WorldWideScience

Sample records for susceptibility genes encoding

  1. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  2. Ocular toxoplasmosis: susceptibility in respect to the genes encoding the KIR receptors and their HLA class I ligands

    Science.gov (United States)

    Ayo, Christiane Maria; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Brandão de Mattos, Cinara de Cássia; Previato, Mariana; Barbosa, Amanda Pires; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos

    2016-01-01

    The objective of this study was to investigate the influence of the genes encoding the KIR receptors and their HLA ligands in the susceptibility of ocular toxoplasmosis. A total of 297 patients serologically-diagnosed with toxoplasmosis were selected and stratified according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping was performed by PCR-SSOP. Statistical analyses were conducted using the Chi-square test, and odds ratio with a 95% confidence interval was also calculated to evaluate the risk association. The activating KIR3DS1 gene was associated with increased susceptibility for ocular toxoplasmosis. The activating KIR together with their HLA ligands (KIR3DS1-Bw4-80Ile and KIR2DS1+/C2++ KIR3DS1+/Bw4-80Ile+) were associated with increased susceptibility for ocular toxoplasmosis and its clinical manifestations. KIR-HLA inhibitory pairs -KIR2DL3/2DL3-C1/C1 and KIR2DL3/2DL3-C1- were associated with decreased susceptibility for ocular toxoplasmosis and its clinical forms, while the KIR3DS1−/KIR3DL1+/Bw4-80Ile+ combination was associated as a protective factor against the development of ocular toxoplasmosis and, in particular, against recurrent manifestations. Our data demonstrate that activating and inhibitory KIR genes may influence the development of ocular toxoplasmosis. PMID:27827450

  3. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  4. Gene knockout of the KCNJ8-encoded Kir6.1 K(ATP) channel imparts fatal susceptibility to endotoxemia.

    Science.gov (United States)

    Kane, Garvan C; Lam, Chen-Fuh; O'Cochlain, Fearghas; Hodgson, Denice M; Reyes, Santiago; Liu, Xiao-Ke; Miki, Takashi; Seino, Susumu; Katusic, Zvonimir S; Terzic, Andre

    2006-11-01

    Sepsis, the systemic inflammatory response to infection, imposes a high demand for bodily adaptation, with the cardiovascular response a key determinant of outcome. The homeostatic elements that secure cardiac tolerance in the setting of the sepsis syndrome are poorly understood. Here, in a model of acute septic shock induced by endotoxin challenge with Escherichia coli lipopolysaccharide (LPS), knockout of the KCNJ8 gene encoding the vascular Kir6.1 K(ATP) channel pore predisposed to an early and profound survival disadvantage. The exaggerated susceptibility provoked by disruption of this stress-responsive sensor of cellular metabolism was linked to progressive deterioration in cardiac activity, ischemic myocardial damage, and contractile dysfunction. Deletion of KCNJ8 blunted the responsiveness of coronary vessels to cytokine- or metabolic-mediated vasodilation necessary to support myocardial perfusion in the wild-type (WT), creating a deficit in adaptive response in the Kir6.1 knockout. Application of a K(ATP) channel opener drug improved survival in the endotoxic WT but had no effect in the Kir6.1 knockout. Restoration of the dilatory capacity of coronary vessels was required to rescue the Kir6.1 knockout phenotype and reverse survival disadvantage in lethal endotoxemia. Thus, the Kir6.1-containing K(ATP) channel, by coupling vasoreactivity with metabolic demand, provides a vital feedback element for cardiovascular tolerance in endotoxic shock.

  5. Characterization of TRZ1, a yeast homolog of the human candidate prostate cancer susceptibility gene ELAC2 encoding tRNase Z

    Directory of Open Access Journals (Sweden)

    Chen Yuan

    2005-05-01

    Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.

  6. The HADHSC gene encoding short-chain L-3-hydroxyacyl-CoA dehydrogenase (SCHAD) and type 2 diabetes susceptibility

    DEFF Research Database (Denmark)

    van Hove, Els C; Hansen, Torben; Dekker, Jacqueline M

    2006-01-01

    of the SCHAD enzyme in glucose-stimulated insulin secretion led us to the hypothesis that common variants in HADHSC on chromosome 4q22-26 might be associated with development of type 2 diabetes. In this study, we have performed a large-scale association study in four different cohorts from the Netherlands...... measure (all P > 0.1). The present study provides no evidence that the specific HADHSC variants or haplotypes examined do influence susceptibility to develop type 2 diabetes. We conclude that it is unlikely that variation in HADHSC plays a major role in the pathogenesis of type 2 diabetes in the examined...

  7. Interaction of polymorphisms in the genes encoding interleukin-6 and estrogen receptor beta on the susceptibility to Parkinson's disease.

    Science.gov (United States)

    Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans

    2005-02-05

    The multifunctional cytokine interleukin-6 (IL-6) is involved in inflammatory processes in the central nervous system and increased levels of IL-6 have been found in patients with Parkinson's disease (PD). It is known that estrogen inhibits the production of IL-6, via action on estrogen receptors, thereby pointing to an important influence of estrogen on IL-6. In a previous study, we reported an association between a G/A single nucleotide polymorphism (SNP) at position 1730 in the gene coding for estrogen receptor beta (ERbeta) and age of onset of PD. To investigate the influence of a G/C SNP at position 174 in the promoter of the IL-6 gene, and the possible interaction of this SNP and the ERbeta G-1730A SNP on the risk for PD, the G-174C SNP was genotyped, by pyrosequencing, in 258 patients with PD and 308 controls. A significantly elevated frequency of the GG genotype of the IL-6 SNP was found in the patient group and this was most obvious among patients with an early age of onset (gene. (c) 2004 Wiley-Liss, Inc.

  8. A genetic association study of the FXYD domain containing ion transport regulator 6 (FXYD6) gene, encoding phosphohippolin, in susceptibility to schizophrenia in a Japanese population.

    Science.gov (United States)

    Ito, Yoshihito; Nakamura, Yukako; Takahashi, Nagahide; Saito, Shinichi; Aleksic, Branko; Iwata, Nakao; Inada, Toshiya; Ozaki, Norio

    2008-06-13

    The FXYD domain containing ion transport regulator 6 (FXYD6) gene is located within a region of chromosome 11 (11q23.3) that has been shown by a number of genome scans to be one of the most well-established linkages to schizophrenia. FXYD6 encodes the protein phosphohippolin, which is primarily expressed in the brain. Phosphohippolin modulates the kinetic activity of Na,K-ATPase and has long-term physiological importance in maintaining cation homeostasis. A recent study reported that FXYD6 was associated with schizophrenia in the United Kingdom samples. Applying the gene-based association concept, we carried out an association study regarding FXYD6 and schizophrenia in a Japanese population, with a sample consisting of 2026 subjects (906 schizophrenics and 1120 controls). After linkage disequilibrium analysis, 23 single nucleotide polymorphisms (SNPs) were genotyped using 5'-exonuclease allelic discrimination assay. We found a significant association of two SNPs (rs11216573; genotypic P value: 0.022 and rs555577; genotypic P value: 0.026, allelic P value: 0.011, uncorrected). Nominal P values did not survive correction for multiple testing (rs11216573; genotypic P value: 0.47 and rs555577; genotypic P value: 0.55, allelic P value: 0.24, after SNPSpD correction). No association was observed between schizophrenia patients and controls in allelic, genotypic and haplotypic analyses. Our findings suggest that FXYD6 is unlikely to be related to the development of schizophrenia in a Japanese population.

  9. Susceptibility Genes in Thyroid Autoimmunity

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ban

    2005-01-01

    Full Text Available The autoimmune thyroid diseases (AITD are complex diseases which are caused by an interaction between susceptibility genes and environmental triggers. Genetic susceptibility in combination with external factors (e.g. dietary iodine is believed to initiate the autoimmune response to thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITD. Various techniques have been employed to identify the genes contributing to the etiology of AITD, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions that are linked with AITD, and in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to Graves' disease (GD and Hashimoto's thyroiditis (HT and some are common to both the diseases, indicating that there is a shared genetic susceptibility to GD and HT. The putative GD and HT susceptibility genes include both immune modifying genes (e.g. HLA, CTLA-4 and thyroid specific genes (e.g. TSHR, Tg. Most likely, these loci interact and their interactions may influence disease phenotype and severity.

  10. Primary angle closure glaucoma (PACG) susceptibility gene PLEKHA7 encodes a novel Rac1/Cdc42 GAP that modulates cell migration and blood-aqueous barrier function.

    Science.gov (United States)

    Lee, Mei-Chin; Shei, William; Chan, Anita S; Chua, Boon-Tin; Goh, Shuang-Ru; Chong, Yaan-Fun; Hilmy, Maryam H; Nongpiur, Monisha E; Baskaran, Mani; Khor, Chiea-Chuen; Aung, Tin; Hunziker, Walter; Vithana, Eranga N

    2017-10-15

    PLEKHA7, a gene recently associated with primary angle closure glaucoma (PACG), encodes an apical junctional protein expressed in components of the blood aqueous barrier (BAB). We found that PLEKHA7 is down-regulated in lens epithelial cells and in iris tissue of PACG patients. PLEKHA7 expression also correlated with the C risk allele of the sentinel SNP rs11024102 with the risk allele carrier groups having significantly reduced PLEKHA7 levels compared to non-risk allele carriers. Silencing of PLEKHA7 in human immortalized non-pigmented ciliary epithelium (h-iNPCE) and primary trabecular meshwork cells, which are intimately linked to BAB and aqueous humor outflow respectively, affected actin cytoskeleton organization. PLEKHA7 specifically interacts with GTP-bound Rac1 and Cdc42, but not RhoA, and the activation status of the two small GTPases is linked to PLEKHA7 expression levels. PLEKHA7 stimulates Rac1 and Cdc42 GTP hydrolysis, without affecting nucleotide exchange, identifying PLEKHA7 as a novel Rac1/Cdc42 GAP. Consistent with the regulatory role of Rac1 and Cdc42 in maintaining the tight junction permeability, silencing of PLEKHA7 compromises the paracellular barrier between h-iNPCE cells. Thus, downregulation of PLEKHA7 in PACG may affect BAB integrity and aqueous humor outflow via its Rac1/Cdc42 GAP activity, thereby contributing to disease etiology. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  12. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  13. The SH2D2A gene and susceptibility to multiple sclerosis

    DEFF Research Database (Denmark)

    Lorentzen, A.R.; Smestad, C.; Lie, B.A.

    2008-01-01

    We previously reported an association between the SH2D2A gene encoding TSAd and multiple sclerosis (MS). Here a total of 2128 Nordic MS patients and 2004 controls were genotyped for the SH2D2A promoter GA repeat polymorphism and rs926103 encoding a serine to asparagine substitution at amino acid...... that the SH2D2A gene may contribute to susceptibility to MS Udgivelsesdato: 2008/7/15...

  14. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  15. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  16. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  17. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  18. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  19. FGF receptor genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Agarwal, D; Pineda, S; Michailidou, K

    2014-01-01

    Background:Breast cancer is one of the most common malignancies in women. Genome-wide association studies have identified FGFR2 as a breast cancer susceptibility gene. Common variation in other fibroblast growth factor (FGF) receptors might also modify risk. We tested this hypothesis by studying...... genotyped single-nucleotide polymorphisms (SNPs) and imputed SNPs in FGFR1, FGFR3, FGFR4 and FGFRL1 in the Breast Cancer Association Consortium.Methods:Data were combined from 49 studies, including 53 835 cases and 50 156 controls, of which 89 050 (46 450 cases and 42 600 controls) were of European ancestry......, 12 893 (6269 cases and 6624 controls) of Asian and 2048 (1116 cases and 932 controls) of African ancestry. Associations with risk of breast cancer, overall and by disease sub-type, were assessed using unconditional logistic regression.Results:Little evidence of association with breast cancer risk...

  20. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  1. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  2. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  3. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  4. Neural stem cell-encoded temporal patterning delineates an early window of malignant susceptibility in Drosophila.

    Science.gov (United States)

    Narbonne-Reveau, Karine; Lanet, Elodie; Dillard, Caroline; Foppolo, Sophie; Chen, Ching-Huan; Parrinello, Hugues; Rialle, Stéphanie; Sokol, Nicholas S; Maurange, Cédric

    2016-06-14

    Pediatric neural tumors are often initiated during early development and can undergo very rapid transformation. However, the molecular basis of this early malignant susceptibility remains unknown. During Drosophila development, neural stem cells (NSCs) divide asymmetrically and generate intermediate progenitors that rapidly differentiate in neurons. Upon gene inactivation, these progeny can dedifferentiate and generate malignant tumors. Here, we find that intermediate progenitors are prone to malignancy only when born during an early window of development while expressing the transcription factor Chinmo, and the mRNA-binding proteins Imp/IGF2BP and Lin-28. These genes compose an oncogenic module that is coopted upon dedifferentiation of early-born intermediate progenitors to drive unlimited tumor growth. In late larvae, temporal transcription factor progression in NSCs silences the module, thereby limiting mitotic potential and terminating the window of malignant susceptibility. Thus, this study identifies the gene regulatory network that confers malignant potential to neural tumors with early developmental origins.

  5. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  6. Wheat Mds-1 encodes a heat-shock protein and governs susceptibility towards the Hessian fly gall midge

    Science.gov (United States)

    Plant pests including insects must manipulate plants in order to utilize the nutrition and environment of the host. Here, we show that the heat-shock protein gene Mayetiola destructor susceptibility gene-1 (Mds-1) is a major susceptibility gene in wheat that allows the gall midge M. destructor, com...

  7. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  8. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  9. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  10. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  11. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  12. Role of T cell receptor delta gene in susceptibility to celiac disease.

    Science.gov (United States)

    Roschmann, E; Wienker, T F; Volk, B A

    1996-02-01

    There is a strong genetic influence on the susceptibility to celiac disease. Although in the vast majority of patients with celiac disease, the HLA-DQ(alpha1*0501, beta1*0201) heterodimer encoded by the alleles HLA-DQA1*0501 and HLA-DQB1*0201 seems to confer the primary disease susceptibility, it cannot be excluded that other genes contribute to disease susceptibility, as indicated by the difference in concordance rates between monozygotic twins and HLA identical siblings (70% vs. 30%). Obviously other genes involved in the genetic control of T cell mediated immune response could potentially influence susceptibility to celiac disease. The density of T cells using the gammadelta T cell receptor (TCR) is considerably increased in the jejunal epithelium of patients with celiac disease, an abnormality considered to be specific for celiac disease. This suggests an involvement of gammadelta T cells in the pathogenesis of the disease. To ascertain whether the TCR delta (TCRD) gene contributes to celiac disease susceptibility we carried out an association study and genetic linkage analysis using a highly polymorphic microsatellite marker at the TCRD locus on chromosome 14q11.2. The association study demonstrated no significant difference in allele frequencies of the TCRD gene marker between celiac disease patients and controls; accordingly, the relative risk estimates did not reach the level of statistical significance. In the linkage analysis, performed in 23 families, the logarithm of the odds (LOD) scores calculated for celiac disease versus the TCRD gene marker excluded linkage, suggesting that there is no determinant contributing to celiac disease status at or 5 cM distant to the analyzed TCRD gene marker. In conclusion, the results of the present study provide no evidence that the analyzed TCRD gene contributes substantially to celiac disease susceptibility.

  13. Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.

    Science.gov (United States)

    Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W

    2018-05-01

    Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  14. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  15. Polymorphisms in the 3' UTR in the neurocalcin delta gene affect mRNA stability, and confer susceptibility to diabetic nephropathy

    DEFF Research Database (Denmark)

    Kamiyama, Masumi; Kobayashi, Masaaki; Araki, Shin-ichi

    2007-01-01

    Using a large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese type 2 diabetic patients, we have identified a gene encoding neurocalcin delta (NCALD) as a candidate for a susceptibility gene to diabetic nephropathy; the landmark SNP was found in the 3' UT...

  16. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  17. Identification of candidate new cancer susceptibility genes using yeast genomics

    International Nuclear Information System (INIS)

    Brown, M.; Brown, J.A.; Game, J.C.

    2003-01-01

    A large proportion of cancer susceptibility syndromes are the result of mutations in genes in DNA repair or in cell-cycle checkpoints in response to DNA damage, such as ataxia telangiectasia (AT), Fanconi's anemia (FA), Bloom's syndrome (BS), Nijmegen breakage syndrome (NBS), and xeroderma pigmentosum (XP). Mutations in these genes often cause gross chromosomal instability leading to an increased mutation rate of all genes including those directly responsible for cancer. We have proposed that because the orthologs of these genes in budding yeast, S. cerevisiae, confer protection against killing by DNA damaging agents it should be possible to identify new cancer susceptibility genes by identifying yeast genes whose deletion causes sensitivity to DNA damage. We therefore screened the recently completed collection of individual gene deletion mutants to identify genes that affect sensitivity to DNA-damaging agents. Screening for sensitivity in this obtained up to now with the F98 glioma model othe fact that each deleted gene is replaced by a cassette containing two molecular 'barcodes', or 20-mers, that uniquely identify the strain when DNA from a pool of strains is hybridized to an oligonucleotide array containing the complementary sequences of the barcodes. We performed the screen with UV, IR, H 2 0 2 and other DNA damaging agents. In addition to identifying genes already known to confer resistance to DNA damaging agents we have identified, and individually confirmed, several genes not previously associated with resistance. Several of these are of unknown function. We have also examined the chromosomal stability of selected strains and found that IR sensitive strains often but not always exhibit genomic instability. We are presently constructing a yeast artificial chromosome to globally interrogate all the genes in the deletion pool for their involvement in genomic stability. This work shows that budding yeast is a valuable eukaryotic model organism to identify

  18. Effects of disruption of heat shock genes on susceptibility of Escherichia coli to fluoroquinolones

    Directory of Open Access Journals (Sweden)

    Morioka Mizue

    2003-08-01

    Full Text Available Abstract Background It is well known that expression of certain bacterial genes responds rapidly to such stimuli as exposure to toxic chemicals and physical agents. It is generally believed that the proteins encoded in these genes are important for successful survival of the organism under the hostile conditions. Analogously, the proteins induced in bacterial cells exposed to antibiotics are believed to affect the organisms' susceptibility to these agents. Results We demonstrated that Escherichia coli cells exposed to levofloxacin (LVFX, a fluoroquinolone (FQ, induce the syntheses of heat shock proteins and RecA. To examine whether the heat shock proteins affect the bactericidal action of FQs, we constructed E. coli strains with mutations in various heat shock genes and tested their susceptibility to FQs. Mutations in dnaK, groEL, and lon increased this susceptibility; the lon mutant exhibited the greatest effects. The increased susceptibility of the lon mutant was corroborated by experiments in which the gene encoding the cell division inhibitor, SulA, was subsequently disrupted. SulA is induced by the SOS response and degraded by the Lon protease. The findings suggest that the hypersusceptibility of the lon mutant to FQs could be due to abnormally high levels of SulA protein resulting from the depletion of Lon and the continuous induction of the SOS response in the presence of FQs. Conclusion The present results show that the bactericidal action of FQs is moderately affected by the DnaK and GroEL chaperones and strongly affected by the Lon protease. FQs have contributed successfully to the treatment of various bacterial infections, but their widespread use and often misuse, coupled with emerging resistance, have gradually compromised their utility. Our results suggest that agents capable of inhibiting the Lon protease have potential for combination therapy with FQs.

  19. Gene susceptibility in Iranian asthmatic patients: a narrative review ...

    African Journals Online (AJOL)

    As environmental factors are important in the development of asthma, genetic factors could have a critical role in the expression of the disease. Hence, we carried out a systematic review to assess the susceptible genes for asthma in Iranian population. We conducted a literature search by using the electronic database ...

  20. Gene-wide analysis detects two new susceptibility genes for Alzheimer's Disease

    OpenAIRE

    Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter Alan; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L.; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A.; Naj, Adam C.; Sims, Rebecca

    2014-01-01

    PUBLISHED BACKGROUND: Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over...

  1. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  2. Genetic Susceptibility to Vitiligo: GWAS Approaches for Identifying Vitiligo Susceptibility Genes and Loci

    Science.gov (United States)

    Shen, Changbing; Gao, Jing; Sheng, Yujun; Dou, Jinfa; Zhou, Fusheng; Zheng, Xiaodong; Ko, Randy; Tang, Xianfa; Zhu, Caihong; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Zhang, Xuejun

    2016-01-01

    Vitiligo is an autoimmune disease with a strong genetic component, characterized by areas of depigmented skin resulting from loss of epidermal melanocytes. Genetic factors are known to play key roles in vitiligo through discoveries in association studies and family studies. Previously, vitiligo susceptibility genes were mainly revealed through linkage analysis and candidate gene studies. Recently, our understanding of the genetic basis of vitiligo has been rapidly advancing through genome-wide association study (GWAS). More than 40 robust susceptible loci have been identified and confirmed to be associated with vitiligo by using GWAS. Most of these associated genes participate in important pathways involved in the pathogenesis of vitiligo. Many susceptible loci with unknown functions in the pathogenesis of vitiligo have also been identified, indicating that additional molecular mechanisms may contribute to the risk of developing vitiligo. In this review, we summarize the key loci that are of genome-wide significance, which have been shown to influence vitiligo risk. These genetic loci may help build the foundation for genetic diagnosis and personalize treatment for patients with vitiligo in the future. However, substantial additional studies, including gene-targeted and functional studies, are required to confirm the causality of the genetic variants and their biological relevance in the development of vitiligo. PMID:26870082

  3. Network Analysis of Human Genes Influencing Susceptibility to Mycobacterial Infections

    Science.gov (United States)

    Lipner, Ettie M.; Garcia, Benjamin J.; Strong, Michael

    2016-01-01

    Tuberculosis and nontuberculous mycobacterial infections constitute a high burden of pulmonary disease in humans, resulting in over 1.5 million deaths per year. Building on the premise that genetic factors influence the instance, progression, and defense of infectious disease, we undertook a systems biology approach to investigate relationships among genetic factors that may play a role in increased susceptibility or control of mycobacterial infections. We combined literature and database mining with network analysis and pathway enrichment analysis to examine genes, pathways, and networks, involved in the human response to Mycobacterium tuberculosis and nontuberculous mycobacterial infections. This approach allowed us to examine functional relationships among reported genes, and to identify novel genes and enriched pathways that may play a role in mycobacterial susceptibility or control. Our findings suggest that the primary pathways and genes influencing mycobacterial infection control involve an interplay between innate and adaptive immune proteins and pathways. Signaling pathways involved in autoimmune disease were significantly enriched as revealed in our networks. Mycobacterial disease susceptibility networks were also examined within the context of gene-chemical relationships, in order to identify putative drugs and nutrients with potential beneficial immunomodulatory or anti-mycobacterial effects. PMID:26751573

  4. Identification of candidate genes for dyslexia susceptibility on chromosome 18.

    Directory of Open Access Journals (Sweden)

    Thomas S Scerri

    2010-10-01

    Full Text Available Six independent studies have identified linkage to chromosome 18 for developmental dyslexia or general reading ability. Until now, no candidate genes have been identified to explain this linkage. Here, we set out to identify the gene(s conferring susceptibility by a two stage strategy of linkage and association analysis.Linkage analysis: 264 UK families and 155 US families each containing at least one child diagnosed with dyslexia were genotyped with a dense set of microsatellite markers on chromosome 18. Association analysis: Using a discovery sample of 187 UK families, nearly 3000 SNPs were genotyped across the chromosome 18 dyslexia susceptibility candidate region. Following association analysis, the top ranking SNPs were then genotyped in the remaining samples. The linkage analysis revealed a broad signal that spans approximately 40 Mb from 18p11.2 to 18q12.2. Following the association analysis and subsequent replication attempts, we observed consistent association with the same SNPs in three genes; melanocortin 5 receptor (MC5R, dymeclin (DYM and neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L.Along with already published biological evidence, MC5R, DYM and NEDD4L make attractive candidates for dyslexia susceptibility genes. However, further replication and functional studies are still required.

  5. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  6. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  7. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  8. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  9. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  10. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  11. Inverse gene-for-gene interactions contribute additively to tan spot susceptibility in wheat.

    Science.gov (United States)

    Liu, Zhaohui; Zurn, Jason D; Kariyawasam, Gayan; Faris, Justin D; Shi, Gongjun; Hansen, Jana; Rasmussen, Jack B; Acevedo, Maricelis

    2017-06-01

    Tan spot susceptibility is conferred by multiple interactions of necrotrophic effector and host sensitivity genes. Tan spot of wheat, caused by Pyrenophora tritici-repentis, is an important disease in almost all wheat-growing areas of the world. The disease system is known to involve at least three fungal-produced necrotrophic effectors (NEs) that interact with the corresponding host sensitivity (S) genes in an inverse gene-for-gene manner to induce disease. However, it is unknown if the effects of these NE-S gene interactions contribute additively to the development of tan spot. In this work, we conducted disease evaluations using different races and quantitative trait loci (QTL) analysis in a wheat recombinant inbred line (RIL) population derived from a cross between two susceptible genotypes, LMPG-6 and PI 626573. The two parental lines each harbored a single known NE sensitivity gene with LMPG-6 having the Ptr ToxC sensitivity gene Tsc1 and PI 626573 having the Ptr ToxA sensitivity gene Tsn1. Transgressive segregation was observed in the population for all races. QTL mapping revealed that both loci (Tsn1 and Tsc1) were significantly associated with susceptibility to race 1 isolates, which produce both Ptr ToxA and Ptr ToxC, and the two genes contributed additively to tan spot susceptibility. For isolates of races 2 and 3, which produce only Ptr ToxA and Ptr ToxC, only Tsn1 and Tsc1 were associated with tan spot susceptibility, respectively. This work clearly demonstrates that tan spot susceptibility in this population is due primarily to two NE-S interactions. Breeders should remove both sensitivity genes from wheat lines to obtain high levels of tan spot resistance.

  12. No support for HLA-DQ encoded susceptibility in rheumatoid arthritis

    NARCIS (Netherlands)

    de Vries, N. [=Niek; van Elderen, C.; Tijssen, H.; van Riel, P. L.; van de Putte, L. B.

    1999-01-01

    To test predictions based on data from immunogenetic and peptide-binding studies of collagen-induced arthritis in mice, in which it has been suggested that susceptibility to rheumatoid arthritis (RA) might be determined by the interaction between susceptibility alleles at the HLA-DQ locus and

  13. Susceptibilities to carbapenems and presence of cphA gene on food-borne Aeromonas

    Directory of Open Access Journals (Sweden)

    Bibiana María Martín Talavera

    2006-07-01

    Full Text Available The purpose of this study was to determine the susceptibilities of food-borne Aeromonas to carbapenems, as well as to investigate the presence of a metallo carbapenemase-encoding gene, named cphA. Minimum Inhibitory Concentration (MIC was determined following NCCLS standards. All the tested microorganisms were susceptible to imipenem, meropenem and biapenem. However, a strong inoculum size effect on carbapenem MICs was observed for most of the strains. Six strains, out of seven, showed the presence of metallo--beta-lactamases but cphA gene was detected in only two strains of A. veronii bv. sobria.O objetivo deste estudo foi determinar a suscetibilidade de aeromonas de origem alimentar a carbapenems bem como investigar a presença de um gene codificante de metalocarbapenemase, denominado "cph A". A suscetibilidade in vitro foi determinada pelo metodo de diluição em agar. Todas as cepas foram suscetíveis a Imipenem, Meropenem e Biapenem. Porém foi observado um forte efeito de tamanho do inóculo sobre as CIM das carbapenems na maioria das cepas. A detecção de metalo-beta-lactamase foi realizada pelo metodo lodometrico. Seis cepas das sete testadas demostraron a presença da enzima. A presença do gene cphA foi determinada por PCR e foi detectada em duas cepas de A veronii bv. sobria.

  14. Variants in the SP110 gene are associated with genetic susceptibility to tuberculosis in West Africa

    Science.gov (United States)

    Tosh, Kerrie; Campbell, Sarah J.; Fielding, Katherine; Sillah, Jackson; Bah, Boubacar; Gustafson, Per; Manneh, Kebba; Lisse, Ida; Sirugo, Giorgio; Bennett, Steve; Aaby, Peter; McAdam, Keith P. W. J.; Bah-Sow, Oumou; Lienhardt, Christian; Kramnik, Igor; Hill, Adrian V. S.

    2006-01-01

    The sst1 locus has been identified in a mouse model to control resistance and susceptibility of Mycobacterium tuberculosis infection. Subsequent studies have now identified Ipr1 (intracellular pathogen resistance 1) to be the gene responsible. Ipr1 is encoded within the sst1 locus and is expressed in the tuberculosis lung lesions and macrophages of sst1-resistant, but not sst1-susceptible mice. We have therefore examined the closest human homologue of Ipr1, SP110, for its ability to control susceptibility to M. tuberculosis infection in humans. In a study of families from The Gambia we have identified three polymorphisms that are associated with disease. On examination of additional families from Guinea-Bissau and the Republic of Guinea, two of these associations were independently replicated. These variants are in strong linkage disequilibrium with each other and lie within a 31-kb block of low haplotypic diversity, suggesting that a polymorphism within this region has a role in genetic susceptibility to tuberculosis in humans. PMID:16803959

  15. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  16. Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

    Science.gov (United States)

    Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

    2017-08-01

    The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  17. Hereditary cancer genes are highly susceptible to splicing mutations

    Science.gov (United States)

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  18. Hereditary cancer genes are highly susceptible to splicing mutations.

    Directory of Open Access Journals (Sweden)

    Christy L Rhine

    2018-03-01

    Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

  19. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  20. Chromosomally Encoded mcr-5 in Colistin non-susceptible Pseudomonas aeruginosa.

