E. amylovora strain or mock (buffer) inoculated. To identify differentially expressed transcripts, electrophoretic banding patterns were obtained from cDNAs. In the AFLP experiments, M.26 and G.41 showed different patterns of expression, including genes specifically induced, not induced, or repressed by E. amylovora. In total, 190 ESTs differentially expressed between M.26 and G.41 were identified using 42 pairs of AFLP primers. cDNA-AFLP analysis of global EST expression in a resistant and a susceptible apple genotype identified different major classes of genes. EST sequencing data showed that genes linked to resistance, encoding proteins involved in recognition, signaling, defense and apoptosis, were modulated by E. amylovora in its host plant. The expression time course of some of these ESTs selected via a bioinformatic analysis has been characterized. Conclusion These data are being used to develop hypotheses of resistance or susceptibility mechanisms in Malus to E. amylovora and provide an initial categorization of genes possibly involved in recognition events, early

  13. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  14. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    Science.gov (United States)

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is , the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.

  15. Common alleles in candidate susceptibility genes associated with risk and development of epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Notaridou, Maria; Quaye, Lydia; Dafou, Dimitra

    2011-01-01

    Common germline genetic variation in the population is associated with susceptibility to epithelial ovarian cancer. Microcell-mediated chromosome transfer and expression microarray analysis identified nine genes associated with functional suppression of tumorogenicity in ovarian cancer cell lines...

  16. The Nuclear Death Domain Protein p84N5; a Candidate Breast Cancer Susceptibility Gene

    National Research Council Canada - National Science Library

    Godwin, Andrew

    2004-01-01

    ...% of all cases of breast cancer exhibit a familial pattern of incidence. Efforts to identify the genetic basis of familial breast cancer reached fruition some years ago, when the breast-cancer susceptibility genes, BRCAl and BRCA2 were identified...

  17. The Nuclear Death Domain Protein p84N5; a Candidate Breast Cancer Susceptibility Gene

    National Research Council Canada - National Science Library

    Godwin, Andrew

    2005-01-01

    ...% of all cases of breast cancer exhibit a familial pattern of incidence. Efforts to identify the genetic basis of familial breast cancer reached fruition some years ago, when the breast cancer susceptibility genes, BRCA1 and BRCA2 were identified...

  18. TMpcp: a Tuber magnatum gene which encodes a putative mitochondrial phosphate carrier.

    Science.gov (United States)

    Garnero, L; Bonfante, P

    2000-01-01

    Little is known about the genome of Tuber, Ascomycetes which comprise a number of ectomycorrhizal species. Screening of a genomic library of Tuber magnatum led to identification of a chitin synthase gene (chs). On sequencing upstream of it in the same phage, we found a 2000 bp long fragment that proved to contain a hypothetical gene with high homology with mitochondrial phosphate carriers from human and bovine heart, and from Saccharomyces cerevisiae. The sequence contains two putative introns and its open reading frame encodes for a protein 305 amino acids long. A primary sequence analysis revealed 6 hydrophobic segments and a signature pattern, similar to that of other mitochondrial carriers.

  19. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne

    1997-01-01

    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  20. Susceptibility to Aminoglycosides and Distribution of aph and aac(3)-XI Genes among Corynebacterium striatum Clinical Isolates.

    Science.gov (United States)

    Navas, Jesús; Fernández-Martínez, Marta; Salas, Carlos; Cano, María Eliecer; Martínez-Martínez, Luis

    2016-01-01

    Corynebacterium striatum is an opportunistic pathogen, often multidrug-resistant, which has been associated with serious infections in humans. Aminoglycosides are second-line or complementary antibiotics used for the treatment of Corynebacterium infections. We investigated the susceptibility to six aminoglycosides and the molecular mechanisms involved in aminoglycoside resistance in a collection of 64 Corynebacterium striatum isolated in our laboratory during the period 2005-2009. Antimicrobial susceptibility was determined using E-test. The mechanisms of aminoglycoside resistance were investigated by PCR and sequencing. The 64 C. striatum were assessed for the possibility of clonal spreading by Pulsed-field Gel Electrophoresis (PFGE). Netilmicin and amikacin were active against the 64 C. striatum isolates (MICs90 = 0.38 and 0.5 mg/L, respectively). Twenty-seven of the 64 C. striatum strains showed a MIC90 for kanamycin > 256 mg/L, and 26 out the 27 were positive for the aph(3')-Ic gene. Thirty-six out of our 64 C. striatum were streptomycin resistant, and 23 out of the 36 carried both the aph(3")-Ib and aph(6)-Id genes. The gene aac(3)-XI encoding a new aminoglycoside 3-N acetyl transferase from C. striatum was present in 44 out of the 64 isolates, all of them showing MICs of gentamicin and tobramycin > 1 mg/L. CS4933, a C. striatum showing very low susceptibility to kanamycin and streptomycin, contains an aminoglycoside resistance region that includes the aph(3')-Ic gene, and the tandem of genes aph(3")-Ib and aph(6)-Id. Forty-six major PFGE types were identified among the 64 C. striatum isolates, indicating that they were mainly not clonal. Our results showed that the 64 clinical C. striatum were highly resistant to aminoglycosides and mostly unrelated.

  1. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  2. Two homologous low-temperature-inducible genes from Arabidopsis encode highly hydrophobic proteins.

    Science.gov (United States)

    Capel, J; Jarillo, J A; Salinas, J; Martínez-Zapater, J M

    1997-10-01

    We have characterized two related cDNAs (RCI2A and RCI2B) corresponding to genes from Arabidopsis thaliana, the expression of which is transiently induced by low, nonfreezing temperatures. RCI2A and RCI2B encode small (54 amino acids), highly hydrophobic proteins that bear two potential transmembrane domains. They show similarity to proteins encoded by genes from barley (Hordeum vulgare L.) and wheatgrass (Lophophyrum elongatum) that are regulated by different stress conditions. Their high level of sequence homology (78%) and their genomic location in a single restriction fragment suggest that both genes originated as a result of a tandem duplication. However, their regulatory sequences have diverged enough to confer on them different expression patterns. Like most of the cold-inducible plant genes characterized, the expression of RCI2A and RCI2B is also promoted by abscisic acid (ABA) and dehydration but is not a general response to stress conditions, since it is not induced by salt stress or by anaerobiosis. Furthermore, low temperatures are able to induce RCI2A and RCI2B expression in ABA-deficient and -insensitive genetic backgrounds, indicating that both ABA-dependent and -independent pathways regulate the low-temperature responsiveness of these two genes.

  3. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  4. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene.

    Science.gov (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de

    2012-02-01

    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  5. Genome-wide transcriptome directed pathway analysis of maternal pre-eclampsia susceptibility genes.

    Directory of Open Access Journals (Sweden)

    Hannah E J Yong

    Full Text Available Preeclampsia (PE is a serious hypertensive pregnancy disorder with a significant genetic component. Numerous genetic studies, including our own, have yielded many susceptibility genes from distinct functional groups. Additionally, transcriptome profiling of tissues at the maternal-fetal interface has likewise yielded many differentially expressed genes. Often there is little overlap between these two approaches, although genes identified in both approaches are significantly associated with PE. We have thus taken a novel integrative bioinformatics approach of analysing pathways common to the susceptibility genes and the PE transcriptome.Using Illumina Human Ht12v4 and Wg6v3 BeadChips, transcriptome profiling was conducted on n = 65 normotensive and n = 60 PE decidua basalis tissues collected at delivery. The R software package libraries lumi and limma were used to preprocess transcript data for pathway analysis. Pathways were analysed and constructed using Pathway Studio. We examined ten candidate genes, which are from these functional groups: activin/inhibin signalling-ACVR1, ACVR1C, ACVR2A, INHA, INHBB; structural components-COL4A1, COL4A2 and M1 family aminopeptidases-ERAP1, ERAP2 and LNPEP.Major common regulators/targets of these susceptibility genes identified were AGT, IFNG, IL6, INHBA, SERPINE1, TGFB1 and VEGFA. The top two categories of pathways associated with the susceptibility genes, which were significantly altered in the PE decidual transcriptome, were apoptosis and cell signaling (p < 0.001. Thus, susceptibility genes from distinct functional groups share similar downstream pathways through common regulators/targets, some of which are altered in PE. This study contributes to a better understanding of how susceptibility genes may interact in the development of PE. With this knowledge, more targeted functional analyses of PE susceptibility genes in these key pathways can be performed to examine their contributions to the pathogenesis

  6. A putative gene cluster from a Lyngbya wollei bloom that encodes paralytic shellfish toxin biosynthesis.

    Directory of Open Access Journals (Sweden)

    Troco K Mihali

    Full Text Available Saxitoxin and its analogs cause the paralytic shellfish-poisoning syndrome, adversely affecting human health and coastal shellfish industries worldwide. Here we report the isolation, sequencing, annotation, and predicted pathway of the saxitoxin biosynthetic gene cluster in the cyanobacterium Lyngbya wollei. The gene cluster spans 36 kb and encodes enzymes for the biosynthesis and export of the toxins. The Lyngbya wollei saxitoxin gene cluster differs from previously identified saxitoxin clusters as it contains genes that are unique to this cluster, whereby the carbamoyltransferase is truncated and replaced by an acyltransferase, explaining the unique toxin profile presented by Lyngbya wollei. These findings will enable the creation of toxin probes, for water monitoring purposes, as well as proof-of-concept for the combinatorial biosynthesis of these natural occurring alkaloids for the production of novel, biologically active compounds.

  7. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  8. The basis for rootstock resilient to Capnodis species: screening for genes encoding δ-endotoxins from Bacillus thuringiensis.

    Science.gov (United States)

    Gindin, Galina; Mendel, Zvi; Levitin, Bella; Kumar, Pradeep; Levi, Tal; Shahi, Preeti; Khasdan, Vadim; Weinthal, Dan; Kuznetsova, Tatiana; Einav, Monica; Kushmaro, Ariel; Protasov, Alex; Zaritsky, Arieh; Ben-Dov, Eitan

    2014-08-01

    Conventional methods often fail to control the flatheaded borers Capnodis spp., major pests of stone fruit trees; the larvae are protected from insecticides and predation because they feed deep in the roots. A potential solution is transgenic trees producing in their roots toxic compounds such as Cry proteins of Bacillus thuringiensis (Bt). Toxicities against Capnodis larvae were demonstrated by exploiting a recently designed artificial larval diet and an available collection of field isolated Bt. An isolate of Bt tenebrionis (Btt) from commercial bioinsecticide (Novodor) displayed LC50 and LC95 values of 3.2 and 164 mg g(-1) , respectively, against neonates of Capnodis tenebrionis, whereas values of the most toxic field isolate K-7 were 1.9 and 25.6 mg g(-1) respectively. Weights of surviving larvae after 1 month on diets containing low concentrations of K-7 (0.1-1.0 mg g(-1) ) were lower than on Btt or untreated larvae. K-7 was also toxic against larvae of C. cariosa and C. miliaris and found to harbour genes encoding Cry9Ea-like and Cry23Aa/Cry37Aa binary toxins. Larvae of Capnodis spp. are susceptible to Bt Cry toxins. Expressing cry genes active against these pests thus seems a feasible solution towards production of transgenic rootstock trees resilient to the pest. © 2013 Society of Chemical Industry.

  9. Typing of Panton-Valentine leukocidin-encoding phages carried by methicillin-susceptible and methicillin-resistant Staphylococcus aureus from Italy.

    Science.gov (United States)

    Sanchini, A; Del Grosso, M; Villa, L; Ammendolia, M G; Superti, F; Monaco, M; Pantosti, A

    2014-11-01

    Panton-Valentine leukocidin (PVL) is the hallmark of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) but can also be found in methicillin-susceptible S. aureus (MSSA) sharing pathogenic and epidemiological characteristics of CA-MRSA. PVL is encoded by two co-transcribed genes that are carried by different staphylococcal bacteriophages. We applied an extended PCR-based typing scheme for the identification of two morphological groups (elongated-head group and icosahedral-head group I phages) and specific PVL phage types in S. aureus isolates recovered in Italy. We examined 48 PVL-positive isolates (25 MSSA and 23 MRSA) collected from different hospital laboratories from April 2005 to May 2011. spa typing, multilocus sequence typing and staphylococcal cassette chromosome mec typing were applied to categorize the isolates. Phage typeability was 48.0% in MSSA and 91.3% in MRSA, highlighting the limitation of the PCR typing scheme when applied to PVL-positive MSSA. Five different PVL phages and two variants of a known phage were detected, the most prevalent being ΦSa2usa, recovered in 15 out of 48 (31.2%) isolates, and carried by both MSSA and MRSA belonging to CC8 and CC5. The recently described ΦTCH60 was recovered in four isolates. A PVL phage (ΦSa119) from an ST772 MRSA, that was not detected using the previous typing scheme, was sequenced, and new primers were designed for the identification of the icosahedral-head group II PVL phages present in ST772 and ST59 MRSA. A comprehensive PVL-phage typing can contribute to the understanding of the epidemiology and evolution of PVL-positive MSSA and MRSA. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  10. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes.

    Directory of Open Access Journals (Sweden)

    H Charlotte van der Does

    2016-11-01

    Full Text Available Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called 'effectors'. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol, effector genes reside on one of four accessory chromosomes, known as the 'pathogenicity' chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  11. Cloning and sequencing of the gene encoding LipL21 in the vaccinal leptospira serovars

    Directory of Open Access Journals (Sweden)

    Rasoul Hoseinpur

    2016-01-01

    Full Text Available Background: Leptospirosis is a zoonotic disease in humans and animals, caused by the bacterium Leptospira interrogans. Gene expressing LipL21 is one of the genes identified in the bacterium, existing only in the pathogenic strains. The aim of this study was to cloning and analyzing the sequence of the gene encoding surface lipoprotein, LipL21, in five vaccinal leptospira serovars in Iran. Material and Methods: Pathogenic Leptospira interrogans serovars were cultured in EMJH medium with 10% rabbit serum. After genomic DNA extraction, PCR with specific primers was employed and the resulting product inserted in a vector then transferred into E. Coli DH5&alpha. The recombinant plasmids were finally sent for sequencing. Results: The analysis of gene lipL21 in domestic vaccinal serovars and comparison of them with other serovars in the GenBank database revealed that three vaccinal serovars serjo hardjo, canicola and pomona had 100% similarity with each other and grippotyphosa serovar had the highest difference with the vaccinal serovars. In general, the results showed that this gene is a highly conserved gene in the domestic vaccinal serovars and serovars in the GenBank database with more than 95.7 percent similarity. Conclusion: These results showed that the gene, lipL21, is highly conserved in the vaccinal serovars (similarities > 96.4 %. Therefore, the gene encoding surface protein LipL21 can serve as a useful serologic test with high specificity and sensitivity for diagnosis of leptospirosis in clinical samples and in future as an effective subunit vaccine candidate to be used.

  12. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes.

    Science.gov (United States)

    van der Does, H Charlotte; Fokkens, Like; Yang, Ally; Schmidt, Sarah M; Langereis, Léon; Lukasiewicz, Joanna M; Hughes, Timothy R; Rep, Martijn

    2016-11-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called 'effectors'. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the 'pathogenicity' chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity

  13. Identification and differential expression dynamics of peach small GTPases encoding genes during fruit development and ripening

    Science.gov (United States)

    Falchi, Rachele; Cipriani, Guido; Marrazzo, Teresa; Nonis, Alberto; Vizzotto, Giannina; Ruperti, Benedetto

    2010-01-01

    The function of monomeric GTPases of the RAS superfamily in fruit development and ripening has been partially characterized. Here the identification of peach (Prunus persica) small GTPases of the RAS superfamily expressed in fruit and the characterization of their expression profiles during fruit development are described. Extensive searches on expressed sequence tag (EST) databases led to the selection of a total of 24 genes from peach encoding proteins with significant similarity to Arabidopsis small GTPases. Sequence similarity analyses and identification of conserved motifs, diagnostic of specific RAS families and subfamilies, enabled bona fide assignment of fourteen PpRAB, seven PpARF/ARL/SAR, two PpROP and one PpRAN GTPases. Transcriptional expression profiles of peach monomeric GTPases, analysed by real-time quantitative reverse transcription-PCR, were obtained for mesocarp samples, collected in two consecutive years. Reproducible patterns of expression could be identified for five peach RAB-encoding genes (PpRABA1-1, PpRABA2, PpRABD2-1, PpRABD2-2, and PpRABC2), two ARFs (PpARFA1-1 and PpARLB1), and two ROPs (PpROP3 and PpROP4). Interestingly, the transient transcriptional up-regulation of PpARF genes and of PpRAB genes of the A and D clades, putatively controlling the exocytic delivery of cell wall components and modifying enzymes, appeared to coincide with peaks of growth speed and sugar accumulation and with the final phases of ripening. To our knowledge, this is the first description of the co-ordinated differential expression of a set of genes encoding small GTPases of the ARF and RAB families which takes place during key moments of fruit development and maturation. PMID:20501747

  14. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  15. Novel approaches to identify low-penetrance cancer susceptibility genes using mouse models.

    Science.gov (United States)

    de Koning, John P; Mao, Jian-Hua; Balmain, Allan

    2003-01-01

    Studies of cancer predisposition have largely concentrated on the role of high-penetrance susceptibility genes. Less than 10% of the total human tumor burden, however, is accounted for by mutations in these genes. More genetic variation in cancer risk is likely to be due to commoner but lower penetrance alleles. In man, such modifier genes will be difficult to find since they do not segregate as single Mendelian traits. The mouse offers a powerful system for studying polygenic traits such as cancer and has been widely used for this purpose. Novel approaches that might accelerate the identification of these low-penetrance cancer susceptibility genes by using mouse models will be discussed.

  16. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding.

    Science.gov (United States)

    Moura, Tiane Martin de; Campos, Fabrício Souza; d'Azevedo, Pedro Alves; Van Der Sand, Sueli Teresinha; Franco, Ana Cláudia; Frazzon, Jeverson; Frazzon, Ana Paula Guedes

    2012-10-01

    Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS) and coagulasepositive (CoPS) isolates from black pudding in southern Brazil. Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa) and enterotoxin (se) genes was investigated by polymerase chain reaction. The isolates were divided into 2 groups: 75.6% (62/82) were CoNS and 24.4% (20/82) were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8%) and Staphylococcus carnosus (15.9%) were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82) of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6%) and seb (27.5%). The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  17. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  18. Identification and characterization of multiple Spidroin 1 genes encoding major ampullate silk proteins in Nephila clavipes.

    Science.gov (United States)

    Gaines, W A; Marcotte, W R

    2008-09-01

    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSps) that consist of a large repeat array flanked by nonrepetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species.

  19. Mapping of gene expression reveals CYP27A1 as a susceptibility gene for sporadic ALS.

    Directory of Open Access Journals (Sweden)

    Frank P Diekstra

    Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS have implicated a few susceptibility loci. However, many more causal loci remain to be discovered. Since it has been shown that genetic variants associated with complex traits are more likely to be eQTLs than frequency-matched variants from GWAS platforms, we conducted a two-stage genome-wide screening for eQTLs associated with ALS. In addition, we applied an eQTL analysis to finemap association loci. Expression profiles using peripheral blood of 323 sporadic ALS patients and 413 controls were mapped to genome-wide genotyping data. Subsequently, data from a two-stage GWAS (3,568 patients and 10,163 controls were used to prioritize eQTLs identified in the first stage (162 ALS, 207 controls. These prioritized eQTLs were carried forward to the second sample with both gene-expression and genotyping data (161 ALS, 206 controls. Replicated eQTL SNPs were then tested for association in the second-stage GWAS data to find SNPs associated with disease, that survived correction for multiple testing. We thus identified twelve cis eQTLs with nominally significant associations in the second-stage GWAS data. Eight SNP-transcript pairs of highest significance (lowest p = 1.27 × 10(-51 withstood multiple-testing correction in the second stage and modulated CYP27A1 gene expression. Additionally, we show that C9orf72 appears to be the only gene in the 9p21.2 locus that is regulated in cis, showing the potential of this approach in identifying causative genes in association loci in ALS. This study has identified candidate genes for sporadic ALS, most notably CYP27A1. Mutations in CYP27A1 are causal to cerebrotendinous xanthomatosis which can present as a clinical mimic of ALS with progressive upper motor neuron loss, making it a plausible

  20. Expression and characterization of the genes encoding azoreductases from Bacillus subtilis and Geobacillus stearothermophilus.

    Science.gov (United States)

    Sugiura, Wataru; Yoda, Tomoko; Matsuba, Takashi; Tanaka, Yoshinori; Suzuki, Yasuhiko

    2006-07-01

    Azoreductases have been characterized as enzymes that can decolorize azo dyes by reducing azo groups. In this study, genes encoding proteins having homology with the azoreductase gene of Bacillus sp. OY1-2 were obtained from Bacillus subtilis ATCC6633, B. subtilis ISW1214, and Geobacillus stearotherophilus IFO13737 by polymerase chain reaction. All three genes encoded proteins with 174 amino acids. The deduced amino acid sequences of azoreductase homologs from B. subtilis ISW1214, B. subtilis ATCC6633, and G. stearotherophilus IFO13737 showed similarity of 53.3, 53.9, and 53.3% respectively to that of Bacillus sp. OY1-2. All three genes were expressed in Escherichia coli, and were characterized as having the decolorizing activity of azo dyes in a beta-NADPH dependent manner. The transformation of several azo dyes into colorless compounds by recombinant enzymes was demonstrated to have distinct substrate specificity from that of azoreductase from Bacillus sp. OY1-2.

  1. A universal method for the identification of genes encoding amatoxins and phallotoxins in poisonous mushrooms

    Science.gov (United States)

    Wołoszyn, Agata; Kotłowski, Roman

    As the currently known diagnostic DNA targets amplified in the PCR assays for detection of poisonous mushrooms have their counterparts in edible species, there is a need to design PCR primers specific to the genes encoding amanitins and phallotoxins, which occur only in poisonous mushrooms. The aim of the study was testing of PCR-based method for detection of all genes encoding hepatotoxic cyclic peptides - amanitins and phallotoxins present in the most dangerous poisonous mushrooms. Degenerate primers in the PCR were designed on the basis of amanitins (n=13) and phallotoxins (n=5) genes in 18 species of poisonous mushrooms deposited to Genbank of the National Center for Biotechnology Information. The specificity of the PCR assays was confirmed against 9 species of edible mushrooms, death cap - Amanita phalloides and panther cap - Amanita pantherina. Designed two couples of PCR-primers specific to amanitins and phallotoxins genes can be recommended for detection of Amanita phalloides and other mushroom species producing hepatotoxic cyclic peptides - amanitins and phallotoxins.

  2. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila

    2014-09-01

    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  3. Chitinase Genes Responsive to Cold Encode Antifreeze Proteins in Winter Cereals1

    Science.gov (United States)

    Yeh, Sansun; Moffatt, Barbara A.; Griffith, Marilyn; Xiong, Fei; Yang, Daniel S.C.; Wiseman, Steven B.; Sarhan, Fathey; Danyluk, Jean; Xue, Yi Qi; Hew, Choy L.; Doherty-Kirby, Amanda; Lajoie, Gilles

    2000-01-01

    Antifreeze proteins similar to two different chitinases accumulate during cold acclimation in winter rye (Secale cereale). To determine whether these cold-responsive chitinases require post-translational modification to bind to ice, cDNAs coding for two different full-length chitinases were isolated from a cDNA library produced from cold-acclimated winter rye leaves. CHT9 is a 1,193-bp clone that encodes a 31.7-kD class I chitinase and CHT46 is a 998-bp clone that codes for a 24.8-kD class II chitinase. Chitinase-antifreeze proteins purified from the plant were similar in mass to the predicted mature products of CHT9 and CHT46, thus indicating that there was little chemical modification of the amino acid sequences in planta. To confirm these results, the mature sequences of CHT9 and CHT46 were expressed in Escherichia coli and the products of both cDNAs modified the growth of ice. Transcripts of both genes accumulated late in cold acclimation in winter rye. Southern analysis of winter rye genomic DNA indicated the presence of a small gene family homologous to CHT46. In hexaploid wheat, CHT46 homologs mapped to the homeologous group 1 chromosomes and were expressed in response to cold and drought. We conclude that two novel cold-responsive genes encoding chitinases with ice-binding activity may have arisen in winter rye and other cereals through gene duplication. PMID:11080301

  4. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.

    Science.gov (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro

    2015-08-01

    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  5. Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana

    Science.gov (United States)

    Samac, Deborah A.; Hironaka, Cathy M.; Yallaly, Peter E.; Shah, Dilip M.

    1990-01-01

    Plants synthesize a number of antimicrobial proteins in response to pathogen invasion and environmental stresses. These proteins include two classes of chitinases that have either basic or acidic isoelectric points and that are capable of degrading fungal cell wall chitin. We have cloned and determined the nucleotide sequence of the genes encoding the acidic and basic chitinases from Arabidopsis thaliana (L.) Heynh. Columbia wild type. Both chitinases are encoded by single copy genes that contain introns, a novel feature in chitinase genes. The basic chitinase has 73% amino acid sequence similarity to the basic chitinase from tobacco, and the acidic chitinase has 60% amino acid sequence similarity to the acidic chitinase from cucumber. Expression of the basic chitinase is organ-specific and age-dependent in Arabidopsis. A high constitutive level of expression was observed in roots with lower levels in leaves and flowering shoots. Exposure of plants to ethylene induced high levels of systemic expression of basic chitinase with expression increasing with plant age. Constitutive expression of basic chitinase was observed in roots of the ethylene insensitive mutant (etr) of Arabidopsis, demonstrating that root-specific expression is ethylene independent. Expression of the acidic chitinase gene was not observed in normal, untreated Arabidopsis plants or in plants treated with ethylene or salicylate. However, a transient expression assay indicated that the acidic chitinase promoter is active in Arabidopsis leaf tissue. Images Figure 6 Figure 7 PMID:16667600

  6. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  7. Phenotypic interactions of spinster with the genes encoding proteins for cell death control in Drosophila melanogaster.

    Science.gov (United States)

    Sakurai, Akira; Nakano, Yoshiro; Koganezawa, Masayuki; Yamamoto, Daisuke

    2010-03-01

    The spin gene was first identified by its mutant phenotype, which is characterized by extremely strong mate refusal by females in response to male courtship in Drosophila. Spin mutants are also known to be accompanied by a remarkable reduction in programmed cell death in the reproductive and nervous systems. To better understand the molecular functions of spin, we searched for its genetic modifiers. Forced expression of spin(+) in somatic cells as driven by ptc-Gal4 in the testis resulted in the invasion of mature sperm into the anterior testes tip, which is otherwise occupied only by immature germ cells. To obtain genes that modulate spin's effect, the gain-of-function spin phenotype was observed in the presence of a chromosome harboring an EP or GS P-element insertion, which initiates transcription of the genomic sequence neighboring the insertion site. We isolated th and emc as suppressors of spin and atg8a as a gene that reproduces the spin phenotype on its own. th encodes Inhibitor of apoptosis-1, and mammalian Id genes homologous to emc are known to inhibit apoptosis. atg8a encodes a protein essential for autophagy. These results suggest that spin promotes cell death mechanisms that are regulated negatively by th and emc and positively by atg8a. (c) 2010 Wiley Periodicals, Inc.

  8. The Non-Mendelian Green Cotyledon Gene in Soybean Encodes a Small Subunit of Photosystem II.

    Science.gov (United States)

    Kohzuma, Kaori; Sato, Yutaka; Ito, Hisashi; Okuzaki, Ayako; Watanabe, Mai; Kobayashi, Hideki; Nakano, Michiharu; Yamatani, Hiroshi; Masuda, Yu; Nagashima, Yumi; Fukuoka, Hiroyuki; Yamada, Tetsuya; Kanazawa, Akira; Kitamura, Keisuke; Tabei, Yutaka; Ikeuchi, Masahiko; Sakamoto, Wataru; Tanaka, Ayumi; Kusaba, Makoto

    2017-04-01

    Chlorophyll degradation plays important roles in leaf senescence including regulation of degradation of chlorophyll-binding proteins. Although most genes encoding enzymes of the chlorophyll degradation pathway have been identified, the regulation of their activity has not been fully understood. Green cotyledon mutants in legume are stay-green mutants, in which chlorophyll degradation is impaired during leaf senescence and seed maturation. Among them, the soybean (Glycine max) green cotyledon gene cytG is unique because it is maternally inherited. To isolate cytG, we extensively sequenced the soybean chloroplast genome, and detected a 5-bp insertion causing a frame-shift in psbM, which encodes one of the small subunits of photosystem II. Mutant tobacco plants (Nicotiana tabacum) with a disrupted psbM generated using a chloroplast transformation technique had green senescent leaves, confirming that cytG encodes PsbM. The phenotype of cytG was very similar to that of mutant of chlorophyll b reductase catalyzing the first step of chlorophyll b degradation. In fact, chlorophyll b-degrading activity in dark-grown cytG and psbM-knockout seedlings was significantly lower than that of wild-type plants. Our results suggest that PsbM is a unique protein linking photosynthesis in presenescent leaves with chlorophyll degradation during leaf senescence and seed maturation. Additionally, we discuss the origin of cytG, which may have been selected during domestication of soybean. © 2017 American Society of Plant Biologists. All Rights Reserved.

