BCL2 genotypes and prostate cancer survival
Energy Technology Data Exchange (ETDEWEB)
Renner, Wilfried [Medical University of Graz, Clinical Institute of Medical and Chemical Laboratory Diagnostics, Graz (Austria); Langsenlehner, Uwe [GKK Outpatient Department, Division of Internal Medicine, Graz (Austria); Krenn-Pilko, Sabine; Langsenlehner, Tanja [Medical University of Graz, Department of Therapeutic Radiology and Oncology, Graz (Austria); Eder, Petra [University Hospital Wuerzburg, Department of Internal Medicine I, Wuerzburg (Germany)
2017-06-15
The antiapoptotic B-cell lymphoma 2 (BCL2) gene is a key player in cancer development and progression. A functional single-nucleotide polymorphism (c.-938C>A, rs2279115) in the inhibitory P2 BCL2 gene promoter has been associated with clinical outcomes in various types of cancer. Aim of the present study was to analyze the role of BCL2-938C>A genotypes in prostate cancer mortality. The association between BCL2-938C>A (rs2279115) genotypes and prostate cancer outcome was studied within the prospective PROCAGENE study comprising 702 prostate cancer patients. During a median follow-up time of 92 months, 120 (17.1%) patients died. A univariate Cox regression model showed a significant association of the CC genotype with reduced cancer-specific survival (CSS; hazard ratio, HR, 2.13, 95% confidence interval, CI, 1.10-4.12; p = 0.024) and overall survival (OS; HR 2.34, 95% CI 1.58-3.47; p < 0.001). In a multivariate Cox regression model including age at diagnosis, risk group, and androgen deprivation therapy, the CC genotype remained a significant predictor of poor CSS (HR 2.05, 95% CI 1.05-3.99; p = 0.034) and OS (HR 2.25, 95% CI 1.51-3.36; p < 0.001). This study provides evidence that the homozygous BCL2-938 CC genotype is associated with OS and C in prostate cancer patients. (orig.) [German] Das antiapoptotische Gen B cell lymphoma 2 (BCL2) spielt eine Schluesselrolle in der Entstehung und Progression von Krebserkrankungen. Ein funktioneller Einzelnukleotid-Polymorphismus (c.-938C>A, rs2279115) im inhibitorischen P2-BCL2-Promotor wurde mit dem klinischen Outcome verschiedener Krebserkrankungen verknuepft. Ziel der vorliegenden Studie war die Untersuchung der Rolle von BCL2-938C>A-Genotypen fuer die Mortalitaet bei Patienten mit Prostatakarzinom. Der Zusammenhang zwischen BCL2-938C>A-Genotypen (rs2279115) und dem Outcome bei Prostatakrebs wurde in der prospektiven PROCAGENE-Studie, die 702 Patienten mit Prostatakarzinom umfasste, untersucht. Waehrend der medianen
Yin, W J; Zhu, X; Yang, H Y; Sun, W Y; Wu, M J
2018-01-08
Objective: To investigate the impact of clinicopathological features, gene rearrangements and protein expression of bcl-6, bcl-2, C-MYC and chemotherapy regime on the prognosis of patients with primary central nervous system diffuse large B-cell lymphoma (PCNS-DLBCL). Methods: Thirty-three cases of PCNS-DLBCL diagnosed from January 2006 to December 2016 at Zhejiang Cancer Hospital were collected. The expression of CD10, bcl-6, bcl-2, MUM1 and MYC were detected by immunohistochemical staining (IHC). The presence of EB virus was detected by in situ hybridization(EBER). Copy number variation (ICN) and translocation status of bcl-6, bcl-2 and C-MYC genes were detected by fluorescence in situ hybridization (FISH). The relationship between the above indexes and the prognosis was analyzed by univariate, bivariate survival analysis and multiple Cox hazard regression analysis. Results: The study included 33 patients of PCNS-DLBCL, without evidence of primary or secondary immunodeficient disease. Male to female ratio was 1.36∶1.00, and the average age was 56 years. Twenty cases had single lesion while 13 had multiple lesions. Deep brain involvement was seen in 12 cases. All patients underwent partial or total tumor resection. Five patients received whole brain post-surgery radiotherapy, nine patients received high-dose methotrexate (HD-MTX) based chemotherapy, and 12 patients received whole-brain radiotherapy combined with HD-MTX based chemotherapy. Severn patients received no further treatment and rituximab was used in 8 patients. According to the Hans model, 27 cases were classified as non-GCB subtypes (81.8%). Bcl-2 was positive in 25 cases (75.8%, 25/33) and highly expressed in 8 (24.2%). MYC was positive in 12 cases (36.4%) and double expression of bcl-2 and MYC was seen in 6 cases. EBER positive rate was 10.0%(3/30), all of which had multiple lesions. Two bcl-6 gene translocations and 3 amplifications were found in 28 patients. Two translocations, 3 ICN or with both
International Nuclear Information System (INIS)
Tsuyama, Naohiro; Danjoh, Inaho; Otsuyama, Ken-ichiro; Obata, Masanori; Tahara, Hidetoshi; Ohta, Tsutomu; Ishikawa, Hideaki
2005-01-01
IL-6 is a growth and survival factor for myeloma cells, although the mechanism by which it induces myeloma cell proliferation through gene expression is largely unknown. Microarray analysis showed that some B-cell lymphoma-associated oncogenes such as Bcl6, which is absent in normal plasma cells, were upregulated by IL-6 in IL-6-dependent myeloma cell lines. We found that Bcl6 variant 2 was upregulated by STAT3. ChIP assay and EMSA showed that STAT3 bound to the upstream region of variant 2 DNA. Expression of p53, a direct target gene of Bcl6, was downregulated in the IL-6-stimulated cells, and this process was impaired by an HDAC inhibitor. Bcl6 was knocked down by introducing small hairpin RNA, resulting in decreased proliferation and increased sensitivity to a DNA damaging agent. Thus, STAT3-inducible Bcl6 variant 2 appears to generate an important IL-6 signal that supports proliferation and survival of IL-6-dependent myeloma cells
Lehnerdt, G F; Franz, P; Bankfalvi, A; Grehl, S; Kelava, A; Nückel, H; Lang, S; Schmid, K W; Siffert, W; Bachmann, H S
2009-06-01
Expression of the antiapoptotic and antiproliferative protein B-cell lymphoma 2 (Bcl-2) has been repeatedly shown to be associated with better locoregional control and patients' survival in oropharyngeal squamous cell carcinoma (OSCC). A regulatory (-938C>A) single-nucleotide polymorphism (SNP) in the inhibitory P2 BCL2 gene promoter generates significantly different BCL2 promoter activities and has been associated with outcome in different malignancies. The aim of the present study was to analyze the possible influence of the (-938C>A) SNP on survival of patients suffering from OSCC. One hundred and thirty-three patients with primary OSCC were retrospectively investigated. Bcl-2 expression of tumor cells was demonstrated by means of immunohistochemistry. Both the Bcl-2 expression and the (-938C>A) genotypes were correlated with the patients' survival. The (-938C>A) SNP was significantly related to Bcl-2 expression (P = 0.008). Kaplan-Meier curves revealed a significant association of the -938 SNP with relapse-free (P = 0.0283) and overall survival (P = 0.0247). Multiple Cox regression identified the BCL2 (-938CC) genotype as an independent prognostic factor for relapse [hazard ratio (HR) 1.898, P = 0.021] as well as for death in OSCC patients (HR 1.897, P = 0.013). The (-938C>A) SNP represents a potential novel prognostic marker in patients with OSCC that could help to identify a group of patients at high risk for relapse and death.
DEFF Research Database (Denmark)
Karlsson, Richard; Engström, Maria; Jönsson, Maria
2003-01-01
Cytokines such as interleukin 3 (IL-3), kit ligand (KL), and flt3 ligand (FL) promote survival of hematopoietic stem cells and myeloid progenitor cells. In many cell types, members of the Bcl-2 gene family are major regulators of survival, but the mediating mechanisms are not fully understood....... Using two myeloid progenitor cell lines, FDCP-mix and FDC-P1, as well as primary mouse bone marrow progenitors, we demonstrate that KL-mediated survival is dependent on the activation of phosphatidylinositol-3 (PI-3) kinase. The inhibitor LY294002 was able to completely abolish survival mediated by KL...
Directory of Open Access Journals (Sweden)
Michaela Waibel
2013-11-01
Full Text Available To design rational therapies for JAK2-driven hematological malignancies, we functionally dissected the key survival pathways downstream of hyperactive JAK2. In tumors driven by mutant JAK2, Stat1, Stat3, Stat5, and the Pi3k and Mek/Erk pathways were constitutively active, and gene expression profiling of TEL-JAK2 T-ALL cells revealed the upregulation of prosurvival Bcl-2 family genes. Combining the Bcl-2/Bcl-xL inhibitor ABT-737 with JAK2 inhibitors mediated prolonged disease regressions and cures in mice bearing primary human and mouse JAK2 mutant tumors. Moreover, combined targeting of JAK2 and Bcl-2/Bcl-xL was able to circumvent and overcome acquired resistance to single-agent JAK2 inhibitor treatment. Thus, inhibiting the oncogenic JAK2 signaling network at two nodal points, at the initiating stage (JAK2 and the effector stage (Bcl-2/Bcl-xL, is highly effective and provides a clearly superior therapeutic benefit than targeting just one node. Therefore, we have defined a potentially curative treatment for hematological malignancies expressing constitutively active JAK2.
Akyurek, Nalan; Uner, Aysegul; Benekli, Mustafa; Barista, Ibrahim
2012-09-01
Diffuse large B-cell lymphomas (DLBCLs) are a biologically heterogeneous group in which various gene alterations have been reported. The aim of this study was to investigate the frequency and prognostic impact of BCL2, BCL6, and MYC rearrangements in cyclophosphamide, doxorubicin, vincristine, and prednisone plus rituximab (R-CHOP)-treated DLBCL cases. Tissue microarrays were constructed from 239 cases of DLBCL, and the expressions of CD10, BCL6, MUM1/IRF4, and BCL2 were evaluated by immunohistochemistry. MYC, BCL2, and BCL6 rearrangements were investigated by interphase fluorescence in situ hybridization on tissue microarrays. Survival analysis was constructed from 145 R-CHOP-treated patients. MYC, BCL2, and BCL6 rearrangements were detected in 14 (6%), 36 (15%), and 69 (29%) of 239 DLBCL patients. Double or triple rearrangements were detected in 7 (3%) of 239 DLBCL cases. Of these, 4 had BCL2 and MYC, 2 had BCL6 and MYC, and 1 had BCL2, BCL6, and MYC rearrangements. The prognosis of these cases was extremely poor, with a median survival of 9 months. MYC rearrangement was associated with significantly worse overall survival (P = .01), especially for the cases with GC phenotype (P = .009). BCL6 rearrangement also predicted significantly shorter overall survival (P = .04), especially for the non-GC phenotype (P = .03). BCL2 rearrangement had no prognostic impact on outcome. International Prognostic Index (P = .004) and MYC rearrangement (P = .009) were independent poor prognostic factors. Analysis of MYC gene rearrangement along with BCL2 and BCL6 is critical in identifying high-risk patients with poor prognosis. Copyright © 2011 American Cancer Society.
Bcl-2 Protein Expression in Egyptian Acute Myeloid Leukemia
International Nuclear Information System (INIS)
El-Shakankiry, N.; El-Sayed, Gh.M.M.; El-Maghraby, Sh.; Moneer, M.M.
2009-01-01
Objective: The primary cause of treatment failure in acute myeloid leukemia (AML) is the emergence of both resistant disease and early relapse. The bcl-2 gene encodes a 26-kDa protein that promotes cell survival by blocking programmed cell death (apoptosis). In the present study, bcl-2 protein expression was evaluated in newly diagnosed AML patients and correlated with the induction of remission and overall survival (OS), in an attempt to define patients who might benefit from modified therapeutic strategies. Patients and methods: Pretreatment cellular bcl-2 protein expression was measured in bone marrow samples obtained from 68 patients of newly diagnosed acute myeloid leukemia and 10 healthy controls by western blotting. Results: The mean bcl-2 protein expression was significantly higher in patients (0.68610.592) compared to controls (0.313±0.016) (p=0.002). The overall survival for patients with mean bcl-2 expression of less, and more than or equal to 0.315, was 67% and 56%, respectively, with no significant difference between the two groups 0»=0.86). Conclusion: Even though we did not observe a significant difference in overall survival between patients with high and low levels of bcl-2, modulation of this protein might still be considered as an option for enhancing the effectiveness of conventional chemotherapy.
International Nuclear Information System (INIS)
Hwang, Jun-Hwa; Lim, Sung-Chul; Kim, Young-Chul; Park, Kyung-Ok; Ahn, Sung-Ja; Chung, Woong-Ki
2001-01-01
Objectives: We assessed the role of apoptosis and the expression of bcl-2, p53, and c-myc oncoproteins in pretreatment histologic specimens as a predictor of response to radiation therapy and survival in non-small-cell lung cancer (NSCLC) patients. Methods: Pretreatment biopsy specimens of 68 patients with NSCLC (62 squamous cell carcinoma, 6 adenocarcinoma) were stained with hematoxylin and eosin. From 5 high-powered fields, the apoptotic index (AI) was calculated as the ratio of apoptotic tumor cells to the total number of tumor cells. Bcl-2, p53, and c-myc oncoprotein expression was detected by immunohistochemical staining. Results: Twenty-nine cases showed partial or complete remission, whereas 39 showed no response. AI ranged from 0.2 to 12.0% (mean ± SD; 4.3±2.6%, median 4.0%). There was no difference in AI between responders (4.0±2.3) and nonresponders (4.5±2.8, p>0.05). However, in the responders, AI was correlated with the degree of change in tumor volume (r=0.41, p<0.05). In an analysis of 53 subjects who survived more than 1 month after the completion of radiation therapy, the patients with a higher AI (n=27, MST=22.8 m) survived longer than those with a lower AI (n=26, MST=9.2, log-rank, p=0.03). Patients expressing bcl-2 had poorer survival (n=22, MST=6.0 m) than patients without bcl-2 (n=31, 22.8 m, p<0.003). According to multivariate analysis, three variables, bcl-2 expression, AI, and response to radiation, were independent prognostic factors for survival. Conclusion: A low level of spontaneous apoptosis and expression of apoptosis blocking bcl-2 protein in pretreatment histology predict a poor prognosis for radiation-treated NSCLC patients
Javid, J; Mir, R; Mirza, M; Imtiyaz, A; Prasant, Y; Mariyam, Z; Julka, P K; Mohan, A; Lone, M; Ray, P C; Saxena, A
2015-04-01
B cell lymphoma 2 (BCL-2) gene is a well-known regulator of apoptosis and a key element in cancer development and progression. A regulatory (-938C>A, rs2279115) single-nucleotide polymorphism in the inhibitory P2 BCL-2 gene promoter generates significantly different BCL-2 promoter activities and has been associated with different clinical outcomes in various malignancies. The aim of the present study was to analyze the possible influence of the (-938C>A) SNP on the risk and survival of Indian patients suffering from NSCLC. A hospital-based case-control study of 155 age- and sex-matched patients diagnosed with NSCLC and 155 cancer-free controls was conducted and genotyped by performing PIRA-PCR to elucidate the putative association between clinical outcome and genotypes of BCL-2 (-938C>A, rs2279115). The association of the polymorphism with the survival of NSCLC patients was analyzed by Kaplan-Meier curves. In Indian NSCLC, patients increased risk of developing NSCLC was found to be associated with BCL-2 (-938) CC genotype, [OR 3.68 (1.92-6.79), RR 1.87 (1.35-2.57) and RD 31.03 (16.79-45.27) p 0.00006 for CC and OR 2.08 (1.18-3.66), RR 1.36 (1.08-1.71) and RD 17.74 (4.68-30.81) p 0.01 for AC genotype]. Patients homozygous for C allele exhibited a significant poor overall survival compared with patients displaying AC + CC or AC or AA genotype [median survival (months) 8 vs. 11 vs. 14 vs. 35.5 (p A) polymorphism. Genetic polymorphism in the inhibitory P2 promoter region of anti-apoptotic BCL-2 genes contributes to the risk of developing non-small-cell lung cancer in Indian population. BCL-2 (-938CC) genotype was an independent adverse prognostic factor for patients with NSCLC.
Energetic heavy ions overcome tumor radioresistance caused by overexpression of Bcl-2
International Nuclear Information System (INIS)
Hamada, Nobuyuki; Hara, Takamitsu; Omura-Minamisawa, Motoko; Funayama, Tomoo; Sakashita, Tetsuya; Sora, Sakura; Yokota, Yuichiro; Nakano, Takashi
2008-01-01
Background and purpose: Overexpression of Bcl-2 is frequent in human cancers and has been associated with radioresistance. Here we investigated the potential impact of heavy ions on Bcl-2 overexpressing tumors. Materials and methods: Bcl-2 cells (Bcl-2 overexpressing HeLa cells) and Neo cells (neomycin resistant gene-expressing HeLa cells) exposed to γ-rays or heavy ions were assessed for the clonogenic survival, apoptosis and cell cycle distribution. Results: Whereas Bcl-2 cells were more resistant to γ-rays (0.2 keV/μm) and helium ions (16.2 keV/μm) than Neo cells, heavy ions (76.3-1610 keV/μm) yielded similar survival regardless of Bcl-2 overexpression. Carbon ions (108 keV/μm) decreased the difference in the apoptotic incidence between Bcl-2 and Neo cells, and prolonged G 2 /M arrest that occurred more extensively in Bcl-2 cells than in Neo cells. Conclusions: High-LET heavy ions overcome tumor radioresistance caused by Bcl-2 overexpression, which may be explained at least in part by the enhanced apoptotic response and prolonged G 2 /M arrest. Thus, heavy-ion therapy may be a promising modality for Bcl-2 overexpressing radioresistant tumors
Huang, Wenting; Medeiros, L Jeffrey; Lin, Pei; Wang, Wei; Tang, Guilin; Khoury, Joseph; Konoplev, Sergej; Yin, C Cameron; Xu, Jie; Oki, Yasuhiro; Li, Shaoying
2018-05-21
High-grade B-cell lymphomas with MYC, BCL2, and BCL6 rearrangements (triple hit lymphoma) are uncommon. We studied the clinicopathologic features of 40 patients with triple hit lymphoma and compared them to 157 patients with MYC/BCL2 double hit lymphoma and 13 patients with MYC/BCL6 double hit lymphoma. The triple hit lymphoma group included 25 men and 15 women with a median age of 61 years (range, 34-85). Nine patients had a history of B-cell lymphoma. Histologically, 23 (58%) cases were diffuse large B-cell lymphoma and 17 cases had features of B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma. Most cases of triple hit lymphoma were positive for CD10 (100%), BCL2 (95%), BCL6 (82%), MYC (74%), and 71% with MYC and BCL2 coexpression. P53 was overexpressed in 29% of triple hit lymphoma cases. The clinicopathological features of triple hit lymphoma patients were similar to patients with MYC/BCL2 and MYC/BCL6 double hit lymphoma, except that triple hit lymphoma cases were more often CD10 positive compared with MYC/BCL6 double hit lymphoma (p hit lymphoma and double hit lymphoma and overall survival in triple hit lymphoma patients was 17.6 months, similar to the overall survival of patients with double hit lymphoma (p = 0.67). Patients with triple hit lymphoma showing P53 overexpression had significantly worse overall survival compared with those without P53 overexpression (p = 0.04). On the other hand, double expressor status and prior history of B-cell lymphoma did not correlate with overall survival. In conclusion, most patients with triple hit lymphoma have an aggressive clinical course and poor prognosis and these tumors have a germinal center B-cell immunophenotype, similar to patients with double hit lymphomas. P53 expression is a poor prognostic factor in patients with triple hit lymphoma.
Energy Technology Data Exchange (ETDEWEB)
Anvekar, Rina A.; Asciolla, James J.; Missert, Derek J.; Chipuk, Jerry E., E-mail: jerry.chipuk@mssm.edu [Department of Oncological Sciences, Mount Sinai School of Medicine, New York, NY (United States); Department of Dermatology, Mount Sinai School of Medicine, New York, NY (United States); The Tisch Cancer Institute, Mount Sinai Medical Center, New York, NY (United States)
2011-10-13
The global incidence of melanoma has dramatically increased during the recent decades, yet the advancement of primary and adjuvant therapies has not kept a similar pace. The development of melanoma is often centered on cellular signaling that hyper-activates survival pathways, while inducing a concomitant blockade to cell death. Aberrations in cell death signaling not only promote tumor survival and enhanced metastatic potential, but also create resistance to anti-tumor strategies. Chemotherapeutic agents target melanoma tumor cells by inducing a form of cell death called apoptosis, which is governed by the BCL-2 family of proteins. The BCL-2 family is comprised of anti-apoptotic proteins (e.g., BCL-2, BCL-xL, and MCL-1) and pro-apoptotic proteins (e.g., BAK, BAX, and BIM), and their coordinated regulation and function are essential for optimal responses to chemotherapeutics. Here we will discuss what is currently known about the mechanisms of BCL-2 family function with a focus on the signaling pathways that maintain melanoma tumor cell survival. Importantly, we will critically evaluate the literature regarding how chemotherapeutic strategies directly impact on BCL-2 family function and offer several suggestions for future regimens to target melanoma and enhance patient survival.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
DNA rearrangement in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene
International Nuclear Information System (INIS)
Tsujimoto, Y.; Bashir, M.M.; Givol, I.; Cossman, J.; Jaffe, E.; Croce, C.M.
1987-01-01
In most human lymphomas, the chromosome translocation t(14;18) occurs within two breakpoint clustering regions on chromosome 18, the major one at the 3' untranslated region of the bcl-2 gene and the minor one at 3' of the gene. Analysis of a panel of follicular lymphoma DNAs using probes for the first exon of the bcl-2 gene indicates that DNA rearrangements may also occur 5' to the involved bcl-2 gene. In this case the IgH locus and the bcl-2 gene are found in an order suggesting that an inversion also occurred during the translocation process. The coding region of the bcl-2 gene, however, are left intact in all cases of follicular lymphoma studied to date
Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger
2009-01-01
Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.
International Nuclear Information System (INIS)
Tsujimoto, Yoshihide
1989-01-01
The biological activity of the human BCL-2 gene product was analyzed in an Epstein-Barr virus (EBV)-infected human lymphoblastoid B-cell line transfected with BCL-2 sequences driven by the simian virus 40 promoter and enhancer. Overproduction of the BCL-2 protein conferred a selective growth advantage to the EBV-infected B cells as compared with control transfectants in low-serum medium and also after seeding at limiting dilution but did not render the cells tumorigenic in athymic nude mice. This growth enhancement was also seen in cells transfected with the BCL-2 gene with its own promoter juxtaposed to the immunoglobulin heavy chain gene enhancer, which represents the translocated form of the BCL-2 gene observed in follicular lymphomas with the t(14;18) translocation. The growth advantage of EBV-infected B cells overproducing the BCL-2 protein is neither due to the enhanced growth factor production nor due to an enhanced sensitivity of the BCL-2 transfectants to interleukins 1 or 6, although both lymphokines are known to stimulate proliferation of EBV-infected B-cell lines. The growth advantage of EBV-infected B-cell lines. The growth advantage of EBV-infected B cells by overproduction of the BCL-2 protein suggests the direct involvement of the BCL-2 gene product in the pathogenesis of follicular lymphoma
Gene expression profiles in BCL11B-siRNA treated malignant T cells
Directory of Open Access Journals (Sweden)
Grabarczyk Piotr
2011-05-01
Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.
Directory of Open Access Journals (Sweden)
Manuel D Díaz-Muñoz
Full Text Available Post-transcriptional mRNA regulation by RNA binding proteins (RBPs associated with AU-rich elements (AREs present in the 3' untranslated region (3'UTR of specific mRNAs modulates transcript stability and translation in eukaryotic cells. Here we have functionally characterised the importance of the AREs present within the Bcl2 3'UTR in order to maintain Bcl2 expression. Gene targeting deletion of 300 nucleotides of the Bcl2 3'UTR rich in AREs diminishes Bcl2 mRNA stability and protein levels in primary B cells, decreasing cell lifespan. Generation of chimeric mice indicates that Bcl2-ARE∆/∆ B cells have an intrinsic competitive disadvantage compared to wild type cells. Biochemical assays and predictions using a bioinformatics approach show that several RBPs bind to the Bcl2 AREs, including AUF1 and HuR proteins. Altogether, association of RBPs to Bcl2 AREs contributes to Bcl2 protein expression by stabilizing Bcl2 mRNA and promotes B cell maintenance.
Directory of Open Access Journals (Sweden)
KARIN S. CUNHA
2013-11-01
Full Text Available AIMS: To study the expression of Bcl-2, Bcl-x, as well the presence of cleaved caspase-3 in neurofibromas and malignant peripheral nerve sheath tumors. The expression of Bcl-2 and Bcl-x and the presence of cleaved caspase 3 were compared to clinicopathological features of malignant peripheral nerve sheath tumors and their impact on survival rates were also investigated. MATERIALS AND METHODS: The evaluation of Bcl-2, Bcl-x and cleaved caspase-3 was performed by immunohistochemistry using tissue microarrays in 28 malignant peripheral nerve sheath tumors and 38 neurofibromas. Immunoquantification was performed by computerized digital image analysis. CONCLUSIONS: Apoptosis is altered in neurofibromas and mainly in malignant peripheral nerve sheath tumors. High levels of cleaved caspase-3 are more common in tumors with more aggressive histological features and it is associated with lower disease free survival of patients with malignant peripheral nerve sheath tumors.
Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...
African Journals Online (AJOL)
apoptotic genes, BCL2, Bcl-xL, XIAP and Survivin), in cervical carcinoma cells. Methods: Annexin V-FITC/propidium iodide (PI) staining was used for the investigation of cell apoptosis. RNA RNeasy Kits was used to isolate RNA and Omniscript ...
Crosstalk between Bcl-2 family and Ras family small GTPases: potential cell fate regulation?
International Nuclear Information System (INIS)
Kang, Jia; Pervaiz, Shazib
2013-01-01
Cell fate regulation is a function of diverse cell signaling pathways that promote cell survival and or inhibit cell death execution. In this regard, the role of the Bcl-2 family in maintaining a tight balance between cell death and cell proliferation has been extensively studied. The conventional dogma links cell fate regulation by the Bcl-2 family to its effect on mitochondrial permeabilization and apoptosis amplification. However, recent evidence provide a novel mechanism for death regulation by the Bcl-2 family via modulating cellular redox metabolism. For example overexpression of Bcl-2 has been shown to contribute to a pro-oxidant intracellular milieu and down-regulation of cellular superoxide levels enhanced death sensitivity of Bcl-2 overexpressing cells. Interestingly, gene knockdown of the small GTPase Rac1 or pharmacological inhibition of its activity also reverted death phenotype in Bcl-2 expressing cells. This appears to be a function of an interaction between Bcl-2 and Rac1. Similar functional associations have been described between the Bcl-2 family and other members of the Ras superfamily. These interactions at the mitochondria provide novel opportunities for strategic therapeutic targeting of drug-resistant cancers.
El Hindy, Nicolai; Bachmann, Hagen S; Lambertz, Nicole; Adamzik, Michael; Nückel, Holger; Worm, Karl; Zhu, Yuan; Sure, Ulrich; Siffert, Winfried; Sandalcioglu, I Erol
2011-06-01
Bcl-2 plays a key role in the downregulation of apoptosis and proliferation and leads to increased chemoresistance in glioblastoma multiforme (GBM). The authors investigated the role of a common regulatory single-nucleotide polymorphism (-938C>A), which is located in the inhibitory P2 promoter of BCL2. Data from 160 patients suffering from GBM were retrospectively evaluated. Study inclusion criteria consisted of available DNA and, in patients still alive, a follow-up of at least 24 months. Results were analyzed with respect to the basic clinical data, type of surgical intervention (gross-total resection [GTR] versus stereotactic biopsy [SB]), adjuvant therapy, MGMT promoter methylation, and survival at the 2-year follow-up. At the 2-year follow-up, 127 (79.4%) of the 160 patients had died. Kaplan-Meier curves revealed a significantly higher rate of survival for homo- and heterozygous C-allele carriers (p = 0.031). In the GTR group, the survival rate was 47.1% for homozygous C-allele carriers, 32.0% for heterozygous C-allele carriers, and only 21.4% for homozygous A-allele carriers (p = 0.024). The SB group showed no genotype-dependent differences. Multivariable Cox regression revealed that the BCL2 (-938AA) genotype was an independent negative prognostic factor for 2-year survival in the GTR group according to the BCL2 (-938CC) genotype reference group (hazard ratio 2.50, 95% CI 1.14-5.48, p = 0.022). These results suggested that the (-938C>A) polymorphism is a survival prognosticator as well as a marker for a high-risk group among patients with GBM who underwent GTR.
Xu, Miao; Chen, Xiumei; Han, Yanling; Ma, Chunqing; Ma, Lin; Li, Shirong
2015-01-01
Clusterin (CLU) is known as a multifunctional protein involved in a variety of physiological processes including lipid transport, epithelial cell differentiation, tumorigenesis, and apoptosis. Our recent study has demonstrated that knockdown of clusterin sensitizes pancreatic cancer cell lines to gmcitabine treatment. However the details of this survival mechanism remain undefined. Of the various downstream targets of CLU, we examined activation of the NF-kB transcription factor and subsequent transcriptional regulation of BCL-2 gene in pancreatic cancer cell MIA-PaCa-2. The MIA-PaCa-2 cells were transfected with an antisense oligonucleotide (ASO) against clusterin, which led to a decreased protein level of the antiapoptotic gene BCL-2. Furthermore, inhibition of CLU decreased the function of NF-kB, which is capable of transcriptional regulation of the BCL-2 gene. Inhibiting this pathway increased the apoptotic effect of gmcitabine chemotherapy. Re-activated NF-kB resulted in attenuation of ASO-induced effects, followed by the bcl-2 upregulation, and bcl-2 re-inhibition resulted in attenuation of Re-activated NF-kB -induced effects. Animals injected with ASO CLU in MIA-PaCa-2 cells combined with gmcitabine treatment had fewer tumors than gmcitabine or ASO CLU alone. These findings suggest that knockdown of CLU sensitized MIA-PaCa-2 cells to gmcitabine chemotherapy through modulating NF-Kb/bcl-2 pathway.
THE EXPRESSION AND CLINICAL VALUE OF APOPTOSIS CONTROL GENE Bcl-2 AND Bax IN BREAST CANCER
Institute of Scientific and Technical Information of China (English)
ZHENG Jun; YAO Zhen-xiang; ZHANG Jing
1999-01-01
Objective: To study the expression and clinical value of apoptosis control gene bcl-2 and bax in breast cancer.Methods: Protein bax and bcl-2 in 41 breast cancers obtained from operations in our hospital in 1996 were detected using ABC immunohistochemical stain assay and compared with 10 cases with normal breast tissues.Results: The positive rate of bax in normal breast tissue was 90% and in breast cancer was 59%, with a significant statistical difference between them (P<0.05), but there was no statistical difference in bcl-2 protein expression. Among the 41 breast cancer, the group with lymph node metastasis (21 cases) had obviously low bax expression (43%) and high bcl-2 expression (76%), showing significant difference to the group without lymph node metastasis (P<0.05).Conclusion: The antiapoptosis function of bcl-2 was stronger than bax in breast cancer. Protein bax and bcl-2 assay may be useful in understanding the biological behaviors of breast cancer.
Interaction between Na-K-ATPase and Bcl-2 proteins BclXL and Bak.
Lauf, Peter K; Alqahtani, Tariq; Flues, Karin; Meller, Jaroslaw; Adragna, Norma C
2015-01-01
In silico analysis predicts interaction between Na-K-ATPase (NKA) and Bcl-2 protein canonical BH3- and BH1-like motifs, consistent with NKA inhibition by the benzo-phenanthridine alkaloid chelerythrine, a BH3 mimetic, in fetal human lens epithelial cells (FHLCs) (Lauf PK, Heiny J, Meller J, Lepera MA, Koikov L, Alter GM, Brown TL, Adragna NC. Cell Physiol Biochem 31: 257-276, 2013). This report establishes proof of concept: coimmunoprecipitation and immunocolocalization showed unequivocal and direct physical interaction between NKA and Bcl-2 proteins. Specifically, NKA antibodies (ABs) coimmunoprecipitated BclXL (B-cell lymphoma extra large) and BAK (Bcl-2 antagonist killer) proteins in FHLCs and A549 lung cancer cells. In contrast, both anti-Bcl-2 ABs failed to pull down NKA. Notably, the molecular mass of BAK1 proteins pulled down by NKA and BclXL ABs appeared to be some 4-kDa larger than found in input monomers. In silico analysis predicts these higher molecular mass BAK1 proteins as alternative splicing variants, encoding 42 amino acid (aa) larger proteins than the known 211-aa long canonical BAK1 protein. These BAK1 variants may constitute a pool separate from that forming mitochondrial pores by specifically interacting with NKA and BclXL proteins. We propose a NKA-Bcl-2 protein ternary complex supporting our hypothesis for a special sensor role of NKA in Bcl-2 protein control of cell survival and apoptosis. Copyright © 2015 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Tsogzolmaa Dorjgochoo
Full Text Available In vitro studies have demonstrated the role of the BCL-2 family of genes in endometrial carcinogenesis. The role of genetic variants in BCL-2 genes and their interactions with non-genetic factors in the development of endometrial cancer has not been investigated in epidemiological studies.We examined the relationship between BCL-2 gene family variants and endometrial cancer risk among 1,028 patients and 1,922 age-matched community controls from Shanghai, China. We also investigated possible interactions between genetic variants and established risk factors (demographic, lifestyle and clinical. Individuals were genotyped for 86 tagging single nucleotide polymorphisms (SNPs in the BCL2, BAX, BAD and BAK1 genes.Significant associations with endometrial cancer risk were found for 9 SNPs in the BCL2 gene (P trend<0.05 for all. For SNPs rs17759659 and rs7243091 (minor allele for both: G, the associations were independent. The odds ratio was 1.27 (95% CI: 1.04-1.53 for women with AG genotype for the SNP rs17759659 and 1.82 (95% CI: 1.21-2.73 for women with the GG genotype for the SNP rs7243091. No interaction between these two SNPs and established non-genetic risk factors of endometrial cancer was noticed.Genetic polymorphisms in the BCL2 gene may be associated with the risk of endometrial cancer in Chinese women.
Directory of Open Access Journals (Sweden)
Monserrate Jessica P
2012-07-01
Full Text Available Abstract Background B cell lymphoma 2 (Bcl-2 proteins are the central regulators of apoptosis. The two bcl-2 genes in Drosophila modulate the response to stress-induced cell death, but not developmental cell death. Because null mutants are viable, Drosophila provides an optimum model system to investigate alternate functions of Bcl-2 proteins. In this report, we explore the role of one bcl-2 gene in nutrient stress responses. Results We report that starvation of Drosophila larvae lacking the bcl-2 gene, buffy, decreases survival rate by more than twofold relative to wild-type larvae. The buffy null mutant reacted to starvation with the expected responses such as inhibition of target of rapamycin (Tor signaling, autophagy initiation and mobilization of stored lipids. However, the autophagic response to starvation initiated faster in larvae lacking buffy and was inhibited by ectopic buffy. We demonstrate that unusually high basal Tor signaling, indicated by more phosphorylated S6K, was detected in the buffy mutant and that removal of a genomic copy of S6K, but not inactivation of Tor by rapamycin, reverted the precocious autophagy phenotype. Instead, Tor inactivation also required loss of a positive nutrient signal to trigger autophagy and loss of both was sufficient to activate autophagy in the buffy mutant even in the presence of enforced phosphoinositide 3-kinase (PI3K signaling. Prior to starvation, the fed buffy mutant stored less lipid and glycogen, had high lactate levels and maintained a reduced pool of cellular ATP. These observations, together with the inability of buffy mutant larvae to adapt to nutrient restriction, indicate altered energy metabolism in the absence of buffy. Conclusions All animals in their natural habitats are faced with periods of reduced nutrient availability. This study demonstrates that buffy is required for adaptation to both starvation and nutrient restriction. Thus, Buffy is a Bcl-2 protein that plays an
Directory of Open Access Journals (Sweden)
Fotini M. Kouri
2012-01-01
Full Text Available Glioblastoma (GBM is a highly aggressive and lethal brain cancer with a median survival of less than two years after diagnosis. Hallmarks of GBM tumors include soaring proliferative indices, high levels of angiogenesis, diffuse invasion into normal brain parenchyma, resistance toward therapy-induced apoptosis, and pseudopallisading necrosis. Despite the recent advances in neurosurgery, radiation therapy, and the development of targeted chemotherapeutic regimes, GBM remains one of the deadliest types of cancer. Particularly, the alkylating agent temozolomide (TMZ in combination with radiation therapy prolonged patient survival only marginally, and clinical studies assessing efficacies of targeted therapies, foremost ATP mimetics inhibiting the activity of receptor tyrosine kinases (RTKs, revealed only few initial responders; tumor recurrence is nearly universal, and salvage therapies to combat such progression remain ineffective. Consequently, myriad preclinical and clinical studies began to define the molecular mechanisms underlying therapy resistance of GBM tumors, and pointed to the Bcl-2 protein family, in particular the atypical member Bcl2-Like 12 (Bcl2L12, as important regulators of therapy-induced cell death. This review will discuss the multi-faceted modi operandi of Bcl-2 family proteins, describe their roles in therapy resistance of malignant glioma, and outline current and future drug development efforts to therapeutically target Bcl-2 proteins.
Targeting MUC1-C suppresses BCL2A1 in triple-negative breast cancer.
Hiraki, Masayuki; Maeda, Takahiro; Mehrotra, Neha; Jin, Caining; Alam, Maroof; Bouillez, Audrey; Hata, Tsuyoshi; Tagde, Ashujit; Keating, Amy; Kharbanda, Surender; Singh, Harpal; Kufe, Donald
2018-01-01
B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in triple-negative breast cancer (TNBC) cells, induces the epithelial-mesenchymal transition (EMT) and promotes anti-cancer drug resistance. The present study demonstrates that targeting MUC1-C genetically and pharmacologically in TNBC cells results in the downregulation of BCL2A1 expression. The results show that MUC1-C activates the BCL2A1 gene by an NF-κB p65-mediated mechanism, linking this pathway with the induction of EMT. The MCL-1 anti-apoptotic protein is also of importance for the survival of TNBC cells and is an attractive target for drug development. We found that inhibiting MCL-1 with the highly specific MS1 peptide results in the activation of the MUC1-C→NF-κB→BCL2A1 pathway. In addition, selection of TNBC cells for resistance to ABT-737, which inhibits BCL-2, BCL-xL and BCL-W but not MCL-1 or BCL2A1, is associated with the upregulation of MUC1-C and BCL2A1 expression. Targeting MUC1-C in ABT-737-resistant TNBC cells suppresses BCL2A1 and induces death, which is of potential therapeutic importance. These findings indicate that MUC1-C is a target for the treatment of TNBCs unresponsive to agents that inhibit anti-apoptotic members of the BCL-2 family.
Wang, Xiaoyuan; Liow, Sing Shy; Wu, Qiaoqiong; Li, Chuang; Owh, Cally; Li, Zibiao; Loh, Xian Jun; Wu, Yun-Long
2017-11-01
Antiapoptotic Bcl-2 protein's upregulated expression is a key reason for drug resistance leading to failure of chemotherapy. In this report, a series of biocompatible amphiphilic cationic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) copolymer, comprising hydrophobic PHB block and cationic PDMAEMA block, is designed to codeliver hydrophobic chemotherapeutic paclitaxel and Bcl-2 converting gene Nur77/ΔDBD with enhanced stability, due to the micelle formation by hydrophobic PHB segment. This copolymer shows less toxicity but similar gene transfection efficiency to polyethyenimine (25k). More importantly, this codelivery approach by PHB-PDMAEMA leads to increased drug resistant HepG2/Bcl-2 cancer cell death, by increased expression of Nur77 proteins in the Bcl-2 present intracellular mitochondria. This work signifies for the first time that cationic amphiphilic PHB-b-PDMAEMA copolymers can be utilized for the drug and gene codelivery to drug resistant cancer cells with high expression of antiapoptosis Bcl-2 protein and the positive results are encouraging for the further design of codelivery platforms for combating drug resistant cancer cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Expression of Bcl-2 in canine osteosarcoma
Piro, F.; Leonardi, L.
2015-01-01
Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359
Bcl-2 antisense therapy in B-cell malignancies.
Chanan-Khan, Asher
2005-07-01
Bcl-2 is an apoptosis regulating protein, overexpression of which is associated with chemotherapy resistant disease, aggressive clinical course, and poor survival in patients with B-cell lymphoproliferative disorders. Overexpression of Bcl-2 protein results in an aberrant intrinsic apoptotic pathway that confers a protective effect on malignant cells against a death signal (e.g., chemotherapy or radiotherapy). Downregulation of this oncoprotein, thus, represents a possible new way to target clinically aggressive disease. Preclinical studies have shown that this oncoprotein can be effectively decreased by Bcl-2 antisense in malignant lymphoid cells and can reverse chemotherapy resistance, as well as enhance the anti-apoptotic potential of both chemotherapeutic and biologic agents. Ongoing clinical trials are exploring the role of Bcl-2 downregulation with oblimersen (Bcl-2 antisense) in patients with non-Hodgkin's lymphoma, chronic lymphocytic leukemia and multiple myeloma. Early results from these studies are promising and support the proof of the principle. As these studies are completed and mature data emerges, the role of Bcl-2 antisense therapy in the treatment of B-cell malignancies will become clearer.
Bcl-2 expression during the development and degeneration of RCS rat retinae.
Sharma, R K
2001-12-14
In various hereditary retinal degenerations, including that in Royal College of Surgeons (RCS) rats, the photoreceptors ultimately die by apoptosis. Bcl-2 is one of the genes, which regulates apoptosis and is thought to promote survival of cells. This study has investigated the developmental expression of Bcl-2 in RCS rat, which is a well-studied animal model for hereditary retinal degeneration. An antibody against Bcl-2 was used for its immunohistochemical localization in dystrophic RCS rat retinae from postnatal (PN) days 4, 7, 13, 35, 45, 70, 202 and 14 months. Results were compared with Bcl-2 localization in congenic non-dystrophic rats from PN 4, 7, 13, 44, 202 and 14 months. Bcl-2 immunoreactivity in non-dystrophic retinae was already present in PN 4 retinae in the nerve fiber layer (presumably in the endfeet of immature Müller cells) and in the proximal parts of certain radially aligned neuroepithelial cells/immature Müller cell radial processes. With increasing age the immunoreactivity in relatively more mature Müller cell radial processes spread distally towards the outer retina and between PN 13 and 44 it reached the adult distribution. No cell bodies in the ganglion cell layer were found to be immunoreactive. Expression of Bcl-2 immunoreactivity in dystrophic RCS rat retinae closely resembled that of non-dystrophic retinae. No immunoreactivity was seen in photoreceptors or retinal pigment epithelium in dystrophic or non-dystrophic retinae. In conclusion, Bcl-2 expression is not altered, either in terms of its chronology or the cell type expressing it, during retinal degeneration in RCS rats.
Chou, Fu-Sheng; Griesinger, Andrea; Wunderlich, Mark; Lin, Shan; Link, Kevin A.; Shrestha, Mahesh; Goyama, Susumu; Mizukawa, Benjamin; Shen, Shuhong; Marcucci, Guido
2012-01-01
AML1-ETO (AE) is a fusion product of translocation (8;21) that accounts for 40% of M2 type acute myeloid leukemia (AML). In addition to its role in promoting preleukemic hematopoietic cell self-renewal, AE represses DNA repair genes, which leads to DNA damage and increased mutation frequency. Although this latter function may promote leukemogenesis, concurrent p53 activation also leads to an increased baseline apoptotic rate. It is unclear how AE expression is able to counterbalance this intrinsic apoptotic conditioning by p53 to promote survival and self-renewal. In this report, we show that Bcl-xL is up-regulated in AE cells and plays an essential role in their survival and self-renewal. Further investigation revealed that Bcl-xL expression is regulated by thrombopoietin (THPO)/MPL-signaling induced by AE expression. THPO/MPL-signaling also controls cell cycle reentry and mediates AE-induced self-renewal. Analysis of primary AML patient samples revealed a correlation between MPL and Bcl-xL expression specifically in t(8;21) blasts. Taken together, we propose that survival signaling through Bcl-xL is a critical and intrinsic component of a broader self-renewal signaling pathway downstream of AML1-ETO–induced MPL. PMID:22337712
Han, Myoung-Eun; Lee, Young-Suk; Baek, Sun-Yong; Kim, Bong-Seon; Kim, Jae-Bong; Oh, Sae-Ock
2009-01-01
Gastric cancer is the second most common cause of cancer deaths worldwide. The underlying molecular mechanisms of its carcinogenesis are relatively poorly characterized. Hedgehog (Hh) signaling, which is critical for development of various organs including the gastrointestinal tract, has been associated with gastric cancer. The present study was undertaken to reveal the underlying mechanism by which Hh signaling controls gastric cancer cell proliferation. Treatment of gastric cancer cells with cyclopamine, a specific inhibitor of Hh signaling pathway, reduced proliferation and induced apoptosis of gastric cancer cells. Cyclopamine treatment induced cytochrome c release from mitochondria and cleavage of caspase 9. Moreover, Bcl-2 expression was significantly reduced by cyclopamine treatment. These results suggest that Hh signaling regulates the survival of gastric cancer cells by regulating the expression of Bcl-2. PMID:19742123
Expression of Bcl-2 in canine osteosarcoma
Directory of Open Access Journals (Sweden)
F. Piro
2015-03-01
Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.
Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K
2011-04-04
New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests
Cui, Ziwei; Shen, Liangyun; Lin, Yue; Wang, Shuqin; Zheng, Dongfeng; Tan, Qian
2014-08-01
Adipose-derived stem cells (ADSCs) have become a promising tool for a wide range of cell-based therapies. However, transplanted ADSCs do not survive well under ischemic conditions. In this study we aimed to inhibit oxygen-glucose deprivation (OGD)-induced apoptosis of human ADSCs by genetic modification with antiapoptotic protein Bcl-2. After isolation and culture, the phenotypes of human ADSCs at passage 3 were analyzed by flow cytometry. Then, genetic modification of ADSCs with Bcl-2 was carried out. Bcl-2 gene transfection was verified by Western blot analysis and multipotent differentiation properties were evaluated in Bcl-2-modified ADSCs (Bcl-2-ADSCs). Apoptosis was evaluated by a TUNEL assay under ischemic conditions induced by OGD. Apoptotic nuclei were also assessed and quantified by Hoechst staining. The cultured ADSCs expressed stem cell-associated markers CD29, CD34, CD44, and CD90, but not fibroblast marker HLA-DR or hematopoietic stem cell marker CD133. The Bcl-2 gene was transferred into ADSCs efficiently, and Bcl-2-ADSCs differentiated into adipocytes, chondrocytes, and osteoblasts. In addition, Bcl-2 overexpression reduced the percentage of apoptotic Bcl-2-ADSCs by 38 % under OGD. Our results indicate that Bcl-2 overexpression through gene transfection inhibits apoptosis of ADSCs under ischemic conditions. This journal requires that authors assign a level of evidence to each submission to which Evidence-Based Medicine rankings are applicable. This excludes Review Articles, Book Reviews, and manuscripts that concern Basic Science, Animal Studies, Cadaver Studies, and Experimental Studies. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
Ryu, Hoon; Smith, Karen; Camelo, Sandra I; Carreras, Isabel; Lee, Junghee; Iglesias, Antonio H; Dangond, Fernando; Cormier, Kerry A; Cudkowicz, Merit E; Brown, Robert H; Ferrante, Robert J
2005-06-01
Multiple molecular defects trigger cell death in amyotrophic lateral sclerosis (ALS). Among these, altered transcriptional activity may perturb many cellular functions, leading to a cascade of secondary pathological effects. We showed that pharmacological treatment, using the histone deacetylase inhibitor sodium phenylbutyrate, significantly extended survival and improved both the clinical and neuropathological phenotypes in G93A transgenic ALS mice. Phenylbutyrate administration ameliorated histone hypoacetylation observed in G93A mice and induced expression of nuclear factor-kappaB (NF-kappaB) p50, the phosphorylated inhibitory subunit of NF-kappaB (pIkappaB) and beta cell lymphoma 2 (bcl-2), but reduced cytochrome c and caspase expression. Curcumin, an NF-kappaB inhibitor, and mutation of the NF-kappaB responsive element in the bcl-2 promoter, blocked butyrate-induced bcl-2 promoter activity. We provide evidence that the pharmacological induction of NF-kappaB-dependent transcription and bcl-2 gene expression is neuroprotective in ALS mice by inhibiting programmed cell death. Phenylbutyrate acts to phosphorylate IkappaB, translocating NF-kappaB p50 to the nucleus, or to directly acetylate NF-kappaB p50. NF-kappaB p50 transactivates bcl-2 gene expression. Up-regulated bcl-2 blocks cytochrome c release and subsequent caspase activation, slowing motor neuron death. These transcriptional and post-translational pathways ultimately promote motor neuron survival and ameliorate disease progression in ALS mice. Phenylbutyrate may therefore provide a novel therapeutic approach for the treatment of patients with ALS.
Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...
African Journals Online (AJOL)
apoptotic ... Quantitative real-time polymerase chain reaction (qPCR) was performed using Taq PCR Master ... Keywords: Anti-apoptotic genes, Cervical cancer, Apoptosis, Cell viability, BCL2, .... polyclonal anti-rabbit immunoglobulin HRP-linked.
Energy Technology Data Exchange (ETDEWEB)
Xiang, Di [Penn State Hershey Cancer Institute, Penn State University College of Medicine, Hershey, PA 17033 (United States); Yuan, Yunsheng [Penn State Hershey Cancer Institute, Penn State University College of Medicine, Hershey, PA 17033 (United States); Engineering Research Center of Cell and Therapeutic Antibody, Ministry of Education, School of Pharmacy, Shanghai Jiao Tong University, Shanghai (China); Chen, Li [Pharmacy College, Fujian University of Traditional Chinese Medicine, Fuzhou (China); Institute of Human Virology, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Liu, Xin; Belani, Chandra [Penn State Hershey Cancer Institute, Penn State University College of Medicine, Hershey, PA 17033 (United States); Cheng, Hua, E-mail: hcheng@ihv.umaryland.edu [Institute of Human Virology, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Marlene and Stewart Greenebaum Cancer Center, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Department of Medicine, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Department Microbiology and Immunology, University of Maryland School of Medicine, Baltimore, MD 21201 (United States)
2015-08-14
Adult T cell leukemia and lymphoma (ATL) is a highly aggressive form of hematological malignancy and is caused by chronic infection of human T cell leukemia virus type 1 (HTLV-1). The viral genome encodes an oncogenic protein, Tax, which plays a key role in transactivating viral gene transcription and in deregulating cellular oncogenic signaling to promote survival, proliferation and transformation of virally infected T cells. Hence, Tax is a desirable therapeutic target, particularly at early stage of HTLV-1-mediated oncogenesis. We here show that niclosamide, an anti-helminthic molecule, induced apoptosis of HTLV-1-transformed T cells. Niclosamide facilitated degradation of the Tax protein in proteasome. Consistent with niclosamide-mediated Tax degradation, this compound inhibited activities of MAPK/ERK1/2 and IκB kinases. In addition, niclosamide downregulated Stat3 and pro-survival Bcl-2 family members such as Mcl-1 and repressed the viral gene transcription of HTLV-1 through induction of Tax degradation. Since Tax, Stat3 and Mcl-1 are crucial molecules for promoting survival and growth of HTLV-1-transformed T cells, our findings demonstrate a novel mechanism of niclosamide in inducing Tax degradation and downregulating various cellular pro-survival molecules, thereby promoting apoptosis of HTLV-1-associated leukemia cells. - Highlights: • Niclosamide is a promising therapeutic candidate for adult T cell leukemia. • Niclosamide employs a novel mechanism through proteasomal degradation of Tax. • Niclosamide downregulates certain cellular pro-survival molecules.
Sun, Wen-Chong; Pei, Ling
2016-07-01
Propofol exerts a cytotoxic influence over immature neurocytes. Our previous study revealed that clinically relevant doses of propofol accelerated apoptosis of primary cultured astrocytes of developing rodent brains via rno-miR-665 regulation. However, the role of rno-miR-665 during the growth spurt of neonatal rodent brains in vivo is still uncertain. Post-natal day 7 (P7) rats received a single injection of propofol 30 mg/kg intraperitoneally (i.p.), and neuroapoptosis of hippocampal astrocytes was analyzed by immunofluorescence and scanning electron microscopy. The differential expression of rno-miR-665, BCL2L1 (Bcl-xl), and cleaved caspase 3 (CC3) was surveyed by qRT-PCR and western blotting. In addition, the utility of A-1155463, a highly potent and BCL2L1-selective antagonist, was aimed to assess the contribution of BCL2L1 for neuroglial survival. Following the intraventricular injection of lentivirus rno-miR-665, neuroprotection was detected by 5-point scale measurement. The single dose of propofol 30 mg/kg triggered dose-dependent apoptosis of developing hippocampal astrocytes. Meanwhile, propofol triggered both rno-miR-665 and CC3, and depressed BCL2L1, which was predicted as one target gene of rno-miR-665. Combination treatment with A-1155463 and propofol induced lower mRNA and protein levels of BCL2L1 and more CC3 activation than propofol treatment alone in vivo. The lentivirus-mediated knockdown of rno-miR-665 elevated BCL2L1 and attenuated CC3 levels, whereas up-regulation of rno-miR-665 suppressed BCL2L1 and induced CC3 expression in vivo. More importantly, rno-miR-665 antagomir infusion improved neurological outcomes of pups receiving propofol during the brain growth spurt. Rno-miR-665, providing a potential target for alternative therapeutics for pediatric anesthesia, is susceptible to propofol by negatively targeting antiapoptotic BCL2L1. Relatively little is known about the association between exposure of astrocytes to brief propofol
Casanelles, Elisenda; Gozzelino, Raffaella; Marqués-Fernández, Fernando; Iglesias-Guimarais, Victoria; Garcia-Belinchón, Mercè; Sánchez-Osuna, María; Solé, Carme; Moubarak, Rana S; Comella, Joan X; Yuste, Victor J
2013-05-01
TNFα can promote either cell survival or cell death. The activation of NF-κB plays a central role in cell survival while its inhibition makes TNFα-triggered cytotoxicity possible. Here, we report that the overexpression of a non-degradable mutant of the inhibitor of NF-κB (super-repressor (SR)-IκBα) sensitizes HeLa cells towards TNFα-induced apoptosis, involving caspases activation and cytocrome C release from the mitochondria. Interestingly, we describe that the specific knockdown of Bcl-xL, but not that of Bcl-2, Bcl-w or Mcl-1, renders cells sensitive to TNFα-induced apoptosis. This cytotoxic effect occurs without altering the activation of NF-κB. Then, the activation of the NF-κB pathway is not sufficient to protect Bcl-xL-downregulated cells from TNFα-induced cell death, meaning that TNFα is not able to promote cell survival in the absence of Bcl-xL. In addition, Bcl-xL silencing does not potentiate the cytotoxicity afforded by the cytokine in SR-IκBα-overexpressing cells. This indicates that TNFα-induced apoptosis in SR-IκBα-overexpressing cells relies on the protein levels of Bcl-xL. We have corroborated these findings using RD and DU-145 cells, which also become sensitive to TNFα-induced apoptosis after Bcl-xL knockdown despite that NF-κB remains activated. Altogether, our results point out that the impairment of the anti-apoptotic function of Bcl-xL should make cells sensitive towards external insults circumventing the TNFα-triggered NF-κB-mediated cytoprotective effect. Hence, the specific inhibition of Bcl-xL could be envisaged as a promising alternative strategy against NF-κB-dependent highly chemoresistant proliferative malignancies. Copyright © 2013 Elsevier B.V. All rights reserved.
Florou, Dimitra; Patsis, Christos; Ardavanis, Alexandros; Scorilas, Andreas
2013-07-01
Defective apoptosis comprises the main reason for tumor aggressiveness and chemotherapy tolerance in solid neoplasias. Among the BCL-2 family members, whose mRNA or protein expression varies considerably in different human malignancies, BCL2L12 is the one for which we have recently shown its propitious prognostic value in gastric cancer. The purpose of the current work was to investigate the expression behavior of BCL2L12, BAX, and BCL-2 in human stomach adenocarcinoma cells following their exposure to anti-tumor substances. The 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide and trypan blue methods assessed the impact of doxorubicin, oxaliplatin and methotrexate on AGS cells' viability and growth. Following isolation from cells, total RNA was reverse-transcribed to cDNA. Quantification of target genes' expression was performed with real-time PCR using SYBR Green detection system. The relative changes in their mRNA levels between drug-exposed and untreated cells were calculated with the comparative Ct method (2(-ddCt)). All three drugs, as a result of their administration to AGS cancer cells for particular time intervals, provoked substantial fluctuations in the transcriptional levels of the apoptosis-related genes studied. While BAX was principally upregulated, striking similar were the notable changes regarding BCL-2 and BCL2L12 expression in our cellular system. Our findings indicate the growth suppressive effects of doxorubicin, oxaliplatin and methotrexate treatment on stomach carcinoma cells and the implication of BCL2L12, BAX, and BCL-2 expression profiles in the molecular signaling pathways triggered by chemotherapy.
Bcl-2 antisense therapy in B-cell malignant proliferative disorders.
Chanan-Khan, Asher; Czuczman, Myron S
2004-08-01
Overexpression of Bcl-2 oncogene has been clinically associated with an aggressive clinical course, chemotherapy and radiotherapy resistance, and poor survival in patients with malignant B-cell disorders. Patients with relapsed or refractory chronic lymphocytic leukemia, multiple myeloma, or non-Hodgkin's lymphoma have limited therapeutic options. Preclinical and early clinical data have shown that Bcl-2 oncoprotein can be decreased by Bcl-2 antisense therapy. Also, downregulation of Bcl-2 protein can result in reversal of chemotherapy resistance and improved antitumor activity of biologic agents. Various clinical trials are evaluating the role of targeting Bcl-2 as a mechanism to enhance the antitumor potential of chemotherapy and immunotherapy. Early results from these clinical studies are encouraging and confirm the proof of principle for antisense therapy. As current data mature, these trials will hopefully validate preliminary results and establish Bcl-2 antisense as an important addition to the current armamentarium used in the treatment of patients with B-cell neoplasms.
Bachmann, Hagen S; Otterbach, Friedrich; Callies, Rainer; Nückel, Holger; Bau, Maja; Schmid, Kurt W; Siffert, Winfried; Kimmig, Rainer
2007-10-01
Expression of the antiapoptotic and antiproliferative protein Bcl-2 has been repeatedly shown to be associated with better clinical outcome in breast cancer. We recently showed a novel regulatory (-938C>A) single-nucleotide polymorphism (SNP) in the inhibitory P2 BCL2 gene promoter generating significantly different BCL2 promoter activities. Paraffin-embedded neoplastic and nonneoplastic tissues from 274 patients (161 still alive after a follow-up period of at least 80 months) with primary unilateral invasive breast carcinoma were investigated. Bcl-2 expression of tumor cells was shown by immunohistochemistry; nonneoplastic tissues were used for genotyping. Both the Bcl-2 expression and the (-938C>A) genotypes were correlated with the patients' survival. Kaplan-Meier curves revealed a significant association of the AA genotype with increased survival (P = 0.030) in lymph node-negative breast cancer patients, whereas no genotype effect could be observed in lymph node-positive cases. Ten-year survival rates were 88.6% for the AA genotype, 78.4% for the AC genotype, and 65.8% for the CC genotype. Multivariable Cox regression identified the BCL2 (-938CC) genotype as an independent prognostic factor for cancer-related death in lymph node-negative breast carcinoma patients (hazard ratio, 3.59; P = 0.032). Immunohistochemical Bcl-2 expression was significantly associated with the clinical outcome of lymph node-positive but not of lymph node-negative breast cancer patients. In lymph node-negative cases, the (-938C>A) SNP was both significantly related with the immunohistochemically determined level of Bcl-2 expression (P = 0.044) and the survival of patients with Bcl-2-expressing carcinomas (P = 0.006). These results suggest the (-938C>A) polymorphism as a survival prognosticator as well as indicator of a high-risk group within patients with lymph node-negative breast cancer.
Pan-Cancer Analysis Links PARK2 to BCL-XL-Dependent Control of Apoptosis
Directory of Open Access Journals (Sweden)
Yongxing Gong
2017-02-01
Full Text Available Mutation of the PARK2 gene can promote both Parkinson's Disease and cancer, yet the underlying mechanisms of how PARK2 controls cellular physiology is incompletely understood. Here, we show that the PARK2 tumor suppressor controls the apoptotic regulator BCL-XL and modulates programmed cell death. Analysis of approximately 10,000 tumor genomes uncovers a striking pattern of mutual exclusivity between PARK2 genetic loss and amplification of BCL2L1, implicating these genes in a common pathway. PARK2 directly binds to and ubiquitinates BCL-XL. Inactivation of PARK2 leads to aberrant accumulation of BCL-XL both in vitro and in vivo, and cancer-specific mutations in PARK2 abrogate the ability of the ubiquitin E3 ligase to target BCL-XL for degradation. Furthermore, PARK2 modulates mitochondrial depolarization and apoptosis in a BCL-XL-dependent manner. Thus, like genes at the nodal points of growth arrest pathways such as p53, the PARK2 tumor suppressor is able to exert its antiproliferative effects by regulating both cell cycle progression and programmed cell death.
Predictive value of bcl-2 immunoreactivity in prostate cancer patients treated with radiotherapy
International Nuclear Information System (INIS)
Bylund, A.; Widmark, A.; Stattin, P.; Bergh, A.
1998-01-01
Background and purpose: Recent experimental evidence suggests that overexpression of bcl-2, a protein functioning by blocking apoptosis, may influence the treatment outcome in human tumours, including prostate cancer. To test the clinical implications of this hypothesis, tumours from patients with prostate cancer treated with external beam radiotherapy were investigated for bcl-2 immunoreactivity (IR) and correlated with prognosis and treatment outcome. Materials and methods: Bcl-2 IR was evaluated in archival tumour specimens obtained through transurethral resection from 42 patients with localized prostate cancer (T0-T4, N0 and M0). Bcl-2 IR expression was related to stage, grade and cancer-specific survival. Specimens were obtained prior to administrating routine radiotherapy for all patients. Results: Bcl-2 IR was present in 19/42 (45%) tumours. The bcl-2-positive patients had a significantly longer cancer-specific survival than the bcl-2-negative patients (10.3 versus 3.4 years, P<0.04). At follow-up (7-19 years), nine patients were still alive, 26 patients had died of prostate cancer and seven patients had died of other causes. Conclusions: This study indicates that pre-treatment bcl-2 overexpression is related to a favourable outcome in prostate cancer treated with radiotherapy. Low bcl-2 along with a high stage may be a predictor of poor prognosis and these patients might benefit from additional treatment. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)
The anti-apoptotic members of the Bcl-2 family are attractive tumor-associated antigens
DEFF Research Database (Denmark)
Straten, Per thor; Andersen, Mads Hald; Andersen, Mads Hald
2010-01-01
Anti-apoptotic members of the Bcl-2 family (Bcl-2, Bcl-X(L) and Mcl-2) are pivotal regulators of apoptotic cell death. They are all highly overexpressed in cancers of different origin in which they enhance the survival of the cancer cells. Consequently, they represent prime candidates for anti-ca...
BCL2-BH4 antagonist BDA-366 suppresses human myeloma growth.
Deng, Jiusheng; Park, Dongkyoo; Wang, Mengchang; Nooka, Ajay; Deng, Qiaoya; Matulis, Shannon; Kaufman, Jonathan; Lonial, Sagar; Boise, Lawrence H; Galipeau, Jacques; Deng, Xingming
2016-05-10
Multiple myeloma (MM) is a heterogeneous plasma cell malignancy and remains incurable. B-cell lymphoma-2 (BCL2) protein correlates with the survival and the drug resistance of myeloma cells. BH3 mimetics have been developed to disrupt the binding between BCL2 and its pro-apoptotic BCL2 family partners for the treatment of MM, but with limited therapeutic efficacy. We recently identified a small molecule BDA-366 as a BCL2 BH4 domain antagonist, converting it from an anti-apoptotic into a pro-apoptotic molecule. In this study, we demonstrated that BDA-366 induces robust apoptosis in MM cell lines and primary MM cells by inducing BCL2 conformational change. Delivery of BDA-366 substantially suppressed the growth of human MM xenografts in NOD-scid/IL2Rγnull mice, without significant cytotoxic effects on normal hematopoietic cells or body weight. Thus, BDA-366 functions as a novel BH4-based BCL2 inhibitor and offers an entirely new tool for MM therapy.
International Nuclear Information System (INIS)
Barreca, A; Martinengo, C; Annaratone, L; Righi, L; Chiappella, A; Ladetto, M; Demurtas, A; Chiusa, L; Stacchini, A; Crosetto, N; Oudenaarden, A van; Chiarle, R
2014-01-01
Most follicular lymphomas (FLs) are genetically defined by the t(14;18)(q32;q21) translocation that juxtaposes the BCL2 gene to the immunoglobulin heavy chain (IgH) 3' regulatory regions (IgH-3'RRs). Despite this recurrent translocation, FL cases are heterogeneous in terms of intratumoral clonal diversity for acquired mutations and variations in the tumor microenvironment. Here we describe an additional mechanism that contributes to inter- and intratumoral heterogeneity in FLs. By applying a novel single-molecule RNA fluorescence-based in situ hybridization (FISH) technique to detect mRNA molecules of BCL2 and IgH in single cells, we found marked heterogeneity in the number of BCL2 mRNA transcripts within individual lymphoma cells. Moreover, BCL2 mRNA molecules correlated with IgH mRNA molecules in individual cells both in t(14;18) lymphoma cell lines and in patient samples. Consistently, a strong correlation between BCL2 and IgH protein levels was found in a series of 205 primary FL cases by flow cytometry and immunohistochemistry. Inter- and intratumoral heterogeneity of BCL2 expression determined resistance to drugs commonly used in FL treatment and affected overall survival of FL patients. These data demonstrate that BCL2 and IgH expressions are heterogeneous and coregulated in t(14;18)-translocated cells, and determine the response to therapy in FL patients
Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar
2016-05-01
The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.
International Nuclear Information System (INIS)
Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng; Nakagami, Yoshihiro; Ito, Megumi; Inoue, Tomio
2005-01-01
Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cell viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2
International Nuclear Information System (INIS)
He Wenqian; Liu Zhonghua
2007-01-01
Objective: To study the effect of bcl-2 antisense oligodexynucleotides on chemotherapy efficacy of Vp-16 on human small cell lung cancer cell line NCI-H69. Methods: Cultured NCI-H69 cells were derided into 4 groups: bcl-2 antisense oligodexynucleotides (ASODN) added, sense oligodexynucleotides (SODN) added, nonsense oligodexynucleotides (NSODN) added and control (no nucleotides added), the oligodexynucleotides were transfected into the cultured cells with oligofectamine. The cellular expression of Bcl-2 protein 72h later was examined with Western-Blot. The four different groups of cultured tumor cells were treated with etopside(Vp-16) at different concentrations (0, 0.25, 0.5, 1.0, 2.0 and 4.0 μg/ml) for 48hr then the cell survival fraction was assessed with MTY test. Results: The apoptotic rate of cells in the ASODN group was significantly higher than that of the control group, also, the survival fraction of cells in ASODN group was significantly lower than that of the control group. The Bcl-2 protein expression in ASODN group was significantly lower than that in the control group, but no inhibition was observed in SODN and NSODN groups. Conclusion: The bcl-2 ASODN could enhance the sensitivity to chemotherapy with Vp-16 in small cell lung cancer cell line NCI-H69 by effectively blocking bcl-2 gene expression. (authors)
The effect of radiation on bcl-2 and bax in hyperplastic prostatic tissues
International Nuclear Information System (INIS)
Ma Qingjie; Li Yuxin; Gu Xinquan; Cao Xia; Zhao Jie; Kong Xiangbo; Cai Shanyu
2004-01-01
Aim: To investigate the expressions of bcl-2 and bax in benign prostatic hyperplasia (BPH) and the effect of β-rays on bcl-2 and bax. Methods: The expressions of bcl-2 and bax are studied by means of immunohistochemical method in 9 normal prostate (NP) and 15 BPH and 35 patients treated with 90Sr/90Y Prostatic Hyperplasia Applicator. Results: The expressions of bcl-2 in epithelia of NP and BPH are higher than that in stroma P<0.01=. The expressions of bcl-2 in epithelia and stroma of BPH are higher than that in NP P<0.01=. The expressions of bax in epithelia of NP are higher than that in BPH P<0.05=. However ,the expressions of bcl-2 in epithelia and stroma of BPH are higher than bax P<0.01 =. Compared with the control group, the expressions of bcl-2 in epithelia and stroma of BPH treated with 90Sr/90Y Prostatic Hyperplasia Applicator decreased and the expressions of bax increased P<0.01=. Conclusion: bcl-2 gene and bax gene play an important role in the regulation of prostatic apoptosis and the treatment of β-rays can accelerate the apoptosis of prostatic tissues. (authors)
International Nuclear Information System (INIS)
Anagnostou, Valsamo K; Boffa, Daniel; Gettinger, Scott; Detterbeck, Frank; Homer, Robert J; Dougenis, Dimitrios; Rimm, David L; Syrigos, Konstantinos N; Lowery, Frank J; Zolota, Vassiliki; Tzelepi, Vassiliki; Gopinath, Arun; Liceaga, Camil; Panagopoulos, Nikolaos; Frangia, Konstantina; Tanoue, Lynn
2010-01-01
Bcl-2 promotes cell survival by inhibiting adapters needed for the activation and cleavage of caspases thus blocking the proteolytic cascade that ultimately dismantles the cell. Bcl-2 has been investigated as a prognostic factor in non small cell lung cancer (NSCLC) patients with conflicting results. Here, we quantitatively assessed Bcl-2 expression in two large and independent cohorts to investigate the impact of Bcl-2 on survival. AQUA ® , a fluorescent-based method for analysis of in situ protein expression, was used to measure Bcl-2 protein levels and classify tumors by Bcl-2 expression in a cohort of 180 NSCLC patients. An independent cohort of 354 NSCLC patients was used to validate Bcl-2 classification and evaluate outcome. Fifty % and 52% of the cases were classified as high expressers in training and validation cohorts respectively. Squamous cell carcinomas were more likely to be high expressers compared to adenocarcinomas (63% vs. 45%, p = 0.002); Bcl-2 was not associated with other clinical or pathological characteristics. Survival analysis showed that patients with high BCL-2 expression had a longer median survival compared to low expressers (22 vs. 17.5 months, log rank p = 0.014) especially in the subset of non-squamous tumors (25 vs. 13.8 months, log rank p = 0.04). Multivariate analysis revealed an independent lower risk for all patients with Bcl-2 expressing tumors (HR = 0.53, 95% CI 0.37-0.75, p = 0.0003) and for patients with non-squamous tumors (HR = 0.5, 95% CI 0.31-0.81, p = 0.005). Bcl-2 expression defines a subgroup of patients with a favorable outcome and may be useful for prognostic stratification of NSCLC patients
Effect of bcl-2 overexpression in mice on ovotoxicity caused by 4-vinylcyclohexene
International Nuclear Information System (INIS)
Flaws, Jodi A.; Marion, Samuel L.; Miller, Kimberly P.; Christian, Patricia J.; Babus, Janice K.; Hoyer, Patricia B.
2006-01-01
The occupational chemical 4-vinylcyclohexene (VCH) destroys small preantral ovarian follicles in mice following repeated daily dosing. The cell survival gene bcl-2 is thought to protect against follicular death during embryogenesis because primordial follicle numbers in newborn bcl-2 overexpressing (OE) mice are greater than in wild-type (WT) controls. Thus, this study was designed to determine if overexpression of bcl-2 protects against VCH-induced follicle loss during embryonic development. Pregnant bcl-2 OE or WT mice were dosed (p.o.) daily with VCH (500 mg/kg) or sesame oil (vehicle control) on days 8-18 of pregnancy. Ovaries were collected from moms and female pups on pup postnatal day (PND) 8. Nonpregnant OE and WT females were also treated with VCH (500 mg/kg p.o.) or vehicle and evaluated in the same manner. As previously reported, ovaries from PND8 OE female pups contained 50% more primordial follicles than WT pups (P < 0.05). Unlike WT pups, relative to vehicle controls, in utero exposure to VCH resulted in a reduction in primordial (25% of control), primary (38% of control), and secondary (33% of control) follicles in ovaries of OE pups (P < 0.05). VCH had no significant effect on follicle numbers in OE or WT moms. Conversely, in nonpregnant adults, VCH did not affect WT mice but caused loss of primordial (55% of control), primary (51% of control), and secondary (69% of control) follicles in OE mice (P < 0.05). These results demonstrate that bcl-2 overexpression does not protect against, but instead increases susceptibility to VCH-induced follicle loss in transplacentally exposed or in nonpregnant mice
Expression of bcl-2 in the Epithelial Lining of Odontogenic Keratocysts
Directory of Open Access Journals (Sweden)
Gh. Jahanshahi
2006-03-01
Full Text Available Statement of Problem: The aggressive nature and high recurrence rate of Odontogenic Keratocysts (OKCs may be due to unknown factors inherent in the epithelium or because of enzymatic activity in the fibrous wall. Bcl-2 protein is characterized by its ability to inhibit apoptosis.Purpose: The aim of the present study was to analyze the expression of bcl-2 protein in OKCs and to compare it with the more common radicular and dentigerous cysts. The possible relationship between inflammation and bcl-2 expression was also investigated.Materials and Methods: Formalin fixed paraffin-embedded tissue sections of 20 OKCs, 20 radicular and 20 dentigerous cysts were immunohistochemically analyzed for immunoreactivity of the bcl-2 protein.Results: Bcl-2 expression was observed in 19 OKCs (95%, one radicular cyst (5%and one dentigerous cyst (5%. There was no statistically significant relationship between inflammation and the number of bcl-2 positive cells. Immunoreactivity was mainly noted in the basal or basal/supra basal layers.Conclusion: Considering the fact that bcl-2 over expression may lead to increased survival of epithelial cells, present study may demonstrate a possible relationship between the aggressive nature of OKC and the intrinsic growth potential of its lining epithelium. Furthermore a basal/supra basal distribution of bcl-2 positive cells was seen in some odontogenic keratocysts which may have a significant impact on the behavior of this cyst.
Directory of Open Access Journals (Sweden)
Ahmed Shalaby
2009-01-01
Full Text Available Background. We studied the effect of fast induction of cardiac arrest with denosine on myocardial bax and bcl-2 expression. Methods and Results. 40 elective CABG patients were allocated into two groups. The adenosine group (n=20 received 250 μg/kg adenosine into the aortic root followed by blood potassium cardioplegia. The control group received potassium cardioplegia in blood. Bcl-2 and bax were measured. Bax was reduced in the postoperative biopsies (1.38 versus 0.47, P=.002 in the control group. Bcl-2 showed a reducing tendency (0.14 versus 0.085, P=.07. After the adenosine treatment, the expression of both bax (0.52 versus 0.59, P=.4 and bcl-2 (0.104 versus 0.107, P=.4 remained unaltered after the operation. Conclusion. Open heart surgery is associated with rapid reduction in the expression of apoptosis regulating genes bax and bcl-2. Fast Adenosine induction abolished changes in their expression.
Vaandrager, J W; Schuuring, E; Raap, T; Philippo, K; Kleiverda, K; Kluin, P
Rearrangement of the BCL2 gene is an important parameter for the differential diagnosis of non-Hodgkin lymphomas. Although a relatively large proportion of breakpoints is clustered, many are missed by standard PCR. A FISH assay is therefore desired. Up to now, a lack of probes flanking the BCL2 gene
Identification and characterization of the Bcl-2- associated ...
African Journals Online (AJOL)
Identification and characterization of the Bcl-2- associated athanogene (BAG) protein family in rice. ... Data obtained from real-time PCR of OsBAG genes under heat stress showed that maximum induction in the expression of all the genes occurred after one hour exposure to heat stress, while reduction in the expression ...
Cannabinoids Regulate Bcl-2 and Cyclin D2 Expression in Pancreatic β Cells.
Directory of Open Access Journals (Sweden)
Jihye Kim
Full Text Available Recent reports have shown that cannabinoid 1 receptors (CB1Rs are expressed in pancreatic β cells, where they induce cell death and cell cycle arrest by directly inhibiting insulin receptor activation. Here, we report that CB1Rs regulate the expression of the anti-apoptotic protein Bcl-2 and cell cycle regulator cyclin D2 in pancreatic β cells. Treatment of MIN6 and βTC6 cells with a synthetic CB1R agonist, WIN55,212-2, led to a decrease in the expression of Bcl-2 and cyclin D2, in turn inducing cell cycle arrest in G0/G1 phase and caspase-3-dependent apoptosis. Additionally, genetic deletion and pharmacological blockade of CB1Rs after injury in mice led to increased levels of Bcl-2 and cyclin D2 in pancreatic β cells. These findings provide evidence for the involvement of Bcl-2 and cyclin D2 mediated by CB1Rs in the regulation of β-cell survival and growth, and will serve as a basis for developing new therapeutic interventions to enhance β-cell function and growth in diabetes.
Directory of Open Access Journals (Sweden)
Bin Tang
Full Text Available B-cell leukemia/lymphoma 11B (Bcl11b is a transcription factor showing predominant expression in the striatum. To date, there are no known gene targets of Bcl11b in the nervous system. Here, we define targets for Bcl11b in striatal cells by performing chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq in combination with genome-wide expression profiling. Transcriptome-wide analysis revealed that 694 genes were significantly altered in striatal cells over-expressing Bcl11b, including genes showing striatal-enriched expression similar to Bcl11b. ChIP-seq analysis demonstrated that Bcl11b bound a mixture of coding and non-coding sequences that were within 10 kb of the transcription start site of an annotated gene. Integrating all ChIP-seq hits with the microarray expression data, 248 direct targets of Bcl11b were identified. Functional analysis on the integrated gene target list identified several zinc-finger encoding genes as Bcl11b targets, and further revealed a significant association of Bcl11b to brain-derived neurotrophic factor/neurotrophin signaling. Analysis of ChIP-seq binding regions revealed significant consensus DNA binding motifs for Bcl11b. These data implicate Bcl11b as a novel regulator of the BDNF signaling pathway, which is disrupted in many neurological disorders. Specific targeting of the Bcl11b-DNA interaction could represent a novel therapeutic approach to lowering BDNF signaling specifically in striatal cells.
BCL-2: Long and winding path from discovery to therapeutic target
International Nuclear Information System (INIS)
Schenk, Robyn L.; Strasser, Andreas; Dewson, Grant
2017-01-01
In 1988, the BCL-2 protein was found to promote cancer by limiting cell death rather than enhancing proliferation. This discovery set the wheels in motion for an almost 30 year journey involving many international research teams that has recently culminated in the approval for a drug, ABT-199/venetoclax/Venclexta that targets this protein in the treatment of cancer. This review will describe the long and winding path from the discovery of this protein and understanding the fundamental process of apoptosis that BCL-2 and its numerous homologues control, through to its exploitation as a drug target that is set to have significant benefit for cancer patients. - Highlights: • BCL-2 proteins control the intrinsic or mitochondrial pathway of apoptosis. • Defective apoptosis is a hallmark of cancer. • BH3-mimetics inhibit pro-survival BCL-2 proteins to induce cancer cell death. • ABT-199/venetoclax is approved for treatment of chronic lymphocytic leukaemia.
Shishkina, Galina T; Kalinina, Tatyana S; Berezova, Inna V; Dygalo, Nikolay N
2012-01-01
Mechanisms underlying stress-induced depression and antidepressant drug action were shown to involve alterations in serotonergic (5-HT) neurotransmission and expression of genes coding for proteins associated with neurotrophic signaling pathways and cell-survival in the hippocampus and cortex. Expression of these genes in the brainstem containing 5-HT neurons may also be related to vulnerability or resilience to stress-related psychopathology. Here we investigated 5-HT markers and expression of genes for Brain-Derived Neurotrophic Factor (BDNF) and apoptotic proteins in the brainstem in relation to swim stress-induced behavioral despair. We found that anti-apoptotic Bcl-xL gene is sensitive to stress during the course of fluoxetine administration. Responsiveness of this gene to stress appeared concomitantly with an antidepressant-like effect of fluoxetine in the forced swim test. Bcl-xL transcript levels showed negative correlations with duration of immobility in the test and 5-HT turnover in the brainstem. In contrast, BDNF and pro-apoptotic protein Bax mRNA levels were unchanged by either fluoxetine or stress, suggesting specificity of Bcl-xL gene responses to these treatments. We also found that the levels of mRNAs for tryptophan hydroxylase-2 (TPH2) and 5-HT transporter (5-HTT) were significantly down-regulated following prolonged treatment with fluoxetine, but were not affected by stress. Unlike TPH2 and 5-HTT, 5-HT1A receptor mRNA levels were not altered by fluoxetine but significantly increased in response to swim stress. These data show that long-term fluoxetine treatment leads to changes in 5-HT and Bcl-xL responses to stress associated with antidepressant-like effects of the drug. This article is part of a Special Issue entitled 'Anxiety and Depression'. Copyright © 2011 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Pedersen, Mette Ølgod; Gang, Anne Ortved; Brown, Peter
2017-01-01
BACKGROUND: Double expression of MYC and BCL2 proteins (DE) and double-hit MYC+BCL2/BCL6 translocations (DH) were established as important biomarkers in patients with diffuse large B-cell lymphoma (DLBCL) by the 2016 revision of the World Health Organization classification of lymphoid neoplasms...... in situ hybridization (FISH). RESULTS: DE with MYC>75% and BCL2>85% was an independent negative prognostic marker of progression free survival (PFS) in patients treated with R-CHOP but not R-CHOEP (peffect of DE for response (PFS) to R...
Mak, Po Yee; Mu, Hong; Zhou, Hongsheng; Mak, Duncan H.; Schober, Wendy; Leverson, Joel D.; Zhang, Bin; Bhatia, Ravi; Huang, Xuelin; Cortes, Jorge; Kantarjian, Hagop; Konopleva, Marina
2016-01-01
BCR-ABL tyrosine kinase inhibitors (TKIs) are effective against chronic myeloid leukemia (CML), but they rarely eliminate CML stem cells. Disease relapse is common upon therapy cessation, even in patients with complete molecular responses. Furthermore, once CML progresses to blast crisis (BC), treatment outcomes are dismal. We hypothesized that concomitant targeting of BCL-2 and BCR-ABL tyrosine kinase could overcome these limitations. We demonstrate increased BCL-2 expression at the protein level in bone marrow cells, particularly in Lin−Sca-1+cKit+ cells of inducible CML in mice as determined by CyTOF mass cytometry. Further, selective inhibition of BCL-2, aided by TKI-mediated MCL-1 and BCL-XL inhibition, markedly decreased leukemic Lin−Sca-1+cKit+ cell numbers and long-term stem cell frequency, and prolonged survival in a murine CML model. Additionally, this combination effectively eradicated CD34+CD38−, CD34+CD38+, and quiescent stem/progenitor CD34+ cells from BC CML patient samples. Our results suggest that BCL-2 is a key survival factor for CML stem/progenitor cells and that combined inhibition of BCL-2 and BCR-ABL tyrosine kinase has the potential to significantly improve depth of response and cure rates of chronic phase and BC CML. PMID:27605552
International Nuclear Information System (INIS)
Logsdon, Mark D.; Meyn, Raymond E.; Besa, Pelayo C.; Pugh, William C.; Stephens, L. Clifton; Peters, Lester J.; Milas, Luka; Cox, James D.; Cabanillas, Fernando; Brisbay, Shawn; Andersen, Margret; McDonnell, Timothy J.
1999-01-01
Purpose: The prognostic significance of spontaneous levels of apoptosis and Bcl-2, Bax, and Bcl-x protein expression in follicular center lymphoma (FCL) is unknown. The objectives of this retrospective study were (1) to investigate the relationship between pretreatment apoptosis levels and long-term treatment outcome in patients with Stage I and II FCL; (2) to define the incidence and patterns of Bax and Bcl-x protein expression in human FC; and (3) to determine the relationship of Bcl-2, Bax, and Bcl-x expression with spontaneous apoptosis levels and clinical outcome in localized FCL. Methods and Materials: Between 1974 and 1988, 144 patients with Stage I or II FCL were treated. Hematoxylin and eosin (H and E) stained tissue sections of pretreatment specimens were retrieved for 96 patients. Treatment consisted of regional radiation therapy (XRT) for 25 patients, combined modality therapy (CMT) consisting of combination chemotherapy and XRT for 57 patients, and other treatments for 14 patients. Median follow-up for living patients was nearly 12 years. The apoptotic index (AI) was calculated by dividing the number of apoptotic cells by the total number of cells counted and multiplying by 100. Expression of Bcl-2, Bax, and Bcl-x proteins was assessed using immunohistochemistry. Results: The mean and median AI values for the entire group were 0.53 and 0.4, respectively (range: 0-5.2). The AI strongly correlated with cytologic grade, with mean AI values of 0.25 for grade 1, 0.56 for grade 2, and 0.84 for grade 3 (p < 0.0005; Kendall correlation). A positive correlation was present between grouped AI and grouped mitotic index (MI) (p = 0.014). For patients treated with CMT, an AI < 0.4 correlated with improved freedom from relapse (FFR) (p = 0.0145) and overall survival (OS) (p = 0.0081). An AI < 0.4 did not correlate with clinical outcome for the entire cohort or for patients receiving XRT only. Staining of tumor follicles for the Bcl-2 protein was positive, variable
Akt regulates drug-induced cell death through Bcl-w downregulation.
Garofalo, Michela; Quintavalle, Cristina; Zanca, Ciro; De Rienzo, Assunta; Romano, Giulia; Acunzo, Mario; Puca, Loredana; Incoronato, Mariarosaria; Croce, Carlo M; Condorelli, Gerolama
2008-01-01
Akt is a serine threonine kinase with a major role in transducing survival signals and regulating proteins involved in apoptosis. To find new interactors of Akt involved in cell survival, we performed a two-hybrid screening in yeast using human full-length Akt c-DNA as bait and a murine c-DNA library as prey. Among the 80 clones obtained, two were identified as Bcl-w. Bcl-w is a member of the Bcl-2 family that is essential for the regulation of cellular survival, and that is up-regulated in different human tumors, such as gastric and colorectal carcinomas. Direct interaction of Bcl-w with Akt was confirmed by immunoprecipitation assays. Subsequently, we addressed the function of this interaction: by interfering with the activity or amount of Akt, we have demonstrated that Akt modulates the amount of Bcl-w protein. We have found that inhibition of Akt activity may promote apoptosis through the downregulation of Bcl-w protein and the consequential reduction in interaction of Bcl-w with pro-apoptotic members of the Bcl-2 family. Our data provide evidence that Bcl-w is a new member of the Akt pathway and that Akt may induce anti-apoptotic signals at least in part through the regulation of the amount and activity of Bcl-w.
Csatlós, Éva; Máté, Szabolcs; Laky, Marcella; Rigó, János; Joó, József Gábor
2015-07-01
To describe gene expression patterns of the apoptotic regulatory genes Bcl and Bax in human uterine leiomyoma tissue. To investigate the relationship between alterations of gene expression patterns and several relevant clinical parameters. We obtained samples from 101 cases undergoing surgery for uterine leiomyoma for gene expression analysis of the Bcl-2 and Bax genes. Gene expression was quantified using RT-PCR technique. In the leiomyoma group, the Bcl-2 gene was significantly overexpressed compared with the control group although there was no such difference in the gene expression of Bax. Gene activity of Bcl-2 positively correlated with the tumor number in individual uterine leiomyoma cases. Although there was no significant correlation between the length of the cumulative lactation period before the development of uterine leiomyoma and Bcl-2 gene expression in the leiomyoma tissue, we observed a trend for a shorter cumulative lactation period to be associated with overexpression of the Bcl-2 gene. Overexpression of the antiapoptotic Bcl-2 gene appeared to be a factor in the development of uterine leiomyoma, whereas gene activity of the proapoptotic Bax gene did not seem to play a role in the process.
van Delft, Mark F.; Wei, Andrew H.; Mason, Kylie D.; Vandenberg, Cassandra J.; Chen, Lin; Czabotar, Peter E.; Willis, Simon N.; Scott, Clare L.; Day, Catherine L.; Cory, Suzanne; Adams, Jerry M.; Roberts, Andrew W.; Huang, David C.S.
2006-01-01
Since apoptosis is impaired in malignant cells overexpressing pro-survival Bcl-2 proteins, drugs mimicking their natural antagonists, BH3-only proteins, might overcome chemoresistance. Of seven putative BH3 mimetics tested, only ABT-737 triggered Bax/Bak-mediated apoptosis. Despite its high affinity for Bcl-2, Bcl-xL and Bcl-w, many cell types proved refractory to ABT-737. We show that this resistance reflects its inability to target another pro-survival relative, Mcl-1. Down-regulation of Mc...
Yu, Albert Cheung Hoi; Yung, Hon Wa; Hui, Michael Hung Kit; Lau, Lok Ting; Chen, Xiao Qian; Collins, Richard A
2003-10-15
An in vitro ischemia model was established and the effect of the metabolic inhibitors cycloheximide (CHX) and actinomycin D (ActD) on apoptosis in astrocytes under ischemia studied. CHX decreased by 75% the number of cells dying after 6 hr of ischemia compared with control cultures. TdT-mediated dUTP nick end labelling (TUNEL) staining of comparable cultures was reduced by 40%. ActD decreased cell death by 60% compared with controls. The number of TUNEL-positive cells was reduced by 38%. The nuclear shrinkage in TUNEL-positive astrocytes in control cultures did not occur in ActD-treated astrocytes, indicating that nuclear shrinkage and DNA fragmentation during apoptosis are two unrelated processes. Expression of bcl-2 (alpha and beta), bax, and Ice in astrocytes under similar ischemic conditions, as measured by quantitative reverse transcription-polymerase chain reaction, indicated that ischemia down-regulated bcl-2 (alpha and beta) and bax. Ice was initially down-regulated from 0 to 4 hr, before returning to control levels after 8 hr of ischemia. ActD decreased the expression of these genes. CHX reduced the expression of bcl-2 (alpha and beta) but increased bax and Ice expression. It is hypothesized that the balance of proapoptotic (Bad, Bax) and antiapoptotic (Bcl-2, Bcl-Xl) proteins determines apoptosis. The data suggest that the ratio of Bcl-2/Bad in astrocytes following ActD and CHX treatment does not decrease as much in untreated cells during ischemia. Our data indicate that it is the ratio of Bcl-2 family members that plays a critical role in determining ischemia-induced apoptosis. It is also important to note that ischemia-induced apoptosis involves the regulation of RNA and protein synthesis. Copyright 2003 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Elainy Patricia Lino Gasparotto
2011-12-01
Full Text Available Apoptosis deregulation might have a role in the pathophysiology of polycythemia vera (PV. This study evaluated Bcl-2 molecule expression in CD34+ cells and leukocytes in 12 PV patients. Gene expression was investigated by real time PCR using SybrGreen Quantitect kit and protein expression was evaluated by western-blotting. JAK2 V617F mutation was detected according to Baxter et al (2005. CD34+ cells from PV patients presented higher levels of A1 and Mcl-1 expression (median: 22.6 and 5.2, respectively in comparison with controls (0.9 and 0.5, p=0.004 and p=0.020; while Bcl-2 and Bcl-xL expression decreased in PV patients (0.18 and 1.19 compared with controls (1.39 and 2.01, p=0.006 and p=0.020. CD34+ cells in PV patients showed an elevated Bid expression (14.4 in comparison with healthy subjects (1.0; p=0.002. Patients' leukocytes showed an A1 augmentation (7.41, p=0.001 and a reduced expression of Bax (0.19; p=0.040 and Bad (0.2; p=0.030. There was no correlation between JAK2 V617F allele burden and molecular expression. PV patients showed alterations in Bcl-2 members' expression, which may interfere with control of apoptotic machinery and contribute to disease pathogenesis.A desregulação da apoptose parece participar da fisiopatologia da policitemia vera (PV. Este estudo avaliou a expressão das moléculas da família Bcl-2 em células hematopoéticas CD34 + e leucócitos de 12 pacientes com PV. Foram realizados: a quantificação da expressão gênica por PCR em tempo real utilizando kit Sybrgreen Quantitect, avaliação da expressão de proteínas por western-blot e detecção da mutação JAK2 V617F segundo Baxter et al. (2005. Células CD34 + dos pacientes com PV apresentaram maior expressão de A1 e Mcl-1 (mediana: 22,6 e 5,2, respectivamente em comparação com controles (0,9 e 0,5, p = 0,004 e p = 0,020 e expressão de Bcl-2 e Bcl-xL diminuída nestes pacientes (0,18 e 1,19 em relação aos controles (1,39 e 2,01, p = 0,006 e p = 0
International Nuclear Information System (INIS)
Pantano, Serafino; Jarrossay, David; Saccani, Simona; Bosisio, Daniela; Natoli, Gioacchino
2006-01-01
Dendritic cell (DC) maturation links peripheral events initiated by the encounter with pathogens to the activation and expansion of antigen-specific T lymphocytes in secondary lymphoid organs. Here, we describe an as yet unrecognized modulator of human DC maturation, the transcriptional repressor BCL6. We found that both myeloid and plasmacytoid DCs constitutively express BCL6, which is rapidly downregulated following maturation triggered by selected stimuli. Both in unstimulated and maturing DCs, control of BCL6 protein levels reflects the convergence of several mechanisms regulating BCL6 stability, mRNA transcription and nuclear export. By regulating the induction of several genes implicated in the immune response, including inflammatory cytokines, chemokines and survival genes, BCL6 may represent a pivotal modulator of the afferent branch of the immune response
Directory of Open Access Journals (Sweden)
Rama Jasty
2001-01-01
Full Text Available The bcl-2 and c-myc oncogenes cooperate to transform multiple cell types. In the pediatric malignancy NB2, Bcl2 is highly expressed. In tumors with a poor prognosis, N-Myc, a protein homologous to c-Myc, is overexpressed as a result of gene amplification. The present study was designed to determine whether Bcl-2 cooperates with N-Myc to bestow a tumorigenic phenotype to neuroblastoma (NB cells. NB cell lines that at baseline express neither Bcl-2 nor N-Myc were stably transfected to express these gene products. In this model, we found Bcl-2 rescues N-Myc-expressing cells from apoptosis induced by serum withdrawal. Coexpression of Bcl-2 and N-Myc supports growth in low serum conditions and anchorage-independent growth in soft agar. Similarly, in vivo tumorigenic and angiogenic activity was dependent on coexpression. Our data further suggests that the mechanism underlying these changes involves the receptor for insulin growth factor type I (IGF-IR.