    Science.gov (United States)

    Snesrud, Erik; Maybank, Rosslyn; Kwak, Yoon I; Jones, Anthony R; Hinkle, Mary K; Mc Gann, Patrick

    2018-05-29

    Whole genome sequencing (WGS) of historical Pseudomonas aeruginosa clinical isolates identified a chromosomal copy of mcr-5 within a Tn 3 -like transposon in P. aeruginosa MRSN 12280. The isolate was non-susceptible to colistin by broth microdilution and genome analysis revealed no mutations known to confer colistin resistance. To the best of our knowledge, this is the first report of mcr in colistin non-susceptible P. aeruginosa .

  1. Multilocus analysis reveals three candidate genes for Chinese migraine susceptibility.

    Science.gov (United States)

    An, X-K; Fang, J; Yu, Z-Z; Lin, Q; Lu, C-X; Qu, H-L; Ma, Q-L

    2017-08-01

    Several genome-wide association studies (GWASs) in Caucasian populations have identified 12 loci that are significantly associated with migraine. More evidence suggests that serotonin receptors are also involved in migraine pathophysiology. In the present study, a case-control study was conducted in a cohort of 581 migraine cases and 533 ethnically matched controls among a Chinese population. Eighteen polymorphisms from serotonin receptors and GWASs were selected, and genotyping was performed using a Sequenom MALDI-TOF mass spectrometry iPLEX platform. The genotypic and allelic distributions of MEF2D rs2274316 and ASTN2 rs6478241 were significantly different between migraine patients and controls. Univariate and multivariate analysis revealed significant associations of polymorphisms in the MEF2D and ASTN2 genes with migraine susceptibility. MEF2D, PRDM16 and ASTN2 were also found to be associated with migraine without aura (MO) and migraine with family history. And, MEF2D and ASTN2 also served as genetic risk factors for the migraine without family history. The generalized multifactor dimensionality reduction analysis identified that MEF2D and HTR2E constituted the two-factor interaction model. Our study suggests that the MEF2D, PRDM16 and ASTN2 genes from GWAS are associated with migraine susceptibility, especially MO, among Chinese patients. It appears that there is no association with serotonin receptor related genes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Genome-wide association studies of adolescent idiopathic scoliosis suggest candidate susceptibility genes

    Science.gov (United States)

    Sharma, Swarkar; Gao, Xiaochong; Londono, Douglas; Devroy, Shonn E.; Mauldin, Kristen N.; Frankel, Jessica T.; Brandon, January M.; Zhang, Dongping; Li, Quan-Zhen; Dobbs, Matthew B.; Gurnett, Christina A.; Grant, Struan F.A.; Hakonarson, Hakon; Dormans, John P.; Herring, John A.; Gordon, Derek; Wise, Carol A.

    2011-01-01

    Adolescent idiopathic scoliosis (AIS) is an unexplained and common spinal deformity seen in otherwise healthy children. Its pathophysiology is poorly understood despite intensive investigation. Although genetic underpinnings are clear, replicated susceptibility loci that could provide insight into etiology have not been forthcoming. To address these issues, we performed genome-wide association studies (GWAS) of ∼327 000 single nucleotide polymorphisms (SNPs) in 419 AIS families. We found strongest evidence of association with chromosome 3p26.3 SNPs in the proximity of the CHL1 gene (P protein related to Robo3. Mutations in the Robo3 protein cause horizontal gaze palsy with progressive scoliosis (HGPPS), a rare disease marked by severe scoliosis. Other top associations in our GWAS were with SNPs in the DSCAM gene encoding an axon guidance protein in the same structural class with Chl1 and Robo3. We additionally found AIS associations with loci in CNTNAP2, supporting a previous study linking this gene with AIS. Cntnap2 is also of functional interest, as it interacts directly with L1 and Robo class proteins and participates in axon pathfinding. Our results suggest the relevance of axon guidance pathways in AIS susceptibility, although these findings require further study, particularly given the apparent genetic heterogeneity in this disease. PMID:21216876

  4. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  5. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  6. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  7. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  8. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  9. Assessment of PALB2 as a candidate melanoma susceptibility gene.

    Directory of Open Access Journals (Sweden)

    Lauren G Aoude

    Full Text Available Partner and localizer of BRCA2 (PALB2 interacts with BRCA2 to enable double strand break repair through homologous recombination. Similar to BRCA2, germline mutations in PALB2 have been shown to predispose to Fanconi anaemia as well as pancreatic and breast cancer. The PALB2/BRCA2 protein interaction, as well as the increased melanoma risk observed in families harbouring BRCA2 mutations, makes PALB2 a candidate for melanoma susceptibility. In order to assess PALB2 as a melanoma predisposition gene, we sequenced the entire protein-coding sequence of PALB2 in probands from 182 melanoma families lacking pathogenic mutations in known high penetrance melanoma susceptibility genes: CDKN2A, CDK4, and BAP1. In addition, we interrogated whole-genome and exome data from another 19 kindreds with a strong family history of melanoma for deleterious mutations in PALB2. Here we report a rare known deleterious PALB2 mutation (rs118203998 causing a premature truncation of the protein (p.Y1183X in an individual who had developed four different cancer types, including melanoma. Three other family members affected with melanoma did not carry the variant. Overall our data do not support a case for PALB2 being associated with melanoma predisposition.

  10. Glutathione S-transferase genes and the risk of type 2 diabetes mellitus: Role of sexual dimorphism, gene-gene and gene-smoking interactions in disease susceptibility.

    Science.gov (United States)

    Azarova, Iuliia; Bushueva, Olga; Konoplya, Alexander; Polonikov, Alexey

    2018-05-01

    Compromised defense against reactive oxygen species (ROS) is considered important in the pathogenesis of type 2 diabetes mellitus (T2DM); therefore, genes encoding antioxidant defense enzymes may contribute to disease susceptibility. This study investigated whether polymorphisms in genes encoding glutathione S-transferase M1 (GSTM1), T1 (GSTT1), and P1 (GSTP1) jointly contribute to the risk of T2DM. In all, 1120 unrelated Russian subjects (600 T2DM patients, 520 age- and sex-matched healthy subjects), were recruited to the study. Genotyping was performed by multiplex polymerase chain reaction (PCR; del/del polymorphisms of GSTM1 and GSTT1) and TaqMan-based PCR (polymorphisms I105V and A114V of GSTP1). Plasma ROS and glutathione levels in study subjects were analyzed by fluorometric and colorimetric assays, respectively. Genotype del/del GSTT1 was significantly associated with the risk of T2DM (odds ratio [OR] 1.60, 95% confidence interval [CI] 1.17-2.21, P = 0.003). Gender-stratified analysis showed that the deletion genotypes of GSTM1 (OR 1.99, 95% CI 1.30-3.05; P = 0.0002, Q = 0.016) and GSTT1 (OR 2.23, 95% CI 1.22-4.09; P = 0.008, Q = 0.0216), as well as genotype 114A/V of GSTP1 (OR 2.85, 95% CI 1.44-5.62; P = 0.005, Q = 0.02) were associated with an increased risk of T2DM exclusively in males. Three genotype combinations (i.e. GSTM1+ × GSTT1+, GSTM1+ × GSTP1 114A/A and GSTT1+ × GSTP1 114A/A) showed significant associations with a decreased risk of T2DM in males. This study demonstrates, for the first time, that genes encoding glutathione S-transferases jointly contribute to the risk of T2DM, and that their effects on disease susceptibility are gender specific. © 2017 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

  11. Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients.

    Science.gov (United States)

    Jansen, Anne M L; Geilenkirchen, Marije A; van Wezel, Tom; Jagmohan-Changur, Shantie C; Ruano, Dina; van der Klift, Heleen M; van den Akker, Brendy E W M; Laros, Jeroen F J; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G W; Gómez-García, Encarna B; Tops, Carli M J; Vasen, Hans F; Devilee, Peter; Hes, Frederik J; Morreau, Hans; Wijnen, Juul T

    2016-01-01

    Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes.

  12. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  13. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  14. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  15. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  16. Virulence Genes and Antibiotic Susceptibilities of Uropathogenic E. coli Strains.

    Science.gov (United States)

    Uzun, Cengiz; Oncül, Oral; Gümüş, Defne; Alan, Servet; Dayioğlu, Nurten; Küçüker, Mine Anğ

    2015-01-01

    The aim of this study is to detect the presence of and possible relation between virulence genes and antibiotic resistance in E. coli strains isolated from patients with acute, uncomplicated urinary tract infections (UTI). 62 E. coli strains isolated from patients with acute, uncomplicated urinary tract infections (50 strains isolated from acute uncomplicated cystitis cases (AUC); 12 strains from acute uncomplicated pyelonephritis cases (AUP)) were screened for virulence genes [pap (pyelonephritis-associated pili), sfa/foc (S and F1C fimbriae), afa (afimbrial adhesins), hly (hemolysin), cnf1 (cytotoxic necrotizing factor), aer (aerobactin), PAI (pathogenicity island marker), iroN (catecholate siderophore receptor), ompT (outer membrane protein T), usp (uropathogenic specific protein)] by PCR and for antimicrobial resistance by disk diffusion method according to CLSI criteria. It was found that 56 strains (90.3%) carried at least one virulence gene. The most common virulence genes were ompT (79%), aer (51.6%), PAI (51.6%) and usp (56.5%). 60% of the strains were resistant to at least one antibiotic. The highest resistance rates were against ampicillin (79%) and co-trimoxazole (41.9%). Fifty percent of the E. coli strains (31 strains) were found to be multiple resistant. Eight (12.9%) out of 62 strains were found to be ESBL positive. Statistically significant relationships were found between the absence of usp and AMP - SXT resistance, iroN and OFX - CIP resistance, PAI and SXT resistance, cnf1 and AMP resistance, and a significant relationship was also found between the presence of the afa and OFX resistance. No difference between E. coli strains isolated from two different clinical presentations was found in terms of virulence genes and antibiotic susceptibility.

  17. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  18. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  19. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  20. Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.

    Science.gov (United States)

    Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola

    2017-08-01

    MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.

  1. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  2. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the

  3. Asthma susceptible genes in Chinese population: A meta-analysis

    Directory of Open Access Journals (Sweden)

    He Chao

    2010-09-01

    Full Text Available Abstract Background Published data regarding the associations between genetic variants and asthma risk in Chinese population were inconclusive. The aim of this study was to investigate asthma susceptible genes in Chinese population. Methods The authors conducted 18 meta-analyzes for 18 polymorphisms in 13 genes from eighty-two publications. Results Seven polymorphisms were found being associated with risk of asthma, namely: A Disintegrin and Metalloprotease 33 (ADAM33 T1-C/T (odds ratio [OR] = 6.07, 95% confidence interval [CI]: 2.69-13.73, Angiotensin-Converting Enzyme (ACE D/I (OR = 3.85, 95%CI: 2.49-5.94, High-affinity IgE receptor β chain (FcεRIβ -6843G/A (OR = 1.49, 95%CI: 1.01-2.22, Interleukin 13(IL-13 -1923C/T (OR = 2.99, 95%CI: 2.12-4.24, IL-13 -2044A/G (OR = 1.49, 95%CI: 1.07-2.08, Regulated upon Activation, Normal T cell Expressed and Secreted (RANTES -28C/G (OR = 1.64, 95%CI: 1.09-2.46, Tumor Necrosis Factor-α (TNF-α -308G/A(OR = 1.42, 95%CI: 1.09, 1.85. After subgroup analysis by age, the ACE D/I, β2-Adrenergic Receptor (β2-AR -79G/C, TNF-α -308G/A, Interleukin 4 receptor(IL-4R -1902G/A and IL-13 -1923C/T polymorphisms were found significantly associated with asthma risk in Chinese children. In addition, the ACE D/I, FcεRIβ -6843G/A, TNF-α -308G/A, IL-13 -1923C/T and IL-13 -2044A/G polymorphisms were associated with asthma risk in Chinese adults. Conclusion ADAM33, FcεRIβ, RANTES, TNF-α, ACE, β2-AR, IL-4R and IL-13 genes could be proposed as asthma susceptible genes in Chinese population. Given the limited number of studies, more data are required to validate these associations.

  4. Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

    Science.gov (United States)

    Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Jun, Gyungah; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Denning, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Vronskaya, Maria; Johnson, Andrew D; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Baldwin, Clinton; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letenneur, Luc; Hernández, Isabel; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleo, Alberto; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick C; Hardy, John; Naranjo, Maria Candida Deniz; Bosco, Paolo; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Scarpini, Elio; Bonuccelli, Ubaldo; Mancuso, Michelangelo; Siciliano, Gabriele; Moebus, Susanne; Mecocci, Patrizia; Zompo, Maria Del; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Frank-García, Ana; Panza, Francesco; Solfrizzi, Vincenzo; Caffarra, Paolo; Nacmias, Benedetta; Perry, William; Mayhaus, Manuel; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alvarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Gu, Wei; Razquin, Cristina; Pastor, Pau; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee F A G; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John S K; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Van Broeckhoven, Christine; Farrer, Lindsay A; van Duijn, Cornelia M; Ramirez, Alfredo; Seshadri, Sudha; Schellenberg, Gerard D; Amouyel, Philippe; Williams, Julie

    2014-01-01

    Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls. In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6) and 14 (IGHV1-67 p = 7.9×10-8) which indexed novel susceptibility loci. The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

  5. Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Valentina Escott-Price

    Full Text Available Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls.In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6 and 14 (IGHV1-67 p = 7.9×10-8 which indexed novel susceptibility loci.The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

  6. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  7. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  8. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  9. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  10. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  11. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  12. Genetic and Functional Evidence Supports LPAR1 as a Susceptibility Gene for Hypertension.

    Science.gov (United States)

    Xu, Ke; Ma, Lu; Li, Yang; Wang, Fang; Zheng, Gu-Yan; Sun, Zhijun; Jiang, Feng; Chen, Yundai; Liu, Huirong; Dang, Aimin; Chen, Xi; Chun, Jerold; Tian, Xiao-Li

    2015-09-01

    Essential hypertension is a complex disease affected by genetic and environmental factors and serves as a major risk factor for cardiovascular diseases. Serum lysophosphatidic acid correlates with an elevated blood pressure in rats, and lysophosphatidic acid interacts with 6 subtypes of receptors. In this study, we assessed the genetic association of lysophosphatidic acid receptors with essential hypertension by genotyping 28 single-nucleotide polymorphisms from genes encoding for lysophosphatidic acid receptors, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, and LPAR6 and their flanking sequences, in 3 Han Chinese cohorts consisting of 2630 patients and 3171 controls in total. We identified a single-nucleotide polymorphism, rs531003 in the 3'-flanking genomic region of LPAR1, associated with hypertension (the Bonferroni corrected P=1.09×10(-5), odds ratio [95% confidence interval]=1.23 [1.13-1.33]). The risk allele C of rs531003 is associated with the increased expression of LPAR1 and the susceptibility of hypertension, particularly in those with a shortage of sleep (P=4.73×10(-5), odds ratio [95% confidence interval]=1.75 [1.34-2.28]). We further demonstrated that blood pressure elevation caused by sleep deprivation and phenylephrine-induced vasoconstriction was both diminished in LPAR1-deficient mice. Together, we show that LPAR1 is a novel susceptibility gene for human essential hypertension and that stress, such as shortage of sleep, increases the susceptibility of patients with risk allele to essential hypertension. © 2015 American Heart Association, Inc.

  13. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  14. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  15. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  16. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  17. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  18. Genetic Predictions of Prion Disease Susceptibility in Carnivore Species Based on Variability of the Prion Gene Coding Region

    Science.gov (United States)

    Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred

    2012-01-01

    Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380

  19. Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

    Directory of Open Access Journals (Sweden)

    Paula Stewart

    Full Text Available Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE during the bovine spongiform encephalopathy (BSE epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD remains an open question. Variation in the host-encoded prion protein (PrP(C largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo and pine marten (Martes martes were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus and mountain lion (Puma concolor from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

  20. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  1. Candidate chromosome 1 disease susceptibility genes for Sjogren’s syndrome xerostomia are narrowed by novel NOD.B10 congenic mice

    Science.gov (United States)

    Mongini, Patricia K. A.; Kramer, Jill M.; Ishikawa, Tomo-o; Herschman, Harvey; Esposito, Donna

    2014-01-01

    Sjogren’s syndrome (SS) is characterized by salivary gland leukocytic infiltrates and impaired salivation (xerostomia). Cox-2 (Ptgs2) is located on chromosome 1 within the span of the Aec2 region. In an attempt to demonstrate that COX-2 drives antibody-dependent hyposalivation, NOD.B10 congenic mice bearing a Cox-2flox gene were generated. A congenic line with non-NOD alleles in Cox-2-flanking genes failed manifest xerostomia. Further backcrossing yielded disease-susceptible NOD.B10 Cox-2flox lines; fine genetic mapping determined that critical Aec2 genes lie within a 1.56 to 2.17 Mb span of DNA downstream of Cox-2. Bioinformatics analysis revealed that susceptible and non-susceptible lines exhibit non-synonymous coding SNPs in 8 protein-encoding genes of this region, thereby better delineating candidate Aec2 alleles needed for SS xerostomia. PMID:24685748

  2. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Science.gov (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  3. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  4. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  5. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  6. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  7. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  8. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  9. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  10. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  11. The Circadian Rhythm Gene Arntl2 Is a Metastasis Susceptibility Gene for Estrogen Receptor-Negative Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Ngoc-Han Ha

    2016-09-01

    Full Text Available Breast cancer mortality is primarily due to metastasis rather than primary tumors, yet relatively little is understood regarding the etiology of metastatic breast cancer. Previously, using a mouse genetics approach, we demonstrated that inherited germline polymorphisms contribute to metastatic disease, and that these single nucleotide polymorphisms (SNPs could be used to predict outcome in breast cancer patients. In this study, a backcross between a highly metastatic (FVB/NJ and low metastatic (MOLF/EiJ mouse strain identified Arntl2, a gene encoding a circadian rhythm transcription factor, as a metastasis susceptibility gene associated with progression, specifically in estrogen receptor-negative breast cancer patients. Integrated whole genome sequence analysis with DNase hypersensitivity sites reveals SNPs in the predicted promoter of Arntl2. Using CRISPR/Cas9-mediated substitution of the MOLF promoter, we demonstrate that the SNPs regulate Arntl2 transcription and affect metastatic burden. Finally, analysis of SNPs associated with ARNTL2 expression in human breast cancer patients revealed reproducible associations of ARNTL2 expression quantitative trait loci (eQTL SNPs with disease-free survival, consistent with the mouse studies.

  12. Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.

    Science.gov (United States)

    Scorpio, A; Zhang, Y

    1996-06-01

    Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.

  13. High Frequency of Interactions between Lung Cancer Susceptibility Genes in the Mouse : Mapping of Sluc5 to Sluc14

    NARCIS (Netherlands)

    Fijneman, Remond J.A.; Jansen, Ritsert C.; Valk, Martin A. van der; Demant, Peter

    1998-01-01

    Although several genes that cause monogenic familial cancer syndromes have been identified, susceptibility to sporadic cancer remains unresolved. Animal experiments have demonstrated multigenic control of tumor susceptibility. Recently, we described four mouse lung cancer susceptibility (Sluc) loci,

  14. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  15. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  16. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  17. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  18. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  19. Roles of Breast Cancer Susceptibility Genes BRCA’s in Mammary Epithelial Cell Differentiation

    Science.gov (United States)

    2006-03-01

    FANCA . Hum. Mol. Genet. 11, 2591-2597 (2002). 13. Tessari, M.A. et al. Transcriptional activation of the cyclin A gene by the architectural...caretakercancer susceptibility gene FANCA (24), as well several IFN- or caspase- associated proteins, were down-regulated. Concomitantly, in these cells...a mammary differentiation factor STAT5B and a caretaker cancer susceptibility gene FANCA were down-regulated. Nev- ertheless, it has yet to be

  20. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany.

    Directory of Open Access Journals (Sweden)

    Jessica Joerling

    Full Text Available Swine dysentery (SD is an economically important diarrheal disease in pigs caused by different strongly hemolytic Brachyspira (B. species, such as B. hyodysenteriae, B. suanatina and B. hampsonii. Possible associations of epidemiologic data, such as multilocus sequence types (STs to virulence gene profiles and antimicrobial susceptibility are rather scarce, particularly for B. hyodysenteriae isolates from Germany. In this study, B. hyodysenteriae (n = 116 isolated from diarrheic pigs between 1990 and 2016 in Germany were investigated for their STs, susceptibility to the major drugs used for treatment of SD (tiamulin and valnemulin and genes that were previously linked with virulence and encode for hemolysins (tlyA, tlyB, tlyC, hlyA, BHWA1_RS02885, BHWA1_RS09085, BHWA1_RS04705, and BHWA1_RS02195, outer membrane proteins (OMPs (bhlp16, bhlp17.6, bhlp29.7, bhmp39f, and bhmp39h as well as iron acquisition factors (ftnA and bitC. Multilocus sequence typing (MLST revealed that 79.4% of the isolates belonged to only three STs, namely ST52 (41.4%, ST8 (12.1%, and ST112 (25.9% which have been observed in other European countries before. Another 24 isolates belonged to twelve new STs (ST113-118, ST120-123, ST131, and ST193. The temporal distribution of STs revealed the presence of new STs as well as the regular presence of ST52 over three decades (1990s-2000s. The proportion of strains that showed resistance to both tiamulin und valnemulin (39.1% varied considerably among the most frequent STs ranging from 0% (0/14 isolates resistant in ST8 isolates to 46.7% (14/30, 52.1% (25/48, and 85.7% (6/7 in isolates belonging to ST112, ST52, and ST114, respectively. All hemolysin genes as well as the iron-related gene ftnA and the OMP gene bhlp29.7 were regularly present in the isolates, while the OMP genes bhlp17.6 and bhmp39h could not be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB, BHWA1_RS02885, BHWA1_RS

  1. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany

    Science.gov (United States)

    Joerling, Jessica; Barth, Stefanie A.; Schlez, Karen; Willems, Hermann

    2018-01-01

    Swine dysentery (SD) is an economically important diarrheal disease in pigs caused by different strongly hemolytic Brachyspira (B.) species, such as B. hyodysenteriae, B. suanatina and B. hampsonii. Possible associations of epidemiologic data, such as multilocus sequence types (STs) to virulence gene profiles and antimicrobial susceptibility are rather scarce, particularly for B. hyodysenteriae isolates from Germany. In this study, B. hyodysenteriae (n = 116) isolated from diarrheic pigs between 1990 and 2016 in Germany were investigated for their STs, susceptibility to the major drugs used for treatment of SD (tiamulin and valnemulin) and genes that were previously linked with virulence and encode for hemolysins (tlyA, tlyB, tlyC, hlyA, BHWA1_RS02885, BHWA1_RS09085, BHWA1_RS04705, and BHWA1_RS02195), outer membrane proteins (OMPs) (bhlp16, bhlp17.6, bhlp29.7, bhmp39f, and bhmp39h) as well as iron acquisition factors (ftnA and bitC). Multilocus sequence typing (MLST) revealed that 79.4% of the isolates belonged to only three STs, namely ST52 (41.4%), ST8 (12.1%), and ST112 (25.9%) which have been observed in other European countries before. Another 24 isolates belonged to twelve new STs (ST113-118, ST120-123, ST131, and ST193). The temporal distribution of STs revealed the presence of new STs as well as the regular presence of ST52 over three decades (1990s–2000s). The proportion of strains that showed resistance to both tiamulin und valnemulin (39.1%) varied considerably among the most frequent STs ranging from 0% (0/14 isolates resistant) in ST8 isolates to 46.7% (14/30), 52.1% (25/48), and 85.7% (6/7) in isolates belonging to ST112, ST52, and ST114, respectively. All hemolysin genes as well as the iron-related gene ftnA and the OMP gene bhlp29.7 were regularly present in the isolates, while the OMP genes bhlp17.6 and bhmp39h could not be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB, BHWA1_RS02885, BHWA1_RS

  2. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  3. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  4. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  5. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  6. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  7. Differential susceptibility to maternal expressed emotion in children with ADHD and their siblings? Investigating plasticity genes, prosocial and antisocial behaviour

    NARCIS (Netherlands)

    Richards, Jennifer S; Hartman, Catharina A; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Arias Vásquez, Alejandro; Buitelaar, Jan K

    The differential susceptibility theory states that children differ in their susceptibility towards environmental experiences, partially due to plasticity genes. Individuals carrying specific variants in such genes will be more disadvantaged in negative but, conversely, more advantaged in positive

  8. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  9. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  10. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  11. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  12. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  13. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  14. Contribution of genes polymorphism to susceptibility and outcome of ...

    African Journals Online (AJOL)

    The evidence that endogenous mediators actually mediate the individual's ... has contribution to susceptibility and outcome of sepsis in some research. ... patients with a high risk of developing severe sepsis and multiple organ dysfunctions.

  15. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  16. The NCAN gene: schizophrenia susceptibility and cognitive dysfunction

    Directory of Open Access Journals (Sweden)

    Wang P

    2016-11-01

    Full Text Available Peirong Wang,1 Jun Cai,2 Jianliang Ni,1 Jiangtao Zhang,1 Wei Tang,3 Chen Zhang2 1Department of Psychiatry, Tongde Hospital of Zhejiang Province, Hangzhou, Zhejiang, 2Schizophrenia Program, Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine, Shanghai, 3Wenzhou Kangning Hospital, Wenzhou, Zhejiang, People’s Republic of China Background: Cognitive dysfunction has been recognized as a cardinal feature of schizophrenia. Elucidating the neurobiological substrates of cognitive dysfunction in schizophrenia would help identify the underlying mechanism of this disorder. The rs1064395 single nucleotide polymorphism, within the gene encoding neurocan (NCAN, is reported to be associated with schizophrenia in European populations and may influence brain structure in patients with schizophrenia.Methods: In this study, we aimed to explore whether NCAN rs1064395 confers some risk for schizophrenia and cognitive dysfunction in Han Chinese. We recruited 681 patients with schizophrenia and 699 healthy subjects. Two hundred and fifty-four patients were evaluated according to Repeatable Battery for the Assessment of Neuropsychological Status (RBANS.Results: There were no significant differences in genotype or allele distributions of the rs1064395 polymorphism between the schizophrenia and control groups. Patients showed significantly poorer performance than controls on immediate memory, visuospatial skill, language, attention, delayed memory, and total RBANS score. Patients with the A/A or A/G genotype of rs1064395 had lower scores of immediate memory, visuospatial skill, attention, and total RBANS score than those with the G/G genotype. We performed an expression quantitative trait loci analysis and observed a significant association between rs1064395 and NCAN expression in the frontal (P=0.0022, P=0.022 after Bonferroni correction and cerebellar cortex (P=0.0032, P=0.032 after Bonferroni correction.Conclusion: Our findings indicate

  17. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  18. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  19. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  20. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  1. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  2. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  3. Cdkal1, a type 2 diabetes susceptibility gene, regulates mitochondrial function in adipose tissue

    Directory of Open Access Journals (Sweden)

    Colin J. Palmer

    2017-10-01

    Conclusions: Cdkal1 is necessary for normal mitochondrial morphology and function in adipose tissue. These results suggest that the type 2 diabetes susceptibility gene CDKAL1 has novel functions in regulating mitochondrial activity.

  4. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  5. Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

    Science.gov (United States)

    Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

    2011-06-01

    Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

  6. Comprehensive Clinical Phenotyping and Genetic Mapping for the Discovery of Autism Susceptibility Genes

    Science.gov (United States)

    2013-03-14

    behavioral teaching strategies and best practice for teaching students with autism spectrum disorders 4.52 Learn strategies for incorporating IEP goals...AFRL-SA-WP-TR-2013-0013 Comprehensive Clinical Phenotyping and Genetic Mapping for the Discovery of Autism Susceptibility Genes...Genetic Mapping for the Discovery of Autism Susceptibility Genes 5a. CONTRACT NUMBER N/A 5b. GRANT NUMBER N/A 5c. PROGRAM ELEMENT NUMBER N/A 6

  7. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  8. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  9. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  10. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  11. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  12. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  13. Mapping of gene expression reveals CYP27A1 as a susceptibility gene for sporadic ALS.

    Directory of Open Access Journals (Sweden)

    Frank P Diekstra

    Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS have implicated a few susceptibility loci. However, many more causal loci remain to be discovered. Since it has been shown that genetic variants associated with complex traits are more likely to be eQTLs than frequency-matched variants from GWAS platforms, we conducted a two-stage genome-wide screening for eQTLs associated with ALS. In addition, we applied an eQTL analysis to finemap association loci. Expression profiles using peripheral blood of 323 sporadic ALS patients and 413 controls were mapped to genome-wide genotyping data. Subsequently, data from a two-stage GWAS (3,568 patients and 10,163 controls were used to prioritize eQTLs identified in the first stage (162 ALS, 207 controls. These prioritized eQTLs were carried forward to the second sample with both gene-expression and genotyping data (161 ALS, 206 controls. Replicated eQTL SNPs were then tested for association in the second-stage GWAS data to find SNPs associated with disease, that survived correction for multiple testing. We thus identified twelve cis eQTLs with nominally significant associations in the second-stage GWAS data. Eight SNP-transcript pairs of highest significance (lowest p = 1.27 × 10(-51 withstood multiple-testing correction in the second stage and modulated CYP27A1 gene expression. Additionally, we show that C9orf72 appears to be the only gene in the 9p21.2 locus that is regulated in cis, showing the potential of this approach in identifying causative genes in association loci in ALS. This study has identified candidate genes for sporadic ALS, most notably CYP27A1. Mutations in CYP27A1 are causal to cerebrotendinous xanthomatosis which can present as a clinical mimic of ALS with progressive upper motor neuron loss, making it a plausible

  14. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  15. TERT gene harbors multiple variants associated with pancreatic cancer susceptibility

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Rizzato, C.; Stolzenberg-Solomon, R.; Pacetti, P.; Vodička, Pavel; Cleary, S.P.; Capurso, G.; Bueno-de-Mesquita, H. B.; Werner, J.; Gazouli, M.; Butterbach, K.; Ivanauskas, A.; Giese, N.; Petersen, G. M.; Fogar, P.; Wang, Z.; Bassi, C.; Ryska, M.; Theodoropoulos, G.E.; Kooperberg, Ch.; Li, D.; Greenhalf, W.; Pasquali, C.; Hackert, T.; Fuchs, Ch.S.; Mohelníková-Duchoňová, B.; Sperti, C.; Funel, N.; Dieffenbach, A.K.; Wareham, N.J.; Buring, J.; Holcátová, I.; Costello, E.; Zambon, C.F.; Kupcinskas, J.; Risch, H.A.; Kraft, P.; Bracci, P.M.; Pezzilli, R.; Olson, S.H.; Sesso, H. D.; Hartge, P.; Strobel, O.; Malecka-Panas, E.; Visvanathan, K.; Arslan, A. A.; Pedrazzoli, S.; Souček, P.; Gioffreda, D.; Key, T.J.; Talar-Wojnarowska, R.; Scarpa, A.; Mambrini, A.; Jacobs, E.J.; Jamroziak, K.; Klein, A.; Tavano, F.; Bambi, F.; Landi, S.; Austin, M. A.; Vodičková, Ludmila; Brenner, H.; Chanock, S. J.; Fave, G.D.; Piepoli, A.; Cantore, M.; Zheng, W.; Wolpin, B.M.; Amundadottir, L. T.; Canzian, F.