  9. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  10. Microsatellite Scan Identifies New Candidate Genes for Susceptibility to Alcoholic Chronic Pancreatitis in Japanese Patients

    Directory of Open Access Journals (Sweden)

    Kei Kitahara

    2008-01-01

    Full Text Available Alcohol abuse is one of the most common risk factor for chronic pancreatitis, but the underlying pathophysiological mechanisms remain unclear. The aim of this study was to identify genes that contribute to susceptibility or resistance for alcoholic chronic pancreatitis by screening the whole genome. Sixty-five patients with alcoholic chronic pancreatitis (63 men and 2 women, mean age 55.2 years and 99 healthy Japanese controls were enrolled in this study. This was an association study using 400 polymorphic microsatellite markers with an average spacing of 10.8 cM distributed throughout the whole genome. This search revealed 10 candidate susceptibility regions and 5 candidate resistant regions throughout the genome. No specific microsatellite markers were detected in association with previously reported susceptibility genes for chronic pancreatitis, such as PRSS1, PRSS2, CTRC, SPINK1, CFTR, ALDH2, and CYP2E1. Among the statistically significant markers, D15S1007 on chromosome 15q14 showed strong evidence for disease susceptibility (70.8% vs. 35.1%, Pc = 0.0001. Within 500 kb of D15S1007, several genes were candidate genes for susceptibility, including FMN1, DKFZP686C2281, LOC440268, RYR3, and AVEN, This study identified 10 candidate susceptibility and 5 candidate resistant regions that may contain genes involved in ACP pathogenesis.

  11. Microsatellite Scan Identifies New Candidate Genes for Susceptibility to Alcoholic Chronic Pancreatitis in Japanese Patients

    Science.gov (United States)

    Kitahara, Kei; Kawa, Shigeyuki; Katsuyama, Yoshihiko; Umemura, Takeji; Ozaki, Yayoi; Takayama, Mari; Arakura, Norikazu; Ota, Masao

    2008-01-01

    Alcohol abuse is one of the most common risk factor for chronic pancreatitis, but the underlying pathophysiological mechanisms remain unclear. The aim of this study was to identify genes that contribute to susceptibility or resistance for alcoholic chronic pancreatitis by screening the whole genome. Sixty-five patients with alcoholic chronic pancreatitis (63 men and 2 women, mean age 55.2 years) and 99 healthy Japanese controls were enrolled in this study. This was an association study using 400 polymorphic microsatellite markers with an average spacing of 10.8 cM distributed throughout the whole genome. This search revealed 10 candidate susceptibility regions and 5 candidate resistant regions throughout the genome. No specific microsatellite markers were detected in association with previously reported susceptibility genes for chronic pancreatitis, such as PRSS1, PRSS2, CTRC, SPINK1, CFTR, ALDH2, and CYP2E1. Among the statistically significant markers, D15S1007 on chromosome 15q14 showed strong evidence for disease susceptibility (70.8% vs. 35.1%, Pc = 0.0001). Within 500 kb of D15S1007, several genes were candidate genes for susceptibility, including FMN1, DKFZP686C2281, LOC440268, RYR3, and AVEN, This study identified 10 candidate susceptibility and 5 candidate resistant regions that may contain genes involved in ACP pathogenesis. PMID:19096130

  12. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  13. Characterisation and expression of a gene encoding a mutarotase from the fungus Rhizopus nigricans.

    Science.gov (United States)

    Vilfan, Tanja; Cresnar, Bronislava; Fournier, Didier; Stojan, Jure; Breskvar, Katja

    2004-06-01

    A gene coding for a mutarotase was isolated and characterised from the filamentous fungus Rhizopus nigricans. In order to determine the encoded enzyme's activity a recombinant protein was prepared in the baculovirus expression system and the mutarotase activity was determined. Expression studies showed that the gene is repressed by high as well as low concentrations of glucose and derepressed during deficiency of glucose. Besides the regulation at the level of transcription, an accelerative effect of glucose in growth medium on the mutarotase mRNA decay was also demonstrated. Moreover, a Southern hybridisation performed at lower temperatures suggested that the R. nigricans genome harbours a nucleotide sequence, that is homologous to the isolated gene.

  14. Cloning of the genes encoding two murine and human cochlear unconventional type I myosins

    Energy Technology Data Exchange (ETDEWEB)

    Crozet, F.; El Amraoui, Z.; Blanchard, S. [Institut Pasteur, Paris (France)] [and others

    1997-03-01

    Several lines of evidence indicate a crucial role for unconventional myosins in the function of the sensory hair cells of the inner ear. We report here the characterization of the cDNAs encoding two unconventional type I myosins from a mouse cochlear cDNA library. The first cDNA encodes a putative protein named Myo1c, which is likely to be the murine orthologue of the bullfrog myosin I{beta} and which may be involved in the gating of the mechanotransduction channel of the sensory hair cells. This myosin belongs to the group of short-tailed myosins I, with its tail ending shortly after a polybasic, TH-1-like domain. The second cDNA encodes a novel type I myosin Myo1f which displays three regions: a head domain with the conserved ATP- and actin-binding sites, a neck domain with a single IQ motif, and a tail domain with the tripartite structure initially described in protozoan myosins I. The tail of Myo1f includes (1) a TH-1 region rich in basic residues, which may interact with anionic membrane phospholipids; (2) a TH-2 proline-rich region, expected to contain an ATP-insensitive actin-binding site; and (3) an SH-3 domain found in a variety of cytoskeletal and signaling proteins. Northern blot analysis indicated that the genes encoding Myo1c and Myo1f display a widespread tissue expression in the adult mouse. Myo1c and Myo1f were mapped by in situ hybridization to the chromosomal regions 11D-11E and 17B-17C, respectively. The human orthologuous genes MYO1C and MYO1F were also characterized, and mapped to the human chromosomal regions 17p13 and 19p13.2- 19p1.3.3, respectively. 45 refs., 5 figs., 2 tabs.

  15. Effects of NFKB1 and NFKBIA gene polymorphisms on susceptibility to environmental factors and the clinicopathologic development of oral cancer.

    Directory of Open Access Journals (Sweden)

    Chiao-Wen Lin

    Full Text Available Oral cancer, which is the fourth most common cancer in Taiwanese men, is associated with environmental carcinogens. The possibility that genetic predisposition in nuclear factor-kappa B (NF-κB-signaling pathways activation is linked to the development of oral squamous cell carcinoma (OSCC requires investigation. The current study examines associations between polymorphisms within promoter regions of NFKB1 encoding NF-κB1 and NFKBIA encoding IkappaBalpha (IκBα with both the susceptibility to develop OSCC and the clinicopathological characteristics of the tumors.Genetic polymorphisms of NFKB1 and NFKBIA were analyzed by a real-time polymerase chain reaction (real-time PCR for 462 patients with oral cancer and 520 non-cancer controls. We found that NFKB1 -94 ATGG1/ATGG2, -94 ATGG2/ATGG2, and the combination of -94 ATGG1/ATGG2 and ATGG2/ATGG2 genotypes NFKBIA -826 T (CT+TT and -881 G (AG+GG allelic carriages, were more prevalent in OSCC patients than in non-cancer participants. Moreover, we found that NFKB1 or NFKBIA gene polymorphisms seem to be related to susceptibility to develop oral cancer linked to betel nut and tobacco consumption. Finally, patients with oral cancer who had at least one -519 T allele of the NFKBIA gene were at higher risk for developing distant metastasis (P<.05, compared with those patients CC homozygotes.Our results suggest that NFKB1 -94 ATTG2, NFKBIA -826 T, and -881 G alleles are associated with oral carcinogenesis. The combination of NFKB1 or NFKBIA gene polymorphisms and environmental carcinogens appears related to an increased risk of oral cancer. More importantly, the genetic polymorphism of NFKBIA -519 might be a predictive factor for the distal metastasis of OSCC in Taiwanese.

  16. Identification of three genes encoding microsomal oleate desaturases (FAD2) from the oilseed crop Camelina sativa.

    Science.gov (United States)

    Kang, Jinling; Snapp, Anna R; Lu, Chaofu

    2011-02-01

    Camelina sativa is a re-emerging low-input oilseed crop that may provide economical vegetable oils for industrial applications. It is desirable to increase the monounsaturated oleic acid (cis-9-octadecenoic acid, 18:1), and to decrease polyunsaturated fatty acids (PUFA), linoleic (cis, cis-9,12-octadecadienoic acid, 18:2) and α-linolenic (all-cis-9,12,15-octadecatrienoic acid, 18:3) acids, in camelina oils to improve oxidative stability. 18:1 desaturation is mainly controlled by the microsomal oleate desaturase (FAD2; EC 1.3.1.35) encoded by the FAD2 gene. Three FAD2 genes, designated CsFAD2-1 to 3, were identified in camelina. Functional expression of these genes in yeast confirmed that they all encode microsomal oleate desaturases. Although the three CsFAD2 genes share very high sequence similarity, they showed different expression patterns. Expression of CsFAD2-1 was detected in all tissues examined, including developing seed, flower, as well as in vegetable tissues such as leaf, root, and stem. Transcripts of CsFAD2-2 and CsFAD2-3 were mainly detected in developing seeds, suggesting their major roles in storage oil desaturation in seed. The introns of the three CsFAD2 genes, which showed greater sequence variations, may provide additional resources for designing molecular markers in breeding. Furthermore, the roles of CsFAD2 in PUFA synthesis were demonstrated by mutant analysis and by antisense gene expression in camelina seed. Published by Elsevier Masson SAS.

  17. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding "...

  18. Proanthocyanidin Synthesis and Expression of Genes Encoding Leucoanthocyanidin Reductase and Anthocyanidin Reductase in Developing Grape Berries and Grapevine Leaves

    National Research Council Canada - National Science Library

    Jochen Bogs; Mark O. Downey; John S. Harvey; Anthony R. Ashton; Gregory J. Tanner; Simon P. Robinson

    2005-01-01

    .... We measured PA content and expression of genes encoding ANR, LAR, and leucoanthocyanidin dioxygenase in grape berries during development and in grapevine leaves, which accumulated PA throughout leaf expansion...

  19. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  20. Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility

    NARCIS (Netherlands)

    de Jong, MM; Nolte, IM; Meerman, GJT; van der Graaf, WTA; Oosterwijk, JC; Kleibeuker, JH; Schaapveld, M; de Vries, EGE

    This review focuses on genes other than the high penetrance genes BRCA1 and BRCA2 that are involved in breast cancer susceptibility. The goal of this review is the discovery of polymorphisms that are either associated with breast cancer or that are in strong linkage disequilibrium with breast cancer

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-04

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju.

    Science.gov (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok

    2003-08-01

    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  4. Role of sequence encoded κB DNA geometry in gene regulation by Dorsal

    Science.gov (United States)

    Mrinal, Nirotpal; Tomar, Archana; Nagaraju, Javaregowda

    2011-01-01

    Many proteins of the Rel family can act as both transcriptional activators and repressors. However, mechanism that discerns the ‘activator/repressor’ functions of Rel-proteins such as Dorsal (Drosophila homologue of mammalian NFκB) is not understood. Using genomic, biophysical and biochemical approaches, we demonstrate that the underlying principle of this functional specificity lies in the ‘sequence-encoded structure’ of the κB-DNA. We show that Dorsal-binding motifs exist in distinct activator and repressor conformations. Molecular dynamics of DNA-Dorsal complexes revealed that repressor κB-motifs typically have A-tract and flexible conformation that facilitates interaction with co-repressors. Deformable structure of repressor motifs, is due to changes in the hydrogen bonding in A:T pair in the ‘A-tract’ core. The sixth nucleotide in the nonameric κB-motif, ‘A’ (A6) in the repressor motifs and ‘T’ (T6) in the activator motifs, is critical to confer this functional specificity as A6 → T6 mutation transformed flexible repressor conformation into a rigid activator conformation. These results highlight that ‘sequence encoded κB DNA-geometry’ regulates gene expression by exerting allosteric effect on binding of Rel proteins which in turn regulates interaction with co-regulators. Further, we identified and characterized putative repressor motifs in Dl-target genes, which can potentially aid in functional annotation of Dorsal gene regulatory network. PMID:21890896

  5. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Science.gov (United States)

    Roedder, Silke; Sigdel, Tara; Hsieh, Szu-Chuan; Cheeseman, Jennifer; Metes, Diana; Macedo, Camila; Reed, Elaine F.; Gritsch, H. A.; Zeevi, Adriana; Shapiro, Ron; Kirk, Allan D.; Sarwal, Minnie M.

    2017-01-01

    Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR) still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB) samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (21 years) renal allograft recipients at the point of AR (n = 61) and absence of rejection (n = 94) for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection). Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression. PMID:29164120

  6. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder

    2017-11-01

    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  7. Identification of RNF213 as a Susceptibility Gene for Moyamoya Disease and Its Possible Role in Vascular Development

    Science.gov (United States)

    Yamazaki, Satoru; Toyoda, Atsushi; Kikuta, Ken-ichiro; Takagi, Yasushi; Harada, Kouji H.; Fujiyama, Asao; Herzig, Roman; Krischek, Boris; Zou, Liping; Kim, Jeong Eun; Kitakaze, Masafumi; Miyamoto, Susumu; Nagata, Kazuhiro; Hashimoto, Nobuo; Koizumi, Akio

    2011-01-01

    Background Moyamoya disease is an idiopathic vascular disorder of intracranial arteries. Its susceptibility locus has been mapped to 17q25.3 in Japanese families, but the susceptibility gene is unknown. Methodology/Principal Findings Genome-wide linkage analysis in eight three-generation families with moyamoya disease revealed linkage to 17q25.3 (Pmoyamoya disease in East Asian populations (251 cases and 707 controls) with an odds ratio of 111.8 (P = 10−119). Sequencing of RNF213 in East Asian cases revealed additional novel variants: p.D4863N, p.E4950D, p.A5021V, p.D5160E, and p.E5176G. Among Caucasian cases, variants p.N3962D, p.D4013N, p.R4062Q and p.P4608S were identified. RNF213 encodes a 591-kDa cytosolic protein that possesses two functional domains: a Walker motif and a RING finger domain. These exhibit ATPase and ubiquitin ligase activities. Although the mutant alleles (p.R4810K or p.D4013N in the RING domain) did not affect transcription levels or ubiquitination activity, knockdown of RNF213 in zebrafish caused irregular wall formation in trunk arteries and abnormal sprouting vessels. Conclusions/Significance We provide evidence suggesting, for the first time, the involvement of RNF213 in genetic susceptibility to moyamoya disease. PMID:21799892

  8. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  9. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  10. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  11. A novel MFS transporter encoding gene in Fusarium verticillioides probably involved in iron-siderophore transport.

    Science.gov (United States)

    López-Errasquín, Elena; González-Jaén, M Teresa; Callejas, Carmen; Vázquez, Covadonga

    2006-09-01

    The major facilitator superfamily (MFS) is a ubiquitous group of proteins involved in the transport of a wide range of compounds, including toxins produced by fungal species. In this paper, a novel MFS encoding gene (Fusarium iron related gene or FIR1), which had shown an up-regulation in fumonisin-inducing conditions, has been identified and characterized. The deduced protein sequence, which predicted 14 transmembrane domains typical of MFS transporters and its phylogenetic relationships with representative members of MFS transporters suggested a possible function of FIR1 as a siderophore transporter. A real-time RT-PCR protocol has been developed to analyse the expression pattern of the FIR1 gene in relation to siderophore production. The results indicated that the synthesis of extracellular siderophores by F. verticillioides observed in absence of extracellular iron was repressed in iron-supplemented cultures and showed a good correspondence with FIR1 gene expression. However, the pattern of FIR1 gene expression observed suggested that this gene did not seem to be functionally related to fumonisin production.

  12. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    Science.gov (United States)

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Expression and characteristics of the gene encoding azoreductase from Rhodobacter sphaeroides AS1.1737.

    Science.gov (United States)

    Bin, Yan; Jiti, Zhou; Jing, Wang; Cuihong, Du; Hongman, Hou; Zhiyong, Song; Yongming, Bao

    2004-07-01

    A gene that encodes a protein with azoreductase activity was obtained by PCR amplification from Rhodobacter sphaeroides AS1.1737. The enzyme, with a molecular weight of 18.7 kD, was heterologously expressed in Escherichia coli and its azoreductase activity was characterized. Furthermore, the reduction mechanism of azo dyes catalyzed by the azoreductase was studied in detail. The presence of a hydrazo-intermediate was identified, which provided a convincing evidence for the assumption that azo dyes were degraded via an incomplete reduction stage.

  14. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    OpenAIRE

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any addit...

  15. Leuconostoc lactis beta-galactosidase is encoded by two overlapping genes.

    OpenAIRE

    David, S; Stevens, H.; van Riel, M.; Simons, G; de Vos, W M

    1992-01-01

    A 16-kb BamHI fragment of the lactose plasmid pNZ63 from Leuconostoc lactis NZ6009 was cloned in Escherichia coli MC1061 by using pACYC184 and was found to express a functional beta-galactosidase. Deletion and complementation analysis showed that the coding region for beta-galactosidase was located on a 5.8-kb SalI-BamHI fragment. Nucleotide sequence analysis demonstrated that this fragment contained two partially overlapping genes, lacL (1,878 bp) and lacM (963 bp), that could encode protein...

  16. Transfer and expression of the gene encoding a human myeloid membrane antigen (gp150).

    Science.gov (United States)

    Look, A T; Peiper, S C; Rebentisch, M B; Ashmun, R A; Roussel, M F; Rettenmier, C W; Sherr, C J

    1985-02-01

    DNA from the human myeloid cell line HL-60 was cotransfected with the cloned thymidine kinase (tk) gene of herpes simplex virus into tk-deficient mouse L cells. tk-positive recipients expressing antigens detected on HL-60 cells were isolated with a fluorescence-activated cell sorter by use of a panel of monoclonal antibodies that detect epitopes on both normal and malignant myeloid cells. Independently sorted populations of transformed mouse cells showed concordant reactivities with four of the monoclonal antibodies in the panel (DU-HL60-4, MY7, MCS.2, and SJ-D1), which suggested that these antibodies reacted to products of a single human gene. A second round of DNA transfection and cell sorting was performed with donor DNA from primary transformants. Two different dominant selection systems were used to isolate secondary mouse L cell and NIH/3T3 cell transformants that coexpressed the same epitopes. Analysis of cellular DNA from secondary mouse cell subclones with a probe specific for human repetitive DNA sequences revealed a minimal human DNA complement containing a characteristic set of restriction fragments common to independently derived subclones. Two glycoproteins, of 130,000 (gp130) and 150,000 (gp150) mol wt, were specifically immunoprecipitated from metabolically labeled lysates of mouse cell transformants and were shown to contain [35S]methionine-labeled tryptic peptides identical to those of analogous glycoproteins expressed in the donor human myeloid cell line. Kinetic and biochemical analyses established that gp130 is a precursor that differs in its carbohydrate moiety from gp150, the mature form of the glycoprotein detected on the cell surface. The isolation of human gene sequences encoding gp150 in a mouse cell genetic background provides the possibility of molecularly cloning the gene and represents a general strategy for isolating human genes encoding differentiation-specific cell surface antigens.

  17. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  18. Hierarchical Control of Nitrite Respiration by Transcription Factors Encoded within Mobile Gene Clusters of Thermus thermophilus.

    Science.gov (United States)

    Alvarez, Laura; Quintáns, Nieves G; Blesa, Alba; Baquedano, Ignacio; Mencía, Mario; Bricio, Carlos; Berenguer, José

    2017-12-01

    Denitrification in Thermus thermophilus is encoded by the nitrate respiration conjugative element (NCE) and nitrite and nitric oxide respiration (nic) gene clusters. A tight coordination of each cluster's expression is required to maximize anaerobic growth, and to avoid toxicity by intermediates, especially nitric oxides (NO). Here, we study the control of the nitrite reductases (Nir) and NO reductases (Nor) upon horizontal acquisition of the NCE and nic clusters by a formerly aerobic host. Expression of the nic promoters PnirS, PnirJ, and PnorC, depends on the oxygen sensor DnrS and on the DnrT protein, both NCE-encoded. NsrR, a nic-encoded transcription factor with an iron-sulfur cluster, is also involved in Nir and Nor control. Deletion of nsrR decreased PnorC and PnirJ transcription, and activated PnirS under denitrification conditions, exhibiting a dual regulatory role never described before for members of the NsrR family. On the basis of these results, a regulatory hierarchy is proposed, in which under anoxia, there is a pre-activation of the nic promoters by DnrS and DnrT, and then NsrR leads to Nor induction and Nir repression, likely as a second stage of regulation that would require NO detection, thus avoiding accumulation of toxic levels of NO. The whole system appears to work in remarkable coordination to function only when the relevant nitrogen species are present inside the cell.

  19. NRAMP1 and VDR Gene Polymorphisms in Susceptibility to Tuberculosis in Venezuelan Population

    Science.gov (United States)

    Fernández-Mestre, Mercedes; Villasmil, Ángel; Takiff, Howard; Fuentes Alcalá, Zhenia

    2015-01-01

    Natural resistance-associated macrophage protein (Nramp1) and the vitamin D receptor (VDR) are central components of the innate and adaptive immunity against Mycobacterium tuberculosis, and associations between susceptibility to tuberculosis and polymorphisms in the genes NRAMP and VDR have been sought in geographically diverse populations. We investigated associations of NRAMP1 and VDR gene polymorphisms with susceptibility to TB in the Venezuelan population. The results suggest the absence of any association between VDR variants FokI, ApaI, and TaqI and susceptibility to tuberculosis. In contrast, the NRAMP1 3′UTR variants were associated with susceptibility to M. tuberculosis infection, as seen in the comparisons between TST+ and TST− controls, and also with progression to TB disease, as shown in the comparisons between TB patients and TST+ controls. This study confirms the previously described association of the NRAMP1 3′UTR polymorphism with M. tuberculosis infection and disease progression. PMID:26578819

  20. Modeling the fitness consequences of a cyanophage-encoded photosynthesis gene.

    Directory of Open Access Journals (Sweden)

    Jason G Bragg

    Full Text Available BACKGROUND: Phages infecting marine picocyanobacteria often carry a psbA gene, which encodes a homolog to the photosynthetic reaction center protein, D1. Host encoded D1 decays during phage infection in the light. Phage encoded D1 may help to maintain photosynthesis during the lytic cycle, which in turn could bolster the production of deoxynucleoside triphosphates (dNTPs for phage genome replication. METHODOLOGY/PRINCIPAL FINDINGS: To explore the consequences to a phage of encoding and expressing psbA, we derive a simple model of infection for a cyanophage/host pair--cyanophage P-SSP7 and Prochlorococcus MED4--for which pertinent laboratory data are available. We first use the model to describe phage genome replication and the kinetics of psbA expression by host and phage. We then examine the contribution of phage psbA expression to phage genome replication under constant low irradiance (25 microE m(-2 s(-1. We predict that while phage psbA expression could lead to an increase in the number of phage genomes produced during a lytic cycle of between 2.5 and 4.5% (depending on parameter values, this advantage can be nearly negated by the cost of psbA in elongating the phage genome. Under higher irradiance conditions that promote D1 degradation, however, phage psbA confers a greater advantage to phage genome replication. CONCLUSIONS/SIGNIFICANCE: These analyses illustrate how psbA may benefit phage in the dynamic ocean surface mixed layer.

  1. Cloning and analysis of the DNA polymerase-encoding gene from Thermus caldophilus GK24.

    Science.gov (United States)

    Kwon, S T; Kim, J S; Park, J H; Kim, H K; Lee, D S

    1997-04-30

    The gene encoding Thermus caldophilus GK24 (Tca) DNA polymerase was cloned into Escherichia coli using the structural gene coding for Thermus aquaticus YT-1 (Taq) DNA polymerase as a hybridization probe. The nucleotide sequence of the cloned DNA was determined. The primary structure of the Tca DNA polymerase was deduced from the nucleotide sequence. The Tca DNA polymerase comprised 834 amino acid residues and its molecular mass was determined to be 93,810. On alignment of the whole amino acid sequence, Tca DNA polymerase showed a high sequence homology with the E. coli DNA polymerase I-like DNA polymerases, and 86% identity with Taq DNA polymerase, 38% with E. coli and Streptococcus pneumoniae (Spn) DNA polymerase I. An extremely high sequence identity was observed in the region containing the polymerase activity. The codon usage in the Tca DNA polymerase gene was in fact similar to the characteristic usages in the genes for proteins from bacteria of genus Thermus: the G+C content in the third position of the codons was as high as 93%. The Tca DNA polymerase gene was expressed under the control of tac promoter on a high copy plasmid, pTCA in E. coli.

  2. Cloning, characterization and identification of the gene encoding phosphatidylinositol 4-kinase.

    Science.gov (United States)

    Pramanik, A; Garcia, E; Ospina, R; Powell, M; Martinez, M; Alejo, W; McKoy, J; Moore, C W

    1997-11-01

    The vast majority of AIDS-related deaths are associated with opportunistic infections. For fungal infections, there are few effective antifungals, particularly for systemic use. The discovery that very low doses of the bleomycin family of anticancer chemical congeners compromise the integrity of fungal cell walls led to our approach to identify genes that complement-cell wall defects, and develop methods to facilitate the identification of new antifungals targeted to fungal cell walls. This report describes one of the genes cloned by complementation of the blm1-1 mutation of S. cerevisiae using a YCp50-based yeast genomic library. Characterization and identification of the gene were carried out using drug screening tests, Southern hybridization analyses, DNA sequencing and DNA sequence similarity searches in databases. The gene STT4, is essential for viability and encodes a phosphatidylinositol 4-kinase that plays an important role in the phosphatidylinositol-mediated signal transduction pathway required for cell wall integrity. Like blm1-1 mutant strains, stt4 cells arrest mostly in the G2/M phase of the cell cycle. Further studies using this approach should help us understand the role of PI4-K in maintaining fungal cell-wall integrity, identify additional genes affecting potential target structures in cell walls of opportunistic fungal pathogens in AIDS patients, and assist in drug discovery and antifungal drug design.

  3. Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937.

    Science.gov (United States)

    Lojkowska, E; Masclaux, C; Boccara, M; Robert-Baudouy, J; Hugouvieux-Cotte-Pattat, N

    1995-06-01

    Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino-terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo-pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo-cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft-rot disease.

  4. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  5. Candidate gene analysis and exome sequencing confirm LBX1 as a susceptibility gene for idiopathic scoliosis.

    Science.gov (United States)

    Grauers, Anna; Wang, Jingwen; Einarsdottir, Elisabet; Simony, Ane; Danielsson, Aina; Åkesson, Kristina; Ohlin, Acke; Halldin, Klas; Grabowski, Pawel; Tenne, Max; Laivuori, Hannele; Dahlman, Ingrid; Andersen, Mikkel; Christensen, Steen Bach; Karlsson, Magnus K; Jiao, Hong; Kere, Juha; Gerdhem, Paul

    2015-10-01

    promoter regions of LBX1. Here, we confirm LBX1 as a susceptibility gene for idiopathic scoliosis in a Scandinavian population and report that we are unable to find evidence of other genes of similar or stronger effect. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  7. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    Science.gov (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  8. MDM2 SNP309, gene-gene interaction, and tumor susceptibility: an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Wu Wei

    2011-05-01

    Full Text Available Abstract Background The tumor suppressor gene p53 is involved in multiple cellular pathways including apoptosis, transcriptional control, and cell cycle regulation. In the last decade it has been demonstrated that the single nucleotide polymorphism (SNP at codon 72 of the p53 gene is associated with the risk for development of various neoplasms. MDM2 SNP309 is a single nucleotide T to G polymorphism located in the MDM2 gene promoter. From the time that this well-characterized functional polymorphism was identified, a variety of case-control studies have been published that investigate the possible association between MDM2 SNP309 and cancer risk. However, the results of the published studies, as well as the subsequent meta-analyses, remain contradictory. Methods To investigate whether currently published epidemiological studies can clarify the potential interaction between MDM2 SNP309 and the functional genetic variant in p53 codon72 (Arg72Pro and p53 mutation status, we performed a meta-analysis of the risk estimate on 27,813 cases with various tumor types and 30,295 controls. Results The data we reviewed indicated that variant homozygote 309GG and heterozygote 309TG were associated with a significant increased risk of all tumor types (homozygote comparison: odds ratio (OR = 1.25, 95% confidence interval (CI = 1.13-1.37; heterozygote comparison: OR = 1.10, 95% CI = 1.03-1.17. We also found that the combination of GG and Pro/Pro, TG and Pro/Pro, GG and Arg/Arg significantly increased the risk of cancer (OR = 3.38, 95% CI = 1.77-6.47; OR = 1.88, 95% CI = 1.26-2.81; OR = 1.96, 95% CI = 1.01-3.78, respectively. In a stratified analysis by tumor location, we also found a significant increased risk in brain, liver, stomach and uterus cancer (OR = 1.47, 95% CI = 1.06-2.03; OR = 2.24, 95%CI = 1.57-3.18; OR = 1.54, 95%CI = 1.04-2.29; OR = 1.34, 95%CI = 1.07-1.29, respectively. However, no association was seen between MDM2 SNP309 and tumor susceptibility

  9. Susceptibility towards enterotoxigenic Escherichia coli F4ac diarrhea is governed by the MUC13 gene in pigs.

    Directory of Open Access Journals (Sweden)

    Jun Ren

    Full Text Available Enterotoxigenic Escherichia coli (ETEC F4ac is a major determinant of diarrhea and mortality in neonatal and young pigs. Susceptibility to ETEC F4ac is governed by the intestinal receptor specific for the bacterium and is inherited as a monogenic dominant trait. To identify the receptor gene (F4acR, we first mapped the locus to a 7.8-cM region on pig chromosome 13 using a genome scan with 194 microsatellite markers. A further scan with high density markers on chromosome 13 refined the locus to a 5.7-cM interval. Recombination breakpoint analysis defined the locus within a 2.3-Mb region. Further genome-wide mapping using 39,720 informative SNPs revealed that the most significant markers were proximal to the MUC13 gene in the 2.3-Mb region. Association studies in a collection of diverse outbred populations strongly supported that MUC13 is the most likely responsible gene. We characterized the porcine MUC13 gene that encodes two transcripts: MUC13A and MUC13B. Both transcripts have the characteristic PTS regions of mucins that are enriched in distinct tandem repeats. MUC13B is predicated to be heavily O-glycosylated, forming the binding site of the bacterium; while MUC13A does not have the O-glycosylation binding site. Concordantly, 127 independent pigs homozygous for MUC13A across diverse breeds are all resistant to ETEC F4ac, and all 718 susceptible animals from the broad breed panel carry at least one MUC13B allele. Altogether, we conclude that susceptibility towards ETEC F4ac is governed by the MUC13 gene in pigs. The finding has an immediate translation into breeding practice, as it allows us to establish an efficient and accurate diagnostic test for selecting against susceptible animals. Moreover, the finding improves our understanding of mucins that play crucial roles in defense against enteric pathogens. It revealed, for the first time, the direct interaction between MUC13 and enteric bacteria, which is poorly understood in mammals.