Akt regulates drug-induced cell death through Bcl-w downregulation.
Directory of Open Access Journals (Sweden)
Michela Garofalo
Full Text Available Akt is a serine threonine kinase with a major role in transducing survival signals and regulating proteins involved in apoptosis. To find new interactors of Akt involved in cell survival, we performed a two-hybrid screening in yeast using human full-length Akt c-DNA as bait and a murine c-DNA library as prey. Among the 80 clones obtained, two were identified as Bcl-w. Bcl-w is a member of the Bcl-2 family that is essential for the regulation of cellular survival, and that is up-regulated in different human tumors, such as gastric and colorectal carcinomas. Direct interaction of Bcl-w with Akt was confirmed by immunoprecipitation assays. Subsequently, we addressed the function of this interaction: by interfering with the activity or amount of Akt, we have demonstrated that Akt modulates the amount of Bcl-w protein. We have found that inhibition of Akt activity may promote apoptosis through the downregulation of Bcl-w protein and the consequential reduction in interaction of Bcl-w with pro-apoptotic members of the Bcl-2 family. Our data provide evidence that Bcl-w is a new member of the Akt pathway and that Akt may induce anti-apoptotic signals at least in part through the regulation of the amount and activity of Bcl-w.
Hamunyela, Roswita H; Serafin, Antonio M; Akudugu, John M
2017-02-01
Targeting pro-survival cell signaling components has been promising in cancer therapy, but the benefit of targeting with single agents is limited. For malignancies such as triple-negative breast cancer, there is a paucity of targets that are amenable to existing interventions as they are devoid of the human epidermal growth factor receptor 2 (HER2), progesterone receptor (PR), and estrogen receptor (ER). Concurrent targeting of cell signaling entities other than HER2, PR and ER with multiple agents may be more effective. Evaluating modes of interaction between agents can inform efficient selection of agents when used in cocktails. Using clonogenic cell survival, interaction between inhibitors of HER2 (TAK-165), phosphoinositide 3-kinase (PI3K) and mammalian target of rapamycin (mTOR) (NVP-BEZ235), and the pro-survival gene (Bcl-2) (ABT-263) in three human breast cell lines (MDA-MB-231, MCF-7 and MCF-12A) ranged from strong to very strong synergism. The strongest synergy was demonstrated in PR and ER negative cells. Inhibition of PI3K, mTOR and Bcl-2 could potentially be effective in the treatment of triple-negative cancers. The very strong synergy observed even at lowest concentrations of inhibitors indicates that these cocktails might be able to be used at a minimised risk of systemic toxicity. Concurrent use of multiple inhibitors can potentiate conventional interventions like radiotherapy and chemotherapy. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Liu Guangwei; Wang Chunyan; Lu Zhe; Liu Shunchun; Gong Shouliang
2003-01-01
The different kinds of spermatogenic cells were separated using density gradient centrifugation and their apoptosis and Bcl-2 and Bax protein expression were measured with flow cytometry and immunohistochemical method, respectively. The results showed the apoptosis in all kinds of spermatogenic cells induced by low dose radiation (LDR) had a obvious regularity. When the doses were 0.025 and 0.05 Gy, spermatogonia apoptosis was dominant. With the increase of irradiation dose (0.075-0.2 Gy), spermatocytes also showed an apoptotic change, but the apoptotic percentage of spermatogonia was significantly higher than that of spermatocytes. Moreover, the apoptosis of spermatids and spermatozoa scarcely occurred after LDR. Bax protein was primarily expressed in spermatogonia and spermatocytes, and the former was significantly higher than that of the latter after LDR. With the increase of irradiation dose, Bax protein expression showed a upgrading tendency, but that of spermatids and spermatozoa scarcely occurred. Bcl-2 protein was primarily expressed in spermatids and spermatozoa, but the Bcl-2 protein expressions of spermatogonia and spermatocytes scarcely occurred after LDR. These results imply that the interacting regulation of Bcl-2 and Bax gene expression might be involved in selective apoptosis of spermatogenic cells induced by LDR, which provided an experimental evidence for further exploring the apoptotic mechanism of adaptive response of spermatogenic cells by LDR
Inhibition of Bcl-2 or IAP proteins does not provoke mutations in surviving cells
Energy Technology Data Exchange (ETDEWEB)
Shekhar, Tanmay M. [Department of Biochemistry, La Trobe Institute for Molecular Science, La Trobe University, Bundoora 3083 (Australia); Green, Maja M. [Department of Biochemistry, La Trobe Institute for Molecular Science, La Trobe University, Bundoora 3083 (Australia); Department of Anatomy & Neuroscience, The University of Melbourne, Parkville 3010 (Australia); Rayner, David M.; Miles, Mark A.; Cutts, Suzanne M. [Department of Biochemistry, La Trobe Institute for Molecular Science, La Trobe University, Bundoora 3083 (Australia); Hawkins, Christine J., E-mail: c.hawkins@latrobe.edu.au [Department of Biochemistry, La Trobe Institute for Molecular Science, La Trobe University, Bundoora 3083 (Australia)
2015-07-15
Graphical abstract: - Highlights: • Mutagenicities of anti-cancer drugs were tested using HPRT, γH2AX and comet assays. • TRAIL, doxorubicin and etoposide were more mutagenic than BH3- or Smac-mimetics. • Physiologically achievable levels of the BH3-mimetic ABT-737 were not mutagenic. • High concentrations of ABT-737 provoked mutations via an off-target mechanism. • Even very high concentrations of IAP antagonists were not mutagenic. - Abstract: Chemotherapy and radiotherapy can cause permanent damage to the genomes of surviving cells, provoking severe side effects such as second malignancies in some cancer survivors. Drugs that mimic the activity of death ligands, or antagonise pro-survival proteins of the Bcl-2 or IAP families have yielded encouraging results in animal experiments and early phase clinical trials. Because these agents directly engage apoptosis pathways, rather than damaging DNA to indirectly provoke tumour cell death, we reasoned that they may offer another important advantage over conventional therapies: minimisation or elimination of side effects such as second cancers that result from mutation of surviving normal cells. Disappointingly, however, we previously found that concentrations of death receptor agonists like TRAIL that would be present in vivo in clinical settings provoked DNA damage in surviving cells. In this study, we used cell line model systems to investigate the mutagenic capacity of drugs from two other classes of direct apoptosis-inducing agents: the BH3-mimetic ABT-737 and the IAP antagonists LCL161 and AT-406. Encouragingly, our data suggest that IAP antagonists possess negligible genotoxic activity. Doses of ABT-737 that were required to damage DNA stimulated Bax/Bak-independent signalling and exceeded concentrations detected in the plasma of animals treated with this drug. These findings provide hope that cancer patients treated by BH3-mimetics or IAP antagonists may avoid mutation-related illnesses that afflict
Inhibition of Bcl-2 or IAP proteins does not provoke mutations in surviving cells
International Nuclear Information System (INIS)
Shekhar, Tanmay M.; Green, Maja M.; Rayner, David M.; Miles, Mark A.; Cutts, Suzanne M.; Hawkins, Christine J.
2015-01-01
Graphical abstract: - Highlights: • Mutagenicities of anti-cancer drugs were tested using HPRT, γH2AX and comet assays. • TRAIL, doxorubicin and etoposide were more mutagenic than BH3- or Smac-mimetics. • Physiologically achievable levels of the BH3-mimetic ABT-737 were not mutagenic. • High concentrations of ABT-737 provoked mutations via an off-target mechanism. • Even very high concentrations of IAP antagonists were not mutagenic. - Abstract: Chemotherapy and radiotherapy can cause permanent damage to the genomes of surviving cells, provoking severe side effects such as second malignancies in some cancer survivors. Drugs that mimic the activity of death ligands, or antagonise pro-survival proteins of the Bcl-2 or IAP families have yielded encouraging results in animal experiments and early phase clinical trials. Because these agents directly engage apoptosis pathways, rather than damaging DNA to indirectly provoke tumour cell death, we reasoned that they may offer another important advantage over conventional therapies: minimisation or elimination of side effects such as second cancers that result from mutation of surviving normal cells. Disappointingly, however, we previously found that concentrations of death receptor agonists like TRAIL that would be present in vivo in clinical settings provoked DNA damage in surviving cells. In this study, we used cell line model systems to investigate the mutagenic capacity of drugs from two other classes of direct apoptosis-inducing agents: the BH3-mimetic ABT-737 and the IAP antagonists LCL161 and AT-406. Encouragingly, our data suggest that IAP antagonists possess negligible genotoxic activity. Doses of ABT-737 that were required to damage DNA stimulated Bax/Bak-independent signalling and exceeded concentrations detected in the plasma of animals treated with this drug. These findings provide hope that cancer patients treated by BH3-mimetics or IAP antagonists may avoid mutation-related illnesses that afflict
Immunogenicity of Bcl-2 in patients with cancer
DEFF Research Database (Denmark)
Andersen, Mads Hald; Svane, Inge Marie; Kvistborg, Pia
2005-01-01
patients suffering from unrelated tumor types (ie, pancreatic cancer, breast cancer, acute myeloid leukemia [AML], and chronic lymphocytic leukemia [CLL]). Additionally, we show that these Bcl-2-reactive T cells are indeed peptide-specific, cytotoxic effector cells. Thus, Bcl-2 may serve as an important......B-cell lymphoma 2 (Bcl-2) is a pivotal regulator of apoptotic cell death and it is overexpressed in many cancers. Consequently, the Bcl-2 protein is an attractive target for drug design, and Bcl-2-specific antisense oligonucleotides or small-molecule Bcl-2 inhibitors have shown broad anticancer......-2 in cancer and the fact that immune escape by down-regulation or loss of expression of this protein would impair sustained tumor growth makes Bcl-2 a very attractive target for anticancer immunotherapy. Herein, we describe spontaneous T-cell reactivity against Bcl-2 in peripheral blood from...
Directory of Open Access Journals (Sweden)
Falah M
2016-07-01
Full Text Available Masoumeh Falah,1,2 Mohammad Najafi,2 Massoud Houshmand,3 Mohammad Farhadi1 1ENT and Head & Neck Research Center and Department, Iran University of Medical Sciences, Tehran, Iran; 2Cellular and Molecular Research Center, Biochemistry Department, Iran University of Medical Sciences, Tehran, Iran; 3Department of Medical Genetics, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran Abstract: Age-related hearing impairment (ARHI is a progressive and a common sensory disorder in the elderly and will become an increasingly important clinical problem given the growing elderly population. Apoptosis of cochlear cells is an important factor in animal models of ARHI. As these cells cannot regenerate, their loss leads to irreversible hearing impairment. Identification of molecular mechanisms can facilitate disease prevention and effective treatment. In this study, we compared the expression of the genes BAK1 and BCL2 as two arms of the intrinsic apoptosis pathway between patients with ARHI and healthy subjects. ARHI and healthy subjects were selected after an ear nose throat examination, otoscopic investigation, and pure tone audiometry. RNA was extracted from peripheral blood samples, and relative gene expression levels were measured using quantitative real-time polymerase chain reaction. BAK1 and the BAK1/BCL2 ratio were statistically significantly upregulated in the ARHI subjects. The BAK1/BCL2 ratio was positively correlated with the results of the audiometric tests. Our results indicate that BAK-mediated apoptosis may be a core mechanism in the progression of ARHI in humans, similar to finding in animal models. Moreover, the gene expression changes in peripheral blood samples could be used as a rapid and simple biomarker for early detection of ARHI. Keywords: age-related hearing impairment (ARHI, presbycusis, biomarker, treatment
Double-hit or dual expression of MYC and BCL2 in primary cutaneous large B-cell lymphomas.
Menguy, Sarah; Frison, Eric; Prochazkova-Carlotti, Martina; Dalle, Stephane; Dereure, Olivier; Boulinguez, Serge; Dalac, Sophie; Machet, Laurent; Ram-Wolff, Caroline; Verneuil, Laurence; Gros, Audrey; Vergier, Béatrice; Beylot-Barry, Marie; Merlio, Jean-Philippe; Pham-Ledard, Anne
2018-03-26
In nodal diffuse large B-cell lymphoma, the search for double-hit with MYC and BCL2 and/or BCL6 rearrangements or for dual expression of BCL2 and MYC defines subgroups of patients with altered prognosis that has not been evaluated in primary cutaneous large B-cell lymphoma. Our objectives were to assess the double-hit and dual expressor status in a cohort of 44 patients with primary cutaneous large B-cell lymphoma according to the histological subtype and to evaluate their prognosis relevance. The 44 cases defined by the presence of more than 80% of large B-cells in the dermis corresponded to 21 primary cutaneous follicle centre lymphoma with large cell morphology and 23 primary cutaneous diffuse large B-cell lymphoma, leg type. Thirty-one cases (70%) expressed BCL2 and 29 (66%) expressed MYC. Dual expressor profile was observed in 25 cases (57%) of either subtypes (n = 6 or n = 19, respectively). Only one primary cutaneous follicle centre lymphoma, large-cell case had a double-hit status (2%). Specific survival was significantly worse in primary cutaneous diffuse large B-cell lymphoma, leg type than in primary cutaneous follicle centre lymphoma, large cell (p = 0.021) and for the dual expressor primary cutaneous large B-cell lymphoma group (p = 0.030). Both overall survival and specific survival were worse for patients belonging to the dual expressor primary cutaneous diffuse large B-cell lymphoma, leg type subgroup (p = 0.001 and p = 0.046, respectively). Expression of either MYC and/or BCL2 negatively impacted overall survival (p = 0.017 and p = 0.018 respectively). As the differential diagnosis between primary cutaneous follicle centre lymphoma, large cell and primary cutaneous diffuse large B-cell lymphoma, leg type has a major impact on prognosis, dual-expression of BCL2 and MYC may represent a new diagnostic criterion for primary cutaneous diffuse large B-cell lymphoma, leg type subtype and further identifies patients with
The downregulation of Mcl-1 via USP9X inhibition sensitizes solid tumors to Bcl-xl inhibition
International Nuclear Information System (INIS)
Peddaboina, Chander; Smythe, W Roy; Cao, Xiaobo; Jupiter, Daniel; Fletcher, Steven; Yap, Jeremy L; Rai, Arun; Tobin, Richard P; Jiang, Weihua; Rascoe, Philip; Rogers, M Karen Newell
2012-01-01
It has been shown in many solid tumors that the overexpression of the pro-survival Bcl-2 family members Bcl-xL and Mcl-1 confers resistance to a variety of chemotherapeutic agents. Mcl-1 is a critical survival protein in a variety of cell lineages and is critically regulated via ubiquitination. The Mcl-1, Bcl-xL and USP9X expression patterns in human lung and colon adenocarcinomas were evaluated via immunohistochemistry. Interaction between USP9X and Mcl-1 was demonstrated by immunoprecipitation-western blotting. The protein expression profiles of Mcl-1, Bcl-xL and USP9X in multiple cancer cell lines were determined by western blotting. Annexin-V staining and cleaved PARP western blotting were used to assay for apoptosis. The cellular toxicities after various treatments were measured via the XTT assay. In our current analysis of colon and lung cancer samples, we demonstrate that Mcl-1 and Bcl-xL are overexpressed and also co-exist in many tumors and that the expression levels of both genes correlate with the clinical staging. The downregulation of Mcl-1 or Bcl-xL via RNAi was found to increase the sensitivity of the tumor cells to chemotherapy. Furthermore, our analyses revealed that USP9X expression correlates with that of Mcl-1 in human cancer tissue samples. We additionally found that the USP9X inhibitor WP1130 promotes Mcl-1 degradation and increases tumor cell sensitivity to chemotherapies. Moreover, the combination of WP1130 and ABT-737, a well-documented Bcl-xL inhibitor, demonstrated a chemotherapeutic synergy and promoted apoptosis in different tumor cells. Mcl-1, Bcl-xL and USP9X overexpression are tumor survival mechanisms protective against chemotherapy. USP9X inhibition increases tumor cell sensitivity to various chemotherapeutic agents including Bcl-2/Bcl-xL inhibitors
Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao
2015-01-01
Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
Directory of Open Access Journals (Sweden)
Selma Olsson Åkefeldt
2013-01-01
Full Text Available Rheumatoid arthritis (RA and Langerhans cell histiocytosis (LCH are common and rare diseases, respectively. They associate myeloid cell recruitment and survival in inflammatory conditions with tissue destruction and bone resorption. Manipulating dendritic cell (DC, and, especially, regulating their half-life and fusion, is a challenge. Indeed, these myeloid cells display pathogenic roles in both diseases and may be an important source of precursors for differentiation of osteoclasts, the bone-resorbing multinucleated giant cells. We have recently documented that the proinflammatory cytokine IL-17A regulates long-term survival of DC by inducing BCL2A1 expression, in addition to the constitutive MCL1 expression. We summarize bibliography of the BCL2 family members and their therapeutic targeting, with a special emphasis on MCL1 and BCL2A1, discussing their potential impact on RA and LCH. Our recent knowledge in the survival pathway, which is activated to perform DC fusion in the presence of IL-17A, suggests that targeting MCL1 and BCL2A1 in infiltrating DC may affect the clinical outcomes in RA and LCH. The development of new therapies, interfering with MCL1 and BCL2A1 expression, to target long-term surviving inflammatory DC should be translated into preclinical studies with the aim to increase the well-being of patients with RA and LCH.
Bcl-2 overexpression prevents 99mTc-MIBI uptake in breast cancer cell lines
International Nuclear Information System (INIS)
Aloj, Luigi; Zannetti, Antonella; Caraco, Corradina; Del Vecchio, Silvana; Salvatore, Marco
2004-01-01
We have previously shown a correlation between the absence of technetium-99m methoxyisobutylisonitrile ( 99m Tc-MIBI) uptake and overexpression of the anti-apoptotic protein Bcl-2 in human breast carcinoma. To establish a direct cause-effect relationship between Bcl-2 overexpression and reduced 99m Tc-MIBI uptake, MCF-7 and T47D breast cancer cell lines were stably transfected with the human Bcl-2 gene to increase intracellular protein levels and tested for 99m Tc-MIBI uptake. All clones overexpressing Bcl-2 showed a dramatic reduction of 99m Tc-MIBI uptake as compared with mock transfected control cells. Tracer uptake was promptly and partially restored by induction of apoptosis with staurosporine treatment. After 4.5 h of staurosporine treatment, a tenfold increase in 99m Tc-MIBI uptake was observed in treated as compared with untreated Bcl-2 overexpressing cells. Our findings provide a rational basis for the development of an in vivo test to detect Bcl-2 overexpression in human tumours. (orig.)
Yang, Xiao; Zhu, Fan; Yu, Chaoran; Lu, Jiaoyang; Zhang, Luyang; Lv, Yanfeng; Sun, Jing; Zheng, Minhua
2017-07-18
N-myc downstream-regulated gene1 (NDRG1) has been identified as a potent tumor suppressor gene. The molecular mechanisms of anti-tumor activity of NDRG1 involve its suppressive effects on a variety of tumorigenic signaling pathways. The purpose of this study was to investigate the role of NDRG1 in the apoptosis of colorectal cancer (CRC) cells. We first collected the clinical data of locally advanced rectal cancer (LARC) patients receiving oxaliplatin-based neoadjuvant chemotherapy in our medical center. Correlation analysis revealed that NDRG1 positively associated with the downstaging rates and prognosis of patients. Then, the effects of over-expression and depletion of NDRG1 gene on apoptosis of colorectal cancer were tested in vitro and in vivo. NDRG1 over-expression promoted apoptosis in colorectal cancer cells whereas depletion of NDRG1 resulted in resistance to oxaliplatin treatment. Furthermore, we observed that Bcl-2, a major anti-apoptotic protein, was regulated by NDRG1 at post-transcriptional level. By binding Protein kinase Cα (PKCα), a classical regulating factor of Bcl-2, NDRG1 enhanced the ubiquitination and degradation of Bcl-2, thus promoting apoptosis in CRC cells. In addition, NDRG1 inhibited tumor growth and promoted apoptosis in mouse xenograft model. In conclusion,NDRG1 promotes oxaliplatin-triggered apoptosis in colorectal cancer. Therefore, colorectal cancer patients can be stratified by the expression level of NDRG1. NDRG1-positive patients may benefit from oxaliplatin-containing chemotherapy regimens whereas those with negative NDRG1 expression should avoid the usage of this cytotoxic drug.
The BCL6 RD2 Domain Governs Commitment of Activated B Cells to Form Germinal Centers
Directory of Open Access Journals (Sweden)
Chuanxin Huang
2014-09-01
Full Text Available To understand how the Bcl6 transcriptional repressor functions in the immune system, we disrupted its RD2 repression domain in mice. Bcl6RD2MUT mice exhibit a complete loss of germinal center (GC formation but retain normal extrafollicular responses. Bcl6RD2MUT antigen-engaged B cells migrate to the interfollicular zone and interact with cognate T helper cells. However, these cells fail to complete early GC-commitment differentiation and coalesce as nascent GC aggregates. Bcl6 directly binds and represses trafficking receptors S1pr1 and Gpr183 by recruiting Hdac2 through the RD2 domain. Deregulation of these genes impairs B cell migration and may contribute to GC failure in Bcl6RD2MUT mice. The development of functional GC-TFH cells was partially impaired in Bcl6RD2MUT mice. In contrast to Bcl6−/− mice, Bcl6RD2MUT animals experience no inflammatory disease or macrophage deregulation. These results reveal an essential role for RD2 repression in early GC commitment and striking biochemical specificity in Bcl6 control of humoral and innate immune-cell phenotypes.
Immunogenicity of Bcl-2 in patients with cancer
DEFF Research Database (Denmark)
Andersen, Mads Hald; Svane, Inge Marie; Kvistborg, Pia
2005-01-01
activities in preclinical models and are currently in several clinical trials. The clinical application of immunotherapy against cancer is rapidly moving forward in multiple areas, including the adoptive transfer of anti-tumor-reactive T cells and the use of "therapeutic" vaccines. The overexpression of Bcl......-2 in cancer and the fact that immune escape by down-regulation or loss of expression of this protein would impair sustained tumor growth makes Bcl-2 a very attractive target for anticancer immunotherapy. Herein, we describe spontaneous T-cell reactivity against Bcl-2 in peripheral blood from......B-cell lymphoma 2 (Bcl-2) is a pivotal regulator of apoptotic cell death and it is overexpressed in many cancers. Consequently, the Bcl-2 protein is an attractive target for drug design, and Bcl-2-specific antisense oligonucleotides or small-molecule Bcl-2 inhibitors have shown broad anticancer...
The T-ALL related gene BCL11B regulates the initial stages of human T-cell differentiation.
Ha, V L; Luong, A; Li, F; Casero, D; Malvar, J; Kim, Y M; Bhatia, R; Crooks, G M; Parekh, C
2017-11-01
The initial stages of T-cell differentiation are characterized by a progressive commitment to the T-cell lineage, a process that involves the loss of alternative (myelo-erythroid, NK, B) lineage potentials. Aberrant differentiation during these stages can result in T-cell acute lymphoblastic leukemia (T-ALL). However, the mechanisms regulating the initial stages of human T-cell differentiation are obscure. Through loss of function studies, we showed BCL11B, a transcription factor recurrently mutated T-ALL, is essential for T-lineage commitment, particularly the repression of NK and myeloid potentials, and the induction of T-lineage genes, during the initial stages of human T-cell differentiation. In gain of function studies, BCL11B inhibited growth of and induced a T-lineage transcriptional program in T-ALL cells. We found previously unknown differentiation stage-specific DNA binding of BCL11B at multiple T-lineage genes; target genes showed BCL11B-dependent expression, suggesting a transcriptional activator role for BCL11B at these genes. Transcriptional analyses revealed differences in the regulatory actions of BCL11B between human and murine thymopoiesis. Our studies show BCL11B is a key regulator of the initial stages of human T-cell differentiation and delineate the BCL11B transcriptional program, enabling the dissection of the underpinnings of normal T-cell differentiation and providing a resource for understanding dysregulations in T-ALL.
Foxp1 controls mature B cell survival and the development of follicular and B-1 B cells
Patzelt, Thomas; Keppler, Selina J.; Gorka, Oliver; Thoene, Silvia; Wartewig, Tim; Reth, Michael; Förster, Irmgard; Lang, Roland; Buchner, Maike; Ruland, Jürgen
2018-01-01
The transcription factor Foxp1 is critical for early B cell development. Despite frequent deregulation of Foxp1 in B cell lymphoma, the physiological functions of Foxp1 in mature B cells remain unknown. Here, we used conditional gene targeting in the B cell lineage and report that Foxp1 disruption in developing and mature B cells results in reduced numbers and frequencies of follicular and B-1 B cells and in impaired antibody production upon T cell-independent immunization in vivo. Moreover, Foxp1-deficient B cells are impaired in survival even though they exhibit an increased capacity to proliferate. Transcriptional analysis identified defective expression of the prosurvival Bcl-2 family gene Bcl2l1 encoding Bcl-xl in Foxp1-deficient B cells, and we identified Foxp1 binding in the regulatory region of Bcl2l1. Transgenic overexpression of Bcl2 rescued the survival defect in Foxp1-deficient mature B cells in vivo and restored peripheral B cell numbers. Thus, our results identify Foxp1 as a physiological regulator of mature B cell survival mediated in part via the control of Bcl-xl expression and imply that this pathway might contribute to the pathogenic function of aberrant Foxp1 expression in lymphoma. PMID:29507226
Estradiol increases the Bax/Bcl-2 ratio and induces apoptosis in the anterior pituitary gland.
Zaldivar, Verónica; Magri, María Laura; Zárate, Sandra; Jaita, Gabriela; Eijo, Guadalupe; Radl, Daniela; Ferraris, Jimena; Pisera, Daniel; Seilicovich, Adriana
2009-01-01
Estrogens are recognized as acting as modulators of pituitary cell renewal, sensitizing cells to mitogenic and apoptotic signals, thus participating in anterior pituitary homeostasis during the estrous cycle. The balance of pro- and antiapoptotic proteins of the Bcl-2 family is known to regulate cell survival and apoptosis. In order to understand the mechanisms underlying apoptosis during the estrous cycle, we evaluated the expression of the proapoptotic protein Bax and the antiapoptotic proteins Bcl-2 and Bcl-xL in the anterior pituitary gland in cycling female rats as well as the influence of estradiol on the expression of these proteins in anterior pituitary cells of ovariectomized rats. As determined by Western blot, the expression of Bax was higher in anterior pituitary glands from rats at proestrus than at diestrus I, Bcl-2 protein levels showed no difference and Bcl-xL expression was lower, thus increasing the Bax/Bcl-2 ratio at proestrus. Assessed by annexin V binding and flow cytometry, the percentage of apoptotic anterior pituitary cells was higher in rats at proestrus than at diestrus I. Chronic estrogen treatment in ovariectomized rats enhanced the Bax/Bcl-2 ratio and induced apoptosis. Moreover, incubation of cultured anterior pituitary cells from ovariectomized rats with 17beta-estradiol for 24 h increased the Bax/Bcl-2 ratio, decreased Bcl-xL expression and induced apoptosis. Our results demonstrate that estradiol increases the ratio between proapoptotic and antiapoptotic proteins of the Bcl-2 family. This effect could participate in the sensitizing action of estrogens to proapoptotic stimuli and therefore be involved in the high apoptotic rate observed at proestrus in the anterior pituitary gland.
Directory of Open Access Journals (Sweden)
Mette Ølgod Pedersen
Full Text Available Double expression of MYC and BCL2 proteins (DE and double-hit MYC+BCL2/BCL6 translocations (DH were established as important biomarkers in patients with diffuse large B-cell lymphoma (DLBCL by the 2016 revision of the World Health Organization classification of lymphoid neoplasms. Whether this applies to the subgroup of young patients with high risk DLBCL is not known. We previously found that in a uniform retrospective population-based cohort of patients aged 18-60 years with high-risk DLBCL, the addition of etoposide to R-CHOP chemotherapy (R-CHOEP resulted in improved survival mainly in patients with germinal center B-cell like (GCB immunophenotype. The aim of this study was to investigate the prognostic and predictive value of DE and DH in this patient cohort.Data on all young Danish patients diagnosed with de novo high-risk DLBCL 2004-2008 and treated with R-CHOP or R-CHOEP were obtained from the Danish Lymphoma database (n = 159. Tumor samples were available from 103 patients. MYC and BCL2 proteins were analyzed with quantitative immunohistochemistry (IHC using different cut off values. MYC-, BCL2- and BCL6-translocations were examined with fluorescent in situ hybridization (FISH.DE with MYC>75% and BCL2>85% was an independent negative prognostic marker of progression free survival (PFS in patients treated with R-CHOP but not R-CHOEP (p<0.001, also after exclusion of patients with DH. A predictive effect of DE for response (PFS to R-CHOEP vs. R-CHOP was almost significant (p = 0.07. DH was not prognostic in this patient cohort.In young patients with high-risk DLBCL, treatment with R-CHOEP may overcome the negative prognostic impact of DE observed in patients treated with R-CHOP.
International Nuclear Information System (INIS)
Zhang, X.; Li, L.; Zhang, L.; Borowitz, J.L.; Isom, G.E.
2009-01-01
Cyanide is a potent inhibitor of mitochondrial oxidative metabolism and produces mitochondria-mediated death of dopaminergic neurons and sublethal intoxications that are associated with a Parkinson-like syndrome. Cyanide toxicity is enhanced when mitochondrial uncoupling is stimulated following up-regulation of uncoupling protein-2 (UCP-2). In this study, the role of a pro-survival protein, Bcl-2, in cyanide-mediated cell death was determined in a rat dopaminergic immortalized mesencephalic cell line (N27 cells). Following pharmacological up-regulation of UCP-2 by treatment with Wy14,643, cyanide reduced cellular Bcl-2 expression by increasing proteasomal degradation of the protein. The increased turnover of Bcl-2 was mediated by an increase of oxidative stress following UCP-2 up-regulation. The oxidative stress involved depletion of mitochondrial glutathione (mtGSH) and increased H 2 O 2 generation. Repletion of mtGSH by loading cells with glutathione ethyl ester reduced H 2 O 2 generation and in turn blocked the cyanide-induced decrease of Bcl-2. To determine if UCP-2 mediated the response, RNAi knock down was conducted. The RNAi decreased cyanide-induced depletion of mtGSH, reduced H 2 O 2 accumulation, and inhibited down-regulation of Bcl-2, thus blocking cell death. To confirm the role of Bcl-2 down-regulation in the cell death, it was shown that over-expression of Bcl-2 by cDNA transfection attenuated the enhancement of cyanide toxicity after UCP-2 up-regulation. It was concluded that UCP-2 up-regulation sensitizes cells to cyanide by increasing cellular oxidative stress, leading to an increase of Bcl-2 degradation. Then the reduced Bcl-2 levels sensitize the cells to cyanide-mediated cell death.
Soleymaninejad, Masoume; Joursaraei, Seyed Gholamali; Feizi, Farideh; Jafari Anarkooli, Iraj
2017-01-01
The aim of this study was to evaluate the effects of antioxidants lycopene and insulin on histological changes and expression of Bcl-2 family genes in the hippocampus of streptozotocin-induced type 1 diabetic rats. Forty-eight Wistar rats were divided into six groups of control (C), control treated with lycopene (CL), diabetic (D), diabetic treated with insulin (DI), diabetic treated with lycopene (DL), and diabetic treated with insulin and lycopene (DIL). Diabetes was induced by an injection of streptozotocin (60 mg/kg, IP), lycopene (4 mg/kg/day) was given to the lycopene treated groups as gavages, and insulin (Sc, 1-2 U/kg/day) was injected to the groups treated with insulin. The number of hippocampus neurons undergoing cell death in group D had significant differences with groups C and DIL ( p lycopene alone or together reduced the expression of Bax , but increased Bcl-2 and Bcl-x L levels in DI, DL, and DIL rats, especially when compared to group D ( p lycopene contribute to the prevention of cell death by reducing the expression of proapoptotic genes and increasing the expression of antiapoptotic genes in the hippocampus.
Xue, Xiaodong; Liu, Yu; Zhang, Jian; Liu, Tao; Yang, Zhonglu; Wang, Huishan
2015-01-01
Objectives. Low survival rate of mesenchymal stem cells (MSCs) severely limited the therapeutic efficacy of cell therapy in the treatment of myocardial infarction (MI). Bcl-xL genetic modification might enhance MSC survival after transplantation. Methods. Adult rat bone marrow MSCs were modified with human Bcl-xL gene (hBcl-xL-MSCs) or empty vector (vector-MSCs). MSC apoptosis and paracrine secretions were characterized using flow cytometry, TUNEL, and ELISA in vitro. In vivo, randomized adult rats with MI received myocardial injections of one of the three reagents: hBcl-xL-MSCs, vector-MSCs, or culture medium. Histochemistry, TUNEL, and echocardiography were carried out to evaluate cell engraftment, apoptosis, angiogenesis, scar formation, and cardiac functional recovery. Results. In vitro, cell apoptosis decreased 43%, and vascular endothelial growth factor (VEGF), insulin-like growth factor-1 (IGF-1), and plate-derived growth factor (PDGF) increased 1.5-, 0.7-, and 1.2-fold, respectively, in hBcl-xL-MSCs versus wild type and vector-MSCs. In vivo, cell apoptosis decreased 40% and 26% in hBcl-xL-MSC group versus medium and vector-MSC group, respectively. Similar results were observed in cell engraftment, angiogenesis, scar formation, and cardiac functional recovery. Conclusions. Genetic modification of MSCs with hBcl-xL gene could be an intriguing strategy to improve the therapeutic efficacy of cell therapy in the treatment of heart infarction.
Bag3 promotes resistance to apoptosis through Bcl-2 family members in non-small cell lung cancer.
Zhang, Yong; Wang, Jian-Hua; Lu, Qiang; Wang, Yun-Jie
2012-01-01
In non-small cell lung cancer (NSCLC) certain molecular characteristics, which are related to molecular alterations have been investigated. These are responsible for both the initiation and maintenance of the malignancy in lung cancer. The aim of this study was to evaluate the influence of Bag3 (Bcl-2 associated athanogene 3) in the regulation of apoptosis on NSCLC. Bag3 and Hsp70 expression were examined by immunohistochemistry to confirm their potential roles in the prevalence of NSCLC. We also established human normal bronchial epithelial cells and HOP-62 cell line as the model to analyze cell apoptosis and the expression of Hsp70, Bcl-XL and Bcl-2, which were affected by Bag3. In this study, we found that Bag3 and Hsp70 are highly expressed in few tissues and cell lines of NSCLC. Bag3 inhibits apoptosis in human normal bronchial epithelial cell lines and sustain the survival of NSCLC cells. Bag3, Hsp70, Bcl-XL and Bcl-2 are up-regulated in NSCLC cell lines. At the same time, the silencing of Bag3 results in diminishing protein levels of Bcl-XL and Bcl-2. The results of immunoprecipitation identified that Bag3 could interact with Hsp70, Bcl-XL and Bcl-2 NSCLC cells directly or indirectly. We conclude that NSCLC cells were protected from apoptosis through increasing Bag3 expression and consequently promoted the expression of Bcl-XL and Bcl-2.
Eliminating Legionella by inhibiting BCL-XL to induce macrophage apoptosis.
Speir, Mary; Lawlor, Kate E; Glaser, Stefan P; Abraham, Gilu; Chow, Seong; Vogrin, Adam; Schulze, Keith E; Schuelein, Ralf; O'Reilly, Lorraine A; Mason, Kylie; Hartland, Elizabeth L; Lithgow, Trevor; Strasser, Andreas; Lessene, Guillaume; Huang, David C S; Vince, James E; Naderer, Thomas
2016-02-24
Human pathogenic Legionella replicate in alveolar macrophages and cause a potentially lethal form of pneumonia known as Legionnaires' disease(1). Here, we have identified a host-directed therapeutic approach to eliminate intracellular Legionella infections. We demonstrate that the genetic deletion, or pharmacological inhibition, of the host cell pro-survival protein BCL-XL induces intrinsic apoptosis of macrophages infected with virulent Legionella strains, thereby abrogating Legionella replication. BCL-XL is essential for the survival of Legionella-infected macrophages due to bacterial inhibition of host-cell protein synthesis, resulting in reduced levels of the short-lived, related BCL-2 pro-survival family member, MCL-1. Consequently, a single dose of a BCL-XL-targeted BH3-mimetic therapy, or myeloid cell-restricted deletion of BCL-XL, limits Legionella replication and prevents lethal lung infections in mice. These results indicate that repurposing BH3-mimetic compounds, originally developed to induce cancer cell apoptosis, may have efficacy in treating Legionnaires' and other diseases caused by intracellular microbes.
Kazi, Aslamuzzaman; Sun, Jiazhi; Doi, Kenichiro; Sung, Shen-Shu; Takahashi, Yoshinori; Yin, Hang; Rodriguez, Johanna M.; Becerril, Jorge; Berndt, Norbert; Hamilton, Andrew D.; Wang, Hong-Gang; Sebti, Saïd M.
2011-01-01
A critical hallmark of cancer cell survival is evasion of apoptosis. This is commonly due to overexpression of anti-apoptotic proteins such as Bcl-2, Bcl-XL, and Mcl-1, which bind to the BH3 α-helical domain of pro-apoptotic proteins such as Bax, Bak, Bad, and Bim, and inhibit their function. We designed a BH3 α-helical mimetic BH3-M6 that binds to Bcl-XL and Mcl-1 and prevents their binding to fluorescently labeled Bak- or Bim-BH3 peptides in vitro. Using several approaches, we demonstrate that BH3-M6 is a pan-Bcl-2 antagonist that inhibits the binding of Bcl-XL, Bcl-2, and Mcl-1 to multi-domain Bax or Bak, or BH3-only Bim or Bad in cell-free systems and in intact human cancer cells, freeing up pro-apoptotic proteins to induce apoptosis. BH3-M6 disruption of these protein-protein interactions is associated with cytochrome c release from mitochondria, caspase-3 activation and PARP cleavage. Using caspase inhibitors and Bax and Bak siRNAs, we demonstrate that BH3-M6-induced apoptosis is caspase- and Bax-, but not Bak-dependent. Furthermore, BH3-M6 disrupts Bcl-XL/Bim, Bcl-2/Bim, and Mcl-1/Bim protein-protein interactions and frees up Bim to induce apoptosis in human cancer cells that depend for tumor survival on the neutralization of Bim with Bcl-XL, Bcl-2, or Mcl-1. Finally, BH3-M6 sensitizes cells to apoptosis induced by the proteasome inhibitor CEP-1612. PMID:21148306
Lin, Grace; LaPensee, Christopher R; Qin, Zhaohui S; Schwartz, Jessica
2014-09-01
Expression of the Growth Hormone (GH)-stimulated gene Socs2 (Suppressor of Cytokine Signaling 2) is mediated by the transcription activator STAT5 (Signal Transducer and Activator of Transcription 5) and the transcription repressor BCL6 (B-Cell Lymphoma 6). ChIP-Sequencing identified Cish (Cytokine-Inducible SH2-containing protein) and Bcl6 as having similar patterns of reciprocal occupancy by BCL6 and STAT5 in response to GH, though GH stimulates Cish and inhibits Bcl6 expression. The co-activator p300 occupied Socs2, Cish and Bcl6 promoters, and enhanced STAT5-mediated activation of Socs2 and Cish. In contrast, on Bcl6, p300 functioned as a repressor and inhibited in conjunction with STAT5 or BCL6. The co-repressor HDAC3 (Histone deacetylase 3) inhibited the Socs2, Cish and Bcl6 promoters in the presence of STAT5. Thus transcriptional outcomes on GH-regulated genes occupied by BCL6 and STAT5 are determined in a promoter-specific fashion by co-regulatory proteins which mediate the distinction between activating and repressive transcription factors. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Effect of Bcl-2 rs956572 polymorphism on age-related gray matter volume changes.
Directory of Open Access Journals (Sweden)
Mu-En Liu
Full Text Available The anti-apoptotic protein B-cell CLL/lymphoma 2 (Bcl-2 gene is a major regulator of neural plasticity and cellular resilience. Recently, the Bcl-2 rs956572 single nucleotide polymorphism was proposed to be a functional allelic variant that modulates cellular vulnerability to apoptosis. Our cross-sectional study investigated the genetic effect of this Bcl-2 polymorphism on age-related decreases in gray matter (GM volume across the adult lifespan. Our sample comprised 330 healthy volunteers (191 male, 139 female with a mean age of 56.2±22.0 years (range: 21-92. Magnetic resonance imaging and genotyping of the Bcl-2 rs956572 were performed for each participant. The differences in regional GM volumes between G homozygotes and A-allele carriers were tested using optimized voxel-based morphometry. The association between the Bcl-2 rs956572 polymorphism and age was a predictor of regional GM volumes in the right cerebellum, bilateral lingual gyrus, right middle temporal gyrus, and right parahippocampal gyrus. We found that the volume of these five regions decreased with increasing age (all P<.001. Moreover, the downward slope was steeper among the Bcl-2 rs956572 A-allele carriers than in the G-homozygous participants. Our data provide convergent evidence for the genetic effect of the Bcl-2 functional allelic variant in brain aging. The rs956572 G-allele, which is associated with significantly higher Bcl-2 protein expression and diminished cellular sensitivity to stress-induced apoptosis, conferred a protective effect against age-related changes in brain GM volume, particularly in the cerebellum.
Kazi, Aslamuzzaman; Sun, Jiazhi; Doi, Kenichiro; Sung, Shen-Shu; Takahashi, Yoshinori; Yin, Hang; Rodriguez, Johanna M; Becerril, Jorge; Berndt, Norbert; Hamilton, Andrew D; Wang, Hong-Gang; Sebti, Saïd M
2011-03-18
A critical hallmark of cancer cell survival is evasion of apoptosis. This is commonly due to overexpression of anti-apoptotic proteins such as Bcl-2, Bcl-X(L), and Mcl-1, which bind to the BH3 α-helical domain of pro-apoptotic proteins such as Bax, Bak, Bad, and Bim, and inhibit their function. We designed a BH3 α-helical mimetic BH3-M6 that binds to Bcl-X(L) and Mcl-1 and prevents their binding to fluorescently labeled Bak- or Bim-BH3 peptides in vitro. Using several approaches, we demonstrate that BH3-M6 is a pan-Bcl-2 antagonist that inhibits the binding of Bcl-X(L), Bcl-2, and Mcl-1 to multi-domain Bax or Bak, or BH3-only Bim or Bad in cell-free systems and in intact human cancer cells, freeing up pro-apoptotic proteins to induce apoptosis. BH3-M6 disruption of these protein-protein interactions is associated with cytochrome c release from mitochondria, caspase-3 activation and PARP cleavage. Using caspase inhibitors and Bax and Bak siRNAs, we demonstrate that BH3-M6-induced apoptosis is caspase- and Bax-, but not Bak-dependent. Furthermore, BH3-M6 disrupts Bcl-X(L)/Bim, Bcl-2/Bim, and Mcl-1/Bim protein-protein interactions and frees up Bim to induce apoptosis in human cancer cells that depend for tumor survival on the neutralization of Bim with Bcl-X(L), Bcl-2, or Mcl-1. Finally, BH3-M6 sensitizes cells to apoptosis induced by the proteasome inhibitor CEP-1612.
Bcl-2 protein level in blood of patients with acute myeloid leukaemia ...
African Journals Online (AJOL)
(AML), bcl-2 being an anti-apoptotic protein incriminated in cancer. ... resistant to apoptosis, defining this protein as a factor of bad prognosis in AML. Moreover, the determination ..... of the molecular mechanisms of physiological ... long term survival in breast cancer, Am. J. Pathol. ... Burkitt subtype at presentation, and is not.
Bcl-2 overexpression: effects on transmembrane calcium movement
International Nuclear Information System (INIS)
Rangaswami, Arun A.; Premack, Brett; Walleczek, Jan; Killoran, Pamela; Gardner, Phyllis; Knox, Susan J.
1996-01-01
Purpose/Objective: High levels of expression of the proto-oncogene bcl-2 and its 26 kD protein product Bcl-2 have been correlated with the inhibition of apoptosis and the increased resistance of tumor cells to cytotoxic drugs and ionizing radiation. Unfortunately, the specific mechanism of action of Bcl-2 remains poorly understood. In the studies described here, the role of intracellular calcium fluxes and plasma membrane calcium cycling in the induction of apoptosis, and the effect of Bcl-2 expression on the modulation of transmembrane calcium fluxes following treatment of cells with cytotoxic agents were studied. The relationship between intracellular calcium release, capacitive calcium entry, and the plasma membrane potential were also investigated. Materials and Methods: Human B-cell lymphoma (PW) and human promyelocytic leukemia (HL60) cell lines were transfected with Bcl-2 and a control vector. The Bcl-2 transfectants over expressed the Bcl-2 onco-protein and were more resistant to irradiation than the control cells. Cells were loaded with fluorescent indicators indo-1 and fura-2 AM to quantify the cytosolic calcium concentration and subsequent calcium responses to a variety of cytotoxic stimuli, including the microsomal ATPase inhibitor, thapsigargin, using fluorometric measurements. Comparisons of resting and stimulated cytosolic calcium concentrations were made between the parental, neomycin control, and bcl-2 transfected cells. In order to determine the actual calcium influx rate, cells were loaded with either indo-1 or fura-2 and then exposed to 0.1 mM extracellular manganese, which enters the cells through calcium influx channels and quenches the fluorescent signal in proportion to the calcium influx rate. In order to determine the role of the membrane potential in driving calcium influx, cells were treated with either 0.1 μM Valinomycin or isotonic potassium chloride to either hyper polarize or depolarize the resting membrane potential, and the
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
The Bcl-2 Family in Host-Virus Interactions.
Kvansakul, Marc; Caria, Sofia; Hinds, Mark G
2017-10-06
Members of the B cell lymphoma-2 (Bcl-2) family are pivotal arbiters of mitochondrially mediated apoptosis, a process of fundamental importance during tissue development, homeostasis, and disease. At the structural and mechanistic level, the mammalian members of the Bcl-2 family are increasingly well understood, with their interplay ultimately deciding the fate of a cell. Dysregulation of Bcl-2-mediated apoptosis underlies a plethora of diseases, and numerous viruses have acquired homologs of Bcl-2 to subvert host cell apoptosis and autophagy to prevent premature death of an infected cell. Here we review the structural biology, interactions, and mechanisms of action of virus-encoded Bcl-2 proteins, and how they impact on host-virus interactions to ultimately enable successful establishment and propagation of viral infections.