    2015-01-01

    Roč. 137, č. 9 (2015), s. 2175-2183 ISSN 0020-7136 R&D Projects: GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : pancreatic cancer * polymorphisms * telomerase * susceptibility Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.531, year: 2015

  16. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  17. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  18. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  19. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  20. Cloning and expression analysis of innate immune genes from red sea bream to assess different susceptibility to megalocytivirus infection.

    Science.gov (United States)

    Jin, J W; Kim, Y C; Hong, S; Kim, M S; Jeong, J B; Jeong, H D

    2017-04-01

    As suggested by the Office International des Epizooties (OIE), fishes belonging to the genus Oplegnathus are more sensitive to megalocytivirus infection than other fish species including red sea bream (Pagrus major). To assess the roles of the innate immune response to these different susceptibilities, we cloned the genes encoding inflammatory factors including IL-8 and COX-2, and the antiviral factor like Mx from red sea bream for the first time and performed phylogenetic and structural analysis. Analysed expression levels of IL-1β, IL-8 and COX-2 and the antiviral factor like Mx genes performed with in vivo challenge experiment showed no difference in inflammatory gene expression or respiratory burst activity between red sea bream and rock bream (Oplegnathus fasciatus). However, the Mx gene expression levels in red sea bream were markedly higher than those in rock bream, suggesting the importance of type I interferon (IFN)-induced proteins, particularly Mx, during megalocytivirus infection, rather than inflammation-related genes. The in vitro challenge experiments using embryonic primary cultures derived from both fish species showed no difference in cytopathic effects (CPE), viral replication profiles, and inflammatory and Mx gene expression pattern between the two fish species. © 2016 John Wiley & Sons Ltd.

  1. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  2. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  3. Molecular detection of genes encoding AcrAB , Qep A efflux pumps in Klebsiella pneumoniae strains isolated from hospitalized patients in selected hospitals in Tehran

    Directory of Open Access Journals (Sweden)

    Mohsen Heidary

    2017-03-01

    Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae  (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.

  4. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  5. Alcohol and aldehyde dehydrogenase gene polymorphisms influence susceptibility to esophageal cancer in Japanese alcoholics.

    Science.gov (United States)

    Yokoyama, A; Muramatsu, T; Omori, T; Matsushita, S; Yoshimizu, H; Higuchi, S; Yokoyama, T; Maruyama, K; Ishii, H

    1999-11-01

    Studies have consistently demonstrated that inactive aldehyde dehydrogenase-2 (ALDH2), encoded by ALDH2*1/2*2, is closely associated with alcohol-related carcinogenesis. Recently, the contributions of alcohol dehydrogenase-2 (ADH2) polymorphism to alcoholism, esophageal cancer, and the flushing response have also been described. To determine the effects of ALDH2 and ADH2 genotypes in genetically based cancer susceptibility, lymphocyte DNA samples from 668 Japanese alcoholic men more than 40 years of age (91 with and 577 without esophageal cancer) were genotyped and the results were expressed as odds ratios (ORs). This study also tested 82 of the alcoholics with esophageal cancer to determine whether cancer susceptibility is associated with patients' responses to simple questions about current or former flushing after drinking a glass of beer. The frequencies of ADH2*1/2*1 and ALDH2*1/2*2 were significantly higher in alcoholics with, than in those without, esophageal cancer (0.473 vs. 0.289 and 0.560 vs. 0.099, respectively). After adjustment for drinking and smoking, the analysis showed significantly increased cancer risk for alcoholics with either ADH2*1/2*I (OR = 2.03) or ALDH2*1/2*2 (OR = 12.76). For those having ADH2*1/2*1 combined with ALDH2*1/2*2, the esophageal cancer risk was enhanced in a multiplicative fashion (OR = 27.66). Responses to flushing questions showed that only 47.8% of the ALDH2*1/2*2 heterozygotes with ADH2*1/ 2*1, compared with 92.3% of those with ALDH2*1/2*2 and the ADH2*2 allele, reported current or former flushing. Genotyping showed that for alcoholics who reported ever flushing, the questionnaire was 71.4% correct in identifying ALDH2*1/2*2 and 87.9% correct in identifying ALDH2*1/2*1. Japanese alcoholics can be divided into cancer susceptibility groups on the basis of their combined ADH2 and ALDH2 genotypes. The flushing questionnaire can predict high risk ALDH2*1/2*2 fairly accurately in persons with ADH2*2 allele, but a reliable

  6. Polymorphisms of genes encoding P2X7R, IL-1B, OPG and RANK in orthodontic-induced apical root resorption.

    Science.gov (United States)

    Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H

    2014-10-01

    Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  8. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  9. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  10. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  11. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  12. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  13. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  14. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  15. Effects of NFKB1 and NFKBIA gene polymorphisms on susceptibility to environmental factors and the clinicopathologic development of oral cancer.

    Directory of Open Access Journals (Sweden)

    Chiao-Wen Lin

    Full Text Available Oral cancer, which is the fourth most common cancer in Taiwanese men, is associated with environmental carcinogens. The possibility that genetic predisposition in nuclear factor-kappa B (NF-κB-signaling pathways activation is linked to the development of oral squamous cell carcinoma (OSCC requires investigation. The current study examines associations between polymorphisms within promoter regions of NFKB1 encoding NF-κB1 and NFKBIA encoding IkappaBalpha (IκBα with both the susceptibility to develop OSCC and the clinicopathological characteristics of the tumors.Genetic polymorphisms of NFKB1 and NFKBIA were analyzed by a real-time polymerase chain reaction (real-time PCR for 462 patients with oral cancer and 520 non-cancer controls. We found that NFKB1 -94 ATGG1/ATGG2, -94 ATGG2/ATGG2, and the combination of -94 ATGG1/ATGG2 and ATGG2/ATGG2 genotypes NFKBIA -826 T (CT+TT and -881 G (AG+GG allelic carriages, were more prevalent in OSCC patients than in non-cancer participants. Moreover, we found that NFKB1 or NFKBIA gene polymorphisms seem to be related to susceptibility to develop oral cancer linked to betel nut and tobacco consumption. Finally, patients with oral cancer who had at least one -519 T allele of the NFKBIA gene were at higher risk for developing distant metastasis (P<.05, compared with those patients CC homozygotes.Our results suggest that NFKB1 -94 ATTG2, NFKBIA -826 T, and -881 G alleles are associated with oral carcinogenesis. The combination of NFKB1 or NFKBIA gene polymorphisms and environmental carcinogens appears related to an increased risk of oral cancer. More importantly, the genetic polymorphism of NFKBIA -519 might be a predictive factor for the distal metastasis of OSCC in Taiwanese.

  16. CELSR2 is a candidate susceptibility gene in idiopathic scoliosis

    DEFF Research Database (Denmark)

    Einarsdottir, Elisabet; Grauers, Anna; Wang, Jingwen

    2017-01-01

    and the US. No association was found to variants in CELSR1 or CELSR3. Our findings suggest a rare variant in CELSR2 as causative for idiopathic scoliosis in a family with dominant segregation and further highlight common variation in CELSR2 in general susceptibility to idiopathic scoliosis in the Swedish......-Danish population. Both variants are located in the highly conserved GAIN protein domain, which is necessary for the auto-proteolysis of CELSR2, suggesting its functional importance....

  17. Typing of Panton-Valentine leukocidin-encoding phages carried by methicillin-susceptible and methicillin-resistant Staphylococcus aureus from Italy.

    Science.gov (United States)

    Sanchini, A; Del Grosso, M; Villa, L; Ammendolia, M G; Superti, F; Monaco, M; Pantosti, A

    2014-11-01

    Panton-Valentine leukocidin (PVL) is the hallmark of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) but can also be found in methicillin-susceptible S. aureus (MSSA) sharing pathogenic and epidemiological characteristics of CA-MRSA. PVL is encoded by two co-transcribed genes that are carried by different staphylococcal bacteriophages. We applied an extended PCR-based typing scheme for the identification of two morphological groups (elongated-head group and icosahedral-head group I phages) and specific PVL phage types in S. aureus isolates recovered in Italy. We examined 48 PVL-positive isolates (25 MSSA and 23 MRSA) collected from different hospital laboratories from April 2005 to May 2011. spa typing, multilocus sequence typing and staphylococcal cassette chromosome mec typing were applied to categorize the isolates. Phage typeability was 48.0% in MSSA and 91.3% in MRSA, highlighting the limitation of the PCR typing scheme when applied to PVL-positive MSSA. Five different PVL phages and two variants of a known phage were detected, the most prevalent being ΦSa2usa, recovered in 15 out of 48 (31.2%) isolates, and carried by both MSSA and MRSA belonging to CC8 and CC5. The recently described ΦTCH60 was recovered in four isolates. A PVL phage (ΦSa119) from an ST772 MRSA, that was not detected using the previous typing scheme, was sequenced, and new primers were designed for the identification of the icosahedral-head group II PVL phages present in ST772 and ST59 MRSA. A comprehensive PVL-phage typing can contribute to the understanding of the epidemiology and evolution of PVL-positive MSSA and MRSA. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  18. Identification of Genetic Susceptibility to Childhood Cancer through Analysis of Genes in Parallel

    Science.gov (United States)

    Plon, Sharon E.; Wheeler, David A.; Strong, Louise C.; Tomlinson, Gail E.; Pirics, Michael; Meng, Qingchang; Cheung, Hannah C.; Begin, Phyllis R.; Muzny, Donna M.; Lewis, Lora; Biegel, Jaclyn A.; Gibbs, Richard A.

    2011-01-01

    Clinical cancer genetic susceptibility analysis typically proceeds sequentially beginning with the most likely causative gene. The process is time consuming and the yield is low particularly for families with unusual patterns of cancer. We determined the results of in parallel mutation analysis of a large cancer-associated gene panel. We performed deletion analysis and sequenced the coding regions of 45 genes (8 oncogenes and 37 tumor suppressor or DNA repair genes) in 48 childhood cancer patients who also (1) were diagnosed with a second malignancy under age 30, (2) have a sibling diagnosed with cancer under age 30 and/or (3) have a major congenital anomaly or developmental delay. Deleterious mutations were identified in 6 of 48 (13%) families, 4 of which met the sibling criteria. Mutations were identified in genes previously implicated in both dominant and recessive childhood syndromes including SMARCB1, PMS2, and TP53. No pathogenic deletions were identified. This approach has provided efficient identification of childhood cancer susceptibility mutations and will have greater utility as additional cancer susceptibility genes are identified. Integrating parallel analysis of large gene panels into clinical testing will speed results and increase diagnostic yield. The failure to detect mutations in 87% of families highlights that a number of childhood cancer susceptibility genes remain to be discovered. PMID:21356188

  19. Knockout of a P-glycoprotein gene increases susceptibility to abamectin and emamectin benzoate in Spodoptera exigua.

    Science.gov (United States)

    Zuo, Y-Y; Huang, J-L; Wang, J; Feng, Y; Han, T-T; Wu, Y-D; Yang, Y-H

    2018-02-01

    P-glycoprotein [P-gp or the ATP-binding cassette transporter B1 (ABCB1)] is an important participant in multidrug resistance of cancer cells, yet the precise function of this arthropod transporter is unknown. The aim of this study was to determine the importance of P-gp for susceptibility to insecticides in the beet armyworm (Spodoptera exigua) using clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) gene-editing technology. We cloned an open reading frame (ORF) encoding the S. exigua P-gp protein (SeP-gp) predicted to display structural characteristics common to P-gp and other insect ABCB1 transporters. A knockout line with a frame shift deletion of four nucleotides in the SeP-gp ORF was established using the CRISPR/Cas9 gene-editing system to test its potential role in determining susceptibility to chemical insecticides or insecticidal proteins from the bacterium Bacillus thuringiensis (Bt). Results from comparative bioassays demonstrate that knockout of SeP-gp significantly increases susceptibility of S. exigua by around threefold to abamectin and emamectin benzoate (EB), but not to spinosad, chlorfenapyr, beta-cypermethrin, carbosulfan indoxacarb, chlorpyrifos, phoxim, diafenthiuron, chlorfluazuron, chlorantraniliprole or two Bt toxins (Cry1Ca and Cry1Fa). Our data support an important role for SeP-gp in susceptibility of S. exigua to abamectin and EB and imply that overexpression of SeP-gp may contribute to abamectin and EB resistance in S. exigua. © 2017 The Royal Entomological Society.

  20. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Prevalence of genes encoding extracellular virulence factors among meticillin-resistant Staphylococcus aureus isolates from the University Hospital, Olomouc, Czech Republic.

    Science.gov (United States)

    Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D

    2008-04-01

    A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.

  2. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  3. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  4. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  5. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  6. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease.

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around

  7. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD

  8. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  9. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  10. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  11. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  12. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  13. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  14. New genes linked to lung cancer susceptibility in Asian women

    Science.gov (United States)

    An international group of scientists has identified three genes that predispose Asian women who have never smoked to lung cancer. The discovery of specific genetic variations, which have not previously been associated with lung cancer risk in other popul

  15. A gene pathway analysis highlights the role of cellular adhesion molecules in multiple sclerosis susceptibility

    DEFF Research Database (Denmark)

    Damotte, V; Guillot-Noel, L; Patsopoulos, N A

    2014-01-01

    adhesion molecule (CAMs) biological pathway using Cytoscape software. This network is a strong candidate, as it is involved in the crossing of the blood-brain barrier by the T cells, an early event in MS pathophysiology, and is used as an efficient therapeutic target. We drew up a list of 76 genes...... in interaction with other genes as a group. Pathway analysis is an alternative way to highlight such group of genes. Using SNP association P-values from eight multiple sclerosis (MS) GWAS data sets, we performed a candidate pathway analysis for MS susceptibility by considering genes interacting in the cell...... belonging to the CAM network. We highlighted 64 networks enriched with CAM genes with low P-values. Filtering by a percentage of CAM genes up to 50% and rejecting enriched signals mainly driven by transcription factors, we highlighted five networks associated with MS susceptibility. One of them, constituted...

  16. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  17. Detecting differential allelic expression using high-resolution melting curve analysis: application to the breast cancer susceptibility gene CHEK2

    Directory of Open Access Journals (Sweden)

    Sinilnikova Olga

    2011-05-01

    Full Text Available Abstract Background The gene CHEK2 encodes a checkpoint kinase playing a key role in the DNA damage pathway. Though CHEK2 has been identified as an intermediate breast cancer susceptibility gene, only a small proportion of high-risk families have been explained by genetic variants located in its coding region. Alteration in gene expression regulation provides a potential mechanism for generating disease susceptibility. The detection of differential allelic expression (DAE represents a sensitive assay to direct the search for a functional sequence variant within the transcriptional regulatory elements of a candidate gene. We aimed to assess whether CHEK2 was subject to DAE in lymphoblastoid cell lines (LCLs from high-risk breast cancer patients for whom no mutation in BRCA1 or BRCA2 had been identified. Methods We implemented an assay based on high-resolution melting (HRM curve analysis and developed an analysis tool for DAE assessment. Results We observed allelic expression imbalance in 4 of the 41 LCLs examined. All four were carriers of the truncating mutation 1100delC. We confirmed previous findings that this mutation induces non-sense mediated mRNA decay. In our series, we ruled out the possibility of a functional sequence variant located in the promoter region or in a regulatory element of CHEK2 that would lead to DAE in the transcriptional regulatory milieu of freely proliferating LCLs. Conclusions Our results support that HRM is a sensitive and accurate method for DAE assessment. This approach would be of great interest for high-throughput mutation screening projects aiming to identify genes carrying functional regulatory polymorphisms.

  18. MDM2 SNP309, gene-gene interaction, and tumor susceptibility: an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Wu Wei

    2011-05-01

    Full Text Available Abstract Background The tumor suppressor gene p53 is involved in multiple cellular pathways including apoptosis, transcriptional control, and cell cycle regulation. In the last decade it has been demonstrated that the single nucleotide polymorphism (SNP at codon 72 of the p53 gene is associated with the risk for development of various neoplasms. MDM2 SNP309 is a single nucleotide T to G polymorphism located in the MDM2 gene promoter. From the time that this well-characterized functional polymorphism was identified, a variety of case-control studies have been published that investigate the possible association between MDM2 SNP309 and cancer risk. However, the results of the published studies, as well as the subsequent meta-analyses, remain contradictory. Methods To investigate whether currently published epidemiological studies can clarify the potential interaction between MDM2 SNP309 and the functional genetic variant in p53 codon72 (Arg72Pro and p53 mutation status, we performed a meta-analysis of the risk estimate on 27,813 cases with various tumor types and 30,295 controls. Results The data we reviewed indicated that variant homozygote 309GG and heterozygote 309TG were associated with a significant increased risk of all tumor types (homozygote comparison: odds ratio (OR = 1.25, 95% confidence interval (CI = 1.13-1.37; heterozygote comparison: OR = 1.10, 95% CI = 1.03-1.17. We also found that the combination of GG and Pro/Pro, TG and Pro/Pro, GG and Arg/Arg significantly increased the risk of cancer (OR = 3.38, 95% CI = 1.77-6.47; OR = 1.88, 95% CI = 1.26-2.81; OR = 1.96, 95% CI = 1.01-3.78, respectively. In a stratified analysis by tumor location, we also found a significant increased risk in brain, liver, stomach and uterus cancer (OR = 1.47, 95% CI = 1.06-2.03; OR = 2.24, 95%CI = 1.57-3.18; OR = 1.54, 95%CI = 1.04-2.29; OR = 1.34, 95%CI = 1.07-1.29, respectively. However, no association was seen between MDM2 SNP309 and tumor susceptibility

  19. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  20. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  3. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  4. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  5. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  6. Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia

    Directory of Open Access Journals (Sweden)

    Judy Natalia Jiménez

    2011-12-01

    Full Text Available Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA and methicillin-resistant S. aureus (MRSA strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric patients between zero-14 years. We identified the genes encoding virulence factors, which included Panton-Valentine leucocidine (PVL, staphylococcal enterotoxins A-E, exfoliative toxins A and B and toxic shock syndrome toxin 1. Typing of the staphylococcal chromosome cassette mec (SCCmec was performed in MRSA strains. The virulence genes were more diverse and frequent in MSSA than in MRSA isolates (83% vs. 73%. MRSA strains harboured SCCmec types IVc (60%, I (30%, IVa (7% and V (3%. SCCmec type IVc isolates frequently carried the PVL encoding genes and harboured virulence determinants resembling susceptible strains while SCCmec type I isolates were often negative. PVL was not exclusive to skin and soft tissue infections. As previously suggested, these differences in the distribution of virulence factor genes may be due to the fitness cost associated with methicillin resistance.

  7. Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia.

    Science.gov (United States)

    Jiménez, Judy Natalia; Ocampo, Ana María; Vanegas, Johanna Marcela; Rodríguez, Erika Andrea; Garcés, Carlos Guillermo; Patiño, Luz Adriana; Ospina, Sigifredo; Correa, Margarita María

    2011-12-01

    Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric patients between zero-14 years. We identified the genes encoding virulence factors, which included Panton-Valentine leucocidine (PVL), staphylococcal enterotoxins A-E, exfoliative toxins A and B and toxic shock syndrome toxin 1. Typing of the staphylococcal chromosome cassette mec (SCCmec) was performed in MRSA strains. The virulence genes were more diverse and frequent in MSSA than in MRSA isolates (83% vs. 73%). MRSA strains harboured SCCmec types IVc (60%), I (30%), IVa (7%) and V (3%). SCCmec type IVc isolates frequently carried the PVL encoding genes and harboured virulence determinants resembling susceptible strains while SCCmec type I isolates were often negative. PVL was not exclusive to skin and soft tissue infections. As previously suggested, these differences in the distribution of virulence factor genes may be due to the fitness cost associated with methicillin resistance.

  8. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  9. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  10. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  11. Hemochromatosis C282Y gene mutation as a potential susceptibility ...

    African Journals Online (AJOL)

    G.M. Mokhtar

    2017-08-12

    Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

  12. Interleukin Gene Polymorphisms and Susceptibility to HIV Infection

    Indian Academy of Sciences (India)

    Chrysa

    vaccines, and with almost 36.7 million HIV-infected individuals worldwide .... The allelic and genotypic distribution of the IL genes SNPs are presented in .... polymorphism using the genetic model-free bivariate approach produced, as in ... Through its immuno-inhibitory and anti-inflammatory activities and, in particular, by.

  13. Chromosomal Abnormalities and Putative Susceptibility Genes in Autism Spectrum Disorders

    DEFF Research Database (Denmark)

    Nielsen, Mette Gilling

    Autism spectrum disorders (ASDs) is a heterogeneous group of neurodevelopmental disorders with a significant genetic component as shown by family and twin studies. However, only a few genes have repeatedly been shown to be involved in the development of ASDs. The aim of this study has been...

  14. Influence of doxorubicin on fluconazole susceptibility and efflux pump gene expression of Candida dubliniensis.

    LENUS (Irish Health Repository)

    Schulz, Bettina

    2012-05-01

    The effect of doxorubicin (DOX) on the fluconazole (FLU) susceptibility of C. dubliniensis was investigated. Isolates were exposed to DOX and FLU in a chequerboard assay and resistance gene expressions were analysed after DOX exposure. The susceptibility of the yeast to FLU was decreased in the presence of DOX in the chequerboard assay with FIC indices suggesting an antagonistic effect. Gene expression analyses showed an overexpression of CdCDR2. Hence, DOX was found to have an impact on resistance mechanisms in C. dubliniensis isolates.

  15. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  16. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo

    2015-03-01

    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  17. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  18. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  19. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    NARCIS (Netherlands)

    L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cornelia); K. Borch-Johnsen; O. Pedersen (Oluf)

    2005-01-01

    textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA

  20. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  1. GAB2 as an Alzheimer Disease Susceptibility Gene

    Science.gov (United States)

    Schjeide, Brit-Maren M.; Hooli, Basavaraj; Parkinson, Michele; Hogan, Meghan F.; DiVito, Jason; Mullin, Kristina; Blacker, Deborah; Tanzi, Rudolph E.; Bertram, Lars

    2009-01-01

    Background Genomewide association (GWA) studies have recently implicated 4 novel Alzheimer disease (AD) susceptibility loci (GAB2, GOLM1, and 2 uncharacterized loci to date on chromosomes 9p and 15q). To our knowledge, these findings have not been independently replicated. Objective To assess these GWA findings in 4 large data sets of families affected by AD. Design Follow-up of genetic association findings in previous studies. Setting Academic research. Participants More than 4000 DNA samples from almost 1300 families affected with AD. Main Outcome Measures Genetic association analysis testing of 4 GWA signals (rs7101429 [GAB2], rs7019241 [GOLM1], rs10519262 [chromosome 15q], and rs9886784 [chromosome 9p]) using family-based methods. Results In the combined analyses, only rs7101429 in GAB2 yielded significant evidence of association with the same allele as in the original GWA study (P = .002). The results are in agreement with recent meta-analyses of this and other GAB2 polymorphisms suggesting approximately a 30% decrease in risk for AD among carriers of the minor alleles. None of the other 3 tested loci showed consistent evidence for association with AD across the investigated data sets. Conclusions GAB2 contains genetic variants that may lead to a modest change in the risk for AD. Despite these promising results, more data from independent samples are needed to better evaluate the potential contribution of GAB2 to AD risk in the general population. PMID:19204163

  2. PTPN22 gene polymorphisms in autoimmune diseases with special reference to systemic lupus erythematosus disease susceptibility

    Directory of Open Access Journals (Sweden)

    Pradhan V

    2010-01-01

    Full Text Available Systemic lupus erythematosus (SLE is a prototype autoimmune disease. SLE is a result of one or more immune mechanisms, like autoantibody production, complement activation, multiple inflammation and immune complex deposition leading to organ tissue damage. SLE affected patients are susceptible to common and opportunistic infections. There are several reports suggesting that Mycobacterium tuberculosis infection precipitates SLE in patients from endemic areas. Genetic factors and environmental factors also play an important role in the overall susceptibility to SLE pathophysiology. Recently, protein tyrosine phosphatase, non-receptor type 22 (PTPN22 gene, has been found to be associated with several autoimmune diseases like SLE, Grave′s disease and Hashimoto thyroiditis. The missense R620W polymorphism, rs 2476601, in PTPN22 gene at the nucleotide 1858 in codon 620 (620Arg > Trp has been associated with autoimmune diseases. The PTPN22 locus is also found to be responsible for development of pulmonary tuberculosis in certain populations. The PTPN22 1858C/T gene locus will be ideal to look for SLE susceptibility to tuberculosis in the Indian population. In this review, we focus on human PTPN22 gene structure and function as well as the association of PTPN22 gene polymorphisms with SLE susceptibility

  3. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  4. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob

    2007-01-01

    for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...

  5. Protocadherin α (PCDHA) as a novel susceptibility gene for autism

    Science.gov (United States)

    Anitha, Ayyappan; Thanseem, Ismail; Nakamura, Kazuhiko; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Iwata, Yasuhide; Suzuki, Katsuaki; Sugiyama, Toshiro; Tsujii, Masatsugu; Yoshikawa, Takeo; Mori, Norio

    2013-01-01

    Background Synaptic dysfunction has been shown to be involved in the pathogenesis of autism. We hypothesized that the protocadherin α gene cluster (PCDHA), which is involved in synaptic specificity and in serotonergic innervation of the brain, could be a suitable candidate gene for autism. Methods We examined 14 PCDHA single nucleotide polymorphisms (SNPs) for genetic association with autism in DNA samples of 3211 individuals (841 families, including 574 multiplex families) obtained from the Autism Genetic Resource Exchange. Results Five SNPs (rs251379, rs1119032, rs17119271, rs155806 and rs17119346) showed significant associations with autism. The strongest association (p < 0.001) was observed for rs1119032 (z score of risk allele G = 3.415) in multiplex families; SNP associations withstand multiple testing correction in multiplex families (p = 0.041). Haplotypes involving rs1119032 showed very strong associations with autism, withstanding multiple testing corrections. In quantitative transmission disequilibrium testing of multiplex families, the G allele of rs1119032 showed a significant association (p = 0.033) with scores on the Autism Diagnostic Interview–Revised (ADI-R)_D (early developmental abnormalities). We also found a significant difference in the distribution of ADI-R_A (social interaction) scores between the A/A, A/G and G/G genotypes of rs17119346 (p = 0.002). Limitations Our results should be replicated in an independent population and/or in samples of different racial backgrounds. Conclusion Our study provides strong genetic evidence of PCDHA as a potential candidate gene for autism. PMID:23031252

  6. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  7. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  8. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  9. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  10. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    Science.gov (United States)

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

    1995-01-01

    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  11. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  12. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  14. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  15. The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus

    OpenAIRE

    Davison, L.J.; Holder, A.; Catchpole, B.; O'Callaghan, C.A.

    2017-01-01

    Background Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. Hypothesis/Objectives To characterize the POMC deletion i...

  16. Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

    Science.gov (United States)

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

    2016-06-01

    Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Mapping the genes for susceptibility and response to Leishmania tropica in mouse

    Czech Academy of Sciences Publication Activity Database

    Sohrabi, Yahya; Havelková, Helena; Kobets, Tetyana; Šíma, Matyáš; Volkova, Valeriya; Grekov, Igor; Jarošíková, T.; Kurey, Irina; Vojtíšková, Jarmila; Svobodová, M.; Demant, P.; Lipoldová, Marie

    2013-01-01

    Roč. 7, č. 7 (2013), s. 1-17 ISSN 1935-2735 R&D Projects: GA ČR GA310/08/1697; GA MŠk LH12049 Institutional support: RVO:68378050 Keywords : Leishmania tropica * gene controlling susceptibility * host-parasite interactions * leishmaniasis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.489, year: 2013

  18. Influence of the IL6 Gene in Susceptibility to Systemic Sclerosis

    NARCIS (Netherlands)

    Cenit, M.C.; Simeon, C.P.; Vonk, M.C.; Callejas-Rubio, J.L.; Espinosa, G.; Carreira, P.; Blanco, F.J.; Narvaez, J.; Tolosa, C.; Roman-Ivorra, J.A.; Gomez-Garcia, I.; Garcia-Hernandez, F.J.; Gallego, M.; Garcia-Portales, R.; Egurbide, M.V.; Fonollosa, V.; Garcia de la Pena, P.; Lopez-Longo, F.J.; Gonzalez-Gay, M.A.; The Spanish Scleroderma, G.; Hesselstrand, R.; Riemekasten, G.; Witte, T.J.M. de; Voskuyl, A.E.; Schuerwegh, A.J.; Madhok, R.; Fonseca, C.; Denton, C.; Nordin, A.; Palm, O.; Laar, J.M. van; Hunzelmann, N.; Distler, J.H.; Kreuter, A.; Herrick, A.; Worthington, J.; Koeleman, B.P.; Radstake, T.R.D.J.; Martin, J.