  10. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  11. Reconstruction of ancestral gene orders using probabilistic and gene encoding approaches.

    Directory of Open Access Journals (Sweden)

    Ning Yang

    Full Text Available Current tools used in the reconstruction of ancestral gene orders often fall into event-based and adjacency-based methods according to the principles they follow. Event-based methods such as GRAPPA are very accurate but with extremely high complexity, while more recent methods based on gene adjacencies such as InferCARsPro is relatively faster, but often produces an excessive number of chromosomes. This issue is mitigated by newer methods such as GapAdj, however it sacrifices a considerable portion of accuracy. We recently developed an adjacency-based method in the probabilistic framework called PMAG to infer ancestral gene orders. PMAG relies on calculating the conditional probabilities of gene adjacencies that are found in the leaf genomes using the Bayes' theorem. It uses a novel transition model which accounts for adjacency changes along the tree branches as well as a re-rooting procedure to prevent any information loss. In this paper, we improved PMAG with a new method to assemble gene adjacencies into valid gene orders, using an exact solver for traveling salesman problem (TSP to maximize the overall conditional probabilities. We conducted a series of simulation experiments using a wide range of configurations. The first set of experiments was to verify the effectiveness of our strategy of using the better transition model and re-rooting the tree under the targeted ancestral genome. PMAG was then thoroughly compared in terms of three measurements with its four major competitors including InferCARsPro, GapAdj, GASTS and SCJ in order to assess their performances. According to the results, PMAG demonstrates superior performance in terms of adjacency, distance and assembly accuracies, and yet achieves comparable running time, even all TSP instances were solved exactly. PMAG is available for free at http://phylo.cse.sc.edu.

  12. CELSR2 is a candidate susceptibility gene in idiopathic scoliosis

    DEFF Research Database (Denmark)

    Einarsdottir, Elisabet; Grauers, Anna; Wang, Jingwen

    2017-01-01

    A Swedish pedigree with an autosomal dominant inheritance of idiopathic scoliosis was initially studied by genetic linkage analysis, prioritising genomic regions for further analysis. This revealed a locus on chromosome 1 with a putative risk haplotype shared by all affected individuals. Two......, but showed reduced penetrance. Analysis of tagging variants in CELSR1-3 in a set of 1739 Swedish-Danish scoliosis cases and 1812 controls revealed significant association (p = 0.0001) to rs2281894, a common synonymous variant in CELSR2. This association was not replicated in case-control cohorts from Japan...... and the US. No association was found to variants in CELSR1 or CELSR3. Our findings suggest a rare variant in CELSR2 as causative for idiopathic scoliosis in a family with dominant segregation and further highlight common variation in CELSR2 in general susceptibility to idiopathic scoliosis in the Swedish...

  13. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    Science.gov (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  14. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  15. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

    Science.gov (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  16. Cell wall-related genes studies on peach cultivars with differential susceptibility to woolliness: looking for candidates as indicators of chilling tolerance.

    Science.gov (United States)

    Genero, Melisa; Gismondi, Mauro; Monti, Laura L; Gabilondo, Julieta; Budde, Claudio O; Andreo, Carlos S; Lara, María V; Drincovich, María F; Bustamante, Claudia A

    2016-06-01

    The results obtained indicate that a β-xylosidase gene may act as good indicator of chilling tolerance and provide new insights into the complex issue of peach fruit woolliness. The storage of peaches at low temperatures for prolonged periods can induce a form of chilling injury (CI) called woolliness, characterized by a lack of juiciness and a mealy texture. As this disorder has been associated with abnormal cell wall dismantling, the levels of 12 transcripts encoding proteins involved in cell wall metabolism were analysed in cultivars with contrasting susceptibility to this disorder selected from five melting flesh peach cultivars. The resistant ('Springlady') and susceptible ('Flordaking') cultivars displayed differences in the level of expression of some of the selected genes during fruit softening and in woolly versus non-woolly fruits. From these genes, the level of expression of PpXyl, which encodes for a putative β-xylosidase, was the one that presented the highest correlation (negative) with the susceptibility to woolliness. PpXyl expression was also analysed in a cultivar ('Rojo 2') with intermediate susceptibility to woolliness, reinforcing the conclusion about the correlation of PpXyl expression to the presence of woolliness symptom. Moreover, the level of expression of PpXyl correlated to protein level detected by Western blot. Analyses of the promoter region of the PpXyl gene (1637 bp) isolated from the three cultivars showed no differences suggesting that cis-elements from other regions of the genome and/or trans elements could be responsible of the differential PpXyl expression patterns. Overall, the results obtained indicate that PpXyl may act as a good indicator of woolliness tolerance and that the regulation of expression of this gene in different cultivars does not depend on sequences upstream the coding sequence.

  17. Identification of susceptibility genes and genetic modifiers of human diseases

    Science.gov (United States)

    Abel, Kenneth; Kammerer, Stefan; Hoyal, Carolyn; Reneland, Rikard; Marnellos, George; Nelson, Matthew R.; Braun, Andreas

    2005-03-01

    The completion of the human genome sequence enables the discovery of genes involved in common human disorders. The successful identification of these genes is dependent on the availability of informative sample sets, validated marker panels, a high-throughput scoring technology, and a strategy for combining these resources. We have developed a universal platform technology based on mass spectrometry (MassARRAY) for analyzing nucleic acids with high precision and accuracy. To fuel this technology, we generated more than 100,000 validated assays for single nucleotide polymorphisms (SNPs) covering virtually all known and predicted human genes. We also established a large DNA sample bank comprised of more than 50,000 consented healthy and diseased individuals. This combination of reagents and technology allows the execution of large-scale genome-wide association studies. Taking advantage of MassARRAY"s capability for quantitative analysis of nucleic acids, allele frequencies are estimated in sample pools containing large numbers of individual DNAs. To compare pools as a first-pass "filtering" step is a tremendous advantage in throughput and cost over individual genotyping. We employed this approach in numerous genome-wide, hypothesis-free searches to identify genes associated with common complex diseases, such as breast cancer, osteoporosis, and osteoarthritis, and genes involved in quantitative traits like high density lipoproteins cholesterol (HDL-c) levels and central fat. Access to additional well-characterized patient samples through collaborations allows us to conduct replication studies that validate true disease genes. These discoveries will expand our understanding of genetic disease predisposition, and our ability for early diagnosis and determination of specific disease subtype or progression stage.

  18. Genomic organization of the human SCN5A gene encoding the cardiac sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qing; Li, Zhizhong; Shen, Jiaxiang; Keating, M.T. [Univ. of Utah Health Sciences Center, Salt Lake City, UT (United States)

    1996-05-15

    The voltage-gated cardiac sodium channel, SCN5A, is responsible for the initial upstroke of the action potential. Mutations in the human SCN5A gene cause susceptibility to cardiac arrhythmias and sudden death in the long QT syndrome (LQT). In this report we characterize the genomic structure of SCN5A. SCN5A consists of 28 exons spanning approximately 80 kb on chromosome 3p21. We describe the sequences of all intron/exon boundaries and a dinucleotide repeat polymorphism in intron 16. Oligonucleotide primers based on exon-flanking sequences amplify all SCN5A exons by PCR. This work establishes the complete genomic organization of SCN5A and will enable high-resolution analyses of this locus for mutations associated with LQT and other phenotypes for which SCN5A may be a candidate gene. 40 refs., 4 figs., 2 tabs.

  19. Variants within the 5'-flanking regions of bovine milk-protein-encoding genes. III. Genes encoding the Ca-sensitive caseins αs1, α s2 and β.

    Science.gov (United States)

    Schild, T A; Geldermann, H

    1996-10-01

    The 5'-flanking regions of the Ca-sensitive casein-encoding gene family were analysed for DNA variants by automated DNA sequencing of 13 cows belonging to seven breeds. About 1 kbp of each 5'-flanking region, including non-coding exon I, was amplified by PCR and sequenced bidirectionally. A total number of 34 variable sites (17 for the α s1, 10 for the α s2, and 7 for the β casein encoding gene) was identified. Variants were computer-analysed for location in putative regulatory sites in order to predict potential influences on gene expression.

  20. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  1. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  2. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    Energy Technology Data Exchange (ETDEWEB)

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

    1988-08-01

    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

  3. Chromosomal Abnormalities and Putative Susceptibility Genes in Autism Spectrum Disorders

    DEFF Research Database (Denmark)

    Nielsen, Mette Gilling

    Autism spectrum disorders (ASDs) is a heterogeneous group of neurodevelopmental disorders with a significant genetic component as shown by family and twin studies. However, only a few genes have repeatedly been shown to be involved in the development of ASDs. The aim of this study has been...

  4. Cloning and characterization of the densoviruses susceptible gene ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... ligase and Escherichia coli (DH5α strain) was used for plasmid amplification, and MiniBEST Plasmid Purification Kit (Takara) was used for purification. The DNA sequencing was performed by. Shanghai Sangon Biological Engineering Technology and Services. Co., Ltd. For the +nsd-2 gene expression, the ...

  5. Interleukin Gene Polymorphisms and Susceptibility to HIV Infection

    Indian Academy of Sciences (India)

    Chrysa

    analysis. Running head: Interleukin gene polymorphisms and HIV. Chrissa G. Tsiara,1,2 Georgios K. Nikolopoulos,3* Niki L. Dimou,4 Katerina G. Pantavou,3 Pantelis. G. Bagos,4 Benedicta Mensah,5 Michael Talias,6 Georgia G. Braliou,4 Dimitra ...

  6. Generating a knockdown transgene against Drosophila heterochromatic Tim17b gene encoding mitochondrial translocase subunit.

    Directory of Open Access Journals (Sweden)

    Mikael Garabedian

    Full Text Available Heterochromatic regions of eukaryotic genomes contain multiple functional elements involved in chromosomal dynamics, as well as multiple housekeeping genes. Cytological and molecular peculiarities of heterochromatic loci complicate genetic studies based on standard approaches developed using euchromatic genes. Here, we report the development of an RNAi-based knockdown transgenic construct and red fluorescent reporter transgene for a small gene, Tim17b, which localizes in constitutive heterochromatin of Drosophila melanogaster third chromosome and encodes a mitochondrial translocase subunit. We demonstrate that Tim17b protein is required strictly for protein delivery to mitochondrial matrix. Knockdown of Tim17b completely disrupts functions of the mitochondrial translocase complex. Using fluorescent recovery after photobleaching assay, we show that Tim17b protein has a very stable localization in the membranes of the mitochondrial network and that its exchange rate is close to zero when compared with soluble proteins of mitochondrial matrix. These results confirm that we have developed comprehensive tools to study functions of heterochromatic Tim17b gene.

  7. The pep4 gene encoding proteinase A is involved in dimorphism and pathogenesis of Ustilago maydis.

    Science.gov (United States)

    Soberanes-Gutiérrez, Cinthia V; Juárez-Montiel, Margarita; Olguín-Rodríguez, Omar; Hernández-Rodríguez, César; Ruiz-Herrera, José; Villa-Tanaca, Lourdes

    2015-10-01

    Vacuole proteases have important functions in different physiological processes in fungi. Taking this aspect into consideration, and as a continuation of our studies on the analysis of the proteolytic system of Ustilago maydis, a phytopathogenic member of the Basidiomycota, we have analysed the role of the pep4 gene encoding the vacuolar acid proteinase PrA in the pathogenesis and morphogenesis of the fungus. After confirmation of the location of the protease in the vacuole using fluorescent probes, we obtained deletion mutants of the gene in sexually compatible strains of U. maydis (FB1 and FB2), and analysed their phenotypes. It was observed that the yeast to mycelium dimorphic transition induced by a pH change in the medium, or the use of a fatty acid as sole carbon source, was severely reduced in Δpep4 mutants. In addition, the virulence of the mutants in maize seedlings was reduced, as revealed by the lower proportion of plants infected and the reduction in size of the tumours induced by the pathogen, when compared with wild-type strains. All of these phenotypic alterations were reversed by complementation of the mutant strains with the wild-type gene. These results provide evidence of the importance of the pep4 gene for the morphogenesis and virulence of U. maydis. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  8. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans.

    Science.gov (United States)

    Cernila, Bostjan; Cresnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress.

  9. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-04-01

    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  10. NECC1, a candidate choriocarcinoma suppressor gene that encodes a homeodomain consensus motif.

    Science.gov (United States)

    Asanoma, Kazuo; Matsuda, Takao; Kondo, Haruhiko; Kato, Kiyoko; Kishino, Tatsuya; Niikawa, Norio; Wake, Norio; Kato, Hidenori

    2003-01-01

    We isolated a candidate choriocarcinoma suppressor gene from a PCR-based subtracted fragmentary cDNA library between normal placental villi and the choriocarcinoma cell line CC1. This gene comprises an open reading frame of 219 nt encoding 73 amino acids and contains a homeodomain as a consensus motif. This gene, designated NECC1 (not expressed in choriocarcinoma clone 1), is located on human chromosome 4q11-q12. NECC1 expression is ubiquitous in the brain, placenta, lung, smooth muscle, uterus, bladder, kidney, and spleen. Normal placental villi expressed NECC1, but all choriocarcinoma cell lines examined and most of the surgically removed choriocarcinoma tissue samples failed to express it. We transfected this gene into choriocarcinoma cell lines and observed remarkable alterations in cell morphology and suppression of in vivo tumorigenesis. Induction of CSH1 (chorionic somatomammotropin hormone 1) by NECC1 expression suggested differentiation of choriocarcinoma cells to syncytiotrophoblasts. Our results suggest that loss of NECC1 expression is involved in malignant conversion of placental trophoblasts.

  11. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    Science.gov (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  12. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  13. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  14. The orphan G-protein-coupled receptor-encoding gene V28 is closely related to genes for chemokine receptors and is expressed in lymphoid and neural tissues.

    Science.gov (United States)

    Raport, C J; Schweickart, V L; Eddy, R L; Shows, T B; Gray, P W

    1995-10-03

    A polymerase chain reaction (PCR) strategy with degenerate primers was used to identify novel G-protein-coupled receptor-encoding genes from human genomic DNA. One of the isolated clones, termed V28, showed high sequence similarity to the genes encoding human chemokine receptors for monocyte chemoattractant protein 1 (MCP-1) and macrophage inflammatory protein 1 alpha (MIP-1 alpha)/RANTES, and to the rat orphan receptor-encoding gene RBS11. When RNA was analyzed by Northern blot, V28 was found to be most highly expressed in neural and lymphoid tissues. Myeloid cell lines, particularly THP.1 cells, showed especially high expression of V28. We have mapped V28 to human chromosome 3p21-3pter, near the MIP-1 alpha/RANTES receptor-encoding gene.

  15. Influence of doxorubicin on fluconazole susceptibility and efflux pump gene expression of Candida dubliniensis.

    LENUS (Irish Health Repository)

    Schulz, Bettina

    2012-05-01

    The effect of doxorubicin (DOX) on the fluconazole (FLU) susceptibility of C. dubliniensis was investigated. Isolates were exposed to DOX and FLU in a chequerboard assay and resistance gene expressions were analysed after DOX exposure. The susceptibility of the yeast to FLU was decreased in the presence of DOX in the chequerboard assay with FIC indices suggesting an antagonistic effect. Gene expression analyses showed an overexpression of CdCDR2. Hence, DOX was found to have an impact on resistance mechanisms in C. dubliniensis isolates.

  16. Cold sore susceptibility gene-1 genotypes affect the expression of herpes labialis in unrelated human subjects

    OpenAIRE

    Kriesel, John D.; Bhatia, Amiteshwar; Thomas, Alun

    2014-01-01

    Our group has recently described a gene on human chromosome 21, the Cold Sore Susceptibility Gene-1 (CSSG-1, also known as C21orf91), which may confer susceptibility to frequent cold sores in humans. We present here a genotype?phenotype analysis of CSSG-1 in a new, unrelated human population. Seven hundred fifty-eight human subjects were enrolled in a case/control Cold Sore Study. CSSG-1 genotyping, herpes simplex virus 1 (HSV1) serotyping, demographic and phenotypic data was available from 6...

  17. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  18. Construction of four double gene substitution human x bovine rotavirus reassortant vaccine candidates: each bears two outer capsid human rotavirus genes, one encoding P serotype 1A and the other encoding G serotype 1, 2, 3, or 4 specificity.

    Science.gov (United States)

    Hoshino, Y; Jones, R W; Chanock, R M; Kapikian, A Z

    1997-04-01

    Previously, four human x bovine rotavirus reassortant candidate vaccines, each of which derived ten genes from bovine rotavirus UK strain and only the outer capsid protein VP7-gene from human rotavirus strain D (G serotype 1), DS-1 (G serotype 2), P (G serotype 3), or ST3 (G serotype 4), were developed [Midthun et al., (1985): Journal of Virology 53:949-954; (1986): Journal of Clinical Microbiology 24:822-826]. Such human x bovine reassortant vaccines should theoretically provide antigenic coverage for the four epidemiologically most important VP7(G) serotypes 1, 2, 3, and 4. In an attempt to increase the antigenicity of VP7-based human x animal reassortant rotavirus vaccines which derive a single VP7-encoding gene from the human strain and the remaining ten genes from the animal strain, we generated double gene substitution reassortants. This was done by incorporating another protective antigen (VP4) of an epidemiologically important human rotavirus by crossing human rotavirus Wa strain (P serotype 1A), with each of the human x bovine single VP7-gene substitution rotavirus reassortants. In this way four separate double gene substitution rotavirus reassortants were generated. Each of these reassortants bears the VP4-encoding gene from human rotavirus Wa strain, the VP7-encoding gene from human rotavirus strain D, DS-1, P, or ST3, and the remaining nine genes from bovine rotavirus strain UK. The safety, antigenicity, and protective efficacy of individual components as well as combinations of strains are currently under evaluation.

  19. Association of rs2294008 and rs9297976 Polymorphisms in PSCA Gene with Gastric Cancer Susceptibility in Uzbekistan.

    Science.gov (United States)

    Turdikulova, Shahlo; Dalimova, Dilbar; Abdurakhimov, Abror; Adilov, Bekzod; Navruzov, Sarimbek; Yusupbekov, Abror; Djuraev, Mirjalol; Abdujapparov, Suleyman; Egamberdiev, Dilshod; Mukhamedov, Rustam

    2016-01-01

    Genetic factors play an important role in the development of gastric cancer (GC), a prevalent malignancy in Central Asia. Recent studies have shown that single-nucleotide polymorphisms (SNPs) in several genes are associated with increased GC risk, indicating that genetic variation contributes to gastric carcinogenesis. Located on chromosome 8q24.2, the prostate stem cell antigen (PSCA) gene encodes a 123-amino acid glycoprotein related to the cell-proliferation inhibition and cell-death induction activity. SNPs in PSCA gene have been found to be associated with gastric cancer risk in a genome-wide association study, but results were not conclusive. This study aimed to investigate the association between two polymorphic variants of PSCA gene (rs2294008 and rs9297976) and the susceptibility to gastric cancer in Uzbekistan. Two hundred sixty eight patients with gastric cancer and a control group of 248 healthy individuals were included in this study. DNA samples isolated from these groups were genotyped using PCR-RFLP method. Comparative analysis of resulting genotypes showed a statistically significant association between CT genotype and gastric cancer (p=0.03, additive model of inheritance, Cochran-Armitage trend test). Comparative analysis of the distribution of genotypes of rs2976392 polymorphism did not show a statistically significant difference; however, analysis of the distribution of the rs2976392 genotypes in a subgroup of young women revealed a statistically significant (p = 0.04, additive model of inheritance, Cochran-Armitage trend test) increase in the incidence of AA (38%) and AG (56%) genotypes in patients with GC, compared to the controls (20% and 40%). Our findings support that PSCA rs2294008 and rs9297976 polymorphism may contribute to the susceptibility to gastric cancer. Genotyping of these polymorphisms can potentially be recommended as one of the criteria for identification of high risk groups for gastric cancer development in Uzbekistan.

  20. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo

    2015-03-01

    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  1. The role of ERBB2 gene polymorphisms in leprosy susceptibility.

    Science.gov (United States)

    Rêgo, Jamile Leão; Oliveira, Joyce Moura; Santana, Nadja de Lima; Machado, Paulo Roberto Lima; Castellucci, Léa Cristina

    2015-01-01

    Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p>0.05) in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

  2. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo

    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  3. GAB2 as an Alzheimer Disease Susceptibility Gene

    Science.gov (United States)

    Schjeide, Brit-Maren M.; Hooli, Basavaraj; Parkinson, Michele; Hogan, Meghan F.; DiVito, Jason; Mullin, Kristina; Blacker, Deborah; Tanzi, Rudolph E.; Bertram, Lars

    2009-01-01

    Background Genomewide association (GWA) studies have recently implicated 4 novel Alzheimer disease (AD) susceptibility loci (GAB2, GOLM1, and 2 uncharacterized loci to date on chromosomes 9p and 15q). To our knowledge, these findings have not been independently replicated. Objective To assess these GWA findings in 4 large data sets of families affected by AD. Design Follow-up of genetic association findings in previous studies. Setting Academic research. Participants More than 4000 DNA samples from almost 1300 families affected with AD. Main Outcome Measures Genetic association analysis testing of 4 GWA signals (rs7101429 [GAB2], rs7019241 [GOLM1], rs10519262 [chromosome 15q], and rs9886784 [chromosome 9p]) using family-based methods. Results In the combined analyses, only rs7101429 in GAB2 yielded significant evidence of association with the same allele as in the original GWA study (P = .002). The results are in agreement with recent meta-analyses of this and other GAB2 polymorphisms suggesting approximately a 30% decrease in risk for AD among carriers of the minor alleles. None of the other 3 tested loci showed consistent evidence for association with AD across the investigated data sets. Conclusions GAB2 contains genetic variants that may lead to a modest change in the risk for AD. Despite these promising results, more data from independent samples are needed to better evaluate the potential contribution of GAB2 to AD risk in the general population. PMID:19204163

  4. Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

    Energy Technology Data Exchange (ETDEWEB)

    Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J. [Univ. Hospital, Utrecht (Netherlands)] [and others

    1995-08-01

    Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryotic expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.

  5. Virulence plasmid of Rhodococcus equi contains inducible gene family encoding secreted proteins.

    Science.gov (United States)

    Byrne, B A; Prescott, J F; Palmer, G H; Takai, S; Nicholson, V M; Alperin, D C; Hines, S A

    2001-02-01

    Rhodococcus equi causes severe pyogranulomatous pneumonia in foals. This facultative intracellular pathogen produces similar lesions in immunocompromised humans, particularly in AIDS patients. Virulent strains of R. equi bear a large plasmid that is required for intracellular survival within macrophages and for virulence in foals and mice. Only two plasmid-encoded proteins have been described previously; a 15- to 17-kDa surface protein designated virulence-associated protein A (VapA) and an antigenically related 20-kDa protein (herein designated VapB). These two proteins are not expressed by the same R. equi isolate. We describe here the substantial similarity between VapA and VapB. Moreover, we identify three additional genes carried on the virulence plasmid, vapC, -D, and -E, that are tandemly arranged downstream of vapA. These new genes are members of a gene family and encode proteins that are approximately 50% homologous to VapA, VapB, and each other. vapC, -D, and -E are found only in R. equi strains that express VapA and are highly conserved in VapA-positive isolates from both horses and humans. VapC, -D, and -E are secreted proteins coordinately regulated by temperature with VapA; the proteins are expressed when R. equi is cultured at 37 degrees C but not at 30 degrees C, a finding that is compatible with a role in virulence. As secreted proteins, VapC, -D, and -E may represent targets for the prevention of rhodococcal pneumonia. An immunologic study using VapA-specific antibodies and recombinant Vap proteins revealed no evidence of cross-reactivity despite extensive sequence similarity over the carboxy terminus of all four proteins.

  6. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.

    1997-01-01

    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  7. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  8. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  9. cDNAs of aminopeptidase-like protein genes from Plodia interpunctella strains with different susceptibilities to Bacillus thuringiensis toxins.

    Science.gov (United States)

    Zhu, Y C; Kramer, K J; Oppert, B; Dowdy, A K

    2000-03-01

    Aminopeptidase N has been reported to be a Bacillus thuringiensis (Bt) Cry1A toxin-binding protein in several lepidopteran insects. cDNAs of aminopeptidase-like proteins from both Bt-susceptible RC688s and Bt-resistant HD198r strains of the Indianmeal moth, Plodia interpunctella, were cloned and sequenced. They contain 3345 and 3358 nucleotides, respectively, and each has a 3048 bp open reading frame that encodes 1016 amino acids. Putative protein sequences include 10 potential glycosylation sites and a zinc metal binding site motif of HEXXH, which is typical of the active site of zinc-dependent metallopeptidases. Sequence analysis indicated that the deduced protein sequences are most similar to an aminopeptidase from Heliothis virescens with 62% sequence identity and highly similar to three other lepidopteran aminopeptidases from Plutella xylostella, Manduca sexta, Bombyx mori with sequence identities of 51-52%. Four nucleotide differences were observed in the open reading frames that translated into two amino acid differences in the putative protein sequences. Polymerase chain reaction (PCR) confirmed an aminopeptidase gene coding difference between RC688s and HD198r strains of P. interpunctella in the PCR amplification of a specific allele (PASA) using preferential primers designed from a single base substitution. The gene mutation for Asp185-->Glu185 was also confirmed in two additional Bt-resistant P. interpunctella strains. This mutation is located within a region homologous to the conserved Cry1Aa toxin binding regions from Bombyx mori and Plutella xylostella. The aminopeptidase-like mRNA expression levels in the Bt-resistant strain were slightly higher than those in the Bt-susceptible strain. The sequences reported in this paper have been deposited in the GenBank database (accession numbers AF034483 for susceptible strain RC688s and AF034484 for resistant strain HD198r).

  10. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.

    Science.gov (United States)

    Daniel, R A; Haiech, J; Denizot, F; Errington, J

    1997-09-01

    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  11. Isolation and characterization of the lacA gene encoding beta-galactosidase in Bacillus subtilis and a regulator gene, lacR.

    OpenAIRE

    Daniel, R A; Haiech, J; Denizot, F; Errington, J

    1997-01-01

    We have isolated transposon insertions in the lacA gene encoding an endogenous beta-galactosidase of Bacillus subtilis. Upstream of the putative operon containing lacA is a negative regulator, lacR, which encodes a product related to a family of regulators that includes the lactose repressor, lacI, of Escherichia coli. New strains with insertions in the lacA gene should be of use in studies using lacZ fusions in B. subtilis.

  12. Pseudomonas aeruginosa LysR PA4203 regulator NmoR acts as a repressor of the PA4202 nmoA gene, encoding a nitronate monooxygenase

    DEFF Research Database (Denmark)

    Vercammen, Ken; Wei, Qing; Charlier, Daniel

    2015-01-01

    The PA4203 gene encodes a LysR regulator and lies between the ppgL gene (PA4204), which encodes a periplasmic gluconolactonase, and, in the opposite orientation, the PA4202 (nmoA) gene, coding for a nitronate monooxygenase, and ddlA (PA4201), encoding a d-alanine alanine ligase. The intergenic...... gene, encoding a quinone oxidoreductase, was the most highly upregulated gene in the nmoR deletion mutant, independently of MexT. Finally, deletion of the nmoA gene resulted in an increased sensitivity of the cells to 3-nitropropionic acid (3-NPA), confirming the role of the nitronate monooxygenase...