Directory of Open Access Journals (Sweden)
Wang J
2015-09-01
Full Text Available Jing Wang,* Min Zhou,* Jing-Yan Xu,* Bing Chen, Jian OuyangDepartment of Hematology, The Affiliated Drum Tower Hospital of Nanjing University Medical School, Nanjing, Jiangsu, People’s Republic of China*These authors contributed equally to this work and should be considered as cofirst authorsPurpose: To evaluate whether the addition of two biological markers (MYC and BCL-2 protein overexpression improves the stratification of high-risk patients with diffuse large B-cell lymphoma (DLBCL.Method: Seven risk factors were identified at diagnosis, and a maximum of 7 points were assigned to each patient. The patients were classified according to four risk groups: low (0–1, low-intermediate (2–3, high-intermediate (4, and high (5–7. Only high-risk patients with DLBCL were included in this analysis. We retrospectively examined 20 cases from 2008 to 2013 at the Nanjing Drum Tower Hospital.Results: The median expression of MYC protein was 60%, and 17 of 20 (65% evaluable cases overexpressed MYC. The median expression of BCL-2 protein was also 60%. Eighteen of 20 (90% evaluable cases showed BCL-2 overexpression. Additionally, 12 out of 20 cases (60% demonstrated coexpression of MYC and BCL-2 proteins. The percentages of overall survival and progression-free survival at the median follow-up time (36 months were 33.3%±16.1% and 16.9%±13.5%, respectively. By comparison, nine, four, and 20 patients were classified as high risk based on the International Prognostic Index (IPI, National Comprehensive Cancer Network(NCCN-IPI, and revised IPI criteria, respectively. According to the IPI and NCCN-IPI stratification, the risk groups demonstrated closely overlapping survival curves. In addition, four out of 20 cases were identified as low-intermediate risk according to the NCCN-IPI criteria.Conclusion: The addition of MYC and BCL-2 protein expression to the IPI could identify a subset of DLBCL patients with high-risk clinicopathological characteristics and
Increased expression of Bcl-2 during mucous cell metaplasia induced by endotoxin and ozone
Energy Technology Data Exchange (ETDEWEB)
Tesfaigzi, J.; Ray, L.M.; Hotchkiss, J.A. [Michigan State Univ., East Lansing, MI (United States)] [and others
1995-12-01
Apoptosis or programmed cell death is accompanied by characteristic morphological changes that distinguish apoptosis from other forms of cell death. These changes include DNA fragmentation, chromatin condensation, cell shrinkage, cell surface pseudopodia, and finally the cellular collapse into membrane-enclosed apoptotic bodies which are rapidly engulfed by macrophages or neighboring cells. Although the morphological features of apoptotic cells are well studied, the biochemical events that control apoptosis are not understood. Programmed cell death is triggered by a variety of pathways that are initiated by different stimuli including noxious agents, DNA damage, the activation of TNF receptors, or the withdrawl of growth factors. The central process of programmed cell death involves a cascade of biochemical events that begins with the initiation of a family of cysteine proteases, including the interleukin-1-{Beta}-converting enzyme, CPP-32, and Apopain. The ratio of Bax, a death-inducer gene, to Bcl-2, an apoptosis suppressor gene, determines whether or not the main apoptotic pathyway is blocked. Apoptosis is suppressed if the ratio of Bcl-2/Bax is > 1, and cells undergo apoptosis if the ratio is < 1. The overexpression of Bcl-2 has been shown to block the apoptotic program triggered by a variety of agents. Therefore, Bcl-2 must be involved in blocking the central pathway of the cell death program. In conclusion, this study showed that high levels of Bcl-2 were detected in some mucous cells at specific time points during mucous cell metaplasia, and this expression was reduced at later time points or was absent after remodeling of this epithelium.
Diagnosis of mantle cell lymphoma and detection of bcl-1 gene rearrangement
International Nuclear Information System (INIS)
Lee, Seung Sook; Cho, Kyung Ja; Lee, Sun Joo
1996-12-01
We reclassified a large series of non-Hogkin's lymphoma diagnosed at Korea Cancer Center Hospital from 1991 to 1995, according to REAL classification, and compared the efficacy of immunohistochemical study for cyclin D1 protein and PCR for bcl-1 gene rearrangement to diagnose mantle cell lymphoma (MCL). By REAL classification, 7 %, diffuse large B-cell lymphoma was the most common type (51.8%) and was followed by peripheral T-cell lymphoma-unspecified (10%) and angiocentric lymphoma (7.5%). The most reliable histologic finding was mitosis to make a differential diagnosis. Mitoses of MCL were 17/10 HPF in average and all the cases showed more than 10/10 HPF. Immunophenotypic study alone cannot lead to a differential diagnosis between MCL and SLL, and the overexpression of cyclin D1 was the most important for diagnosis of MCL . Both immunohistochemistry for cyclin D1 and PCR for bcl-1 were specific for MCL and immunohistochemistry was more sensitive than PCR. Statistical analysis showed a different survival rate between MCL and the other low-grade B-cell lymphomas (SLL + MALT + LPL) and a difference between MCL and SLL. Immunohistochemical detection of cyclin D1 has a practical usefulness in making routine diagnosis of MCL. The initial accurate diagnosis of MCL will help clinicians make a proper management. (author). 27 refs., 6 tabs., 4 figs
Diagnosis of mantle cell lymphoma and detection of bcl-1 gene rearrangement
Energy Technology Data Exchange (ETDEWEB)
Lee, Seung Sook; Cho, Kyung Ja; Lee, Sun Joo [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-12-01
We reclassified a large series of non-Hogkin`s lymphoma diagnosed at Korea Cancer Center Hospital from 1991 to 1995, according to REAL classification, and compared the efficacy of immunohistochemical study for cyclin D1 protein and PCR for bcl-1 gene rearrangement to diagnose mantle cell lymphoma (MCL). By REAL classification, 7 %, diffuse large B-cell lymphoma was the most common type (51.8%) and was followed by peripheral T-cell lymphoma-unspecified (10%) and angiocentric lymphoma (7.5%). The most reliable histologic finding was mitosis to make a differential diagnosis. Mitoses of MCL were 17/10 HPF in average and all the cases showed more than 10/10 HPF. Immunophenotypic study alone cannot lead to a differential diagnosis between MCL and SLL, and the overexpression of cyclin D1 was the most important for diagnosis of MCL . Both immunohistochemistry for cyclin D1 and PCR for bcl-1 were specific for MCL and immunohistochemistry was more sensitive than PCR. Statistical analysis showed a different survival rate between MCL and the other low-grade B-cell lymphomas (SLL + MALT + LPL) and a difference between MCL and SLL. Immunohistochemical detection of cyclin D1 has a practical usefulness in making routine diagnosis of MCL. The initial accurate diagnosis of MCL will help clinicians make a proper management. (author). 27 refs., 6 tabs., 4 figs.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Bcl-2 prevents loss of mitochondria in CCCP-induced apoptosis
International Nuclear Information System (INIS)
Graaf, Aniek O. de; Heuvel, Lambert P. van den; Dijkman, Henry B.P.M.; Abreu, Ronney A. de; Birkenkamp, Kim U.; Witte, Theo de; Reijden, Bert A. van der; Smeitink, Jan A.M.; Jansen, Joop H.
2004-01-01
Bcl-2 family proteins regulate apoptosis at the level of mitochondria. To examine the mechanism of Bcl-2 function, we investigated the effects of the protonophore carbonyl cyanide m-chlorophenyl hydrazone (CCCP) on two hematopoietic cell lines and Bcl-2 overexpressing transfectants. CCCP directly interferes with mitochondrial function and induces apoptosis. We show that Bcl-2 inhibits apoptosis and that the antiapoptotic effect of Bcl-2 takes place upstream of caspase activation and nuclear changes associated with apoptosis, since these were markedly inhibited in cells overexpressing Bcl-2. Bcl-2 does not prevent the decrease in mitochondrial membrane potential nor the alterations in cellular ATP content induced by CCCP in FL5.12 and Jurkat cells. A higher number of mitochondria was observed in untreated Bcl-2 transfected cells compared to parental cells, as shown by electron microscopy. Exposure to CCCP induced a dramatic decrease in the number of mitochondria and severely disrupted mitochondrial ultrastructure, with apparent swelling and loss of cristae in parental cells. Bcl-2 clearly diminished the disruption of mitochondrial structure and preserved a higher number of mitochondria. These data suggest that CCCP induces apoptosis by structural disruption of mitochondria and that Bcl-2 prevents apoptosis and mitochondrial degeneration by preserving mitochondrial integrity
Bcl-2 prevents loss of mitochondria in CCCP-induced apoptosis.
de Graaf, Aniek O; van den Heuvel, Lambert P; Dijkman, Henry B P M; de Abreu, Ronney A; Birkenkamp, Kim U; de Witte, Theo; van der Reijden, Bert A; Smeitink, Jan A M; Jansen, Joop H
2004-10-01
Bcl-2 family proteins regulate apoptosis at the level of mitochondria. To examine the mechanism of Bcl-2 function, we investigated the effects of the protonophore carbonyl cyanide m-chlorophenyl hydrazone (CCCP) on two hematopoietic cell lines and Bcl-2 overexpressing transfectants. CCCP directly interferes with mitochondrial function and induces apoptosis. We show that Bcl-2 inhibits apoptosis and that the antiapoptotic effect of Bcl-2 takes place upstream of caspase activation and nuclear changes associated with apoptosis, since these were markedly inhibited in cells overexpressing Bcl-2. Bcl-2 does not prevent the decrease in mitochondrial membrane potential nor the alterations in cellular ATP content induced by CCCP in FL5.12 and Jurkat cells. A higher number of mitochondria was observed in untreated Bcl-2 transfected cells compared to parental cells, as shown by electron microscopy. Exposure to CCCP induced a dramatic decrease in the number of mitochondria and severely disrupted mitochondrial ultrastructure, with apparent swelling and loss of cristae in parental cells. Bcl-2 clearly diminished the disruption of mitochondrial structure and preserved a higher number of mitochondria. These data suggest that CCCP induces apoptosis by structural disruption of mitochondria and that Bcl-2 prevents apoptosis and mitochondrial degeneration by preserving mitochondrial integrity.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
Directory of Open Access Journals (Sweden)
Lech Chyczewski
2012-01-01
Full Text Available The objective of this study was to verify the frequency of P53 and BCL-2 immunohistochemical expression in 98 patients with endometrial carcinoma, and to correlate it with clinical stage and patient survival. A significant difference was found regarding the frequency of P53 expression when comparing type I and II tumors (23.7% and 54.5%, respectively; p = 0.006. A positive correlation was observed between P53 immunoexpression and patient survival in type I and II tumors (p = 0.009 and p = 0.036, respectively. BCL-2 expression was significantly more frequent in early clinical stages in both types of endometrial cancer (p < 0.001 and 0.002 and correlated with a decrease in overall survival in type I endometrial cancer (p = 0.014. Thus, the prognostic value of these biomarkers in endometrial cancer needs to be further investigated. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 4, pp. 631–635
Bartchewsky, Waldemar; Martini, Mariana R; Squassoni, Aline C; Alvarez, Marisa C; Ladeira, Marcelo S P; Salvatore, Daisy M F; Trevisan, Miriam A; Pedrazzoli, José; Ribeiro, Marcelo L
2010-01-01
The aim of the present study is to evaluate the influence of Helicobacter pylori on Bax and Bcl-2 mRNA and protein levels in patients with chronic gastritis and gastric cancer. The study included 217 patients, of which 26 were uninfected; 127 had chronic gastritis and were H. pylori-positive, and 64 had gastric cancer. Bacterial genotypes were evaluated by PCR, and the expression values were determined by quantitative real-time PCR and immunohistochemistry. Our data showed that the up-regulationary effects of H. pylori infection on the pro-apoptotic gene, Bax, were stronger than its induction of Bcl-2; this effect may increase apoptosis in patients with chronic gastritis. In patients with gastric cancer, the up-regulation of the anti-apoptotic gene, Bcl-2, counteracted the pro-apoptotic effects of Bax, leading to a deregulation of apoptosis-associated gene expression, favoring cell proliferation. Thus, the disturbance in Bax and Bcl-2 balance, induced by H. pylori, might be important in gastric cancer development.
International Nuclear Information System (INIS)
Dai, Guodong; Peng, Tao; Zhou, Xuhong; Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi; Yuan, Yulin
2013-01-01
Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and
Energy Technology Data Exchange (ETDEWEB)
Dai, Guodong [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Peng, Tao; Zhou, Xuhong [Department of Otolaryngology-Head and Neck Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Zhu, Jun; Kong, Zhihua; Ma, Li; Xiong, Zhi [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China); Yuan, Yulin, E-mail: yuanyulin19620120@126.com [Anatomy and Embryology, Wuhan University School of Medicine, Wuhan, Hubei 430071 (China)
2013-11-01
Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messenger RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and
Chowdhury, Indrajit; Thompson, Winston E; Welch, Crystal; Thomas, Kelwyn; Matthews, Roland
2013-12-01
Mammalian ovarian follicular development is tightly regulated by crosstalk between cell death and survival signals, which include both endocrine and intra-ovarian regulators. Whether the follicle ultimately ovulates or undergoes atresia is dependent on the expression and actions of factors promoting follicular cell proliferation, differentiation or apoptosis. Prohibitin (PHB) is a highly conserved, ubiquitous protein that is abundantly expressed in granulosa cells (GCs) and associated with GC differentiation and apoptosis. The current study was designed to characterize the regulation of anti-apoptotic and pro-apoptotic factors in undifferentiated rat GCs (gonadotropin independent phase) governed by PHB. Microarray technology was initially employed to identify potential apoptosis-related genes, whose expression levels within GCs were altered by either staurosporine (STS) alone or STS in presence of ectopically over-expressed PHB. Next, immunoblot studies were performed to examine the expression patterns of selective Bcl-2 family members identified by the microarray analysis, which are commonly regulated in the intrinsic-apoptotic pathway. These studies were designed to measure protein levels of Bcl2 family in relation to expression of the acidic isoform (phosphorylated) PHB and the components of MEK-Erk1/2 pathway. These studies indicated that over-expression of PHB in undifferentiated GCs inhibit apoptosis which concomitantly results in an increased level of the anti-apoptotic proteins Bcl2 and Bclxl, reduced release of cytochrome c from mitochondria and inhibition of caspase-3 activity. In contrast, silencing of PHB expression resulted in change of mitochondrial morphology from the regular reticular network to a fragmented form, which enhanced sensitization of these GCs to the induction of apoptosis. Collectively, these studies have provided new insights on the PHB-mediated anti-apoptotic mechanism, which occurs in undifferentiated GCs through a PHB → Mek-Erk1/2
Capello, D; Fais, F; Vivenza, D; Migliaretti, G; Chiorazzi, N; Gaidano, G; Ferrarini, M
2000-05-01
Although B cell chronic lymphocytic leukemia (B-CLL) has been traditionally viewed as a tumor of virgin B cells, this notion has been recently questioned by data suggesting that a fraction of B-CLL derives from antigen experienced B cells. In order to further clarify the histogenetic derivation of this lymphoproliferation, we have analyzed the DNA sequences of the 5' non-coding region of BCL-6 proto-oncogene in 28 cases of B-CLL. Mutations of BCL-6 proto-oncogene, a zinc finger transcription factor implicated in lymphoma development, represent a histogenetic marker of B cell transit through the germinal center (GC) and occur frequently in B cell malignancies derived from GC or post-GC B cells. For comparison, the same tumor panel was analyzed for somatic mutations of the rearranged immunoglobulin variable (IgV) genes, which are known to be acquired at the time of B cell transit through the GC. Sequence analyses of BCL-6 and IgV genes allowed the definition of three groups of B-CLL. Group I B-CLL displayed mutations of both BCL-6 and IgV genes (10/28; 36%). Group II B-CLL displayed mutated IgV genes, but a germline BCL-6 gene (5/28; 18%). Finally, group III B-CLL included the remaining cases (13/28; 46%) that were characterized by the absence of somatic mutations of both BCL-6 and IgV genes. Overall, the distribution of BCL-6 and IgV mutations in B-CLL reinforce the notion that this leukemia is histogenetically heterogeneous and that a substantial subgroup of these lymphoproliferations derives from post-germinal center B cells.
Mapping of the bcl-2 oncogene on mouse chromosome 1.
Mock, B A; Givol, D; D'Hoostelaere, L A; Huppi, K; Seldin, M F; Gurfinkel, N; Unger, T; Potter, M; Mushinski, J F
1988-01-01
Two bcl-2 alleles have been identified in inbred strains of mice by restriction fragment length polymorphism (RFLP). Analysis of a bcl-2 RFLP in a series of bilineal congenic strains (C.D2), developed as a tool for chromosomal mapping studies, revealed linkage of bcl-2 to the Idh-1/Pep-3 region of murine chromosome 1. The co-segregation of bcl-2 alleles with allelic forms of two other chromosome 1 loci, Ren-1,2 and Spna-1, in a set of back-cross progeny, positions bcl-2 7.8 cM centromeric from Ren-1,2.
Induction of Protective Genes Leads to Islet Survival and Function
Directory of Open Access Journals (Sweden)
Hongjun Wang
2011-01-01
Full Text Available Islet transplantation is the most valid approach to the treatment of type 1 diabetes. However, the function of transplanted islets is often compromised since a large number of β cells undergo apoptosis induced by stress and the immune rejection response elicited by the recipient after transplantation. Conventional treatment for islet transplantation is to administer immunosuppressive drugs to the recipient to suppress the immune rejection response mounted against transplanted islets. Induction of protective genes in the recipient (e.g., heme oxygenase-1 (HO-1, A20/tumor necrosis factor alpha inducible protein3 (tnfaip3, biliverdin reductase (BVR, Bcl2, and others or administration of one or more of the products of HO-1 to the donor, the islets themselves, and/or the recipient offers an alternative or synergistic approach to improve islet graft survival and function. In this perspective, we summarize studies describing the protective effects of these genes on islet survival and function in rodent allogeneic and xenogeneic transplantation models and the prevention of onset of diabetes, with emphasis on HO-1, A20, and BVR. Such approaches are also appealing to islet autotransplantation in patients with chronic pancreatitis after total pancreatectomy, a procedure that currently only leads to 1/3 of transplanted patients being diabetes-free.
Regulatory effect of Bcl-2 in ultraviolet radiation-induced apoptosis of the mouse crystalline lens.
Dong, Yuchen; Zheng, Yajuan; Xiao, Jun; Zhu, Chao; Zhao, Meisheng
2016-03-01
The aim of the present study was to analyze the role of Bcl-2 during the process of apoptosis in the mouse crystalline lens. In total, 12 normal mice served as the control group and 12 Bcl-2 knockout (K.O) mice served as the experimental group. The mouse crystalline lens was sampled for the detection of Bcl-2 and caspase-3 expression following exposure to ultraviolet (UV) radiation. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to determine Bcl-2 expression in the groups of normal mice receiving UV radiation or not receiving UV radiation. Samples of the murine crystalline lens were microscopically harvested and analyzed using western blotting. Apoptosis was detected using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay. Furthermore, caspase 3 activity was examined using enzyme-linked immunosorbent assay kits, and RT-qPCR was used to analyze caspase-3 expression levels. The results of the present study demonstrated that there was no statistically significant difference in the level of Bcl-2 gene transcription between the two groups. In addition, UV radiation did not change the macrostructure of the crystalline lens in the group of normal mice or the group of Bcl-2 K.O mice. The results of the TUNEL assay indicated that the normal-UV group exhibited a more significant apoptosis level compared with the Bcl-2 K.O-UV group. Furthermore, the mRNA expression level of caspase-3 in the normal-UV group was significantly higher compared with the normal-nonUV group (Plens.
Early diagnostic value of Bcl-3 localization in colorectal cancer
International Nuclear Information System (INIS)
Saamarthy, Karunakar; Björner, Sofie; Johansson, Martin; Landberg, Göran; Massoumi, Ramin; Jirström, Karin; Masoumi, Katarzyna Chmielarska
2015-01-01
B-cell leukemia 3 (Bcl-3) is a member of the inhibitor of κB family, which regulates a wide range of biological processes by functioning as a transcriptional activator or as a repressor of target genes. Elevated expression, sustained nuclear accumulation, and uncontrolled activation of Bcl-3 causes increased cellular proliferation or survival, dependent on the tissue and type of stimuli. We retrospectively reviewed patients who were diagnosed with colorectal cancer at Skåne University Hospital in Malmö between 1st of January 1990 and 31st of December 1991. Bcl-3 localization in colorectal cancer was assessed by immunohistochemistry on tissue microarray and freshly isolated colon from patients. Correlation between Bcl-3 localization and clinicopathological parameters of the cohort were evaluated using the Spearman rank-order correlation coefficient. In addition, Bcl-3 expression and localization in colon adenocarcinoma cells were analysed by western blot, immunohistochemistry and subcellular fractionation separately. We found that Bcl-3 was mainly localized in the cytoplasm in the tumour tissue isolated from colon cancer patients. Normal colon samples from the same patients showed Bcl-3 localization in the nucleus. In three out of six colon cancer cell lines, we detected elevated levels of Bcl-3. In these cell lines Bcl-3 was accumulated in the cytosol. We confirmed these findings by analysing Bcl-3 localization in a colon tissue micro array consisting of 270 cases. In these samples Bcl-3 localization correlated with the proliferation marker Ki-67, but not with the apoptotic marker Caspase 3. These findings indicate that analysis of the subcellular localization of Bcl-3 could be a potential-early diagnostic marker in colon cancer
Expression of Bcl-2, Melan A and HMB-45 in Dysplastic Nevi.
Patrascu, Oana Maria; Costache, Mariana; Dumitru, Adrian Vasile; Mehotin, Corina Nicoleta; Sajin, Maria; Lazaroiu, Anca Mihaela
2016-03-01
From the first recognition of dysplastic nevi as a pathology per se, many debates have been raised and many histological and immunohistological studies have been conducted in order to establish the true significance of these lesions. Therefore, the aim of this study was to establish if there is a correlation between HMB-45, Melan A and Bcl-2 expression and the grade of dysplasia, as well as between the marker's staining patterns. Ten dysplastic nevi from six female patients were selected and their histological features (size, dysplasia), as well as the immunohistological staining patterns, were studied (HMB-45, Melan A, Bcl-2). The Pearson correlation coefficient and regression was calculated with Windows Excel Data Analysis. We demonstrated that there was a notable correlation between the dysplasia and the size of the lesions (r(8)= 0.62 with p-value= 0.052), and also between Melan A and Bcl-2 (a r(6)= 0.73, p0.05). We can affirm, at least in our cases, there is a correlation between the grade of dysplasia and the size of the lesion, and also, that there is a correlation between Melan A and Bcl-2 staining, explained by MITF gene. These results were only partial concordant with those in other studies, therefore a larger number of cases is recommended to be further analyzed in order to clearly draw a conclusion.
Lee, Woo Sang; Woo, Eun Young; Kwon, Junhye; Park, Myung-Jin; Lee, Jae-Seon; Han, Young-Hoon; Bae, In Hwa
2013-01-01
Bcl-w a pro-survival member of the Bcl-2 protein family, is expressed in a variety of cancer types, including gastric and colorectal adenocarcinomas, as well as glioblastoma multiforme (GBM), the most common and lethal brain tumor type. Previously, we demonstrated that Bcl-w is upregulated in gastric cancer cells, particularly those displaying infiltrative morphology. These reports propose that Bcl-w is strongly associated with aggressive characteristic, such as invasive or mesenchymal phenotype of GBM. However, there is no information from studies of the role of Bcl-w in GBM. In the current study, we showed that Bcl-w is upregulated in human glioblastoma multiforme (WHO grade IV) tissues, compared with normal and glioma (WHO grade III) tissues. Bcl-w promotes the mesenchymal traits of glioblastoma cells by inducing vimentin expression via activation of transcription factors, β-catenin, Twist1 and Snail in glioblastoma U251 cells. Moreover, Bcl-w induces invasiveness by promoting MMP-2 and FAK activation via the PI3K-p-Akt-p-GSK3β-β-catenin pathway. We further confirmed that Bcl-w has the capacity to induce invasiveness in several human cancer cell lines. In particular, Bcl-w-stimulated β-catenin is translocated into the nucleus as a transcription factor and promotes the expression of target genes, such as mesenchymal markers or MMPs, thereby increasing mesenchymal traits and invasiveness. Our findings collectively indicate that Bcl-w functions as a positive regulator of invasiveness by inducing mesenchymal changes and that trigger their aggressiveness of glioblastoma cells. PMID:23826359
Renault, Thibaud T; Elkholi, Rana; Bharti, Archana; Chipuk, Jerry E
2014-09-19
The B cell lymphoma-2 (BCL-2) family is the key mediator of cellular sensitivity to apoptosis during pharmacological interventions for numerous human pathologies, including cancer. There is tremendous interest to understand how the proapoptotic BCL-2 effector members (e.g. BCL-2-associated X protein, BAX) cooperate with the BCL-2 homology domain only (BH3-only) subclass (e.g. BCL-2 interacting mediator of death, BIM; BCL-2 interacting-domain death agonist, BID) to induce mitochondrial outer membrane permeabilization (MOMP) and apoptosis and whether these mechanisms may be pharmacologically exploited to enhance the killing of cancer cells. Indeed, small molecule inhibitors of the anti-apoptotic BCL-2 family members have been designed rationally. However, the success of these "BH3 mimetics" in the clinic has been limited, likely due to an incomplete understanding of how these drugs function in the presence of multiple BCL-2 family members. To increase our mechanistic understanding of how BH3 mimetics cooperate with multiple BCL-2 family members in vitro, we directly compared the activity of several BH3-mimetic compounds (i.e. ABT-263, ABT-737, GX15-070, HA14.1, TW-37) in biochemically defined large unilamellar vesicle model systems that faithfully recapitulate BAX-dependent mitochondrial outer membrane permeabilization. Our investigations revealed that the presence of BAX, BID, and BIM differentially regulated the ability of BH3 mimetics to derepress proapoptotic molecules from anti-apoptotic proteins. Using mitochondria loaded with fluorescent BH3 peptides and cells treated with inducers of cell death, these differences were supported. Together, these data suggest that although the presence of anti-apoptotic BCL-2 proteins primarily dictates cellular sensitivity to BH3 mimetics, additional specificity is conferred by proapoptotic BCL-2 proteins. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Prognostic Importance of Bcl-2 Expression in Colon Cancer
Directory of Open Access Journals (Sweden)
Arsenal Alikanoðlu
2012-09-01
Full Text Available Aim: TNM classification, that had been established according to pathologic and anatomic characteristics of the lesion , is the most important factor in decision of adjuvant therapy in colon cancer. Despite curative resection, recurrence can ocur with a rate of 20-30% in early stage disease. Therefore efficieny of TNM classification is controversial. In recent years ,significance of molecular characteristics of the tumors besides their anatomic and pathologic characteristics in determining the biological behaviour and response to treatment have been discussed. In our study, relation between expression of Bcl-2 and the other known prognostic factors in colon cancer had been searched. Material and Method: Patients who had been followed up in our clinic were enrolled in this study. Expression of Bcl-2 was searched by immunohistochemical method. Results: A total of 52, 19 (%36.5 female and 33 (%63.5 male patients were enrolled in this study. Bcl-2 expression was found positive in 7 (%13.5 and negative in 45 (%86.5 patients. Statistically no significant relationship was found between Bcl-2 expression and sex, stage, regional lymph node involvement, presence of distant metastasis and histologic grade. Discussion: In our study, although not in a statistical significance, we found that Bcl-2 expression is related to early stage disease. Bcl-2 is a low-priced and easily accessible prognostic marker. We think that establishing expression of Bcl-2 by immunohistohemistry may play a role in determining prognosis of patients with colon cancer.
MicroRNAs expression in ox-LDL treated HUVECs: MiR-365 modulates apoptosis and Bcl-2 expression
Energy Technology Data Exchange (ETDEWEB)
Qin, Bing; Xiao, Bo [Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); Liang, Desheng [State Key Laboratory of Medical Genetics, Central South University, Changsha, Hunan 410078 (China); Xia, Jian; Li, Ye [Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); Yang, Huan, E-mail: yangh69@yahoo.cn [Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China)
2011-06-24
Highlights: {yields} We evaluated the role of miRNAs in ox-LDL induced apoptosis in ECs. {yields} We found 4 up-regulated and 11 down-regulated miRNAs in apoptotic ECs. {yields} Target genes of the dysregulated miRNAs regulate ECs apoptosis and atherosclerosis. {yields} MiR-365 promotes ECs apoptosis via suppressing Bcl-2 expression. {yields} MiR-365 inhibitor alleviates ECs apoptosis induced by ox-LDL. -- Abstract: Endothelial cells (ECs) apoptosis induced by oxidized low-density lipoprotein (ox-LDL) is thought to play a critical role in atherosclerosis. MicroRNAs (miRNAs) are a class of noncoding RNAs that posttranscriptionally regulate the expression of genes involved in diverse cell functions, including differentiation, growth, proliferation, and apoptosis. However, whether miRNAs are associated with ox-LDL induced apoptosis and their effect on ECs is still unknown. Therefore, this study evaluated potential miRNAs and their involvement in ECs apoptosis in response to ox-LDL stimulation. Microarray and qRT-PCR analysis performed on human umbilical vein endothelial cells (HUVECs) exposed to ox-LDL identified 15 differentially expressed (4 up- and 11 down-regulated) miRNAs. Web-based query tools were utilized to predict the target genes of the differentially expressed miRNAs, and the potential target genes were classified into different function categories with the gene ontology (GO) term and KEGG pathway annotation. In particular, bioinformatics analysis suggested that anti-apoptotic protein B-cell CLL/lymphoma 2 (Bcl-2) is a target gene of miR-365, an apoptomir up-regulated by ox-LDL stimulation in HUVECs. We further showed that transfection of miR-365 inhibitor partly restored Bcl-2 expression at both mRNA and protein levels, leading to a reduction of ox-LDL-mediated apoptosis in HUVECs. Taken together, our findings indicate that miRNAs participate in ox-LDL-mediated apoptosis in HUVECs. MiR-365 potentiates ox-LDL-induced ECs apoptosis by regulating the
International Nuclear Information System (INIS)
Wiese, Claudia; Pierce, Andrew J.; Gauny, Stacey S.; Jasin, Maria; Kronenberg, Amy
2001-01-01
Homology-directed repair (HDR) of DNA double-strand breaks (DSBs) is a well-established mechanism that contributes to the maintenance of genomic stability in rodent cells, and it has been assumed that HDR is of similar importance in the repair of DSBs in human cells. However, in addition to promoting genomic stability, some outcomes of homologous recombination can be deleterious, suggesting that factors exist to regulate HDR. We previously demonstrated that overexpression of BCL-2 or BCL-xL enhanced the frequency of x-ray-induced mutations involving the TK1 locus, including loss of heterozygosity (LOH) events presumed to arise by mitotic recombination. The present study was designed to test whether HDR is a prominent DSB repair pathway in human cells, and to directly determine whether ectopic expression of BCL-xL affects HDR. We used the B-lymphoblastoid cell line TK6, which expresses wild-type TP53 and resembles normal lymphocytes in undergoing apoptosis following genotoxic stress. U sing isogenic derivatives of TK6 cells (TK6-neo, TK6-bcl-xL), we find that a DSB in an integrated HDR reporter stimulates gene conversion 40-50-fold in TK6-neo cells, demonstrating that a DSB can be efficiently repaired by gene conversion in human cells. Significantly, DSB-induced gene conversion events are 3- to 4-fold more frequent in BCL-xL overexpressing cells. The results demonstrate that HDR plays an important role in maintaining genomic integrity in human cells and that ectopic expression of BCL-xL enhances HDR of DSBs. To our knowledge, this is the first study to highlight a function for BCL-xL in modulating DSB repair in human cells
International Nuclear Information System (INIS)
Li, Yi; Cui, Jiang-Tao
2016-01-01
Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.
Energy Technology Data Exchange (ETDEWEB)
Li, Yi; Cui, Jiang-Tao, E-mail: cuijingtaopaper@126.com
2016-09-02
Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.
Mito-priming as a method to engineer Bcl-2 addiction.
Lopez, Jonathan; Bessou, Margaux; Riley, Joel S; Giampazolias, Evangelos; Todt, Franziska; Rochegüe, Tony; Oberst, Andrew; Green, Douglas R; Edlich, Frank; Ichim, Gabriel; Tait, Stephen W G
2016-02-02
Most apoptotic stimuli require mitochondrial outer membrane permeabilization (MOMP) in order to execute cell death. As such, MOMP is subject to tight control by Bcl-2 family proteins. We have developed a powerful new technique to investigate Bcl-2-mediated regulation of MOMP. This method, called mito-priming, uses co-expression of pro- and anti-apoptotic Bcl-2 proteins to engineer Bcl-2 addiction. On addition of Bcl-2 targeting BH3 mimetics, mito-primed cells undergo apoptosis in a rapid and synchronous manner. Using this method we have comprehensively surveyed the efficacy of BH3 mimetic compounds, identifying potent and specific MCL-1 inhibitors. Furthermore, by combining different pro- and anti-apoptotic Bcl-2 pairings together with CRISPR/Cas9-based genome editing, we find that tBID and PUMA can preferentially kill in a BAK-dependent manner. In summary, mito-priming represents a facile and robust means to trigger mitochondrial apoptosis.
Energy Technology Data Exchange (ETDEWEB)
Jiang, L.C.; Huang, S.Y.; Zhang, D.S.; Zhang, S.H.; Li, W.G.; Zheng, P.H.; Chen, Z.W. [Shandong Provincial Hospital Affiliated to Shandong University, Department of Oral and Maxillofacial Surgery, Jinan, China, Department of Oral and Maxillofacial Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan (China)
2014-03-03
Beclin 1 plays a critical role in autophagy and functions as a haploinsufficient tumor suppressor. The expression and prognostic significance of beclin 1 in head and neck adenoid cystic carcinoma (ACC) are largely unexplored. Therefore, we investigated the expression of beclin 1, Bcl-2, and p53 in head and neck ACC tissue. Tissue samples from 35 cases (15 females, 20 males) of head and neck ACC were utilized for immunohistochemistry. Beclin 1 expression was observed in 32 cases (91.4%) and considered to be high in 15 cases (42.9%) and low in 20 cases (57.1%). Beclin 1 expression was significantly correlated with a histological growth pattern (P=0.046) and histological grade (P=0.037). Beclin 1 expression was inversely correlated with Bcl-2 expression (P=0.013) and significantly associated with overall survival (P=0.006). Bcl-2 and p53 expression were observed in 21 cases (60.0%) and 16 cases (45.7%). Bcl-2 expression was significantly correlated with perineural invasion (P=0.041) and not associated with overall survival (P=0.053). p53 expression was directly correlated with beclin 1 expression (P=0.044). Our results indicated that beclin 1 may be a novel, promising prognostic factor for clinical outcome in head and neck ACC patients and may play a part in the development of head and neck ACC by interacting with Bcl-2 and p53.
International Nuclear Information System (INIS)
Fang, Jun; Gu, Lubing; Zhu, Ningxi; Tang, Hao; Alvarado, Carlos S; Zhou, Muxiang
2008-01-01
Tissue factor (TF) is a transmembrane protein that acts as a receptor for activated coagulation factor VII (FVIIa), initiating the coagulation cascade. Recent studies demonstrate that expression of tumor-derived TF also mediates intracellular signaling relevant to tumor growth and apoptosis. Our present study investigates the possible mechanism by which the interaction between TF and FVIIa regulates chemotherapy resistance in neuroblastoma cell lines. Gene and siRNA transfection was used to enforce TF expression in a TF-negative neuroblastoma cell line and to silence endogenous TF expression in a TF-overexpressing neuroblastoma line, respectively. The expression of TF, Bcl-2, STAT5, and Akt as well as the phosphorylation of STAT5 and Akt in gene transfected cells or cells treated with JAK inhibitor and LY294002 were determined by Western blot assay. Tumor cell growth was determined by a clonogenic assay. Cytotoxic and apoptotic effect of doxorubicin on neuroblastoma cell lines was analyzed by WST assay and annexin-V staining (by flow cytometry) respectively. Enforced expression of TF in a TF-negative neuroblastoma cell line in the presence of FVIIa induced upregulation of Bcl-2, leading to resistance to doxorubicin. Conversely, inhibition of endogenous TF expression in a TF-overexpressing neuroblastoma cell line using siRNA resulted in down-regulation of Bcl-2 and sensitization to doxorubicin-induced apoptosis. Additionally, neuroblastoma cells expressing high levels of either endogenous or transfected TF treated with FVIIa readily phosphorylated STAT5 and Akt. Using selective pharmacologic inhibitors, we demonstrated that JAK inhibitor I, but not the PI3K inhibitor LY294002, blocked the TF/FVIIa-induced upregulation of Bcl-2. This study shows that in neuroblastoma cell lines overexpressed TF ligated with FVIIa produced upregulation of Bcl-2 expression through the JAK/STAT5 signaling pathway, resulting in resistance to apoptosis. We surmise that this TF
Macaire, Héloïse; Riquet, Aurélien; Moncollin, Vincent; Biémont-Trescol, Marie-Claude; Duc Dodon, Madeleine; Hermine, Olivier; Debaud, Anne-Laure; Mahieux, Renaud; Mesnard, Jean-Michel; Pierre, Marlène; Gazzolo, Louis; Bonnefoy, Nathalie; Valentin, Hélène
2012-01-01
Human T lymphotropic virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia/lymphoma (ATLL). ATLL is a severe malignancy with no effective treatment. HTLV-1 regulatory proteins Tax and HTLV-1 basic leucine zipper factor (HBZ) play a major role in ATLL development, by interfering with cellular functions such as CD4+ T-cell survival. In this study, we observed that the expression of Bfl-1, an antiapoptotic protein of the Bcl-2 family, is restricted to HTLV-1-infected T-cell lines and to T-cells expressing both Tax and HBZ proteins. We showed that Tax-induced bfl-1 transcription through the canonical NF-κB pathway. Moreover, we demonstrated that Tax cooperated with c-Jun or JunD, but not JunB, transcription factors of the AP-1 family to stimulate bfl-1 gene activation. By contrast, HBZ inhibited c-Jun-induced bfl-1 gene activation, whereas it increased JunD-induced bfl-1 gene activation. We identified one NF-κB, targeted by RelA, c-Rel, RelB, p105/p50, and p100/p52, and two AP-1, targeted by both c-Jun and JunD, binding sites in the bfl-1 promoter of T-cells expressing both Tax and HBZ. Analyzing the potential role of antiapoptotic Bcl-2 proteins in HTLV-1-infected T-cell survival, we demonstrated that these cells are differentially sensitive to silencing of Bfl-1, Bcl-xL, and Bcl-2. Indeed, both Bfl-1 and Bcl-xL knockdowns decreased the survival of HTLV-1-infected T-cell lines, although no cell death was observed after Bcl-2 knockdown. Furthermore, we demonstrated that Bfl-1 knockdown sensitizes HTLV-1-infected T-cells to ABT-737 or etoposide treatment. Our results directly implicate Bfl-1 and Bcl-xL in HTLV-1-infected T-cell survival and suggest that both Bfl-1 and Bcl-xL represent potential therapeutic targets for ATLL treatment. PMID:22553204
International Nuclear Information System (INIS)
Liu, Junye; Guo, Guozhen; Yang, Le; Zhang, Jian; Zhang, Jing; Chen, Yongbin; Li, Kangchu; Li, Yurong; Li, Yan; Yao, Libo
2012-01-01
NDRG2, a member of N-Myc downstream regulated gene family, plays some roles in cellular stress, cell differentiation and tumor suppression. We have found that NDRG2 expression in cervical cancer Hela cells increases significantly upon stimulation with cisplatin, the most popular chemotherapeutic agent currently used for the treatment of advanced cervical cancer. This interesting phenomenon drove us to evaluate the role of NDRG2 in chemosensitivity of Hela cells. In the present study, RNA interference was employed to down-regulate NDRG2 expression in Hela cells. RT-PCR and Western blot were used to detect expression of NDRG2, Bcl-2 and Bax in cancer cells. Real-time PCR was applied to detect miR-15b and miR-16 expression levels. Drug sensitivity was determined with MTT assay. Cell cloning efficiency was evaluated by Colony-forming assay. Apoptotic cells were detected with annexin V staining and flow cytometry. In vitro drug sensitivity assay revealed that suppression of NDRG2 could sensitize Hela cells to cisplatin. Down-regulation of NDRG2 didn’t influence the colony-forming ability but promoted cisplatin-induced apoptosis of Hela cells. Inhibition of NDRG2 in Hela cells was accompanied by decreased Bcl-2 protein level. However, Bcl-2 mRNA level was not changed in Hela cells with down-regulation of NDRG2. Further study indicated that miR-15b and miR-16, two microRNAs targetting Bcl-2, were significantly up-regulated in NDRG2-suppressed Hela cells. These data suggested that down-regulation of NDRG2 could enhance sensitivity of Hela cells to cisplatin through inhibiting Bcl-2 protein expression, which might be mediated by up-regulating miR-15b and miR-16
Mottolese, M; Benevolo, M; Del Monte, G; Buglioni, S; Papaldo, P; Nisticò, C; Di Filippo, F; Vasselli, S; Vici, P; Botti, C
2000-12-01
Adjuvant therapy has become an integral component of the managment of primary high-risk breast cancer patients. However, a considerable fraction of women receive no benefit from this treatment. This study investigates whether a number of biopathological factors can influence the outcome of patients submitted to adjuvant chemotherapy involving the use of high-dose epirubicin and cyclophosphamide. One hundred and fifty-seven primary breast cancer patients, considered at high risk according to the St. Gallen Meeting Consensus Conference, were evaluated immunohistochemically for estrogen, progesterone receptors, p53, bcl-2, HER-2/neu, and Ki-67, of which the results were correlated with patient outcome. Results obtained demonstrated that p53 is a significant predictor of disease-free survival (DFS P < 0.0001) and overall survival (OS P = 0.0002) both in ductal and lobular carcinomas, whereas bcl-2 expression seems to be of prognostic value only in lobular carcinomas (DFS P = 0.01; OS P = 0.02). This data indicates that in high-risk breast cancer patients the immunohistochemical evaluation of p53 and bcl-2 may be of clinical value in distinguishing different responses to adjuvant anthracycline-based chemotherapy.
Stability and Function of Hippocampal Mossy Fiber Synapses Depend on Bcl11b/Ctip2
Directory of Open Access Journals (Sweden)
Elodie De Bruyckere
2018-04-01
Full Text Available Structural and functional plasticity of synapses are critical neuronal mechanisms underlying learning and memory. While activity-dependent regulation of synaptic strength has been extensively studied, much less is known about the transcriptional control of synapse maintenance and plasticity. Hippocampal mossy fiber (MF synapses connect dentate granule cells to CA3 pyramidal neurons and are important for spatial memory formation and consolidation. The transcription factor Bcl11b/Ctip2 is expressed in dentate granule cells and required for postnatal hippocampal development. Ablation of Bcl11b/Ctip2 in the adult hippocampus results in impaired adult neurogenesis and spatial memory. The molecular mechanisms underlying the behavioral impairment remained unclear. Here we show that selective deletion of Bcl11b/Ctip2 in the adult mouse hippocampus leads to a rapid loss of excitatory synapses in CA3 as well as reduced ultrastructural complexity of remaining mossy fiber boutons (MFBs. Moreover, a dramatic decline of long-term potentiation (LTP of the dentate gyrus-CA3 (DG-CA3 projection is caused by adult loss of Bcl11b/Ctip2. Differential transcriptomics revealed the deregulation of genes associated with synaptic transmission in mutants. Together, our data suggest Bcl11b/Ctip2 to regulate maintenance and function of MF synapses in the adult hippocampus.
Maiuri, Maria Chiara; Criollo, Alfredo; Tasdemir, Ezgi; Vicencio, José Miguel; Tajeddine, Nicolas; Hickman, John A; Geneste, Olivier; Kroemer, Guido
2007-01-01
Beclin 1 has recently been identified as novel BH3-only protein, meaning that it carries one Bcl-2-homology-3 (BH3) domain. As other BH3-only proteins, Beclin 1 interacts with anti-apoptotic multidomain proteins of the Bcl-2 family (in particular Bcl-2 and its homologue Bcl-X(L)) by virtue of its BH3 domain, an amphipathic alpha-helix that binds to the hydrophobic cleft of Bcl-2/Bcl-X(L). The BH3 domains of other BH3-only proteins such as Bad, as well as BH3-mimetic compounds such as ABT737, competitively disrupt the inhibitory interaction between Beclin 1 and Bcl-2/Bcl-X(L). This causes autophagy of mitochondria (mitophagy) but not of the endoplasmic reticulum (reticulophagy). Only ER-targeted (not mitochondrion-targeted) Bcl-2/Bcl-X(L) can inhibit autophagy induced by Beclin 1, and only Beclin 1-Bcl-2/Bcl-X(L) complexes present in the ER (but not those present on heavy membrane fractions enriched in mitochondria) are disrupted by ABT737. These findings suggest that the Beclin 1-Bcl-2/Bcl-X(L) complexes that normally inhibit autophagy are specifically located in the ER and point to an organelle-specific regulation of autophagy. Furthermore, these data suggest a spatial organization of autophagy and apoptosis control in which BH3-only proteins exert two independent functions. On the one hand, they can induce apoptosis, by (directly or indirectly) activating the mitochondrion-permeabilizing function of pro-apoptotic multidomain proteins from the Bcl-2 family. On the other hand, they can activate autophagy by liberating Beclin 1 from its inhibition by Bcl-2/Bcl-X(L) at the level of the endoplasmic reticulum.
Bim and Mcl-1 exert key roles in regulating JAK2V617F cell survival
International Nuclear Information System (INIS)
Rubert, Joëlle; Qian, Zhiyan; Andraos, Rita; Guthy, Daniel A; Radimerski, Thomas
2011-01-01
The JAK2 V617F mutation plays a major role in the pathogenesis of myeloproliferative neoplasms and is found in the vast majority of patients suffering from polycythemia vera and in roughly every second patient suffering from essential thrombocythemia or from primary myelofibrosis. The V617F mutation is thought to provide hematopoietic stem cells and myeloid progenitors with a survival and proliferation advantage. It has previously been shown that activated JAK2 promotes cell survival by upregulating the anti-apoptotic STAT5 target gene Bcl-xL. In this study, we have investigated the role of additional apoptotic players, the pro-apoptotic protein Bim as well as the anti-apoptotic protein Mcl-1. Pharmacological inhibition of JAK2/STAT5 signaling in JAK2 V617F mutant SET-2 and MB-02 cells was used to study effects on signaling, cell proliferation and apoptosis by Western blot analysis, WST-1 proliferation assays and flow cytometry. Cells were transfected with siRNA oligos to deplete candidate pro- and anti-apoptotic proteins. Co-immunoprecipitation assays were performed to assess the impact of JAK2 inhibition on complexes of pro- and anti-apoptotic proteins. Treatment of JAK2 V617F mutant cell lines with a JAK2 inhibitor was found to trigger Bim activation. Furthermore, Bim depletion by RNAi suppressed JAK2 inhibitor-induced cell death. Bim activation following JAK2 inhibition led to enhanced sequestration of Mcl-1, besides Bcl-xL. Importantly, Mcl-1 depletion by RNAi was sufficient to compromise JAK2 V617F mutant cell viability and sensitized the cells to JAK2 inhibition. We conclude that Bim and Mcl-1 have key opposing roles in regulating JAK2 V617F cell survival and propose that inactivation of aberrant JAK2 signaling leads to changes in Bim complexes that trigger cell death. Thus, further preclinical evaluation of combinations of JAK2 inhibitors with Bcl-2 family antagonists that also tackle Mcl-1, besides Bcl-xL, is warranted to assess the therapeutic potential
Directory of Open Access Journals (Sweden)
Synne Torkildsen
Full Text Available RNA-sequencing of a case of acute myeloid leukemia with the bone marrow karyotype 46,XY,t(2;14(q22;q32[5]/47,XY,idem,+?4,del(6(q13q21[cp6]/46,XY[4] showed that the t(2;14 generated a ZEB2-BCL11B chimera in which exon 2 of ZEB2 (nucleotide 595 in the sequence with accession number NM_014795.3 was fused to exon 2 of BCL11B (nucleotide 554 in the sequence with accession number NM_022898.2. RT-PCR together with Sanger sequencing verified the presence of the above-mentioned fusion transcript. All functional domains of BCL11B are retained in the chimeric protein. Abnormal expression of BCL11B coding regions subjected to control by the ZEB2 promoter seems to be the leukemogenic mechanism behind the translocation.