    2012-01-01

    OBJECTIVE: Systemic sclerosis (SSc) is a genetically complex autoimmune disease; the genetic component has not been fully defined. Interleukin 6 (IL-6) plays a crucial role in immunity and fibrosis, both key aspects of SSc. We investigated the influence of IL6 gene in the susceptibility and

  19. Strain-dependent susceptibility for hypertension in mice resides in the natural killer gene complex

    NARCIS (Netherlands)

    Taherzadeh, Zhila; VanBavel, Ed; de Vos, Judith; Matlung, Hanke L.; van Montfrans, Gert; Brewster, Lizzy M.; Seghers, Leonard; Quax, Paul H. A.; Bakker, Erik N. T. P.

    2010-01-01

    Taherzadeh Z, VanBavel E, de Vos J, Matlung HL, van Montfrans G, Brewster LM, Seghers L, Quax PH, Bakker EN. Strain-dependent susceptibility for hypertension in mice resides in the natural killer gene complex. Am J Physiol Heart Circ Physiol 298: H1273-H1282, 2010. First published February 12, 2010;

  20. The inflammatory bowel disease (IBD susceptibility genes NOD1 and NOD2 have conserved anti-bacterial roles in zebrafish

    Directory of Open Access Journals (Sweden)

    Stefan H. Oehlers

    2011-11-01

    Inflammatory bowel disease (IBD, in the form of Crohn’s disease (CD or ulcerative colitis (UC, is a debilitating chronic immune disorder of the intestine. A complex etiology resulting from dysfunctional interactions between the intestinal immune system and its microflora, influenced by host genetic susceptibility, makes disease modeling challenging. Mutations in NOD2 have the highest disease-specific risk association for CD, and a related gene, NOD1, is associated with UC. NOD1 and NOD2 encode intracellular bacterial sensor proteins acting as innate immune triggers, and represent promising therapeutic targets. The zebrafish has the potential to aid in modeling genetic and environmental aspects of IBD pathogenesis. Here, we report the characterization of the Nod signaling components in the zebrafish larval intestine. The nod1 and nod2 genes are expressed in intestinal epithelial cells and neutrophils together with the Nod signaling pathway genes ripk2, a20, aamp, cd147, centaurin b1, erbin and grim-19. Using a zebrafish embryo Salmonella infection model, morpholino-mediated depletion of Nod1 or Nod2 reduced the ability of embryos to control systemic infection. Depletion of Nod1 or Nod2 decreased expression of dual oxidase in the intestinal epithelium and impaired the ability of larvae to reduce intracellular bacterial burden. This work highlights the potential use of zebrafish larvae in the study of components of IBD pathogenesis.

  1. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    Science.gov (United States)

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  2. Disease susceptibility genes shared by primary biliary cirrhosis and Crohn's disease in the Japanese population.

    Science.gov (United States)

    Aiba, Yoshihiro; Yamazaki, Keiko; Nishida, Nao; Kawashima, Minae; Hitomi, Yuki; Nakamura, Hitomi; Komori, Atsumasa; Fuyuno, Yuta; Takahashi, Atsushi; Kawaguchi, Takaaki; Takazoe, Masakazu; Suzuki, Yasuo; Motoya, Satoshi; Matsui, Toshiyuki; Esaki, Motohiro; Matsumoto, Takayuki; Kubo, Michiaki; Tokunaga, Katsushi; Nakamura, Minoru

    2015-09-01

    We previously identified TNFSF15 as the most significant susceptibility gene at non-HLA loci for both primary biliary cirrhosis (PBC) and Crohn's diseases (CD) in the Japanese population. The aim of this study is to identify further disease susceptibility genes shared by PBC and CD. We selected 15 and 33 genetic variants that were significantly associated with PBC and CD, respectively, based on previously reported genome-wide association studies of the Japanese population. Next, an association study was independently performed for these genetic variants in CD (1312 CD patients and 3331 healthy controls) and PBC (1279 PBC patients and 1015 healthy controls) cohorts. Two CD susceptibility genes, ICOSLG rs2838519 and IL12B rs6556412, were also nominally associated with susceptibility to PBC (P=3.85 × 10(-2) and P=8.40 × 10(-3), respectively). Three PBC susceptibility genes, CXCR5 rs6421571, STAT4 rs7574865 and NFKB1 rs230534, were nominally associated with susceptibility to CD (P=2.82 × 10(-2), P=3.88 × 10(-2) and P=2.04 × 10(-2), respectively). The effect of ICOSLG and CXCR5 variants were concordant but the effect of STAT4, NFKB1 and IL12B variants were discordant for PBC and CD. TNFSF15 and ICOSLG-CXCR5 might constitute a shared pathogenic pathway in the development of PBC and CD in the Japanese population, whereas IL12B-STAT4-NFKB1 might constitute an opposite pathogenic pathway, reflecting the different balance between Th1 and Th17 in the two diseases.

  3. Association analysis of a highly polymorphic CAG Repeat in the human potassium channel gene KCNN3 and migraine susceptibility

    Directory of Open Access Journals (Sweden)

    Ovcaric Mick

    2005-09-01

    Full Text Available Abstract Background Migraine is a polygenic multifactorial disease, possessing environmental and genetic causative factors with multiple involved genes. Mutations in various ion channel genes are responsible for a number of neurological disorders. KCNN3 is a neuronal small conductance calcium-activated potassium channel gene that contains two polyglutamine tracts, encoded by polymorphic CAG repeats in the gene. This gene plays a critical role in determining the firing pattern of neurons and acts to regulate intracellular calcium channels. Methods The present association study tested whether length variations in the second (more 3' polymorphic CAG repeat in exon 1 of the KCNN3 gene, are involved in susceptibility to migraine with and without aura (MA and MO. In total 423 DNA samples from unrelated individuals, of which 202 consisted of migraine patients and 221 non-migraine controls, were genotyped and analysed using a fluorescence labelled primer set on an ABI310 Genetic Analyzer. Allele frequencies were calculated from observed genotype counts for the KCNN3 polymorphism. Analysis was performed using standard contingency table analysis, incorporating the chi-squared test of independence and CLUMP analysis. Results Overall, there was no convincing evidence that KCNN3 CAG lengths differ between Caucasian migraineurs and controls, with no significant difference in the allelic length distribution of CAG repeats between the population groups (P = 0.090. Also the MA and MO subtypes did not differ significantly between control allelic distributions (P > 0.05. The prevalence of the long CAG repeat (>19 repeats did not reach statistical significance in migraineurs (P = 0.15, nor was there a significant difference between the MA and MO subgroups observed compared to controls (P = 0.46 and P = 0.09, respectively, or between MA vs MO (P = 0.40. Conclusion This association study provides no evidence that length variations of the second polyglutamine array in

  4. Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice

    Science.gov (United States)

    Ren, Juansheng; Gao, Fangyuan; Wu, Xianting; Lu, Xianjun; Zeng, Lihua; Lv, Jianqun; Su, Xiangwen; Luo, Hong; Ren, Guangjun

    2016-01-01

    An urgent need exists to identify more brown planthopper (Nilaparvata lugens Stål, BPH) resistance genes, which will allow the development of rice varieties with resistance to BPH to counteract the increased incidence of this pest species. Here, using bioinformatics and DNA sequencing approaches, we identified a novel BPH resistance gene, LOC_Os06g03240 (MSU LOCUS ID), from the rice variety Ptb33 in the interval between the markers RM19291 and RM8072 on the short arm of chromosome 6, where a gene for resistance to BPH was mapped by Jirapong Jairin et al. and renamed as “Bph32”. This gene encodes a unique short consensus repeat (SCR) domain protein. Sequence comparison revealed that the Bph32 gene shares 100% sequence identity with its allele in Oryza latifolia. The transgenic introgression of Bph32 into a susceptible rice variety significantly improved resistance to BPH. Expression analysis revealed that Bph32 was highly expressed in the leaf sheaths, where BPH primarily settles and feeds, at 2 and 24 h after BPH infestation, suggesting that Bph32 may inhibit feeding in BPH. Western blotting revealed the presence of Pph (Ptb33) and Tph (TN1) proteins using a Penta-His antibody, and both proteins were insoluble. This study provides information regarding a valuable gene for rice defence against insect pests. PMID:27876888

  5. Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice.

    Science.gov (United States)

    Ren, Juansheng; Gao, Fangyuan; Wu, Xianting; Lu, Xianjun; Zeng, Lihua; Lv, Jianqun; Su, Xiangwen; Luo, Hong; Ren, Guangjun

    2016-11-23

    An urgent need exists to identify more brown planthopper (Nilaparvata lugens Stål, BPH) resistance genes, which will allow the development of rice varieties with resistance to BPH to counteract the increased incidence of this pest species. Here, using bioinformatics and DNA sequencing approaches, we identified a novel BPH resistance gene, LOC_Os06g03240 (MSU LOCUS ID), from the rice variety Ptb33 in the interval between the markers RM19291 and RM8072 on the short arm of chromosome 6, where a gene for resistance to BPH was mapped by Jirapong Jairin et al. and renamed as "Bph32". This gene encodes a unique short consensus repeat (SCR) domain protein. Sequence comparison revealed that the Bph32 gene shares 100% sequence identity with its allele in Oryza latifolia. The transgenic introgression of Bph32 into a susceptible rice variety significantly improved resistance to BPH. Expression analysis revealed that Bph32 was highly expressed in the leaf sheaths, where BPH primarily settles and feeds, at 2 and 24 h after BPH infestation, suggesting that Bph32 may inhibit feeding in BPH. Western blotting revealed the presence of Pph (Ptb33) and Tph (TN1) proteins using a Penta-His antibody, and both proteins were insoluble. This study provides information regarding a valuable gene for rice defence against insect pests.

  6. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  7. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  8. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  9. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  10. The BTNL2 G16071A gene polymorphism increases granulomatous disease susceptibility

    Science.gov (United States)

    Tong, Xiang; Ma, Yao; Niu, Xundong; Yan, Zhipeng; Liu, Sitong; Peng, Bo; Peng, Shifeng; Fan, Hong

    2016-01-01

    Abstract Objective: The butyrophilin-like 2 (BTNL2) G16071A gene polymorphism has been implicated in the susceptibility to granulomatous diseases, but the results were inconclusive. The objective of the current study was to precisely explore the relationship between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility by the meta-analysis including false-positive report probability (FPRP) test. Methods: A systematic literature search in the PubMed, Embase, and Wanfang databases, China National Knowledge Internet, and commercial Internet search engines was conducted to identify studies published up to April 1, 2016. The odds ratio (OR) with 95% confidence interval (CI) was used to assess the effect size. Statistical analysis was conducted using the STATA 12.0 software and FPRP test sheet. Results: In total, all 4324 cases and 4386 controls from 14 eligible studies were included in the current meta-analysis. By the overall meta-analysis, we found a significant association between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility (A vs G: OR = 1.25, 95% CI = 1.07–1.45, P = 0.005). The meta-regression analyses showed that a large proportion of the between-study heterogeneity was significantly attributed to the ethnicity (A vs G, P = 0.013) and the types of granulomatous diseases (A vs G, P = 0.002). By the subgroup meta-analysis, the BTNL2 G16071A gene polymorphism was associated with granulomatous disease susceptibility in Caucasians (A vs G: OR = 1.37, 95% CI = 1.18–1.58, P susceptibility (A vs G: OR = 1.52, 95% CI = 1.39–1.66, P susceptibility (A vs G, FPRP susceptibility among Caucasians (A vs G, FPRP susceptibility, especially increasing the sarcoidosis susceptibility. In addition, the polymorphism may be greatly associated with likelihood of granulomatous diseases among Caucasians. PMID:27472712

  11. [Relationship between interleukin-17A gene polymorphisms and the susceptibility to childhood asthma].

    Science.gov (United States)

    Zhong, Fang-Fang; Zou, Yan; Liu, Chun-Yan; Liu, Wen-Jun

    2016-12-01

    To explore the relationship between polymorphisms of interleukin-17A (IL-17A) gene promoter (-197G/A and -692C/T) and the susceptibility to childhood asthma, to further identify the candidate genes for asthma, and to provide a basis for early prevention of asthma in high-risk children. Sixty-five outpatients or inpatients with childhood asthma between August 2013 and August 2015 were assigned to asthma group. Seventy healthy children within the same period were assigned to control group. Using peripheral venous blood from the two groups, PCR with sequence-specific primers was carried out to determine single nucleotide polymorphisms at positions -197G/A and -692C/T in IL-17A gene promoter. A statistical analysis was used to evaluate differences in genotype and allele frequencies between the two groups. Compared with the control group, the asthma group had significantly higher frequencies of TT genotype (29% vs 16%; P=0.012) and T allele (52% vs 42%; P=0.039) at position -692C/T of IL-17A gene. Children with T allele had 1.413-fold higher risk of childhood asthma than those with C allele (OR=1.413, 95%CI: 1.015-1.917). There were no significant differences in genotype and allele frequencies at position -197G/A in IL-17A gene between the two groups (p>0.05). Polymorphisms at position -692C/T in IL-17A gene promoter is associated with the susceptibility to childhood asthma. Children with -692T allele are more susceptible to childhood asthma. There is no significant relationship between polymorphisms at position -197G/A in IL-17A gene promoter and the susceptibility to childhood asthma.

  12. Identification of Variants in Breast Cancer Susceptibility Genes and Determination of Functional and Clinical Significance of Novel Mutations

    Science.gov (United States)

    2014-10-01

    to cause other cancer susceptibility (CDKN2A, MLH1, MSH2, MSH6, PMS2 ); 3) genes known or postulated to be moderate penetrance cancer susceptibility...susceptibility (CDKN2A, MLH1, MSH2, MSH6, PMS2 ); 3) genes known or postulated to be moderate penetrance cancer susceptibility genes (ATM, BARD1, BRIP1...three patients in TP53 and 12 patients in MLH1, MSH2, MSH6, or PMS2 ; no VUSs were found in CDH1, CDKN2A, STK11 or PTEN. Three additional patients each

  13. Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-01-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  14. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  15. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  16. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  17. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  18. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  19. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  20. Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

    Directory of Open Access Journals (Sweden)

    Hsin-Chou Yang

    Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

  1. Deletion of the Candida glabrata ERG3 and ERG11 genes: effect on cell viability, cell growth, sterol composition, and antifungal susceptibility.

    Science.gov (United States)

    Geber, A; Hitchcock, C A; Swartz, J E; Pullen, F S; Marsden, K E; Kwon-Chung, K J; Bennett, J E

    1995-01-01

    We have cloned and sequenced the structural genes encoding the delta 5,6 sterol desaturase (ERG3 gene) and the 14 alpha-methyl sterol demethylase (ERG11 gene) from Candida glabrata L5 (leu2). Single and double mutants of these genes were created by gene deletion. The phenotypes of these mutants, including sterol profiles, aerobic viabilities, antifungal susceptibilities, and generation times, were studied. Strain L5D (erg3 delta::LEU2) accumulated mainly ergosta-7,22-dien-3 beta-ol, was aerobically viable, and remained susceptible to antifungal agents but had a slower generation time than its parent strain. L5LUD (LEU2 erg11 delta::URA3) strains required medium supplemented with ergosterol and an anaerobic environment for growth. A spontaneous aerobically viable mutant, L5LUD40R (LEU erg11 delta::URA3), obtained from L5LUD (LEU2 erg11 delta::URA3), was found to accumulate lanosterol and obtusifoliol, was resistant to azole antifungal agents, demonstrated some increase in resistance to amphotericin B, and exhibited a 1.86-fold increase in generation time in comparison with L5 (leu2). The double-deletion mutant L5DUD61 (erg3 delta::LEU2 erg11 delta::URA3) was aerobically viable, produced mainly 14 alpha-methyl fecosterol, and had the same antifungal susceptibility pattern as L5LUD40R (LEU2 erg11 delta::URA3), and its generation time was threefold greater than that of L5 (leu2). Northern (RNA) analysis revealed that the single-deletion mutants had a marked increase in message for the undeleted ERG3 and ERG11 genes. These results indicate that differences in antifungal susceptibilities and the restoration of aerobic viability exist between the C. glabrata ergosterol mutants created in this study and those sterol mutants with similar genetic lesions previously reported for Saccharomyces cerevisiae. PMID:8593007

  2. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  4. Association Analysis Suggests SOD2 as a Newly Identified Candidate Gene Associated With Leprosy Susceptibility.

    Science.gov (United States)

    Ramos, Geovana Brotto; Salomão, Heloisa; Francio, Angela Schneider; Fava, Vinícius Medeiros; Werneck, Renata Iani; Mira, Marcelo Távora

    2016-08-01

    Genetic studies have identified several genes and genomic regions contributing to the control of host susceptibility to leprosy. Here, we test variants of the positional and functional candidate gene SOD2 for association with leprosy in 2 independent population samples. Family-based analysis revealed an association between leprosy and allele G of marker rs295340 (P = .042) and borderline evidence of an association between leprosy and alleles C and A of markers rs4880 (P = .077) and rs5746136 (P = .071), respectively. Findings were validated in an independent case-control sample for markers rs295340 (P = .049) and rs4880 (P = .038). These results suggest SOD2 as a newly identified gene conferring susceptibility to leprosy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  5. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  6. Identification of susceptibility genes for bipolar affective disorder and schizophrenia on chromosome 22q13

    DEFF Research Database (Denmark)

    Severinsen, Jacob Eg

    2006-01-01

    Linkage analyses suggest that chromosome 22q12-13 may harbor one or more shared susceptibility loci for bipolar affective disorder (BPD) and schizophrenia (SZ). In a study of distantly related cases and control individuals from the Faeroe Islands our group has previously reported that chromosome 22...... samples (total of 1,751 individuals), and by bioinformatic and expression analyses of a subset of disease associated genes and gene variants. In total 67 single nucleotide polymorphisms (SNPs) located in 18 positional candidate genes, and 4 microsattelite markers were investigated, using a Scottish case...

  7. Genome-wide characterization of pectin methyl esterase genes reveals members differentially expressed in tolerant and susceptible wheats in response to Fusarium graminearum.

    Science.gov (United States)

    Zega, Alessandra; D'Ovidio, Renato

    2016-11-01

    Pectin methyl esterase (PME) genes code for enzymes that are involved in structural modifications of the plant cell wall during plant growth and development. They are also involved in plant-pathogen interaction. PME genes belong to a multigene family and in this study we report the first comprehensive analysis of the PME gene family in bread wheat (Triticum aestivum L.). Like in other species, the members of the TaPME family are dispersed throughout the genome and their encoded products retain the typical structural features of PMEs. qRT-PCR analysis showed variation in the expression pattern of TaPME genes in different tissues and revealed that these genes are mainly expressed in flowering spikes. In our attempt to identify putative TaPME genes involved in wheat defense, we revealed a strong variation in the expression of the TaPME following Fusarium graminearum infection, the causal agent of Fusarium head blight (FHB). Particularly interesting was the finding that the expression profile of some PME genes was markedly different between the FHB-resistant wheat cultivar Sumai3 and the FHB-susceptible cultivar Bobwhite, suggesting a possible involvement of these PME genes in FHB resistance. Moreover, the expression analysis of the TaPME genes during F. graminearum progression within the spike revealed those genes that responded more promptly to pathogen invasion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  9. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  10. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  11. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  12. Expression and functional assessment of candidate type 2 diabetes susceptibility genes identify four new genes contributing to human insulin secretion

    Directory of Open Access Journals (Sweden)

    Fatou K. Ndiaye

    2017-06-01

    Full Text Available Objectives: Genome-wide association studies (GWAS have identified >100 loci independently contributing to type 2 diabetes (T2D risk. However, translational implications for precision medicine and for the development of novel treatments have been disappointing, due to poor knowledge of how these loci impact T2D pathophysiology. Here, we aimed to measure the expression of genes located nearby T2D associated signals and to assess their effect on insulin secretion from pancreatic beta cells. Methods: The expression of 104 candidate T2D susceptibility genes was measured in a human multi-tissue panel, through PCR-free expression assay. The effects of the knockdown of beta-cell enriched genes were next investigated on insulin secretion from the human EndoC-βH1 beta-cell line. Finally, we performed RNA-sequencing (RNA-seq so as to assess the pathways affected by the knockdown of the new genes impacting insulin secretion from EndoC-βH1, and we analyzed the expression of the new genes in mouse models with altered pancreatic beta-cell function. Results: We found that the candidate T2D susceptibility genes' expression is significantly enriched in pancreatic beta cells obtained by laser capture microdissection or sorted by flow cytometry and in EndoC-βH1 cells, but not in insulin sensitive tissues. Furthermore, the knockdown of seven T2D-susceptibility genes (CDKN2A, GCK, HNF4A, KCNK16, SLC30A8, TBC1D4, and TCF19 with already known expression and/or function in beta cells changed insulin secretion, supporting our functional approach. We showed first evidence for a role in insulin secretion of four candidate T2D-susceptibility genes (PRC1, SRR, ZFAND3, and ZFAND6 with no previous knowledge of presence and function in beta cells. RNA-seq in EndoC-βH1 cells with decreased expression of PRC1, SRR, ZFAND6, or ZFAND3 identified specific gene networks related to T2D pathophysiology. Finally, a positive correlation between the expression of Ins2 and the

  13. Profiling gene expression of antimony response genes in Leishmania (Viannia) panamensis and infected macrophages and its relationship with drug susceptibility.

    Science.gov (United States)

    Barrera, Maria Claudia; Rojas, Laura Jimena; Weiss, Austin; Fernandez, Olga; McMahon-Pratt, Diane; Saravia, Nancy G; Gomez, Maria Adelaida

    2017-12-01

    The mechanisms of Leishmania resistance to antimonials have been primarily determined in experimentally derived Leishmania strains. However, their participation in the susceptibility phenotype in field isolates has not been conclusively established. Being an intracellular parasite, the activity of antileishmanials is dependent on internalization of drugs into host cells and effective delivery to the intracellular compartments inhabited by the parasite. In this study we quantified and comparatively analyzed the gene expression of nine molecules involved in mechanisms of xenobiotic detoxification and Leishmania resistance to antimonial drugs in resistant and susceptible laboratory derived and clinical L.(Viannia) panamensis strains(n=19). In addition, we explored the impact of Leishmania susceptibility to antimonials on the expression of macrophage gene products having putative functions in transport, accumulation and metabolism of antimonials. As previously shown for other Leishmania species, a trend of increased abcc3 and lower aqp-1 expression was observed in the laboratory derived Sb-resistant L.(V.) panamensis line. However, this was not found in clinical strains, in which the expression of abca2 was significantly higher in resistant strains as both, promastigotes and intracellular amastigotes. The effect of drug susceptibility on host cell gene expression was evaluated on primary human macrophages from patients with cutaneous leishmaniasis (n=17) infected ex-vivo with the matched L.(V.) panamensis strains isolated at diagnosis, and in THP-1 cells infected with clinical strains (n=6) and laboratory adapted L.(V.) panamensis lines. Four molecules, abcb1 (p-gp), abcb6, aqp-9 and mt2a were differentially modulated by drug resistant and susceptible parasites, and among these, a consistent and significantly increased expression of the xenobiotic scavenging molecule mt2a was observed in macrophages infected with Sb-susceptible L. (V.) panamensis. Our results

  14. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  15. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  16. Germline variants in the ATM gene and breast cancer susceptibility in Moroccan women: A meta-analysis

    Directory of Open Access Journals (Sweden)

    Chaymaa Marouf

    2017-10-01

    Full Text Available Background: The ATM gene encoding a large protein kinase is mutated in ataxia-telangiectasia (AT, an autosomale recessive disease characterized by neurological and immunological symptoms, and cancer predisposition. Previous studies suggest that heterozygous carriers of ATM mutations have an increased risk of breast cancer compared with non carriers, but the contribution of specific variants has been difficult to estimate. However, two functional ATM variants, c.7271T > G and c.1066–6T > G (IVS10–6T > G, are associated with increased risk for the development of breast cancer. Methods: To investigate the role of ATM in breast cancer susceptibility, we genotyped 163 case patients with breast cancer and 150 healthy control individuals for the c.7271T > G and c.1066–6T > G (IVS10–6T > G ATM variants using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP analysis. Results: We did not detect the ATM c.7271T > G and c.1066–6T > G (IVS10–6T > G mutations in any of 150 healthy control individuals and 163 breast cancer patients, including 59 women diagnosed with breast cancer at an early age ( G (IVS10–6T > G mutation and the rare c.7271T > G variant are not a risk factor for developing breast cancer in the Moroccan population. Larger and/or combined association studies are needed to clarify this issue. Keywords: Breast cancers, ATM gene, Germline mutation, Genetic susceptibility, Moroccan population

  17. Polymorphisms in xenobiotic metabolizing genes (EPHX1, NQO1 and PON1) in lymphoma susceptibility: a case control study

    International Nuclear Information System (INIS)

    Conesa-Zamora, Pablo; Vicente, Vicente; Pérez-Guillermo, Miguel; Ruiz-Cosano, Javier; Torres-Moreno, Daniel; Español, Ignacio; Gutiérrez-Meca, María D; Trujillo-Santos, Javier; Pérez-Ceballos, Elena; González-Conejero, Rocío; Corral, Javier

    2013-01-01

    The interplay between genetic susceptibility and carcinogenic exposure is important in the development of haematopoietic malignancies. EPHX1, NQO1 and PON1 are three genes encoding proteins directly involved in the detoxification of potential carcinogens. We have studied the prevalence of three functional polymorphisms affecting these genes rs1051740 EPHX1, rs1800566 NQO1 and rs662 PON1 in 215 patients with lymphoma and 214 healthy controls. Genotype frequencies for EPHX and NQO1 polymorphisms did not show any correlation with disease. In contrast, the GG genotype in the PON1 polymorphism was found to be strongly associated with the disease (15.3% vs. 4.7%; OR = 3.7 CI (95%): 1.8-7.7; p < 0.001). According to the pathological diagnosis this association was related to follicular (p = 0.004) and diffuse large B-cell (p = 0.016) lymphomas. Despite the fact that further confirmation is needed, this study shows that the PON1 GG genotype in rs662 polymorphism could be a risk factor for B-cell lymphomas

  18. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  19. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  20. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  1. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  2. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy

    International Nuclear Information System (INIS)

    Casula, Milena; Sini, MariaCristina; Palomba, Grazia; The Italian Melanoma Intergroup; Palmieri, Giuseppe; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio

    2009-01-01

    Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16 CDKN2A , BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16 CDKN2A genes. For melanoma susceptibility, investigations at germline level indicated that p16 CDKN2A was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16 CDKN2A gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16 CDKN2A silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis

  3. Gene Variants Are Associated with PCOS Susceptibility and Hyperandrogenemia in Young Korean Women

    Directory of Open Access Journals (Sweden)

    Do Kyeong Song

    2014-08-01

    Full Text Available BackgroundThe fat mass and obesity-associated (FTO gene is associated with obesity and type 2 diabetes mellitus. Obesity and insulin resistance are also common features of polycystic ovary syndrome (PCOS. Therefore, the FTO gene might be a candidate gene for PCOS susceptibility. The aim of the present study was to evaluate the effects of FTO gene variants on PCOS susceptibility and metabolic and reproductive hormonal parameters.MethodsWe recruited 432 women with PCOS (24±5 years and 927 healthy women with regular menstrual cycles (27±5 years and performed a case-control association study. We genotyped the single nucleotide polymorphisms rs1421085, rs17817449, and rs8050136 in the FTO gene and collected metabolic and hormonal measurements.ResultsLogistic regression revealed that the G/G genotype (rs1421085, 1.6%, the C/C genotype (rs17817449, 1.6%, and the A/A genotype (rs8050136, 1.6% were strongly associated with an increased risk of PCOS (odds ratio, 2.551 to 2.559; all P<0.05. The strengths of these associations were attenuated after adjusting for age and BMI. The women with these genotypes were more obese and exhibited higher free androgen indices (P<0.05 and higher free testosterone levels (P=0.053 to 0.063 compared to the other genotypes. However the significant differences disappeared after adjusting for body mass index (BMI. When we analyzed the women with PCOS and the control groups separately, there were no significant differences in the metabolic and reproductive hormonal parameters according to the FTO gene variants.ConclusionThe rs1421085, rs17817449, and rs8050136 variants of the FTO gene were associated with PCOS susceptibility and hyperandrogenemia in young Korean women. These associations may be mediated through an effect of BMI.

  4. Biocide Susceptibility of Staphylococcus aureus CC398 and CC30 Isolates from Pigs and Identification of the Biocide Resistance Genes, qacG and qacC

    DEFF Research Database (Denmark)

    Seier-Petersen, Maria Amalie; Nielsen, Lene Nørby; Ingmer, Hanne

    2015-01-01

    Objectives: Methicillin-resistant Staphylococcus aureus (MRSA), in particular clonal complex (CC) 398, is increasingly found in livestock. Recently, MRSA CC30 was identified in Danish pigs. We determined the susceptibility of porcine S. aureus isolates of CC398 and CC30 to disinfectants used in pig......)-encoding virulence factors were investigated. Methods: Susceptibilities to biocides and antimicrobial agents of 79 porcine S. aureus isolates were determined by the microdilution method. Isolates comprised 21 methicillin-sensitive S. aureus (MSSA) and 40 MRSA isolates belonging to CC398 and 13 MSSA and 5 MRSA...... isolates belonging to CC30. The presence of quaternary ammonium compound (QAC) resistance efflux pumps was analyzed using an ethidium bromide accumulation assay. The presence of qac resistance genes in active efflux pump positive isolates was determined by whole-genome sequencing data. All isolates were...