  13. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    Science.gov (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2015-10-16

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Biological processes, properties and molecular wiring diagrams of candidate low-penetrance breast cancer susceptibility genes

    Directory of Open Access Journals (Sweden)

    Moreno Víctor

    2008-12-01

    Full Text Available Abstract Background Recent advances in whole-genome association studies (WGASs for human cancer risk are beginning to provide the part lists of low-penetrance susceptibility genes. However, statistical analysis in these studies is complicated by the vast number of genetic variants examined and the weak effects observed, as a result of which constraints must be incorporated into the study design and analytical approach. In this scenario, biological attributes beyond the adjusted statistics generally receive little attention and, more importantly, the fundamental biological characteristics of low-penetrance susceptibility genes have yet to be determined. Methods We applied an integrative approach for identifying candidate low-penetrance breast cancer susceptibility genes, their characteristics and molecular networks through the analysis of diverse sources of biological evidence. Results First, examination of the distribution of Gene Ontology terms in ordered WGAS results identified asymmetrical distribution of Cell Communication and Cell Death processes linked to risk. Second, analysis of 11 different types of molecular or functional relationships in genomic and proteomic data sets defined the "omic" properties of candidate genes: i/ differential expression in tumors relative to normal tissue; ii/ somatic genomic copy number changes correlating with gene expression levels; iii/ differentially expressed across age at diagnosis; and iv/ expression changes after BRCA1 perturbation. Finally, network modeling of the effects of variants on germline gene expression showed higher connectivity than expected by chance between novel candidates and with known susceptibility genes, which supports functional relationships and provides mechanistic hypotheses of risk. Conclusion This study proposes that cell communication and cell death are major biological processes perturbed in risk of breast cancer conferred by low-penetrance variants, and defines the common

  15. Biological processes, properties and molecular wiring diagrams of candidate low-penetrance breast cancer susceptibility genes.

    Science.gov (United States)

    Bonifaci, Núria; Berenguer, Antoni; Díez, Javier; Reina, Oscar; Medina, Ignacio; Dopazo, Joaquín; Moreno, Víctor; Pujana, Miguel Angel

    2008-12-18

    Recent advances in whole-genome association studies (WGASs) for human cancer risk are beginning to provide the part lists of low-penetrance susceptibility genes. However, statistical analysis in these studies is complicated by the vast number of genetic variants examined and the weak effects observed, as a result of which constraints must be incorporated into the study design and analytical approach. In this scenario, biological attributes beyond the adjusted statistics generally receive little attention and, more importantly, the fundamental biological characteristics of low-penetrance susceptibility genes have yet to be determined. We applied an integrative approach for identifying candidate low-penetrance breast cancer susceptibility genes, their characteristics and molecular networks through the analysis of diverse sources of biological evidence. First, examination of the distribution of Gene Ontology terms in ordered WGAS results identified asymmetrical distribution of Cell Communication and Cell Death processes linked to risk. Second, analysis of 11 different types of molecular or functional relationships in genomic and proteomic data sets defined the "omic" properties of candidate genes: i/ differential expression in tumors relative to normal tissue; ii/ somatic genomic copy number changes correlating with gene expression levels; iii/ differentially expressed across age at diagnosis; and iv/ expression changes after BRCA1 perturbation. Finally, network modeling of the effects of variants on germline gene expression showed higher connectivity than expected by chance between novel candidates and with known susceptibility genes, which supports functional relationships and provides mechanistic hypotheses of risk. This study proposes that cell communication and cell death are major biological processes perturbed in risk of breast cancer conferred by low-penetrance variants, and defines the common omic properties, molecular interactions and possible functional

  16. Whole exome sequencing identifies novel candidate genes that modify chronic obstructive pulmonary disease susceptibility.

    Science.gov (United States)

    Bruse, Shannon; Moreau, Michael; Bromberg, Yana; Jang, Jun-Ho; Wang, Nan; Ha, Hongseok; Picchi, Maria; Lin, Yong; Langley, Raymond J; Qualls, Clifford; Klensney-Tait, Julia; Zabner, Joseph; Leng, Shuguang; Mao, Jenny; Belinsky, Steven A; Xing, Jinchuan; Nyunoya, Toru

    2016-01-07

    Chronic obstructive pulmonary disease (COPD) is characterized by an irreversible airflow limitation in response to inhalation of noxious stimuli, such as cigarette smoke. However, only 15-20 % smokers manifest COPD, suggesting a role for genetic predisposition. Although genome-wide association studies have identified common genetic variants that are associated with susceptibility to COPD, effect sizes of the identified variants are modest, as is the total heritability accounted for by these variants. In this study, an extreme phenotype exome sequencing study was combined with in vitro modeling to identify COPD candidate genes. We performed whole exome sequencing of 62 highly susceptible smokers and 30 exceptionally resistant smokers to identify rare variants that may contribute to disease risk or resistance to COPD. This was a cross-sectional case-control study without therapeutic intervention or longitudinal follow-up information. We identified candidate genes based on rare variant analyses and evaluated exonic variants to pinpoint individual genes whose function was computationally established to be significantly different between susceptible and resistant smokers. Top scoring candidate genes from these analyses were further filtered by requiring that each gene be expressed in human bronchial epithelial cells (HBECs). A total of 81 candidate genes were thus selected for in vitro functional testing in cigarette smoke extract (CSE)-exposed HBECs. Using small interfering RNA (siRNA)-mediated gene silencing experiments, we showed that silencing of several candidate genes augmented CSE-induced cytotoxicity in vitro. Our integrative analysis through both genetic and functional approaches identified two candidate genes (TACC2 and MYO1E) that augment cigarette smoke (CS)-induced cytotoxicity and, potentially, COPD susceptibility.

  17. Biocide Susceptibility of Staphylococcus aureus CC398 and CC30 Isolates from Pigs and Identification of the Biocide Resistance Genes, qacG and qacC.

    Science.gov (United States)

    Seier-Petersen, Maria Amalie; Nielsen, Lene Nørby; Ingmer, Hanne; Aarestrup, Frank Møller; Agersø, Yvonne

    2015-10-01

    Methicillin-resistant Staphylococcus aureus (MRSA), in particular clonal complex (CC) 398, is increasingly found in livestock. Recently, MRSA CC30 was identified in Danish pigs. We determined the susceptibility of porcine S. aureus isolates of CC398 and CC30 to disinfectants used in pig farming (benzalkonium chloride, hydrogen peroxide, formaldehyde, sodium hypochlorite, and caustic soda). Furthermore, efflux pump activity, antimicrobial resistance profiles, hemolysis properties, and the presence of toxic shock syndrome toxin-1 (TSST-1) and Panton-Valentine Leukocidin (PVL)-encoding virulence factors were investigated. Susceptibilities to biocides and antimicrobial agents of 79 porcine S. aureus isolates were determined by the microdilution method. Isolates comprised 21 methicillin-sensitive S. aureus (MSSA) and 40 MRSA isolates belonging to CC398 and 13 MSSA and 5 MRSA isolates belonging to CC30. The presence of quaternary ammonium compound (QAC) resistance efflux pumps was analyzed using an ethidium bromide accumulation assay. The presence of qac resistance genes in active efflux pump positive isolates was determined by whole-genome sequencing data. All isolates were screened for lukPV and tst genes with PCR, and hemolytic activities were determined using an agar plate assay. S. aureus isolates did not show reduced susceptibility to the biocides tested. However, the QAC resistance gene, qacG, was detected in three MRSA CC30 isolates and the qacC in one MRSA CC30 isolate. CC30 isolates were generally more susceptible to non-beta-lactam antibiotics than CC398. Isolates generally had low hemolytic activity and none encoded PVL or TSST-1. The presence of qac genes in European porcine S. aureus isolates and in livestock-associated MRSA CC30 is for the first time described in this study. This finding is concerning as it ultimately may compromise disinfection with QACs and thereby contribute to the selection and spread of MRSA CC30.

  18. Cloning and expression of putative cytotonic enterotoxin-encoding genes from Aeromonas hydrophila.

    Science.gov (United States)

    Chopra, A K; Pham, R; Houston, C W

    1994-02-11

    A genomic library from a diarrheal isolate, SSU, of Aeromonas hydrophila was constructed in a cosmid vector, pHC79, and in bacteriophage lambda EMBL3. Cell lysates from various Escherichia coli clones containing the recombinant cosmid were examined for their ability to elongate Chinese hamster ovary (CHO) cells, which is a typical enterotoxic response. Based on restriction analysis, a 4.0-kb SalI DNA fragment from one of the clones that exhibited enterotoxic activity was subcloned into a bacteriophage T7 RNA polymerase/promoter hyperexpression system. The cell lysate from this E. coli [pSL24] clone caused CHO cells to elongate and revealed the presence of a major 35-kDa polypeptide by [35S]methionine labeling and sodium dodecyl sulfate (SDS)-polyacrylamide-gel electrophoresis (PAGE). The toxin was biologically heat labile, losing all activity within 20 min at 56 degrees C. In addition, another enterotoxin-producing clone, E. coli[pSBS32], was isolated from cosmid and lambda bacteriophage libraries. We localized this heat-stable (56 degrees C/20 min) enterotoxin to a 4.8-kb SalI-BamHI fragment. Both enterotoxins caused elevation of cyclic adenosine monophosphate (cAMP) in CHO cells. The DNA fragments encoding these enterotoxins did not hybridize with each other. However, a 4.8-kb SalI-BamHI DNA fragment encoding a heat-stable enterotoxin hybridized to a 3.5-kb BamHI DNA fragment of a plasmid, pHPC100, that contained a cytotonic enterotoxin-encoding gene isolated from A. trota. Our data suggest Aeromonas species produce different structural types of cytotonic enterotoxins that are functionally similar.

  19. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...

  20. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom

    2004-08-01

    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  1. Design and evaluation of novel primers for the detection of genes encoding diverse enzymes of methylotrophy and autotrophy.

    Science.gov (United States)

    Hung, Wei-Lian; Wade, William G; Chen, Yin; Kelly, Donovan P; Wood, Ann P

    2012-01-01

    The phylogenetic significance of the diversity of key enzymes of methylotrophic and autotrophic metabolism is discussed. Primers for these key enzymes were designed using gene sequences encoding methanol dehydrogenase (mxaF; using subsets from database sequences for 22 Bacteria), hydroxypyruvate reductase (hpr; 36 sequences), methylamine dehydrogenase (mauA; 12 sequences), methanesulfonate monooxygenase (msmA; four sequences), and the ccbL and cbbM genes of ribulose bisphosphate carboxylase (26 and 23 sequences). These were effective in amplifying the correct gene products for the target genes in reference organisms and in test organisms not previously shown to contain the genes, as well as in some methylotrophic Proteobacteria isolated from the human mouth. The availability of the new primers increases the probability of detecting diverse examples of the genes encoding these key enzymes both in natural populations and in isolated bacterial strains.

  2. Contribution of the two genes encoding histone variant h3.3 to viability and fertility in mice.

    Directory of Open Access Journals (Sweden)

    Michelle C W Tang

    2015-02-01

    Full Text Available Histones package DNA and regulate epigenetic states. For the latter, probably the most important histone is H3. Mammals have three near-identical H3 isoforms: canonical H3.1 and H3.2, and the replication-independent variant H3.3. This variant can accumulate in slowly dividing somatic cells, replacing canonical H3. Some replication-independent histones, through their ability to incorporate outside S-phase, are functionally important in the very slowly dividing mammalian germ line. Much remains to be learned of H3.3 functions in germ cell development. Histone H3.3 presents a unique genetic paradigm in that two conventional intron-containing genes encode the identical protein. Here, we present a comprehensive analysis of the developmental effects of null mutations in each of these genes. H3f3a mutants were viable to adulthood. Females were fertile, while males were subfertile with dysmorphic spermatozoa. H3f3b mutants were growth-deficient, dying at birth. H3f3b heterozygotes were also growth-deficient, with males being sterile because of arrest of round spermatids. This sterility was not accompanied by abnormalities in sex chromosome inactivation in meiosis I. Conditional ablation of H3f3b at the beginning of folliculogenesis resulted in zygote cleavage failure, establishing H3f3b as a maternal-effect gene, and revealing a requirement for H3.3 in the first mitosis. Simultaneous ablation of H3f3a and H3f3b in folliculogenesis resulted in early primary oocyte death, demonstrating a crucial role for H3.3 in oogenesis. These findings reveal a heavy reliance on H3.3 for growth, gametogenesis, and fertilization, identifying developmental processes that are particularly susceptible to H3.3 deficiency. They also reveal partial redundancy in function of H3f3a and H3f3b, with the latter gene being generally the most important.

  3. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  4. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  5. Sudden infant death syndrome caused by cardiac arrhythmias: only a matter of genes encoding ion channels?

    Science.gov (United States)

    Sarquella-Brugada, Georgia; Campuzano, Oscar; Cesar, Sergi; Iglesias, Anna; Fernandez, Anna; Brugada, Josep; Brugada, Ramon

    2016-03-01

    Sudden infant death syndrome is the unexpected demise of a child younger than 1 year of age which remains unexplained after a complete autopsy investigation. Usually, it occurs during sleep, in males, and during the first 12 weeks of life. The pathophysiological mechanism underlying the death is unknown, and the lethal episode is considered multifactorial. However, in cases without a conclusive post-mortem diagnosis, suspicious of cardiac arrhythmias may also be considered as a cause of death, especially in families suffering from any cardiac disease associated with sudden cardiac death. Here, we review current understanding of sudden infant death, focusing on genetic causes leading to lethal cardiac arrhythmias, considering both genes encoding ion channels as well as structural proteins due to recent association of channelopathies and desmosomal genes. We support a comprehensive analysis of all genes associated with sudden cardiac death in families suffering of infant death. It allows the identification of the most plausible cause of death but also of family members at risk, providing cardiologists with essential data to adopt therapeutic preventive measures in families affected with this lethal entity.

  6. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  7. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  8. Mutations Affecting Light Regulation of Nuclear Genes Encoding Chloroplast Glyceraldehyde-3-Phosphate Dehydrogenase in Arabidopsis1

    Science.gov (United States)

    Chan, Chui Sien; Peng, Hsiao-Ping; Shih, Ming-Che

    2002-01-01

    Expression of nuclear genes that encode the A and B subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPA and GAPB) of Arabidopsis is known to be regulated by light. We used a negative selection approach to isolate mutants that were defective in light-regulated expression of the GAPA gene. Two dominant mutants belonging to the same complementation group, uga1-1 and uga1-2, were then characterized. These two mutants showed a dramatic reduction in GAPA mRNA level in both mature plants and seedlings. Surprisingly, mutations in uga1-1 and uga1-2 had no effect on the expression of GAPB and several other light-regulated genes. In addition, we found that the chloroplast glyceraldehyde-3-phosphate dehydrogenase enzyme activity of the mutants was only slightly lower than that of the wild type. Western-blot analysis showed that the GAPA protein level was nearly indistinguishable between the wild-type and the uga mutants. These results suggested that posttranscriptional control was involved in the up-regulation of the GAPA protein in the mutants. The uga1-1 mutation was mapped to the bottom arm of chromosome V of the Arabidopsis genome. PMID:12428012

  9. Mutations affecting light regulation of nuclear genes encoding chloroplast glyceraldehyde-3-phosphate dehydrogenase in Arabidopsis.

    Science.gov (United States)

    Chan, Chui Sien; Peng, Hsiao-Ping; Shih, Ming-Che

    2002-11-01

    Expression of nuclear genes that encode the A and B subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPA and GAPB) of Arabidopsis is known to be regulated by light. We used a negative selection approach to isolate mutants that were defective in light-regulated expression of the GAPA gene. Two dominant mutants belonging to the same complementation group, uga1-1 and uga1-2, were then characterized. These two mutants showed a dramatic reduction in GAPA mRNA level in both mature plants and seedlings. Surprisingly, mutations in uga1-1 and uga1-2 had no effect on the expression of GAPB and several other light-regulated genes. In addition, we found that the chloroplast glyceraldehyde-3-phosphate dehydrogenase enzyme activity of the mutants was only slightly lower than that of the wild type. Western-blot analysis showed that the GAPA protein level was nearly indistinguishable between the wild-type and the uga mutants. These results suggested that posttranscriptional control was involved in the up-regulation of the GAPA protein in the mutants. The uga1-1 mutation was mapped to the bottom arm of chromosome V of the Arabidopsis genome.

  10. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger

    2017-01-01

    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  11. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  12. Analysis of a polygalacturonase gene of Ustilago maydis and characterization of the encoded enzyme.

    Science.gov (United States)

    Castruita-Domínguez, José P; González-Hernández, Sandra E; Polaina, Julio; Flores-Villavicencio, Lérida L; Alvarez-Vargas, Aurelio; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Leal-Morales, Carlos A

    2014-05-01

    Ustilago maydis is a pathogenic fungus that produces the corn smut. It is a biotrophic parasite that depends on living plant tissues for its proliferation and development. Polygalacturonases are secreted by pathogens to solubilize the plant cell-wall and are required for pathogen virulence. In this paper, we report the isolation of a U. maydis polygalacturonase gene (Pgu1) and the functional and structural characterization of the encoded enzyme. The U. maydis Pgu1 gene is expressed when the fungus is grown in liquid culture media containing different carbon sources. In plant tissue, the expression increased as a function of incubation time. Pgu1 gene expression was detected during plant infection around 10 days post-infection with U. maydis FB-D12 strain in combination with teliospore formation. Synthesis and secretion of active recombinant PGU1 were achieved using Pichia pastoris, the purified enzyme had a optimum temperature of 34 °C, optimum pH of 4.5, a Km of 57.84 g/L for polygalacturonic acid, and a Vmax of 28.9 µg/min mg. Structural models of PGU1 based on homologous enzymes yielded a typical right-handed β-helix fold of pectinolytic enzymes classified in the glycosyl hydrolases family 28, and the U. maydis PGU1 is related with endo rather than exo polygalacturonases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The novel BLM3 gene encodes a protein that protects against lethal effects of oxidative damage.

    Science.gov (United States)

    Febres, D E; Pramanik, A; Caton, M; Doherty, K; McKoy, J; Garcia, E; Alejo, W; Moore, C W

    2001-11-01

    Mutational alteration of the BLM3 gene in Saccharomyces cerevisiae confers hypersensitivities to lethal effects of ionizing radiation, anticancer bleomycins and structurally-related phleomycins. Bleomycin is used clinically in the treatment of many types of cancers, including Kaposi's sarcoma. The BLM3 gene was cloned from a genomic library by complementing the drug hypersensitivities conferred by the codominant blm3-1 mutation. The nucleotide sequence of BLM3 encodes a predicted integral protein of 1804 amino acids with seven to ten potential transmembrane domains and additional motifs. The blm3 null mutation was created by gene replacement, and found not to be essential for growth in the absence of the bleomycin-phleomycin antibiotics. Sequence analyses suggest the Blm3p could be a potential member of the major facilitator superfamily (MFS) of permeases. Northern dot blot analyses using a human RNA master tissue blot containing RNA from fifty different fetal and adult tissues revealed sequence homology in adult tissues to BLM3, but no sequence homology in fetal tissues. The function of the Blm3p is presently unknown. We propose several functions for the Blm3p in protecting cells against oxidative agents, including roles in detoxification, transport and defending against DNA damage.

  14. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  15. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells.

    Science.gov (United States)

    Sateriale, Adam; Miller, Peter; Huston, Christopher D

    2016-04-01

    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Calcium-activated potassium (BK) channels are encoded by duplicate slo1 genes in teleost fishes.

    Science.gov (United States)

    Rohmann, Kevin N; Deitcher, David L; Bass, Andrew H

    2009-07-01

    Calcium-activated, large conductance potassium (BK) channels in tetrapods are encoded by a single slo1 gene, which undergoes extensive alternative splicing. Alternative splicing generates a high level of functional diversity in BK channels that contributes to the wide range of frequencies electrically tuned by the inner ear hair cells of many tetrapods. To date, the role of BK channels in hearing among teleost fishes has not been investigated at the molecular level, although teleosts account for approximately half of all extant vertebrate species. We identified slo1 genes in teleost and nonteleost fishes using polymerase chain reaction and genetic sequence databases. In contrast to tetrapods, all teleosts examined were found to express duplicate slo1 genes in the central nervous system, whereas nonteleosts that diverged prior to the teleost whole-genome duplication event express a single slo1 gene. Phylogenetic analyses further revealed that whereas other slo1 duplicates were the result of a single duplication event, an independent duplication occurred in a basal teleost (Anguilla rostrata) following the slo1 duplication in teleosts. A third, independent slo1 duplication (autotetraploidization) occurred in salmonids. Comparison of teleost slo1 genomic sequences to their tetrapod orthologue revealed a reduced number of alternative splice sites in both slo1 co-orthologues. For the teleost Porichthys notatus, a focal study species that vocalizes with maximal spectral energy in the range electrically tuned by BK channels in the inner ear, peripheral tissues show the expression of either one (e.g., vocal muscle) or both (e.g., inner ear) slo1 paralogues with important implications for both auditory and vocal physiology. Additional loss of expression of one slo1 paralogue in nonneural tissues in P. notatus suggests that slo1 duplicates were retained via subfunctionalization. Together, the results predict that teleost fish achieve a diversity of BK channel subfunction via

  17. Wound healing genes and susceptibility to cutaneous leishmaniasis in Brazil.

    Science.gov (United States)

    Castellucci, Léa; Jamieson, Sarra E; Almeida, Lucas; Oliveira, Joyce; Guimarães, Luiz Henrique; Lessa, Marcus; Fakiola, Michaela; Jesus, Amélia Ribeiro de; Nancy Miller, E; Carvalho, Edgar M; Blackwell, Jenefer M

    2012-07-01

    Leishmania braziliensis causes cutaneous (CL) and mucosal (ML) leishmaniasis. In the mouse, Fli1 was identified as a gene influencing enhanced wound healing and resistance to CL caused by Leishmania major. Polymorphism at FLI1 is associated with CL caused by L. braziliensis in humans, with an inverse association observed for ML disease. Here we extend the analysis to look at other wound healing genes, including CTGF, TGFB1, TGFBR1/2, SMADS 2/3/4/7 and FLII, all functionally linked along with FLI1 in the TGF beta pathway. Haplotype tagging single nucleotide polymorphisms (tag-SNPs) were genotyped using Taqman technology in 325 nuclear families (652 CL cases; 126 ML cases) from Brazil. Robust case-pseudocontrol (CPC) conditional logistic regression analysis showed associations between CL and SNPs at CTGF (SNP rs6918698; CC genotype; OR 1.67; 95%CI 1.10-2.54; P=0.016), TGFBR2 (rs1962859; OR 1.50; 95%CI 1.12-1.99; P=0.005), SMAD2 (rs1792658; OR 1.57; 95%CI 1.04-2.38; P=0.03), SMAD7 (rs4464148; AA genotype; OR 2.80; 95%CI 1.00-7.87; P=0.05) and FLII (rs2071242; OR 1.60; 95%CI 1.14-2.24; P=0.005), and between ML and SNPs at SMAD3 (rs1465841; OR 2.15; 95%CI 1.13-4.07; P=0.018) and SMAD7 (rs2337107; TT genotype; OR 3.70; 95%CI 1.27-10.7; P=0.016). Stepwise logistic regression analysis showed that all SNPs associated with CL at FLI1, CTGF, TGFBR2, and FLII showed independent effects from each other, but SNPs at SMAD2 and SMAD7 did not add independent effects to SNPs from other genes. These results suggest that TGFβ signalling via SMAD2 is important in directing events that contribute to CL, whereas signalling via SMAD3 is important in ML. Both are modulated by the inhibitory SMAD7 that acts upstream of SMAD2 and SMAD3 in this signalling pathway. Along with the published FLI1 association, these data further contribute to the hypothesis that wound healing processes are important determinants of pathology associated with cutaneous forms of leishmaniasis. Copyright © 2012

  18. Triple subcellular targeting of isopentenyl diphosphate isomerases encoded by a single gene.

    Science.gov (United States)

    Guirimand, Grégory; Guihur, Anthony; Phillips, Michael A; Oudin, Audrey; Glévarec, Gaëlle; Mahroug, Samira; Melin, Céline; Papon, Nicolas; Clastre, Marc; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Rodríguez-Concepción, Manuel; Burlat, Vincent; Courdavault, Vincent

    2012-11-01

    Isopentenyl diphosphate isomerase (IDI) is a key enzyme of the isoprenoid pathway, catalyzing the interconversion of isopentenyl diphosphate and dimethylallyl diphosphate, the universal precursors of all isoprenoids. In plants, several subcellular compartments, including cytosol/ER, peroxisomes, mitochondria and plastids, are involved in isoprenoid biosynthesis. Here, we report on the unique triple targeting of two Catharanthus roseus IDI isoforms encoded by a single gene (CrIDI1). The triple localization of CrIDI1 in mitochondria, plastids and peroxisomes is explained by alternative transcription initiation of CrIDI1, by the specificity of a bifunctional N-terminal mitochondria/plastid transit peptide and by the presence of a C-terminal peroxisomal targeting signal. Moreover, bimolecular fluorescence complementation assays revealed self-interactions suggesting that the IDI likely acts as a multimer in vivo.

  19. Chromosomal location of the genes encoding complement components C5 and factor H in the mouse

    DEFF Research Database (Denmark)

    D'Eustachio, P; Kristensen, Torsten; Wetsel, R A

    1986-01-01

    Complementary DNA probes corresponding to the factor H and C5 polypeptides have been used to determine the chromosomal localizations of these two complement components. Both probes revealed complex and polymorphic arrays of DNA fragments in Southern blot analysis of mouse genomic DNA. Following...... to chromosome 1 or chromosome 3. Following the inheritance of DNA restriction fragment-length polymorphisms revealed by the probes in recombinant inbred mouse strains allowed the factor H-associated fragments to be mapped to Sas-1 on chromosome 1, and the C5-associated fragments to be mapped to Hc. Analysis...... of three-point crosses, in turn, placed the latter locus 19 cM distal to Sd on chromosome 2. We have designated the two loci Cfh and C5, respectively. This genetic analysis raises the possibility that C5 and factor H are both encoded by complex loci composed of distinct structural and regulatory genes....

  20. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters.

    Science.gov (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann

    2017-04-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  1. MED resulting from recessively inherited mutations in the gene encoding calcium-activated nucleotidase CANT1.

    Science.gov (United States)

    Balasubramanian, Karthika; Li, Bing; Krakow, Deborah; Nevarez, Lisette; Ho, Patric J; Ainsworth, Julia A; Nickerson, Deborah A; Bamshad, Michael J; Immken, LaDonna; Lachman, Ralph S; Cohn, Daniel H

    2017-09-01

    Multiple Epiphyseal Dysplasia (MED) is a relatively mild skeletal dysplasia characterized by mild short stature, joint pain, and early-onset osteoarthropathy. Dominantly inherited mutations in COMP, MATN3, COL9A1, COL9A2, and COL9A3, and recessively inherited mutations in SLC26A2, account for the molecular basis of disease in about 80-85% of the cases. In two families with recurrent MED of an unknown molecular basis, we used exome sequencing and candidate gene analysis to identify homozygosity for recessively inherited missense mutations in CANT1, which encodes calcium-activated nucleotidase 1. The MED phenotype is thus allelic to the more severe Desbuquois dysplasia phenotype and the results identify CANT1 as a second locus for recessively inherited MED. © 2017 Wiley Periodicals, Inc.

  2. Cloning and identification of a gene encoding spore cortex-lytic enzyme in Bacillus thuringiensis.

    Science.gov (United States)

    Hu, Kun; Yang, Haihua; Liu, Gang; Tan, Huarong

    2007-04-01

    Spore cortex-lytic enzymes are essential for germination in Bacilli. A gene-encoding spore cortex-lytic enzyme designated sleB was cloned from Bacillus thuringiensis. Disruption of sleB did not affect vegetative growth of B. thuringiensis, but the fall in optical density at 600 nm in the mutant spores was much slower than in the wild type strain during spore germination induced by L-alanine. Moreover, the mutant spores did not become completely dark, as compared with the wild type strain. These showed that sleB is required for normal spore germination in B. thuringiensis. Reverse transcription polymerase chain reaction analysis indicated that sleB is transcribed during sporulation. Western blot experiment also proved that SleB accumulated in sporulating cells as a precursor protein, and in spores as a mature processed form.

  3. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  4. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  5. Stable disruption of ethanol production by deletion of the genes encoding alcohol dehydrogenase isozymes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ida, Yoshihiro; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi

    2012-02-01

    We analyzed the effects of the deletions of genes encoding alcohol dehydrogenase (ADH) isozymes of Saccharomyces cerevisiae. The decrease in ethanol production by ADH1 deletion alone could be partially compensated by the upregulation of other isozyme genes, while the deletion of all known ADH isozyme genes stably disrupted ethanol production. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. Cloning and overexpression in Escherichia coli of the genes encoding NAD-dependent alcohol dehydrogenase from two Sulfolobus species.

    Science.gov (United States)

    Cannio, R; Fiorentino, G; Carpinelli, P; Rossi, M; Bartolucci, S

    1996-01-01

    The gene adh encoding a NAD-dependent alcohol dehydrogenase from the novel strain RC3 of Sulfolobus sp. was cloned and sequenced. Both the adh gene from Sulfolobus sp. strain RC3 and the alcohol dehydrogenase gene from Sulfolobus solfataricus (DSM 1617) were expressed at a high level in Escherichia coli, and the recombinant enzymes were purified, characterized, and compared. Only a few amino acid replacements were responsible for the different kinetic and physicochemical features investigated. PMID:8550434

  7. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  8. The microcephaly ASPM gene is expressed in proliferating tissues and encodes for a mitotic spindle protein.