SPATA4 Counteracts Etoposide-Induced Apoptosis via Modulating Bcl-2 Family Proteins in HeLa Cells.
Jiang, Junjun; Li, Liyuan; Xie, Mingchao; Fuji, Ryosuke; Liu, Shangfeng; Yin, Xiaobei; Li, Genlin; Wang, Zhao
2015-01-01
Spermatogenesis associated 4 (SPATA4) is a testis-specific gene first cloned by our laboratory, and plays an important role in maintaining the physiological function of germ cells. Accumulated evidence suggests that SPATA4 might be associated with apoptosis. Here we established HeLa cells that stably expressed SPATA4 to investigate the function of SPATA4 in apoptosis. SPATA4 protected HeLa cells from etoposide-induced apoptosis through the mitochondrial apoptotic pathway, in the way that SPATA4 suppressed decrease of the mitochondrial membrane potential, the release of cytochrome c, and subsequent activation of caspase-9 and -3. We further demonstrated that SPATA4 upregulated anti-apoptotic members of Bcl-2 family proteins, Bcl-2, and downregulated the pro-apoptotic member of Bcl-2 family proteins, Bax. Knockdown of SPATA4 in HeLa/SPATA4 cells could partially rescue expression levels of bcl-2 and bax. In conclusion, SPATA4 protects HeLa cells against etoposide-induced apoptosis through the mitochondrial apoptotic pathway. Our findings provide further evidence that SPATA4 plays a role in regulating apoptosis.
International Nuclear Information System (INIS)
Changchien, Jung-Jung; Chen, Ying-Jung; Huang, Chia-Hui; Cheng, Tian-Lu; Lin, Shinne-Ren; Chang, Long-Sen
2015-01-01
Although previous studies have revealed the anti-cancer activity of quinacrine, its effect on leukemia is not clearly resolved. We sought to explore the cytotoxic effect and mechanism of quinacrine action in human leukemia K562 cells. Quinacrine induced K562 cell apoptosis accompanied with ROS generation, mitochondrial depolarization, and down-regulation of BCL2L1 and BCL2. Upon exposure to quinacrine, ROS-mediated p38 MAPK activation and ERK inactivation were observed in K562 cells. Quinacrine-induced cell death and mitochondrial depolarization were suppressed by the p38MAPK inhibitor SB202190 and constitutively active MEK1 over-expression. Activation of p38 MAPK was shown to promote BCL2 degradation. Further, ERK inactivation suppressed c-Jun-mediated transcriptional expression of BCL2L1. Over-expression of BCL2L1 and BCL2 attenuated quinacrine-evoked mitochondrial depolarization and rescued the viability of quinacrine-treated cells. Taken together, our data indicate that quinacrine-induced K562 cell apoptosis is mediated through mitochondrial alterations triggered by p38 MAPK-mediated BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression. - Highlights: • Quinacrine induces K562 cell apoptosis via down-regulation of BCL2 and BCL2L1. • Quinacrine induces p38 MAPK activation and ERK inactivation in K562 cells. • Quinacrine elicits p38 MAPK-mediated BCL2 down-regulation. • Quinacrine suppresses ERK/c-Jun-mediated BCL2L1 expression
Directory of Open Access Journals (Sweden)
Bruno Christian Koehler
Full Text Available Despite the fact that new treatment regimes have improved overall survival of patients challenged by colorectal cancer (CRC, prognosis in the metastatic situation is still restricted. The Bcl-2 family of proteins has been identified as promising anti cancer drug target. Even though small molecules targeting Bcl-2 proteins are in clinical trials, little is known regarding their effects on CRC. The aim of this study was to preclinically investigate the value of ABT-737 and Obatoclax as anticancer drugs for CRC treatment. The effects of the BH3-mimetics ABT-737 and Obatoclax on CRC cells were assessed using viability and apoptosis assays. Wound healing migration and boyden chamber invasion assays were applied. 3-dimensional cell cultures were used for long term assessment of invasion and proliferation. Clinically relevant concentrations of pan-Bcl-2 inhibitor Obatoclax did not induce cell death. In contrast, the BH3-mimetic ABT-737 induced apoptosis in a dose dependent manner. Obatoclax caused a cell line specific slowdown of CRC cell growth. Furthermore, Obatoclax, but not ABT-737, recovered E-Cadherin expression and led to impaired migration and invasion of CRC cells. The proliferative capacity and invasiveness of CRC cells was strikingly inhibited by low dose Obatoclax in long term 3-dimensional cell cultures. Obatoclax, but not ABT-737, caused a G1-phase arrest accompanied by a downregulation of Cyclin D1 and upregulation of p27 and p21. Overexpression of Mcl-1, Bcl-xL or Bcl-2 reversed the inhibitory effect of Obatoclax on migration but failed to restore the proliferative capacity of Obatoclax-treated CRC cells. The data presented indicate broad and multifaceted antitumor effects of the pan-Bcl-2 inhibitor Obatoclax on CRC cells. In contrast to ABT-737, Obatoclax inhibited migration, invasion and proliferation in sublethal doses. In summary, this study recommends pan-Bcl-2 inhibition as a promising approach for clinical trials in CRC.
Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan
2016-01-01
Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.
Zheng, Shukai; Liu, Caixia; Huang, Yanhong; Bao, Mian; Huang, Yuanni; Wu, Kusheng
2017-10-15
Polybrominated diphenyl ethers (PBDEs) are persistent organic pollutants in various environmental matrices and organisms and pose a threat to neural systems of organisms. However, though quite a few studies have explored the effect of PBDEs on neural behaviors such as learning and memory abilities in animals, their mechanisms are less known. We used the zebrafish model to evaluate neurotoxicity of PBDEs and observe changes in behavior and related gene expression. In behavioral testing, 50 zebrafish were divided into five groups treated with different concentrations of BDE-47. T-maze exploration was used for learning and memory testing, which was recorded by camera every 7days. After 21days, all fish were killed, and the gene expression of c-fos, bcl-2, lingo1b and grin1b in brain tissue was analyzed by RT-qPCR. The behavioral changes (latency to leave the start zone, reach the reward zone, and stay in the reward zone; accuracy in choosing the right maze arm, accumulation of freezing bouts, etc.) were related to BDE-47 concentration and had a time-effect relation with increasing exposure days, especially with 500μg/L BDE-47. BDE-47 elevated brain bcl-2, grin1b and lingo1b expression. The expression of c-fos showed an increase with 50 and 100μg/L BDE-47 exposure. The PBDE BDE-47 had a negative impact on the neurobehaviors of zebrafish and affected the expression of c-fos, bcl-2, lingo1b and grin1b in zebrafish brain tissue. Copyright © 2017 Elsevier Inc. All rights reserved.
Targeted BCL2 inhibition effectively inhibits neuroblastoma tumour growth
Lamers, Fieke; Schild, Linda; den Hartog, Ilona J. M.; Ebus, Marli E.; Westerhout, Ellen M.; Ora, Ingrid; Koster, Jan; Versteeg, Rogier; Caron, Huib N.; Molenaar, Jan J.
2012-01-01
Genomic aberrations of key regulators of the apoptotic pathway have hardly been identified in neuroblastoma. We detected high BCL2 mRNA and protein levels in the majority of neuroblastoma tumours by Affymetrix expression profiling and Tissue Micro Array analysis. This BCL2 mRNA expression is
Chang, Chiung-Chih; Chang, Ya-Ting; Huang, Chi-Wei; Tsai, Shih-Jen; Hsu, Shih-Wei; Huang, Shu-Hua; Lee, Chen-Chang; Chang, Wen-Neng; Lui, Chun-Chung; Lien, Chia-Yi
2018-02-08
Alzheimer's disease (AD) is a complex neurodegenerative disease, and genetic differences may mediate neuronal degeneration. In humans, a single-nucleotide polymorphism in the B-cell chronic lymphocytic leukemia/lymphoma-2 (Bcl-2) gene, rs956572, has been found to significantly modulate Bcl-2 protein expression in the brain. The Bcl-2 AA genotype has been associated with reduced Bcl-2 levels and lower gray matter volume in healthy populations. We hypothesized that different Bcl-2 genotype groups may modulate large-scale brain networks that determine neurobehavioral test scores. Gray matter structural covariance networks (SCNs) were constructed in 104 patients with AD using T1-weighted magnetic resonance imaging with seed-based correlation analysis. The patients were stratified into two genotype groups on the basis of Bcl-2 expression (G carriers, n = 76; A homozygotes, n = 28). Four SCNs characteristic of AD were constructed from seeds in the default mode network, salience network, and executive control network, and cognitive test scores served as the major outcome factor. For the G carriers, influences of the SCNs were observed mostly in the default mode network, of which the peak clusters anchored by the posterior cingulate cortex seed determined the cognitive test scores. In contrast, genetic influences in the A homozygotes were found mainly in the executive control network, and both the dorsolateral prefrontal cortex seed and the interconnected peak clusters were correlated with the clinical scores. Despite a small number of cases, the A homozygotes showed greater covariance strength than the G carriers among all four SCNs. Our results suggest that the Bcl-2 rs956572 polymorphism is associated with different strengths of structural covariance in AD that determine clinical outcomes. The greater covariance strength in the four SCNs shown in the A homozygotes suggests that different Bcl-2 polymorphisms play different modulatory roles.
Kelemen, Katalin; Holden, Jaclyn; Johnson, Laura J; Davion, Simone; Robetorye, Ryan S
2017-07-01
B-lymphoblastic leukemias (B-LBL) with combined IGH/BCL2 and MYC rearrangement are rare and their clinical, cytogenetic and immunophenotypic features are not well characterized. Here, we describe a case of a 61-year-old woman with B-LBL associated with these cytogenetic alterations and present a review of the literature of this disease. Four-color flow cytometry (FC) was performed on a BD FACSCanto II flow cytometer. Data were analyzed with BD FACSDiva software. Cytogenetic, fluorescence in situ hybridization (FISH), and molecular studies were performed by conventional methods. A review of the literature was performed by a PubMed-assisted search. Including our case, eight B-LBLs associated with a documented "double-hit" karyotype (IGH/BCL2 and 8q24/MYC rearrangement) were identified in the literature (male/female 2/6, age 15-65). Three occurred de-novo, and five had a history of a CD10+ B-cell lymphoma. The typical immunophenotype was CD10, CD19, TdT positive, and negative for CD34 and surface immunoglobulin (Ig), established either by FC or immunohistochemistry. Seven cases were CD20-, and one case was CD20+. Translocation partners of MYC varied, and included IGH, lambda light chain, and an unknown gene on chromosome 9. Prognosis was poor with median survival of five months. Patients with B-LBL associated with a combined IGH/BCL2 and MYC rearrangement often have a history of a mature B-cell lymphoma. The immunophenotype of these cases is different from that of mature "double-hit" lymphomas; FC is essential to differentiate the B-LBL cases from the leukemic phase of mature B-cell lymphomas. © 2015 International Clinical Cytometry Society. © 2015 International Clinical Cytometry Society.
Energy Technology Data Exchange (ETDEWEB)
Noh, Woo Chul; Ham, Yong Ho [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1998-01-01
To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10`-`9M) and tamoxifen (10`-`5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs
International Nuclear Information System (INIS)
Noh, Woo Chul; Ham, Yong Ho
1998-01-01
To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10'-'9M) and tamoxifen (10'-'5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
Rech de Laval , Valentine
2013-01-01
BCL-2 proteins play an essential role in the decision of life or death of animal cells. They control the induction of apoptosis (programmed cell death) in the mitochondrial pathway via regulators having opposite functions: anti- or pro-apoptotic. Proteins containing one or more Bcl-2 homology domains (BHl-4) are systematically classified in this family. Through bioinformatics and phylogenetic analysis, we revisited the different criteria for protein inclusion in the BCL-2 group and proposed a...
Micro-Economics of Apoptosis in Cancer: ncRNAs Modulation of BCL-2 Family Members.
Villanova, Lidia; Careccia, Silvia; De Maria, Ruggero; Fiori, Micol E
2018-03-23
In the last few years, non-coding RNAs (ncRNAs) have been a hot topic in cancer research. Many ncRNAs were found to regulate the apoptotic process and to play a role in tumor cell resistance to treatment. The apoptotic program is on the frontline as self-defense from cancer onset, and evasion of apoptosis has been classified as one of the hallmarks of cancer responsible for therapy failure. The B-cell lymphoma 2 (BCL-2) family members are key players in the regulation of apoptosis and mediate the activation of the mitochondrial death machinery in response to radiation, chemotherapeutic agents and many targeted therapeutics. The balance between the pro-survival and the pro-apoptotic BCL-2 proteins is strictly controlled by ncRNAs. Here, we highlight the most common mechanisms exerted by microRNAs, long non-coding RNAs and circular RNAs on the main mediators of the intrinsic apoptotic cascade with particular focus on their significance in cancer biology.
International Nuclear Information System (INIS)
Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi
2006-01-01
Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer
Directory of Open Access Journals (Sweden)
Nishizaki Takashi
2006-07-01
Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.
RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.
Directory of Open Access Journals (Sweden)
Xiaoming Wang
Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.
DEFF Research Database (Denmark)
Nyvold, Charlotte G; Bendix, Knud; Brandsborg, Margrethe
2007-01-01
prospectively been evaluated. Eleven patients (4%) were found t(11;14)+ and 37 patients (14%) t(14;18)+. Comparing these results to standard diagnostic methods of PB and/or BM identified PCR+ samples that were normal by morphology (BCL-1/IGH: 1/11; BCL-2/IGH: 17/37). Equally important, patients who were......We have designed a multiplex PCR, which allows for fast and high throughput demonstration of the BCL-1/IGH and BCL-2/IGH fusion DNA observed primarily in mantle cell- and follicular non-Hodgkin's lymphoma (NHL). Blood (PB) and/or bone marrow (BM) from 258 patients suspected of NHL have...... not clonal in PB and/or BM by flow cytometry were identified as PCR+ (BCL-1/IGH: 3/11; BCL-2/IGH: 23/37). We conclude that this multiplex approach allows for easy and sensitive molecular determination of molecular lesions in NHL, which have diagnostic and prognostic importance. Udgivelsesdato: 2007-null...
Expression of Bcl-2 and Bax in extrahepatic biliary tract carcinoma and dysplasia
Li, Sheng-Mian; Yao, Shu-Kun; Yamamura, Nobuyoshi; Nakamura, Toshitsugu
2003-01-01
AIM: To compare the difference of expression of Bcl-2 and Bax in extrahepatic biliary tract carcinoma and dysplasia, and to analyze the role of Bcl-2 and Bax proteins in the progression from dysplasia to carcinoma and to evaluate the correlation of Bcl-2/Bax protein expression with the biological behaviors. METHODS: Expressions of Bcl-2 and Bax were examined immunohistochemically in 27 cases of extrahepatic biliary tract carcinomas (bile duct carcinoma: n = 21, carcinoma of ampulla of Vater: n = 6), and 10 cases of atypical dysplasia. Five cases of normal biliary epithelial tissues were used as controls. A semiquantitative scoring system was used to assess the Bcl-2 and Bax reactivity. RESULTS: The expression of Bcl-2 was observed in 10 out of 27 (37.0%) invasive carcinomas, 1 out of 10 dysplasias, none out of 5 normal epithelial tissues. Bax expression rate was 74.1% (20/27) in invasive carcinoma, 30% (3/10) in dysplasia, and 40% (2/5) in normal biliary epithelium. Bcl-2 and Bax activities were more intense in carcinoma than in dysplasia, with no significant difference in Bcl-2 expression (P = 0.110), and significant difference in Bax expression (P = 0.038). Level of Bax expression was higher in invasive carcinoma than in dysplasia and normal tissue (P = 0.012). Bcl-2 expression was correlated to Bax expression (P = 0.0059). However, Bcl-2/Bax expression had no correlation with histological subtype, grade of differentiation, or level of invasion. CONCLUSION: Increased Bcl-2/Bax expression from dysplasia to invasive tumors supports the view that this is the usual route for the development of extrahepatic biliary tract carcinoma. Bcl-2/Bax may be involved, at least in part, in the apoptotic activity in extrahepatic biliary carcinoma. PMID:14606101
Metastatic Breast Cancer Survival according to HER2 and Topo2a Gene Status
Directory of Open Access Journals (Sweden)
N. Todorović-Raković
2009-01-01
Full Text Available The aim of this study was to determine the relationship between amplification of HER2 (Human epidermal growth factor receptor 2 and Topo2a (topoisomerase 2a and their influence on prognosis in metastatic breast cancer (MBC patients. Amplification of both HER2 and Topo2a genes was determined by chromogenic in situ hybridization (CISH in primary tumor tissue of 71 MBC patients. Starting point for follow-up was the time of diagnosis of metastatic disease. Although there was significant correlation between HER2 amplification and Topo2a alterations, Topo2a amplification was not strictly related to HER2 amplification. Follow-up of patients showed that there was no difference in MBC survival between HER2-nonamplified and HER2-amplified patients for subgroup as whole, but there was significant difference in MBC survival between patients with and without Topo2a amplification. HER2 amplification showed prognostic value in subgroups of patients, as well as Topo2a. Combination of these two genes with different status (nonamplified, amplified, coamplified indicated that they might have additive effect. Also, it has been shown that Topo2a-amplified cases have poorer survival than Topo2a-nonamplified, when treated with CMF therapy.
The Tumor Suppressor BCL7B Functions in the Wnt Signaling Pathway.
Directory of Open Access Journals (Sweden)
Tomoko Uehara
2015-01-01
Full Text Available Human BCL7 gene family consists of BCL7A, BCL7B, and BCL7C. A number of clinical studies have reported that BCL7 family is involved in cancer incidence, progression, and development. Among them, BCL7B, located on chromosome 7q11.23, is one of the deleted genes in patients with Williams-Beuren syndrome. Although several studies have suggested that malignant diseases occurring in patients with Williams-Beuren syndrome are associated with aberrations in BCL7B, little is known regarding the function of this gene at the cellular level. In this study, we focused on bcl-7, which is the only homolog of BCL7 gene family in Caenorhabditis elegans, and analyzed bcl-7 deletion mutants. As a result, we found that bcl-7 is required for the asymmetric differentiation of epithelial seam cells, which have self-renewal properties as stem cells and divide asymmetrically through the WNT pathway. Distal tip cell development, which is regulated by the WNT pathway in Caenorhabditis elegans, was also affected in bcl-7-knockout mutants. Interestingly, bcl-7 mutants exhibited nuclear enlargement, reminiscent of the anaplastic features of malignant cells. Furthermore, in KATOIII human gastric cancer cells, BCL7B knockdown induced nuclear enlargement, promoted the multinuclei phenotype and suppressed cell death. In addition, this study showed that BCL7B negatively regulates the Wnt-signaling pathway and positively regulates the apoptotic pathway. Taken together, our data indicate that BCL7B/BCL-7 has some roles in maintaining the structure of nuclei and is involved in the modulation of multiple pathways, including Wnt and apoptosis. This study may implicate a risk of malignancies with BCL7B-deficiency, such as Williams-Beuren syndrome.
Directory of Open Access Journals (Sweden)
Anastasia Wyce
Full Text Available BET family proteins are epigenetic regulators known to control expression of genes involved in cell growth and oncogenesis. Selective inhibitors of BET proteins exhibit potent anti-proliferative activity in a number of hematologic cancer models, in part through suppression of the MYC oncogene and downstream Myc-driven pathways. However, little is currently known about the activity of BET inhibitors in solid tumor models, and whether down-regulation of MYC family genes contributes to sensitivity. Here we provide evidence for potent BET inhibitor activity in neuroblastoma, a pediatric solid tumor associated with a high frequency of MYCN amplifications. We treated a panel of neuroblastoma cell lines with a novel small molecule inhibitor of BET proteins, GSK1324726A (I-BET726, and observed potent growth inhibition and cytotoxicity in most cell lines irrespective of MYCN copy number or expression level. Gene expression analyses in neuroblastoma cell lines suggest a role of BET inhibition in apoptosis, signaling, and N-Myc-driven pathways, including the direct suppression of BCL2 and MYCN. Reversal of MYCN or BCL2 suppression reduces the potency of I-BET726-induced cytotoxicity in a cell line-specific manner; however, neither factor fully accounts for I-BET726 sensitivity. Oral administration of I-BET726 to mouse xenograft models of human neuroblastoma results in tumor growth inhibition and down-regulation MYCN and BCL2 expression, suggesting a potential role for these genes in tumor growth. Taken together, our data highlight the potential of BET inhibitors as novel therapeutics for neuroblastoma, and suggest that sensitivity is driven by pleiotropic effects on cell growth and apoptotic pathways in a context-specific manner.
Gene expression in Catla catla (Hamilton) subjected to acute and protracted doses of gamma radiation
Energy Technology Data Exchange (ETDEWEB)
Anbumani, S., E-mail: aquatox1982@gmail.com; Mohankumar, Mary N., E-mail: marynmk@gmail.com
2016-09-15
Highlights: • Gamma radiation induced up- and down- regulation of cell cycle genes. • Protracted dose-rate induced gene up-regulation to facilitate cell survival. • bcl-2 gene facilitates repair at protracted dose and cell death at acute exposures. • gadd45α, cdk1 and bcl-2 genes work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells. - Abstract: Studies on transcriptional modulation after gamma radiation exposure in fish are limited. Cell cycle perturbations and expression of apoptotic genes were investigated in the fish, Catla catla after acute and protracted exposures to gamma radiation over a 90 day period. Significant changes in gene expression were observed between day 1 and 90 post-exposure. Gamma radiation induced a significant down-regulation of target genes gadd45α, cdk1 and bcl-2 from day 1 to day 3 after protracted exposure, whereas it persists till day 6 upon acute exposure. From day 12 onwards, Gadd45α, cdk1 and bcl-2 genes were up-regulated following protracted exposure, indicating DNA repair, cell-cycle arrest and apoptosis. There exists a linear correlation between these genes (gadd45α – r = 0.85, p = 0.0073; cdk1 – r = 0.86, p = 0.0053; bcl-2 – r = 0.89, p = 0.0026) at protracted exposures. This is the first report on the dual role of bcl-2 gene in fish exposed to acute and protracted radiation and correlation among the aforementioned genes that work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells.
Gene expression in Catla catla (Hamilton) subjected to acute and protracted doses of gamma radiation
International Nuclear Information System (INIS)
Anbumani, S.; Mohankumar, Mary N.
2016-01-01
Highlights: • Gamma radiation induced up- and down- regulation of cell cycle genes. • Protracted dose-rate induced gene up-regulation to facilitate cell survival. • bcl-2 gene facilitates repair at protracted dose and cell death at acute exposures. • gadd45α, cdk1 and bcl-2 genes work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells. - Abstract: Studies on transcriptional modulation after gamma radiation exposure in fish are limited. Cell cycle perturbations and expression of apoptotic genes were investigated in the fish, Catla catla after acute and protracted exposures to gamma radiation over a 90 day period. Significant changes in gene expression were observed between day 1 and 90 post-exposure. Gamma radiation induced a significant down-regulation of target genes gadd45α, cdk1 and bcl-2 from day 1 to day 3 after protracted exposure, whereas it persists till day 6 upon acute exposure. From day 12 onwards, Gadd45α, cdk1 and bcl-2 genes were up-regulated following protracted exposure, indicating DNA repair, cell-cycle arrest and apoptosis. There exists a linear correlation between these genes (gadd45α – r = 0.85, p = 0.0073; cdk1 – r = 0.86, p = 0.0053; bcl-2 – r = 0.89, p = 0.0026) at protracted exposures. This is the first report on the dual role of bcl-2 gene in fish exposed to acute and protracted radiation and correlation among the aforementioned genes that work in concert to promote ‘repair’ and ‘death’ circuitries in fish blood cells.
Directory of Open Access Journals (Sweden)
Eliseos J. Mucaki
2017-05-01
Full Text Available Genomic aberrations and gene expression-defined subtypes in the large METABRIC patient cohort have been used to stratify and predict survival. The present study used normalized gene expression signatures of paclitaxel drug response to predict outcome for different survival times in METABRIC patients receiving hormone (HT and, in some cases, chemotherapy (CT agents. This machine learning method, which distinguishes sensitivity vs. resistance in breast cancer cell lines and validates predictions in patients; was also used to derive gene signatures of other HT (tamoxifen and CT agents (methotrexate, epirubicin, doxorubicin, and 5-fluorouracil used in METABRIC. Paclitaxel gene signatures exhibited the best performance, however the other agents also predicted survival with acceptable accuracies. A support vector machine (SVM model of paclitaxel response containing genes ABCB1, ABCB11, ABCC1, ABCC10, BAD, BBC3, BCL2, BCL2L1, BMF, CYP2C8, CYP3A4, MAP2, MAP4, MAPT, NR1I2, SLCO1B3, TUBB1, TUBB4A, and TUBB4B was 78.6% accurate in predicting survival of 84 patients treated with both HT and CT (median survival ≥ 4.4 yr. Accuracy was lower (73.4% in 304 untreated patients. The performance of other machine learning approaches was also evaluated at different survival thresholds. Minimum redundancy maximum relevance feature selection of a paclitaxel-based SVM classifier based on expression of genes BCL2L1, BBC3, FGF2, FN1, and TWIST1 was 81.1% accurate in 53 CT patients. In addition, a random forest (RF classifier using a gene signature (ABCB1, ABCB11, ABCC1, ABCC10, BAD, BBC3, BCL2, BCL2L1, BMF, CYP2C8, CYP3A4, MAP2, MAP4, MAPT, NR1I2,SLCO1B3, TUBB1, TUBB4A, and TUBB4B predicted >3-year survival with 85.5% accuracy in 420 HT patients. A similar RF gene signature showed 82.7% accuracy in 504 patients treated with CT and/or HT. These results suggest that tumor gene expression signatures refined by machine learning techniques can be useful for
Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel
2008-12-01
Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.
Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M
1999-12-22
About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Rafal Goraczniak
2013-01-01
Full Text Available U1 Adaptor is a recently discovered oligonucleotide-based gene-silencing technology with a unique mechanism of action that targets nuclear pre-mRNA processing. U1 Adaptors have two distinct functional domains, both of which must be present on the same oligonucleotide to exert their gene-silencing function. Here, we present the first in vivo use of U1 Adaptors by targeting two different human genes implicated in melanomagenesis, B-cell lymphoma 2 (BCL2 and metabotropic glutamate receptor 1 (GRM1, in a human melanoma cell xenograft mouse model system. Using a newly developed dendrimer delivery system, anti-BCL2 U1 Adaptors were very potent and suppressed tumor growth at doses as low as 34 µg/kg with twice weekly intravenous (iv administration. Anti-GRM1 U1 Adaptors suppressed tumor xenograft growth with similar potency. Mechanism of action was demonstrated by showing target gene suppression in tumors and by observing that negative control U1 Adaptors with just one functional domain show no tumor suppression activity. The anti-BCL2 and anti-GRM1 treatments were equally effective against cell lines harboring either wild-type or a mutant V600E B-RAF allele, the most common mutation in melanoma. Treatment of normal immune-competent mice (C57BL6 indicated no organ toxicity or immune stimulation. These proof-of-concept studies represent an in-depth (over 800 mice in ~108 treatment groups validation that U1 Adaptors are a highly potent gene-silencing therapeutic and open the way for their further development to treat other human diseases.
Bakhirev, Alexei G; Vasef, Mohammad A; Zhang, Qian-Yun; Reichard, Kaaren K; Czuchlewski, David R
2014-04-01
BCL6 translocations are a frequent finding in B-cell lymphomas of diverse subtypes, including some cases of nodular lymphocyte-predominant Hodgkin lymphoma (NLPHL). However, reliable analysis of BCL6 rearrangements using fluorescence in situ hybridization is difficult in NLPHL because of the relative paucity of neoplastic cells. Combined immunofluorescence microscopy and fluorescence in situ hybridization, or fluorescence immunophenotyping and interphase cytogenetics as a tool for the investigation of neoplasms (FICTION), permits targeted analysis of neoplastic cells. To better define the spectrum of BCL6 abnormalities in NLPHL using FICTION analysis. We performed an optimized FICTION analysis of 24 lymph nodes, including 11 NLPHL, 5 follicular hyperplasia with prominent progressive transformation of germinal centers, and 8 follicular hyperplasia without progressive transformation of germinal centers. BCL6 rearrangement was identified in 5 of 11 cases of NLPHL (46%). In addition, BCL6 gene amplification, with large clusters of BCL6 signals in the absence of chromosome 3 aneuploidy, was detected in 3 of 11 cases of NLPHL (27%). One NLPHL showed extra copies of BCL6 present in conjunction with multiple copies of chromosome 3. Altogether, we detected BCL6 abnormalities in 9 of 11 cases of NLPHL (82%). None of the progressive transformation of germinal centers or follicular hyperplasia cases showed BCL6 abnormalities by FICTION. To our knowledge, this is the first report of BCL6 gene amplification in NLPHL. Our optimized protocol for FICTION permits detection of cytogenetic abnormalities in most NLPHL cases and may represent a useful ancillary diagnostic technique.
International Nuclear Information System (INIS)
Yamashita, Hideomi; Murakami, Naoya; Asari, Takao; Okuma, Kae; Ohtomo, Kuni; Nakagawa, Keiichi
2009-01-01
Purpose: The expressions of six cell-cycle-associated proteins were analyzed in cervical squamous cell carcinomas in correlation in a search for prognostic correlations in tumors treated with concurrent chemoradiation therapy (cCRT). Methods and Materials: The expressions of p53, p21/waf1/cip1, molecular immunology borstel-1 (MIB-1), epidermal growth factor receptor (EGFR), human epidermal growth factor receptor type 2 (HER2), and Bcl-2 were studied using an immunohistochemical method in 57 cases of cervical squamous cell carcinoma treated with cCRT. Patients received cCRT between 1998 and 2005. The mean patient age was 61 years (range, 27-82 years). The number of patients with Stage II, III, and IVA disease was 18, 29, and 10, respectively. Results: The number of patients with tumors positive for p53, p21/waf1/cip1, MIB-1, EGFR, HER2, and Bcl-2 was 26, 24, 49, 26, 13, and 11, respectively; no significant correlation was noted. The 5-year overall survival rates of HER2-positive and -negative patients was 76% vs. 44%, which was of borderline significance (p = 0.0675). No significant correlation was noted between overall survival and expressions of p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2. No correlation was observed between local control and expression of any of the proteins. Conclusion: Expression of HER2 protein had a weak impact of borderline significance on overall survival in squamous cell carcinoma of the uterine cervix treated with cCRT. However, no clinical associations could be established for p53, p21/waf1/cip1, MIB-1, EGFR, and Bcl-2 protein expressions.
Directory of Open Access Journals (Sweden)
Yu-Li Lo
Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity
Li, Zhiqiang; Sun, Yang; Wan, Hongxing; Chai, Fang
2017-01-01
Objective To investigate the role of N-myc downstream regulated gene 2 (NDRG2) gene in the proliferation, migration and apoptosis of rectal cancer cells. Methods Human rectal cancer SW480 cells were cultured and transfected with pCDNA3.1-NDRG2 and empty vector (SW480-Ve). SW480 cells were set as a control group. Cell proliferation was detected in SW480 cells, SW480-Ve cells and SW480-NDRG2 cells by MTT assay; cell migration distance in the three groups at 24, 48, 72 hours was tested by wound healing assay; apoptosis rate was determined in the three groups at 48 hours by flow cytometry; the expressions of Bax, caspase-3, Bcl-2 proteins in the three groups were examined by Western blotting. Results After the cells were cultured for 7 days, cell survival rate in SW480-NDRG2 group was significantly lower than that in SW480 cells and SW480-Ve cells; the cell survival rate decreased gradually with the prolongation of the culture time; and it had no significant difference between SW480-Ve group and SW480 group. Cell migration distance in SW480-NDRG2 group was significantly lower than that in SW480-Ve cells and SW480 cells, and it had also no significant difference between SW480-Ve cells and SW480 cells. The apoptosis rate in SW480-NDRG2 group was significantly higher than that in SW480 group and SW480-Ve group, and SW480 cells and SW480-Ve cells had no significant difference in the rate. The expressions of Bax and caspase-3 proteins in SW480-NDRG2 group were significantly higher than those in SW480 cells and SW480-Ve cells; Bcl-2 protein expression was significantly lower in SW480-NDRG2 group than in SW480 cells and SW480-Ve cells; and the expressions of Bax, caspase-3 and Bcl-2 proteins were not significantly different between SW480 cells and SW480-Ve cells. Conclusion Overexpression of NDRG2 can inhibit the proliferation, reduce cell migration, and promote cell apoptosis by regulating the expressions of Bcl-2, Bax and caspase-3 proteins in SW480 cells.
Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein
2017-09-01
The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.
Li, Lu; Li, Yanyan; Que, Ximei; Gao, Xue; Gao, Qian; Yu, Mingxing; Ma, Kaili; Xi, Yanfeng; Wang, Tong
2018-04-19
Numerous studies have investigated the prognostic values of MYC and/or BCL2 protein overexpression in diffuse large B-cell lymphoma (DLBCL). However, the results still demonstrate discrepancies among different studies. We aimed to do a systematic review and meta-analysis on the relationships between overexpression MYC and/or BCL2 and DLBCLs treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). This study followed the guidelines of PRISMA and Cochrane handbook. The hazard ratios (HRs) for overall survival (OS) were pooled to estimate the main effect size. Twenty studies recruited a total of 5576 patients were available for this meta-analysis. The results showed that MYC (HR = 1.96, 95%CI (confidence interval) = 1.69-2.27)without heterogeneity(I 2 = 17.2%, P = 0.280), BCL2 (HR = 1.65, 95%CI = 1.43-1.89, I 2 = 20.7%, P = 0.234) protein overexpression, and co-overexpression (HR = 2.58, 95%CI = 2.19-3.04, I 2 = 17.2%, P = 0.275) had a poor prognosis in R-CHOP treated DLBCL patients, respectively. The current analysis indicated that MYC and/or BCL2 protein overexpression, and particularly co-overexpression was related to short overall survival in R-CHOP treated DLBCL patients, showing that application of the two new biomarkers can help to better stratify DLBCL patients and guide targeted treatment.
Bcl-xL regulates mitochondrial energetics by stabilizing the inner membrane potential.
Chen, Ying-Bei; Aon, Miguel A; Hsu, Yi-Te; Soane, Lucian; Teng, Xinchen; McCaffery, J Michael; Cheng, Wen-Chih; Qi, Bing; Li, Hongmei; Alavian, Kambiz N; Dayhoff-Brannigan, Margaret; Zou, Shifa; Pineda, Fernando J; O'Rourke, Brian; Ko, Young H; Pedersen, Peter L; Kaczmarek, Leonard K; Jonas, Elizabeth A; Hardwick, J Marie
2011-10-17
Mammalian Bcl-x(L) protein localizes to the outer mitochondrial membrane, where it inhibits apoptosis by binding Bax and inhibiting Bax-induced outer membrane permeabilization. Contrary to expectation, we found by electron microscopy and biochemical approaches that endogenous Bcl-x(L) also localized to inner mitochondrial cristae. Two-photon microscopy of cultured neurons revealed large fluctuations in inner mitochondrial membrane potential when Bcl-x(L) was genetically deleted or pharmacologically inhibited, indicating increased total ion flux into and out of mitochondria. Computational, biochemical, and genetic evidence indicated that Bcl-x(L) reduces futile ion flux across the inner mitochondrial membrane to prevent a wasteful drain on cellular resources, thereby preventing an energetic crisis during stress. Given that F(1)F(O)-ATP synthase directly affects mitochondrial membrane potential and having identified the mitochondrial ATP synthase β subunit in a screen for Bcl-x(L)-binding partners, we tested and found that Bcl-x(L) failed to protect β subunit-deficient yeast. Thus, by bolstering mitochondrial energetic capacity, Bcl-x(L) may contribute importantly to cell survival independently of other Bcl-2 family proteins.
Apoptosis in differentiating C2C12 muscle cells selectively targets Bcl-2-deficient myotubes
Schoneich, Christian; Dremina, Elena; Galeva, Nadezhda; Sharov, Victor
2014-01-01
Muscle cell apoptosis accompanies normal muscle development and regeneration, as well as degenerative diseases and aging. C2C12 murine myoblast cells represent a common model to study muscle differentiation. Though it was already shown that myogenic differentiation of C2C12 cells is accompanied by enhanced apoptosis in a fraction of cells, either the cell population sensitive to apoptosis or regulatory mechanisms for the apoptotic response are unclear so far. In the current study we characterize apoptotic phenotypes of different types of C2C12 cells at all stages of differentiation, and report here that myotubes of differentiated C2C12 cells with low levels of anti-apoptotic Bcl-2 expression are particularly vulnerable to apoptosis even though they are displaying low levels of pro-apoptotic proteins Bax, Bak and Bad. In contrast, reserve cells exhibit higher levels of Bcl-2 and high resistance to apoptosis. The transfection of proliferating myoblasts with Bcl-2 prior to differentiation did not protect against spontaneous apoptosis accompanying differentiation of C2C12 cell but led to Bcl-2 overexpression in myotubes and to significant protection from apoptotic cell loss caused by exposure to hydrogen peroxide. Overall, our data advocate for a Bcl-2-dependent mechanism of apoptosis in differentiated muscle cells. However, downstream processes for spontaneous and hydrogen peroxide induced apoptosis are not completely similar. Apoptosis in differentiating myoblasts and myotubes is regulated not through interaction of Bcl-2 with pro-apoptotic Bcl-2 family proteins such as Bax, Bak, and Bad. PMID:24129924
Tabata, Rie; Yasumizu, Ryoji; Tabata, Chiharu; Kojima, Masaru
2013-01-01
Here, we report a rare case of double-hit lymphoma, demonstrating t(6;14;18)(p25;q32;q21), suggesting two independent dual-translocations, c-MYC/BCL-2 and IRF4/BCL-2. The present case had a rare abnormal chromosome, t(6;14;18)(p25;q32;q21), independently, in addition to known dual-hit chromosomal abnormalities, t(14;18)(q32;q21) and t(8;22)(q24;q11.2). Lymph node was characterized by a follicular and diffuse growth pattern with variously sized neoplastic follicles. The intrafollicular area was composed of centrocytes with a few centroblasts and the interfollicular area was occupied by uniformly spread medium- to large-sized lymphocytes. CD23 immunostaining demonstrated a disrupted follicular dendritic cell meshwork. The intrafollicular tumor cells had a germinal center phenotype with the expression of surface IgM, CD10, Bcl-2, Bcl-6, and MUM1/IRF4. However, the interfollicular larger cells showed plasmacytic differentiation with diminished CD20, Bcl-2, Bcl-6, and positive intracytoplasmic IgM, and co-expression of MUM1/IRF4 and CD138 with increased Ki-67-positive cells (> 90%). MUM1/IRF4 has been found to induce c-MYC expression, and in turn, MYC transactivates MUM1/IRF4, creating a positive autoregulatory feedback loop. On the other hand, MUM1/IRF4 functions as a tumor suppressor in c-MYC-induced B-cell leukemia. The present rare case arouses interest in view of the possible "dual" activation of both c-MYC and MUM1/IRF4 through two independent dual-translocations, c-MYC/BCL-2 and IRF4/BCL-2.
Dendritic cell fate is determined by BCL11A
Ippolito, Gregory C.; Dekker, Joseph D.; Wang, Yui-Hsi; Lee, Bum-Kyu; Shaffer, Arthur L.; Lin, Jian; Wall, Jason K.; Lee, Baeck-Seung; Staudt, Louis M.; Liu, Yong-Jun; Iyer, Vishwanath R.; Tucker, Haley O.
2014-01-01
The plasmacytoid dendritic cell (pDC) is vital to the coordinated action of innate and adaptive immunity. pDC development has not been unequivocally traced, nor has its transcriptional regulatory network been fully clarified. Here we confirm an essential requirement for the BCL11A transcription factor in fetal pDC development, and demonstrate this lineage-specific requirement in the adult organism. Furthermore, we identify BCL11A gene targets and provide a molecular mechanism for its action in pDC commitment. Embryonic germ-line deletion of Bcl11a revealed an absolute cellular, molecular, and functional absence of pDCs in fetal mice. In adults, deletion of Bcl11a in hematopoietic stem cells resulted in perturbed yet continued generation of progenitors, loss of downstream pDC and B-cell lineages, and persisting myeloid, conventional dendritic, and T-cell lineages. Challenge with virus resulted in a marked reduction of antiviral response in conditionally deleted adults. Genome-wide analyses of BCL11A DNA binding and expression revealed that BCL11A regulates transcription of E2-2 and other pDC differentiation modulators, including ID2 and MTG16. Our results identify BCL11A as an essential, lineage-specific factor that regulates pDC development, supporting a model wherein differentiation into pDCs represents a primed “default” pathway for common dendritic cell progenitors. PMID:24591644
Induction of Bim and Bid gene expression during accelerated apoptosis in severe sepsis.
Weber, Stefan U; Schewe, Jens-Christian; Lehmann, Lutz E; Müller, Stefan; Book, Malte; Klaschik, Sven; Hoeft, Andreas; Stüber, Frank
2008-01-01
In transgenic animal models of sepsis, members of the Bcl-2 family of proteins regulate lymphocyte apoptosis and survival of sepsis. This study investigates the gene regulation of pro-apoptotic and anti-apoptotic members of the Bcl-2 family of proteins in patients with early stage severe sepsis. In this prospective case-control study, patients were recruited from three intensive care units (ICUs) in a university hospital. Sixteen patients were enrolled when they fulfilled the criteria of severe sepsis. Ten critically ill but non-septic patients and 11 healthy volunteers served as controls. Blood samples were immediately obtained at inclusion. To confirm the presence of accelerated apoptosis in the patient groups, caspase-3 activation and phosphatidylserine externalisation in CD4+, CD8+ and CD19+ lymphocyte subsets were assessed using flow cytometry. Specific mRNAs of Bcl-2 family members were quantified from whole blood by real-time PCR. To test for statistical significance, Kruskal-Wallis testing with Dunn's multiple comparison test for post hoc analysis was performed. In all lymphocyte populations caspase-3 (p < 0.05) was activated, which was reflected in an increased phosphatidylserine externalisation (p < 0.05). Accordingly, lymphocyte counts were decreased in early severe sepsis. In CD4+ T-cells (p < 0.05) and B-cells (p < 0.001) the Bcl-2 protein was decreased in severe sepsis. Gene expression of the BH3-only Bim was massively upregulated as compared with critically ill patients (p < 0.001) and 51.6-fold as compared with healthy controls (p < 0.05). Bid was increased 12.9-fold compared with critically ill patients (p < 0.001). In the group of mitochondrial apoptosis inducers, Bak was upregulated 5.6-fold, while the expression of Bax showed no significant variations. By contrast, the pro-survival members Bcl-2 and Bcl-xl were both downregulated in severe sepsis (p < 0.001 and p < 0.05, respectively). In early severe sepsis a gene expression pattern with
Hemoglobin genetics: recent contributions of GWAS and gene editing
Smith, Elenoe C.; Orkin, Stuart H.
2016-01-01
The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226
International Nuclear Information System (INIS)
Lee, Kyung-Hun; Noh, Dong-Young; Heo, Dae Seog; Ha, Sung Whan; Bang, Yung-Jue; Im, Seock-Ah; Oh, Do-Youn; Lee, Se-Hoon; Chie, Eui Kyu; Han, Wonshik; Kim, Dong-Wan; Kim, Tae-You; Park, In Ae
2007-01-01
Bcl-2 is positively regulated by hormonal receptor pathways in breast cancer. A study was conducted to assess the prognostic significances of clinico-pathologic variables and of ER, PR, p53, c-erbB2, bcl-2, or Ki-67 as markers of relapse in breast cancer patients who had received the identical adjuvant therapy at a single institution. A cohort of 151 curatively resected stage III breast cancer patients (M:F = 3:148, median age 46 years) who had 4 or more positive lymph nodes and received doxorubicin and cyclophosphamide followed by paclitaxel (AC/T) as adjuvant chemotherapy was analyzed for clinico-pathologic characteristics including disease-free survival (DFS) and overall survival (OS). Patients with positive ER and/or PR expression received 5 years of tamoxifen following AC/T. The protein expressions of biomarkers were assessed immunohistochemically. The median follow-up duration was 36 months, and 37 patients (24.5%) experienced a recurrence. Univariate analyses indicated that the tumor size (P = 0.038) and the number of involved lymph nodes (P < 0.001) significantly affected the recurrences. However, the type of surgery, the histology, histologic grade, the presence of endolymphatic emboli, and a close resection margin did not. Moreover, ER positivity (P = 0.013), bcl-2 positivity (P = 0.002) and low p53 expression (P = 0.032) were found to be significantly associated with a prolonged DFS. Furthermore, multivariate analysis identified 10 or more involved lymph nodes (HR 7.366; P < 0.001), negative bcl-2 expression (HR 2.895; P = 0.030), and c-erbB2 over-expression (HR 3.535; P = 0.001) as independent indicators of poorer DFS. In addition, bcl-2 expression was found to be significantly correlated with the expressions of ER and PR, and inversely correlated with the expressions of p53, c-erbB2 and Ki-67. Patients with bcl-2 expression had a significantly longer DFS than those without, even in the ER (+) subgroup. Moreover, OS was significantly affected by ER, bcl
Directory of Open Access Journals (Sweden)
Kim Dong-Wan
2007-04-01
Full Text Available Abstract Background Bcl-2 is positively regulated by hormonal receptor pathways in breast cancer. A study was conducted to assess the prognostic significances of clinico-pathologic variables and of ER, PR, p53, c-erbB2, bcl-2, or Ki-67 as markers of relapse in breast cancer patients who had received the identical adjuvant therapy at a single institution. Methods A cohort of 151 curatively resected stage III breast cancer patients (M:F = 3:148, median age 46 years who had 4 or more positive lymph nodes and received doxorubicin and cyclophosphamide followed by paclitaxel (AC/T as adjuvant chemotherapy was analyzed for clinico-pathologic characteristics including disease-free survival (DFS and overall survival (OS. Patients with positive ER and/or PR expression received 5 years of tamoxifen following AC/T. The protein expressions of biomarkers were assessed immunohistochemically. Results The median follow-up duration was 36 months, and 37 patients (24.5% experienced a recurrence. Univariate analyses indicated that the tumor size (P = 0.038 and the number of involved lymph nodes (P P = 0.013, bcl-2 positivity (P = 0.002 and low p53 expression (P = 0.032 were found to be significantly associated with a prolonged DFS. Furthermore, multivariate analysis identified 10 or more involved lymph nodes (HR 7.366; P P = 0.030, and c-erbB2 over-expression (HR 3.535; P = 0.001 as independent indicators of poorer DFS. In addition, bcl-2 expression was found to be significantly correlated with the expressions of ER and PR, and inversely correlated with the expressions of p53, c-erbB2 and Ki-67. Patients with bcl-2 expression had a significantly longer DFS than those without, even in the ER (+ subgroup. Moreover, OS was significantly affected by ER, bcl-2 and c-erbB2. Conclusion Bcl-2 is an independent prognostic factor of DFS in curatively resected stage III breast cancer patients and appears to be a useful prognostic factor in combination with c-erbB2 and the
Identification of an HLA-A*0201 restricted Bcl2-derived epitope expressed on tumors
DEFF Research Database (Denmark)
Wang, Mingjun; Johansen, Britta; Nissen, Mogens H
2006-01-01
A large number of human tumor-associated antigen-derived peptides have been identified that are recognized by CTLs in a MHC-I restricted fashion. The apoptosis inhibitory protein Bcl2 is overexpressed in many human cancers as part of their neoplastic phenotype. Since inhibition or loss of Bcl2...... from the amino acid sequence of the Bcl2 protein and its binding affinity for HLA-A*0201 was confirmed using a biochemical binding assay. We here demonstrate that the 9-mer peptide Bcl2(85-93) induces specific CTL reactivity in immunized C57-A2K(b) or -A2D(b) tg mice. These Bcl2(85-93) specific CTLs...... react with and lyse Bcl2-expressing human colon carcinoma CCL220 cells which have been transfected with a chimeric HLA-A*0201/H2-K(b) DNA construct similar to that expressed in the transgenic mice. Based on these observations, we suggest that Bcl2(85-93) may be a target for immune therapy....