  5. Investigation of Gamma-aminobutyric acid (GABA A receptors genes and migraine susceptibility

    Directory of Open Access Journals (Sweden)

    Ciccodicola Alfredo

    2008-12-01

    Full Text Available Abstract Background Migraine is a neurological disorder characterized by recurrent attacks of severe headache, affecting around 12% of Caucasian populations. It is well known that migraine has a strong genetic component, although the number and type of genes involved is still unclear. Prior linkage studies have reported mapping of a migraine gene to chromosome Xq 24–28, a region containing a cluster of genes for GABA A receptors (GABRE, GABRA3, GABRQ, which are potential candidate genes for migraine. The GABA neurotransmitter has been implicated in migraine pathophysiology previously; however its exact role has not yet been established, although GABA receptors agonists have been the target of therapeutic developments. The aim of the present research is to investigate the role of the potential candidate genes reported on chromosome Xq 24–28 region in migraine susceptibility. In this study, we have focused on the subunit GABA A receptors type ε (GABRE and type θ (GABRQ genes and their involvement in migraine. Methods We have performed an association analysis in a large population of case-controls (275 unrelated Caucasian migraineurs versus 275 controls examining a set of 3 single nucleotide polymorphisms (SNPs in the coding region (exons 3, 5 and 9 of the GABRE gene and also the I478F coding variant of the GABRQ gene. Results Our study did not show any association between the examined SNPs in our test population (P > 0.05. Conclusion Although these particular GABA receptor genes did not show positive association, further studies are necessary to consider the role of other GABA receptor genes in migraine susceptibility.

  6. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  7. Gene-environment interaction involving recently identified colorectal cancer susceptibility loci

    Science.gov (United States)

    Kantor, Elizabeth D.; Hutter, Carolyn M.; Minnier, Jessica; Berndt, Sonja I.; Brenner, Hermann; Caan, Bette J.; Campbell, Peter T.; Carlson, Christopher S.; Casey, Graham; Chan, Andrew T.; Chang-Claude, Jenny; Chanock, Stephen J.; Cotterchio, Michelle; Du, Mengmeng; Duggan, David; Fuchs, Charles S.; Giovannucci, Edward L.; Gong, Jian; Harrison, Tabitha A.; Hayes, Richard B.; Henderson, Brian E.; Hoffmeister, Michael; Hopper, John L.; Jenkins, Mark A.; Jiao, Shuo; Kolonel, Laurence N.; Le Marchand, Loic; Lemire, Mathieu; Ma, Jing; Newcomb, Polly A.; Ochs-Balcom, Heather M.; Pflugeisen, Bethann M.; Potter, John D.; Rudolph, Anja; Schoen, Robert E.; Seminara, Daniela; Slattery, Martha L.; Stelling, Deanna L.; Thomas, Fridtjof; Thornquist, Mark; Ulrich, Cornelia M.; Warnick, Greg S.; Zanke, Brent W.; Peters, Ulrike; Hsu, Li; White, Emily

    2014-01-01

    BACKGROUND Genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) that are associated with risk of colorectal cancer (CRC). Prior research has evaluated the presence of gene-environment interaction involving the first 10 identified susceptibility loci, but little work has been conducted on interaction involving SNPs at recently identified susceptibility loci, including: rs10911251, rs6691170, rs6687758, rs11903757, rs10936599, rs647161, rs1321311, rs719725, rs1665650, rs3824999, rs7136702, rs11169552, rs59336, rs3217810, rs4925386, and rs2423279. METHODS Data on 9160 cases and 9280 controls from the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) and Colon Cancer Family Registry (CCFR) were used to evaluate the presence of interaction involving the above-listed SNPs and sex, body mass index (BMI), alcohol consumption, smoking, aspirin use, post-menopausal hormone (PMH) use, as well as intake of dietary calcium, dietary fiber, dietary folate, red meat, processed meat, fruit, and vegetables. Interaction was evaluated using a fixed-effects meta-analysis of an efficient Empirical Bayes estimator, and permutation was used to account for multiple comparisons. RESULTS None of the permutation-adjusted p-values reached statistical significance. CONCLUSIONS The associations between recently identified genetic susceptibility loci and CRC are not strongly modified by sex, BMI, alcohol, smoking, aspirin, PMH use, and various dietary factors. IMPACT Results suggest no evidence of strong gene-environment interactions involving the recently identified 16 susceptibility loci for CRC taken one at a time. PMID:24994789

  8. Bipolar disorder: idioms of susceptibility and disease and the role of 'genes' in illness explanations.

    Science.gov (United States)

    Baart, Ingrid; Widdershoven, Guy

    2013-11-01

    This qualitative study explores (1) how members of the Dutch Association for People with Bipolar Disorder explain the affliction of bipolar disorder; (2) the relationship between genetic, environmental and personal factors in these explanations and (3) the relationship between illness explanations, self-management and identity. A total of 40 participants took part in seven different focus group discussions. The results demonstrate that there are two different explanatory idioms, each one centred around an opposing concept, that is, susceptibility and disease. Individuals who construct explanations around the concept of 'disease' attach more importance to 'genes and chemicals' than to environmental components in the onset of the disorder, whereas individuals adhering to the central concept of 'susceptibility' tend to do this much less. Compared with individuals using the 'susceptibility' idiom, those who use a 'disease' idiom tend to observe fewer possibilities for self-management and are less inclined to construct normalcy through a quest for personal growth. Stories of suffering seem more integral to the 'disease' idiom than to the 'susceptibility' idiom. The 'disease' idiom seems less integrated in a contemporary surveillance psychiatric discourse than the 'susceptibility' idiom; however, both vocabularies can offer normative constraints.

  9. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  10. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  11. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  12. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  13. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  14. Possible association of β2- and β3-adrenergic receptor gene polymorphisms with susceptibility to breast cancer

    International Nuclear Information System (INIS)

    Huang, Xin-En; Tokudome, Shinkan; Tajima, Kazuo; Hamajima, Nobuyuki; Saito, Toshiko; Matsuo, Keitaro; Mizutani, Mitsuhiro; Iwata, Hiroji; Iwase, Takuji; Miura, Shigeto; Mizuno, Tsutomu

    2001-01-01

    The involvement of β 2 -adrenergic receptor (ADRB2) and β 3 -adrenergic receptor (ADRB3) in both adipocyte lipolysis and thermogenic activity suggests that polymorphisms in the encoding genes might be linked with interindividual variation in obesity, an important risk factor for postmenopausal breast cancer. In order to examine the hypothesis that genetic variations in ADRB2 and ADRB3 represent interindividual susceptibility factors for obesity and breast cancer, we conducted a hospital-based, case-control study in the Aichi Cancer Center, Japan. A self-administered questionnaire was given to 200 breast cancer patients and 182 control individuals, and pertinent information on lifestyle, family history and reproduction was collected. ADRB2 and ADRB3 genotypes were determined by polymerase chain reaction (PCR) restriction fragment length polymorphism assessment. Twenty-five (12.4%) breast cancer patients and 32 (17.6%) control individuals were found to bear a glutamic acid (Glu) allele for the ADRB2 gene (odds ratio [OR] 0.67, 95% confidence interval [CI] 0.38-1.18), and 60 (30.0%) breast cancer patients and 61 (33.5%) control individuals were found to bear an Arg allele for the ADRB3 gene (OR 0.85, 95% CI 0.55-1.31). A significantly lower risk was observed in those who carried the Glu ADRB2 allele and who reported first childbirth when they were younger than 25 years (OR 0.35; 95% CI 0.13-0.99). A potential association may exist between risk of breast cancer and polymorphisms in the ADRB2 and ADRB3 genes; further studies in larger samples and/or in different ethnic groups are warranted to investigate this potential association

  15. Research advances in susceptibility genes and their role in the pathogenesis of nonalcoholic fatty liver disease

    Directory of Open Access Journals (Sweden)

    XUAN Shiying

    2016-03-01

    Full Text Available Currently the incidence of nonalcoholic fatty liver disease (NAFLD is increasing, and the age of onset is getting younger worldwide, resulting in a heavy economic burden for both individuals and the society. Since NAFLD is closely related to heredity, metabolism, and the environment, genetic factors play an important role in the development and progression of NAFLD. With the development and wide application of the techniques from the genome-wide association studies, new research advances have been achieved in the susceptibility genes of NAFLD. This review summarizes the related research findings at home and abroad, and investigates the pathogenic factors for NAFLD and related mechanisms with a focus on the polymorphisms of susceptibility genes.

  16. Linking susceptibility genes and pathogenesis mechanisms using mouse models of systemic lupus erythematosus

    Science.gov (United States)

    Crampton, Steve P.; Morawski, Peter A.; Bolland, Silvia

    2014-01-01

    Systemic lupus erythematosus (SLE) represents a challenging autoimmune disease from a clinical perspective because of its varied forms of presentation. Although broad-spectrum steroids remain the standard treatment for SLE, they have many side effects and only provide temporary relief from the symptoms of the disease. Thus, gaining a deeper understanding of the genetic traits and biological pathways that confer susceptibility to SLE will help in the design of more targeted and effective therapeutics. Both human genome-wide association studies (GWAS) and investigations using a variety of mouse models of SLE have been valuable for the identification of the genes and pathways involved in pathogenesis. In this Review, we link human susceptibility genes for SLE with biological pathways characterized in mouse models of lupus, and discuss how the mechanistic insights gained could advance drug discovery for the disease. PMID:25147296

  17. Differential in vivo gene expression of major Leptospira proteins in resistant or susceptible animal models.

    Science.gov (United States)

    Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme; Goarant, Cyrille

    2012-09-01

    Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals.

  18. Linking susceptibility genes and pathogenesis mechanisms using mouse models of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Steve P. Crampton

    2014-09-01

    Full Text Available Systemic lupus erythematosus (SLE represents a challenging autoimmune disease from a clinical perspective because of its varied forms of presentation. Although broad-spectrum steroids remain the standard treatment for SLE, they have many side effects and only provide temporary relief from the symptoms of the disease. Thus, gaining a deeper understanding of the genetic traits and biological pathways that confer susceptibility to SLE will help in the design of more targeted and effective therapeutics. Both human genome-wide association studies (GWAS and investigations using a variety of mouse models of SLE have been valuable for the identification of the genes and pathways involved in pathogenesis. In this Review, we link human susceptibility genes for SLE with biological pathways characterized in mouse models of lupus, and discuss how the mechanistic insights gained could advance drug discovery for the disease.

  19. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  20. Comprehensive Clinical Phenotyping & Genetic Mapping for the Discovery of Autism Susceptibility Genes

    Science.gov (United States)

    2012-12-05

    teaching students with autism spectrum disorders 4.52 Learn strategies for incorporating IEP goals and district standard into daily teaching...W403 Columbus, OH 43205 Final Report Comprehensive Clinical Phenotyping & Genetic Mapping for the Discovery of Autism Susceptibility Genes...QFOXGHDUHDFRGH 1.0 Summary In 2006, the Central Ohio Registry for Autism (CORA) was initiated as a collaboration between Wright-Patterson Air

  1. Rrp1b, a new candidate susceptibility gene for breast cancer progression and metastasis.

    Directory of Open Access Journals (Sweden)

    Nigel P S Crawford

    2007-11-01

    Full Text Available A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b, was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis.

  2. Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in Hui Chinese Women.

    Directory of Open Access Journals (Sweden)

    Lingxia Ha

    Full Text Available Polycystic ovary syndrome (PCOS is one of the most common endocrine-metabolic disorders. Evidence of familial aggregation analysis and different clinical traits among different regions and ethnicities indicated that the pathogenesis of PCOS is associated with multiple genetic and environmental factors. Our previous research had identified three susceptibility loci (rs2479106, DENND1A; rs13405728, LHCGR; rs13429458, THADA for PCOS in Han Chinese women. The overall aim of this study was to investigate the relationship between three susceptibility gene polymorphisms and PCOS in Hui ethnic women.151 patients with PCOS (case group and 99 healthy women (control group were recruited from the Reproductive Medicine Center of the General Hospital of Ningxia Medical University. Clinical data and serum hormone characteristics of case and control groups were collected and analyzed. The three susceptibility single-nucleotide polymorphisms have been replicated in both case and control groups. Gene polymorphisms were detected by direct sequencing after polymerase chain reaction.The Body Mass Index, LH, LH/FSH ratio and total testosterone were significantly elevated in PCOS patients compared to control group (P0.05.The present study suggested that the SNP rs13405728 in the LHCGR gene was associated with PCOS in Hui ethnic women, and its TT genotype characterized with higher level of TT, TG and LDL.

  3. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  4. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  5. Mapping of Gene Expression Reveals CYP27A1 as a Susceptibility Gene for Sporadic ALS

    NARCIS (Netherlands)

    Diekstra, Frank P.; Saris, Christiaan G. J.; van Rheenen, Wouter; Franke, Lude; Jansen, Ritsert C.; van Es, Michael A.; van Vught, Paul W. J.; Blauw, Hylke M.; Groen, Ewout J. N.; Horvath, Steve; Estrada, Karol; Rivadeneira, Fernando; Hofman, Albert; Uitterlinden, Andre G.; Robberecht, Wim; Andersen, Peter M.; Melki, Judith; Meininger, Vincent; Hardiman, Orla; Landers, John E.; Brown, Robert H.; Shatunov, Aleksey; Shaw, Christopher E.; Leigh, P. Nigel; Al-Chalabi, Ammar; Ophoff, Roel A.; van den Berg, Leonard H.; Veldink, Jan H.; Brown Jr., Robert H.; Brug, Marcel P. van der

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal loci remain

  6. Mapping of gene expression reveals CYP27A1 as a susceptibility gene for sporadic ALS

    NARCIS (Netherlands)

    F.P. Diekstra (Frank); C.G.J. Saris (Christiaan); W. van Rheenen (Wouter); L. Franke (Lude); R.C. Jansen (Ritsert); M.A. van Es (Michael); K. Estrada Gil (Karol); P.W.J. van Vught (Paul); H.M. Blauw (Hylke); E.J.N. Groen (Ewout); S. Horvath (Steve); K. Estrada Gil (Karol); F. Rivadeneira Ramirez (Fernando); A. Hofman (Albert); A.G. Uitterlinden (André); W. Robberecht (Wim); P.M. Andersen (Peter); J. Melki (Judith); V. Meininger (Vincent); O. Hardiman (Orla); J.E. Landers (John); R.H. Brown (Robert); A. Shatunov (Aleksey); C.E. Shaw (Christopher); P.N. Leigh (Nigel); A. Al-Chalabi (Ammar); R.A. Ophoff (Roel); L.H. van den Berg (Leonard); J.H. Veldink (Jan)

    2012-01-01

    textabstractAmyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal

  7. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  8. Timecourse microarray analyses reveal global changes in gene expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines (soybean cyst nematode).

    Science.gov (United States)

    Alkharouf, Nadim W; Klink, Vincent P; Chouikha, Imed B; Beard, Hunter S; MacDonald, Margaret H; Meyer, Susan; Knap, Halina T; Khan, Rana; Matthews, Benjamin F

    2006-09-01

    Changes in gene expression within roots of Glycine max (soybean), cv. Kent, susceptible to infection by Heterodera glycines (the soybean cyst nematode [SCN]), at 6, 12, and 24 h, and 2, 4, 6, and 8 days post-inoculation were monitored using microarrays containing more than 6,000 cDNA inserts. Replicate, independent biological samples were examined at each time point. Gene expression was analyzed statistically using T-tests, ANOVA, clustering algorithms, and online analytical processing (OLAP). These analyses allow the user to query the data in several ways without importing the data into third-party software. RT-PCR confirmed that WRKY6 transcription factor, trehalose phosphate synthase, EIF4a, Skp1, and CLB1 were differentially induced across most time-points. Other genes induced across most timepoints included lipoxygenase, calmodulin, phospholipase C, metallothionein-like protein, and chalcone reductase. RT-PCR demonstrated enhanced expression during the first 12 h of infection for Kunitz trypsin inhibitor and sucrose synthase. The stress-related gene, SAM-22, phospholipase D and 12-oxophytodienoate reductase were also induced at the early time-points. At 6 and 8 dpi there was an abundance of transcripts expressed that encoded genes involved in transcription and protein synthesis. Some of those genes included ribosomal proteins, and initiation and elongation factors. Several genes involved in carbon metabolism and transport were also more abundant. Those genes included glyceraldehyde 3-phosphate dehydrogenase, fructose-bisphosphate aldolase and sucrose synthase. These results identified specific changes in gene transcript levels triggered by infection of susceptible soybean roots by SCN.

  9. Rice Yellow Mottle Virus stress responsive genes from susceptible and tolerant rice genotypes

    Directory of Open Access Journals (Sweden)

    Siré Christelle

    2008-03-01

    Full Text Available Abstract Background The effects of viral infection involve concomitant plant gene variations and cellular changes. A simple system is required to assess the complexity of host responses to viral infection. The genome of the Rice yellow mottle virus (RYMV is a single-stranded RNA with a simple organisation. It is the most well-known monocotyledon virus model. Several studies on its biology, structure and phylogeography have provided a suitable background for further genetic studies. 12 rice chromosome sequences are now available and provide strong support for genomic studies, particularly physical mapping and gene identification. Results The present data, obtained through the cDNA-AFLP technique, demonstrate differential responses to RYMV of two different rice cultivars, i.e. susceptible IR64 (Oryza sativa indica, and partially resistant Azucena (O. s. japonica. This RNA profiling provides a new original dataset that will enable us to gain greater insight into the RYMV/rice interaction and the specificity of the host response. Using the SIM4 subroutine, we took the intron/exon structure of the gene into account and mapped 281 RYMV stress responsive (RSR transcripts on 12 rice chromosomes corresponding to 234 RSR genes. We also mapped previously identified deregulated proteins and genes involved in partial resistance and thus constructed the first global physical map of the RYMV/rice interaction. RSR transcripts on rice chromosomes 4 and 10 were found to be not randomly distributed. Seven genes were identified in the susceptible and partially resistant cultivars, and transcripts were colocalized for these seven genes in both cultivars. During virus infection, many concomitant plant gene expression changes may be associated with host changes caused by the infection process, general stress or defence responses. We noted that some genes (e.g. ABC transporters were regulated throughout the kinetics of infection and differentiated susceptible and

  10. The interaction of BDNF and NTRK2 gene increases the susceptibility of paranoid schizophrenia.

    Directory of Open Access Journals (Sweden)

    Zheng Lin

    Full Text Available The association between BDNF gene functional Val66Met polymorphism rs6265 and the schizophrenia is far from being consistent. In addition to the heterogeneous in schizophrenia per se leading to the inconsistent results, the interaction among multi-genes is probably playing the main role in the pathogenesis of schizophrenia, but not a single gene. Neurotrophic tyrosine kinase receptor 2 (NTRK2 is the high-affinity receptor of BDNF, and was reported to be associated with mood disorders, though no literature reported the association with schizophrenia. Thus, in the present study, total 402 patients with paranoid schizophrenia (the most common subtype of schizophrenia and matched 406 healthy controls were recruited to investigate the role of rs6265 in BDNF, three polymorphisms in NTRK2 gene (rs1387923, rs2769605 and rs1565445 and their interaction in the susceptibility to paranoid schizophrenia in a Chinese Han population. We did not observe significant differences in allele and genotype frequencies between patients and healthy controls for all four polymorphisms separately. The haplotype analysis also showed no association between haplotype of NTRK2 genes (rs1387923, rs2769605, and rs1565445 and paranoid schizophrenia. However, we found the association between the interaction of BDNF and NTRK2 with paranoid schizophrenia by using the MDR method followed by conventional statistical analysis. The best gene-gene interaction model was a three-locus model (BDNF rs6265, NTRK2 rs1387923 and NTRK2 rs2769605, in which one low-risk and three high-risk four-locus genotype combinations were identified. Our findings implied that single polymorphism of rs6265 rs1387923, rs2769605, and rs1565445 in BDNF and NTRK2 were not associated with the development of paranoid schizophrenia in a Han population, however, the interaction of BDNF and NTRK2 genes polymorphisms (BDNF-rs6265, NTRK2-rs1387923 and NTRK2-rs2769605 may be involved in the susceptibility to paranoid

  11. The interaction of BDNF and NTRK2 gene increases the susceptibility of paranoid schizophrenia.

    Science.gov (United States)

    Lin, Zheng; Su, Yousong; Zhang, Chengfang; Xing, Mengjuan; Ding, Wenhua; Liao, Liwei; Guan, Yangtai; Li, Zezhi; Cui, Donghong

    2013-01-01

    The association between BDNF gene functional Val66Met polymorphism rs6265 and the schizophrenia is far from being consistent. In addition to the heterogeneous in schizophrenia per se leading to the inconsistent results, the interaction among multi-genes is probably playing the main role in the pathogenesis of schizophrenia, but not a single gene. Neurotrophic tyrosine kinase receptor 2 (NTRK2) is the high-affinity receptor of BDNF, and was reported to be associated with mood disorders, though no literature reported the association with schizophrenia. Thus, in the present study, total 402 patients with paranoid schizophrenia (the most common subtype of schizophrenia) and matched 406 healthy controls were recruited to investigate the role of rs6265 in BDNF, three polymorphisms in NTRK2 gene (rs1387923, rs2769605 and rs1565445) and their interaction in the susceptibility to paranoid schizophrenia in a Chinese Han population. We did not observe significant differences in allele and genotype frequencies between patients and healthy controls for all four polymorphisms separately. The haplotype analysis also showed no association between haplotype of NTRK2 genes (rs1387923, rs2769605, and rs1565445) and paranoid schizophrenia. However, we found the association between the interaction of BDNF and NTRK2 with paranoid schizophrenia by using the MDR method followed by conventional statistical analysis. The best gene-gene interaction model was a three-locus model (BDNF rs6265, NTRK2 rs1387923 and NTRK2 rs2769605), in which one low-risk and three high-risk four-locus genotype combinations were identified. Our findings implied that single polymorphism of rs6265 rs1387923, rs2769605, and rs1565445 in BDNF and NTRK2 were not associated with the development of paranoid schizophrenia in a Han population, however, the interaction of BDNF and NTRK2 genes polymorphisms (BDNF-rs6265, NTRK2-rs1387923 and NTRK2-rs2769605) may be involved in the susceptibility to paranoid schizophrenia.

  12. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  13. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  14. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  15. Antimicrobial Susceptibility of Bordetella bronchiseptica Isolates from Swine and Companion Animals and Detection of Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Sandra Prüller

    Full Text Available Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1-2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147, blaOXA-2, (n = 4, strA and strB (n = 17, sul1 (n = 10, sul2 (n = 73, dfrA7 (n = 3 and tet(A (n = 8 were detected and a plasmid localisation was identified for several of the resistance genes.

  16. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  17. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  18. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Science.gov (United States)

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  20. Naturally Occurring Frameshift Mutations in the tvb Receptor Gene Are Responsible for Decreased Susceptibility of Chicken to Infection with Avian Leukosis Virus Subgroups B, D, and E.

    Science.gov (United States)

    Li, Xinjian; Chen, Weiguo; Zhang, Huanmin; Li, Aijun; Shu, Dingming; Li, Hongxing; Dai, Zhenkai; Yan, Yiming; Zhang, Xinheng; Lin, Wencheng; Ma, Jingyun; Xie, Qingmei

    2018-04-15

    The group of highly related avian leukosis viruses (ALVs) in chickens are thought to have evolved from a common retroviral ancestor into six subgroups, A to E and J. These ALV subgroups use diverse cellular proteins encoded by four genetic loci in chickens as receptors to gain entry into host cells. Hosts exposed to ALVs might be under selective pressure to develop resistance to ALV infection. Indeed, resistance alleles have previously been identified in all four receptor loci in chickens. The tvb gene encodes a receptor, which determines the susceptibility of host cells to ALV subgroup B (ALV-B), ALV-D, and ALV-E. Here we describe the identification of two novel alleles of the tvb receptor gene, which possess independent insertions each within exon 4. The insertions resulted in frameshift mutations that reveal a premature stop codon that causes nonsense-mediated decay of the mutant mRNA and the production of truncated Tvb protein. As a result, we observed that the frameshift mutations in the tvb gene significantly lower the binding affinity of the truncated Tvb receptors for the ALV-B, ALV-D, and ALV-E envelope glycoproteins and significantly reduce susceptibility to infection by ALV-B, ALV-D and ALV-E in vitro and in vivo Taken together, these findings suggest that frameshift mutation can be a molecular mechanism of reducing susceptibility to ALV and enhance our understanding of virus-host coevolution. IMPORTANCE Avian leukosis virus (ALV) once caused devastating economic loss to the U.S. poultry industry prior the current eradication schemes in place, and it continues to cause severe calamity to the poultry industry in China and Southeast Asia, where deployment of a complete eradication scheme remains a challenge. The tvb gene encodes the cellular receptor necessary for subgroup B, D, and E ALV infection. Two tvb allelic variants that resulted from frameshift mutations have been identified in this study, which have been shown to have significantly reduced

  1. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  2. Detection of Amp C genes encoding for beta-lactamases in Escherichia coli and Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    M Shanthi

    2012-01-01

    Full Text Available Purpose : Amp C beta-lactamase are Ambler class C enzymes that confer resistance to extended spectrum cephalosporins and are not inhibited by beta-lactamase inhibitors. Their detection is crucial, since the phenotypic tests are not standardised leading to ambiguity in interpretation of results. This study was done to detect the types of Amp C prevalent in Escherichia coli and Klebsiella pneumoniae by multiplex polymerase chain reaction (PCR. Materials and Methods : Seventy-seven consecutive cefoxitin resistant clinical isolates of E. coli (n = 25 and K. pneumoniae (n = 52 were included in the study. Antibiotic susceptibility testing to various classes of antibiotics was performed by disc diffusion using Clinical Laboratory Standards Institute (CLSI guidelines. Minimum inhibitory concentration (MIC to cefoxitin, imipenem and meropenem were determined by broth microdilution method. Isolates were screened for production of Extended Spectrum Beta-Lactamase (ESBL. Multiplex PCR was performed for the detection of Amp C genes after phenotypic testing (Hodge test and inhibitor based test. Results : Cefoxitin Hodge test was positive in 40 isolates which included 20 E. coli and 20 K. pneumoniae. There was zone enhancement with boronic acid in 55 isolates, of which 36 were K. pneumoniae and 19 were E. coli. Multiplex PCR detected Amp C in 11/25 E. coli and 12/52 K. pneumoniae isolates. The Amp C genes detected were CIT (Amp C origin - Citrobacter freundii, DHA (Dhahran Hospital, Saudi Arabia, ACC (Ambler class C, EBC (Amp C origin - Enterobacter cloacae groups. ESBL was co-produced in 54 isolates. Conclusions : Amp C was detected in 29.87% of the study isolates. Majority of them co-produced ESBL. The most common Amp C was the CIT family. Screen tests for cefoxitin resistance may be falsely positive due to production of carbapenamases.

  3. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Transcription factor SP4 is a susceptibility gene for bipolar disorder.

    Directory of Open Access Journals (Sweden)

    Xianjin Zhou

    Full Text Available The Sp4 transcription factor plays a critical role for both development and function of mouse hippocampus. Reduced expression of the mouse Sp4 gene results in a variety of behavioral abnormalities relevant to human psychiatric disorders. The human SP4 gene is therefore examined for its association with both bipolar disorder and schizophrenia in European Caucasian and Chinese populations respectively. Out of ten SNPs selected from human SP4 genomic locus, four displayed significant association with bipolar disorder in European Caucasian families (rs12668354, p = 0.022; rs12673091, p = 0.0005; rs3735440, p = 0.019; rs11974306, p = 0.018. To replicate the genetic association, the same set of SNPs was examined in a Chinese bipolar case control sample. Four SNPs displayed significant association (rs40245, p = 0.009; rs12673091, p = 0.002; rs1018954, p = 0.001; rs3735440, p = 0.029, and two of them (rs12673091, rs3735440 were shared with positive SNPs from European Caucasian families. Considering the genetic overlap between bipolar disorder and schizophrenia, we extended our studies in Chinese trios families for schizophrenia. The SNP7 (rs12673091, p = 0.012 also displayed a significant association. The SNP7 (rs12673091 was therefore significantly associated in all three samples, and shared the same susceptibility allele (A across all three samples. On the other hand, we found a gene dosage effect for mouse Sp4 gene in the modulation of sensorimotor gating, a putative endophenotype for both schizophrenia and bipolar disorder. The deficient sensorimotor gating in Sp4 hypomorphic mice was partially reversed by the administration of dopamine D2 antagonist or mood stabilizers. Both human genetic and mouse pharmacogenetic studies support Sp4 gene as a susceptibility gene for bipolar disorder or schizophrenia. The studies on the role of Sp4 gene in hippocampal development may provide novel insights for the contribution of hippocampal abnormalities in these

  6. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity

    International Nuclear Information System (INIS)

    Halaban, R.; Moellmann, G.