    Science.gov (United States)

    Kouprina, Natalay; Pavlicek, Adam; Collins, N Keith; Nakano, Megumi; Noskov, Vladimir N; Ohzeki, Jun-Ichirou; Mochida, Ganeshwaran H; Risinger, John I; Goldsmith, Paul; Gunsior, Michelle; Solomon, Greg; Gersch, William; Kim, Jung-Hyun; Barrett, J Carl; Walsh, Christopher A; Jurka, Jerzy; Masumoto, Hiroshi; Larionov, Vladimir

    2005-08-01

    The most common cause of primary autosomal recessive microcephaly (MCPH) appears to be mutations in the ASPM gene which is involved in the regulation of neurogenesis. The predicted gene product contains two putative N-terminal calponin-homology (CH) domains and a block of putative calmodulin-binding IQ domains common in actin binding cytoskeletal and signaling proteins. Previous studies in mouse suggest that ASPM is preferentially expressed in the developing brain. Our analyses reveal that ASPM is widely expressed in fetal and adult tissues and upregulated in malignant cells. Several alternatively spliced variants encoding putative ASPM isoforms with different numbers of IQ motifs were identified. The major ASPM transcript contains 81 IQ domains, most of which are organized into a higher order repeat (HOR) structure. Another prominent spliced form contains an in-frame deletion of exon 18 and encodes 14 IQ domains not organized into a HOR. This variant is conserved in mouse. Other spliced variants lacking both CH domains and a part of the IQ motifs were also detected, suggesting the existence of isoforms with potentially different functions. To elucidate the biochemical function of human ASPM, we developed peptide specific antibodies to the N- and C-termini of ASPM. In a western analysis of proteins from cultured human and mouse cells, the antibodies detected bands with mobilities corresponding to the predicted ASPM isoforms. Immunostaining of cultured human cells with antibodies revealed that ASPM is localized in the spindle poles during mitosis. This finding suggests that MCPH is the consequence of an impairment in mitotic spindle regulation in cortical progenitors due to mutations in ASPM.

  9. Genome-wide search for atopy susceptibility genes in Dutch families with asthma

    NARCIS (Netherlands)

    Koppelman, GH; Stine, OC; Howard, TD; Zheng, SQL; Kauffman, HF; Bleecker, ER; Meyers, DA; Postma, DS

    Background: Atopy is a phenotype associated with asthma that has a heritable component. However, the role of atopy-susceptibility genes in the development and expression of asthma and allergic disorders is not understood. Objective: We sought to study the familial aggregation and co-occurrence of

  10. Influence of the IL6 Gene in Susceptibility to Systemic Sclerosis

    NARCIS (Netherlands)

    Cenit, M.C.; Simeon, C.P.; Vonk, M.C.; Callejas-Rubio, J.L.; Espinosa, G.; Carreira, P.; Blanco, F.J.; Narvaez, J.; Tolosa, C.; Roman-Ivorra, J.A.; Gomez-Garcia, I.; Garcia-Hernandez, F.J.; Gallego, M.; Garcia-Portales, R.; Egurbide, M.V.; Fonollosa, V.; Garcia de la Pena, P.; Lopez-Longo, F.J.; Gonzalez-Gay, M.A.; The Spanish Scleroderma, G.; Hesselstrand, R.; Riemekasten, G.; Witte, T.; Voskuyl, A.E.; Schuerwegh, A.J.; Madhok, R.; Fonseca, C.; Denton, C.; Nordin, A.; Palm, O.; Laar, J.M. van; Hunzelmann, N.; Distler, J.H.; Kreuter, A.; Herrick, A.; Worthington, J.; Koeleman, B.P.; Radstake, T.R.D.J.; Martin, J.

    2012-01-01

    OBJECTIVE: Systemic sclerosis (SSc) is a genetically complex autoimmune disease; the genetic component has not been fully defined. Interleukin 6 (IL-6) plays a crucial role in immunity and fibrosis, both key aspects of SSc. We investigated the influence of IL6 gene in the susceptibility and

  11. Enrichment of putative PAX8 target genes at serous epithelial ovarian cancer susceptibility loci

    DEFF Research Database (Denmark)

    Kar, Siddhartha P; Adler, Emily; Tyrer, Jonathan

    2017-01-01

    BACKGROUND: Genome-wide association studies (GWAS) have identified 18 loci associated with serous ovarian cancer (SOC) susceptibility but the biological mechanisms driving these findings remain poorly characterised. Germline cancer risk loci may be enriched for target genes of transcription facto...

  12. Variation at the serotonin transporter gene influences susceptibility to bipolar affective puerperal psychosis.

    Science.gov (United States)

    Coyle, N; Jones, I; Robertson, E; Lendon, C; Craddock, N

    2000-10-28

    Up to half of parous females with bipolar disorder (manic depression) develop an episode of severe psychiatric disturbance, usually called puerperal psychosis, within a few days of giving birth. We report significant evidence (p<0.003) that variation at the serotonin transporter gene exerts a substantial (odds ratio=4) and important (population attributable fraction=69%) influence on susceptibility to such episodes.

  13. The Nuclear Death Domain Protein p84N5; a Candidate Breast Cancer Susceptibility Gene

    National Research Council Canada - National Science Library

    Godwin, Andrew

    2006-01-01

    ...% of all cases of breast cancer exhibit a familial pattern of incidence. Efforts to identify the genetic basis of familial breast cancer reached fruition some years ago, when the breast-cancer susceptibility genes BRCA1 and BRCA2 were identified...

  14. Genetic variability of glutamate-gated chloride channel genes in ivermectin-susceptible and -resistant strains of Cooperia oncophora.

    Science.gov (United States)

    Njue, A I; Prichard, R K

    2004-12-01

    The glutamate-gated chloride channels (GluCls) are members of the ligand-gated ion channel superfamily that are thought to be involved in the mode of action of ivermectin and mechanism of resistance. Using reverse-transcriptase PCR techniques, 2 full-length GluCl cDNAs, encoding GluClalpha3 and GluClbeta subunits, were cloned from Cooperia oncophora, a nematode parasite of cattle. The two sequences show a high degree of identity to similar subunits from other nematodes. The C. oncophora GluClalpha3 subunit is most closely related to the Haemonchus contortus GluClalpha3B subunit, while C. oncophora GluClbeta subunit shares high sequence identity with the H. contortus GluClbeta subunit. Using single-strand conformation polymorphism, the genetic variability of these two genes was analysed in an ivermectin-susceptible isolate and an ivermectin-resistant field isolate of C. oncophora. Statistical analysis suggested an association between the C. oncophora GluClalpha3 gene and ivermectin resistance. No such association was seen with the GluClbeta gene.

  15. Linkage analysis of bipolar illness with X-chromosome DNA markers: A susceptibility gene in Xq27-q28 cannot be excluded

    Energy Technology Data Exchange (ETDEWEB)

    De bruyn, A.; Raeymaekers, P.; Raes, G. [Univ. of Antwerp (Belgium)] [and others

    1994-12-15

    Transmission studies have supported the presence of a susceptibility gene for bipolar (BP) illness on the X-chromosome. Initial linkage studies with color blindness (CB), glucose-6-phosphate dehydrogenase (G6PD) deficiency, and the blood coagulation factor IX (F9) have suggested that a gene for BP illness is located in the Xq27-q28 region. We tested linkage with several DNA markers located in Xq27-q28 in 2 families, MAD3 and MAD4, that previously were linked to F9, and 7 newly ascertained families of BP probands. Linkage was also examined with the gene encoding the {alpha}3 subunit of the gamma-amino butyric acid receptor (GABRA3), a candidate gene for BP illness located in this region. The genetic data were analyzed with the LOD score method using age-dependent penetrance of an autosomal dominant disease gene and narrow and broad clinical models. In MAD3 and MAD4 the multipoint LOD score data suggested a localization of a BPI gene again near F9. In the 7 new families the overall linkage data excluded the Xq27-q28 region. However, if the families were grouped according to their proband`s phenotype BPI or BPII, a susceptibility gene for BPI disorder at the DXS52-F8 cluster could not be excluded. 48 refs., 2 figs., 3 tabs.

  16. Detection of vanC1 gene transcription in vancomycin-susceptible Enterococcus faecalis

    Science.gov (United States)

    de Moura, Tiane Martin; Cassenego, Ana Paula Vaz; Campos, Fabrício Souza; Ribeiro, Andrea Machado Leal; Franco, Ana Cláudia; d'Azevedo, Pedro Alves; Frazzon, Jeverson; Frazzon, Ana Paula Guedes

    2013-01-01

    Here we report the presence and expression levels of the vanC 1 and vanC 2/3 genes in vancomycin-susceptible strains of Enterococcus faecalis. The vanC 1 and vanC 2/3 genes were located in the plasmid DNA and on the chromosome, respectively. Specific mRNA of the vanC 1 gene was detected in one of these strains. Additionally, analysis of the vanC gene sequences showed that these genes are related to the vanC genes of Enterococcus gallinarum and Enterococcus casseliflavus. The presence of vanC genes is useful for the identification of E. gallinarum and E. casseliflavus. Moreover, this is the first report of vanC mRNA in E. faecalis. PMID:23828012

  17. Detection of vanC 1 gene transcription in vancomycin-susceptible Enterococcus faecalis

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2013-06-01

    Full Text Available Here we report the presence and expression levels of the vanC 1 and vanC 2/3 genes in vancomycin-susceptible strains of Enterococcus faecalis. The vanC 1 and vanC 2/3 genes were located in the plasmid DNA and on the chromosome, respectively. Specific mRNA of the vanC 1 gene was detected in one of these strains. Additionally, analysis of the vanC gene sequences showed that these genes are related to the vanC genes of Enterococcus gallinarum and Enterococcus casseliflavus. The presence of vanC genes is useful for the identification of E. gallinarum and E. casseliflavus. Moreover, this is the first report of vanC mRNA in E. faecalis.

  18. The k43 gene, required for chorion gene amplification and diploid cell chromosome replication, encodes the Drosophila homolog of yeast origin recognition complex subunit 2

    OpenAIRE

    Landis, Gary; Kelley, Richard; Spradling, Allan C.; Tower, John

    1997-01-01

    Lethal alleles of the Drosophila k43 gene result in small or missing imaginal discs, greatly reduced mitotic index, and fragmented and abnormally condensed chromosomes. A female-sterile allele of k43 specifically reduces chorion gene amplification in ovarian follicle cells. k43 was cloned by chromosomal walking, and the identification of the k43 gene was confirmed by phenotypic rescue and sequence analysis of mutant alleles. The sequence analyses reveal that the k43 gene encodes the Drosophil...

  19. Association analysis of a highly polymorphic CAG Repeat in the human potassium channel gene KCNN3 and migraine susceptibility

    Directory of Open Access Journals (Sweden)

    Ovcaric Mick

    2005-09-01

    Full Text Available Abstract Background Migraine is a polygenic multifactorial disease, possessing environmental and genetic causative factors with multiple involved genes. Mutations in various ion channel genes are responsible for a number of neurological disorders. KCNN3 is a neuronal small conductance calcium-activated potassium channel gene that contains two polyglutamine tracts, encoded by polymorphic CAG repeats in the gene. This gene plays a critical role in determining the firing pattern of neurons and acts to regulate intracellular calcium channels. Methods The present association study tested whether length variations in the second (more 3' polymorphic CAG repeat in exon 1 of the KCNN3 gene, are involved in susceptibility to migraine with and without aura (MA and MO. In total 423 DNA samples from unrelated individuals, of which 202 consisted of migraine patients and 221 non-migraine controls, were genotyped and analysed using a fluorescence labelled primer set on an ABI310 Genetic Analyzer. Allele frequencies were calculated from observed genotype counts for the KCNN3 polymorphism. Analysis was performed using standard contingency table analysis, incorporating the chi-squared test of independence and CLUMP analysis. Results Overall, there was no convincing evidence that KCNN3 CAG lengths differ between Caucasian migraineurs and controls, with no significant difference in the allelic length distribution of CAG repeats between the population groups (P = 0.090. Also the MA and MO subtypes did not differ significantly between control allelic distributions (P > 0.05. The prevalence of the long CAG repeat (>19 repeats did not reach statistical significance in migraineurs (P = 0.15, nor was there a significant difference between the MA and MO subgroups observed compared to controls (P = 0.46 and P = 0.09, respectively, or between MA vs MO (P = 0.40. Conclusion This association study provides no evidence that length variations of the second polyglutamine array in

  20. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  1. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  2. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  3. Identification of Antithrombin-Modulating Genes. Role of LARGE, a Gene Encoding a Bifunctional Glycosyltransferase, in the Secretion of Proteins?

    Science.gov (United States)

    de la Morena-Barrio, María Eugenia; Buil, Alfonso; Antón, Ana Isabel; Martínez-Martínez, Irene; Miñano, Antonia; Gutiérrez-Gallego, Ricardo; Navarro-Fernández, José; Aguila, Sonia; Souto, Juan Carlos; Vicente, Vicente; Soria, José Manuel; Corral, Javier

    2013-01-01

    The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin and 307,984 polymorphisms in the GAIT study (352 individuals from 21 Spanish families). Despite no SNP reaching the genome wide significance threshold, we verified milder positive associations in 307 blood donors from a different cohort. This validation study suggested LARGE, a gene encoding a protein with xylosyltransferase and glucuronyltransferase activities that forms heparin-like linear polysaccharides, as a potential modulator of antithrombin based on the significant association of one SNPs, rs762057, with anti-FXa activity, particularly after adjustment for age, sex and SERPINC1 rs2227589 genotype, all factors influencing antithrombin levels (p = 0.02). Additional results sustained this association. LARGE silencing inHepG2 and HEK-EBNA cells did not affect SERPINC1 mRNA levels but significantly reduced the secretion of antithrombin with moderate intracellular retention. Milder effects were observed on α1-antitrypsin, prothrombin and transferrin. Our study suggests LARGE as the first known modifier of plasma antithrombin, and proposes a new role for LARGE in modulating extracellular secretion of certain glycoproteins. PMID:23705025

  4. L-lactic acid production from D-xylose with Candida sonorensis expressing a heterologous lactate dehydrogenase encoding gene.

    Science.gov (United States)

    Koivuranta, Kari T; Ilmén, Marja; Wiebe, Marilyn G; Ruohonen, Laura; Suominen, Pirkko; Penttilä, Merja

    2014-08-08

    Bioplastics, like polylactic acid (PLA), are renewable alternatives for petroleum-based plastics. Lactic acid, the monomer of PLA, has traditionally been produced biotechnologically with bacteria. With genetic engineering, yeast have the potential to replace bacteria in biotechnological lactic acid production, with the benefits of being acid tolerant and having simple nutritional requirements. Lactate dehydrogenase genes have been introduced to various yeast to demonstrate this potential. Importantly, an industrial lactic acid producing process utilising yeast has already been implemented. Utilisation of D-xylose in addition to D-glucose in production of biochemicals such as lactic acid by microbial fermentation would be beneficial, as it would allow lignocellulosic raw materials to be utilised in the production processes. The yeast Candida sonorensis, which naturally metabolises D-xylose, was genetically modified to produce L-lactic acid from D-xylose by integrating the gene encoding L-lactic acid dehydrogenase (ldhL) from Lactobacillus helveticus into its genome. In microaerobic, CaCO3-buffered conditions a C. sonorensis ldhL transformant having two copies of the ldhL gene produced 31 g l-1 lactic acid from 50 g l-1 D-xylose free of ethanol.Anaerobic production of lactic acid from D-xylose was assessed after introducing an alternative pathway of D-xylose metabolism, i.e. by adding a xylose isomerase encoded by XYLA from Piromyces sp. alone or together with the xylulokinase encoding gene XKS1 from Saccharomyces cerevisiae. Strains were further modified by deletion of the endogenous xylose reductase encoding gene, alone or together with the xylitol dehydrogenase encoding gene. Strains of C. sonorensis expressing xylose isomerase produced L-lactic acid from D-xylose in anaerobic conditions. The highest anaerobic L-lactic acid production (8.5 g l-1) was observed in strains in which both the xylose reductase and xylitol dehydrogenase encoding genes had been

  5. Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

    Science.gov (United States)

    Adewoye, L O; Worobec, E A

    2000-08-08

    The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

  6. All genes encoding enzymes participating in melatonin biosynthesis in the chicken pineal gland are transcribed rhythmically.

    Science.gov (United States)

    Adamska, I; Marhelava, K; Walkiewicz, D; Kedzierska, U; Markowska, M; Majewski, P M

    2016-08-01

    Our recent research on the pineal gland of young chickens confirmed that three genes encoding enzymes involved in pineal melatonin biosynthesis, tryptophan hydroxylase 1 (Tph1), arylalkylamine-N-acetyltransferase (Aanat) and acetylserotonin O-methyltransferase (Asmt), are transcribed rhythmically under light:dark (L:D) 12:12 conditions in vivo. Additionally, in the pineal gland of maturing chickens, the dopa decarboxylase (Ddc) gene is transcribed rhythmically at a specific stage of the developmental process. Therefore, the aim of the present study was to verify whether all of these genes are transcribed rhythmically in vivo under constant darkness (D:D) and in pinealocyte cultures under both L:D and D:D. Experiments were performed on chickens maintained under L:D 12:12 conditions. Chickens at 15 days of age were divided into two groups; chickens from the first group remained under the same conditions, whereas those from the second group were kept in darkness. Subsequently, 16-day-old animals were sacrificed every 2 hours over a 24-h period. For the in vitro experiments, 16-day-old chickens were sacrificed at ZT 6, and their pineal glands were isolated. Pineal cultures were maintained for up to two days in L:D conditions. Then, the pinealocyte cultures were divided into two groups: the first remained under L:D conditions, whereas the second was transferred to D:D conditions. Pinealocytes were subsequently collected every 2 hours over a 24-h period. Transcription was evaluated using the RT-qPCR method, and the rhythm percentage was calculated through Cosinor analysis. The mRNA levels of all genes examined were rhythmic under all conditions. Moreover, in silico analysis of the promoters of all of the genes examined revealed the presence of enhancer box sequences in all of the promoters as well as DBP/E4BP4 binding elements in the promoters of Tph1 and Asmt. This suggests that these genes may all be regulated transcriptionally by the molecular clock mechanism and may

  7. Diversification and molecular evolution of ATOH8, a gene encoding a bHLH transcription factor.

    Directory of Open Access Journals (Sweden)

    Jingchen Chen

    Full Text Available ATOH8 is a bHLH domain transcription factor implicated in the development of the nervous system, kidney, pancreas, retina and muscle. In the present study, we collected sequence of ATOH8 orthologues from 18 vertebrate species and 24 invertebrate species. The reconstruction of ATOH8 phylogeny and sequence analysis showed that this gene underwent notable divergences during evolution. For those vertebrate species investigated, we analyzed the gene structure and regulatory elements of ATOH8. We found that the bHLH domain of vertebrate ATOH8 was highly conserved. Mammals retained some specific amino acids in contrast to the non-mammalian orthologues. Mammals also developed another potential isoform, verified by a human expressed sequence tag (EST. Comparative genomic analyses of the regulatory elements revealed a replacement of the ancestral TATA box by CpG-islands in the eutherian mammals and an evolutionary tendency for TATA box reduction in vertebrates in general. We furthermore identified the region of the effective promoter of human ATOH8 which could drive the expression of EGFP reporter in the chicken embryo. In the opossum, both the coding region and regulatory elements of ATOH8 have some special features, such as the unique extended C-terminus encoded by the third exon and absence of both CpG islands and TATA elements in the regulatory region. Our gene mapping data showed that in human, ATOH8 was hosted in one chromosome which is a fusion product of two orthologous chromosomes in non-human primates. This unique chromosomal environment of human ATOH8 probably subjects its expression to the regulation at chromosomal level. We deduce that the great interspecific differences found in both ATOH8 gene sequence and its regulatory elements might be significant for the fine regulation of its spatiotemporal expression and roles of ATOH8, thus orchestrating its function in different tissues and organisms.

  8. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  9. Gene Encoding Duffy Antigen/Receptor for Chemokines Is Associated with Asthma and IgE in Three Populations

    Science.gov (United States)

    Vergara, Candelaria; Tsai, Yuhjung J.; Grant, Audrey V.; Rafaels, Nicholas; Gao, Li; Hand, Tracey; Stockton, Maria; Campbell, Monica; Mercado, Dilia; Faruque, Mezbah; Dunston, Georgia; Beaty, Terri H.; Oliveira, Ricardo Riccio; Ponte, Eduardo V.; Cruz, Alvaro A.; Carvalho, Edgar; Araujo, Maria Ilma; Watson, Harold; Schleimer, Robert P.; Caraballo, Luis; Nickel, Renate G.; Mathias, Rasika A.; Barnes, Kathleen C.

    2008-01-01

    Rationale: Asthma prevalence and severity are high among underserved minorities, including those of African descent. The Duffy antigen/receptor for chemokines is the receptor for Plasmodium vivax on erythrocytes and functions as a chemokine-clearing receptor. Unlike European populations, decreased expression of the receptor on erythrocytes is common among populations of African descent, and results from a functional T-46C polymorphism (rs2814778) in the promoter. This variant provides an evolutionary advantage in malaria-endemic regions, because Duffy antigen/receptor for chemokines-negative erythrocytes are more resistant to infection by P. vivax. Objectives: To determine the role of the rs2814778 polymorphism in asthma and atopy as measured by total serum IgE levels among four populations of African descent (African Caribbean, African American, Brazilian, and Colombian) and a European American population. Methods: Family-based association tests were performed in each of the five populations to test for association between the rs2814778 polymorphism and asthma or total IgE concentration. Measurements and Main Results: Asthma was significantly associated with the rs2814778 polymorphism in the African Caribbean, Colombian, and Brazilian families (P < 0.05). High total IgE levels were associated with this variant in African Caribbean and Colombian families (P < 0.05). The variant allele was not polymorphic among European Americans. Conclusions: Susceptibility to asthma and atopy among certain populations of African descent is influenced by a functional polymorphism in the gene encoding Duffy antigen/receptor for chemokines. This genetic variant, which confers resistance to malarial parasitic infection, may also partially explain ethnic differences in morbidity of asthma. PMID:18827265

  10. The apeE Gene of Salmonella typhimurium Encodes an Outer Membrane Esterase Not Present in Escherichia coli

    OpenAIRE

    Carinato, Maria E.; Collin-Osdoby, Patricia; Yang, Xioming; Knox, Tina M.; Conlin, Christopher A.; Miller, Charles G.

    1998-01-01

    Salmonella typhimurium apeR mutations lead to overproduction of an outer membrane-associated N-acetyl phenylalanine β-naphthyl ester-cleaving esterase that is encoded by the apeE gene (P. Collin-Osdoby and C. G. Miller, Mol. Gen. Genet. 243:674–680, 1994). This paper reports the cloning and nucleotide sequencing of the S. typhimurium apeE gene as well as some properties of the esterase that it encodes. The predicted product of apeE is a 69.9-kDa protein which is processed to a 67-kDa species ...

  11. Association between IL-13 Gene rs20541 Polymorphism and Glioma Susceptibility: A Meta-Analysis.

    Science.gov (United States)

    Yang, Dong; Yuan, Yue; Zhang, Sixun; Zhao, Kuiming; Li, Fang; Ren, Hongxiang; Zhang, Zhe; Yu, Yanbing

    2018-01-01

    We performed a meta-analysis to estimate the association between IL-13 gene rs20541 (R130Q) polymorphism and the susceptibility of glioma. Potentially eligible studies published before February 1, 2016 were searched in 4 databases including PubMed, EMBASE, EBSCO, and Ovid. Odds ratios (ORs) and their corresponding 95% confidence intervals (95% CIs) were used to estimate the strength of relationship between the IL-13 gene rs20541 polymorphism and glioma susceptibility. Stata 11.0 software was used to perform the present meta-analysis. In total, 10 case-control studies with 13 datasets including 3,123 cases and 5,390 controls were identified. A significant increase in glioma susceptibility was found in the dominant model (AA + AG vs. GG: OR = 1.14, 95% CI 1.01-1.29; P = 0.031). Significantly decreasing glioma susceptibility was found for Asians in the heterozygote comparison (AG vs. GG: OR = 0.74, 95% CI 0.55-0.99; P = 0.042) and the allele contrast genetic model (A vs. G: OR = 0.67, 95% CI 0.47-0.96; P = 0.028). By contrast, in Caucasians, a significant increase in glioma susceptibility was found in the dominant model (AA + AG vs. GG: OR = 1.25, 95% CI 1.11-1.41; P = 0.000). There may be a weak association between the IL-13 gene rs20541 polymorphism and glioma susceptibility, and the associations may be different between ethnicities. © 2018 S. Karger GmbH, Freiburg.

  12. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  13. Case-control analysis of truncating mutations in DNA damage response genes connects TEX15 and FANCD2 with hereditary breast cancer susceptibility.

    Science.gov (United States)

    Mantere, Tuomo; Tervasmäki, Anna; Nurmi, Anna; Rapakko, Katrin; Kauppila, Saila; Tang, Jiangbo; Schleutker, Johanna; Kallioniemi, Anne; Hartikainen, Jaana M; Mannermaa, Arto; Nieminen, Pentti; Hanhisalo, Riitta; Lehto, Sini; Suvanto, Maija; Grip, Mervi; Jukkola-Vuorinen, Arja; Tengström, Maria; Auvinen, Päivi; Kvist, Anders; Borg, Åke; Blomqvist, Carl; Aittomäki, Kristiina; Greenberg, Roger A; Winqvist, Robert; Nevanlinna, Heli; Pylkäs, Katri

    2017-04-06

    Several known breast cancer susceptibility genes encode proteins involved in DNA damage response (DDR) and are characterized by rare loss-of-function mutations. However, these explain less than half of the familial cases. To identify novel susceptibility factors, 39 rare truncating mutations, identified in 189 Northern Finnish hereditary breast cancer patients in parallel sequencing of 796 DDR genes, were studied for disease association. Mutation screening was performed for Northern Finnish breast cancer cases (n = 578-1565) and controls (n = 337-1228). Mutations showing potential cancer association were analyzed in additional Finnish cohorts. c.7253dupT in TEX15, encoding a DDR factor important in meiosis, associated with hereditary breast cancer (p = 0.018) and likely represents a Northern Finnish founder mutation. A deleterious c.2715 + 1G > A mutation in the Fanconi anemia gene, FANCD2, was over two times more common in the combined Finnish hereditary cohort compared to controls. A deletion (c.640_644del5) in RNF168, causative for recessive RIDDLE syndrome, had high prevalence in majority of the analyzed cohorts, but did not associate with breast cancer. In conclusion, truncating variants in TEX15 and FANCD2 are potential breast cancer risk factors, warranting further investigations in other populations. Furthermore, high frequency of RNF168 c.640_644del5 indicates the need for its testing in Finnish patients with RIDDLE syndrome symptoms.

  14. Association Analysis Suggests SOD2 as a Newly Identified Candidate Gene Associated With Leprosy Susceptibility.

    Science.gov (United States)

    Ramos, Geovana Brotto; Salomão, Heloisa; Francio, Angela Schneider; Fava, Vinícius Medeiros; Werneck, Renata Iani; Mira, Marcelo Távora

    2016-08-01

    Genetic studies have identified several genes and genomic regions contributing to the control of host susceptibility to leprosy. Here, we test variants of the positional and functional candidate gene SOD2 for association with leprosy in 2 independent population samples. Family-based analysis revealed an association between leprosy and allele G of marker rs295340 (P = .042) and borderline evidence of an association between leprosy and alleles C and A of markers rs4880 (P = .077) and rs5746136 (P = .071), respectively. Findings were validated in an independent case-control sample for markers rs295340 (P = .049) and rs4880 (P = .038). These results suggest SOD2 as a newly identified gene conferring susceptibility to leprosy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  15. Systematic evaluation of genes and genetic variants associated with type 1 diabetes susceptibility

    DEFF Research Database (Denmark)

    Ram, Ramesh; Mehta, Munish; Nguyen, Tri Quang

    2016-01-01

    Genome-wide association studies have found >60 loci that confer genetic susceptibility to type 1 diabetes (T1D). Many of these are defined only by anonymous single nucleotide polymorphisms: the underlying causative genes, as well as the molecular bases by which they mediate susceptibility...... cell type. Additionally, we observed 25 loci that affected 38 transcripts in trans. In summary, our systems genetics analyses defined the effect of T1D risk alleles on levels of gene expression and provide novel insights into the complex genetics of T1D, suggesting that most of the T1D risk alleles......, are not known. Identification of how these variants affect the complex mechanisms contributing to the loss of tolerance is a challenge. In this study, we performed systematic analyses to characterize these variants. First, all known genes in strong linkage disequilibrium (r2 > 0.8) with the reported single...

  16. Glyceraldehyde-3-Phosphate Dehydrogenase-Encoding Gene as a Useful Taxonomic Tool for Staphylococcus spp.

    Science.gov (United States)

    Yugueros, Javier; Temprano, Alejandro; Berzal, Beatriz; Sánchez, María; Hernanz, Carmen; Luengo, José María; Naharro, Germán

    2000-01-01

    The gap gene of Staphylococcus aureus, encoding glyceraldehyde-3-phosphate dehydrogenase, was used as a target to amplify a 933-bp DNA fragment by PCR with a pair of primers 26 and 25 nucleotides in length. PCR products, detected by agarose gel electrophoresis, were also amplified from 12 Staphylococcus spp. analyzed previously. Hybridization with an internal 279-bp DNA fragment probe was positive in all PCR-positive samples. No PCR products were amplified when other gram-positive and gram-negative bacterial genera were analyzed using the same pair of primers. AluI digestion of PCR-generated products gave 12 different restriction fragment length polymorphism (RFLP) patterns, one for each species analyzed. However, we could detect two intraspecies RFLP patterns in Staphylococcus epidermidis, Staphylococcus hominis, and Staphylococcus simulans which were different from the other species. An identical RFLP pattern was observed for 112 S. aureus isolates from humans, cows, and sheep. The sensitivity of the PCR assays was very high, with a detection limit for S. aureus cells of 20 CFU when cells were suspended in saline. PCR amplification of the gap gene has the potential for rapid identification of at least 12 species belonging to the genus Staphylococcus, as it is highly specific. PMID:11101563

  17. [Detection of Leishmania spp. based on the gene encoding HSP20].