Paternal breed effects on expression of IGF-II, BAK1 and BCL2-L1 in bovine preimplantation embryos
DEFF Research Database (Denmark)
Valleh, Mehdi Vafaye; Tahmoorespur, Mojtaba; Joupari, Morteza Daliri
2015-01-01
of this study was to investigate the effects of the paternal breed on the early embryonic development and relative expression of the maternally imprinted gene, IGF-II, and the apoptosis-related genes BAK1 and BCL2-L1 in in vitro produced (IVP) bovine embryos derived from two unrelated paternal breeds (Holstein......Summary The effects of the paternal breed on early embryo and later pre- and postnatal development are well documented. Several recent studies have suggested that such paternal effects may be mediated by the paternally induced epigenetic modifications during early embryogenesis. The objective...... and Brown Swiss). The degree of correlation of IGF-II expression pattern with embryo developmental competence and apoptosis-related genes was also investigated. The relative abundance of IGF-II, BCL2-L1 and BAK1 transcripts in day 8 embryos was measured by quantitative reverse-transcription polymerase chain...
International Nuclear Information System (INIS)
Carthy, Christopher M.; Yanagawa, Bobby; Luo Honglin; Granville, David J.; Yang, Decheng; Cheung, Paul; Cheung, Caroline; Esfandiarei, Mitra; Rudin, Charles M.; Thompson, Craig B.; Hunt, David W.C.; McManus, Bruce M.
2003-01-01
Coxsackievirus B3, a cytopathic virus in the family Picornaviridae, induces degenerative changes in host cell morphology. Here we demonstrate cytochrome c release and caspases-2, -3, -6, -7, -8, and -9 processing. Enforced Bcl-2 and Bcl-xL expression markedly reduced release of cytochrome c, presentation of the mitochondrial epitope 7A6, and depressed caspase activation following infection. In comparison, cell death using TRAIL ligand caused caspase-8 processing prior to cytochrome c release and executioner caspases and cell death was only partially rescued by Bcl-2 and Bcl-xL overexpression. Disruption of the mitochondrial inner membrane potential following CVB3 infection was not inhibited by zVAD.fmk treatment. Bcl-2 or Bcl-xL overexpression or zVAD.fmk treatment delayed the loss of host cell viability and decreased progeny virus release following infection. Our data suggest that mitochondrial release of cytochrome c may be an important early event in caspase activation in CVB3 infection, and, as such, may contribute to the loss of host-cell viability and progeny virus release
The role of BIM-EL and BCL2-α on the efficacy of erlotinib and gefitinib in lung cancer.
Simasi, Jacinta; Oelkrug, Christopher; Schubert, Andreas; Nieber, Karen; Gillissen, Adrian
2015-04-01
Tyrosine kinase inhibitors (TKI), erlotinib and gefitinib are small molecule inhibitors which are used for the treatment of lung cancer. But, the development of drug resistance has been reported as one of the major setbacks in oncology. This study focused on the mechanisms leading to secondary resistance by assessing the gene expression of BCL2 family proteins which are associated with the intrinsic apoptotic signaling pathway. 8 genes were investigated in erlotinib and gefitinib treated cells by real time PCR and protein analysis by western blotting. The cells were exposed to the test drugs 48h prior to RNA or protein isolation. It was observed that BIM-EL, a pro-apoptotic protein was up-regulated in cells sensitive to the drugs but not in the resistant cells. On the other hand BCL2-α, an anti-apoptotic protein was up-regulated in the resistant cells and not in the sensitive cells. BCL2-α revealed a counter-regulation effect on BIM-EL and this effect is probably one of the causes of secondary resistance to erlotinib and gefitinib. Copyright © 2014 Elsevier B.V. All rights reserved.
Visco, C.; Tzankov, A.; Xu-Monette, Z.Y.; Miranda, R.N.; Tai, Y.C.; Li, Y.; Liu, W.M.; d'Amore, E.S.; Li, Y.O.; Montes-Moreno, S.; Dybkaer, K.; Chiu, A.; Orazi, A.; Zu, Y.; Bhagat, G.; Wang, H.Y.; Dunphy, C.H.; His, E.D.; Zhao, X.F.; Choi, W.W.; Krieken, J.H.J.M. van; Huang, Q.; Ai, W.; O'Neill, S.; Ponzoni, M.; Ferreri, A.J.; Kahl, B.S.; Winter, J.N.; Go, R.S.; Dirnhofer, S.; Piris, M.A.; Moller, M.B.; Wu, L.; Medeiros, L.J.; Young, K.H.
2013-01-01
Diffuse large B-cell lymphoma can be classified by gene expression profiling into germinal center and activated B-cell subtypes with different prognoses after rituximab-CHOP. The importance of previously recognized prognostic markers, such as Bcl-2 protein expression and BCL2 gene abnormalities, has
HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.
Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C
2006-02-01
HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.
Energy Technology Data Exchange (ETDEWEB)
Lee, Dong-Hwa; Ha, Ji-Hyang [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of); Kim, Yul [Department of Bio and Brain Engineering, KAIST, Daejeon 305-701 (Korea, Republic of); Bae, Kwang-Hee [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of); Park, Jae-Yong [Department of Physiology, Institute of Health Science, School of Medicine, Gyeongsang National University, Jinju, Gyeongnam 660-751 (Korea, Republic of); Choi, Wan Sung [Department of Anatomy and Neurobiology, Institute of Health Science, School of Medicine, Gyeongsang National University, Jinju, Gyeongnam 660-751 (Korea, Republic of); Yoon, Ho Sup [Division of Structural and Computational Biology, School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637511 (Singapore); Park, Sung Goo; Park, Byoung Chul [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of); Yi, Gwan-Su, E-mail: gsyi@kaist.ac.kr [Department of Bio and Brain Engineering, KAIST, Daejeon 305-701 (Korea, Republic of); Chi, Seung-Wook, E-mail: swchi@kribb.re.kr [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of)
2011-05-20
Highlights: {yields} Identification of a conserved BH3 motif in C-terminal coiled coil region of nCLU. {yields} The nCLU BH3 domain binds to BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. {yields} A conserved binding mechanism of nCLU BH3 and the other pro-apoptotic BH3 peptides with Bcl-X{sub L}. {yields} The absolutely conserved Leu323 and Asp328 of nCLU BH3 domain are critical for binding to Bcl-X{sub L.} {yields} Molecular understanding of the pro-apoptotic function of nCLU as a novel BH3-only protein. -- Abstract: Clusterin (CLU) is a multifunctional glycoprotein that is overexpressed in prostate and breast cancers. Although CLU is known to be involved in the regulation of apoptosis and cell survival, the precise molecular mechanism underlying the pro-apoptotic function of nuclear CLU (nCLU) remains unclear. In this study, we identified a conserved BH3 motif in C-terminal coiled coil (CC2) region of nCLU by sequence analysis and characterized the molecular interaction of the putative nCLU BH3 domain with anti-apoptotic Bcl-2 family proteins by nuclear magnetic resonance (NMR) spectroscopy. The chemical shift perturbation data demonstrated that the nCLU BH3 domain binds to pro-apoptotic BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. A structural model of the Bcl-X{sub L}/nCLU BH3 peptide complex reveals that the binding mode is remarkably similar to those of other Bcl-X{sub L}/BH3 peptide complexes. In addition, mutational analysis confirmed that Leu323 and Asp328 of nCLU BH3 domain, absolutely conserved in the BH3 motifs of BH3-only protein family, are critical for binding to Bcl-X{sub L}. Taken altogether, our results suggest a molecular basis for the pro-apoptotic function of nCLU by elucidating the residue specific interactions of the BH3 motif in nCLU with anti-apoptotic Bcl-2 family proteins.
Directory of Open Access Journals (Sweden)
Hagit Kvitt
Full Text Available Elevated seawater temperatures are associated with coral bleaching events and related mortality. Nevertheless, some coral species are able to survive bleaching and recover. The apoptotic responses associated to this ability were studied over 3 years in the coral Stylophora pistillata from the Gulf of Eilat subjected to long term thermal stress. These include caspase activity and the expression profiles of the S. pistillata caspase and Bcl-2 genes (StyCasp and StyBcl-2-like cloned in this study. In corals exposed to thermal stress (32 or 34°C, caspase activity and the expression levels of the StyBcl-2-like gene increased over time (6-48 h and declined to basal levels within 72 h of thermal stress. Distinct transcript levels were obtained for the StyCasp gene, with stimulated expression from 6 to 48 h of 34°C thermal stress, coinciding with the onset of bleaching. Increased cell death was detected in situ only between 6 to 48 h of stress and was limited to the gastroderm. The bleached corals survived up to one month at 32°C, and recovered back symbionts when placed at 24°C. These results point to a two-stage response in corals that withstand thermal stress: (i the onset of apoptosis, accompanied by rapid activation of anti-oxidant/anti-apoptotic mediators that block the progression of apoptosis to other cells and (ii acclimatization of the coral to the chronic thermal stress alongside the completion of symbiosis breakdown. Accordingly, the coral's ability to rapidly curb apoptosis appears to be the most important trait affecting the coral's thermotolerance and survival.
Expression of Bcl-2 in canine osteosarcoma | Piro | Open Veterinary ...
African Journals Online (AJOL)
Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different ...
DEFF Research Database (Denmark)
Visco, Carlo; Wang, Jinfen; Tisi, Maria Chiara
2017-01-01
apoptotic pathways, have higher proliferative index, and lack BCL2 translocations. CONCLUSIONS: HCV-positive DLBCL have distinct molecular and pathological features compared to the HCV-negative counterparts.British Journal of Cancer advance online publication, 26 September 2017; doi:10.1038/bjc.2017.345 www.bjcancer.com....... in lymphomagenesis, as witnessed by the curative potential of antiviral therapy in HCV-related low-grade B-cell lymphomas. METHODS: We performed a case-control study including 44 HCV-positive cases of de novo DLBCL, comparing them with 132 HCV-negative patients as controls (ratio 3 to 1). Cases and controls were...... for MYC, BCL2 and BCL6, TP53 mutations, and diagnostic specimens reviewed to exclude transformation from low-grade lymphoma. RESULTS: Compared to the HCV-negative controls, patients with HCV-positive de novo DLBCL had differential expression of genes that regulate innate immune response and modulate...
EGFR and Bcl-2 in gastric mucosa of children infected with Helicobacter pylori
Directory of Open Access Journals (Sweden)
Ewa Ryszczuk
2016-03-01
Full Text Available Aim: The aim of the study was to evaluate the expression of EGFR and Bcl-2 proteins as inhibitory markers of apoptosis in surface epithelial cells and gland cells of antral gastric mucosa in children infected with Helicobacter pylori according to the severity and activity of antral gastritis and to assess the correlation between the number of cells expressing EGFR and the number of cells expressing Bcl-2 in H. pylori infected children.Materials and methods: The study included 44 children: 68.2% with chronic gastritis and positive IgG against H. pylori, and 31.8% with functional disorders of the gastrointestinal tract and with normal IgG against H. pylori. The evaluation of EGFR expression in gastric mucosa was performed immunohistochemically using monoclonal mouse anti-EGFR antibody. The polyclonal antibody was used to determine the expression of anti-Bcl-2.Results: A significant increase in the number of cells expressing EGFR and Bcl-2 protein was found in the epithelial cells in severe as well as mild and moderate gastritis in the group of children infected with H. pylori. An increase in the number of cells expressing EGFR and Bcl-2 protein was also found in the epithelial cells in group I according to the activity of gastritis. There was a statistically significant positive correlation between the numbers of cells expressing EGFR and Bcl-2 in H. pylori infected children.Conclusion: Increased expression of EGFR and Bcl-2 proteins in the epithelial cells and a statistically significant positive correlation between the numbers of cells expressing EGFR and Bcl-2 in H. pylori infected children could suggest increased regeneration abilities of gastric mucosa.
Extracellular tumor-related mRNA in plasma of lymphoma patients and survival implications.
Directory of Open Access Journals (Sweden)
Vanesa Garcia
Full Text Available BACKGROUND: We studied anomalous extracellular mRNAs in plasma from patients with diffuse large B-cell lymphoma (DLBCL and their survival implications. mRNAs studied have been reported in the literature as markers of poor (BCL2, CCND2, MYC and favorable outcome (LMO2, BCL6, FN1 in tumors. These markers were also analyzed in lymphoma tissues to test possible associations with their presence in plasma. METHODOLOGY/PRINCIPAL FINDINGS: mRNA from 42 plasma samples and 12 tumors from patients with DLBCL was analyzed by real-time PCR. Samples post-treatment were studied. The immunohistochemistry of BCL2 and BCL6 was defined. Presence of circulating tumor cells was determined by analyzing the clonality of the immunoglobulin heavy-chain genes by PCR. In DLBCL, MYC mRNA was associated with short overall survival. mRNA targets with unfavorable outcome in tumors were associated with characteristics indicative of poor prognosis, with partial treatment response and with short progression-free survival in patients with complete response. In patients with low IPI score, unfavorable mRNA targets were related to shorter overall survival, partial response, high LDH levels and death. mRNA disappeared in post-treatment samples of patients with complete response, and persisted in those with partial response or death. No associations were found between circulating tumor cells and plasma mRNA. Absence of BCL6 protein in tumors was associated with presence of unfavorable plasma mRNA. CONCLUSIONS/SIGNIFICANCE: Through a non-invasive procedure, tumor-derived mRNAs can be obtained in plasma. mRNA detected in plasma did not proceed from circulating tumor cells. In our study, unfavorable targets in plasma were associated with poor prognosis in B-cell lymphomas, mainly MYC mRNA. Moreover, the unfavorable targets in plasma could help us to classify patients with poor outcome within the good prognosis group according to IPI.
Lian, Jiqin; Karnak, David; Xu, Liang
2010-11-01
Bcl-2 is a key dual regulator of autophagy and apoptosis, but how the level of Bcl-2 influences the cellular decision between autophagy and apoptosis is unclear. The natural BH3-mimetic (-)-gossypol preferentially induces autophagy in androgen-independent (AI) prostate cancer cells that have high levels of Bcl-2 and are resistant to apoptosis, whereas apoptosis is preferentially induced in androgen-dependent or -independent cells with low Bcl-2. (-)-Gossypol induces autophagy via blocking Bcl-2-Beclin 1 interaction at the endoplasmic reticulum (ER), together with downregulating Bcl-2, upregulating Beclin 1 and activating the autophagic pathway. Furthermore, (-)-gossypol-induced autophagy is Beclin 1- and Atg5-dependent. These results provide new insights into the mode of cell death induced by Bcl-2 inhibitors, which could facilitate the rational design of clinical trials by selecting patients who are most likely to benefit from the Bcl-2-targeted molecular therapy.
G3139, a Bcl-2 antisense oligodeoxynucleotide, induces clinical responses in VAD refractory myeloma
van de Donk, N. W. C. J.; de Weerdt, O.; Veth, G.; Eurelings, M.; van Stralen, E.; Frankel, S. R.; Hagenbeek, A.; Bloem, A. C.; Lokhorst, H. M.
2004-01-01
Expression of Bcl-2 in multiple myeloma is associated with resistance to chemotherapeutic drugs. Conversely, suppression of Bcl-2 enhanced the chemosensitivity of myeloma cells in vitro. G3139 is an antisense oligodeoxynucleotide targeted to the first six codons of the Bcl-2 mRNA open reading frame.
Badr, Ramak; Hashemi, Mehrdad; Javadi, Gholamreza; Movafagh, Abolfazl; Mahdian, Reza
2015-12-01
The hippocampus is a tiny nub in the mammalian brain that is involved in forming, organizing, and storing memories. Global cerebral ischemia (GCI) and reperfusion induced apoptosis lead to cell injury and death. FK-506 is a strong immunosuppressant drug that has neuroprotective effects on the hypoxic-ischemic effects of brain damage. BAD and Bcl-xL are pro-apoptotic and anti-apoptotic genes, respectively. These genes belong to The B-cell lymphoma-2 (Bcl-2) family. In this study, we assessed the neurotrophic properties of FK-506 on expression of the BAD and Bcl-xL genes in the hippocampus following global ischemia and reperfusion. In the present experimental study, adult male Wistar rats were obtained and housed under standard conditions in the Tehran University of Medical Science in Iran. Rats were equally distributed in groups of three among the following groups: normal control, treated-1 (ischemia/reperfusion), and treated-2 (ischemia/reperfusion followed by FK-506). Global ischemia was induced for animals in the treated-1 and treated-2 groups. In treated-2, two doses of FK-506 were injected: one dose as an IV injection immediately after reperfusion and another as an intra-peritoneal (IP) injection after 48 hours. Then, the hippocampus tissue was removed after anaesthetizing the rats. RNA was isolated, cDNA was synthesized, and real-time PCR was performed. Finally, the obtained data were analyzed statistically (P value ˂ 0.05). The quantitative results of real-time PCR show that the mRNA expression ratio of Bcl-xL down-regulated was 0.75 ± 0.06 in the ischemia/reperfusion group versus 1.57 ± 0.09 in the control group (P value BAD up-regulated in the ischemia/reperfusion + FK506 group was 3.65 ± 0.49 compared to Normal control (1.39 ± 0.09) and Ischemia/reperfusion + FK506 was 1.09 ± 0.20 (P value BAD /Bcl-xL) confirmed that expression of the pro-apoptotic gene significantly decreased (P value ˂ 0.001) under the ischemia/reperfusion condition. In contrast
Directory of Open Access Journals (Sweden)
Daruka Mahadevan
Full Text Available Pearson correlation coefficient for expression analysis of the Lymphoma/Leukemia Molecular Profiling Project (LLMPP demonstrated Aurora A and B are highly correlated with MYC in DLBCL and mantle cell lymphoma (MCL, while both Auroras correlate with BCL2 only in DLBCL. Auroras are up-regulated by MYC dysregulation with associated aneuploidy and resistance to microtubule targeted agents such as vincristine. Myc and Bcl2 are differentially expressed in U-2932, TMD-8, OCI-Ly10 and Granta-519, but only U-2932 cells over-express mutated p53. Alisertib [MLN8237 or M], a highly selective small molecule inhibitor of Aurora A kinase, was synergistic with vincristine [VCR] and rituximab [R] for inhibition of cell proliferation, abrogation of cell cycle checkpoints and enhanced apoptosis versus single agent or doublet therapy. A DLBCL (U-2932 mouse model showed tumor growth inhibition (TGI of ∼ 10-20% (p = 0.001 for M, VCR and M-VCR respectively, while R alone showed ∼ 50% TGI (p = 0.001. M-R and VCR-R led to tumor regression [TR], but relapsed 10 days after discontinuing therapy. In contrast, M-VCR-R demonstrated TR with no relapse >40 days after stopping therapy with a Kaplan-Meier survival of 100%. Genes that are modulated by M-VCR-R (CENP-C, Auroras play a role in centromere-kinetochore function in an attempt to maintain mitosis in the presence of synthetic lethality. Together, our data suggest that the interaction between alisertib plus VCR plus rituximab is synergistic and synthetic lethal in Myc and Bcl-2 co-expressing DLBCL. Alisertib plus vincristine plus rituximab [M-VCR-R] may represent a new strategy for DLBCL therapy.
Mahadevan, Daruka; Morales, Carla; Cooke, Laurence S; Manziello, Ann; Mount, David W; Persky, Daniel O; Fisher, Richard I; Miller, Thomas P; Qi, Wenqing
2014-01-01
Pearson correlation coefficient for expression analysis of the Lymphoma/Leukemia Molecular Profiling Project (LLMPP) demonstrated Aurora A and B are highly correlated with MYC in DLBCL and mantle cell lymphoma (MCL), while both Auroras correlate with BCL2 only in DLBCL. Auroras are up-regulated by MYC dysregulation with associated aneuploidy and resistance to microtubule targeted agents such as vincristine. Myc and Bcl2 are differentially expressed in U-2932, TMD-8, OCI-Ly10 and Granta-519, but only U-2932 cells over-express mutated p53. Alisertib [MLN8237 or M], a highly selective small molecule inhibitor of Aurora A kinase, was synergistic with vincristine [VCR] and rituximab [R] for inhibition of cell proliferation, abrogation of cell cycle checkpoints and enhanced apoptosis versus single agent or doublet therapy. A DLBCL (U-2932) mouse model showed tumor growth inhibition (TGI) of ∼ 10-20% (p = 0.001) for M, VCR and M-VCR respectively, while R alone showed ∼ 50% TGI (p = 0.001). M-R and VCR-R led to tumor regression [TR], but relapsed 10 days after discontinuing therapy. In contrast, M-VCR-R demonstrated TR with no relapse >40 days after stopping therapy with a Kaplan-Meier survival of 100%. Genes that are modulated by M-VCR-R (CENP-C, Auroras) play a role in centromere-kinetochore function in an attempt to maintain mitosis in the presence of synthetic lethality. Together, our data suggest that the interaction between alisertib plus VCR plus rituximab is synergistic and synthetic lethal in Myc and Bcl-2 co-expressing DLBCL. Alisertib plus vincristine plus rituximab [M-VCR-R] may represent a new strategy for DLBCL therapy.
Liu, Ling; Huang, Zile; Chen, Jingjing; Wang, Jiangang; Wang, Shuying
2018-04-25
Protein phosphatase 2A (PP2A) is an important enzyme within various signal transduction pathways. The present study was investigated PP2A mediates JS-K-induced apoptosis by affecting Bcl-2 family protein. JS-K showed diverse inhibitory effects in five HCC cell lines, especially HepG2 cells. JS-K caused a dose- and time-dependent reduction in cell viability and increased in levels of LDH release. Meanwhile, JS-K- induced apoptosis was characterized by mitochondrial membrane potential reduction, Hoechst 33342 + /PI + dual staining, release of cytochrome c (Cyt c), and activation of cleaved caspase-9/3. Moreover, JS-K-treatment could lead to the activation of protein phosphatase 2A-C (PP2A-C), decrease of anti-apoptotic Bcl-2 family-protein expression including p-Bcl-2 (Ser70), Bcl-2, Bcl-xL, and Mcl-1 as well as the increase of pro-apoptosis Bcl-2 family-protein including Bim, Bad, Bax, and Bak. Furthermore, JS-K caused a marked increase of intracellular NO levels while pre-treatment with Carboxy-PTIO (a NO scavenger) reduced the cytotoxicity effects and the apoptosis rate. Meanwhile, pre-treatment with Carboxy-PTIO attenuated the JS-K-induced up-regulation of PP2A, Cyt c, and cleaved-caspase-9/3 activation. The silencing PP2A-C by siRNA could abolish the activation of PP2A-C, down-regulation of anti-apoptotic Bcl-2 family-protein (p-Bcl-2, Bcl-2, Bcl-xL, and Mcl-1), increase of pro-apoptosis Bcl-2 family-protein (Bim, Bad, Bax, and Bak) and apoptotic-related protein (Cyt c, cleaved caspase-9/3) that were caused by JS-K in HepG2 cells. In addition, pre-treatment with OA (a PP2A inhibitor) also attenuated the above effects induced by JS-K. In summary, NO release from JS-K induces apoptosis through PP2A activation, which contributed to the regulation of Bcl-2 family proteins. © 2018 Wiley Periodicals, Inc.
Miyaoka, Masashi; Kikuti, Yara Y; Carreras, Joaquim; Ikoma, Haruka; Hiraiwa, Shinichiro; Ichiki, Akifumi; Kojima, Minoru; Ando, Kiyoshi; Yokose, Tomoyuki; Sakai, Rika; Hoshikawa, Masahiro; Tomita, Naoto; Miura, Ikuo; Takata, Katsuyoshi; Yoshino, Tadashi; Takizawa, Jun; Bea, Silvia; Campo, Elias; Nakamura, Naoya
2018-02-01
Most high-grade B-cell lymphomas with MYC and BCL2 and/or BCL6 rearrangements are aggressive B-cell lymphomas. Occasional double-hit follicular lymphomas have been described but the clinicopathological features of these tumors are not well known. To clarify the characteristics of double-hit follicular lymphomas, we analyzed 10 cases of double-hit follicular lymphomas and 15 cases of high-grade B-cell lymphomas with MYC and BCL2 and/or BCL6 rearrangements for clinicopathological and genome-wide copy-number alterations and copy-neutral loss-of-heterozygosity profiles. For double-hit follicular lymphomas, the median age was 67.5 years (range: 48-82 years). The female/male ratio was 2.3. Eight patients presented with advanced clinical stage. The median follow-up time was 20 months (range: 1-132 months). At the end of the follow-up, 8 patients were alive, 2 patients were dead including 1 patient with diffuse large B-cell lymphoma transformation. Rearrangements of MYC/BCL2, MYC/BCL6, and MYC/BCL2/BCL6 were seen in 8, 1, and 1 cases, respectively. The partner of MYC was IGH in 6 cases. There were no cases of histological grade 1, 4 cases of grade 2, 5 cases of grade 3a, and 1 case of grade 3b. Two cases of grade 3a exhibited immunoblast-like morphology. Immunohistochemistry demonstrated 9 cases with ≥50% MYC-positive cells. There was significant difference in MYC intensity (P=0.00004) and MIB-1 positivity (P=0.001) between double-hit follicular lymphomas and high-grade B-cell lymphomas with MYC and BCL2 and/or BCL6 rearrangements. The genome profile of double-hit follicular lymphomas was comparable with conventional follicular lymphomas (GSE67385, n=198) with characteristic gains of 2p25.3-p11.1, 7p22.3-q36.3, 12q11-q24.33, and loss of 18q21.32-q23 (Phit follicular lymphomas had fewer copy-number alterations and minimal common region of gain at 2p16.1 (70%), locus also significant against conventional follicular lymphomas (P=0.0001). In summary, double-hit follicular
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
International Nuclear Information System (INIS)
Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie
2012-01-01
Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
Energy Technology Data Exchange (ETDEWEB)
Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)
2012-04-20
Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
International Nuclear Information System (INIS)
Jin Xiaodong; Li Qiang; Gong Li; Wu Qingfeng; Li Ping; Dai Zhongying; Liu Xinguo; Tao Jiajun
2010-01-01
It has been proven that over-expression of surviving in cancerous cell lines is related to the radioresistance of cells to high-LET radiation in previous work. In this study, action mechanisms of surviving gene in apoptosis induced by high-LET radiation were investigated. We found that inhibiting surviving by siRNA had no notable influence on Bcl-2 and Bax expressions induced by carbon ions. Surviving depressed cell apoptosis through the inhibition of the activities of caspase-3 and -9 possibly in cell apoptosis induced by high-LET radiation. (authors)
Bcl-2 family-regulated apoptosis in health and disease
Directory of Open Access Journals (Sweden)
Grant Dewson
2010-04-01
Full Text Available Grant Dewson, Ruth M KluckMolecular Genetics of Cancer Division, Walter and Eliza Hall Institute of Medical Research, Melbourne, AustraliaAbstract: Apoptotic cell death is essential for embryonic development, tissue homeostasis, and a well-functioning immune system, with aberrant apoptosis contributing to numerous disease conditions. Inadequate cell death is a major contributing factor to tumorigenesis, while excess cell death contributes to neurodegeneration and autoimmune disease. The major pathway of apoptotic cell death, the mitochondrial pathway, is controlled by the Bcl-2 family of proteins. The members of this family, more than 17 in humans, share significant sequence and structural homology, and fulfil either prosurvival or proapoptotic roles. Specific interactions between these functionally polar proteins, and their relative expression levels, govern the susceptibility of each cell to toxic insults. Here we review the current understanding on how apoptotic cell death is controlled by this important protein family. We also discuss how excessive or insufficient cell death can contribute to disease, and how targeting the Bcl-2 family offers novel therapeutic opportunities.Keywords: apoptosis, Bcl-2, cancer, cytochrome c, mitochondria
DEFF Research Database (Denmark)
Ye, Qing; Xu-Monette, Zijun Y; Tzankov, Alexandar
2016-01-01
Double-hit B-cell lymphoma is a common designation for a group of tumors characterized by concurrent translocations of MYC and BCL2, BCL6, or other genes. The prognosis of concurrent MYC and BCL6 translocations is not well known. In this study, we assessed rearrangements and expression of MYC, BCL2...... frequent in activated B-cell like diffuse large B-cell lymphoma). In summary, diffuse large B-cell lymphoma patients with either MYC/BCL6 rearrangements or MYC/BCL6 co-expression did not always have poorer prognosis; MYC expression levels should be evaluated simultaneously; and double-hit B-cell lymphoma...
Energy Technology Data Exchange (ETDEWEB)
Stein, J.; Hecht, T. [Univ. of Texas, Houston, TX (United States); Stal, S. [Texas Children`s Hospital, Houston, TX (United States)] [and others
1995-08-01
Nonsyndromic cleft lip with or without cleft palate (CL/P) is a common craniofacial developmental defect. Recent segregation analyses have suggested that major genes play a role in the etiology of CL/P. Linkage to 22 candidate genes was tested in 11 multigenerational families with CL/P, and 21 of these candidates were excluded. APOC2, 19q13.1, which is linked to the proto-oncogene BCL3, gave suggestive evidence for linkage to CL/P. The study was expanded to include a total of 39 multigenerational CL/P families. Linkage was tested in all families, using anonymous marker, D19S178, and intragenic markers in BCL3 and APOC2. Linkage was tested under two models, autosomal dominant with reduced penetrance and affecteds-only model. Both models showed evidence of heterogeneity, with 43% of families linked at zero recombination to BCL3 when marker data from BCL3 and APOC2 were included. A maximum multipoint LOD score of 7.00 at BCL3 was found among the 17 families that had posterior probabilities {ge}50% in favor of linkage. The transmission disequilibrium test provided additional evidence for linkage with the 3 allele of BCL3 more often transmitted to affected children. These results suggest that BCL3, or a nearby gene, plays a role in the etiology of CL/P in some families. 39 refs., 8 figs., 4 tabs.
Directory of Open Access Journals (Sweden)
Ohlemiller Kevin K
2010-07-01
Full Text Available Abstract Age-related decline of neuronal function is associated with age-related structural changes. In the central nervous system, age-related decline of cognitive performance is thought to be caused by synaptic loss instead of neuronal loss. However, in the cochlea, age-related loss of hair cells and spiral ganglion neurons (SGNs is consistently observed in a variety of species, including humans. Since age-related loss of these cells is a major contributing factor to presbycusis, it is important to study possible molecular mechanisms underlying this age-related cell death. Previous studies suggested that apoptotic pathways were involved in age-related loss of hair cells and SGNs. In the present study, we examined the role of Bcl-2 gene in age-related hearing loss. In one transgenic mouse line over-expressing human Bcl-2, there were no significant differences between transgenic mice and wild type littermate controls in their hearing thresholds during aging. Histological analysis of the hair cells and SGNs showed no significant conservation of these cells in transgenic animals compared to the wild type controls during aging. These data suggest that Bcl-2 overexpression has no significant effect on age-related loss of hair cells and SGNs. We also found no delay of age-related hearing loss in mice lacking Bax gene. These findings suggest that age-related hearing loss is not through an apoptotic pathway involving key members of Bcl-2 family.
Bcl-x(L) expression in vivo in rheumatoid synovium.
LENUS (Irish Health Repository)
Busteed, S
2012-02-03
To examine the expression of the apoptosis regulatory protein, Bcl-x(L), in the synovium of patients with rheumatoid arthritis (RA) and osteoarthritis (OA). Immunohistochemistry for Bcl-x(L) was carried out on synovial samples from patients with RA and OA. Reverse transcriptase polymerase chain reaction (RT-PCR) and Western blot analysis were performed to qualitatively examine the expression of Bcl-x(L). Bcl-x(L) expression was detected in the lining, endothelium and inflammatory cells of both RA (n=20) and OA (n=10) samples. However, there was significantly more expression in the lining of RA synovium compared to OA (77 vs 61%, p<0.05). Many of the positive cells in the RA subsynovium were noted to be plasma cells. There was a significant correlation between Bcl-x(L) expression and the number of inflammatory cells in the subsynovium of RA and OA patients (r (s)=0.376, p<0.05, n=30). Age and disease duration did not correlate with Bcl-x(L) expression in rheumatoid patients. Bcl-x(L) may play a role in the extended survival of synoviocytes and inflammatory cells in rheumatoid synovium.
[Behavior in the forced-swimming test and expression of BDNF and Bcl-xl genes in the rat brain].
Berezova, I V; Shishkina, G T; Kalinina, T S; Dygalo, N N
2011-01-01
A single exposure of rats to the forced-swimming stress decreased BDNF mRNA levels in the cortex and increased Bcl-xl gene expression in the hippocampus and amygdala 24 h after the stress. The animals demonstrated a depressive-like behavior and elevated blood corticosterone level. There was a significant negative correlation between BDNF mRNA level in the cortex and immobility time during swimming. Repeated exposure to swimming stress caused the elevation of the hippocampal BDNF mRNA level assessed 24 h after the second swimming session. The data suggest that stress-induced down-regulation of cortical BDNF gene expression and behavioral despair in the forced-swimming test may be interrelated. The increase in the BDNF and Bcl-xl mRNA levels may contribute to the mechanisms protecting the brain against negative effects of stress.
Gaballah, Mohammad A; Ahmed, Rehab-Allah
2015-12-01
The distinction between cutaneous basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and seborrheic keratosis (SK), which are common entities in clinical practice, can be difficult clinically and histologically. CD10 and Bcl2 antigens are important factors in tumor growth, survival and spread. The aim of the present study is to define the frequency of CD10 and Bcl2 expression in such cutaneous tumors and its relation to the clinicopathological characteristics as well as their possible diagnostic utility. CD10 and Bcl2 immunohistochemistry was performed on 30 BCC, 20 SCC and 15 SK. 93.3% of SK cases and 53.3% of BCC cases showed significant expression of CD10 in tumor cells when compared either with each other or with SCC cases (100% negative). Stromal CD10 expression was positive in 50% of BCC cases and 75% of SCC cases. Stromal CD10 expression was significantly higher in high risk BCC and BCC with infiltrating deep margins; furthermore, it showed a significant positive correlation with grade of SCC. A significant inverse correlation between CD10 expression in stromal and tumor cells of BCC was present. Bcl2 was significantly expressed in 93.3% of SK cases and 80% of BCC cases when compared with SCC cases (100% negative). It was found that for distinguishing BCC from SK, only CD10 expression in tumor cells provided a high diagnostic value with positive likelihood ratio (PLR) was 7.00. In addition, CD10 and Bcl2 expression in tumor cells could give convincing diagnostic value to distinguish SCC from SK (PLR=15.00 for each marker). Moreover, for differentiating BCC from SCC, only Bcl2 in the tumor cells could provide a high diagnostic value (PLR=5.5). In conclusion, CD10 and Bcl2 can help in differentiating cutaneous BCC from SK and SCC. The overexpression of CD10 in the stromal cells of SCC and some variants of BCC suggests the invasive properties of such tumors. Copyright © 2015 Elsevier GmbH. All rights reserved.
De novo microdeletion of BCL11A is associated with severe speech sound disorder.
Peter, Beate; Matsushita, Mark; Oda, Kaori; Raskind, Wendy
2014-08-01
In 10 cases of 2p15p16.1 microdeletions reported worldwide to date, shared phenotypes included growth retardation, craniofacial and skeletal dysmorphic traits, internal organ defects, intellectual disability, nonverbal or low verbal status, abnormal muscle tone, and gross motor delays. The size of the deletions ranged from 0.3 to 5.7 Mb, where the smallest deletion involved the BCL11A, PAPOLG, and REL genes. Here we report on an 11-year-old male with a heterozygous de novo 0.2 Mb deletion containing a single gene, BCL11A, and a phenotype characterized by childhood apraxia of speech and dysarthria in the presence of general oral and gross motor dyspraxia and hypotonia as well as expressive language and mild intellectual delays. BCL11A is situated within the dyslexia susceptibility candidate region 3 (DYX3) candidate region on chromosome 2. The present case is the first to involve a single gene within the microdeletion region and a phenotype restricted to a subset of the traits observed in other cases with more extensive deletions. © 2014 Wiley Periodicals, Inc.
Yap, Jeremy L; Chen, Lijia; Lanning, Maryanna E; Fletcher, Steven
2017-02-09
A hallmark of cancer is the evasion of apoptosis, which is often associated with the upregulation of the antiapoptotic members of the Bcl-2 family of proteins. The prosurvival function of the antiapoptotic Bcl-2 proteins is manifested by capturing and neutralizing the proapoptotic Bcl-2 proteins via their BH3 death domains. Accordingly, strategies to antagonize the antiapoptotic Bcl-2 proteins have largely focused on the development of low-molecular-weight, synthetic BH3 mimetics ("magic bullets") to disrupt the protein-protein interactions between anti- and proapoptotic Bcl-2 proteins. In this way, apoptosis has been reactivated in malignant cells. Moreover, several such Bcl-2 family inhibitors are presently being evaluated for a range of cancers in clinical trials and show great promise as new additions to the cancer armamentarium. Indeed, the selective Bcl-2 inhibitor venetoclax (Venclexta) recently received FDA approval for the treatment of a specific subset of patients with chronic lymphocytic leukemia. This review focuses on the major developments in the field of Bcl-2 inhibitors over the past decade, with particular emphasis on binding modes and, thus, the origins of selectivity for specific Bcl-2 family members.
Janjua, Omer Sefvan; Qureshi, Sana Mehmood; Khan, Tariq Sarfraz; Alamgir, Wajiha
2012-01-01
Mucoepidermoid carcinoma is the most common salivary gland tumor with varying behavior among different histopathological grades. The objective of this study was to determine the expression of Bcl-2 protein in mucoepidermoid carcinoma (MEC) and to correlate with histological grades. The records of 40 cases of MEC were collected from the histopathology department. Fresh slides were prepared and fresh diagnoses were made using the grading criteria for MEC. Immunohistochemical markers for Bcl-2 were applied and the results analyzed using the chi-square test. Of 40 cases, 20 were males and 20 were females. The range in age of the patients was 6 to 67 years mean (SD) was 42.6 (1.85) years. Twenty-two were low grade (55%), 11 high grade (27.5%) and 7 (17.5%) were intermediate grade MEC. Among these 40 cases, Bcl-2 expression was positive in 24 cases and negative in 16 cases. In 22 cases of low-grade MEC, 19 were positive while only 3 were negative. In high-grade tumors, all 11 cases were found to have a negative expression of Bcl-2 protein. In intermediate-grade MEC, 5 cases showed positive expression while only 2 cases showed negative expression. Bcl-2 protein expression showed positive expression in low-grade and negative expression in high-grade MEC. Intermediate grade showed more than 50% positive results for Bcl-2. Correlation between grades of MEC and expression of Bcl-2 is statistically significant and can be used for the depicting the prognosis of MEC along with other prognostic and clinico-pathological parameters.
International Nuclear Information System (INIS)
Bhatelia, Khyati D.; Nambiar, Mridula; Choudhary, Bibha; Raghvan, Sathees C.
2010-01-01
Cancer is a disease characterized by uncontrolled proliferation of cells, caused by genetic alterations such as chromosomal translocations, which are present in almost all hematological malignancies. Diffuse Large B-cell Lymphoma (DLBL) is the most common non-Hodgkin's lymphoma, comprising 40-50% of all lymphomas both in India and worldwide, and is characterized by BCL6 chromosomal translocation. However, the mechanism of this translocation is completely unknown. By mapping of translocation breakpoints from patients, we have identified three breakpoint cluster regions at 5' UTR of BCL6 gene. Bioinformatics analysis of cluster II, which possesses majority of breakpoints, this region may form cruciform DNA structures. Gel mobility shift assays using oligomeric DNA from the region suggested that a portion of cluster II folded into hairpin structures. Mutations to the wild type sequences disrupted hairpin formation. Circular dichroism studies on BCL6 oligomers resulted in a spectra containing two overlapping peaks at 265 nm and 285 nm, confirming hairpin structure. Further, the structure was destroyed upon heating, and reformed when appropriate conditions were provided. P1 nuclease assay in conjunction with KMnO 4 probing suggested that the structure possessed an eight nucleotide double-stranded stem and a nine nucleotide loop. To further understand the mechanism of BCL6 translocation in vivo, human cells were transfected with episomes harboring cluster II region and the results obtained will be discussed. Hence, our results suggest the formation of a putative cruciform DNA structure at BCL6 breakpoint region and that may facilitate breakage at BCL6 gene explaining chromosomal translocations in DLBL. (author)
Expression of Bcl-2 family proteins and spontaneous apoptosis in normal human testis.
Oldereid, N B; Angelis, P D; Wiger, R; Clausen, O P
2001-05-01
We investigated the frequency of spontaneous apoptosis and expression of the Bcl-2 family of proteins during normal spermatogenesis in man. Testicular tissue with both normal morphology and DNA content was obtained from necro-donors and fixed in Bouin's solution. A TdT-mediated dUTP end-labelling method (TUNEL) was used for the detection of apoptotic cells. Expression of apoptosis regulatory Bcl-2 family proteins and of p53 and p21(Waf1) was assessed by immunohistochemistry. Germ cell apoptosis was detected in all testes and was mainly seen in primary spermatocytes and spermatids and in a few spermatogonia. Bcl-2 and Bak were preferentially expressed in the compartments of spermatocytes and differentiating spermatids, while Bcl-x was preferentially expressed in spermatogonia. Bax showed a preferential expression in nuclei of round spermatids, whereas Bad was only seen in the acrosome region of various stages of spermatids. Mcl-1 staining was weak without a particular pattern, whereas expression of Bcl-w, p53 and p21(Waf1) proteins was not detected by immunohistochemistry. The results show that spontaneous apoptosis occurs in all male germ cell compartments in humans. Bcl-2 family proteins are distributed preferentially within distinct germ cell compartments suggesting a specific role for these proteins in the processes of differentiation and maturation during human spermatogenesis.
International Nuclear Information System (INIS)
Zerp, Shuraila F.; Stoter, T. Rianne; Hoebers, Frank J. P.; Brekel, Michiel W. M. van den; Dubbelman, Ria; Kuipers, Gitta K.; Lafleur, M. Vincent M.; Slotman, Ben J.; Verheij, Marcel
2015-01-01
Pro-survival Bcl-2 family members can promote cancer development and contribute to treatment resistance. Head and neck squamous cell carcinoma (HNSCC) is frequently characterized by overexpression of anti-apoptotic Bcl-2 family members. Increased levels of these anti-apoptotic proteins have been associated with radio- and chemoresistance and poor clinical outcome. Inhibition of anti-apoptotic Bcl-2 family members therefore represents an appealing strategy to overcome resistance to anti-cancer therapies. The aim of this study was to evaluate combined effects of radiation and the pan-Bcl-2 inhibitor AT-101 in HNSCC in vitro. In addition, we determined human plasma levels of AT-101 obtained from a phase I/II trial, and compared these with the effective in vitro concentrations to substantiate therapeutic opportunities. We examined the effect of AT-101, radiation and the combination on apoptosis induction and clonogenic survival in two HNSCC cell lines that express the target proteins. Apoptosis was assessed by bis-benzimide staining to detect morphological nuclear changes and/or by propidium iodide staining and flow-cytometry analysis to quantify sub-diploid apoptotic nuclei. The type of interaction between AT-101 and radiation was evaluated by calculating the Combination Index (CI) and by performing isobolographic analysis. For the pharmacokinetic analysis, plasma AT-101 levels were measured by HPLC in blood samples collected from patients enrolled in our clinical phase I/II study. These patients with locally advanced HNSCC were treated with standard cisplatin-based chemoradiotherapy and received dose-escalating oral AT-101 in a 2-weeks daily schedule every 3 weeks. In vitro results showed that AT-101 enhances radiation-induced apoptosis with CI’s below 1.0, indicating synergy. This effect was sequence-dependent. Clonogenic survival assays demonstrated a radiosensitizing effect with a DEF 37 of 1.3 at sub-apoptotic concentrations of AT-101. Pharmacokinetic analysis
Wu, Weizhong; Liu, Sanguang; Liang, Yunfei; Zhou, Zegao; Bian, Wei; Liu, Xueqing
2017-12-01
The pathogenesis of hepatocellular carcinoma (HC) is unclear. It is suggested that psychological stress associates with the pathogenesis of liver cancer. Bcl2-like protein 12 (Bcl2L12) suppresses p53 protein. This study tests a hypothesis that the major stress hormone, cortisol, inhibits the expression of p53 in HC cells (HCC) via up regulating the expression of Bcl2L12. Peripheral blood samples were collected from patients with HC to be analyzed for the levels of cortisol. HCC were cultured to assess the role of cortisol in the regulation of the expression of Bcl2L12 and p53 in HCC. We observed that the serum cortisol levels were higher in HC patients. Expression of Bcl2L12 in HCC was correlated with serum cortisol. Cortisol enhanced the Bcl2L12 expression in HCC. Bcl2L12 binding to the TP53 promoter was correlated with p53 expression in HCC. Cortisol increased the Bcl2L12 expression in HCC to inhibit p53 expression. Stress hormone cortisol suppresses p53 in HCC via enhancing Bcl2L12 expression in HCC. The results suggest that cortisol may be a therapeutic target for the treatment of HC.
Anti-apoptotic BFL-1 is the major effector in activation-induced human mast cell survival.