    1990-01-01

    Melanogenesis is regulated in large part by tyrosinase, and defective tyrosinase leads to albinism. The mechanisms for other pigmentation determinants (e.g., those operative in tyrosinase-positive albinism and in murine coat-color mutants) are not yet known. One murine pigmentation gene, the brown (b) locus, when mutated leads to a brown (b/b) or hypopigmentated (B lt /B lt ) coat versus the wild-type black (B/B). The authors show that the b locus codes for a glycoprotein with the activity of a catalase (catalase B). Only the c locus protein is a tyrosinase. Because peroxides may be by-products of melanogenic activity and hydrogen peroxide in particular is known to destroy melanin precursors and melanin, they conclude that pigmentation is controlled not only by tyrosinase but also by a hydroperoxidase. The studies indicate that catalase B is identical with gp75, a known human melanosomal glycoprotein; that the b mutation is in a heme-associated domain; and that the B lt mutation renders the protein susceptible to rapid proteolytic degradation

  7. Evaluation of Fanconi anaemia genes FANCA, FANCC and FANCL in cervical cancer susceptibility.

    Science.gov (United States)

    Juko-Pecirep, Ivana; Ivansson, Emma L; Gyllensten, Ulf B

    2011-08-01

    Disrupting the function of any of the 13 Fanconi anaemia (FA) genes causes a DNA repair deficiency disorder, with patients being susceptible to a number of cancer types. Variation in the family of FA genes has been suggested to affect risk of cervical cancer. The current study evaluates the influence of three genes in the FA pathway on cervical cancer risk in Swedish women. TagSNPs in FANCA, FANCC and FANCL were selected using the Tagger algorithm in Haploview. A total of 81 tagSNPs were genotyped in 782 cases (CIN3 or ICC) and 775 controls using the Illumina GoldenGate Assay and statistically analyzed for association with cervical cancer. 72 SNPs were successfully genotyped in >98% of the samples. Nominal associations were detected for FANCA rs11649196 (p=0.05) and rs4128763 in FANCC (p=0.02). The associations did not withstand correction for multiple testing. The current study does not support that genetic variation in FANCA, FANCC or FANCL genes affects susceptibility to cervical cancer in the Swedish population. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Polymorphisms in the CISH gene are associated with susceptibility to tuberculosis in the Chinese Han population.

    Science.gov (United States)

    Ji, Lin-dan; Xu, Wei-nan; Chai, Peng-fei; Zheng, Wei; Qian, Hai-xia; Xu, Jin

    2014-12-01

    A recent multi-center case-control study identified several single nucleotide polymorphisms (SNPs) within the cytokine-inducible SRC homology 2 domain (CISH) gene that are associated with susceptibility to tuberculosis (TB) in both African and Asian populations. To acquire a more robust and well-powered estimate of the putative influence of these SNPs on TB susceptibility, we conducted a well-designed case-control study in the Chinese Han population. We genotyped 3 previously identified SNPs within CISH in 600 patients with pulmonary TB and 618 healthy controls, and we calculated the pooled P-values and ORs of several studies that have also been conducted in the Chinese populations. The results of the case-control study showed that the C allele of rs2239751 and the T allele of rs414171 are associated with TB susceptibility, and this association exists only in women and young adults. The pooled analysis indicated that both SNPs are significantly associated with TB in the global populations and Chinese populations. The current study confirms that variants of CISH are associated with susceptibility to TB, suggesting that negative regulators of cytokine signaling may have a role in immunity against TB infection. We hypothesize that CISH and estrogen may interact in the cytokine-dependent regulation of the immune system. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  10. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  11. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  12. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  13. Genetic polymorphisms in DNA double-strand break repair genes XRCC5, XRCC6 and susceptibility to hepatocellular carcinoma.

    Science.gov (United States)

    Li, Rui; Yang, Yuan; An, Yu; Zhou, Yun; Liu, Yanhong; Yu, Qing; Lu, Daru; Wang, Hongyang; Jin, Li; Zhou, Weiping; Qian, Ji; Shugart, Yin Yao

    2011-04-01

    Environmental risk factors cause DNA damages. Imprecise DNA repair leads to chromosome aberrations, genome destabilization and hepatocarcinogenesis. Ku is a key DNA double-strand break repair protein. We hypothesized that the genetic variants in Ku subunits encoding genes, XRCC5/XRCC6, may contribute to hepatocellular carcinoma (HCC) susceptibility. We genotyped 13 common single nucleotide polymorphisms (SNPs) in XRCC5 and XRCC6 and evaluated their associations with HCC risk in 689 pathologically confirmed cases and 690 cancer-free controls from a Chinese population. We found that a significantly reduced risk for HCC was associated with XRCC5 rs16855458 [odds ratio (OR)=0.59; 95% confidence interval (CI)=0.43-0.81; CA+AA versus CC] and a significantly increased risk for HCC was associated with XRCC5 rs9288516 (OR=2.02; 95% CI=1.42-2.86; TA+AA versus TT) even after Bonferroni correction (Pcorrected=0.026 and 0.002, respectively). The effects of rs16855458 (OR=0.57; 95% CI=0.37-0.86, P=0.008) and rs9288516 (OR=1.86; 95% CI=1.19-2.90, P=0.007) were more significant in hepatitis B surface antigen-infected subjects than non-infected subjects. The haplotype-based analysis revealed that in XRCC5, AA in block 1 (OR=0.63; 95% CI=0.48-0.83) and CGGTT in block 2 (OR=0.52; 95% CI=0.39-0.69) were associated with decreased HCC risk (Pcorrected=0.013 and analysis. In conclusion, XRCC5 variants may play a role in determining individual's HCC susceptibility, which warranted validation in larger studies.

  14. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  15. Integrative analyses of leprosy susceptibility genes indicate a common autoimmune profile.

    Science.gov (United States)

    Zhang, Deng-Feng; Wang, Dong; Li, Yu-Ye; Yao, Yong-Gang

    2016-04-01

    Leprosy is an ancient chronic infection in the skin and peripheral nerves caused by Mycobacterium leprae. The development of leprosy depends on genetic background and the immune status of the host. However, there is no systematic view focusing on the biological pathways, interaction networks and overall expression pattern of leprosy-related immune and genetic factors. To identify the hub genes in the center of leprosy genetic network and to provide an insight into immune and genetic factors contributing to leprosy. We retrieved all reported leprosy-related genes and performed integrative analyses covering gene expression profiling, pathway analysis, protein-protein interaction network, and evolutionary analyses. A list of 123 differentially expressed leprosy related genes, which were enriched in activation and regulation of immune response, was obtained in our analyses. Cross-disorder analysis showed that the list of leprosy susceptibility genes was largely shared by typical autoimmune diseases such as lupus erythematosus and arthritis, suggesting that similar pathways might be affected in leprosy and autoimmune diseases. Protein-protein interaction (PPI) and positive selection analyses revealed a co-evolution network of leprosy risk genes. Our analyses showed that leprosy associated genes constituted a co-evolution network and might undergo positive selection driven by M. leprae. We suggested that leprosy may be a kind of autoimmune disease and the development of leprosy is a matter of defect or over-activation of body immunity. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. Exercise-Induced Rhabdomyolysis and Stress-Induced Malignant Hyperthermia Events, Association with Malignant Hyperthermia Susceptibility, and RYR1 Gene Sequence Variations

    Directory of Open Access Journals (Sweden)

    Antonella Carsana

    2013-01-01

    Full Text Available Exertional rhabdomyolysis (ER and stress-induced malignant hyperthermia (MH events are syndromes that primarily afflict military recruits in basic training and athletes. Events similar to those occurring in ER and in stress-induced MH events are triggered after exposure to anesthetic agents in MH-susceptible (MHS patients. MH is an autosomal dominant hypermetabolic condition that occurs in genetically predisposed subjects during general anesthesia, induced by commonly used volatile anesthetics and/or the neuromuscular blocking agent succinylcholine. Triggering agents cause an altered intracellular calcium regulation. Mutations in RYR1 gene have been found in about 70% of MH families. The RYR1 gene encodes the skeletal muscle calcium release channel of the sarcoplasmic reticulum, commonly known as ryanodine receptor type 1 (RYR1. The present work reviews the documented cases of ER or of stress-induced MH events in which RYR1 sequence variations, associated or possibly associated to MHS status, have been identified.

  17. Inherited variants in the inner centromere protein (INCENP) gene of the chromosomal passenger complex contribute to the susceptibility of ER-negative breast cancer

    DEFF Research Database (Denmark)

    Kabisch, Maria; Lorenzo Bermejo, Justo; Dünnebier, Thomas

    2015-01-01

    The chromosomal passenger complex (CPC) plays a pivotal role in the regulation of cell division. Therefore, inherited CPC variability could influence tumor development. The present candidate gene approach investigates the relationship between single nucleotide polymorphisms (SNPs) in genes encoding......% CI 1.02-1.10, P = 0.0002). Two genotyped SNPs in BIRC5 were associated with familial breast cancer risk (top SNP rs2071214: per G allele OR 1.12, 95% CI 1.04-1.21, P = 0.002). The data suggest that INCENP in the CPC pathway contributes to ER-negative breast cancer susceptibility in the European...... population. In spite of a modest contribution of CPC-inherited variants to the total burden of sporadic and familial breast cancer, their potential as novel targets for breast cancer treatment should be further investigated....

  18. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  19. Identification of MAMDC1 as a candidate susceptibility gene for systemic lupus erythematosus (SLE.

    Directory of Open Access Journals (Sweden)

    Anna Hellquist

    2009-12-01

    Full Text Available Systemic lupus erythematosus (SLE is a complex autoimmune disorder with multiple susceptibility genes. We have previously reported suggestive linkage to the chromosomal region 14q21-q23 in Finnish SLE families.Genetic fine mapping of this region in the same family material, together with a large collection of parent affected trios from UK and two independent case-control cohorts from Finland and Sweden, indicated that a novel uncharacterized gene, MAMDC1 (MAM domain containing glycosylphosphatidylinositol anchor 2, also known as MDGA2, MIM 611128, represents a putative susceptibility gene for SLE. In a combined analysis of the whole dataset, significant evidence of association was detected for the MAMDC1 intronic single nucleotide polymorphisms (SNP rs961616 (P -value = 0.001, Odds Ratio (OR = 1.292, 95% CI 1.103-1.513 and rs2297926 (P -value = 0.003, OR = 1.349, 95% CI 1.109-1.640. By Northern blot, real-time PCR (qRT-PCR and immunohistochemical (IHC analyses, we show that MAMDC1 is expressed in several tissues and cell types, and that the corresponding mRNA is up-regulated by the pro-inflammatory cytokines tumour necrosis factor alpha (TNF-alpha and interferon gamma (IFN-gamma in THP-1 monocytes. Based on its homology to known proteins with similar structure, MAMDC1 appears to be a novel member of the adhesion molecules of the immunoglobulin superfamily (IgCAM, which is involved in cell adhesion, migration, and recruitment to inflammatory sites. Remarkably, some IgCAMs have been shown to interact with ITGAM, the product of another SLE susceptibility gene recently discovered in two independent genome wide association (GWA scans.Further studies focused on MAMDC1 and other molecules involved in these pathways might thus provide new insight into the pathogenesis of SLE.

  20. Absence of linkage between MHC and a gene involved in susceptibility to human schistosomiasis

    Directory of Open Access Journals (Sweden)

    Chiarella J.M.

    1998-01-01

    Full Text Available Six hundred million people are at risk of infection by Schistosoma mansoni. MHC haplotypes have been reported to segregate with susceptibility to schistosomiasis in murine models. In humans, a major gene related to susceptibility/resistance to infection by S. mansoni (SM1 and displaying the mean fecal egg count as phenotype was detected by segregation analysis. This gene displayed a codominant mode of inheritance with an estimated frequency of 0.20-0.25 for the deleterious allele and accounted for more than 50% of the variance of infection levels. To determine if the SM1 gene segregates with the human MHC chromosomal region, we performed a linkage study by the lod score method. We typed for HLA-A, B, C, DR and DQ antigens in 11 informative families from an endemic area for schistosomiasis in Bahia, Brazil, by the microlymphocytotoxicity technique. HLA-DR typing by the polymerase chain reaction with sequence-specific primers (PCR-SSP and HLA-DQ were confirmed by PCR-sequence-specific oligonucleotide probes (PCR-SSOP. The lod scores for the different q values obtained clearly indicate that there is no physical linkage between HLA and SM1 genes. Thus, susceptibility or resistance to schistosomiasis, as defined by mean fecal egg count, is not primarily dependent on the host's HLA profile. However, if the HLA molecule plays an important role in specific immune responses to S. mansoni, this may involve the development of the different clinical aspects of the disease such as granuloma formation and development of hepatosplenomegaly.

  1. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  2. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  3. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  4. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  5. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  6. Enrichment of putative PAX8 target genes at serous epithelial ovarian cancer susceptibility loci

    DEFF Research Database (Denmark)

    Kar, Siddhartha P; Adler, Emily; Tyrer, Jonathan

    2017-01-01

    BACKGROUND: Genome-wide association studies (GWAS) have identified 18 loci associated with serous ovarian cancer (SOC) susceptibility but the biological mechanisms driving these findings remain poorly characterised. Germline cancer risk loci may be enriched for target genes of transcription factors...... (TFs) critical to somatic tumorigenesis. METHODS: All 615 TF-target sets from the Molecular Signatures Database were evaluated using gene set enrichment analysis (GSEA) and three GWAS for SOC risk: discovery (2196 cases/4396 controls), replication (7035 cases/21 693 controls; independent from discovery...... to interact with PAX8 in the literature to the PAX8-target set and applying an alternative to GSEA, interval enrichment, further confirmed this association (P=0.006). Fifteen of the 157 genes from this expanded PAX8 pathway were near eight loci associated with SOC risk at P

  7. Targeted Resequencing and Functional Testing Identifies Low-Frequency Missense Variants in the Gene Encoding GARP as Significant Contributors to Atopic Dermatitis Risk.

    Science.gov (United States)

    Manz, Judith; Rodríguez, Elke; ElSharawy, Abdou; Oesau, Eva-Maria; Petersen, Britt-Sabina; Baurecht, Hansjörg; Mayr, Gabriele; Weber, Susanne; Harder, Jürgen; Reischl, Eva; Schwarz, Agatha; Novak, Natalija; Franke, Andre; Weidinger, Stephan

    2016-12-01

    Gene-mapping studies have consistently identified a susceptibility locus for atopic dermatitis and other inflammatory diseases on chromosome band 11q13.5, with the strongest association observed for a common variant located in an intergenic region between the two annotated genes C11orf30 and LRRC32. Using a targeted resequencing approach we identified low-frequency and rare missense mutations within the LRRC32 gene encoding the protein GARP, a receptor on activated regulatory T cells that binds latent transforming growth factor-β. Subsequent association testing in more than 2,000 atopic dermatitis patients and 2,000 control subjects showed a significant excess of these LRRC32 variants in individuals with atopic dermatitis. Structural protein modeling and bioinformatic analysis predicted a disruption of protein transport upon these variants, and overexpression assays in CD4 + CD25 - T cells showed a significant reduction in surface expression of the mutated protein. Consistently, flow cytometric (FACS) analyses of different T-cell subtypes obtained from atopic dermatitis patients showed a significantly reduced surface expression of GARP and a reduced conversion of CD4 + CD25 - T cells into regulatory T cells, along with lower expression of latency-associated protein upon stimulation in carriers of the LRRC32 A407T variant. These results link inherited disturbances of transforming growth factor-β signaling with atopic dermatitis risk. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  9. Wound healing genes and susceptibility to cutaneous leishmaniasis in Brazil: Role of COL1A1

    Science.gov (United States)

    Almeida, Lucas; Oliveira, Joyce; Guimarães, Luiz Henrique; Carvalho, Edgar M; Blackwell, Jenefer M

    2015-01-01

    Previous studies have demonstrated a role for wound healing genes in resolution of cutaneous lesions caused by Leishmania spp. in both mice and humans, including the gene FLI1 encoding Friend leukaemia virus integration 1. Reduction of Fli1 expression in mice has been shown to result in up-regulation of collagen type I alpha 1 (Col1a1) and alpha 2 (Col1a2) genes and, conversely, in down-regulation of the matrix metalloproteinase 1 (Mmp1) gene, suggesting that Fli1 suppression is involved in activation of the profibrotic gene program. Here we examined single nucleotide polymorphisms (SNPs) in these genes as risk factors for cutaneous (CL) and mucosal leishmaniasis (ML), and leishmaniasis per se, caused by L. braziliensis in humans. SNPs were genotyped in 168 nuclear families (250 CL; 87 ML cases) and replicated in 157 families (402 CL; 39 ML cases). Family-based association tests (FBAT) showed the strongest association between SNPs rs1061237 (combined P=0.002) and rs2586488 (combined P=0.027) at COL1A1 and CL disease. This contributes to our further understanding of the role of wound healing in the resolution of CL disease, providing potential for therapies modulating COL1A1 via drugs acting on FLI1. PMID:25562121

  10. Association of common variants in mismatch repair genes and breast cancer susceptibility: a multigene study

    International Nuclear Information System (INIS)

    Conde, João; Silva, Susana N; Azevedo, Ana P; Teixeira, Valdemar; Pina, Julieta Esperança; Rueff, José; Gaspar, Jorge F

    2009-01-01

    MMR is responsible for the repair of base-base mismatches and insertion/deletion loops. Besides this, MMR is also associated with an anti-recombination function, suppressing homologous recombination. Losses of heterozygosity and/or microsatellite instability have been detected in a large number of skin samples from breast cancer patients, suggesting a potential role of MMR in breast cancer susceptibility. We carried out a hospital-based case-control study in a Caucasian Portuguese population (287 cases and 547 controls) to estimate the susceptibility to non-familial breast cancer associated with some polymorphisms in mismatch repair genes (MSH3, MSH4, MSH6, MLH1, MLH3, PMS1 and MUTYH). Using unconditional logistic regression we found that MLH3 (L844P, G>A) polymorphism GA (Leu/Pro) and AA (Pro/Pro) genotypes were associated with a decreased risk: OR = 0.65 (0.45-0.95) (p = 0.03) and OR = 0.62 (0.41-0.94) (p = 0.03), respectively. Analysis of two-way SNP interaction effects on breast cancer revealed two potential associations to breast cancer susceptibility: MSH3 Ala1045Thr/MSH6 Gly39Glu - AA/TC [OR = 0.43 (0.21-0.83), p = 0.01] associated with a decreased risk; and MSH4 Ala97Thr/MLH3 Leu844Pro - AG/AA [OR = 2.35 (1.23-4.49), p = 0.01], GG/AA [OR = 2.11 (1.12-3,98), p = 0.02], and GG/AG [adjusted OR = 1.88 (1.12-3.15), p = 0.02] all associated with an increased risk for breast cancer. It is possible that some of these common variants in MMR genes contribute significantly to breast cancer susceptibility. However, further studies with a large sample size will be needed to support our results

  11. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  12. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis.

    Science.gov (United States)

    Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin

    2014-03-01

    Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  13. RETRACTED: Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression.

    Science.gov (United States)

    Yang, Chun-Hua; Zhou, Tian-Biao

    2015-12-01

    This article has been included in a multiple retraction: Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 This article has been retracted at the request of the Editors and the Publisher. After conducting a thorough investigation, SAGE found that the submitting authors of a number of papers published in the Journal of the Renin-Angiotensin Aldosterone System ( JRAAS) (listed below) had supplied fabricated contact details for their nominated reviewers. The Editors accepted these papers based on the reports supplied by the individuals using these fake reviewer email accounts. After concluding that the peer review process was therefore seriously compromised, SAGE and the journal Editors have decided to retract all affected articles. Online First articles (these articles will not be published in an issue) Wenzhuang Tang, Tian-Biao Zhou, and Zongpei Jiang Association of the angiotensinogen M235T gene polymorphism with risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314563426, first published on December 18, 2014 doi: 10.1177/1470320314563426 Tian-Biao Zhou, Hong-Yan Li, Zong-Pei Jiang, Jia-Fan Zhou, Miao-Fang Huang, and Zhi-Yang Zhou Role of renin-angiotensin-aldosterone system inhibitors in radiation nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314563424, first published on December 18, 2014 doi: 10.1177/1470320314563424 Weiqiang Zhong, Zongpei Jiang, and Tian-Biao Zhou Association between the ACE I/D gene polymorphism and T2DN susceptibility: The risk of T2DM developing into T2DN in the Asian population Journal of Renin-Angiotensin-Aldosterone System 1470320314566019, first published on January 26, 2015 doi: 10.1177/1470320314566019 Tian-Biao Zhou, Xue-Feng Guo, Zongpei

  14. Testing differential susceptibility: Plasticity genes, the social environment, and their interplay in adolescent response inhibition.

    Science.gov (United States)

    Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K

    2017-06-01

    Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.

  15. Antibiotic Susceptibility, Genetic Diversity, and the Presence of Toxin Producing Genes in Campylobacter Isolates from Poultry.

    Science.gov (United States)

    Lee, Jeeyeon; Jeong, Jiyeon; Lee, Heeyoung; Ha, Jimyeong; Kim, Sejeong; Choi, Yukyung; Oh, Hyemin; Seo, Kunho; Yoon, Yohan; Lee, Soomin

    2017-11-17

    This study examined antibiotic susceptibility, genetic diversity, and characteristics of virulence genes in Campylobacter isolates from poultry. Chicken ( n = 152) and duck ( n = 154) samples were collected from 18 wet markets in Korea. Campylobacter spp. isolated from the carcasses were identified by PCR. The isolated colonies were analyzed for antibiotic susceptibility to chloramphenicol, amikacin, erythromycin, tetracycline, ciprofloxacin, nalidixic acid, and enrofloxacin. The isolates were also used to analyze genetic diversity using the DiversiLab TM system and were tested for the presence of cytolethal distending toxin ( cdt ) genes. Campylobacter spp. were isolated from 45 poultry samples out of 306 poultry samples (14.7%) and the average levels of Campylobacter contamination were 22.0 CFU/g and 366.1 CFU/g in chicken and duck samples, respectively. Moreover, more than 90% of the isolates showed resistance to nalidixic acid and ciprofloxacin. Genetic correlation analysis showed greater than 95% similarity between 84.4% of the isolates, and three cdt genes ( cdtA , cdtB , and cdtC ) were present in 71.1% of Campylobacter isolates. These results indicate that Campylobacter contamination should be decreased to prevent and treat Campylobacter foodborne illness.

  16. Role of tumour necrosis factor gene polymorphisms (-308 and -238) in breast cancer susceptibility and severity

    International Nuclear Information System (INIS)

    Azmy, Iman AF; Balasubramanian, Saba P; Wilson, Anthony G; Stephenson, Timothy J; Cox, Angela; Brown, Nicola J; Reed, Malcolm WR

    2004-01-01

    Genetic polymorphisms in the promoter region of the tumour necrosis factor (TNF) gene can regulate gene expression and have been associated with inflammatory and malignant conditions. We have investigated two polymorphisms in the promoter of the TNF gene (-308 G>A and -238 G>A) for their role in breast cancer susceptibility and severity by means of an allelic association study. Using a case–control study design, breast cancer patients (n = 709) and appropriate age-matched and sex-matched controls obtained from the Breast Screening Unit (n = 498) were genotyped for these TNF polymorphisms, using a high-throughput allelic discrimination method. Allele frequencies for both polymorphisms were similar in both breast cancer cases and controls. However, the -308 polymorphism was found to be associated with vascular invasion in breast tumours (P = 0.024). Comparison with other standard prognostic indices did not show any association for either genotype. We demonstrated no association between the -308G>A polymorphism and the -238G>A polymorphism in the promoter region of TNF and susceptibility to breast cancer, in a large North European population. However, the -308 G>A polymorphism was found to be associated with the presence of vascular invasion in breast tumours

  17. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  18. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  19. Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer.

    Science.gov (United States)

    Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun

    2018-05-12

    Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

  20. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  1. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  2. Impact of MCP-1 and CCR-2 gene polymorphisms on coronary artery disease susceptibility.

    Science.gov (United States)

    Lin, Hsiu-Ling; Ueng, Kwo-Chang; Hsieh, Yih-Shou; Chiang, Whei-Ling; Yang, Shun-Fa; Chu, Shu-Chen

    2012-09-01

    Coronary artery disease (CAD) was the second leading cause of death during the last 3 years in Taiwan. Smooth muscle cells, monocytes/macrophages, and endothelial cells produce monocyte chemoattractant protein-1 (MCP-1) within atherosclerotic plaques following binding to the chemokine receptor-2 (CCR-2). Previous studies have well-documented the association between MCP-1 expression and susceptibility to, or clinicopathological features, of CAD. This study investigated the relationships between MCP-1-2518A/G and CCR-2-V64I genetic polymorphisms and CAD in the Taiwanese population. A total of 608 subjects, including 392 non-CAD controls and 216 patients with CAD, were recruited and subjected to polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to evaluate the effects of these two polymorphic variants on CAD. Results indicated a significant association between MCP-1 -2548 gene polymorphism and susceptibility to CAD. GG genotypes (OR = 1.629; 95 % CI = 1.003-2.644), or individuals with at least one G allele (OR = 1.511; 95 % CI = 1.006-2.270), had a higher risk of CAD as compared with AA genotypes. Results also revealed that subjects with at least one A allele of the V64I CCR2 gene polymorphism had significantly increased risk of CAD. G allele in MCP-1-2518 might contribute to higher prevalence of atrial fibrillation in CAD patients (OR = 4.254; p CCR-2 64I gene polymorphisms represent important factors in determining susceptibility to CAD, and the contribution of MCP-1-2518G could be through effects on atrial fibrillation in CAD patients.

  3. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  4. Investigation on the association between NLRP3 gene polymorphisms and susceptibility to primary gout.

    Science.gov (United States)

    Wang, L F; Ding, Y J; Zhao, Q; Zhang, X L

    2015-12-09

    We conducted a case-control study to investigate the association between 3 common NALP3 polymorphisms (rs10754558, rs7512998, and rs12137901) and the susceptibility to primary gout. A total of 320 patients with primary gout and 320 controls were included in this study. The genotyping of NALP3 rs10754558, rs7512998, and rs12137901 were conducted by polymerase chain reaction-restriction fragment length polymorphism. Comparison analysis showed that primary gout patients were more likely to have higher body mass index, prevalence of hypertension, blood glucose, triglycerides, urea nitrogen, and uric acid (P gene polymorphisms and the risk of primary gout.

  5. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  6. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  7. Identification of RNF213 as a susceptibility gene for moyamoya disease and its possible role in vascular development.

    Directory of Open Access Journals (Sweden)

    Wanyang Liu

    Full Text Available Moyamoya disease is an idiopathic vascular disorder of intracranial arteries. Its susceptibility locus has been mapped to 17q25.3 in Japanese families, but the susceptibility gene is unknown.Genome-wide linkage analysis in eight three-generation families with moyamoya disease revealed linkage to 17q25.3 (P<10(-4. Fine mapping demonstrated a 1.5-Mb disease locus bounded by D17S1806 and rs2280147. We conducted exome analysis of the eight index cases in these families, with results filtered through Ng criteria. There was a variant of p.N321S in PCMTD1 and p.R4810K in RNF213 in the 1.5-Mb locus of the eight index cases. The p.N321S variant in PCMTD1 could not be confirmed by the Sanger method. Sequencing RNF213 in 42 index cases confirmed p.R4810K and revealed it to be the only unregistered variant. Genotyping 39 SNPs around RNF213 revealed a founder haplotype transmitted in 42 families. Sequencing the 260-kb region covering the founder haplotype in one index case did not show any coding variants except p.R4810K. A case-control study demonstrated strong association of p.R4810K with moyamoya disease in East Asian populations (251 cases and 707 controls with an odds ratio of 111.8 (P = 10(-119. Sequencing of RNF213 in East Asian cases revealed additional novel variants: p.D4863N, p.E4950D, p.A5021V, p.D5160E, and p.E5176G. Among Caucasian cases, variants p.N3962D, p.D4013N, p.R4062Q and p.P4608S were identified. RNF213 encodes a 591-kDa cytosolic protein that possesses two functional domains: a Walker motif and a RING finger domain. These exhibit ATPase and ubiquitin ligase activities. Although the mutant alleles (p.R4810K or p.D4013N in the RING domain did not affect transcription levels or ubiquitination activity, knockdown of RNF213 in zebrafish caused irregular wall formation in trunk arteries and abnormal sprouting vessels.We provide evidence suggesting, for the first time, the involvement of RNF213 in genetic susceptibility to moyamoya

  8. HSD3B and gene-gene interactions in a pathway-based analysis of genetic susceptibility to bladder cancer.

    Directory of Open Access Journals (Sweden)

    Angeline S Andrew

    Full Text Available Bladder cancer is the 4(th most common cancer among men in the U.S. We analyzed variant genotypes hypothesized to modify major biological processes involved in bladder carcinogenesis, including hormone regulation, apoptosis, DNA repair, immune surveillance, metabolism, proliferation, and telomere maintenance. Logistic regression was used to assess the relationship between genetic variation affecting these processes and susceptibility in 563 genotyped urothelial cell carcinoma cases and 863 controls enrolled in a case-control study of incident bladder cancer conducted in New Hampshire, U.S. We evaluated gene-gene interactions using Multifactor Dimensionality Reduction (MDR and Statistical Epistasis Network analysis. The 3'UTR flanking variant form of the hormone regulation gene HSD3B2 was associated with increased bladder cancer risk in the New Hampshire population (adjusted OR 1.85 95%CI 1.31-2.62. This finding was successfully replicated in the Texas Bladder Cancer Study with 957 controls, 497 cases (adjusted OR 3.66 95%CI 1.06-12.63. The effect of this prevalent SNP was stronger among males (OR 2.13 95%CI 1.40-3.25 than females (OR 1.56 95%CI 0.83-2.95, (SNP-gender interaction P = 0.048. We also identified a SNP-SNP interaction between T-cell activation related genes GATA3 and CD81 (interaction P = 0.0003. The fact that bladder cancer incidence is 3-4 times higher in males suggests the involvement of hormone levels. This biologic process-based analysis suggests candidate susceptibility markers and supports the theory that disrupted hormone regulation plays a role in bladder carcinogenesis.