    Science.gov (United States)

    Montalvo, Ana M; Fraga, Jorge; Rodríguez, Omaira; Blanco, Orestes; Llanos-Cuentas, Alejandro; García, Ana L; Valencia, Braulio M; Muskus, Carlos; Van der Auwera, Gert; Requena, José M

    2014-01-01

    Explore a new target for molecular diagnosis of Leishmania. We evaluated the utility of the gene that encodes the heat shock protein 20-kDa (Hsp20) for detecting Leishmania by polymerase chain reaction (PCR). PCR was normalized and analytical parameters were determined, as well as the validity and diagnostic accuracy, and concordance with the PCR - 18S. PCR-Hsp20 with DNA was obtained from a group of clinical samples from different sources. The analytical parameters were adequate. The sensitivity obtained was 86% and the specificity was 100%. The concordance with the reference method was good (κ = 0.731), which supports its potential use for diagnosis. The possibility of subsequent identification of the species by sequencing the amplified product gives an additional advantage. The usefulness of this gene as a new target for the detection of Leishmania was demonstrated. Because of its potential, it is recommended to improve the sensitivity of the method and to evaluate it in different endemic regions.

  18. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  19. Cloning and analysis of the DNA polymerase-encoding gene from Thermus filiformis.

    Science.gov (United States)

    Jung, S E; Choi, J J; Kim, H K; Kwon, S T

    1997-12-31

    The gene encoding Thermus filiformis (Tfi) DNA polymerase was cloned and its nucleotide sequence was determined. The primary structure of Tfi DNA polymerase was deduced from its nucleotide sequence. Tfi DNA polymerase is comprised of 833 amino acid residues and its molecular mass was determined to be 93,890 Da. The deduced amino acid sequence of Tfi DNA polymerase showed a high sequence homology to E. coli DNA polymerase I-like DNA polymerases: 78.5% homology to Taq DNA polymerase, 78.4% to Tca DNA polymerase, and 41.8% to E. coli DNA polymerase I. An extremely high sequence identity was observed in the region containing polymerase activity. The G + C content of the coding region for the Tfi DNA polymerase gene was 68.5%, which was higher than that of the chromosomal DNA (65%). The G + C contents in the first, second, and third positions of the codons used were 71.8%, 40.9%, and 92.7% respectively. Codon usage in Tfi DNA polymerase was heavily biased towards the use of G + C in the third position. Rare codons with U or A as the third base were sometimes used to avoid using GA(A/T) TC and TCGA sequences, as they are recognition sites for the restriction endonucleases TfiI and TaqI.

  20. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  1. Cotton PRP5 gene encoding a proline-rich protein is involved in fiber development.

    Science.gov (United States)

    Xu, Wen-Liang; Zhang, De-Jing; Wu, Yan-Feng; Qin, Li-Xia; Huang, Geng-Qing; Li, Juan; Li, Long; Li, Xue-Bao

    2013-07-01

    Proline-rich proteins contribute to cell wall structure of specific cell types and are involved in plant growth and development. In this study, a fiber-specific gene, GhPRP5, encoding a proline-rich protein was functionally characterized in cotton. GhPRP5 promoter directed GUS expression only in trichomes of both transgenic Arabidopsis and tobacco plants. The transgenic Arabidopsis plants with overexpressing GhPRP5 displayed reduced cell growth, resulting in smaller cell size and consequently plant dwarfs, in comparison with wild type plants. In contrast, knock-down of GhPRP5 expression by RNA interference in cotton enhanced fiber development. The fiber length of transgenic cotton plants was longer than that of wild type. In addition, some genes involved in fiber elongation and wall biosynthesis of cotton were up-regulated or down-regulated in the transgenic cotton plants owing to suppression of GhPRP5. Collectively, these data suggested that GhPRP5 protein as a negative regulator participates in modulating fiber development of cotton.

  2. Arabidopsis STAY-GREEN, Mendel's Green Cotyledon Gene, Encodes Magnesium-Dechelatase.

    Science.gov (United States)

    Shimoda, Yousuke; Ito, Hisashi; Tanaka, Ayumi

    2016-09-07

    Pheophytin a is an essential component of oxygenic photosynthetic organisms, because the primary charge separation between chlorophyll a and pheophytin a is the first step in the conversion of light energy. In addition, conversion of chlorophyll a to pheophytin a is the first step of chlorophyll degradation. Pheophytin is synthesized by extracting magnesium (Mg) from chlorophyll; the enzyme Mg-dechelatase catalyzes this reaction. In this study, we report that Mendel's green cotyledon gene, STAY-GREEN (SGR), encodes Mg-dechelatase. The Arabidopsis thaliana genome has three SGR genes, STAY-GREEN1 (SGR1), STAY-GREEN2 (SGR2), and STAY-GREEN LIKE (SGRL). Recombinant SGR1/2 extracted Mg from chlorophyll a but had very low or no activity against chlorophyllide a; in contrast, SGRL had higher dechelating activity against chlorophyllide a compared to chlorophyll a. All SGRs could not extract Mg from chlorophyll b. Enzymatic experiments using the photosystem and light-harvesting complexes showed that SGR extracts Mg not only from free chlorophyll but also from chlorophyll in the chlorophyll-protein complexes. Furthermore, most of the chlorophyll and chlorophyll-binding proteins disappeared when SGR was transiently expressed by a chemical induction system. Thus, SGR is not only involved in chlorophyll degradation but also contributes to photosystem degradation. {copyright, serif} 2016 American Society of Plant Biologists. All rights reserved.

  3. Vitamin D Receptor Gene Polymorphisms in Susceptibility to Tuberculosis in the Kazakh Population in Almaty and Almaty Area

    Directory of Open Access Journals (Sweden)

    Maxat Zhabagin

    2014-01-01

    Full Text Available Introduction: Vitamin D receptor (VDR plays an important role in activating the immune response against various infectious agents. It is known that the active metabolite of ligand receptor Vitamin D (1,25 – dihydroxyvitamin D is encoded by VDR and helps mononuclear phagocytes to suppress the intracellular growth of M. tuberculosis. The VDR gene harbors approximately 200 polymorphisms, some of which are linked to differences in receptor Vitamin D uptake and therefore can be considered as candidate disease risk variants. The relation between VDR gene polymorphisms and susceptibility to TB has been studied in different populations. There is not a great deal of information regarding the association of these SNPs with TB risk in the Kazakh population. The four most commonly investigated VDR polymorphisms in association with different diseases, including susceptibility to tuberculosis, are located in exon 2 (rs2228570 or FokI, intron 8 (rs1544410 or BsmI and rs7975232 or ApaI, and exon 9 (rs731236 or TaqI. The aim of our study was to determine whether these four VDR gene single nucleotide polymorphisms were associated with TB and whether they were a risk for the development of TB in the Kazakh Population in Almaty city and Almaty area. Methods: This study was a hospital-based case-control analysis of 283 individuals (99 TB patients and 184 healthy controls. Genotyping was performed by Taqman SNP allelic discrimination using commercial TaqMan SNP Genotyping assays.  Statistical analysis was conducted using SPSS Version 19.0 software. Results: Genotype frequencies for the Kazakh population are close to world (HapMap data on Asian populations. FokI and ApaI polymorphisms genotypes tend to be associated with TB risk under the co-dominant model [OR=1.18; 95%CI: (0.68, 2.07, p=0.15] for FokI and [OR=1.33; 95%CI: (0.61, 2.91, p=0.6] for ApaI. No significant association between the disease and TaqI, BsmI genotypes was observed. Conclusions: In summary, we

  4. Cloning, mapping and nucleotide sequencing of a gene encoding a universal stress protein in Escherichia coli.

    Science.gov (United States)

    Nyström, T; Neidhardt, F C

    1992-11-01

    The response of non-differentiating bacteria to nutrient starvation is complex and includes the sequential synthesis of starvation-inducible proteins. Although starvation for different individual nutrients generally provokes unique and individual patterns of protein expression, some starvation stimulons share member proteins. Two-dimensional polyacrylamide gel electrophoresis revealed that the synthesis of a small (13.5 kDa) cytoplasmic protein in Escherichia coli was greatly increased during growth inhibition caused by the exhaustion of any of a variety of nutrients (carbon, nitrogen, phosphate, sulphate, required amino acid) or by the presence of a variety of toxic agents including heavy metals, oxidants, acids and antibiotics. To determine further the mode of regulation of the protein designated UspA (universal stress protein A) we cloned the gene encoding the protein by the technique of reverse genetics. We isolated the protein from a preparative two-dimensional polyacrylamide gel, determined its N-terminal amino acid sequence, and used this sequence to construct a degenerate oligonucleotide probe. Two phages of the Kohara library were found to contain the gene which then was subcloned from the DNA in the overlapping region of these two clones. The amino acid sequence, deduced from the nucleotide sequence of the uspA gene, shows no significant homology with any other known protein. The uspA gene maps at 77 min on the E. coli W3110 chromosome, and is transcribed in a clockwise direction. The increase in the level of UspA during growth arrest was found to be primarily a result of transcriptional activation of the corresponding gene. The induction was independent of the RelA/SpoT, RpoH, KatF, OmpR, AppY, Lrp, PhoB and H-NS proteins during stress conditions that are known to induce or activate these global regulators. The -10 and -35 regions upstream of the transcriptional start site of the uspA gene are characteristic of a sigma 70-dependent promoter.

  5. Multiple transmissible genes encoding fluoroquinolone and third-generation cephalosporin resistance co-located in non-typhoidal Salmonella isolated from food-producing animals in China.

    Science.gov (United States)

    Jiang, Hong-Xia; Song, Li; Liu, Ji; Zhang, Xiao-Hua; Ren, Yan-Na; Zhang, Wen-Hui; Zhang, Jing-Yuan; Liu, Ya-Hong; Webber, Mark A; Ogbolu, David O; Zeng, Zhen-Ling; Piddock, Laura J V

    2014-03-01

    The aim of this study was to identify genes conferring resistance to fluoroquinolones and extended-spectrum β-lactams in non-typhoidal Salmonella (NTS) from food-producing animals in China. In total, 31 non-duplicate NTS were obtained from food-producing animals that were sick. Isolates were identified and serotyped and the genetic relatedness of the isolates was determined by pulsed-field gel electrophoresis of XbaI-digested chromosomal DNA. Antimicrobial susceptibility was determined using Clinical and Laboratory Standards Institute methodology. The presence of extended-spectrum β-lactamase (ESBL) and fluoroquinolone resistance genes was established by PCR and sequencing. Genes encoded on transmissible elements were identified by conjugation and transformation. Plasmids were typed by PCR-based replicon typing. The occurrence and diversity of numerous different transmissible genes conferring fluoroquinolone resistance [qnrA, qnrD, oqxA and aac(6')-Ib-cr] and ESBLs (CTX-M-27 and CTX-M-14), and which co-resided in different isolates and serovars of Salmonella, were much higher than in European countries. Furthermore, different plasmids encoded fluoroquinolone resistance (ca. 6 kb) and β-lactam resistance (ca. 63 kb) and these co-resided in isolates with mutations in topoisomerase genes (gyrA and parC) giving very resistant Salmonella. The presence of multidrug-resistant bacteria in food-producing animals in countries that export foodstuffs suggests that global transfer of antibiotic resistances from country to country on food is possible. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  6. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease

    Science.gov (United States)

    Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B.; Yang, Bing; White, Frank F.; Wang, Nian; Jones, Jeffrey B.

    2014-01-01

    Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccAw, induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations. PMID:24474801

  7. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease.

    Science.gov (United States)

    Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B; Yang, Bing; White, Frank F; Wang, Nian; Jones, Jeffrey B

    2014-01-28

    Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccA(w), induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations.

  8. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  9. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  10. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome.

    Science.gov (United States)

    Frank, Valeska; den Hollander, Anneke I; Brüchle, Nadina Ortiz; Zonneveld, Marijke N; Nürnberg, Gudrun; Becker, Christian; Du Bois, Gabriele; Kendziorra, Heide; Roosing, Susanne; Senderek, Jan; Nürnberg, Peter; Cremers, Frans P M; Zerres, Klaus; Bergmann, Carsten

    2008-01-01

    Meckel-Gruber syndrome (MKS) is an autosomal recessive, lethal multisystemic disorder characterized by meningooccipital encephalocele, cystic kidney dysplasia, hepatobiliary ductal plate malformation, and postaxial polydactyly. Recently, genes for MKS1 and MKS3 were identified, putting MKS on the list of ciliary disorders (ciliopathies). By positional cloning in a distantly related multiplex family, we mapped a novel locus for MKS to a 3-Mb interval on 12q21. Sequencing of the CEP290 gene located in the minimal critical region showed a homozygous 1-bp deletion supposed to lead to loss of function of the encoded centrosomal protein CEP290/nephrocystin-6. CEP290 is thought to be involved in chromosome segregation and localizes to cilia, centrosomes, and the nucleus. Subsequent analysis of another consanguineous multiplex family revealed homozygous haplotypes and the same frameshift mutation. Our findings add to the increasing body of evidence that ciliopathies can cause a broad spectrum of disease phenotypes, and pleiotropic effects of CEP290 mutations range from single organ involvement with isolated Leber congenital amaurosis to Joubert syndrome and lethal early embryonic multisystemic malformations in Meckel-Gruber syndrome. We compiled clinical and genetic data of all patients with CEP290 mutations described so far. No clear-cut genotype-phenotype correlations were apparent as almost all mutations are nonsense, frameshift, or splice-site changes and scattered throughout the gene irrespective of the patients' phenotypes. Conclusively, other factors than the type and location of CEP290 mutations may underlie phenotypic variability. (c) 2007 Wiley-Liss, Inc.

  11. Crystallographic Studies of Prion Protein (PrP) Segments Suggest How Structural Changes Encoded by Polymorphism at Residue 129 Modulate Susceptibility to Human Prion Disease

    Energy Technology Data Exchange (ETDEWEB)

    Apostol, Marcin I.; Sawaya, Michael R.; Cascio, Duilio; Eisenberg, David (UCLA)

    2010-09-23

    A single nucleotide polymorphism (SNP) in codon 129 of the human prion gene, leading to a change from methionine to valine at residue 129 of prion protein (PrP), has been shown to be a determinant in the susceptibility to prion disease. However, the molecular basis of this effect remains unexplained. In the current study, we determined crystal structures of prion segments having either Met or Val at residue 129. These 6-residue segments of PrP centered on residue 129 are 'steric zippers,' pairs of interacting {beta}-sheets. Both structures of these 'homozygous steric zippers' reveal direct intermolecular interactions between Met or Val in one sheet and the identical residue in the mating sheet. These two structures, plus a structure-based model of the heterozygous Met-Val steric zipper, suggest an explanation for the previously observed effects of this locus on prion disease susceptibility and progression.

  12. The occurrence of subtilase-cytotoxin-encoding genes in environmental Escherichia coli isolated from a Northern California estuary.

    Science.gov (United States)

    Pereira, Maria das Graças C; Byrne, Barbara A; Nguyen, Trân B H; Lewis, David J; Atwill, E Robert

    2013-06-01

    The presence of subtilase-cytotoxin-encoding genes was determined in 397 environmental Escherichia coli strains isolated from water, suspended solids, and sediments sampled from different hydrological and environmental conditions in a California estuary. A total of 7 strains (1.76%) were found to harbor subtilase-cytotoxin-encoding genes. Using primers targeting subA only, we generated PCR amplicons from 2 strains; while using primers targeting the 3' end of SubA downstream to the 5' end of SubB, amplicons of 232 bp were generated from 5 additional strains. The 556 bp subA sequences were almost identical to that in the subtilase-cytotoxin-positive strain ED 591 (98%), while subAB sequences of 2 non-Shiga-toxigenic strains revealed 100% similarity with the Shiga-toxigenic E. coli O113:H21 strain 98NK2 that was isolated from an outbreak of hemolytic uremic syndrome. Additionally, the serogroup O113:H21 was present in this collection of environmental E. coli, and it was found to harbor stx2d, hra1 that encodes the heat resistant agglutinin 1, and a subAB sequence similar to that in the non-Shiga-toxigenic E. coli subtilase cytotoxin strain ED 591. To further understand potential health risks posed by strains encoding SubAB, future epidemiological studies should consider screening isolates for subAB regardless of the presence of Shiga-toxin-encoding genes.

  13. Distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins in Mekong river sediments in Vietnam.

    Science.gov (United States)

    Kobayashi, Takeshi; Suehiro, Fujiyo; Cach Tuyen, Bui; Suzuki, Satoru

    2007-03-01

    We investigated the distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins (RPPs) in river and channel sediments of the Mekong Delta in Vietnam. The sediment samples were taken from nine sites in the Hau River in southern Vietnam and from 1 site in a channel in Can Tho City in May 2004 using an Ekman-Birge sediment surface sampler. The RPP genes were amplified using PCR with DNA templates obtained directly from the sediments. The tet(M), tet(S), and tet(W) genes were detected by PCR in most sediment samples. Denaturing gradient gel electrophoresis analysis of these genes and sequencing of the resulting bands showed that tet(S) and tet(W) had only one genotype each, but that tet(M) had at least two, which were tentatively called type 1 and type 2. Type 1 tet(M) was identical to the gene encoded in various plasmids and transposons of gram-positive and gram-negative bacteria, and type 2tet(M) was similar to the gene encoded in Tn1545 of Enterococcus faecalis (99% identity, 170 bp/171 bp). This study showed that various RPP genes were widely distributed in the river and channel sediments of the Mekong Delta.

  14. Association of the tumor necrosis factor alpha gene polymorphism with susceptibility and clinical-immunological findings of systemic lupus erythematosus.

    Science.gov (United States)

    Azizah, M R; Kuak, S H; Ainol, S S; Rahim, M N; Normaznah, Y; Norella, K

    2004-01-01

    The etiology of systemic lupus erythematosus (SLE) is unknown but genetic factors seem to play a role in the disease pathogenesis. The tumor necrosis factor alpha (TNFa) gene, encoded at the TNF locus in the MHC class III region, is now known to be an important candidate gene in SLE, due to the proinflammatory activities of the TNFa. The objectives of this study were to examine the role of the TNFa polymorphism for the susceptibility of Malaysian Chinese lupus patients to SLE and to determine its association with organ involvement. The allelic frequencies of the TNFa polymorphic variant (TNF2) of seventy lupus patients were determined during follow-up at the Medical Clinic of the National University Hospital Malaysia by PCR-RFLP technique. Sixty-four females and 6 males with a mean age of 33+/-12 years were included. Clinical data were obtained from case records. Autoantibody levels were measured by ELISA. Fifty-nine ethnically-matched blood donors were used as controls. The allelic frequency of the TNF2 variant was found to be significantly increased in the patients compared to the controls (52.8% vs 33.8%). SLE patients with the polymorphic TNF2 variant were found to be at increased risk of central nervous system involvement (p = 0.004, RR = 2.59) and to have an increased frequency of anti-La antibodies (p = 0.03). In view of these findings we suggest that TNF2 variant is playing a role in conferring susceptibility to SLE and in the disease pathogenesis.

  15. Quantitative analysis of clinically relevant mutations occurring in lymphoid cells harboring γ-retrovirus-encoded hsvtk suicide genes

    OpenAIRE

    Wang, X.; Olszewska, M; Capacio, V; Stefanski, J; Przybylowski, M.; Samakoglu, S; Chang, AH; Sadelain, M.; Rivière, I

    2008-01-01

    The in vivo regulation of T lymphocyte activity by the activation of a suicide mechanism is an essential paradigm for the safety of adoptive cell therapies. In light of reports showing that γ-retroviral vector-encoded herpes simplex virus thymidine kinase (hsvtk) undergoes recombination, we undertook a thorough investigation of the genomic stability of SFG-based vectors using two variants of the wild-type hsvtk gene. In a large panel of independent clones, we demonstrate that both hsvtk genes...

  16. Mutagenesis of the gene encoding cytochrome c550 of Paracoccus denitrificans and analysis of the resultant physiological effects.

    OpenAIRE

    Van Spanning, R J; Wansell, C; Harms, N; Oltmann, L F; Stouthamer, A H

    1990-01-01

    By using synthetic oligonucleotides, the gene encoding soluble cytochrome c550 was isolated from a genomic bank of Paracoccus denitrificans. The nucleotide sequence of the gene was determined, and the deduced amino acid sequence of the mature protein was found to be similar to the primary structure of purified cytochrome c550 except for the presence of seven additional amino acid residues at the C terminus. At the N terminus of the primary structure was found an additional stretch of 19 amino...

  17. Gene Variants Are Associated with PCOS Susceptibility and Hyperandrogenemia in Young Korean Women

    Directory of Open Access Journals (Sweden)

    Do Kyeong Song

    2014-08-01

    Full Text Available BackgroundThe fat mass and obesity-associated (FTO gene is associated with obesity and type 2 diabetes mellitus. Obesity and insulin resistance are also common features of polycystic ovary syndrome (PCOS. Therefore, the FTO gene might be a candidate gene for PCOS susceptibility. The aim of the present study was to evaluate the effects of FTO gene variants on PCOS susceptibility and metabolic and reproductive hormonal parameters.MethodsWe recruited 432 women with PCOS (24±5 years and 927 healthy women with regular menstrual cycles (27±5 years and performed a case-control association study. We genotyped the single nucleotide polymorphisms rs1421085, rs17817449, and rs8050136 in the FTO gene and collected metabolic and hormonal measurements.ResultsLogistic regression revealed that the G/G genotype (rs1421085, 1.6%, the C/C genotype (rs17817449, 1.6%, and the A/A genotype (rs8050136, 1.6% were strongly associated with an increased risk of PCOS (odds ratio, 2.551 to 2.559; all P<0.05. The strengths of these associations were attenuated after adjusting for age and BMI. The women with these genotypes were more obese and exhibited higher free androgen indices (P<0.05 and higher free testosterone levels (P=0.053 to 0.063 compared to the other genotypes. However the significant differences disappeared after adjusting for body mass index (BMI. When we analyzed the women with PCOS and the control groups separately, there were no significant differences in the metabolic and reproductive hormonal parameters according to the FTO gene variants.ConclusionThe rs1421085, rs17817449, and rs8050136 variants of the FTO gene were associated with PCOS susceptibility and hyperandrogenemia in young Korean women. These associations may be mediated through an effect of BMI.

  18. Knockdown of MLO genes reduces susceptibility to powdery mildew in grapevine.

    Science.gov (United States)

    Pessina, Stefano; Lenzi, Luisa; Perazzolli, Michele; Campa, Manuela; Dalla Costa, Lorenza; Urso, Simona; Valè, Giampiero; Salamini, Francesco; Velasco, Riccardo; Malnoy, Mickael

    2016-01-01

    Erysiphe necator is the causal agent of powdery mildew (PM), one of the most destructive diseases of grapevine. PM is controlled by sulfur-based and synthetic fungicides, which every year are dispersed into the environment. This is why PM-resistant varieties should become a priority for sustainable grapevine and wine production. PM resistance can be achieved in other crops by knocking out susceptibility S-genes, such as those residing at genetic loci known as MLO (Mildew Locus O). All MLO S-genes of dicots belong to the phylogenetic clade V, including grapevine genes VvMLO7, 11 and 13, which are upregulated during PM infection, and VvMLO6, which is not upregulated. Before adopting a gene-editing approach to knockout candidate S-genes, the evidence that loss of function of MLO genes can reduce PM susceptibility is necessary. This paper reports the knockdown through RNA interference of VvMLO6, 7, 11 and 13. The knockdown of VvMLO6, 11 and 13 did not decrease PM severity, whereas the knockdown of VvMLO7 in combination with VvMLO6 and VvMLO11 reduced PM severity up to 77%. The knockdown of VvMLO7 and VvMLO6 seemed to be important for PM resistance, whereas a role for VvMLO11 does not seem likely. Cell wall appositions (papillae) were present in both resistant and susceptible lines in response to PM attack. Thirteen genes involved in defense were less upregulated in infected mlo plants, highlighting the early mlo-dependent disruption of PM invasion.

  19. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy

    Directory of Open Access Journals (Sweden)

    Canzanella Sergio

    2009-10-01

    Full Text Available Abstract Background Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. Methods A large series (N = 846 of sporadic and familial cases originating from South Italy was screened for germline mutations in p16CDKN2A, BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35 as well as melanoma cell lines (N = 18 were analyzed for somatic mutations in NRAS, BRAF, and p16CDKN2A genes. Results For melanoma susceptibility, investigations at germline level indicated that p16CDKN2A was exclusively mutated in 16/545 (2.9% non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4% patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds in cultured and in vivo melanomas (either primary or metastatic lesions. Conversely, p16CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16CDKN2A silencing. Conclusion Our findings further clarified that: a mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b multiple molecular events are accumulating during melanomagenesis.

  20. The pathogenic human monoclonal anti-DNA that induces experimental systemic lupus erythematosus in mice is encoded by a VH4 gene segment.

    Science.gov (United States)

    Waisman, A; Shoenfeld, Y; Blank, M; Ruiz, P J; Mozes, E

    1995-04-01

    Systemic lupus erythematosus (SLE) can be induced in mice by immunization with a human anti-DNA IgM mAb that was derived from a patient with cold agglutinin disease. The latter anti-DNA mAb expresses the common idiotype (Id) designated 16/6 Id. The original human hybridoma 16/6 that secreted an IgM antibody that bound ssDNA and carried the 16/6 Id had switched in culture to secrete an IgG molecule. Herein we show that the IgG 16/6 antibody contains the previously reported characteristics of the original IgM 16/6 mAb: it expresses the 16/6 Id and is capable of inducing experimental SLE in susceptible mouse strains. The identify of the IgG 16/6 anti-DNA mAb to the original IgM mAb was shown both by serological techniques and at the T cell level. The human IgG 16/6 mAb was found to be encoded by a germline gene from the human VH4 gene family, with high similarity to the germline gene VH4.21 that was previously shown to code for anti-DNA antibodies isolated from SLE patients. The VH4.21 germline gene was found to also code for most antibodies with cold agglutinin activity that were isolated from patients with cold agglutinin disease.

  1. The ARG9 Gene Encodes the Plastid-Resident N-Acetyl Ornithine Aminotransferase in the Green Alga Chlamydomonas reinhardtii▿

    OpenAIRE

    Remacle, Claire; Cline, Sara; Boutaffala, Layla; Gabilly, Stéphane; Larosa, Véronique; Barbieri, M. Rosario; Coosemans, Nadine; Hamel, Patrice P.

    2009-01-01

    Here we report the characterization of the Chlamydomonas reinhardtii gene ARG9, encoding the plastid resident N-acetyl ornithine aminotransferase, which is involved in arginine synthesis. Integration of an engineered ARG9 cassette in the plastid chromosome of the nuclear arg9 mutant restores arginine prototrophy. This suggests that ARG9 could be used as a new selectable marker for plastid transformation.

  2. Molecular cloning of the gene which encodes beta-N-acetylglucosaminidase from a marine bacterium, Alteromonas sp. strain O-7.

    Science.gov (United States)

    Tsujibo, H; Fujimoto, K; Tanno, H; Miyamoto, K; Kimura, Y; Imada, C; Okami, Y; Inamori, Y

    1995-01-01

    The gene encoding the periplasmic beta-N-acetylglucosaminidase (GlcNAcase B) from a marine Alteromonas sp. strain, O-7, was cloned and sequenced. The protein sequence of GlcNAcase B revealed a highly significant homology with Vibrio GlcNAcase and alpha- and beta-chains of human beta-hexosaminidase. PMID:7574618

  3. Molecular cloning of the gene which encodes beta-N-acetylglucosaminidase from a marine bacterium, Alteromonas sp. strain O-7.

    OpenAIRE

    Tsujibo, H; Fujimoto, K; Tanno, H; Miyamoto, K.; Kimura, Y.; Imada, C; Okami, Y; Inamori, Y

    1995-01-01

    The gene encoding the periplasmic beta-N-acetylglucosaminidase (GlcNAcase B) from a marine Alteromonas sp. strain, O-7, was cloned and sequenced. The protein sequence of GlcNAcase B revealed a highly significant homology with Vibrio GlcNAcase and alpha- and beta-chains of human beta-hexosaminidase.

  4. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Science.gov (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  5. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    Science.gov (United States)

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  6. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus : the DAMAGE study

    NARCIS (Netherlands)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V.; van't Riet, Esther; van Haeften, Timon W.; Arp, Pascal A.; Hansen, Torben; Kremer, Dennis; Groenewoud, Marlous J.; van Hove, Els C.; Romijn, Johannes A.; Smit, Jan W. A.; Nijpels, Giel; Heine, Robert J.; Uitterlinden, Andre G.; Pedersen, Oluf; Slagboom, P. Eline; Maassen, Johannes A.; Hofker, Marten H.; 't Hart, Leen M.; Dekker, Jacqueline M.