Directory of Open Access Journals (Sweden)
Maria Ekoff
Full Text Available Mast cells are best known for their role in allergic reactions, where aggregation of FcεRI leads to the release of mast cell mediators causing allergic symptoms. The activation also induces a survival program in the cells, i.e., activation-induced mast cell survival. The aim of the present study was to investigate how the activation-induced survival is mediated. Cord blood-derived mast cells and the mast cell line LAD-2 were activated through FcεRI crosslinking, with or without addition of chemicals that inhibit the activity or expression of selected Bcl-2 family members (ABT-737; roscovitine. Cell viability was assessed using staining and flow cytometry. The expression and function of Bcl-2 family members BFL-1 and MCL-1 were investigated using real-time quantitative PCR and siRNA treatment. The mast cell expression of Bfl-1 was investigated in skin biopsies. FcεRI crosslinking promotes activation-induced survival of human mast cells and this is associated with an upregulation of the anti-apoptotic Bcl-2 family member Bfl-1. ABT-737 alone or in combination with roscovitine decreases viability of human mast cells although activation-induced survival is sustained, indicating a minor role for Bcl-X(L, Bcl-2, Bcl-w and Mcl-1. Reducing BFL-1 but not MCL-1 levels by siRNA inhibited activation-induced mast cell survival. We also demonstrate that mast cell expression of Bfl-1 is elevated in birch-pollen-provocated skin and in lesions of atopic dermatitis and psoriasis patients. Taken together, our results highlight Bfl-1 as a major effector in activation-induced human mast cell survival.
Lee, Jaetae; Lee, Young Sup
2015-01-01
The COX-2/PGE2 pathway has been implicated in the occurrence and progression of cancer. The underlying mechanisms facilitating the production of COX-2 and its mediator, PGE2, in cancer survival remain unknown. Herein, we investigated PGE2-induced COX-2 expression and signaling in HL-60 cells following menadione treatment. Treatment with PGE2 activated anti-apoptotic proteins such as Bcl-2 and Bcl-xL while reducing pro-apoptotic proteins, thereby enhancing cell survival. PGE2 not only induced COX-2 expression, but also prevented casapse-3, PARP, and lamin B cleavage. Silencing and inhibition of COX-2 with siRNA transfection or treatment with indomethacin led to a pronounced reduction of the extracellular levels of PGE2, and restored the menadione-induced cell death. In addition, pretreatment of cells with the MEK inhibitor PD98059 and the PKA inhibitor H89 abrogated the PGE2-induced expression of COX-2, suggesting involvement of the MAPK and PKA pathways. These results demonstrate that PGE2 signaling acts in an autocrine manner, and specific inhibition of PGE2 will provide a novel approach for the treatment of leukemia. [BMB Reports 2015; 48(2): 109-114] PMID:24965577
Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.
Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald
2017-06-01
p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.
Liu, Qi; Si, Tianlei; Xu, Xiaoyun; Liang, Fuqiang; Wang, Lufeng; Pan, Siyi
2015-08-04
The decreased reproductive capacity of men is an important factor contributing to infertility. Accumulating evidence has shown that Electromagnetic radiation potentially has negative effects on human health. However, whether radio frequency electromagnetic radiation (RF-EMR) affects the human reproductive system still requires further investigation. Therefore, The present study investigates whether RF-EMR at a frequency of 900 MHz can trigger sperm cell apoptosis and affect semen morphology, concentration, and microstructure. Twenty four rats were exposed to 900 MHz electromagnetic radiation with a special absorption rate of 0.66 ± 0.01 W/kg for 2 h/d. After 50d, the sperm count, morphology, apoptosis, reactive oxygen species (ROS), and total antioxidant capacity (TAC), representing the sum of enzymatic and nonenzymatic antioxidants, were investigated. Western blotting and reverse transcriptase PCR were used to determine the expression levels of apoptosis-related proteins and genes, including bcl-2, bax, cytochrome c, and capase-3. In the present study, the percentage of apoptotic sperm cells in the exposure group was significantly increased by 91.42% compared with the control group. Moreover, the ROS concentration in exposure group was increased by 46.21%, while the TAC was decreased by 28.01%. Radiation also dramatically decreased the protein and mRNA expression of bcl-2 and increased that of bax, cytochrome c, and capase-3. RF-EMR increases the ROS level and decreases TAC in rat sperm. Excessive oxidative stress alters the expression levels of apoptosis-related genes and triggers sperm apoptosis through bcl-2, bax, cytochrome c and caspase-3 signaling pathways.
Directory of Open Access Journals (Sweden)
Dárcio Matenhauer Lehrbach
2009-12-01
Full Text Available CONTEXT: Esophagogastric junction adenocarcinoma has an aggressive behavior, and TNM (UICC staging is not always accurate enough to categorize patient's outcome. OBJECTIVES: To evaluated p53, cyclin D1 and Bcl-2 immunoexpressions in esophagogastric junction adenocarcinoma patients, without Barrett's esophagus, and to compared to clinicopathological characteristics and survival rate. METHODS: Tissue sections from 75 esophagogastric junction adenocarcinomas resected from 1991 to 2003 were analyzed by immunohistochemistry for p53, cyclin D1 and Bcl-2 using streptavidin-biotin-peroxidase method. The mean follow-up time was 60 months SD = 61.5 (varying from 4 to 273 months. RESULTS: Fifty (66.7% of the tumors were intestinal type and 25 (33.3% were diffuse. Vascular, lymph node and perineural infiltration were verified in 16%, 80% and 68% of the patients, respectively. The patients were distributed according to the TNM staging in IA in 4 (5.3%, IB in 10 (13.3%, II in 15 (20%, IIA in 15 (20%, IIIB in 15 (20% and IV in 16 (21.3%. Immunohistochemical analysis was positive for p53, cyclin D1 and bcl-2 in 68%, 18.7% and 100%, respectively. There was no association between immunoexpression and vascular and/or perineural invasions, clinicopathological characteristics and patients' survival rate. CONCLUSION: In this selected population, there was no association between the immunomarkers, p53, cyclin D1 and bcl-2 and clinicopathological data and/or overall survival.CONTEXTO: O adenocarcinoma da junção esôfago-gástrica tem um comportamento agressivo e o estádio TNM não é sempre suficiente para categorizar o paciente de acordo com a evolução do mesmo. OBJETIVO: Avaliar a imunoexpressão do p53, ciclina D1 e Bcl-2 em pacientes com adenocarcinoma da junção esôfago-gástrica sem esôfago de Barrett e comparar com as características clínicas e sobrevida. MÉTODOS: Cortes histológicos de 75 adenocarcinomas da esôfago-gástrica ressecados de 1991 a
Cinar, Munevver; Rosenfelt, Fred; Rokhsar, Sepehr; Lopategui, Jean; Pillai, Raju; Cervania, Melissa; Pao, Andy; Cinar, Bekir; Alkan, Serhan
2015-07-01
Double hit lymphoma or triple hit lymphoma (DHL/THL) is a rare form of aggressive B-Cell Lymphoma. Overexpression of MYC, BCL2 or/and BCL6 due to genomic rearrangements are the key molecular features of DHL/THL. Patients with DHL/THL show very aggressive disease course and poor survival due to the lack of effective treatment modalities. Here, we established new THL cell model and assessed its in vitro growth characteristics along with the DHL cell line in response to potent MYC inhibitors, 10058-F4 and JQ-1, and a BCL2 inhibitor, ABT-199, with or without chemotherapeutic agent vincristine or doxorubicin. We found that 10058-F4, JQ-1 or ABT-199 exposure as a single agent inhibited the growth of DHL/THL cells in a dose-dependent manner. Combined exposure of 10058-F4 or JQ-1 and ABT-199 as well as vincristine or doxorubicin markedly suppressed the growth of DHL/THL cells compared with the single treatment. As assessed by multiple approaches, apoptosis induced by ABT-199, 10058-F4 or JQ-1 was underlying cause of the observed growth suppression. These findings suggest that co-inhibition of MYC and BCL2 signaling is a promising therapeutic strategy for patients with DHL/THL lymphomas. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ibrahim Tekedereli
2013-01-01
Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.
Sun, Wen-Chong; Liang, Zuo-Di; Pei, Ling
2015-12-01
Propofol exerts neurotoxic effects on the developing mammalian brains, but the underlying molecular mechanism remains unclear. MicroRNAs (miRNAs) are a class of small noncoding RNAs that modulate gene expression at the post-transcriptional level. However, in specific types of neurocytes, the detailed functions of miRNAs were not entirely understood. We investigated the potential role of miRNAs in astrocyte pathogenesis caused by propofol. We performed genome-wide microRNA expression profiling in immature cultured hippocampal astrocytes by microarray analysis and predicted their targets and functions using bioinformatics tools. The functional effects of one differentially expressed miRNA were examined experimentally in relation to astrocyte viability. The results showed that 13 miRNAs were significantly differentially expressed after both short-term exposure to high-concentration propofol (10 μg/ml for 1h) and long-term exposure to low-concentration propofol (0.9 μg/ml for 48 h), including rno-miR-665, differing significantly between the 2. Bioinformatics predicted putative binding sites for rno-miR-665 existing in the 3'-untranslated region of Bcl-2-like protein 1 BCL2L1 (Bcl-xl) mRNA. Moreover, such relationship was assessed by luciferase reporter assay, qRT-PCR and western blot. Rno-miR-665 which was significantly up-regulated by propofol can suppress BCL2L1 and elevate cleaved caspase-3 expression in immature astrocytes in vitro. Apoptosis of developing hippocampal astrocytes was thus significantly influenced by propofol or rno-miR-665, or both. Taken together, rno-miR-665 is involved in the neurotoxicity induced by propofol via a caspase-3 mediated mechanism by negatively regulating BCL2L1. It might act as an alternative therapeutic target for treatment of neurological disorders in peadiatric prolonged anesthesia or sedation with propofol clinically. Copyright © 2015. Published by Elsevier B.V.
Li, Xiaomei; Huang, Ying; Bi, Chengfeng; Yuan, Ji; He, Hong; Zhang, Hong; Yu, QiuBo; Fu, Kai; Li, Dan
2017-06-01
Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma, whose main prognostic factor is closely related to germinal center B-cell-like subtype (GCB- DLBCL) or activated B-cell-like type (non-GCB-DLBCL). The most common type of primary central nervous system lymphoma is diffuse large B-cell type with poor prognosis and the reason is unclear. This study aims to stratify primary central nervous system diffuse large B-cell lymphoma (PCNS-DLBCL) according to the cell-of-origin (COO) and to investigate the multiple proteins expression of C-MYC, BCL-6, BCL-2, TP53, further to elucidate the reason why primary central nervous system diffuse large B-cell lymphoma possesses a poor clinical outcome as well. Nineteen cases of primary central nervous system DLBCL were stratified according to immunostaining algorithms of Hans, Choi and Meyer (Tally) and we investigated the multiple proteins expression of C-MYC, BCL-6, BCL-2, TP53. The Epstein-Barr virus and Borna disease virus infection were also detected. Among nineteen cases, most (15-17 cases) were assigned to the activated B-cell-like subtype, highly expression of C-MYC (15 cases, 78.9%), BCL-2 (10 cases, 52.6%), BCL-6 (15 cases, 78.9%). Unfortunately, two cases were positive for PD-L1 while PD-L2 was not expressed in any case. Two cases infected with BDV but no one infected with EBV. In conclusion, most primary central nervous system DLBCLs show an activated B-cell-like subtype characteristic and have multiple expressions of C-MYC, BCL-2, BCL-6 protein, these features might be significant factor to predict the outcome and guide treatment of PCNS-DLBCLs. Copyright © 2017 Elsevier GmbH. All rights reserved.
The studies on thyrocyte apoptosis and expression of Bcl-2 and Bax in Hashimoto's thyroiditis
International Nuclear Information System (INIS)
Zhao Yaping; Wang Jialing; Fan Zhiyong; Liu Zehong; Wu HeJun; Zhou Wei; Jia Meizhai
2003-01-01
To investigate the thyrocyte apoptosis, the expression of Bcl-2, Bax and the relationship between apoptosis and the pathogenesis in Hashimoto's thyroiditis (HT), 41 HT thyroid and 10 normal thyroid specimens were selected. The level of apoptosis was detected by TUNEL methods. The expression and distribution of Bcl-2 and Bax were detected using immunohistochemical methods and analyzed by Mias99 pathological image system. Immunohistochemical staining was carried out using S-P kit. The Result showed that an increased level of apoptosis was observed in Hashimoto's glands. The apoptosis mainly distributed in thyroid follicles destruction area. This was associated with increased Bax expression. The strongly positive Bcl-2 staining was observed in the thyrocyte of intact thyroid follicles. The ratios of positive granule area and total light density of Bcl-2 to those of Bax in HT thyroid follicle area were lower than those in normal thyroid. The apoptosis of thyrocyte induced by dysregulation of Bcl-2 and Bax may be involved in the pathogeneses of HT
Directory of Open Access Journals (Sweden)
Inga Karch
Full Text Available Inactivation of CDH1, encoding E-cadherin, promotes cancer initiation and progression. According to a newly proposed molecular mechanism, loss of E-cadherin triggers an upregulation of the anti-apoptotic oncoprotein BCL2. Conversely, reconstitution of E-cadherin counteracts overexpression of BCL2. This reciprocal regulation is thought to be critical for early tumor development. We determined the relevance of this new concept in human infiltrating lobular breast cancer (ILBC, the prime tumor entity associated with CDH1 inactivation. BCL2 expression was examined in human ILBC cell lines (IPH-926, MDA-MB-134, SUM-44 harboring deleterious CDH1 mutations. To test for an intact regulatory axis between E-cadherin and BCL2, wild-type E-cadherin was reconstituted in ILBC cells by ectopic expression. Moreover, BCL2 and E-cadherin were evaluated in primary invasive breast cancers and in synchronous lobular carcinomas in situ (LCIS. MDA-MB-134 and IPH-926 showed little or no BCL2 expression, while SUM-44 ILBC cells were BCL2-positive. Reconstitution of E-cadherin failed to impact on BCL2 expression in all cell lines tested. Primary ILBCs were almost uniformly E-cadherin-negative (97% and were frequently BCL2-negative (46%. When compared with an appropriate control group, ILBCs showed a trend towards an increased frequency of BCL2-negative cases (P = 0.064. In terminal duct-lobular units affected by LCIS, the E-cadherin-negative neoplastic component showed a similar or a reduced BCL2-immunoreactivity, when compared with the adjacent epithelium. In conclusion, upregulation of BCL2 is not involved in lobular breast carcinogenesis and is unlikely to represent an important determinant of tumor development driven by CDH1 inactivation.
Mcl-1 is essential for the survival of plasma cells
Peperzak, Victor; Vikström, Ingela; Walker, Jennifer; Glaser, Stefan P.; LePage, Melanie; Coquery, Christine M.; Erickson, Loren D.; Fairfax, Kirsten; Mackay, Fabienne; Strasser, Andreas; Nutt, Stephen L.; Tarlinton, David M.
2013-01-01
The long-term survival of plasma cells is entirely dependent on signals derived from their environment. These extrinsic factors presumably induce and sustain the expression of antiapoptotic proteins of the Bcl-2 family. It is uncertain whether there is specificity among Bcl-2 family members in the
Directory of Open Access Journals (Sweden)
W. Y. Liu
2013-01-01
Full Text Available This work investigates the effects of oxidative stress due to exhaustive training on uncoupling protein 2 (UCP2 and Bcl-2/Bax in rat skeletal muscles. A total of 18 Sprague-Dawley female rats were randomly divided into three groups: the control group (CON, the trained control group (TC, and the exhaustive trained group (ET. Malondialdehyde (MDA, superoxide dismutase (SOD, xanthine oxidase (XOD, ATPase, UCP2, and Bcl-2/Bax ratio in red gastrocnemius muscles were measured. Exhaustive training induced ROS increase in red gastrocnemius muscles, which led to a decrease in the cell antiapoptotic ability (Bcl-2/Bax ratio. An increase in UCP2 expression can reduce ROS production and affect mitochondrial energy production. Thus, oxidative stress plays a significant role in overtraining.
EMX2 gene expression predicts liver metastasis and survival in colorectal cancer.
Aykut, Berk; Ochs, Markus; Radhakrishnan, Praveen; Brill, Adrian; Höcker, Hermine; Schwarz, Sandra; Weissinger, Daniel; Kehm, Roland; Kulu, Yakup; Ulrich, Alexis; Schneider, Martin
2017-08-22
The Empty Spiracles Homeobox (EMX-) 2 gene has been associated with regulation of growth and differentiation in neuronal development. While recent studies provide evidence that EMX2 regulates tumorigenesis of various solid tumors, its role in colorectal cancer remains unknown. We aimed to assess the prognostic significance of EMX2 expression in stage III colorectal adenocarcinoma. Expression levels of EMX2 in human colorectal cancer and adjacent mucosa were assessed by qRT-PCR technology, and results were correlated with clinical and survival data. siRNA-mediated knockdown and adenoviral delivery-mediated overexpression of EMX2 were performed in order to investigate its effects on the migration of colorectal cancer cells in vitro. Compared to corresponding healthy mucosa, colorectal tumor samples had decreased EMX2 expression levels. Furthermore, EMX2 down-regulation in colorectal cancer tissue was associated with distant metastasis (M1) and impaired overall patient survival. In vitro knockdown of EMX2 resulted in increased tumor cell migration. Conversely, overexpression of EMX2 led to an inhibition of tumor cell migration. EMX2 is frequently down-regulated in human colorectal cancer, and down-regulation of EMX2 is a prognostic marker for disease-free and overall survival. EMX2 might thus represent a promising therapeutic target in colorectal cancer.
Park, Shin-Young; Ma, Weina; Yoon, Sung Nyo; Kang, Min Jeong; Han, Joong-Soo
2015-01-01
We studied the possible role of phospholipase D1 (PLD1) in the neuronal differentiation, including neurite formation of neural stem cells. PLD1 protein and PLD activity increased during neuronal differentiation. Bcl-2 also increased. Downregulation of PLD1 by transfection with PLD1 siRNA or a dominant-negative form of PLD1 (DN-PLD1) inhibited both neurite outgrowth and Bcl-2 expression. PLD activity was dramatically reduced by a PLCγ (phospholipase Cγ) inhibitor (U73122), a Ca(2+)chelator (BAPTA-AM), and a PKCα (protein kinase Cα) inhibitor (RO320432). Furthermore, treatment with arachidonic acid (AA) which is generated by the action of PLA2 (phospholipase A2) on phosphatidic acid (a PLD1 product), increased the phosphorylation of p38 MAPK and CREB, as well as Bcl-2 expression, indicating that PLA2 is involved in the differentiation process resulting from PLD1 activation. PGE2 (prostaglandin E2), a cyclooxygenase product of AA, also increased during neuronal differentiation. Moreover, treatment with PGE2 increased the phosphorylation of p38 MAPK and CREB, as well as Bcl-2 expression, and this effect was inhibited by a PKA inhibitor (Rp-cAMP). As expected, inhibition of p38 MAPK resulted in loss of CREB activity, and when CREB activity was blocked with CREB siRNA, Bcl-2 production also decreased. We also showed that the EP4 receptor was required for the PKA/p38MAPK/CREB/Bcl-2 pathway. Taken together, these observations indicate that PLD1 is activated by PLCγ/PKCα signaling and stimulate Bcl-2 expression through PLA2/Cox2/EP4/PKA/p38MAPK/CREB during neuronal differentiation of rat neural stem cells.
International Nuclear Information System (INIS)
Sun Yuanlin; Tang Jian; Gu Xiaohong; Li Deyuan
2009-01-01
Objective: To investigate the effect of polysaccharides from Angelica sinensis (ASP3) on Bcl-2 and Bax protein expression of irradiated liver cells from mice. Methods: Bcl-2 and Bax protein expression of liver cells in vitro exposed to 2.0 Gy rays were examined by using immunohistochemistry method. Results: The expression of apoptosis-accelerating protein Bax in the irradiation group was enhanced obviously (70.83%), while apoptosis inhibiting protein Bcl-2 tended to decline (55.60%), with the statistically significant difference (P <0.01) compared with that of the control. ASP3 pretreatment could regulate Bcl-2 and Bax protein expression of liver cells, inhibiting Bax protein expression(64.14/58.37%) and increasing Bcl-2 protein expression(59.21%/ 67.45%). The differences between the high dosage (100 mg/L of ASP3) and the irradiation group were statistically significant (P<0.05). Conclusions: ASP3 pretreatment could prohibit the apoptosis of radiation- damaged liver cells due to abnormal expression of Bcl-2 and Bax, and reduce the cell apoptosis by increasing Bcl-2/Bax protein expression so as to enhance the radiation endurance of liver cells. (authors)
Giuliano, Mario; Hu, Huizhong; Wang, Yen-Chao; Fu, Xiaoyong; Nardone, Agostina; Herrera, Sabrina; Mao, Sufeng; Contreras, Alejandro; Gutierrez, Carolina; Wang, Tao; Hilsenbeck, Susan G.; De Angelis, Carmine; Wang, Nicholas J.; Heiser, Laura M.; Gray, Joe W.; Lopez-Tarruella, Sara; Pavlick, Anne C.; Trivedi, Meghana V.; Chamness, Gary C.; Chang, Jenny C.; Osborne, C. Kent; Rimawi, Mothaffar F.; Schiff, Rachel
2015-01-01
Purpose To investigate the direct effect and therapeutic consequences of epidermal growth factor receptor 2 (HER2)-targeting therapy on expression of estrogen receptor (ER) and Bcl2 in preclinical models and clinical tumor samples. Experimental design Archived xenograft tumors from two preclinical models (UACC812 and MCF7/HER2-18) treated with ER and HER2-targeting therapies, and also HER2+ clinical breast cancer specimens collected in a lapatinib neoadjuvant trial (baseline and week 2 post treatment), were used. Expression levels of ER and Bcl2 were evaluated by immunohistochemistry and western blot. The effects of Bcl2 and ER inhibition, by ABT-737 and fulvestrant respectively, were tested in parental versus lapatinib-resistant UACC812 cells in vitro. Results Expression of ER and Bcl2 was significantly increased in xenograft tumors with acquired resistance to anti-HER2 therapy, compared with untreated tumors, in both preclinical models (UACC812: ER p=0.0014; Bcl2 p<0.001. MCF7/HER2-18: ER p=0.0007; Bcl2 p=0.0306). In the neoadjuvant clinical study, lapatinib treatment for two weeks was associated with parallel upregulation of ER and Bcl2 (Spearman’s coefficient: 0.70; p=0.0002). Importantly, 18% of tumors originally ER-negative (ER−) converted to ER+ upon anti-HER2 therapy. In ER−/HER2+ MCF7/HER2-18 xenografts, ER re-expression was primarily observed in tumors responding to potent combination of anti-HER2 drugs. Estrogen deprivation added to this anti-HER2 regimen significantly delayed tumor progression (p=0.018). In the UACC812 cells, fulvestrant, but not ABT-737, was able to completely inhibit anti-HER2-resistant growth (p<0.0001). Conclusion HER2 inhibition can enhance or restore ER expression with parallel Bcl2 upregulation, representing an ER-dependent survival mechanism potentially leading to anti-HER2 resistance. PMID:26015514
SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production
Energy Technology Data Exchange (ETDEWEB)
Jauharoh, Siti Nur Aisyah [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta 15412 (Indonesia); Saegusa, Jun; Sugimoto, Takeshi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Ardianto, Bambang [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Child Health, Faculty of Medicine, Gadjah Mada University, Yogyakarta 55282 (Indonesia); Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Tokuno, Osamu; Nakamachi, Yuji [Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan); Kumagai, Shunichi [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Kawano, Seiji, E-mail: sjkawano@med.kobe-u.ac.jp [Department of Clinical Pathology and Immunology, Kobe University Graduate School of Medicine, Hyogo 650-0017 (Japan); Department of Laboratory Medicine, Kobe University Hospital, Hyogo 650-0017 (Japan)
2012-01-06
Highlights: Black-Right-Pointing-Pointer Ro52{sup low} HeLa cells are resistant to apoptosis upon various stimulations. Black-Right-Pointing-Pointer Ro52 is upregulated by IFN-{alpha}, etoposide, or IFN-{gamma} and anti-Fas Ab. Black-Right-Pointing-Pointer Ro52-mediated apoptosis is independent of p53. Black-Right-Pointing-Pointer Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjoegren's syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52's role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52{sup low} HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H{sub 2}O{sub 2}- or diamide-induced oxidative stress, IFN-{alpha}, IFN-{gamma} and anti-Fas antibody, etoposide, or {gamma}-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.
SS-A/Ro52 promotes apoptosis by regulating Bcl-2 production
International Nuclear Information System (INIS)
Jauharoh, Siti Nur Aisyah; Saegusa, Jun; Sugimoto, Takeshi; Ardianto, Bambang; Kasagi, Shimpei; Sugiyama, Daisuke; Kurimoto, Chiyo; Tokuno, Osamu; Nakamachi, Yuji; Kumagai, Shunichi; Kawano, Seiji
2012-01-01
Highlights: ► Ro52 low HeLa cells are resistant to apoptosis upon various stimulations. ► Ro52 is upregulated by IFN-α, etoposide, or IFN-γ and anti-Fas Ab. ► Ro52-mediated apoptosis is independent of p53. ► Ro52 selectively regulates Bcl-2 expression. -- Abstract: SS-A/Ro52 (Ro52), an autoantigen in systemic autoimmune diseases such as systemic lupus erythematosus and Sjögren’s syndrome, has E3 ligase activity to ubiquitinate proteins that protect against viral infection. To investigate Ro52’s role during stress, we transiently knocked it down in HeLa cells by siRo52 transfection. We found that Ro52 low HeLa cells were significantly more resistant to apoptosis than wild-type HeLa cells when stimulated by H 2 O 2 - or diamide-induced oxidative stress, IFN-α, IFN-γ and anti-Fas antibody, etoposide, or γ-irradiation. Furthermore, Ro52-mediated apoptosis was not influenced by p53 protein level in HeLa cells. Depleting Ro52 in HeLa cells caused Bcl-2, but not other Bcl-2 family molecules, to be upregulated. Taken together, our data showed that Ro52 is a universal proapoptotic molecule, and that its proapoptotic effect does not depend on p53, but is exerted through negative regulation of the anti-apoptotic protein Bcl-2. These findings shed light on a new physiological role for Ro52 that is important to intracellular immunity.
International Nuclear Information System (INIS)
ALENZI, F.Q.Ph.; ABBAS, M.Y.Ph.; HAMAD, A.M.; EL-SAEED, O.M.; EL-NASHAR, E.M.; AL-GHAMDI, S.S.; WYSE, R.K.H.; LOTFY, M.
2010-01-01
Bcl-2 family members can be functionally divided into anti-apoptotic and pro-apoptotic groups. The balance between these two groups may determine the fate of tumor cells. In hepatocellular carcinoma (HCC), this balance is often tilted towards the anti-apoptotic members in tumor cells, leading to resistance to cell death and rapid proliferation. Material and Methods: In the current study, we in-vestigated Bcl-2 and proliferating cell nuclear antigen (PCNA) immunohistochemically, using specific mono-clonal antibodies in liver tissues obtained from two patient groups. The first group included fifty patients infected with hepatitis C virus (HCV) without hepatocellular carcinoma, the other group included twenty five HCV-infected patients but with confirmed HCC. Serum Bcl-2 was assayed using enzyme immunoassay. Results: Results showed serum Bcl-2 was elevated in 82% versus 100% in HCC-free and HCC patients, respectively. Moreover, cytoplasmic staining of Bcl-2 was found in only 16% of chronic HCV patients without HCC, versus 8% in HCC patients. On the other hand, nuclear staining of PCNA was detected in 100% of HCC patients, but in none of the HCV patients without HCC. Conclusion: The results collectively suggest that in HCV-infected patients with and without HCC, apoptosis is dysregulated and proliferation activity perturbed. There may be prognostic and/or diagnostic potential in estimating Bcl-2 and PCNA proteins in these patient groups
Lauf, Peter K; Heiny, Judith; Meller, Jarek; Lepera, Michael A; Koikov, Leonid; Alter, Gerald M; Brown, Thomas L; Adragna, Norma C
2013-01-01
Chelerythrine [CET], a protein kinase C [PKC] inhibitor, is a prop-apoptotic BH3-mimetic binding to BH1-like motifs of Bcl-2 proteins. CET action was examined on PKC phosphorylation-dependent membrane transporters (Na+/K+ pump/ATPase [NKP, NKA], Na+-K+-2Cl+ [NKCC] and K+-Cl- [KCC] cotransporters, and channel-supported K+ loss) in human lens epithelial cells [LECs]. K+ loss and K+ uptake, using Rb+ as congener, were measured by atomic absorption/emission spectrophotometry with NKP and NKCC inhibitors, and Cl- replacement by NO3ˉ to determine KCC. 3H-Ouabain binding was performed on a pig renal NKA in the presence and absence of CET. Bcl-2 protein and NKA sequences were aligned and motifs identified and mapped using PROSITE in conjunction with BLAST alignments and analysis of conservation and structural similarity based on prediction of secondary and crystal structures. CET inhibited NKP and NKCC by >90% (IC50 values ~35 and ~15 μM, respectively) without significant KCC activity change, and stimulated K+ loss by ~35% at 10-30 μM. Neither ATP levels nor phosphorylation of the NKA α1 subunit changed. 3H-ouabain was displaced from pig renal NKA only at 100 fold higher CET concentrations than the ligand. Sequence alignments of NKA with BH1- and BH3-like motifs containing pro-survival Bcl-2 and BclXl proteins showed more than one BH1-like motif within NKA for interaction with CET or with BH3 motifs. One NKA BH1-like motif (ARAAEILARDGPN) was also found in all P-type ATPases. Also, NKA possessed a second motif similar to that near the BH3 region of Bcl-2. Findings support the hypothesis that CET inhibits NKP by binding to BH1-like motifs and disrupting the α1 subunit catalytic activity through conformational changes. By interacting with Bcl-2 proteins through their complementary BH1- or BH3-like-motifs, NKP proteins may be sensors of normal and pathological cell functions, becoming important yet unrecognized signal transducers in the initial phases of apoptosis. CET
Touré, B Barry; Miller-Moslin, Karen; Yusuff, Naeem; Perez, Lawrence; Doré, Michael; Joud, Carol; Michael, Walter; DiPietro, Lucian; van der Plas, Simon; McEwan, Michael; Lenoir, Francois; Hoe, Madelene; Karki, Rajesh; Springer, Clayton; Sullivan, John; Levine, Kymberly; Fiorilla, Catherine; Xie, Xiaoling; Kulathila, Raviraj; Herlihy, Kara; Porter, Dale; Visser, Michael
2013-02-14
Overexpression of the antiapoptotic members of the Bcl-2 family of proteins is commonly associated with cancer cell survival and resistance to chemotherapeutics. Here, we describe the structure-based optimization of a series of N-heteroaryl sulfonamides that demonstrate potent mechanism-based cell death. The role of the acidic nature of the sulfonamide moiety as it relates to potency, solubility, and clearance is examined. This has led to the discovery of novel heterocyclic replacements for the acylsulfonamide core of ABT-737 and ABT-263.
Chemically Induced Degradation of the Oncogenic Transcription Factor BCL6
Directory of Open Access Journals (Sweden)
Nina Kerres
2017-09-01
Full Text Available The transcription factor BCL6 is a known driver of oncogenesis in lymphoid malignancies, including diffuse large B cell lymphoma (DLBCL. Disruption of its interaction with transcriptional repressors interferes with the oncogenic effects of BCL6. We used a structure-based drug design to develop highly potent compounds that block this interaction. A subset of these inhibitors also causes rapid ubiquitylation and degradation of BCL6 in cells. These compounds display significantly stronger induction of expression of BCL6-repressed genes and anti-proliferative effects than compounds that merely inhibit co-repressor interactions. This work establishes the BTB domain as a highly druggable structure, paving the way for the use of other members of this protein family as drug targets. The magnitude of effects elicited by this class of BCL6-degrading compounds exceeds that of our equipotent non-degrading inhibitors, suggesting opportunities for the development of BCL6-based lymphoma therapeutics.
miR-326 targets antiapoptotic Bcl-xL and mediates apoptosis in human platelets.
Directory of Open Access Journals (Sweden)
Shifang Yu
Full Text Available Platelets play crucial roles in hemostasis, thrombosis, wound healing, inflammation, angiogenesis, and tumor metastases. Because they are anucleated blood cells, platelets lack nuclear DNA, but they do contain mitochondrial DNA, which plays a key role in regulating apoptosis. Recent evidence has suggested that miRNAs are also involved in regulating gene expression and apoptosis in platelets. Our previous study showed that the expression of miR-326 increased visibly when apheresis platelets were stored in vitro. The antiapoptotic Bcl-2 family regulator Bcl-xL has been identified as a putative target of miR-326. In the present study, dual reporter luciferase assays were used to characterize the function of miR-326 in the regulation of the apoptosis of platelet cells. These assays demonstrated that miR-326 bound to the 3'-translated region of Bcl-xL. To directly assess the functional effects of miR-326 expression, levels of Bcl-xL and the apoptotic status of stored apheresis platelets were measured after transfection of miR-326 mimic or inhibitor. Results indicated that miR-326 inhibited Bcl-xL expression and induced apoptosis in stored platelets. Additionally, miR-326 inhibited Bcl-2 protein expression and enhanced Bak expression, possibly through an indirect mechanism, though there was no effect on the expression of Bax. The effect of miR-326 appeared to be limited to apoptosis, with no significant effect on platelet activation. These results provide new insight into the molecular mechanisms affecting differential platelet gene regulation, which may increase understanding of the role of platelet apoptosis in multiple diseases.
Effect of low dose ionizing radiation on Bcl-2 transcription level of Peyer's patches in mouse
International Nuclear Information System (INIS)
Liu Jiamei; Chen Dong; Zheng Yongchen; Liu Shuzheng
2001-01-01
Objective: To study the effect of whole body irradiation (WBI) with different doses of X-rays on apoptosis in cells of mouse Peyer's patches and its molecular mechanism. Methods: RT-PCR was used to detect the changes of Bcl-2 transcription level. Agarose electrophoresis and flow cytometry were used to detect the changes of DNA and apoptotic bodies in Peyer's patches after WBI with different doses of X-rays. Results: The apoptotic was increased and Bcl-2 transcription level was decreased in Peyer's patches after 2 Gy X-rays. The apoptotic rate was decreased and Bcl-2 transcription level was increased in Peyer's patches after 75 mGy X-rays. Conclusion: Bcl-2 participates in the regulation of radiation-induced apoptosis in Peyer's patches
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
Inhibitory effects of Bcl-2 on mitochondrial respiration
Czech Academy of Sciences Publication Activity Database
Vrbacký, M.; Krijt, J.; Drahota, Zdeněk; Mělková, Z.
2003-01-01
Roč. 52, č. 5 (2003), s. 545-554 ISSN 0862-8408 R&D Projects: GA ČR GA301/00/1259; GA MZd NC5463 Institutional research plan: CEZ:AV0Z5011922 Keywords : apoptosis * mitochondria * Bcl-2 Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 0.939, year: 2003
Nie, Jing; Liu, Lin; Zheng, Wei; Chen, Lin; Wu, Xin; Xu, Yingxin; Du, Xiaohui; Han, Weidong
2012-01-01
Deregulated microRNAs participate in carcinogenesis and cancer progression, but their roles in cancer development remain unclear. In this study, miR-365 expression was found to be downregulated in human colon cancer tissues as compared with that in matched non-neoplastic mucosa tissues, and its downregulation was correlated with cancer progression and poor survival in colon cancer patients. Functional studies revealed that restoration of miR-365 expression inhibited cell cycle progression, promoted 5-fluorouracil-induced apoptosis and repressed tumorigenicity in colon cancer cell lines. Furthermore, bioinformatic prediction and experimental validation were used to identify miR-365 target genes and indicated that the antitumor effects of miR-365 were probably mediated by its targeting and repression of Cyclin D1 and Bcl-2 expression, thus inhibiting cell cycle progression and promoting apoptosis. These results suggest that downregulation of miR-365 in colon cancer may have potential applications in prognosis prediction and gene therapy in colon cancer patients.
Directory of Open Access Journals (Sweden)
Giovanni Monaco
Full Text Available The anti-apoptotic Bcl-2 protein is the founding member and namesake of the Bcl-2-protein family. It has recently been demonstrated that Bcl-2, apart from its anti-apoptotic role at mitochondrial membranes, can also directly interact with the inositol 1,4,5-trisphosphate receptor (IP3R, the primary Ca(2+-release channel in the endoplasmic reticulum (ER. Bcl-2 can thereby reduce pro-apoptotic IP3R-mediated Ca(2+ release from the ER. Moreover, the Bcl-2 homology domain 4 (Bcl-2-BH4 has been identified as essential and sufficient for this IP3R-mediated anti-apoptotic activity. In the present study, we investigated whether the reported inhibitory effect of a Bcl-2-BH4 peptide on the IP 3R1 was related to the distinctive α-helical conformation of the BH4 domain peptide. We therefore designed a peptide with two glycine "hinges" replacing residues I14 and V15, of the wild-type Bcl-2-BH4 domain (Bcl-2-BH4-IV/GG. By comparing the structural and functional properties of the Bcl-2-BH4-IV/GG peptide with its native counterpart, we found that the variant contained reduced α-helicity, neither bound nor inhibited the IP 3R1 channel, and in turn lost its anti-apoptotic effect. Similar results were obtained with other substitutions in Bcl-2-BH4 that destabilized the α-helix with concomitant loss of IP3R inhibition. These results provide new insights for the further development of Bcl-2-BH4-derived peptides as specific inhibitors of the IP3R with significant pharmacological implications.
Sensory Neuropathy Due to Loss of Bcl-w
Courchesne, Stephanie L.; Karch, Christoph; Pazyra-Murphy, Maria F.; Segal, Rosalind A.
2010-01-01
Small fiber sensory neuropathy is a common disorder in which progressive degeneration of small diameter nociceptors causes decreased sensitivity to thermal stimuli and painful sensations in the extremities. In the majority of patients, the cause of small fiber sensory neuropathy is unknown, and treatment options are limited. Here, we show that Bcl-w (Bcl-2l2) is required for the viability of small fiber nociceptive sensory neurons. Bcl-w −/− mice demonstrate an adult-onset progressive decline in thermosensation and a decrease in nociceptor innervation of the epidermis. This denervation occurs without cell body loss, indicating that lack of Bcl-w results in a primary axonopathy. Consistent with this phenotype, we show that Bcl-w, in contrast to the closely related Bcl-2 and Bcl-xL, is enriched in axons of sensory neurons and that Bcl-w prevents the dying back of axons. Bcl-w −/− sensory neurons exhibit mitochondrial abnormalities, including alterations in axonal mitochondrial size, axonal mitochondrial membrane potential, and cellular ATP levels. Collectively, these data establish bcl-w −/− mice as an animal model of small fiber sensory neuropathy, and provide new insight regarding the role of bcl-w and of mitochondria in preventing axonal degeneration. PMID:21289171
Directory of Open Access Journals (Sweden)
Channakeshava Sokke Umeshappa
Full Text Available Involvement of CD4(+ helper T (Th cells is crucial for CD8(+ cytotoxic T lymphocyte (CTL-mediated immunity. However, CD4(+ Th's signals that govern CTL survival and functional memory are still not completely understood. In this study, we assessed the role of CD4(+ Th cells with acquired antigen-presenting machineries in determining CTL fates. We utilized an adoptive co-transfer into CD4(+ T cell-sufficient or -deficient mice of OTI CTLs and OTII Th cells or Th cells with various gene deficiencies pre-stimulated in vitro by ovalbumin (OVA-pulsed dendritic cell (DCova. CTL survival was kinetically assessed in these mice using FITC-anti-CD8 and PE-H-2K(b/OVA257-264 tetramer staining by flow cytometry. We show that by acting via endogenous CD40L and IL-2, and acquired peptide-MHC-I (pMHC-I complex signaling, CD4(+ Th cells enhance survival of transferred effector CTLs and their differentiation into the functional memory CTLs capable of protecting against highly-metastasizing tumor challenge. Moreover, RT-PCR, flow cytometry and Western blot analysis demonstrate that increased survival of CD4(+ Th cell-helped CTLs is matched with enhanced Akt1/NF-κB activation, down-regulation of TRAIL, and altered expression profiles with up-regulation of prosurvival (Bcl-2 and down-regulation of proapoptotic (Bcl-10, Casp-3, Casp-4, Casp-7 molecules. Taken together, our results reveal a previously unexplored mechanistic role for CD4(+ Th cells in programming CTL survival and memory recall responses. This knowledge could also aid in the development of efficient adoptive CTL cancer therapy.
Umeshappa, Channakeshava Sokke; Xie, Yufeng; Xu, Shulin; Nanjundappa, Roopa Hebbandi; Freywald, Andrew; Deng, Yulin; Ma, Hong; Xiang, Jim
2013-01-01
Involvement of CD4(+) helper T (Th) cells is crucial for CD8(+) cytotoxic T lymphocyte (CTL)-mediated immunity. However, CD4(+) Th's signals that govern CTL survival and functional memory are still not completely understood. In this study, we assessed the role of CD4(+) Th cells with acquired antigen-presenting machineries in determining CTL fates. We utilized an adoptive co-transfer into CD4(+) T cell-sufficient or -deficient mice of OTI CTLs and OTII Th cells or Th cells with various gene deficiencies pre-stimulated in vitro by ovalbumin (OVA)-pulsed dendritic cell (DCova). CTL survival was kinetically assessed in these mice using FITC-anti-CD8 and PE-H-2K(b)/OVA257-264 tetramer staining by flow cytometry. We show that by acting via endogenous CD40L and IL-2, and acquired peptide-MHC-I (pMHC-I) complex signaling, CD4(+) Th cells enhance survival of transferred effector CTLs and their differentiation into the functional memory CTLs capable of protecting against highly-metastasizing tumor challenge. Moreover, RT-PCR, flow cytometry and Western blot analysis demonstrate that increased survival of CD4(+) Th cell-helped CTLs is matched with enhanced Akt1/NF-κB activation, down-regulation of TRAIL, and altered expression profiles with up-regulation of prosurvival (Bcl-2) and down-regulation of proapoptotic (Bcl-10, Casp-3, Casp-4, Casp-7) molecules. Taken together, our results reveal a previously unexplored mechanistic role for CD4(+) Th cells in programming CTL survival and memory recall responses. This knowledge could also aid in the development of efficient adoptive CTL cancer therapy.
Combining Gene Signatures Improves Prediction of Breast Cancer Survival
Zhao, Xi; Naume, Bjørn; Langerød, Anita; Frigessi, Arnoldo; Kristensen, Vessela N.; Børresen-Dale, Anne-Lise; Lingjærde, Ole Christian
2011-01-01
Background Several gene sets for prediction of breast cancer survival have been derived from whole-genome mRNA expression profiles. Here, we develop a statistical framework to explore whether combination of the information from such sets may improve prediction of recurrence and breast cancer specific death in early-stage breast cancers. Microarray data from two clinically similar cohorts of breast cancer patients are used as training (n = 123) and test set (n = 81), respectively. Gene sets from eleven previously published gene signatures are included in the study. Principal Findings To investigate the relationship between breast cancer survival and gene expression on a particular gene set, a Cox proportional hazards model is applied using partial likelihood regression with an L2 penalty to avoid overfitting and using cross-validation to determine the penalty weight. The fitted models are applied to an independent test set to obtain a predicted risk for each individual and each gene set. Hierarchical clustering of the test individuals on the basis of the vector of predicted risks results in two clusters with distinct clinical characteristics in terms of the distribution of molecular subtypes, ER, PR status, TP53 mutation status and histological grade category, and associated with significantly different survival probabilities (recurrence: p = 0.005; breast cancer death: p = 0.014). Finally, principal components analysis of the gene signatures is used to derive combined predictors used to fit a new Cox model. This model classifies test individuals into two risk groups with distinct survival characteristics (recurrence: p = 0.003; breast cancer death: p = 0.001). The latter classifier outperforms all the individual gene signatures, as well as Cox models based on traditional clinical parameters and the Adjuvant! Online for survival prediction. Conclusion Combining the predictive strength of multiple gene signatures improves prediction of breast
Combining gene signatures improves prediction of breast cancer survival.
Directory of Open Access Journals (Sweden)
Xi Zhao
Full Text Available BACKGROUND: Several gene sets for prediction of breast cancer survival have been derived from whole-genome mRNA expression profiles. Here, we develop a statistical framework to explore whether combination of the information from such sets may improve prediction of recurrence and breast cancer specific death in early-stage breast cancers. Microarray data from two clinically similar cohorts of breast cancer patients are used as training (n = 123 and test set (n = 81, respectively. Gene sets from eleven previously published gene signatures are included in the study. PRINCIPAL FINDINGS: To investigate the relationship between breast cancer survival and gene expression on a particular gene set, a Cox proportional hazards model is applied using partial likelihood regression with an L2 penalty to avoid overfitting and using cross-validation to determine the penalty weight. The fitted models are applied to an independent test set to obtain a predicted risk for each individual and each gene set. Hierarchical clustering of the test individuals on the basis of the vector of predicted risks results in two clusters with distinct clinical characteristics in terms of the distribution of molecular subtypes, ER, PR status, TP53 mutation status and histological grade category, and associated with significantly different survival probabilities (recurrence: p = 0.005; breast cancer death: p = 0.014. Finally, principal components analysis of the gene signatures is used to derive combined predictors used to fit a new Cox model. This model classifies test individuals into two risk groups with distinct survival characteristics (recurrence: p = 0.003; breast cancer death: p = 0.001. The latter classifier outperforms all the individual gene signatures, as well as Cox models based on traditional clinical parameters and the Adjuvant! Online for survival prediction. CONCLUSION: Combining the predictive strength of multiple gene signatures improves
Directory of Open Access Journals (Sweden)
Naeem Khan
Full Text Available In acute myeloid leukemia (AML quiescence and low oxidative state, linked to BCL2 mitochondrial regulation, endow leukemic stem cells (LSC with treatment-resistance. LSC in CD34+ and more mature CD34- AML have heterogeneous immunophenotypes overlapping with normal stem/progenitor cells (SPC but may be differentiated by functional markers. We therefore investigated the oxidative/reactive oxygen species (ROS profile, its relationship with cell-cycle/BCL2 for normal SPC, and whether altered in AML and myelodysplasia (MDS. In control BM (n = 24, ROS levels were highest in granulocyte-macrophage progenitors (GMP and CD34- myeloid precursors but megakaryocyte-erythroid progenitors had equivalent levels to CD34+CD38low immature-SPC although they were ki67high. BCL2 upregulation was specific to GMPs. This profile was also observed for CD34+SPC in MDS-without-excess-blasts (MDS-noEB, n = 12. Erythroid CD34- precursors were, however, abnormally ROS-high in MDS-noEB, potentially linking oxidative stress to cell loss. In pre-treatment AML (n = 93 and MDS-with-excess-blasts (MDS-RAEB (n = 14, immunophenotypic mature-SPC had similar ROS levels to co-existing immature-SPC. However ROS levels varied between AMLs; Flt3ITD+/NPM1wild-type CD34+SPC had higher ROS than NPM1mutated CD34+ or CD34- SPC. An aberrant ki67lowBCL2high immunophenotype was observed in CD34+AML (most prominent in Flt3ITD AMLs but also in CD34- AMLs and MDS-RAEB, suggesting a shared redox/pro-survival adaptation. Some patients had BCL2 overexpression in CD34+ ROS-high as well as ROS-low fractions which may be indicative of poor early response to standard chemotherapy. Thus normal SPC subsets have distinct ROS, cell-cycle, BCL2 profiles that in AML /MDS-RAEB are decoupled from maturation. The combined profile of these functional properties in AML subpopulations may be relevant to differential treatment resistance.