  9. Methodological issues in detecting gene-gene interactions in breast cancer susceptibility: a population-based study in Ontario

    Directory of Open Access Journals (Sweden)

    Onay Venus

    2007-08-01

    Full Text Available Abstract Background There is growing evidence that gene-gene interactions are ubiquitous in determining the susceptibility to common human diseases. The investigation of such gene-gene interactions presents new statistical challenges for studies with relatively small sample sizes as the number of potential interactions in the genome can be large. Breast cancer provides a useful paradigm to study genetically complex diseases because commonly occurring single nucleotide polymorphisms (SNPs may additively or synergistically disturb the system-wide communication of the cellular processes leading to cancer development. Methods In this study, we systematically studied SNP-SNP interactions among 19 SNPs from 18 key genes involved in major cancer pathways in a sample of 398 breast cancer cases and 372 controls from Ontario. We discuss the methodological issues associated with the detection of SNP-SNP interactions in this dataset by applying and comparing three commonly used methods: the logistic regression model, classification and regression trees (CART, and the multifactor dimensionality reduction (MDR method. Results Our analyses show evidence for several simple (two-way and complex (multi-way SNP-SNP interactions associated with breast cancer. For example, all three methods identified XPD-[Lys751Gln]*IL10-[G(-1082A] as the most significant two-way interaction. CART and MDR identified the same critical SNPs participating in complex interactions. Our results suggest that the use of multiple statistical approaches (or an integrated approach rather than a single methodology could be the best strategy to elucidate complex gene interactions that have generally very different patterns. Conclusion The strategy used here has the potential to identify complex biological relationships among breast cancer genes and processes. This will lead to the discovery of novel biological information, which will improve breast cancer risk management.

  10. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  11. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  12. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  13. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  14. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  15. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  16. Differential susceptibility to maternal expressed emotion in children with ADHD and their siblings? Investigating plasticity genes, prosocial and antisocial behaviour.

    Science.gov (United States)

    Richards, Jennifer S; Hartman, Catharina A; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Arias Vásquez, Alejandro; Buitelaar, Jan K

    2015-02-01

    The differential susceptibility theory states that children differ in their susceptibility towards environmental experiences, partially due to plasticity genes. Individuals carrying specific variants in such genes will be more disadvantaged in negative but, conversely, more advantaged in positive environments. Understanding gene-environment interactions may help unravel the causal mechanisms involved in multifactorial psychiatric disorders such as Attention-Deficit/Hyperactivity Disorder (ADHD). The differential susceptibility theory was examined by investigating the presence of interaction effects between maternal expressed emotion (EE; warmth and criticism) and the solitary and combined effects of plasticity genes (DAT1, DRD4, 5-HTT) on prosocial and antisocial behaviour (measured with parent- and self-reports) in children with ADHD and their siblings (N = 366, M = 17.11 years, 74.9% male). Maternal warmth was positively associated with prosocial behaviour and negatively with antisocial behaviour, while maternal criticism was positively associated with antisocial behaviour and negatively with prosocial behaviour. No evidence of differential susceptibility was found. The current study found no evidence for differential susceptibility based on the selected plasticity genes, in spite of strong EE-behaviour associations. It is likely that additional factors play a role in the complex relationship between genes, environment and behaviour.

  17. Toxoplasmosis and Polygenic Disease Susceptibility Genes: Extensive Toxoplasma gondii Host/Pathogen Interactome Enrichment in Nine Psychiatric or Neurological Disorders

    Directory of Open Access Journals (Sweden)

    C. J. Carter

    2013-01-01

    Full Text Available Toxoplasma gondii is not only implicated in schizophrenia and related disorders, but also in Alzheimer's or Parkinson's disease, cancer, cardiac myopathies, and autoimmune disorders. During its life cycle, the pathogen interacts with ~3000 host genes or proteins. Susceptibility genes for multiple sclerosis, Alzheimer's disease, schizophrenia, bipolar disorder, depression, childhood obesity, Parkinson's disease, attention deficit hyperactivity disorder (multiple sclerosis, and autism (, but not anorexia or chronic fatigue are highly enriched in the human arm of this interactome and 18 (ADHD to 33% (MS of the susceptibility genes relate to it. The signalling pathways involved in the susceptibility gene/interactome overlaps are relatively specific and relevant to each disease suggesting a means whereby susceptibility genes could orient the attentions of a single pathogen towards disruption of the specific pathways that together contribute (positively or negatively to the endophenotypes of different diseases. Conditional protein knockdown, orchestrated by T. gondii proteins or antibodies binding to those of the host (pathogen derived autoimmunity and metabolite exchange, may contribute to this disruption. Susceptibility genes may thus be related to the causes and influencers of disease, rather than (and as well as to the disease itself.

  18. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  19. Discovering susceptibility genes for allergic rhinitis and allergy using a genome-wide association study strategy.

    Science.gov (United States)

    Li, Jingyun; Zhang, Yuan; Zhang, Luo

    2015-02-01

    Allergic rhinitis and allergy are complex conditions, in which both genetic and environmental factors contribute to the pathogenesis. Genome-wide association studies (GWASs) employing common single-nucleotide polymorphisms have accelerated the search for novel and interesting genes, and also confirmed the role of some previously described genes which may be involved in the cause of allergic rhinitis and allergy. The aim of this review is to provide an overview of the genetic basis of allergic rhinitis and the associated allergic phenotypes, with particular focus on GWASs. The last decade has been marked by the publication of more than 20 GWASs of allergic rhinitis and the associated allergic phenotypes. Allergic diseases and traits have been shown to share a large number of genetic susceptibility loci, of which IL33/IL1RL1, IL-13-RAD50 and C11orf30/LRRC32 appear to be important for more than two allergic phenotypes. GWASs have further reflected the genetic heterogeneity underlying allergic phenotypes. Large-scale genome-wide association strategies are underway to discover new susceptibility variants for allergic rhinitis and allergic phenotypes. Characterization of the underlying genetics provides us with an insight into the potential targets for future studies and the corresponding interventions.

  20. Assessment of relatedness between neurocan gene as bipolar disorder susceptibility locus and schizophrenia

    Directory of Open Access Journals (Sweden)

    Lilijana Oruč

    2012-11-01

    Full Text Available Large scale genetic association meta-analyses showed that neurocan (NCAN gene polymorphism rs1064395 is susceptibility locus for bipolar disorder. These studies also included patients with bipolar disorder originated from Bosnia and Herzegovina. Followed by theory of shared genetic elements between bipolar disorder and schizophrenia susceptibility, other studies explored several genetic factors with schizophrenia vulnerability as well. In this work, authors investigated the association between previously confirmed bipolar disorder genetic risk factor-neurocan with schizophrenia in a population sample of Bosnia and Herzegovina.Ethical aspects of this research were assessed by Ethics Committee of Clinical Center University of Sarajevo. Blood samples for DNA extraction were taken from the total of 86 patients and healthy individuals who previously signed informed consent. Genotyping for rs 1064395 was done using direct sequencing method. A case-control analysis of common genetic polymorphism within neurocan gene and schizophrenia status in a consecutively sampled patient cohort have been done using Fisher-exact test with odds-ratio calculation. No statistically significant allele and genotype association with disease status was found (p>0.05.Our finding supports the fact that large-scale genetic association studies approach need to be employed when detecting the variants with small additive effect in phenotypes with complex ethiology.

  1. Impacts of CA9 gene polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic characteristics in Taiwan.

    Directory of Open Access Journals (Sweden)

    Shian-Shiang Wang

    Full Text Available Carbonic anhydrase 9 (CA9 is reportedly overexpressed in several types of carcinomas and is generally considered a marker of malignancy. The current study explored the effect of CA9 gene polymorphisms on the susceptibility of developing urothelial cell carcinoma (UCC and the clinicopathological status.A total of 442 participants, including 221 healthy people and 221 patients with UCC, were recruited for this study. Four single-nucleotide polymorphisms (SNPs of the CA9 gene were assessed by a real-time PCR with the TaqMan assay. After adjusting for other co-variants, the individuals carrying at least one A allele at CA9 rs1048638 had a 2.303-fold risk of developing UCC than did wild-type (CC carriers. Furthermore, UCC patients who carried at least one A allele at rs1048638 had a higher invasive stage risk (p< 0.05 than did patients carrying the wild-type allele. Moreover, among the UCC patients with smoker, people with at least one A allele of CA9 polymorphisms (rs1048638 had a 4.75-fold (95% CI = 1.204-18.746 increased risk of invasive cancer.The rs1048638 polymorphic genotypes of CA9 might contribute to the prediction of susceptibility to and pathological development of UCC. This is the first study to provide insight into risk factors associated with CA9 variants in carcinogenesis of UCC in Taiwan.

  2. Role of MHC-Linked Susceptibility Genes in the Pathogenesis of Human and Murine Lupus

    Directory of Open Access Journals (Sweden)

    Manfred Relle

    2012-01-01

    Full Text Available Systemic lupus erythematosus (SLE is a chronic autoimmune disease characterized by the production of autoantibodies against nuclear antigens and a systemic inflammation that can damage a broad spectrum of organs. SLE patients suffer from a wide variety of symptoms, which can affect virtually almost any tissue. As lupus is difficult to diagnose, the worldwide prevalence of SLE can only be roughly estimated to range from 10 and 200 cases per 100,000 individuals with dramatic differences depending on gender, ethnicity, and location. Although the treatment of this disease has been significantly ameliorated by new therapies, improved conventional drug therapy options, and a trained expert eye, the underlying pathogenesis of lupus still remain widely unknown. The complex etiology reflects the complex genetic background of the disease, which is also not well understood yet. However, in the past few years advances in lupus genetics have been made, notably with the publication of genome-wide association studies (GWAS in humans and the identification of susceptibility genes and loci in mice. This paper reviews the role of MHC-linked susceptibility genes in the pathogenesis of systemic lupus erythematosus.

  3. MicroRNA gene polymorphisms and environmental factors increase patient susceptibility to hepatocellular carcinoma.

    Directory of Open Access Journals (Sweden)

    Yin-Hung Chu

    Full Text Available BACKGROUND: Micro RNAs (miRNAs are small RNA fragments that naturally exist in the human body. Through various physiological mechanisms, miRNAs can generate different functions for regulating RNA protein levels and balancing abnormalities. Abnormal miRNA expression has been reported to be highly related to several diseases and cancers. Single-nucleotide polymorphisms (SNPs in miRNAs have been reported to increase patient susceptibility and affect patient prognosis and survival. We adopted a case-control research design to verify the relationship between miRNAs and hepatocellular carcinoma. METHODOLOGY/PRINCIPAL FINDINGS: A total of 525 subjects, including 377 controls and 188 hepatocellular carcinoma patients, were selected. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and real-time PCR were used to analyze miRNA146a (rs2910164, miRNA149 (rs2292832, miRNA196 (rs11614913, and miRNA499 (rs3746444 genetic polymorphisms between the control group and the case group. The results indicate that people who carry the rs3746444 CT or CC genotypes may have a significantly increased susceptibility to hepatocellular carcinoma (adjusted odds ratio [AOR] = 2.84, 95% confidence interval [CI] = 1.88-4.30. In addition, when combined with environmental risk factors, such as smoking and alcohol consumption, interaction effects were observed between gene polymorphisms and environmental factors (odds ratio [OR] = 4.69, 95% CI = 2.52-8.70; AOR = 3.38, 95% CI = 1.68-6.80. CONCLUSIONS: These results suggest that a significant association exists between miRNA499 SNPs and hepatocellular carcinoma. Gene-environment interactions of miRNA499 polymorphisms, smoking, and alcohol consumption might alter hepatocellular carcinoma susceptibility.

  4. Disease susceptibility of the human macula: differential gene transcription in the retinal pigmented epithelium/choroid.

    Science.gov (United States)

    Radeke, Monte J; Peterson, Katie E; Johnson, Lincoln V; Anderson, Don H

    2007-09-01

    The discoveries of gene variants associated with macular diseases have provided valuable insight into their molecular mechanisms, but they have not clarified why the macula is particularly vulnerable to degenerative disease. Its predisposition may be attributable to specialized structural features and/or functional properties of the underlying macular RPE/choroid. To examine the molecular basis for the macula's disease susceptibility, we compared the gene expression profile of the human RPE/choroid in the macula with the profile in the extramacular region using DNA microarrays. Seventy-five candidate genes with differences in macular:extramacular expression levels were identified by microarray analysis, of which 29 were selected for further analysis. Quantitative PCR confirmed that 21 showed statistically significant differences in expression. Five genes were expressed at higher levels in the macula. Two showed significant changes in the macular:extramacular expression ratio; another two exhibited changes in absolute expression level, as a function of age or AMD. Several of the differentially expressed genes have potential relevance to AMD pathobiology. One is an RPE cell growth factor (TFPI2), five are extracellular matrix components (DCN, MYOC, OGN, SMOC2, TFPI2), and six are related to inflammation (CCL19, CCL26, CXCL14, SLIT2) and/or angiogenesis (CXCL14, SLIT2, TFPI2, WFDC1). The identification of regional differences in gene expression in the RPE/choroid is a first step in clarifying the macula's propensity for degeneration. These findings lay the groundwork for further studies into the roles of the corresponding gene products in the normal, aged, and diseased macula.

  5. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  6. Candidate gene analysis and exome sequencing confirm LBX1 as a susceptibility gene for idiopathic scoliosis

    DEFF Research Database (Denmark)

    Grauers, Anna; Wang, Jingwen; Einarsdottir, Elisabet

    2015-01-01

    samples from 100 surgically treated idiopathic scoliosis patients. Novel or rare missense, nonsense, or splice site variants were selected for individual genotyping in the 1,739 cases and 1,812 controls. In addition, the 5'UTR, noncoding exon and promoter regions of LBX1, not covered by exome sequencing...... by exome sequencing after filtration and an initial genotyping validation. However, we could not verify any association to idiopathic scoliosis in the large cohort of 1,739 cases and 1,812 controls. We did not find any variants in the 5'UTR, noncoding exon and promoter regions of LBX1. CONCLUSIONS: Here...... that are significantly associated with idiopathic scoliosis in Asian and Caucasian populations, rs11190870 close to the LBX1 gene being the most replicated finding. PURPOSE: The aim of the present study was to investigate the genetics of idiopathic scoliosis in a Scandinavian cohort by performing a candidate gene study...

  7. Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.

    Science.gov (United States)

    Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke

    2018-06-01

    In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .

  8. Association of single nucleotide polymorphisms in the gene encoding GLUT1 and diabetic nephropathy in Brazilian patients with type 1 diabetes mellitus.

    Science.gov (United States)

    Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L

    2015-04-15

    Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  10. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  11. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  12. Candida albicans AGE3, the ortholog of the S. cerevisiae ARF-GAP-encoding gene GCS1, is required for hyphal growth and drug resistance.

    Directory of Open Access Journals (Sweden)

    Thomas Lettner

    Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it

  13. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

    Science.gov (United States)

    Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

    2005-07-01

    To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

  14. Variations in testosterone pathway genes and susceptibility to testicular cancer in Norwegian men.

    Science.gov (United States)

    Kristiansen, W; Aschim, E L; Andersen, J M; Witczak, O; Fosså, S D; Haugen, T B

    2012-12-01

    Imbalance between the oestrogen and androgen levels in utero is hypothesized to influence testicular cancer (TC) risk. Thus, variation in genes involved in the action of sex hormones may contribute to variability of an individual's susceptibility to TC. Mutations in testosterone pathway genes may alter the level of testosterone in vivo and hypothetically the risk of developing TC. Luteinizing hormone receptor (LHR), 5α-reductase II (SRD5A2) and androgen receptor (AR) are key elements in androgen action. A case-control study comprising 651 TC cases and 313 controls in a Norwegian population was conducted for investigation of polymorphisms in the LHR, SRD5A and AR genes and their possible association with TC. A statistical significant difference was observed in patients being heterozygous for the LHR Asn312Ser polymorphism when comparing genotypes between all TC cases and controls (OR = 0.66, 95% CI = 0.48-0.89, p(adj) = 0.049). No statistically significant difference between the histological subtypes seminoma and non-seminoma was observed. Our results may suggest a possible association between genetic variation in the LHR gene and the risk of developing TC. © 2012 The Authors. International Journal of Andrology © 2012 European Academy of Andrology.

  15. Differentially Expressed Genes in Resistant and Susceptible Common Bean (Phaseolus vulgaris L. Genotypes in Response to Fusarium oxysporum f. sp. phaseoli.

    Directory of Open Access Journals (Sweden)

    Renfeng Xue

    Full Text Available Fusarium wilt of common bean (Phaseolus vulgaris L., caused by Fusarium oxysporum Schlechtend.:Fr. f.sp. phaseoli (Fop, is one of the most important diseases of common beans worldwide. Few natural sources of resistance to Fop exist and provide only moderate or partial levels of protection. Despite the economic importance of the disease across multiple crops, only a few of Fop induced genes have been analyzed in legumes. Therefore, our goal was to identify transcriptionally regulated genes during an incompatible interaction between common bean and the Fop pathogen using the cDNA amplified fragment length polymorphism (cDNA-AFLP technique. We generated a total of 8,730 transcript-derived fragments (TDFs with 768 primer pairs based on the comparison of a moderately resistant and a susceptible genotype. In total, 423 TDFs (4.9% displayed altered expression patterns after inoculation with Fop inoculum. We obtained full amplicon sequences for 122 selected TDFs, of which 98 were identified as annotated known genes in different functional categories based on their putative functions, 10 were predicted but non-annotated genes and 14 were not homologous to any known genes. The 98 TDFs encoding genes of known putative function were classified as related to metabolism (22, signal transduction (21, protein synthesis and processing (20, development and cytoskeletal organization (12, transport of proteins (7, gene expression and RNA metabolism (4, redox reactions (4, defense and stress responses (3, energy metabolism (3, and hormone responses (2. Based on the analyses of homology, 19 TDFs from different functional categories were chosen for expression analysis using quantitative RT-PCR. The genes found to be important here were implicated at various steps of pathogen infection and will allow a better understanding of the mechanisms of defense and resistance to Fop and similar pathogens. The differential response genes discovered here could also be used as

  16. Low frequency variants in the exons only encoding isoform A of HNF1A do not contribute to susceptibility to type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Bahram Jafar-Mohammadi

    2009-08-01

    Full Text Available There is considerable interest in the hypothesis that low frequency, intermediate penetrance variants contribute to the proportion of Type 2 Diabetes (T2D susceptibility not attributable to the common variants uncovered through genome-wide association approaches. Genes previously implicated in monogenic and multifactorial forms of diabetes are obvious candidates in this respect. In this study, we focussed on exons 8-10 of the HNF1A gene since rare, penetrant mutations in these exons (which are only transcribed in selected HNF1A isoforms are associated with a later age of diagnosis of Maturity onset diabetes of the young (MODY than mutations in exons 1-7. The age of diagnosis in the subgroup of HNF1A-MODY individuals with exon 8-10 mutations overlaps with that of early multifactorial T2D, and we set out to test the hypothesis that these exons might also harbour low-frequency coding variants of intermediate penetrance that contribute to risk of multifactorial T2D.We performed targeted capillary resequencing of HNF1A exons 8-10 in 591 European T2D subjects enriched for genetic aetiology on the basis of an early age of diagnosis ( or =1 affected sibling. PCR products were sequenced and compared to the published HNF1A sequence. We identified several variants (rs735396 [IVS9-24T>C], rs1169304 [IVS8+29T>C], c.1768+44C>T [IVS9+44C>T] and rs61953349 [c.1545G>A, p.T515T] but no novel non-synonymous coding variants were detected.We conclude that low frequency, nonsynonymous coding variants in the terminal exons of HNF1A are unlikely to contribute to T2D-susceptibility in European samples. Nevertheless, the rationale for seeking low-frequency causal variants in genes known to contain rare, penetrant mutations remains strong and should motivate efforts to screen other genes in a similar fashion.

  17. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  18. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    Science.gov (United States)

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  19. Susceptibility to experimental biliary atresia linked to different hepatic gene expression profiles in two mouse strains.

    Science.gov (United States)

    Leonhardt, Johannes; Kuebler, Joachim F; Turowski, Carmen; Tschernig, Thomas; Geffers, Robert; Petersen, Claus

    2010-02-01

    To compare hepatic gene expression during the development of experimental biliary atresia (BA) in two different mouse strains. Balb/c mice and C57Black/6 (Black/6) mice were infected with rhesus rotavirus (RRV) postpartum, clinical signs of BA and survival were noted. Liver sections were assessed for cluster of differentiation antigen (CD) 3, CD4 and CD8 expression, and the hepatic virus load was determined. Second, mice of both strains were sacrificed three days after infection. Isolated hepatic RNA was subjected to gene expression analysis using Affymetrix Gene Chip MOE 430 2.0. The incidence of BA was significantly lower in Black/6 mice compared to Balb/c mice (13.5% vs. 67%, P < 0.05). The mean virus titers were higher in mice with BA compared to mice without BA. Different gene profiles three days after virus infection were noted, with differential expression of 201 genes, including those regulating apoptosis, nucleic acid binding, transport function and particularly the immune response (chemokine C-C motif ligand 2, toll-like receptor 3, CD antigen 14, chemokine (C-X-C motif) ligands 10 and 11). This correlated with a significant increase of CD4 positive cells only in Balb/c mice with BA compared to healthy mice (13.5 vs. 5.0; P < 0.05). Black/6 mice did not exhibit any significant increase of CD3 or CD4 leukocytes despite cholestasis. The different susceptibility to experimental BA was associated with an increase of CD4 T-cells in the liver of Balb/c mice, which is linked to different gene profiles at the onset of bile duct obstruction.

  20. The methylenetetrahydrofolate reductase gene variant C677T influences susceptibility to migraine with aura

    Directory of Open Access Journals (Sweden)

    Sundholm James

    2004-02-01

    Full Text Available Abstract Background The C677T variant in the methylenetetrahydrofolate reductase (MTHFR gene is associated with increased levels of circulating homocysteine and is a mild risk factor for vascular disease. Migraine, with and without aura (MA and MO, is a prevalent and complex neurovascular disorder that may also be affected by genetically influenced hyperhomocysteinaemia. To determine whether the C677T variant in the MTHFR gene is associated with migraine susceptibility we utilised unrelated and family-based case-control study designs. Methods A total of 652 Caucasian migraine cases were investigated in this study. The MTHFR C677T variant was genotyped in 270 unrelated migraine cases and 270 controls as well as 382 affected subjects from 92 multiplex pedigrees. Results In the unrelated case-control sample we observed an over-representation of the 677T allele in migraine patients compared to controls, specifically for the MA subtype (40% vs. 33% (χ2 = 5.70, P = 0.017. The Armitage test for trend indicated a significant dosage effect of the risk allele (T for MA (χ2 = 5.72, P = 0.017. This linear trend was also present in the independent family-based sample (χ2 = 4.25, Padjusted = 0.039. Overall, our results indicate that the T/T genotype confers a modest, yet significant, increase in risk for the MA subtype (odds ratio: 2.0 – 2.5. No increased risk for the MO subtype was observed (P > 0.05. Conclusions In Caucasians, the C677T variant in the MTHFR gene influences susceptibility to MA, but not MO. Investigation into the enzyme activity of MTHFR and the role of homocysteine in the pathophysiology of migraine is warranted.

  1. Relationship Between LAPTM4B Gene Polymorphism and Susceptibility of Malignant Melanoma in Chinese Patients

    Directory of Open Access Journals (Sweden)

    Meng Zhang

    2014-10-01

    Full Text Available Lysosomal-associated protein transmembrane 4 beta (LAPTM4B is known as an oncogene associated with many human malignant tumors. There are two alleles of the gene, LAPTM4B*1 and LAPTM4B*2. Previous studies have shown that LAPTM4B polymorphism contributes to the risk of many cancers. This case-control study was to investigate the relationship between LAPTM4B gene polymorphism and susceptibility of malignant melanoma. The genotypes of LAPTM4B were determined in 617 control subjects and 220 patients with malignant melanoma by utilizing polymerase chain reaction based on specific primers. The genotypic distribution of LAPTM4B and Hardy–Weinberg equilibrium were analyzed by χ2 test. Odds ratio and 95% confidence interval was calculated by unconditional logistic regression. The distributions of LAPTM4B genotypes were significantly different between melanoma patients (45.9% for *1/1, 46.4% for *1/2 and 7.7 for *2/2 and controls (54.5% for *1/1, 39.9% for *1/2 and 5.7 for *2/2. LAPTM4B *1/2 and LAPTM4B *2/2 had a 1.396-fold and 1.619-fold higher risk for melanoma occurrence than *1/1, and subjects with LAPTM4B*2 have a 1.308-fold higher risk than LAPTM4B*1 carriers. No association between LAPTM4B genotypes and gender, age, subtype, Clark level of invasion, Breslow thickness, ulceration, clinical stage, and C-KIT, BRAF gene mutation status was observed. LAPTM4B*2 is associated with the high risk of malignant melanoma and carrying LAPTM4B *2 may be a susceptible factor to Chinese melanoma patients.

  2. Variants in toll-like receptor 9 gene influence susceptibility to tuberculosis in a Mexican population.

    Science.gov (United States)

    Torres-García, Diana; Cruz-Lagunas, Alfredo; García-Sancho Figueroa, Ma Cecilia; Fernández-Plata, Rosario; Baez-Saldaña, Renata; Mendoza-Milla, Criselda; Barquera, Rodrigo; Carrera-Eusebio, Aida; Ramírez-Bravo, Salomón; Campos, Lizeth; Angeles, Javier; Vargas-Alarcón, Gilberto; Granados, Julio; Gopal, Radha; Khader, Shabaana A; Yunis, Edmond J; Zuñiga, Joaquin

    2013-09-21

    The control of Mycobacterium tuberculosis (Mtb) infection begins with the recognition of mycobacterial structural components by toll like receptors (TLRs) and other pattern recognition receptors. Our objective was to determine the influence of TLRs polymorphisms in the susceptibility to develop tuberculosis (TB) in Amerindian individuals from a rural area of Oaxaca, Mexico with high TB incidence. We carried out a case-control association community based study, genotyping 12 polymorphisms of TLR2, TLR4, TLR6 and TLR9 genes in 90 patients with confirmed pulmonary TB and 90 unrelated exposed but asymptomatic household contacts. We found a significant increase in the frequency of the allele A of the TLR9 gene polymorphism rs352139 (A>G) in the group of TB patients (g.f. = 0.522) when compared with controls (g.f. = 0.383), (Pcorr = 0.01, OR = 1.75). Under the recessive model (A/G + A/A vs G/G) this polymorphism was also significantly associated with TB (Pcorr = 0.01, OR= 2.37). The association of the SNP rs352139 was statistically significant after adjustment by age, gender and comorbidities by regression logistic analysis (Dominant model: p value = 0.016, OR = 2.31; Additive model: p value = 0.023, OR = 1.68). The haplotype GAA of TLR9 SNPs was also associated with TB susceptibility (Pcorr = 0.02). Differences in the genotype or allele frequencies of TLR2, TLR4 and TLR6 polymorphisms between TB patients and healthy contacts were not detected. Our study suggests that the allele A of the intronic polymorphism rs352139 on TLR9 gene might contribute to the risk of developing TB in Mexican Amerindians.

  3. Variants in toll-like receptor 9 gene influence susceptibility to tuberculosis in a Mexican population

    Science.gov (United States)

    2013-01-01

    Background The control of Mycobacterium tuberculosis (Mtb) infection begins with the recognition of mycobacterial structural components by toll like receptors (TLRs) and other pattern recognition receptors. Our objective was to determine the influence of TLRs polymorphisms in the susceptibility to develop tuberculosis (TB) in Amerindian individuals from a rural area of Oaxaca, Mexico with high TB incidence. Methods We carried out a case–control association community based study, genotyping 12 polymorphisms of TLR2, TLR4, TLR6 and TLR9 genes in 90 patients with confirmed pulmonary TB and 90 unrelated exposed but asymptomatic household contacts. Results We found a significant increase in the frequency of the allele A of the TLR9 gene polymorphism rs352139 (A>G) in the group of TB patients (g.f. = 0.522) when compared with controls (g.f. = 0.383), (Pcorr = 0.01, OR = 1.75). Under the recessive model (A/G + A/A vs G/G) this polymorphism was also significantly associated with TB (Pcorr = 0.01, OR= 2.37). The association of the SNP rs352139 was statistically significant after adjustment by age, gender and comorbidities by regression logistic analysis (Dominant model: p value = 0.016, OR = 2.31; Additive model: p value = 0.023, OR = 1.68). The haplotype GAA of TLR9 SNPs was also associated with TB susceptibility (Pcorr = 0.02). Differences in the genotype or allele frequencies of TLR2, TLR4 and TLR6 polymorphisms between TB patients and healthy contacts were not detected. Conclusions Our study suggests that the allele A of the intronic polymorphism rs352139 on TLR9 gene might contribute to the risk of developing TB in Mexican Amerindians. PMID:24053111

  4. Association of common variants in mismatch repair genes and breast cancer susceptibility: a multigene study

    Directory of Open Access Journals (Sweden)

    Pina Julieta

    2009-09-01

    Full Text Available Abstract Background MMR is responsible for the repair of base-base mismatches and insertion/deletion loops. Besides this, MMR is also associated with an anti-recombination function, suppressing homologous recombination. Losses of heterozygosity and/or microsatellite instability have been detected in a large number of skin samples from breast cancer patients, suggesting a potential role of MMR in breast cancer susceptibility. Methods We carried out a hospital-based case-control study in a Caucasian Portuguese population (287 cases and 547 controls to estimate the susceptibility to non-familial breast cancer associated with some polymorphisms in mismatch repair genes (MSH3, MSH4, MSH6, MLH1, MLH3, PMS1 and MUTYH. Results Using unconditional logistic regression we found that MLH3 (L844P, G>A polymorphism GA (Leu/Pro and AA (Pro/Pro genotypes were associated with a decreased risk: OR = 0.65 (0.45-0.95 (p = 0.03 and OR = 0.62 (0.41-0.94 (p = 0.03, respectively. Analysis of two-way SNP interaction effects on breast cancer revealed two potential associations to breast cancer susceptibility: MSH3 Ala1045Thr/MSH6 Gly39Glu - AA/TC [OR = 0.43 (0.21-0.83, p = 0.01] associated with a decreased risk; and MSH4 Ala97Thr/MLH3 Leu844Pro - AG/AA [OR = 2.35 (1.23-4.49, p = 0.01], GG/AA [OR = 2.11 (1.12-3,98, p = 0.02], and GG/AG [adjusted OR = 1.88 (1.12-3.15, p = 0.02] all associated with an increased risk for breast cancer. Conclusion It is possible that some of these common variants in MMR genes contribute significantly to breast cancer susceptibility. However, further studies with a large sample size will be needed to support our results.