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes

  7. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  8. Investigation of Gamma-aminobutyric acid (GABA A receptors genes and migraine susceptibility

    Directory of Open Access Journals (Sweden)

    Ciccodicola Alfredo

    2008-12-01

    Full Text Available Abstract Background Migraine is a neurological disorder characterized by recurrent attacks of severe headache, affecting around 12% of Caucasian populations. It is well known that migraine has a strong genetic component, although the number and type of genes involved is still unclear. Prior linkage studies have reported mapping of a migraine gene to chromosome Xq 24–28, a region containing a cluster of genes for GABA A receptors (GABRE, GABRA3, GABRQ, which are potential candidate genes for migraine. The GABA neurotransmitter has been implicated in migraine pathophysiology previously; however its exact role has not yet been established, although GABA receptors agonists have been the target of therapeutic developments. The aim of the present research is to investigate the role of the potential candidate genes reported on chromosome Xq 24–28 region in migraine susceptibility. In this study, we have focused on the subunit GABA A receptors type ε (GABRE and type θ (GABRQ genes and their involvement in migraine. Methods We have performed an association analysis in a large population of case-controls (275 unrelated Caucasian migraineurs versus 275 controls examining a set of 3 single nucleotide polymorphisms (SNPs in the coding region (exons 3, 5 and 9 of the GABRE gene and also the I478F coding variant of the GABRQ gene. Results Our study did not show any association between the examined SNPs in our test population (P > 0.05. Conclusion Although these particular GABA receptor genes did not show positive association, further studies are necessary to consider the role of other GABA receptor genes in migraine susceptibility.

  9. Bipolar disorder: idioms of susceptibility and disease and the role of 'genes' in illness explanations.

    Science.gov (United States)

    Baart, Ingrid; Widdershoven, Guy

    2013-11-01

    This qualitative study explores (1) how members of the Dutch Association for People with Bipolar Disorder explain the affliction of bipolar disorder; (2) the relationship between genetic, environmental and personal factors in these explanations and (3) the relationship between illness explanations, self-management and identity. A total of 40 participants took part in seven different focus group discussions. The results demonstrate that there are two different explanatory idioms, each one centred around an opposing concept, that is, susceptibility and disease. Individuals who construct explanations around the concept of 'disease' attach more importance to 'genes and chemicals' than to environmental components in the onset of the disorder, whereas individuals adhering to the central concept of 'susceptibility' tend to do this much less. Compared with individuals using the 'susceptibility' idiom, those who use a 'disease' idiom tend to observe fewer possibilities for self-management and are less inclined to construct normalcy through a quest for personal growth. Stories of suffering seem more integral to the 'disease' idiom than to the 'susceptibility' idiom. The 'disease' idiom seems less integrated in a contemporary surveillance psychiatric discourse than the 'susceptibility' idiom; however, both vocabularies can offer normative constraints.

  10. Association of surfactant protein B gene with chronic obstructive pulmonary disease susceptibility.

    Science.gov (United States)

    Yang, J; Wang, B; Zhou, H-X; Liang, B-M; Chen, H; Ma, C-L; Xiao, J; Deng, J; Yan, L; Chen, Y-P; Chen, C-L; Chen, F; Ou, X-M; Feng, Y-L

    2014-11-01

    Genetic predisposition, in addition to smoking, is known to play a key role in susceptibility to chronic obstructive pulmonary disease (COPD). Several candidate genes have been proposed for COPD, including surfactant protein B (SFTPB). However, large studies in populations with different ethnic backgrounds and environments are required to clarify the role of SFTPB in COPD. We investigated the association of SFTPB polymorphisms with COPD susceptibility and lung function in a Chinese Han population. Four single nucleotide polymorphisms (SNPs) in the SFTPB gene were genotyped in 680 COPD patients and 687 controls. Allele frequencies and genotype distributions were compared between cases and controls and the potential relationships between these SNPs and lung function were investigated. Associations between haplotypes and COPD susceptibility were also assessed. The SFTPB exon polymorphism rs1130866 significantly protected subjects from COPD (adjusted P = 0.004) and was associated with an increase in forced expiratory volume in 1 s (FEV(1)) (adjusted P = 0.014). SFTPB variants are associated with COPD susceptibility and lung function in the Chinese Han population.

  11. The genome of the mustard leaf beetle encodes two active xylanases originally acquired from bacteria through horizontal gene transfer.

    Science.gov (United States)

    Pauchet, Yannick; Heckel, David G

    2013-07-22

    The primary plant cell wall comprises the most abundant polysaccharides on the Earth and represents a rich source of energy for organisms which have evolved the ability to digest them. Enzymes able to degrade plant cell wall polysaccharides are widely distributed in micro-organisms but are generally absent in animals, although their presence in insects, especially phytophagous beetles from the superfamilies Chrysomeloidea and Curculionoidea, has recently begun to be appreciated. The observed patchy distribution of endogenous genes encoding these enzymes in animals has raised questions about their evolutionary origins. Recent evidence suggests that endogenous plant cell wall degrading enzymes-encoding genes have been acquired by animals through a mechanism known as horizontal gene transfer (HGT). HGT describes how genetic material is moved by means other than vertical inheritance from a parent to an offspring. Here, we provide evidence that the mustard leaf beetle, Phaedon cochleariae, possesses in its genome genes encoding active xylanases from the glycoside hydrolase family 11 (GH11). We also provide evidence that these genes were originally acquired by P. cochleariae from a species of gammaproteobacteria through HGT. This represents the first example of the presence of genes from the GH11 family in animals.

  12. Transcript accumulation from the rpoS gene encoding a stationary-phase sigma factor in Pseudomonas chlororaphis strain O6 is regulated by the polyphosphate kinase gene.

    Science.gov (United States)

    Kim, H J; Yang, K Y; Cho, B H; Kim, K Y; Lee, M C; Kim, Y H; Anderson, A J; Kim, Y C

    2007-03-01

    Polyphosphate levels are modulated by the actions of polyphosphate kinase, encoded by ppk, and exopolyphosphatase, encoded by ppx. The genes ppk and ppx are adjacent to each other in the genome of the root colonizer, Pseudomonas chlororaphis O6. A ppk-deficient mutant was more sensitive to oxidative stress than the wild-type and the ppx mutant. Transcripts from ppx increased as cultures matured from mid- to late-logarithmic and stationary phases, whereas abundance was greater for ppk in the late-logarithmic phase than in the stationary phase. Transcript accumulation from the rpoS gene, encoding the stationary-phase sigma factor RpoS, was decreased in the mid- and late-logarithmic and stationary phases in the ppk mutant. Thus, ppk regulates rpoS transcript accumulation in P. chlororaphis 06. However, mutations in either the ppk or ppx genes had no effect on induction of systemic resistance in plants colonized by P. chlororaphis O6.

  13. Efficient antibody diversification by gene conversion in vivo in the absence of selection for V(D)J-encoded determinants.

    Science.gov (United States)

    Sayegh, C E; Drury, G; Ratcliffe, M J

    1999-11-15

    Antibody diversification in the bursa of Fabricius occurs by gene conversion: pseudogene-derived sequences replace homologous sequences in rearranged immunoglobulin genes. Bursal cells expressing a truncated immunoglobulin mu heavy chain, introduced by retroviral gene transfer, bypass normal requirements for endogenous surface immunoglobulin expression. Immunoglobulin light chain rearrangements in such cells undergo gene conversion under conditions where the products are not selected based on their ability to encode a functional protein. The efficiency with which gene conversion maintains a productive reading frame exceeds 97% under such non-selective conditions. By analysis of donor pseudogene usage we demonstrate that bursal cell development is not driven by a restricted set of antigenic specificities. We further demonstrate that gene conversion can restore a productive reading frame to out-of-frame VJ(L) junctions, providing a rationale for the elimination of cells containing non-productive VJ(L) rearrangements prior to the onset of gene conversion in normal bursal cell development.

  14. Linking susceptibility genes and pathogenesis mechanisms using mouse models of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Steve P. Crampton

    2014-09-01

    Full Text Available Systemic lupus erythematosus (SLE represents a challenging autoimmune disease from a clinical perspective because of its varied forms of presentation. Although broad-spectrum steroids remain the standard treatment for SLE, they have many side effects and only provide temporary relief from the symptoms of the disease. Thus, gaining a deeper understanding of the genetic traits and biological pathways that confer susceptibility to SLE will help in the design of more targeted and effective therapeutics. Both human genome-wide association studies (GWAS and investigations using a variety of mouse models of SLE have been valuable for the identification of the genes and pathways involved in pathogenesis. In this Review, we link human susceptibility genes for SLE with biological pathways characterized in mouse models of lupus, and discuss how the mechanistic insights gained could advance drug discovery for the disease.

  15. Research advances in susceptibility genes and their role in the pathogenesis of nonalcoholic fatty liver disease

    Directory of Open Access Journals (Sweden)

    XUAN Shiying

    2016-03-01

    Full Text Available Currently the incidence of nonalcoholic fatty liver disease (NAFLD is increasing, and the age of onset is getting younger worldwide, resulting in a heavy economic burden for both individuals and the society. Since NAFLD is closely related to heredity, metabolism, and the environment, genetic factors play an important role in the development and progression of NAFLD. With the development and wide application of the techniques from the genome-wide association studies, new research advances have been achieved in the susceptibility genes of NAFLD. This review summarizes the related research findings at home and abroad, and investigates the pathogenic factors for NAFLD and related mechanisms with a focus on the polymorphisms of susceptibility genes.

  16. Linking susceptibility genes and pathogenesis mechanisms using mouse models of systemic lupus erythematosus

    Science.gov (United States)

    Crampton, Steve P.; Morawski, Peter A.; Bolland, Silvia

    2014-01-01

    Systemic lupus erythematosus (SLE) represents a challenging autoimmune disease from a clinical perspective because of its varied forms of presentation. Although broad-spectrum steroids remain the standard treatment for SLE, they have many side effects and only provide temporary relief from the symptoms of the disease. Thus, gaining a deeper understanding of the genetic traits and biological pathways that confer susceptibility to SLE will help in the design of more targeted and effective therapeutics. Both human genome-wide association studies (GWAS) and investigations using a variety of mouse models of SLE have been valuable for the identification of the genes and pathways involved in pathogenesis. In this Review, we link human susceptibility genes for SLE with biological pathways characterized in mouse models of lupus, and discuss how the mechanistic insights gained could advance drug discovery for the disease. PMID:25147296

  17. Possible association of β2- and β3-adrenergic receptor gene polymorphisms with susceptibility to breast cancer

    Science.gov (United States)

    Huang, Xin-En; Hamajima, Nobuyuki; Saito, Toshiko; Matsuo, Keitaro; Mizutani, Mitsuhiro; Iwata, Hiroji; Iwase, Takuji; Miura, Shigeto; Mizuno, Tsutomu; Tokudome, Shinkan; Tajima, Kazuo

    2001-01-01

    Background The involvement of β2-adrenergic receptor (ADRB2) and β3-adrenergic receptor (ADRB3) in both adipocyte lipolysis and thermogenic activity suggests that polymorphisms in the encoding genes might be linked with interindividual variation in obesity, an important risk factor for postmenopausal breast cancer. In order to examine the hypothesis that genetic variations in ADRB2 and ADRB3 represent interindividual susceptibility factors for obesity and breast cancer, we conducted a hospital-based, case-control study in the Aichi Cancer Center, Japan. Methods A self-administered questionnaire was given to 200 breast cancer patients and 182 control individuals, and pertinent information on lifestyle, family history and reproduction was collected. ADRB2 and ADRB3 genotypes were determined by polymerase chain reaction (PCR) restriction fragment length polymorphism assessment. Results Twenty-five (12.4%) breast cancer patients and 32 (17.6%) control individuals were found to bear a glutamic acid (Glu) allele for the ADRB2 gene (odds ratio [OR] 0.67, 95% confidence interval [CI] 0.38-1.18), and 60 (30.0%) breast cancer patients and 61 (33.5%) control individuals were found to bear an Arg allele for the ADRB3 gene (OR 0.85, 95% CI 0.55-1.31). A significantly lower risk was observed in those who carried the Glu ADRB2 allele and who reported first childbirth when they were younger than 25 years (OR 0.35; 95% CI 0.13-0.99). Conclusion A potential association may exist between risk of breast cancer and polymorphisms in the ADRB2 and ADRB3 genes; further studies in larger samples and/or in different ethnic groups are warranted to investigate this potential association. PMID:11434877

  18. Association of rare variation in the glutamate receptor gene SLC1A2 with susceptibility to bipolar disorder and schizophrenia.

    Science.gov (United States)

    Fiorentino, Alessia; Sharp, Sally I; McQuillin, Andrew

    2015-09-01

    The SLC1A2 gene encodes the excitatory amino acid transporter 2 (EAAT2). Glutamate is the major mediator of excitatory neurotransmission and EAAT2 is responsible for clearing the neurotransmitter from the synaptic cleft. Genetic variation in SLC1A2 has been implicated in a range of neurological and neuropsychiatric conditions including schizophrenia (SZ), autism and in core phenotypes of bipolar disorder (BD). The coding and putative regulatory regions of SLC1A2 gene were screened for variants using high resolution melting or sequenced in 1099 or in 32 BD subjects. Thirty-two variants were detected in the SLC1A2 gene. Fifteen potentially etiological variants were selected for genotyping in 1099 BD and 1095 control samples. Five amino acid changing variants were also genotyped in 630 participants suffering from SZ. None of the variants were found to be associated with BD or SZ or with the two diseases combined. However, two recurrent missense variants (rs145827578:G>A, p.(G6S); rs199599866:G>A, p.(R31Q)) and one recurrent 5'-untranslated region (UTR) variant (ss825678885:G>T) were detected in cases only. Combined analysis of the recurrent-case-only missense variants and of the case-only missense and 5'-UTR variants showed nominal evidence for association with the combined diseases (Fisher's P=0.019 and 0.0076). These findings are exploratory in nature and await replication in larger cohorts, however, they provide intriguing evidence that potentially functional rare variants in the SLC1A2 gene may confer susceptibility to psychotic disorders.

  19. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

    Science.gov (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

    2006-07-01

    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  20. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  1. Identification of genes encoding glycosyltransferases involved in lipopolysaccharide synthesis in Porphyromonas gingivalis.

    Science.gov (United States)

    Shoji, Mikio; Sato, Keiko; Yukitake, Hideharu; Kamaguchi, Arihide; Sasaki, Yuko; Naito, Mariko; Nakayama, Koji

    2017-10-03

    Porphyromonas gingivalis can synthesize both A-LPS and O-LPS, which contain anionic O-polysaccharides and conventional O-polysaccharides, respectively. A-LPS can anchor virulence proteins to the cell surface, and elucidating the mechanism of A-LPS synthesis is therefore important for understanding the pathogenicity of this bacterium. To identify the genes involved in LPS synthesis, we focused on uncharacterized genes encoding the glycosyltransferases, PGN_0361, PGN_ 1239, PGN_1240, and PGN_1668, which were tentatively named gtfC, gtfD, gtfE, and gtfF, respectively, and characterized their mutants. We found that disruption of gtfC and gtfF resulted in A-LPS deficiency. In addition, a gtfD mutant had abnormal A-LPS synthesis, and a gtfE mutant exhibited a rough-type LPS which possesses a short oligosaccharide with lipid A-core. We then constructed a gtfC and gtfD double mutant, since their amino acid sequences are very similar, and this mutant similarly possessed a rough-type LPS. Cross-complementation analysis revealed that the GtfD protein is a functional homolog of the Escherichia coli WbbL protein, which is a rhamnosyltransferase. These results suggested that the GtfE protein is essential for the synthesis of both O-LPS and A-LPS, and that GtfC and GtfD proteins may work together to synthesize the two kinds of LPS. In addition, the GtfF protein was essential for A-LPS synthesis, although this may be achieved in a strain-specific manner. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  2. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard

    2009-04-28

    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  3. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  4. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  5. Brd1 gene in maize encodes a brassinosteroid C-6 oxidase.

    Directory of Open Access Journals (Sweden)

    Irina Makarevitch

    Full Text Available The role of brassinosteroids in plant growth and development has been well-characterized in a number of plant species. However, very little is known about the role of brassinosteroids in maize. Map-based cloning of a severe dwarf mutant in maize revealed a nonsense mutation in an ortholog of a brassinosteroid C-6 oxidase, termed brd1, the gene encoding the enzyme that catalyzes the final steps of brassinosteroid synthesis. Homozygous brd1-m1 maize plants have essentially no internode elongation and exhibit no etiolation response when germinated in the dark. These phenotypes could be rescued by exogenous application of brassinolide, confirming the molecular defect in the maize brd1-m1 mutant. The brd1-m1 mutant plants also display alterations in leaf and floral morphology. The meristem is not altered in size but there is evidence for differences in the cellular structure of several tissues. The isolation of a maize mutant defective in brassinosteroid synthesis will provide opportunities for the analysis of the role of brassinosteroids in this important crop system.

  6. The rice FISH BONE gene encodes a tryptophan aminotransferase, which affects pleiotropic auxin-related processes.

    Science.gov (United States)

    Yoshikawa, Takanori; Ito, Momoyo; Sumikura, Tsuyoshi; Nakayama, Akira; Nishimura, Takeshi; Kitano, Hidemi; Yamaguchi, Isomaro; Koshiba, Tomokazu; Hibara, Ken-Ichiro; Nagato, Yasuo; Itoh, Jun-Ichi

    2014-06-01

    Auxin is a fundamental plant hormone and its localization within organs plays pivotal roles in plant growth and development. Analysis of many Arabidopsis mutants that were defective in auxin biosynthesis revealed that the indole-3-pyruvic acid (IPA) pathway, catalyzed by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) and YUCCA (YUC) families, is the major biosynthetic pathway of indole-3-acetic acid (IAA). In contrast, little information is known about the molecular mechanisms of auxin biosynthesis in rice. In this study, we identified a auxin-related rice mutant, fish bone (fib). FIB encodes an orthologue of TAA genes and loss of FIB function resulted in pleiotropic abnormal phenotypes, such as small leaves with large lamina joint angles, abnormal vascular development, small panicles, abnormal organ identity and defects in root development, together with a reduction in internal IAA levels. Moreover, we found that auxin sensitivity and polar transport activity were altered in the fib mutant. From these results, we suggest that FIB plays a pivotal role in IAA biosynthesis in rice and that auxin biosynthesis, transport and sensitivity are closely interrelated. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  7. The Arabidopsis DELAYED DEHISCENCE1 Gene Encodes an Enzyme in the Jasmonic Acid Synthesis Pathway

    Science.gov (United States)

    Sanders, Paul M.; Lee, Pei Yun; Biesgen, Christian; Boone, James D.; Beals, Thomas P.; Weiler, Elmar W.; Goldberg, Robert B.

    2000-01-01

    delayed dehiscence1 is an Arabidopsis T-DNA mutant in which anthers release pollen grains too late for pollination to occur. The delayed dehiscence1 defect is caused by a delay in the stomium degeneration program. The gene disrupted in delayed dehiscence1 encodes 12-oxophytodienoate reductase, an enzyme in the jasmonic acid biosynthesis pathway. We rescued the mutant phenotype by exogenous application of jasmonic acid and obtained seed set from previously male-sterile plants. In situ hybridization studies showed that during the early stages of floral development, DELAYED DEHISCENCE1 mRNA accumulated within all floral organs. Later, DELAYED DEHISCENCE1 mRNA accumulated specifically within the pistil, petals, and stamen filaments. DELAYED DEHISCENCE1 mRNA was not detected in the stomium and septum cells of the anther that are involved in pollen release. The T-DNA insertion in delayed dehiscence1 eliminated both DELAYED DEHISCENCE1 mRNA accumulation and 12-oxophytodienoate reductase activity. These experiments suggest that jasmonic acid signaling plays a role in controlling the time of anther dehiscence within the flower. PMID:10899973

  8. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  9. Cell-Type-Specific Epigenetic Editing at the Fosb Gene Controls Susceptibility to Social Defeat Stress.

    Science.gov (United States)

    Hamilton, Peter J; Burek, Dominika J; Lombroso, Sonia I; Neve, Rachael L; Robison, Alfred J; Nestler, Eric J; Heller, Elizabeth A

    2018-01-01

    Chronic social defeat stress regulates the expression of Fosb in the nucleus accumbens (NAc) to promote the cell-type-specific accumulation of ΔFosB in the two medium spiny neuron (MSN) subtypes in this region. ΔFosB is selectively induced in D1-MSNs in the NAc of resilient mice, and in D2-MSNs of susceptible mice. However, little is known about the consequences of such selective induction, particularly in D2-MSNs. This study examined how cell-type-specific control of the endogenous Fosb gene in NAc regulates susceptibility to social defeat stress. Histone post-translational modifications (HPTMs) were targeted specifically to Fosb using engineered zinc-finger proteins (ZFPs). Fosb-ZFPs were fused to either the transcriptional repressor, G9a, which promotes histone methylation or the transcriptional activator, p65, which promotes histone acetylation. These ZFPs were expressed in D1- vs D2-MSNs using Cre-dependent viral expression in the NAc of mice transgenic for Cre recombinase in these MSN subtypes. We found that stress susceptibility is oppositely regulated by the specific cell type and HPTM targeted. We report that Fosb-targeted histone acetylation in D2-MSNs or histone methylation in D1-MSNs promotes a stress-susceptible, depressive-like phenotype, while histone methylation in D2-MSNs or histone acetylation in D1-MSNs increases resilience to social stress as quantified by social interaction behavior and sucrose preference. This work presents the first demonstration of cell- and gene-specific targeting of histone modifications, which model naturally occurring transcriptional phenomena that control social defeat stress behavior. This epigenetic-editing approach, which recapitulates physiological changes in gene expression, reveals clear differences in the social defeat phenotype induced by Fosb gene manipulation in MSN subtypes.

  10. Gene expression profiling in the thiamethoxam resistant and susceptible B-biotype sweetpotato whitefly, Bemisia tabaci.

    Science.gov (United States)

    Xie, Wen; Yang, Xin; Wang, Shao-Ii; Wu, Qing-jun; Yang, Ni-na; Li, Ru-mei; Jiao, Xiao-guo; Pan, Hui-peng; Liu, Bai-ming; Feng, Yun-tao; Xu, Bao-yun; Zhou, Xu-guo; Zhang, You-jun

    2012-01-01

    Thiamethoxam has been used as a major insecticide to control the B-biotype sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Due to its excessive use, a high level of resistance to thiamethoxam has developed worldwide over the past several years. To better understand the molecular mechanisms underlying this resistance in B. tabaci, gene profiles between the thiamethoxam-resistant and thiamethoxam-susceptible strains were investigated using the suppression subtractive hybridization (SSH) library approach. A total of 72 and 52 upand down-regulated genes were obtained from the forward and reverse SSH libraries, respectively. These expressed sequence tags (ESTs) belong to several functional categories based on their gene ontology annotation. Some categories such as cell communication, response to abiotic stimulus, lipid particle, and nuclear envelope were identified only in the forward library of thiamethoxam-resistant strains. In contrast, categories such as behavior, cell proliferation, nutrient reservoir activity, sequence-specific DNA binding transcription factor activity, and signal transducer activity were identified solely in the reverse library. To study the validity of the SSH method, 16 differentially expressed genes from both forward and reverse SSH libraries were selected randomly for further analyses using quantitative realtime PCR (qRT-PCR). The qRT-PCR results were fairly consistent with the SSH results; however, only 50% of the genes showed significantly different expression profiles between the thiamethoxam-resistant and thiamethoxam-susceptible whiteflies. Among these genes, a putative NAD-dependent methanol dehydrogenase was substantially over-expressed in the thiamethoxamresistant adults compared to their susceptible counterparts. The distributed profiles show that it was highly expressed during the egg stage, and was most abundant in the abdomen of adult females.

  11. Detection of Amp C genes encoding for beta-lactamases in Escherichia coli and Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    M Shanthi

    2012-01-01

    Full Text Available Purpose : Amp C beta-lactamase are Ambler class C enzymes that confer resistance to extended spectrum cephalosporins and are not inhibited by beta-lactamase inhibitors. Their detection is crucial, since the phenotypic tests are not standardised leading to ambiguity in interpretation of results. This study was done to detect the types of Amp C prevalent in Escherichia coli and Klebsiella pneumoniae by multiplex polymerase chain reaction (PCR. Materials and Methods : Seventy-seven consecutive cefoxitin resistant clinical isolates of E. coli (n = 25 and K. pneumoniae (n = 52 were included in the study. Antibiotic susceptibility testing to various classes of antibiotics was performed by disc diffusion using Clinical Laboratory Standards Institute (CLSI guidelines. Minimum inhibitory concentration (MIC to cefoxitin, imipenem and meropenem were determined by broth microdilution method. Isolates were screened for production of Extended Spectrum Beta-Lactamase (ESBL. Multiplex PCR was performed for the detection of Amp C genes after phenotypic testing (Hodge test and inhibitor based test. Results : Cefoxitin Hodge test was positive in 40 isolates which included 20 E. coli and 20 K. pneumoniae. There was zone enhancement with boronic acid in 55 isolates, of which 36 were K. pneumoniae and 19 were E. coli. Multiplex PCR detected Amp C in 11/25 E. coli and 12/52 K. pneumoniae isolates. The Amp C genes detected were CIT (Amp C origin - Citrobacter freundii, DHA (Dhahran Hospital, Saudi Arabia, ACC (Ambler class C, EBC (Amp C origin - Enterobacter cloacae groups. ESBL was co-produced in 54 isolates. Conclusions : Amp C was detected in 29.87% of the study isolates. Majority of them co-produced ESBL. The most common Amp C was the CIT family. Screen tests for cefoxitin resistance may be falsely positive due to production of carbapenamases.

  12. Expression of Phenylalanine Ammonia Lyase Genes in Maize Lines Differing in Susceptibility to Meloidogyne incognita.

    Science.gov (United States)

    Starr, J L; Yang, W; Yan, Y; Crutcher, F; Kolomiets, M

    2014-12-01

    Maize is a well-known host for Meloidogyne incognita, and there is substantial variation in host status among maize genotypes. In previous work it was observed that nematode reproduction increased in the moderately susceptible maize inbred line B73 when the ZmLOX3 gene from oxylipid metabolism was knocked out. Additionally, in this mutant line, use of a nonspecific primer for phenyl alanine ammonialyase (PAL) genes indicated that expression of these genes was reduced in the mutant maize plants whereas expression of several other defense related genes was increased. In this study, we used more specific gene primers to examine the expression of six PAL genes in three maize genotypes that were good, moderate, and poor hosts for M. incognita, respectively. Of the six PAL genes interrogated, two (ZmPAL3 and ZmPAL6) were not expressed in either M. incognita-infected or noninfected roots. Three genes (ZmPAL1, ZmPAL2, and ZmPAL5) were strongly expressed in all three maize lines, in both nematode-infected and noninfected roots, between 2 and 16 d after inoculation (DAI). In contrast, ZmPAL4 was most strongly expressed in the most-resistant maize line W438, was not detected in the most-susceptible maize line CML, and was detected only at 8 DAI in the maize line B73 that supported intermediate levels of reproduction by M. incognita. These observations are consistent with at least one PAL gene playing a role in modulating host status of maize toward M. incognita and suggest a need for additional research to further elucidate this association.

  13. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity

    Energy Technology Data Exchange (ETDEWEB)

    Halaban, R.; Moellmann, G. (Yale Univ. School of Medicine, New Haven, CT (USA))

    1990-06-01

    Melanogenesis is regulated in large part by tyrosinase, and defective tyrosinase leads to albinism. The mechanisms for other pigmentation determinants (e.g., those operative in tyrosinase-positive albinism and in murine coat-color mutants) are not yet known. One murine pigmentation gene, the brown (b) locus, when mutated leads to a brown (b/b) or hypopigmentated (B{sup lt}/B{sup lt}) coat versus the wild-type black (B/B). The authors show that the b locus codes for a glycoprotein with the activity of a catalase (catalase B). Only the c locus protein is a tyrosinase. Because peroxides may be by-products of melanogenic activity and hydrogen peroxide in particular is known to destroy melanin precursors and melanin, they conclude that pigmentation is controlled not only by tyrosinase but also by a hydroperoxidase. The studies indicate that catalase B is identical with gp75, a known human melanosomal glycoprotein; that the b mutation is in a heme-associated domain; and that the B{sup lt} mutation renders the protein susceptible to rapid proteolytic degradation.

  14. From Identification to Characterization of the Multiple Sclerosis Susceptibility Gene CLEC16A

    Directory of Open Access Journals (Sweden)

    Tone Berge

    2013-02-01

    Full Text Available Multiple sclerosis (MS is an inflammatory, demyelinating disorder of the central nervous system that develops in genetically susceptible individuals, probably triggered by common environmental factors. Human leukocyte antigen (HLA loci were early shown to confer the strongest genetic associations in MS. Now, more than 50 non-HLA MS susceptibility loci are identified, of which the majority are located in immune-regulatory genes. Single nucleotide polymorphisms (SNPs in the C-type lectin-like domain family 16A (CLEC16A gene were among the first non-HLA genetic variants that were confirmed to be associated with MS. Fine-mapping has indicated a primary association in MS and also other autoimmune diseases to intronic CLEC16A SNPs. Here, we review the identification of MS susceptibility variants in the CLEC16A gene region, functional studies of the CLEC16A molecule and the recent progress in understanding the implications thereof for MS development. This may serve as an example of the importance for further molecular investigation of the loci identified in genetic studies, with the aim to translate this knowledge into the clinic.