  5. Cancer Risks Associated with Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2

    Science.gov (United States)

    2016-05-01

    25 other candidate genes in the Fanconi anemia-BRCA pathway: ATR, BABAM1, BAP1, BLM, BRCC3, BRE, CHEK1, ERCC1, ERCC4 (FANCQ), FANCA , FANCB, FANCC...AWARD NUMBER: W81XWH-13-1-0484 TITLE: Cancer Risks Associated with Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and...DNA repair genes on small core biopsy specimens iv) begun accessioning samples from the phase 2 rucaparib trial (Ariel 2, NCT01891344). 15

  6. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  7. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  8. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  9. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  10. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  11. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  12. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  13. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  14. Association between genes encoding components of the IL-4/IL-4 receptor pathway and dermatitis in children.

    Science.gov (United States)

    Hussein, Yousri M; Shalaby, Sally M; Nassar, Amani; Alzahrani, Saad S; Alharbi, Ayman S; Nouh, Maha

    2014-07-25

    To determine whether IL-4, IL-4Rα and STAT6 polymorphisms are associated with susceptibility to dermatitis in Egyptian children. We genotyped three groups of children, consisting of 106 atopic dermatitis (AD) children, 95 non-AD children, and 100 of healthy controls, for IL-4 (-590 C/T), (-33 C/T), IL-4Rα (I50V), (Q576R) and STAT6 (2964 G/A), (2892 C/T) gene polymorphisms using PCR-RFLP assay. Total serum IgE and serum IL-4 levels were detected by ELISA. There was a non-significant association of IL-4 -590 C/T, -33 C/T polymorphisms in the children with non-AD or those with AD when compared with the controls. We identified a significant association between IL-4Rα I50V, Q576R polymorphisms and dermatitis susceptibility in AD (p=0.002, dermatitis was found. Patients who were carriers of IL4 -590C, IL-4Rα I50V G, STAT6 2964 A and STAT6 2892 T had an increased risk of AD [OR and 95% CI: 3.2 (2.5-4.2), p=0.005]. Furthermore, there was no relation between each polymorphism and serum IL-4 level (p>0.05 for each) while homozygosity for the risk alleles of IL-4, IL-4Rα and STAT6 SNPs were significantly associated with increased total IgE levels in all subjects. In Egyptian children, the IL-4Rα and the STAT6 polymorphism may play a role in susceptibility to AD. In addition, gene-gene interaction between the IL-4, the IL-4Rα and the STAT6 significantly increases an individual's susceptibility to AD. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  16. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  17. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  18. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  19. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  20. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  1. The Interaction of TXNIP and AFq1 Genes Increases the Susceptibility of Schizophrenia.

    Science.gov (United States)

    Su, Yousong; Ding, Wenhua; Xing, Mengjuan; Qi, Dake; Li, Zezhi; Cui, Donghong

    2017-08-01

    Although previous studies showed the reduced risk of cancer in patients with schizophrenia, whether patients with schizophrenia possess genetic factors that also contribute to tumor suppressor is still unknown. In the present study, based on our previous microarray data, we focused on the tumor suppressor genes TXNIP and AF1q, which differentially expressed in patients with schizophrenia. A total of 413 patients and 578 healthy controls were recruited. We found no significant differences in genotype, allele, or haplotype frequencies at the selected five single nucleotide polymorphisms (SNPs) (rs2236566 and rs7211 in TXNIP gene; rs10749659, rs2140709, and rs3738481 in AF1q gene) between patients with schizophrenia and controls. However, we found the association between the interaction of TXNIP and AF1q with schizophrenia by using the MDR method followed by traditional statistical analysis. The best gene-gene interaction model identified was a three-locus model TXNIP (rs2236566, rs7211)-AF1q (rs2140709). After traditional statistical analysis, we found the high-risk genotype combination was rs2236566 (GG)-rs7211(CC)-rs2140709(CC) (OR = 1.35 [1.03-1.76]). The low-risk genotype combination was rs2236566 (GT)-rs7211(CC)-rs2140709(CC) (OR = 0.67 [0.49-0.91]). Our finding suggested statistically significant role of interaction of TXNIP and AF1q polymorphisms (TXNIP-rs2236566, TXNIP-rs7211, and AF1q-rs2769605) in schizophrenia susceptibility.

  2. Epstein-Barr virus-induced gene 3 (EBI3) polymorphisms and expression are associated with susceptibility to pulmonary tuberculosis.

    Science.gov (United States)

    Zheng, Ruijuan; Liu, Haipeng; Song, Peng; Feng, Yonghong; Qin, Lianhua; Huang, Xiaochen; Chen, Jianxia; Yang, Hua; Liu, Zhonghua; Cui, Zhenglin; Hu, Zhongyi; Ge, Baoxue

    2015-07-01

    Tuberculosis (TB) remains a major global health problem and host genetic factors play a critical role in susceptibility and resistance to TB. The aim of this study was to identify novel candidate genes associated with TB susceptibility. We performed a population-based case-control study to genotype 13 tag SNPs spanning Epstein-Barr virus-induced gene 3 (EBI3), colony stimulating factor 2 (CSF2), IL-4, interferon beta 1 (IFNB1), chemokine (C-X-C motif) ligand 14 (CXCL14) and myeloid differentiation primary response gene 88 (Myd88) genes in 435 pulmonary TB patients and 375 health donors from China. We observed that EBI3 gene rs4740 polymorphism was associated with susceptibility to pulmonary tuberculosis (PTB) and the allele G was associated with a protective effect against PTB. Furthermore, EBI3 deficiency led to reduced bacterial burden and histopathological impairment in the lung of mice infected with Mycobacterium bovis BCG. Meanwhile, higher abundance of EBI3 was observed in the granuloma of PTB patients and in the lung tissue of BCG-infected mice. Of note, the expression of EBI3 in macrophages was remarkably induced by mycobacteria infection at both mRNA and protein level. In conclusion, EBI3 gene rs4740 polymorphism is closely associated with susceptibility to PTB and the elevation and enrichment of EBI3 in the lung which at least partially derived from macrophages may contribute to the exacerbation of mycobacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Structure models of G72, the product of a susceptibility gene to schizophrenia.

    Science.gov (United States)

    Kato, Yusuke; Fukui, Kiyoshi

    2017-02-01

    The G72 gene is one of the most susceptible genes to schizophrenia and is contained exclusively in the genomes of primates. The product of the G72 gene modulates the activity of D-amino acid oxidase (DAO) and is a small protein prone to aggregate, which hampers its structural studies. In addition, lack of a known structure of a homologue makes it difficult to use the homology modelling method for the prediction of the structure. Thus, we first developed a hybrid ab initio approach for small proteins prior to the prediction of the structure of G72. The approach uses three known ab initio algorithms. To evaluate the hybrid approach, we tested our prediction of the structure of the amino acid sequences whose structures were already solved and compared the predicted structures with the experimentally solved structures. Based on these comparisons, the average accuracy of our approach was calculated to be ∼5 Å. We then applied the approach to the sequence of G72 and successfully predicted the structures of the N- and C-terminal domains (ND and CD, respectively) of G72. The predicted structures of ND and CD were similar to membrane-bound proteins and adaptor proteins, respectively. © The Authors 2016. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  4. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  5. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  6. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  7. Microarray analysis of gene expression profiles of Schistosoma japonicum derived from less-susceptible host water buffalo and susceptible host goat.

    Directory of Open Access Journals (Sweden)

    Jianmei Yang

    Full Text Available BACKGROUND: Water buffalo and goats are natural hosts for S. japonicum in endemic areas of China. The susceptibility of these two hosts to schistosome infection is different, as water buffalo are less conducive to S. japonicum growth and development. To identify genes that may affect schistosome development and survival, we compared gene expression profiles of schistosomes derived from these two natural hosts using high-throughput microarray technology. RESULTS: The worm recovery rate was lower and the length and width of worms from water buffalo were smaller compared to those from goats following S. japonicum infection for 7 weeks. Besides obvious morphological difference between the schistosomes derived from the two hosts, differences were also observed by scanning and transmission electron microscopy. Microarray analysis showed differentially expressed gene patterns for parasites from the two hosts, which revealed that genes related to lipid and nucleotide metabolism, as well as protein folding, sorting, and degradation were upregulated, while others associated with signal transduction, endocrine function, development, immune function, endocytosis, and amino acid/carbohydrate/glycan metabolism were downregulated in schistosomes from water buffalo. KEGG pathway analysis deduced that the differentially expressed genes mainly involved lipid metabolism, the MAPK and ErbB signaling pathways, progesterone-mediated oocyte maturation, dorso-ventral axis formation, reproduction, and endocytosis, etc. CONCLUSION: The microarray gene analysis in schistosomes derived from water buffalo and goats provide a useful platform to disclose differences determining S. japonicum host compatibility to better understand the interplay between natural hosts and parasites, and identify schistosome target genes associated with susceptibility to screen vaccine candidates.

  8. Genome-scale examination of NBS-encoding genes in blueberry

    Science.gov (United States)

    Blueberry is an important crop worldwide. It is, however, susceptible to a variety of diseases, which can lead to losses in yield and fruit quality. Although screening studies have identified resistant germplasm for some important diseases, still little is known about the molecular basis underlying...

  9. Variant alleles of the CYP1B1 gene are associated with colorectal cancer susceptibility

    International Nuclear Information System (INIS)

    Trubicka, Joanna; Byrski, Tomasz; Gronwald, Jacek; Złowocka, Elżbieta; Kładny, Józef; Banaszkiewicz, Zbigniew; Wiśniowski, Rafał; Kowalska, Elżbieta; Lubinski, Jan; Scott, Rodney J; Grabowska-Kłujszo, Ewa; Suchy, Janina; Masojć, Bartłomiej; Serrano-Fernandez, Pablo; Kurzawski, Grzegorz; Cybulski, Cezary; Górski, Bohdan; Huzarski, Tomasz

    2010-01-01

    CYP1B1 is a P450 enzyme which is involved in the activation of pro-carcinogens to carcinogens as well as sex hormone metabolism. Because differences in the activity of the enzyme have been correlated with variant alleles of single nucleotide polymorphisms (SNPs), it represents an attractive candidate gene for studies into colorectal cancer susceptibility. We genotyped 597 cancer patients and 597controls for three CYP1B1 SNPs, which have previously been shown to be associated with altered enzymatic activity. Using the three SNPs, eight different haplotypes were constructed. The haplotype frequencies were estimated in cases and controls and then compared. The odds ratio for each tumour type, associated with each haplotype was estimated, with reference to the most common haplotype observed in the controls. The three SNPs rs10012, rs1056827 and rs1056836 alone did not provide any significant evidence of association with colorectal cancer risk. Haplotypes of rs1056827 and rs10012 or rs1056827 and rs1056836 revealed an association with colorectal cancer which was significantly stronger in the homozygous carriers. One haplotype was under represented in the colorectal cancer patient group compared to the control population suggesting a protective effect. Genetic variants within the CYP1B1 that are associated with altered function appear to influence susceptibility to a colorectal cancer in Poland. Three haplotypes were associated with altered cancer risk; one conferred protection and two were associated with an increased risk of disease. These observations should be confirmed in other populations

  10. Search of type 2 diabetes susceptibility gene on chromosome 20q

    International Nuclear Information System (INIS)

    Takeuchi, F.; Yanai, K.; Inomata, H.; Kuzuya, N.; Kajio, H.; Honjo, S.; Takeda, N.; Kaburagi, Y.; Yasuda, K.; Shirasawa, S.; Sasazuki, T.; Kato, N.

    2007-01-01

    Significant evidence of linkage to type 2 diabetes (T2D) has been shown in a relatively broad region on chromosome 20q, where the hepatocyte nuclear factor-4α (HNF4A) has been noted as a positional candidate. To systematically evaluate genetic susceptibility to T2D in the relevant region, we examined the disease association by using 1145 SNPs in two-step screening in the Japanese population. The marker screening enabled us to identify significant disease association in the lipopolysaccharide binding protein (LBP) but not in the HNF4A locus. In a 17.7-Mb interval screened, the strongest association was identified for a SNP, rs2232592, located in the intron of LBP, with an estimated odds ratio of 1.73 (95% CI 1.30-2.31) (P 0.0002) in the whole study panel involving 675 case and 474 control subjects. Our data suggest that the LBP gene may confer genetic susceptibility to T2D and this warrants further replication study

  11. Polymorphism of Gene and Association with Susceptibility to Digestive Disorders in Rabbit

    Directory of Open Access Journals (Sweden)

    Yu Yang

    2013-04-01

    Full Text Available NLR family pyrin domain containing 3 (NLRP3 is a key component of the inflammasome, whose assembly is a crucial part of the innate immune response. The aim of the present study was to evaluate the association between exon 3 polymorphisms of NLRP3 and the susceptibility to digestive disorders in rabbits. In total, five coding single-nucleotide polymorphisms (cSNPs were identified; all of which are synonymous. Among them, c.456 C> and c.594 G> were further genotyped for association analysis based on case-control design (n =162 vs n =102. Meanwhile, growing rabbits were experimentally induced to digestive disorders by feeding a fiber-deficient diet, subsequently they were subjected to mRNA expression analysis. Association analysis revealed that haplotype H1 (the two cSNPs: GT played a potential protective role against digestive disorders (p<0.001. The expression of NLRP3 in the group H1HX1 (H1HX1 is composed of H1H1, H1H3 and H1H4 was the lowest among four groups which were classified by different types of diplotypes. Those results suggested that the NLRP3 gene was significantly associated with susceptibility to digestive disorders in rabbit.

  12. Mutations in BRCA1, BRCA2 and other breast and ovarian cancer susceptibility genes in Central and South American populations.

    Science.gov (United States)

    Jara, Lilian; Morales, Sebastian; de Mayo, Tomas; Gonzalez-Hormazabal, Patricio; Carrasco, Valentina; Godoy, Raul

    2017-10-06

    Breast cancer (BC) is the most common malignancy among women worldwide. A major advance in the understanding of the genetic etiology of BC was the discovery of BRCA1 and BRCA2 (BRCA1/2) genes, which are considered high-penetrance BC genes. In non-carriers of BRCA1/2 mutations, disease susceptibility may be explained of a small number of mutations in BRCA1/2 and a much higher proportion of mutations in ethnicity-specific moderate- and/or low-penetrance genes. In Central and South American populations, studied have focused on analyzing the distribution and prevalence of BRCA1/2 mutations and other susceptibility genes that are scarce in Latin America as compared to North America, Europe, Australia, and Israel. Thus, the aim of this review is to present the current state of knowledge regarding pathogenic BRCA variants and other BC susceptibility genes. We conducted a comprehensive review of 47 studies from 12 countries in Central and South America published between 2002 and 2017 reporting the prevalence and/or spectrum of mutations and pathogenic variants in BRCA1/2 and other BC susceptibility genes. The studies on BRCA1/2 mutations screened a total of 5956 individuals, and studies on susceptibility genes analyzed a combined sample size of 11,578 individuals. To date, a total of 190 different BRCA1/2 pathogenic mutations in Central and South American populations have been reported in the literature. Pathogenic mutations or variants that increase BC risk have been reported in the following genes or genomic regions: ATM, BARD1, CHECK2, FGFR2, GSTM1, MAP3K1, MTHFR, PALB2, RAD51, TOX3, TP53, XRCC1, and 2q35.

  13. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  14. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  15. Genome-wide linkage scan for colorectal cancer susceptibility genes supports linkage to chromosome 3q

    Directory of Open Access Journals (Sweden)

    Velculescu Victor E

    2008-04-01

    Full Text Available Abstract Background Colorectal cancer is one of the most common causes of cancer-related mortality. The disease is clinically and genetically heterogeneous though a strong hereditary component has been identified. However, only a small proportion of the inherited susceptibility can be ascribed to dominant syndromes, such as Hereditary Non-Polyposis Colorectal Cancer (HNPCC or Familial Adenomatous Polyposis (FAP. In an attempt to identify novel colorectal cancer predisposing genes, we have performed a genome-wide linkage analysis in 30 Swedish non-FAP/non-HNPCC families with a strong family history of colorectal cancer. Methods Statistical analysis was performed using multipoint parametric and nonparametric linkage. Results Parametric analysis under the assumption of locus homogeneity excluded any common susceptibility regions harbouring a predisposing gene for colorectal cancer. However, several loci on chromosomes 2q, 3q, 6q, and 7q with suggestive linkage were detected in the parametric analysis under the assumption of locus heterogeneity as well as in the nonparametric analysis. Among these loci, the locus on chromosome 3q21.1-q26.2 was the most consistent finding providing positive results in both parametric and nonparametric analyses Heterogeneity LOD score (HLOD = 1.90, alpha = 0.45, Non-Parametric LOD score (NPL = 2.1. Conclusion The strongest evidence of linkage was seen for the region on chromosome 3. Interestingly, the same region has recently been reported as the most significant finding in a genome-wide analysis performed with SNP arrays; thus our results independently support the finding on chromosome 3q.

  16. Associations between CD36 gene polymorphisms and susceptibility to coronary artery heart disease

    International Nuclear Information System (INIS)

    Zhang, Y.; Ling, Z.Y.; Deng, S.B.; Du, H.A.; Yin, Y.H.; Yuan, J.; She, Q.; Chen, Y.Q.

    2014-01-01

    Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD

  17. Endostatin gene variation and protein levels in breast cancer susceptibility and severity

    International Nuclear Information System (INIS)

    Balasubramanian, Sabapathy P; Cross, Simon S; Globe, Jenny; Cox, Angela; Brown, Nicola J; Reed, Malcolm W

    2007-01-01

    Endostatin is a potent endogenous anti-angiogenic agent which inhibits tumour growth. A non-synonymous coding polymorphism in the Endostatin gene is thought to affect Endostatin activity. We aimed to determine the role of this Endostatin polymorphism in breast cancer pathogenesis and any influence on serum Endostatin levels in healthy volunteers. Endostatin protein expression on a breast cancer micro array was also studied to determine any relationship to genotype and to breast cancer prognosis. The 4349G > A (coding non-synonymous) polymorphism in exon 42 of the Endostatin gene was genotyped in approximately 846 breast cancer cases and 707 appropriate controls. In a separate healthy cohort of 57 individuals, in addition to genotyping, serum Endostatin levels were measured using enzyme linked immunosorbant assay (ELISA). A semi-quantitative assessment of Endostatin protein expression on immunostained tissue micro arrays (TMA) constructed from breast cancer samples of patients with genotype data was performed. The rare allele (A) was significantly associated with invasive breast cancers compared to non-invasive tumours (p = 0.03), but there was no association with tumour grade, nodal status, vascular invasion or overall survival. There was no association with breast cancer susceptibility. Serum Endostatin levels and Endostatin protein expression on the tissue micro array were not associated with genotype. The Endostatin 4349A allele is associated with invasive breast cancer. The Endostatin 4349G > A polymorphism however does not appear to be associated with breast cancer susceptibility or severity in invasive disease. By studying circulating levels and tumour Endostatin protein expression, we have shown that any influence of this polymorphism is unlikely to be through an effect on the levels of protein produced

  18. Associations between CD36 gene polymorphisms and susceptibility to coronary artery heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.; Ling, Z.Y.; Deng, S.B.; Du, H.A.; Yin, Y.H.; Yuan, J.; She, Q.; Chen, Y.Q. [Department of Cardiology, The Second Affiliated Hospital, Chongqing Medical University, Chongqing (China)

    2014-08-08

    Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

  19. Introgression of ivermectin resistance genes into a susceptible Haemonchus contortus strain by multiple backcrossing.

    Directory of Open Access Journals (Sweden)

    Elizabeth Redman

    2012-02-01

    Full Text Available Anthelmintic drug resistance in livestock parasites is already widespread and in recent years there has been an increasing level of anthelmintic drug selection pressure applied to parasitic nematode populations in humans leading to concerns regarding the emergence of resistance. However, most parasitic nematodes, particularly those of humans, are difficult experimental subjects making mechanistic studies of drug resistance extremely difficult. The small ruminant parasitic nematode Haemonchus contortus is a more amenable model system to study many aspects of parasite biology and investigate the basic mechanisms and genetics of anthelmintic drug resistance. Here we report the successful introgression of ivermectin resistance genes from two independent ivermectin resistant strains, MHco4(WRS and MHco10(CAVR, into the susceptible genome reference strain MHco3(ISE using a backcrossing approach. A panel of microsatellite markers were used to monitor the procedure. We demonstrated that after four rounds of backcrossing, worms that were phenotypically resistant to ivermectin had a similar genetic background to the susceptible reference strain based on the bulk genotyping with 18 microsatellite loci and individual genotyping with a sub-panel of 9 microsatellite loci. In addition, a single marker, Hcms8a20, showed evidence of genetic linkage to an ivermectin resistance-conferring locus providing a starting point for more detailed studies of this genomic region to identify the causal mutation(s. This work presents a novel genetic approach to study anthelmintic resistance and provides a "proof-of-concept" of the use of forward genetics in an important model strongylid parasite of relevance to human hookworms. The resulting strains provide valuable resources for candidate gene studies, whole genome approaches and for further genetic analysis to identify ivermectin resistance loci.

  20. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    DEFF Research Database (Denmark)

    hart, Leen M; Hansen, Torben; Rietveld, Ingrid

    2005-01-01

    Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... in the Netherlands and Denmark. A -109 g/a variant was not associated with type 2 diabetes. Allele frequencies for the other variant, H324Q, were 3.5% in type 2 diabetic and 2.7% in control subjects, respectively. The common odds ratio across all four studies was 1.40 (95% CI 1.12-1.76), P = 0.004. There were...

  1. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  2. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  3. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  5. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  6. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  7. HLA non-class II genes may confer type I diabetes susceptibility in a Mapuche (Amerindian) affected family.

    Science.gov (United States)

    Pérez-Bravo, Francisco; Martinez-Laso, Jorge; Martin-Villa, Jose M; Moscoso, Juan; Moreno, Almudena; Serrano-Vela, Juan I; Zamora, Jorge; Asenjo, Silvia; Gleisner, Andrea; Arnaiz-Villena, Antonio

    2006-01-01

    A rare case of type I diabetes is studied in an Amerindian (Mapuche) family from Chile, analyzing glutamic acid decarboxylase, islet-cell autoantibodies and human leukocyte antigen (HLA) genes. The affected sib is the only one that has one specific HLA haplotype combination that differs from the other sibs only in the HLA class I genes. It is concluded that HLA diabetes susceptibility factors may be placed outside the class II region or even that susceptibility factors do not exist in the HLA region in this Amerindian family.

  8. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  9. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  11. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  12. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.

    2002-01-01

    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  13. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  14. The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus.

    Science.gov (United States)

    Davison, L J; Holder, A; Catchpole, B; O'Callaghan, C A

    2017-03-01

    Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. To characterize the POMC deletion in Labrador retrievers, to develop a simple genetic test for this mutation, and to test the hypothesis that the POMC gene deletion is associated with an increased risk of DM in this breed. Sixty-one non-diabetic Labrador retrievers aged >6 years and 57 Labrador retrievers with DM. Case-control genotyping study to compare the frequency of the POMC deletion in dogs with and without DM. After polymerase chain reaction (PCR) and sequencing to characterize the mutation, a PCR-based test was developed and validated using 2 different restriction fragment length polymorphism assays. A 14-base-pair deletion was confirmed and localized to exon 3 of the canine POMC gene. A PCR-based test for the deletion was successfully developed. There was no association between the presence of the POMC deletion mutation and DM in this population of Labrador retriever dogs (P = .31). This study adds to the existing scientific literature indicating that there is little evidence for a direct link between obesity and DM in dogs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  15. Genetic variations of MMP9 gene and intracerebral hemorrhage susceptibility: a case-control study in Chinese Han population.

    Science.gov (United States)

    Yang, Jie; Wu, Bo; Lin, Sen; Zhou, Junshan; Li, Yingbin; Dong, Wei; Arima, Hisatomi; Zhang, Chanfei; Liu, Yukai; Liu, Ming

    2014-06-15

    To investigate the association between genetic variations of matrix metalloproteinase 9 (MMP9) gene and intracerebral hemorrhage (ICH) susceptibility in Chinese Han population. The clinical data and peripheral blood samples from the patients with ICH and hypertension, and controlled subjects with hypertension only, were collected. MassARRAY Analyzer was used to genotype the tagger single nucleotide polymorphism (SNP) of MMP9 gene. Haploview4.2 and Unphased3.1.7 were employed to construct haplotypes and to analyze the association between genetic variations (alleles, genotypes and haplotypes) of MMP9 gene and ICH susceptibility. 181 patients with ICH and hypertension, and 197 patients with hypertension only, were recruited between Sep 2009 and Oct 2010. Patients in the ICH group were younger (61.80 ± 13.27 vs. 72.44 ± 12.71 years, ppopulation. Our logistical regression analysis showed that there were no significant associations between genetic variations of the MPP9 gene and ICH susceptibility (all p>0.05). The genetic variations of MMP9 gene were not significantly associated with ICH susceptibility in the Chinese Han population. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Association of vitamin D receptor BsmI (rs1544410) gene polymorphism with the chronic kidney disease susceptibility.

    Science.gov (United States)

    Zhou, Tian-Biao; Jiang, Zong-Pei; Huang, Miao-Fang

    2015-02-01

    Association of vitamin D receptor (VDR) BsmI (rs1544410) gene polymorphism with the chronic kidney disease (CKD) susceptibility from the published reports are still conflicting. This meta-analysis was performed to evaluate the relationship between VDR BsmI (rs1544410) gene polymorphism and the risk of CKD. The association studies were identified from PubMed, Cochrane Library and China Biological Medicine Database on 1 March 2014, and eligible investigations were included and synthesized using meta-analysis method. Nine reports were recruited into this meta-analysis for the association of VDR BsmI gene polymorphism with CKD susceptibility. In this meta-analysis for overall populations, the BsmI B allele BB genotype and bb genotype were not associated with the risk of CKD (B allele: OR = 1.12, 95% CI: 0.88-1.44, p = 0.36; BB genotype: OR = 1.15, 95% CI: 0.81-1.62, p = 0.43; bb genotype: OR = 0.86, 95% CI: 0.61-1.20, p = 0.36). Furthermore, VDR BsmI gene polymorphism was not associated with CKD susceptibility in Asians and in Caucasians. In conclusion, the BsmI gene polymorphism was not associated with CKD susceptibility in overall populations, in Asians and in Caucasians. However, more studies should be conducted to confirm it.

  17. Fluxomic evidence for impaired contribution of short-chain acyl-CoA dehydrogenase to mitochondrial palmitate β-oxidation in symptomatic patients with ACADS gene susceptibility variants.

    Science.gov (United States)

    Dessein, Anne-Frédérique; Fontaine, Monique; Joncquel-Chevalier Curt, Marie; Briand, Gilbert; Sechter, Claire; Mention-Mulliez, Karine; Dobbelaere, Dries; Douillard, Claire; Lacour, Arnaud; Redonnet-Vernhet, Isabelle; Lamireau, Delphine; Barth, Magalie; Minot-Myhié, Marie-Christine; Kuster, Alice; de Lonlay, Pascale; Gregersen, Niels; Acquaviva, Cécile; Vianey-Saban, Christine; Vamecq, Joseph

    2017-08-01

    Despite ACADS (acyl-CoA dehydrogenase, short-chain) gene susceptibility variants (c.511C>T and c.625G>A) are considered to be non-pathogenic, encoded proteins are known to exhibit altered kinetics. Whether or not, they might affect overall fatty acid β-oxidation still remains, however, unclear. De novo biosynthesis of acylcarnitines by whole blood samples incubated with deuterated palmitate (16- 2 H 3 ,15- 2 H 2 -palmitate) is suitable as a fluxomic exploration to distinguish between normal and disrupted β-oxidation, abnormal profiles and ratios of acylcarnitines with different chain-lengths being indicative of the site for enzymatic blockade. Determinations in 301 control subjects of ratios between deuterated butyrylcarnitine and sum of deuterated C2 to C14 acylcarnitines served here as reference values to state specifically functional SCAD impairment in patients addressed for clinical and/or biological suspicion of a β-oxidation disorder. Functional SCAD impairment was found in 39 patients. The 27 patients accepting subsequent gene studies were all positive for ACADS mutations. Twenty-six of 27 patients were positive for c.625G>A variant. Twenty-three of 27 patients harbored susceptibility variants as sole ACADS alterations (18 homozygous and 3 heterozygous for c.625G>A, 2 compound heterozygous for c.625G>A/c.511C>T). Our present fluxomic assessment of SCAD suggests a link between ACADS susceptibility variants and abnormal β-oxidation consistent with known altered kinetics of these variants. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.

    1989-01-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  19. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  20. Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

    Directory of Open Access Journals (Sweden)

    Laura Mejía-Teniente

    2015-11-01

    Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  1. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

    Science.gov (United States)

    Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

    2015-11-25

    Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  2. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by dec