  15. Rrp1b, a new candidate susceptibility gene for breast cancer progression and metastasis.

    Directory of Open Access Journals (Sweden)

    Nigel P S Crawford

    2007-11-01

    Full Text Available A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b, was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis.

  16. [Identification of susceptibility gene for pig umbilical hernia in different populations using transmission disequilibrium test].

    Science.gov (United States)

    Su, Ying; Long, Yi; Ruan, Guorong; Wu, Lihua; Zhang, Zhiyan; Xiao, Shijun; Deng, Weiyun; Lv, Xianshan; Hu, Dou; Wu, Guozao; Shen, Huqun; Liao, Xinjun; Ding, Nengshui; Huang, Lusheng

    2014-10-01

    A genome-wide scan for pig umbilical hernia (UH) was performed in a White Duroc × Erhualian resource population reported by our previously study, which detected two susceptibility microsatellite markers (SWR1928 on SSC7 and SW830 on SSC10) significantly affecting pig UH. Herein, fine mapping studies and identification of susceptibility genes for UH were performed in two different populations. A total of 40 SNPs in 12 positional candidate genes located on the two significant segments were genotyped in the F2/F3 resource population. Quality control of the genotype data and transmission disequilibrium test (TDT) were conducted using Plink v1.07 software. The results showed that g.708G>A in IL16 (interleukin 16) gene and g.10664G>A in CDC73 (cell division cycle 73) gene were significantly associated with pig UH. These two prominent SNPs and another two weakly associated SNPs g.10546A>G and g.10811A>G in CDC73 were also undergone the replication TDT test in the outbred commercial populations. All SNPs in the CDC73 gene were confirmed to be significantly associated with pig UH (PG and g.10811A>G with extreme significant level (Ppig UH according to its biological functions and the molecular pathogenesis of UH.

  17. Transgenic citrus expressing synthesized cecropin B genes in the phloem exhibits decreased susceptibility to Huanglongbing.

    Science.gov (United States)

    Zou, Xiuping; Jiang, Xueyou; Xu, Lanzhen; Lei, Tiangang; Peng, Aihong; He, Yongrui; Yao, Lixiao; Chen, Shanchun

    2017-03-01

    Expression of synthesized cecropin B genes in the citrus phloem, where Candidatus Liberibacter asiaticus resides, significantly decreased host susceptibility to Huanglongbing. Huanglongbing (HLB), associated with Candidatus Liberibacter asiaticus bacteria, is the most destructive disease of citrus worldwide. All of the commercial sweet orange cultivars lack resistance to this disease. The cationic lytic peptide cecropin B, isolated from the Chinese tasar moth (Antheraea pernyi), has been shown to effectively eliminate bacteria. In this study, we demonstrated that transgenic citrus (Citrus sinensis Osbeck) expressing the cecropin B gene specifically in the phloem had a decreased susceptibility to HLB. Three plant codon-optimized synthetic cecropin B genes, which were designed to secrete the cecropin B peptide into three specific sites, the extracellular space, the cytoplasm, and the endoplasmic reticulum, were constructed. Under the control of the selected phloem-specific promoter GRP1.8, these constructs were transferred into the citrus genome. All of the cecropin B genes were efficiently expressed in the phloem of transgenic plants. Over more than a year of evaluation, the transgenic lines exhibited reduced disease severity. Bacterial populations in transgenic lines were significantly lower than in the controls. Two lines, in which bacterial populations were significantly lower than in others, showed no visible symptoms. Thus, we demonstrated the potential application of the phloem-specific expression of an antimicrobial peptide gene to protect citrus plants from HLB.

  18. Hypersensitive Response of Plasmid-Encoded AHL Synthase Gene to Lifestyle and Nutrient by Ensifer adhaerens X097

    Directory of Open Access Journals (Sweden)

    Yanhua Zeng

    2017-06-01

    Full Text Available It is known that some bacteria, especially members of the family Rhizobiaceae, have multiple N-acyl homoserine lactones (AHL synthase genes and produce multiple AHL signals. However, how bacteria selectively utilize these multiple genes and signals to cope with changing environments is poorly understood. Ensifer adhaerens is an important microorganism in terms of biotechnology, ecology and evolutionary. In this study, we investigated the AHL-based QS system of E. adhaerens X097 and its response to different lifestyles or nutrients. Draft genome sequence data indicated that X097 harbored three distinct AHL synthase genes (ensI1, 2, 3 and seven luxR homologs, which was different from other E. adhaerens strains. In vitro expression indicated that plasmid-encoded ensI1 and ensI2 directed production of multiple AHLs, while chromosome-encoded ensI3 only directed production of C14-HSL. Predicted three dimensional structure of EnsI3 was quite different from that of EnsI1 and EnsI2. X097 produced different AHL profiles in Luria-Bertani (LB and NFB medium, under biofilm and planktonic lifestyle, respectively. Notably, expression of ensI1 and ensI2 but not ensI3 is hypersensitive to different lifestyles and nutrients. The hypersensitive response of plasmid-encoded AHL synthase genes to different culture conditions may shed a light on the phylogenetic development of AHL synthase genes in Rhizobiaceae family.

  19. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  20. Mutations of the Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel homolog, induce L-glutamic acid production.

    Science.gov (United States)

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

    2007-07-01

    Corynebacterium glutamicum is a biotin auxotroph that secretes L-glutamic acid in response to biotin limitation; this process is employed in industrial L-glutamic acid production. Fatty acid ester surfactants and penicillin also induce L-glutamic acid secretion, even in the presence of biotin. However, the mechanism of L-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in L-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive L-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive L-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an L-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes L-glutamic acid secretion, causing an increase in the intracellular L-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased L-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an L-glutamic acid exporter. We propose that treatments that induce L-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export L-glutamic acid.

  1. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie

    2003-05-01

    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  2. [Antimicrobial susceptibilities of clinical Nocardia isolates identified by 16S rRNA gene sequence analysis].

    Science.gov (United States)

    Uner, Mahmut Celalettin; Hasçelik, Gülşen; Müştak, Hamit Kaan

    2016-01-01

    Nocardia species are ubiquitous in the environment and responsible for various human infections such as pulmonary, cutaneous, central nervous system and disseminated nocardiosis. Since the clinical pictures and antimicrobial susceptibilities of Nocardia species exhibit variability, susceptibility testing is recommended for every Nocardia isolates. The aims of this study was to determine the antimicrobial susceptibilities of Nocardia clinical isolates and to compare the results of broth microdilution and disc diffusion susceptibility tests. A total of 45 clinical Nocardia isolates (isolated from 17 respiratory tract, 8 brain abscess, 7 pus, 3 skin, 3 conjunctiva, 2 blood, 2 tissue, 2 pleural fluid and 1 cerebrospinal fluid samples) were identified by using conventional methods and 16S rRNA gene sequence analysis. Susceptibility testing was performed for amikacin, ciprofloxacin, ceftriaxone, linezolid and trimethoprim-sulfamethoxazole (TMP-SMX) by broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) criteria recommended in 2011 approved standard (M24-A2) and disk diffusion method used as an alternative comparative susceptibility testing method. Among the 45 Nocardia strains, N.cyriacigeorgica (n: 26, 57.8%) was the most common species, followed by N.farcinica (n: 12, 26.7%), N.otitiscaviarum (n: 4, 8.9%), N.asteroides (n: 1, 2.2%), N.neocaledoniensis (n: 1, 2.2%) and N.abscessus (n: 1, 2.2%). Amikacin and linezolid were the only two antimicrobials to which all isolates were susceptible for both broth microdilution and disk diffusion tests. In broth microdilution test, resistance rates to TMP-SMX, ceftriaxone and ciprofloxacin were found as 15.6%, 37.8% and 84.4% respectively, whereas in the disk diffusion test, the highest resistance rate was observed against ciprofloxacin (n: 33, 73.3%), followed by TMP-SMX (n: 22, 48.9%) and ceftriaxone (n: 15, 33.3%). In both of these tests, N.cyriacigeorgica was the species with the

  3. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  4. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    . In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...... feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases...... only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based...

  5. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  6. Predominance of a versatile-peroxidase-encoding gene, mnp4, as demonstrated by gene replacement via a gene targeting system for Pleurotus ostreatus.

    Science.gov (United States)

    Salame, Tomer M; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded; Hadar, Yitzhak

    2012-08-01

    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn(2+)-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn(2+)-dependent and Mn(2+)-independent peroxidase activity under Mn(2+)-deficient culture conditions.

  7. Predominance of a Versatile-Peroxidase-Encoding Gene, mnp4, as Demonstrated by Gene Replacement via a Gene Targeting System for Pleurotus ostreatus

    Science.gov (United States)

    Salame, Tomer M.; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded

    2012-01-01

    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn2+-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn2+-dependent and Mn2+-independent peroxidase activity under Mn2+-deficient culture conditions. PMID:22636004

  8. Mapping of gene expression reveals CYP27A1 as a susceptibility gene for sporadic ALS

    NARCIS (Netherlands)

    F.P. Diekstra (Frank); C.G.J. Saris (Christiaan); W. van Rheenen (Wouter); L. Franke (Lude); R.C. Jansen (Ritsert); M.A. van Es (Michael); K. Estrada Gil (Karol); P.W.J. van Vught (Paul); H.M. Blauw (Hylke); E.J.N. Groen (Ewout); S. Horvath (Steve); K. Estrada Gil (Karol); F. Rivadeneira Ramirez (Fernando); A. Hofman (Albert); A.G. Uitterlinden (André); W. Robberecht (Wim); P.M. Andersen (Peter); J. Melki (Judith); V. Meininger (Vincent); O. Hardiman (Orla); J.E. Landers (John); R.H. Brown (Robert); A. Shatunov (Aleksey); C.E. Shaw (Christopher); P.N. Leigh (Nigel); A. Al-Chalabi (Ammar); R.A. Ophoff (Roel); L.H. van den Berg (Leonard); J.H. Veldink (Jan)

    2012-01-01

    textabstractAmyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal

  9. Mapping of Gene Expression Reveals CYP27A1 as a Susceptibility Gene for Sporadic ALS

    NARCIS (Netherlands)

    Diekstra, Frank P.; Saris, Christiaan G. J.; van Rheenen, Wouter; Franke, Lude; Jansen, Ritsert C.; van Es, Michael A.; van Vught, Paul W. J.; Blauw, Hylke M.; Groen, Ewout J. N.; Horvath, Steve; Estrada, Karol; Rivadeneira, Fernando; Hofman, Albert; Uitterlinden, Andre G.; Robberecht, Wim; Andersen, Peter M.; Melki, Judith; Meininger, Vincent; Hardiman, Orla; Landers, John E.; Brown, Robert H.; Shatunov, Aleksey; Shaw, Christopher E.; Leigh, P. Nigel; Al-Chalabi, Ammar; Ophoff, Roel A.; van den Berg, Leonard H.; Veldink, Jan H.; Brown Jr., Robert H.; Brug, Marcel P. van der

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal loci remain

  10. Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes

    Directory of Open Access Journals (Sweden)

    Siré Christelle

    2008-03-01

    Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and

  11. Correlations of EZH2 and SMDY3 Gene Polymorphisms with Breast Cancer Susceptibility and Prognosis.

    Science.gov (United States)

    Ma, Shao-Jun; Liu, Yan-Mei; Zhang, Yue-Lang; Chen, Ming-Wei; Cao, Wei

    2017-10-31

    To investigate the correlation of EZH2 and SMYD3 gene polymorphisms with breast cancer susceptibility and prognosis. A total of 712 patients with breast cancer and 783 healthy individuals were selected. Normal breast epithelial cells MCF-10A and breast cancer cells MCF-7, MDA-MB-231, T47D and Bcap-37 were cultured. Polymerase chain reaction-restriction fragment length polymorphism method was applied for genotyping. Reverse transcription quantitative polymerase chain reaction and Western blotting were used to EZH2 and SMYD3 expression in breast cancer tissues and cells. The risk factors and prognostic factors for breast cancer were estimated. The C allele of EZH2 rs12670401 (odds ratio (OR) = 1.255, 95% confidence interval (95% CI): 1.085~1.452), T allele of EZH2 rs6464926 (OR = 1.240, 95% CI: 1.071~1.435) and 3 allele of SMYD3 VNTR (OR = 1.305, 95% CI: 1.097~1.552) could increase susceptibility to breast cancer. Combined genotypes of EZH2 rs12670401 (TC + CC) and EZH2 rs6464926 (CT + TT) were associated with breast cancer susceptibility. Breast cancer tissues had higher EZH2 and SMYD3 expression. EZH2 rs12670401, EZH2 rs6464926, age of menarche and menopausal status were associated with breast cancer susceptibility. Patients with TT genotype of EZH2 rs12670401 or with CC genotype of EZH2 rs6464926 had higher overall survival. EZH2 rs12670401, EZH2 rs6464926 and clinical staging were independent prognostic factors for breast cancer. SMYD3 VNTR polymorphism exhibited no association with susceptibility and prognosis. EZH2 rs12670401 and rs6464926 polymorphisms, EZH2 and SMYD3 expression, clinical staging, lymph node metastasis, HER2 status and metastasis may be correlated with breast cancer susceptibility and prognosis. ©2017 The Author(s).

  12. A gene for familial psoriasis susceptibility maps to the distal end of human chromosome 17q

    Energy Technology Data Exchange (ETDEWEB)

    Bowcock, A.; Tomfohrde, J.; Barnes, R. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States)] [and others

    1994-09-01

    Psoriasis is a chronic inflammatory dermatosis that affects approximately 2% of the population. A gene for psoriasis susceptibility was localized to the distal region of human chromosome 17q as a result of a genome wide linkage-analysis with polymorphic microsatellites and eight multiply affected psoriasis kindreds. With one large kindred a maximum two-point lod score with D17S784 was 5.70 at 15% recombination. Heterogeneity testing indicated that psoriasis susceptibility in 50% of the families was linked to distal 17q. Susceptibility to psoriasis has repeatedly been found to be associated with HLA-Cw6 and associated HLA alleles. We therefore genotyped the families for loci within and flanking HLA; these included PCR assays for susceptibility alleles. By lod score analysis no evidence of linkage of psoriasis susceptibility to HLA was detected. The distribution of HLA-Cw6 and HLA-Class II alleles showed that HLA-Cw6 was frequent among patients, particularly in 4 of the 5 unlinked families. All affected members of two of these unlinked families carried HLA-Cw6 (empirical P values of 0.027 and 0.004). In 2 other families 4 of 6 and 6 of 7 had HLA-Cw6. In some of these families, an inability to detect linkage to HLA may have been due to the occurrence of multiple haplotypes carrying the psoriasis associated allele, HLA-Cw6. Contrasting with these findings, we observed a lack of association between HLA-Cw6 and psoriasis in the 3 families in which 17q markers were linked to susceptibility. The ability to detect linkage to 17q confirms that some forms of familial psoriasis are due to molecular defects at a single major genetic locus other than HLA.

  13. Ketamine and Imipramine Reverse Transcriptional Signatures of Susceptibility and Induce Resilience-Specific Gene Expression Profiles.

    Science.gov (United States)

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Vialou, Vincent; Heller, Elizabeth A; Yieh, Lynn; LaBonté, Benoit; Peña, Catherine J; Shen, Li; Wittenberg, Gayle M; Nestler, Eric J

    2017-02-15

    Examining transcriptional regulation by antidepressants in key neural circuits implicated in depression and understanding the relation to transcriptional mechanisms of susceptibility and natural resilience may help in the search for new therapeutic agents. Given the heterogeneity of treatment response in human populations, examining both treatment response and nonresponse is critical. We compared the effects of a conventional monoamine-based tricyclic antidepressant, imipramine, and a rapidly acting, non-monoamine-based antidepressant, ketamine, in mice subjected to chronic social defeat stress, a validated depression model, and used RNA sequencing to analyze transcriptional profiles associated with susceptibility, resilience, and antidepressant response and nonresponse in the prefrontal cortex (PFC), nucleus accumbens, hippocampus, and amygdala. We identified similar numbers of responders and nonresponders after ketamine or imipramine treatment. Ketamine induced more expression changes in the hippocampus; imipramine induced more expression changes in the nucleus accumbens and amygdala. Transcriptional profiles in treatment responders were most similar in the PFC. Nonresponse reflected both the lack of response-associated gene expression changes and unique gene regulation. In responders, both drugs reversed susceptibility-associated transcriptional changes and induced resilience-associated transcription in the PFC. We generated a uniquely large resource of gene expression data in four interconnected limbic brain regions implicated in depression and its treatment with imipramine or ketamine. Our analyses highlight the PFC as a key site of common transcriptional regulation by antidepressant drugs and in both reversing susceptibility- and inducing resilience-associated molecular adaptations. In addition, we found region-specific effects of each drug, suggesting both common and unique effects of imipramine versus ketamine. Copyright © 2016 Society of Biological

  14. Antimicrobial Susceptibility of Bordetella bronchiseptica Isolates from Swine and Companion Animals and Detection of Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Sandra Prüller

    Full Text Available Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1-2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147, blaOXA-2, (n = 4, strA and strB (n = 17, sul1 (n = 10, sul2 (n = 73, dfrA7 (n = 3 and tet(A (n = 8 were detected and a plasmid localisation was identified for several of the resistance genes.

  15. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  16. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  17. Targeted Resequencing and Functional Testing Identifies Low-Frequency Missense Variants in the Gene Encoding GARP as Significant Contributors to Atopic Dermatitis Risk.

    Science.gov (United States)

    Manz, Judith; Rodríguez, Elke; ElSharawy, Abdou; Oesau, Eva-Maria; Petersen, Britt-Sabina; Baurecht, Hansjörg; Mayr, Gabriele; Weber, Susanne; Harder, Jürgen; Reischl, Eva; Schwarz, Agatha; Novak, Natalija; Franke, Andre; Weidinger, Stephan

    2016-12-01

    Gene-mapping studies have consistently identified a susceptibility locus for atopic dermatitis and other inflammatory diseases on chromosome band 11q13.5, with the strongest association observed for a common variant located in an intergenic region between the two annotated genes C11orf30 and LRRC32. Using a targeted resequencing approach we identified low-frequency and rare missense mutations within the LRRC32 gene encoding the protein GARP, a receptor on activated regulatory T cells that binds latent transforming growth factor-β. Subsequent association testing in more than 2,000 atopic dermatitis patients and 2,000 control subjects showed a significant excess of these LRRC32 variants in individuals with atopic dermatitis. Structural protein modeling and bioinformatic analysis predicted a disruption of protein transport upon these variants, and overexpression assays in CD4+CD25- T cells showed a significant reduction in surface expression of the mutated protein. Consistently, flow cytometric (FACS) analyses of different T-cell subtypes obtained from atopic dermatitis patients showed a significantly reduced surface expression of GARP and a reduced conversion of CD4+CD25- T cells into regulatory T cells, along with lower expression of latency-associated protein upon stimulation in carriers of the LRRC32 A407T variant. These results link inherited disturbances of transforming growth factor-β signaling with atopic dermatitis risk. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Identification of candidate susceptibility and resistance genes of mice infected with Streptococcus suis type 2.

    Directory of Open Access Journals (Sweden)

    Jie Rong

    Full Text Available Streptococcus suis type 2 (SS2 is an important swine pathogen and zoonosis agent. A/J mice are significantly more susceptible than C57BL/6 (B6 mice to SS2 infection, but the genetic basis is largely unknown. Here, alterations in gene expression in SS2 (strain HA9801-infected mice were identified using Illumina mouse BeadChips. Microarray analysis revealed 3,692 genes differentially expressed in peritoneal macrophages between A/J and B6 mice due to SS2 infection. Between SS2-infected A/J and control A/J mice, 2646 genes were differentially expressed (1469 upregulated; 1177 downregulated. Between SS2-infected B6 and control B6 mice, 1449 genes were differentially expressed (778 upregulated; 671 downregulated. These genes were analyzed for significant Gene Ontology (GO categories and signaling pathways using the Kyoto Encylopedia of Genes and Genomes (KEGG database to generate a signaling network. Upregulated genes in A/J and B6 mice were related to response to bacteria, immune response, positive regulation of B cell receptor signaling pathway, type I interferon biosynthesis, defense and inflammatory responses. Additionally, upregulated genes in SS2-infected B6 mice were involved in antigen processing and presentation of exogenous peptides, peptide antigen stabilization, lymphocyte differentiation regulation, positive regulation of monocyte differentiation, antigen receptor-mediated signaling pathway and positive regulation of phagocytosis. Downregulated genes in SS2-infected B6 mice played roles in glycolysis, carbohydrate metabolic process, amino acid metabolism, behavior and muscle regulation. Microarray results were verified by quantitative real-time PCR (qRT-PCR of 14 representative deregulated genes. Four genes differentially expressed between SS2-infected A/J and B6 mice, toll-like receptor 2 (Tlr2, tumor necrosis factor (Tnf, matrix metalloproteinase 9 (Mmp9 and pentraxin 3 (Ptx3, were previously implicated in the response to S. suis

  19. IncFIIk plasmid harbouring an amplification of 16S rRNA methyltransferase-encoding gene rmtH associated with mobile element ISCR2.

    Science.gov (United States)

    Beyrouthy, Racha; Robin, Frederic; Hamze, Monzer; Bonnet, Richard

    2017-02-01

    To investigate the resistance mechanisms and genetic support underlying the high resistance level of the Klebsiella pneumoniae strain CMUL78 to aminoglycoside and β-lactam antibiotics. Antibiotic susceptibility was assessed by the disc diffusion method and MICs were determined by the microdilution method. Antibiotic resistance genes and their genetic environment were characterized by PCR and Sanger sequencing. Plasmid contents were analysed in the clinical strain and transconjugants obtained by mating-out assays. Complete plasmid sequencing was performed with PacBio and Illumina technology. Strain CMUL78 co-produced the 16S rRNA methyltransferase (RMTase) RmtH, carbapenemase OXA-48 and ESBL SHV-12. The rmtH- and blaSHV-12-encoding genes were harboured by a novel ∼115 kb IncFIIk plasmid designated pRmtH, and blaOXA-48 by a ∼62 kb IncL/M plasmid related to pOXA-48a. pRmtH plasmid possessed seven different stability modules, one of which is a novel hybrid toxin-antitoxin system. Interestingly, pRmtH plasmid harboured a 4-fold amplification of an rmtH-ISCR2 unit arranged in tandem and inserted within a novel IS26-based composite transposon designated Tn6329. This is the first known report of the 16S RMTase-encoding gene rmtH in a plasmid. The rmtH-ISCR2 unit was inserted in a composite transposon as a 4-fold tandem repeat, a scarcely reported organization. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Nucleotide variants of genes encoding components of the Wnt signalling pathway and the risk of non-syndromic tooth agenesis.

    Science.gov (United States)

    Mostowska, A; Biedziak, B; Zadurska, M; Dunin-Wilczynska, I; Lianeri, M; Jagodzinski, P P

    2013-11-01

    Tooth agenesis is one of the most common dental anomalies, with a complex and not yet fully elucidated aetiology. Given the crucial role of the Wnt signalling pathway during tooth development, the purpose of this study was to determine whether nucleotide variants of genes encoding components of this signalling pathway might be associated with hypodontia and oligodontia in the Polish population. A set of 34 single nucleotide polymorphism (SNPs) in 13 WNT and WNT-related genes were analyzed in a group of 157 patients with tooth agenesis and a properly matched control group (n = 430). In addition, direct sequencing was performed to detect mutations in the MSX1, PAX9 and WNT10A genes. Both single-marker and haplotype analyses showed highly significant association between SNPs in the WNT10A gene and the risk for tooth agenesis. Moreover, nine pathogenic mutations within the coding region of the WNT10A gene were identified in 26 out of 42 (62%) tested patients. One novel heterozygous mutation was identified in the PAX9 gene. Borderline association with the risk of non-syndromic tooth agenesis was also observed for the APC, CTNNB1, DVL2 and WNT11 polymorphisms. In conclusion, nucleotide variants of genes encoding important components of the Wnt signalling pathway might influence the risk of tooth agenesis. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. The Aspergillus niger (ficuum) aphA gene encodes a pH 6.0-optimum acid phosphatase.

    Science.gov (United States)

    Mullaney, E J; Daly, C B; Ehrlich, K C; Ullah, A H

    1995-08-30

    We have used the Aspergillus niger (An) aphA gene as a probe and cloned the A. ficuum (Af) SRRC 265 gene encoding an extracellular pH 6.0-optimum acid phosphatase (APase6) from a genomic library. The identity of the Af aphA gene was confirmed and its nucleotide (nt) sequence verified by comparing its deduced amino acid (aa) sequence to that of purified Af APase6. A comparison of the nt sequences of the An and Af genes suggested that errors were made in the previously reported An aphA sequence. Several regions of the An aphA were resequenced and the mistakes corrected. With its nt sequence corrected, the An aphA is nearly identical to the cloned Af gene encoding APase6, and in 90.4% agreement in the coding regions. Both genes have three conserved introns and when translated, both nt sequences code for a polypeptide of 614 aa. There is now evidence that the two cloned genes are homologous and code for acid phosphatases that are 96% identical.

  2. Polymorphisms in human telomerase reverse transcriptase (hTERT) gene, gene- gene and gene-smoking interaction with susceptibility to gastric cancer in Chinese Han population.

    Science.gov (United States)

    Zhang, Jian; Ju, Hui; Gao, Jun-Ru; Jiao, Xue-Long; Lu, Yun

    2017-03-21

    To investigate the association of telomerase reverse transcriptase (TERT) gene polymorphisms and additional gene-gene and gene- environment interaction with gastric cancer (GC) risk. GC risk was significantly higher in carriers of G allele of rs2736100 than those with TT genotype (TG+ GG versus TT), adjusted OR (95%CI) =1.68 (1.26-2.17), and higher in carriers of G allele of rs2853669 than those with AA genotype (AG+ GG versus AA), adjusted OR (95%CI) = 1.72 (1.19-2.33). We also found that interaction between rs2736100 and smoking was associated with higher GC risk. Smokers with TG or GG of rs2736100 genotype have elevated GC risk, compared to never- smokers with TT of rs2736100 genotype, OR (95%CI) = 3.12 (1.82 -4.61). Pairwise linkage equilibrium (LD) analysis between SNPs was measured and the D' value between rs2736100 and rs2736109 was more than 0.8. A haplotype containing the rs2736100- G and rs2736109- A alleles was associated with a statistically increased GC risk (OR= 2.66, 95%CI= 1.28 - 4.12, pLogistic regression was performed to investigate association between single nucleotide polymorphisms (SNPs) within TERT gene and GC susceptibility. Generalized multifactor dimensionality reduction (GMDR) model was used to screen gene- gene and gene- environment interaction combinations. We found that G allele of rs2736100 and G allele of rs2853669 in TERT gene, interaction between rs2736100 and smoking, and haplotype containing the rs2736100- G and rs2736109- A alleles were all associated with increased GC risk.

  3. A Novel Differential Susceptibility Gene: "CHRNA4" and Moderation of the Effect of Maltreatment on Child Personality

    Science.gov (United States)

    Grazioplene, Rachael G.; DeYoung, Colin G.; Rogosch, Fred A.; Cicchetti, Dante

    2013-01-01

    Background: The differential susceptibility hypothesis states that some genetic variants that confer risk in adverse environments are beneficial in normal or nurturing environments. The cholinergic system is promising as a source of susceptibility genes because of its involvement in learning and neural plasticity. The cholinergic receptor gene…

  4. Beta defensin-1 gene polymorphisms and susceptibility to atypical squamous cells of undetermined significance lesions in Italian gynecological patients.

    Science.gov (United States)

    Casalicchio, Giorgia; Freato, Nadia; Maestri, Iva; Comar, Manola; Crovella, Sergio; Segat, Ludovica

    2014-12-01

    The role of the human beta-defensin 1 (hBD-1) in the susceptibility to the onset of the Atypical Squamous Cells of Undetermined Significance (ASCUS) lesion, in the presence or not of HPV infection, is still unknown. In the current study, the three functional single nucleotide polymorphisms (SNPs) -52G > A, -44C > G, and -20G > A at the 5' un-translated region (UTR) of DEFB1 gene, encoding hBD-1, were analyzed in ASCUS lesion gynecological patients and healthy women from the north-east of Italy (Trieste). Cervical samples from 249 European-Caucasian women were collected, screened for HPV and cytologically evaluated; DEFB1 genotyping has been performed by direct sequencing. No significant differences were found for -52G > A, -44C > G, and -20G > A SNPs allele and genotype frequencies between women with and without ASCUS lesions. DEFB1 minor haplotypes were significantly more frequent in ASCUS lesion positive than negative women, associating with an increased risk of this type of lesion. When women were stratified according to HPV infection status, significant differences in the distribution of -52G > A SNP genotype frequencies were found: the presence of the A allele in the homozygous genotype A/A associated with a lower risk of developing ASCUS lesions in HPV negative women. DEFB1 minor haplotypes were also associated with an increased risk of developing ASCUS lesions, being significantly more frequent in HPV negative women with lesions, than without lesions. Although these results highlight the possible involvement of DEFB1, further studies are needed to support the role of DEFB1 in the modulation of the susceptibility to ASCUS lesions. © 2014 Wiley Periodicals, Inc.

  5. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae

    Science.gov (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.

    1999-01-01

    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  6. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of s