Discovery and molecular characterization of a Bcl-2-regulated cell death pathway in schistosomes.
Lee, Erinna F; Clarke, Oliver B; Evangelista, Marco; Feng, Zhiping; Speed, Terence P; Tchoubrieva, Elissaveta B; Strasser, Andreas; Kalinna, Bernd H; Colman, Peter M; Fairlie, W Douglas
2011-04-26
Schistosomiasis is an infectious disease caused by parasites of the phylum platyhelminthe. Here, we describe the identification and characterization of a Bcl-2-regulated apoptosis pathway in Schistosoma japonicum and S. mansoni. Genomic, biochemical, and cell-based mechanistic studies provide evidence for a tripartite pathway, similar to that in humans including BH3-only proteins that are inhibited by prosurvival Bcl-2-like molecules, and Bax/Bak-like proteins that facilitate mitochondrial outer-membrane permeabilization. Because Bcl-2 proteins have been successfully targeted with "BH3 mimetic" drugs, particularly in the treatment of cancer, we investigated whether schistosome apoptosis pathways could provide targets for future antischistosomal drug discovery efforts. Accordingly, we showed that a schistosome prosurvival protein, sjA, binds ABT-737, a well-characterized BH3 mimetic. A crystal structure of sjA bound to a BH3 peptide provides direct evidence for the feasibility of developing BH3 mimetics to target Bcl-2 prosurvival proteins in schistosomes, suggesting an alternative application for this class of drugs beyond cancer treatment.
Henríquez-Hernández, Luis Alberto; Lloret, Marta; Pinar, Beatriz; Bordón, Elisa; Rey, Agustín; Lubrano, Amina; Lara, Pedro Carlos
2011-09-01
To investigate whether BCL-2 expression would improve MVP/IGF-1R prediction of clinical outcome in cervix carcinoma patients treated by radiochemotherapy, and suggest possible mechanisms behind this effect. Fifty consecutive patients, who achieved complete response to treatment, from a whole series of 60 cases suffering from non-metastatic localized cervical carcinoma, were prospectively included in this study from July 1999 to December 2003. Follow-up was closed in January 2011. All patients received pelvic radiation (45-64.80 Gy in 1.8-2 Gy fractions) with concomitant cisplatin at 40 mg/m2/week doses followed by brachytherapy. Oncoprotein expression was studied by immunohistochemistry in paraffin-embedded tumour tissue. No relation was found between BCL-2 and clinicopathological variables. High MVP/IGF-1R/BCL-2 tumour expression was strongly related to poor local and regional disease-free survival (PMVP, and IGF-1R overexpression were related to poorer clinical outcome in cervical cancer patients who achieved clinical complete response to radiochemotherapy. The NHEJ repair protein Ku70/80 expression could be involved in the regulation of these oncoproteins. Copyright © 2011 Elsevier Inc. All rights reserved.
A Review on Structures and Functions of Bcl-2 Family Proteins from Homo sapiens.
Sivakumar, Dakshinamurthy; Sivaraman, Thirunavukkarasu
2016-01-01
Cancer cells evade apoptosis, which is regulated by proteins of Bcl-2 family in the intrinsic pathways. Numerous experimental three-dimensional (3D) structures of the apoptotic proteins and the proteins bound with small chemical molecules/peptides/proteins have been reported in the literature. In this review article, the 3D structures of the Bcl-2 family proteins from Homo sapiens and as well complex structures of the anti-apoptotic proteins bound with small molecular inhibitors reported in the literature to date have been comprehensively listed out and described in detail. Moreover, the molecular mechanisms by which the Bcl-2 family proteins modulate the apoptotic processes and strategies for designing antagonists to anti-apoptotic proteins have been concisely discussed.
DEFF Research Database (Denmark)
Maddika, S; Ande, SR; Panigrahi, S
2007-01-01
)), and the Cip1/Waf1/Kip1-2-family (p21(Cip1/Waf1), p27(Kip1), p57(Kip2)) are shown both in the context of proliferation regulators and as contributors to the apoptotic machinery. Bcl2-family members (i.e. Bcl2, Bcl-X(L) Mcl-1(L); Bax, Bok/Mtd, Bak, and Bcl-X(S); Bad, Bid, Bim(EL), Bmf, Mcl-1(S)) are highlighted...... approaches that would involve redirecting over-active survival and proliferation pathways towards induction of apoptosis in cancer cells....
Alteration of apoptosis-related genes in postmenopausal women with uterine prolapse.
Saatli, Bahadir; Kizildag, Sefa; Cagliyan, Erkan; Dogan, Erbil; Saygili, Ugur
2014-07-01
We aimed to compare expression levels of antiapoptotic and proapoptotic genes in parametrial and vaginal tissues from postmenopausal women with and without pelvic organ prolapse (POP). We hypothesized that the expression of genes that induce apoptosis may be altered in vaginal and parametrial tissues in postmenopausal women with POP. Samples of vaginal and parametrial tissues were obtained from postmenopausal women with (n = 10) and without (n = 10) POP who underwent vaginal or abdominal hysterectomy. Expression levels of antiapoptotic (BCL-2, BCL-XL) and proapoptotic (BAX, BAD) genes were studied by real-time reverse-transcription polymerase chain reaction (RT-PCR). Gene expression levels of BCL-2 (P gene expression levels of BCL-2 (p gene expression levels differed significantly between postmenopausal women with and without POP. Bcl-2 family genes were overexpressed in the parametrium of patients with POP compared with vaginal tissue, suggesting that the processes responsible for POP have a greater effect on parametrial tissue than vaginal tissue during the development of POP.
Neuropilin-2 mediated β-catenin signaling and survival in human gastro-intestinal cancer cell lines.
Directory of Open Access Journals (Sweden)
Shaija Samuel
Full Text Available NRP-2 is a high-affinity kinase-deficient receptor for ligands belonging to the class 3 semaphorin and vascular endothelial growth factor families. NRP-2 has been detected on the surface of several types of human cancer cells, but its expression and function in gastrointestinal (GI cancer cells remains to be determined. We sought to determine the function of NRP-2 in mediating downstream signals regulating the growth and survival of human gastrointestinal cancer cells. In human gastric cancer specimens, NRP-2 expression was detected in tumor tissues but not in adjacent normal mucosa. In CNDT 2.5 cells, shRNA mediated knockdown NRP-2 expression led to decreased migration and invasion in vitro (p<0.01. Focused gene-array analysis demonstrated that loss of NRP-2 reduced the expression of a critical metastasis mediator gene, S100A4. Steady-state levels and function of β-catenin, a known regulator of S100A4, were also decreased in the shNRP-2 clones. Furthermore, knockdown of NRP-2 sensitized CNDT 2.5 cells in vitro to 5FU toxicity. This effect was associated with activation of caspases 3 and 7, cleavage of PARP, and downregulation of Bcl-2. In vivo growth of CNDT 2.5 cells in the livers of nude mice was significantly decreased in the shNRP-2 group (p<0.05. Intraperitoneal administration of NRP-2 siRNA-DOPC decreased the tumor burden in mice (p = 0.01. Collectively, our results demonstrate that tumor cell-derived NRP-2 mediates critical survival signaling in gastrointestinal cancer cells.
Bax/Bcl-2 expression ratio in prediction of response to breast cancer radiotherapy
Directory of Open Access Journals (Sweden)
Hosein Azimian
2018-03-01
Full Text Available Objective(s: Radiotherapy is one of the most effective modalities of cancer therapy, but clinical responses of individual patients varies considerably. To enhance treatment efficiency it is essential to implement an individual-based treatment. The aim of present study was to identify the mechanism of intrinsic apoptosis pathway on radiosensitivity and normal tissue complications caused by the radiotherapy. Materials and Methods: Peripheral blood mononuclear cells from ten breast cancer patients were exposed to 6MV X-rays to deliver 1 and 2 Gy. Expression levels of Bax, Bcl-2, and Bax/Bcl-2 ratio were examined by relative quantitative RT-PCR. All the patients received similar tangential irradiation of the whole breast and conventional fractionation. Skin dosimetry was done by GAFChromic EBT-3 film and clinical radiosensitivity was determined using the acute reactions to radiotherapy of the skin according to Radiation Therapy Oncology Group score. All statistical analyses were performed using GraphPad Prism, version 7.01. Results: In the in-vitro experiment, Bax and Bax/Bcl-2 ratios were significantly increased with 1 and 2 Gy doses (PP0.05 for all patients. Conclusion: Significant correlation between Bax/Bcl-2 ratio determined before radiation therapy and clinical response in the patients, can be used as a biomarker to identify radiosensitive individuals. However, further studies are required to validate radiation-induced apoptotic biomarkers.
Institute of Scientific and Technical Information of China (English)
ZHANG Xuezhao; XIAO Maolei; SUN Guojie
2002-01-01
Objective: To study the effect of auricular acupuncture on dysmnesia and the relationship between the memory improvement and bcl-2 protein expression in vascular dementia (VD) rats. Methods: Forty Wistar rats were randomized into control group, VD group, acupuncture+ VD group and pseudo-operation group, with 10 cases in each group. Rat VD model was established by using 4-vessel occlusion method. Otopoint "Nao"-point and "Shen"(MA-SC)were punctured, once daily continuously for 15 days. The rats' memory capability was tested with Y-maze method and bcl-2 expression of the brain tissues displayed by immunohistochemical method and measured using MIAS-2000 Image Analyzer. Results: Results showed that the scores of control group, VD group and acupuncture+ VD group before operation were 5.68±1.29, 6.07±1.67 and 5.86±1.74 respectively, while following auricular acupuncture treatment,the scores of the 3 groups were 5.81±1.51, 18.06±2.68 and 8.31 ± 1.85 separately, suggesting that the VD rat's learning and memory abilities in acupuncture+ VD group were raised apparently in comparison with those of VD group (P < 0.01 ). In control, VD and acupuncture+VD group, bcl-2 immuno-reaction positive neurons in CA1 area of the hippocampus were 14.31 ± 4.87, 28.67 ± 5.63 and 65.74 ± 8.19 respectively, displaying that the improvement of learning and memory abilities caused by auricular acupuncture treatment may be related to the up-regulation of bcl-2expression (an inhibitory gene of apoptosis). In comparison with control group, the loss of neurons in the pyramidal cell layer of the hippocampal CA1 area of VD group was more severe, while that of acupuncture group was markedly lighter. Conclusion: Auricular acupuncture of otopoint "Nao"-point and "Shen" (MA-SC) can raise the learning and memory abilities of VD rats, which may be realized by its inhibitory effect on apoptosis and the protection action on ischemic hippocampal neurons.
Chen, Chao; Liu, Tian Shu; Zhao, Si Cong; Yang, Wen Zheng; Chen, Zong Ping; Yan, Yong
2018-05-01
Efficient apoptosis requires Bcl-2 family-mediated mitochondrial outer membrane permeabilization (MOMP), which releases pro-apoptotic proteins to the cytosol, activating apoptosis and inhibiting X-linked inhibitor of apoptosis protein (XIAP). XIAP is a member of the inhibitors of apoptosis protein family whose expression is elevated in many cancer types and participates in the release of pro-apoptotic proteins. To explore the association between XIAP and the Bcl-2 family, and the influence of XIAP on mitochondria, RNA interference of XIAP was performed in Caki-1 cells and the dynamic change in the levels of related proteins was compared with the original Caki-1 cells upon induction of apoptosis. Upon knockdown of XIAP, the release of cytochrome c (Cyt-c), second mitochondria-derived activator of caspase (Smac) and apoptotic protease activating factor 1 (Apaf-1) from mitochondria proceeded normally, whereas in Caki-1 cells, the release of these pro-apoptotic proteins was significantly prolonged, and incomplete. Downregulation of XIAP through small interfering RNA resulted in an increase of apoptosis and a marked decrease in Bcl-2 and Bcl-xl levels at 3 h. Additionally, the regulation of the level of XIAP protein affected the specific ratios of Bcl-2/Bax and Bcl-xl/Bax, which play decisive roles in cell death. In the present study, it was revealed that XIAP can feed back to mitochondria, delaying Cyt-c and Apaf-1 release. Furthermore, XIAP can limit the release of its inhibitor Smac with the involvement of Bcl-2 family proteins.
Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.
Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S
2016-06-21
Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.
Directory of Open Access Journals (Sweden)
Kamel Nermen A
2011-01-01
Full Text Available Abstract Background Local pelvic recurrence after radical cystectomy for muscle invasive bilharzial related squamous cell carcinoma accounts for 75% of treatment failures even in organ confined tumors. Despite the proven value of lymphadenectomy, up to 60% of patients undergoing cystectomy do not have it. These factors are in favor of adjuvant radiotherapy reevaluation. objectives: to evaluate the effect of adjuvant radiotherapy on disease free survival in muscle invasive bilharzial related squamous cell carcinoma of the urinary bladder and to test the predictability of radio-sensitivity using the anti apoptotic protein Bcl-XL. Methods The study prospectively included 71 patients, (47 males, 24 females with muscle invasive bilharzial related squamous cell carcinoma of the bladder (Stage pT2a-T3N0-N3M0 who underwent radical cystectomy in Assiut university hospitals between January 2005 and December 2006. Thirty eight patients received adjuvant radiotherapy to the pelvis in the dose of 50Gy/25 fractions/5 weeks (Group 1, while 33 patients did not receive adjuvant radiotherapy (group 2. Immunohistochemical characterization for bcl-xL expression was done. Follow up was done every 3 months for 12 to 36 months with a mean of 16 ± 10 months. All data were analyzed using SPSS version 16. Three years cumulative disease free survival was calculated and adjusted to Bcl-XL expression and side effects of the treatment were recorded. Results The disease free cumulative survival was 48% for group 1 and 29% for group 2 (log rank p value 0.03. The multivariate predictors of tumor recurrence were the positive Bcl-XL expression (odd ratio 41.1, 95% CI 8.4 - 102.3, p Conclusions Adjuvant radiotherapy for muscle invasive bilharzial related squamous cell carcinoma of the urinary bladder has potential effectiveness and minor side effects. Moreover, Bcl-XL expression is a valuable tool for predicting those who might not respond to this adjuvant treatment.
International Nuclear Information System (INIS)
Phillips, D C; Xiao, Y; Lam, L T; Litvinovich, E; Roberts-Rapp, L; Souers, A J; Leverson, J D
2015-01-01
As a population, non-Hodgkin's lymphoma (NHL) cell lines positive for the t(14;18) translocation and/or possessing elevated BCL2 copy number (CN; BCL2 High ) are exquisitely sensitive to navitoclax or the B-cell lymphoma protein-2 (BCL-2)-selective inhibitor venetoclax. Despite this, some BCL2 High cell lines remain resistant to either agent. Here we show that the MCL-1-specific inhibitor A-1210477 sensitizes these cell lines to navitoclax. Chemical segregation of this synergy with the BCL-2-selective inhibitor venetoclax or BCL-X L -selective inhibitor A-1155463 indicated that MCL-1 and BCL-2 are the two key anti-apoptotic targets for sensitization. Similarly, the CDK inhibitor flavopiridol downregulated MCL-1 expression and synergized with venetoclax in BCL2 High NHL cell lines to a similar extent as A-1210477. A-1210477 also synergized with navitoclax in the majority of BCL2 Low NHL cell lines. However, chemical segregation with venetoclax or A-1155463 revealed that synergy was driven by BCL-X L inhibition in this population. Collectively these data emphasize that BCL2 status is predictive of venetoclax potency in NHL not only as a single agent, but also in the adjuvant setting with anti-tumorigenic agents that inhibit MCL-1 function. These studies also potentially identify a patient population (BCL2 Low ) that could benefit from BCL-X L (navitoclax)-driven combination therapy
Directory of Open Access Journals (Sweden)
Peter K. Lauf
2013-02-01
Full Text Available Background/Aims: Chelerythrine [CET], a protein kinase C [PKC] inhibitor, is a prop-apoptotic BH3-mimetic binding to BH1-like motifs of Bcl-2 proteins. CET action was examined on PKC phosphorylation-dependent membrane transporters (Na+/K+ pump/ATPase [NKP, NKA], Na+-K+-2Cl+ [NKCC] and K+-Cl- [KCC] cotransporters, and channel-supported K+ loss in human lens epithelial cells [LECs]. Methods: K+ loss and K+ uptake, using Rb+ as congener, were measured by atomic absorption/emission spectrophotometry with NKP and NKCC inhibitors, and Cl- replacement by NO3ˉ to determine KCC. 3H-Ouabain binding was performed on a pig renal NKA in the presence and absence of CET. Bcl-2 protein and NKA sequences were aligned and motifs identified and mapped using PROSITE in conjunction with BLAST alignments and analysis of conservation and structural similarity based on prediction of secondary and crystal structures. Results: CET inhibited NKP and NKCC by >90% (IC50 values ∼35 and ∼15 µM, respectively without significant KCC activity change, and stimulated K+ loss by ∼35% at 10-30 µM. Neither ATP levels nor phosphorylation of the NKA α1 subunit changed. 3H-ouabain was displaced from pig renal NKA only at 100 fold higher CET concentrations than the ligand. Sequence alignments of NKA with BH1- and BH3-like motifs containing pro-survival Bcl-2 and BclXl proteins showed more than one BH1-like motif within NKA for interaction with CET or with BH3 motifs. One NKA BH1-like motif (ARAAEILARDGPN was also found in all P-type ATPases. Also, NKA possessed a second motif similar to that near the BH3 region of Bcl-2. Conclusion: Findings support the hypothesis that CET inhibits NKP by binding to BH1-like motifs and disrupting the α1 subunit catalytic activity through conformational changes. By interacting with Bcl-2 proteins through their complementary BH1- or BH3-like-motifs, NKP proteins may be sensors of normal and pathological cell functions, becoming important yet
Directory of Open Access Journals (Sweden)
Sarah E. Sinnett
2017-06-01
Full Text Available Intravenous administration of adeno-associated virus serotype 9 (AAV9/hMECP2 has been shown to extend the lifespan of Mecp2−/y mice, but this delivery route induces liver toxicity in wild-type (WT mice. To reduce peripheral transgene expression, we explored the safety and efficacy of AAV9/hMECP2 injected into the cisterna magna (ICM. AAV9/hMECP2 (1 × 1012 viral genomes [vg]; ICM extended Mecp2−/y survival but aggravated hindlimb clasping and abnormal gait phenotypes. In WT mice, 1 × 1012 vg of AAV9/hMECP2 induced clasping and abnormal gait. A lower dose mitigated these adverse phenotypes but failed to extend survival of Mecp2−/y mice. Thus, ICM delivery of this vector is impractical as a treatment for Rett syndrome (RTT. To improve the safety of MeCP2 gene therapy, the gene expression cassette was modified to include more endogenous regulatory elements believed to modulate MeCP2 expression in vivo. In Mecp2−/y mice, ICM injection of the modified vector extended lifespan and was well tolerated by the liver but did not rescue RTT behavioral phenotypes. In WT mice, these same doses of the modified vector had no adverse effects on survival or neurological phenotypes. In summary, we identified limitations of the original vector and demonstrated that an improved vector design extends Mecp2−/y survival, without apparent toxicity.
The function of BCL9 in Wnt/β-catenin signaling and colorectal cancer cells
International Nuclear Information System (INIS)
Roche, Marc de la; Worm, Jesper; Bienz, Mariann
2008-01-01
Most cases of colorectal cancer are initiated by hyperactivation of the Wnt/β-catenin pathway due to mutations in the APC tumour suppressor, or in β-catenin itself. A recently discovered component of this pathway is Legless, which is essential for Wnt-induced transcription during Drosophila development. Limited functional information is available for its two mammalian relatives, BCL9 and B9L/BCL9-2: like Legless, these proteins bind to β-catenin, and RNAi-mediated depletion of B9L/BCL9-2 has revealed that this protein is required for efficient β-catenin-mediated transcription in mammalian cell lines. No loss-of-function data are available for BCL9. We have used overexpression of dominant-negative forms of BCL9, and RNAi-mediated depletion, to study its function in human cell lines with elevated Wnt pathway activity, including colorectal cancer cells. We found that BCL9 is required for efficient β-catenin-mediated transcription in Wnt-stimulated HEK 293 cells, and in the SW480 colorectal cancer cell line whose Wnt pathway is active due to APC mutation. Dominant-negative mutants of BCL9 indicated that its function depends not only on its β-catenin ligand, but also on an unknown ligand of its C-terminus. Finally, we show that BCL9 and B9L are both Wnt-inducible genes, hyperexpressed in colorectal cancer cell lines, indicating that they are part of a positive feedback loop. BCL9 is required for efficient β-catenin-mediated transcription in human cell lines whose Wnt pathway is active, including colorectal cancer cells, indicating its potential as a drug target in colorectal cancer
International Nuclear Information System (INIS)
Bubb, Robbin S.; Komaki, Ritsuko; Hachiya, Tsutomu; Milas, Ivan; Ro, Jae Y.; Langford, Lauren; Sawaya, Raymond; Putnam, Joe B.; Allen, Pamela; Cox, James D.; McDonnell, Timothy J.; Brock, William; Hong, Waun K.; Roth, Jack A.; Milas, Luka
2002-01-01
Purpose: The study was conducted to determine whether immunohistochemical analysis of Ki-67, p53, and bcl-2 in patients with non-small-cell lung cancer is associated with a higher rate of brain metastases and whether the intrapatient expression of these biomarkers (in the primary tumors vs. brain lesions) is similar. Methods and Materials: At the M. D. Anderson Cancer Center, tumors from 29 case patients with primary lung tumor and brain metastasis and 29 control patients with primary lung tumor but no brain metastasis were resected and examined for immunohistochemical expression. Ki-67, p53, and bcl-2 were analyzed in resected primary lung, lymph node, and metastatic brain tumors. Each control patient was matched by age, gender, and histology to a patient with brain metastasis. Results: No significant differences in patient survival characteristics were detected between the case group and control group. Also, difference in patient outcome between the two groups was not generally predicted by biomarker analysis. However, when the groups were combined, the biomarker analysis was predictive for certain patient outcome end points. Using median values as cutoff points between low and high expression of biomarkers, it was observed that high expression of Ki-67 (>40%) in lung primaries was associated with poorer disease-free survival (p=0.04), whereas low expression of p53 in lung primaries was associated with poorer overall survival (p=0.04), and these patients had a higher rate of nonbrain distant metastases (p=0.02). The patients with brain metastases were particularly prone to developing nonbrain distant metastases if the percentage of p53-positive cells in brain metastases was low (p=0.01). There was a positive correlation in the expression of Ki-67 (p=0.02) (r 2 =0.1608), as well as p53 (p 2 =0.7380), between lung primaries and brain metastases. Compared to Ki-67 and p53, bcl-2 was the least predictive. Conclusion: Differences in biomarker expression between the
Mucaki, Eliseos J; Baranova, Katherina; Pham, Huy Q; Rezaeian, Iman; Angelov, Dimo; Ngom, Alioune; Rueda, Luis; Rogan, Peter K
2016-01-01
Genomic aberrations and gene expression-defined subtypes in the large METABRIC patient cohort have been used to stratify and predict survival. The present study used normalized gene expression signatures of paclitaxel drug response to predict outcome for different survival times in METABRIC patients receiving hormone (HT) and, in some cases, chemotherapy (CT) agents. This machine learning method, which distinguishes sensitivity vs. resistance in breast cancer cell lines and validates predictions in patients; was also used to derive gene signatures of other HT (tamoxifen) and CT agents (methotrexate, epirubicin, doxorubicin, and 5-fluorouracil) used in METABRIC. Paclitaxel gene signatures exhibited the best performance, however the other agents also predicted survival with acceptable accuracies. A support vector machine (SVM) model of paclitaxel response containing genes ABCB1, ABCB11, ABCC1, ABCC10, BAD, BBC3, BCL2, BCL2L1, BMF, CYP2C8, CYP3A4, MAP2, MAP4, MAPT, NR1I2, SLCO1B3, TUBB1, TUBB4A, and TUBB4B was 78.6% accurate in predicting survival of 84 patients treated with both HT and CT (median survival ≥ 4.4 yr). Accuracy was lower (73.4%) in 304 untreated patients. The performance of other machine learning approaches was also evaluated at different survival thresholds. Minimum redundancy maximum relevance feature selection of a paclitaxel-based SVM classifier based on expression of genes BCL2L1, BBC3, FGF2, FN1, and TWIST1 was 81.1% accurate in 53 CT patients. In addition, a random forest (RF) classifier using a gene signature ( ABCB1, ABCB11, ABCC1, ABCC10, BAD, BBC3, BCL2, BCL2L1, BMF, CYP2C8, CYP3A4, MAP2, MAP4, MAPT, NR1I2,SLCO1B3, TUBB1, TUBB4A, and TUBB4B ) predicted >3-year survival with 85.5% accuracy in 420 HT patients. A similar RF gene signature showed 82.7% accuracy in 504 patients treated with CT and/or HT. These results suggest that tumor gene expression signatures refined by machine learning techniques can be useful for
Opposite role of Bax and BCL-2 in the anti-tumoral responses of the immune system
International Nuclear Information System (INIS)
Bougras, Gwenola; Cartron, Pierre-François; Gautier, Fabien; Martin, Stéphane; LeCabellec, Marité; Meflah, Khaled; Gregoire, Marc; Vallette, François M
2004-01-01
The relative role of anti apoptotic (i.e. Bcl-2) or pro-apoptotic (e.g. Bax) proteins in tumor progression is still not completely understood. The rat glioma cell line A15A5 was stably transfected with human Bcl-2 and Bax transgenes and the viability of theses cell lines was analyzed in vitro and in vivo. In vitro, the transfected cell lines (huBax A15A5 and huBcl-2 A15A5) exhibited different sensitivities toward apoptotic stimuli. huBax A15A5 cells were more sensitive and huBcl-2 A15A5 cells more resistant to apoptosis than mock-transfected A15A5 cells (pCMV A15A5). However, in vivo, in syngenic rat BDIX, these cell lines behaved differently, as no tumor growth was observed with huBax A15A5 cells while huBcl-2 A15A5 cells formed large tumors. The immune system appeared to be involved in the rejection of huBax A15A5 cells since i) huBax A15A5 cells were tumorogenic in nude mice, ii) an accumulation of CD8+ T-lymphocytes was observed at the site of injection of huBax A15A5 cells and iii) BDIX rats, which had received huBax A15A5 cells developed an immune protection against pCMV A15A5 and huBcl-2 A15A5 cells. We show that the expression of Bax and Bcl-2 controls the sensitivity of the cancer cells toward the immune system. This sensitization is most likely to be due to an increase in immune induced cell death and/or the amplification of an anti tumour immune response
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
International Nuclear Information System (INIS)
Zhang Yili; Du Hongwen; Zhang Yun; Zhang Yuelang; Kuang Fangjun; Guo Zuomin
2004-01-01
Objective: To discuss the correlation of mammographical imaging signs with the expression of bcl-2 and bax proteins in breast cancer for early diagnosis and forecast of its prognoses. Methods: Fifty-four breast cancers and 26 benign diseases were proved by pathologic methods and all cases underwent mammography. Immunohistochemical technique was used to measure the expression of bcl-2 and bax proteins in these tissues. The correlation of imaging signs with the expression of bcl-2 and bax proteins in breast cancer and benign lesion was analyzed. Results: The expression of bcl-2 or bax protein in the breast cancer was higher than that in breast benign diseases (χ 2 =15.116, 11.361, P 2 =10.358, 12.818, P 2 =10.996, 10.667, P 2 =10.405, P 2 =6.841, P<0.05). Conclusion: Some imaging signs of breast cancer were closely related to the expression of bcl-2 and bax proteins and these signs could reflect the biological behavior of tumor cells and prognoses. Therefore it could be helpful to the early diagnosis and treatment of breast cancer. (authors)
Yang, X-C; Wang, X; Luo, L; Dong, D-H; Yu, Q-C; Wang, X-S; Zhao, K
2013-06-01
S100A4 is a well established marker and mediator of metastatic disease, but the exact mechanisms responsible for the metastasis promoting effects are less well defined. We tested a hypothesis that the S100A4 gene plays a role in the proliferation and invasiveness of human renal cancer cells (RCC) and may be associated with its metastatic spread. The small interference RNA vector pcDNA3.1-S100A4 siRNA was transfected in to the human renal cancer cell lines ACHN, Ketr-3, OS-RC-2, CaKi-2 and HTB-47, then treated with ABT-737 or BB94. Cell apoptosis and cell viability was detected by flow cytometry and MTT assay. Matrigel was used for cell motility and invasion assay. MMP-2, bcl-2 and S100A4 was detected by RT-PCR and western blot assay. NF-kB subunit p65 activity was detected by confocal microscopy assay. We then determine the effect S100A4 sliencing on tumor growth, lung metastasis development in vivo. Immunohistochemistry was used to detected the expression of S100A4, bcl-2, MMP-2, p65 and CD31. S100A4 silencing in ACHN cells by RNA interference significantly inhibited NF-kB and NF-kB-mediated MMP-2 and bcl-2 activation and cellular migration, proliferation, and promoted apoptosis. Furthermore, re-expression of S100A4 in S100A4-siRNA-transfected ACHN cells by transient S100A4 cDNA transfection restored the NF-kB and NF-kB-mediated MMP-2 and bcl-2 activation and their high migratory and cellular proliferative ability. An inhibitor ABT-737 (the Bcl-2 antagonist targets Bcl-2) against Bcl-2 suppressed cellular proliferation and promoted apoptosis induced by S100A4 re-expression in S100A4-siRNA-transfected ACHN cells. A inhibitor BB94 against MMPs to neutralize MMP-2 protein suppressed cellular invasion and migration induced by S100A4 re-expression in S100A4-siRNA-transfected ACHN cells. In the prevention model, S100A4 silencing inhibited primary tumor growth by (tumor weight) (76 ± 8%) and (tumor volum) (78 ± 4%) respectively and promoted apoptosis and the formation
Valera, Alexandra; López-Guillermo, Armando; Cardesa-Salzmann, Teresa; Climent, Fina; González-Barca, Eva; Mercadal, Santiago; Espinosa, Iñigo; Novelli, Silvana; Briones, Javier; Mate, José L; Salamero, Olga; Sancho, Juan M; Arenillas, Leonor; Serrano, Sergi; Erill, Nadina; Martínez, Daniel; Castillo, Paola; Rovira, Jordina; Martínez, Antonio; Campo, Elias; Colomo, Luis
2013-10-01
MYC alterations influence the survival of patients with diffuse large B-cell lymphoma. Most studies have focused on MYC translocations but there is little information regarding the impact of numerical alterations and protein expression. We analyzed the genetic alterations and protein expression of MYC, BCL2, BCL6, and MALT1 in 219 cases of diffuse large B-cell lymphoma. MYC rearrangement occurred as the sole abnormality (MYC single-hit) in 3% of cases, MYC and concurrent BCL2 and/or BCL6 rearrangements (MYC double/triple-hit) in 4%, MYC amplifications in 2% and MYC gains in 19%. MYC single-hit, MYC double/triple-hit and MYC amplifications, but not MYC gains or other gene rearrangements, were associated with unfavorable progression-free survival and overall survival. MYC protein expression, evaluated using computerized image analysis, captured the unfavorable prognosis of MYC translocations/amplifications and identified an additional subset of patients without gene alterations but with similar poor prognosis. Patients with tumors expressing both MYC/BCL2 had the worst prognosis, whereas those with double-negative tumors had the best outcome. High MYC expression was associated with shorter overall survival irrespectively of the International Prognostic Index and BCL2 expression. In conclusion, MYC protein expression identifies a subset of diffuse large B-cell lymphoma with very poor prognosis independently of gene alterations and other prognostic parameters.
Directory of Open Access Journals (Sweden)
Barros, Rosana M. G.
2005-01-01
Full Text Available Anormalidades em genes que regulam a proliferação e morte celular podem provocar inúmeras doenças entre elas o carcinoma epidermóide de boca. Tem sido relatado que alterações genéticas nas células tumorais predizem a agressividade biológica dos tumores. Marcadores genéticos como c-erbB-2, Bcl-2 e EGFR são considerados indicadores promissores de prognósticos para as lesões cancerizáveis e as neoplasias. Objetivo: Avaliar a expressão imunohistoquímica das proteínas c-erbB-2, Bcl-2 e EGFR (oncoproteínas envolvidas nas vias de proliferação celular Material e Métodos: cento e cinco blocos e parafina contendo fragmentos de biopsias incisionais, sendo 54 de carcinomas epidermóides, 25 blocos de leucoplasias e 26 blocos de hiperlasias obtidos do Laboratório de Patologia de Boca da Universidade Federal de Mato Grosso do Sul (UFSM. A expressão das proteínas foi verificada através da técnica imunohistoquímica utilizando a estreptoavidina-biotina-peroxidase no Laboratório de Patologia da Universidade de Brasília (UNB. Resultados: Os resultados revelaram diferença estatisticamente significante da proteína EGFR para os carcinomas epidermóides de boca e para as demais proteínas não houve diferença estatisticamente significante entre as lesões. Conclusões: Os resultados sugerem que o EGFR pode ser utilizado como marcador em carcinoma de boca podendo contribuir para a progressão da neoplasia, porém sendo insuficiente na predição da carcinogênese. Abnormalities in genes that regulate the proliferation and cell death can provoke many lesions as oral epidermal carcinoma. It has been related that genetic alterations in tumoral cells predict the biologic agressivity in the tumors. Genetic markers as cerbB-2, Bcl-2 and EGFR are considered indicators of prognostic to the pre-malignant lesions and neoplasias. Objective: to study in the fragments of incisional biopsy the expression of c-erbB-2, Bcl-2 and EGFR proteins
Mechanism of effect of ionizing radiation on bcl-2 protein expression and apoptosis in mouse thymus
International Nuclear Information System (INIS)
Liu Jiamei; Chen Aijun; Chen Dong; Liu Shuzheng
2002-01-01
Objective: To study the mechanism of effect of ionizing radiation in varied doses of X-rays on bcl-2 express and apoptosis in mouse thymus. Methods: Immunohistochemistry, image analysis and transmission electron microscope were used in the study. Results: The expression of bcl-2 protein was limited within thymic medulla, decreased with 2 Gy, however, increased with 0.075 Gy after whole-body irradiation. Some typical apoptotic cells were found in thymic cortex after 2 Gy irradiation. The apoptotic cells decreased and mitotic metaphase increased after 0.075 Gy irradiation. Conclusion: The mechanism of effect of ionizing radiation on apoptosis of thymus was related with the expression of bcl-2 proteins
Discovery and molecular characterization of a Bcl-2–regulated cell death pathway in schistosomes
Lee, Erinna F.; Clarke, Oliver B.; Evangelista, Marco; Feng, Zhiping; Speed, Terence P.; Tchoubrieva, Elissaveta B.; Strasser, Andreas; Kalinna, Bernd H.; Colman, Peter M.; Fairlie, W. Douglas
2011-01-01
Schistosomiasis is an infectious disease caused by parasites of the phylum platyhelminthe. Here, we describe the identification and characterization of a Bcl-2–regulated apoptosis pathway in Schistosoma japonicum and S. mansoni. Genomic, biochemical, and cell-based mechanistic studies provide evidence for a tripartite pathway, similar to that in humans including BH3-only proteins that are inhibited by prosurvival Bcl-2–like molecules, and Bax/Bak-like proteins that facilitate mitochondrial outer-membrane permeabilization. Because Bcl-2 proteins have been successfully targeted with “BH3 mimetic” drugs, particularly in the treatment of cancer, we investigated whether schistosome apoptosis pathways could provide targets for future antischistosomal drug discovery efforts. Accordingly, we showed that a schistosome prosurvival protein, sjA, binds ABT-737, a well-characterized BH3 mimetic. A crystal structure of sjA bound to a BH3 peptide provides direct evidence for the feasibility of developing BH3 mimetics to target Bcl-2 prosurvival proteins in schistosomes, suggesting an alternative application for this class of drugs beyond cancer treatment. PMID:21444803
International Nuclear Information System (INIS)
Vergis, Roy; Corbishley, Catherine M.; Thomas, Karen
2010-01-01
Purpose: Established prognostic factors in localized prostate cancer explain only a moderate proportion of variation in outcome. We analyzed tumor expression of apoptotic markers with respect to outcome in men with localized prostate cancer in two randomized controlled trials of radiotherapy dose escalation. Methods and Materials: Between 1995 and 2001, 308 patients with localized prostate cancer received neoadjuvant androgen deprivation and radical radiotherapy at our institution in one of two dose-escalation trials. The biopsy specimens in 201 cases were used to make a biopsy tissue microarray. We evaluated tumor expression of Bcl-2, p53, and MDM2 by immunohistochemistry with respect to outcome. Results: Median follow-up was 7 years, and 5-year freedom from biochemical failure (FFBF) was 70.4% (95% CI, 63.5-76.3%). On univariate analysis, expression of Bcl-2 (p < 0.001) and p53 (p = 0.017), but not MDM2 (p = 0.224), was significantly associated with FFBF. Expression of Bcl-2 remained significantly associated with FFBF (p = 0.001) on multivariate analysis, independently of T stage, Gleason score, initial prostate-specific antigen level, and radiotherapy dose. Seven-year biochemical control was 61% vs. 41% (p = 0.0122) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-positive tumors and 87% vs. 81% (p = 0.423) for 74 Gy vs. 64 Gy, respectively, among patients with Bcl-2-negative tumors. There was no statistically significant interaction between dose and Bcl-2 expression. Conclusions: Bcl-2 expression was a significant, independent determinant of biochemical control after neoadjuvant androgen deprivation and radical radiotherapy for prostate cancer. These data generate the hypothesis that Bcl-2 expression could be used to inform the choice of radiotherapy dose in individual patients.
International Nuclear Information System (INIS)
Abrol, Ravinder; Edderkaoui, Mouad; Goddard, William A.; Pandol, Stephen J.
2012-01-01
Highlights: ► Direct role of Bcl-2 protein interactions in cell proliferation is not clear. ► Designed Bcl-xL mutants show opposite effects on apoptosis and proliferation. ► Disrupting Bcl-xL:Bim interaction increased apoptosis in pancreatic cancer. ► Disrupting Bcl-xL:Bim interaction decreased proliferation in pancreatic cancer. ► Bcl-xL:Bim interaction can control both apoptosis and proliferation. -- Abstract: A major mechanism through which cancer cells avoid apoptosis is by promoting the association of anti-apoptotic members of the pro-survival Bcl-2 protein family (like Bcl-2 and Bcl-xL) with BH 3 domain-only proteins (like Bim and Bid). Apoptosis and cell proliferation have been shown to be linked for many cancers but the molecular basis for this link is far from understood. We have identified the Bcl-xL:Bim protein–protein interface as a direct regulator of proliferation and apoptosis in pancreatic cancer cells. We were able to predict and subsequently verify experimentally the effect of various Bcl-xL single-point mutants (at the position A142) on binding to Bim by structural analysis and computational modeling of the inter-residue interactions at the Bcl-xL:Bim protein–protein interface. The mutants A142N, A142Q, and A142Y decreased binding of Bim to Bcl-xL and A142S increased this binding. The Bcl-xL mutants, with decreased affinity for Bim, caused an increase in apoptosis and a corresponding decrease in cell proliferation. However, we could prevent these effects by introducing a small interfering RNA (siRNA) targeted at Bim. These results show a novel role played by the Bcl-xL:Bim interaction in regulating proliferation of pancreatic cancer cells at the expense of apoptosis. This study presents a physiologically relevant model of the Bcl-xL:Bim interface that can be used for rational therapeutic design for the inhibition of proliferation and cancer cell resistance to apoptosis.
Atherosclerosis-Associated Endothelial Cell Apoptosis by MiR-429-Mediated Down Regulation of Bcl-2
Directory of Open Access Journals (Sweden)
Tao Zhang
2015-10-01
Full Text Available Background/Aims: Endothelial cell injury and subsequent apoptosis play a key role in the development and pathogenesis of atherosclerosis, which is hallmarked by dysregulated lipid homeostasis, aberrant immunity and inflammation, and plaque-instability-associated coronary occlusion. Nevertheless, our understanding of the mechanisms underlying endothelial cell apoptosis is still limited. MicroRNA-429 (miR-29 is a known cancer suppressor that promotes cancer cell apoptosis. However, it is unknown whether miR-429 may be involved in the development of atherosclerosis through similar mechanisms. We addressed these questions in the current study. Methods: We examined the levels of endothelial cell apoptosis in ApoE (-/- mice suppled with high-fat diet (HFD, a mouse model for atherosclerosis (simplified as HFD mice. We analyzed the levels of anti-apoptotic protein Bcl-2 and the levels of miR-429 in the purified CD31+ endothelial cells from mouse aorta. Prediction of the binding between miR-429 and 3'-UTR of Bcl-2 mRNA was performed by bioinformatics analyses and confirmed by a dual luciferase reporter assay. The effects of miR-429 were further analyzed in an in vitro model using oxidized low-density lipoprotein (ox-LDL-treated human aortic endothelial cells (HAECs. Results: HFD mice developed atherosclerosis in 12 weeks, while the control ApoE (-/- mice that had received normal diet (simplified as NOR mice did not. HFD mice had significantly lower percentage of endothelial cells and significantly higher percentage of mesenchymal cells in the aorta than NOR mice. Significantly higher levels of endothelial cell apoptosis were detected in HFD mice, resulting from decreases in Bcl-2 protein, but not mRNA. The decreases in Bcl-2 in endothelial cells were due to increased levels of miR-429, which suppressed the translation of Bcl-2 mRNA via 3'-UTR binding. These in vivo findings were reproduced in vitro on ox-LDL-treated HAECs. Conclusion: Atherosclerosis
International Nuclear Information System (INIS)
Ryu, Samuel; Stein, Joseph P.; Chung, Chung T.; Lee, Yong J.; Kim, Jae Ho
2001-01-01
Purpose: Combined use of 13-cis-retinoic acid (cRA) and interferon-α2a (IFNα) induced significant radiosensitization in human cervical cancer ME-180 cell line, whereas it failed to achieve similar radiation enhancement in HeLa cells. The differential radiosensitization could be from the difference of retinoic acid receptor (RAR) expression because RAR-β was highly expressed in ME-180 cells in contrast to the HeLa cells where RAR-β was not detectable. We examined the role of this gene in mediating radiosensitization by cRA and IFNα, and explored the mechanism of radiation-induced cell killing. Methods and Materials: Human cervical cancer cell lines, ME-180 and HeLa, were treated with cRA and IFNα followed by radiation. Apoptosis and radiosensitization were quantitated by TUNEL assay (in situ DNA nick end labeling) and colony-forming ability of surviving cells. The cells were transfected with bcl-2 gene and RAR-β gene to test the role of these genes in mediating radiosensitization and apoptosis. Results: Synergistic radiosensitization and apoptosis was observed by combined use of cRA and IFNα with radiation in ME-180 cells which express high level of RAR-β mRNA, whereas these were not seen in HeLa cells where RAR-β mRNA is not detectable. Both radiosensitization and apoptosis were abolished by bcl-2 gene in ME-180 cells. RAR-β gene transfection induced similar radiation enhancement and apoptosis in HeLa cells. Conclusion: Apoptosis and radiation response were enhanced in the cells with high level of RAR-β mRNA expression. The RAR-β gene appears to mediate the radiation-induced apoptosis by cRA and IFNα. These findings indicate that presence of RAR-β in the cancer cells could be exploited for patient selection in using these drugs for apoptosis and radiosensitization
Bcl6 promotes osteoblastogenesis through Stat1 inhibition
Energy Technology Data Exchange (ETDEWEB)
Fujie, Atsuhiro; Funayama, Atsushi; Miyauchi, Yoshiteru [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Sato, Yuiko [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Musculoskeletal Reconstruction and Regeneration Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Kobayashi, Tami [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Integrated Bone Metabolism and Immunology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Kanagawa, Hiroya; Katsuyama, Eri; Hao, Wu; Tando, Toshimi; Watanabe, Ryuichi [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Morita, Mayu [Department of Dentistry and Oral Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Miyamoto, Kana; Kanaji, Arihiko; Morioka, Hideo; Matsumoto, Morio; Toyama, Yoshiaki [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Miyamoto, Takeshi, E-mail: miyamoto@z5.keio.jp [Department of Orthopedic Surgery, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan); Department of Integrated Bone Metabolism and Immunology, Keio University School of Medicine, 35 Shinano-machi, Shinjuku-ku, Tokyo 160-8582 (Japan)
2015-02-13
Bone mass is tightly controlled by a balance between osteoclast and osteoblast activities. Although these cell types mature via different pathways, some factors reportedly regulate differentiation of both. Here, in a search for factors governing osteoblastogenesis but also expressed in osteoclasts to control both cell types by one molecule, we identified B cell lymphoma 6 (Bcl6) as one of those factors and show that it promotes osteoblast differentiation. Bcl6 was previously shown to negatively regulate osteoclastogenesis. We report that lack of Bcl6 results in significant inhibition of osteoblastogensis in vivo and in vitro and in defects in secondary ossification center formation in vivo. Signal transducer and activator of transcription 1 (Stat1) reportedly attenuates osteoblast differentiation by inhibiting nuclear translocation of runt-related transcription factor 2 (Runx2), which is essential for osteoblast differentiation. We found that lack of Bcl6 resulted in significant elevation of Stat1 mRNA and protein expression in osteoblasts and showed that Stat1 is a direct target of Bcl6 using a chromatin immune-precipitation assay. Mice lacking both Bcl6 and Stat1 (DKO) exhibited significant rescue of bone mass and osteoblastic parameters as well as partial rescue of secondary ossification center formation compared with Bcl6-deficient mice in vivo. Altered osteoblastogenesis in Bcl6-deficient cells was also restored in DKO in vitro. Thus, Bcl6 plays crucial roles in regulating both osteoblast activation and osteoclast inhibition. - Highlights: • Bcl6 is required for osteoblast differentiation. • Bcl6{sup −/−} mice exhibited altered osteoblastogenesis and reduced bone mass in vivo and in vitro. • We identified Stat1 as a direct target of Bcl6 in osteoblasts. • Bcl6 and Stat1 doubly deficient mice exhibited rescued bone phenotypes compared with Bcl6{sup −/−} mice.
LncRNA TUG1 sponges microRNA-9 to promote neurons apoptosis by up-regulated Bcl2l11 under ischemia.
Chen, Shengcai; Wang, Mengdie; Yang, Hang; Mao, Ling; He, Quanwei; Jin, Huijuan; Ye, Zi-Ming; Luo, Xue-Ying; Xia, Yuan-Peng; Hu, Bo
2017-03-25
Emerging studies have illustrated that LncRNAs TUG1 play critical roles in multiple biologic processes. However, the LncRNA TUG1 expression and function in ischemic stroke have not been reported yet. In this study, we found that LncRNA TUG1 expression was significantly up-regulated in brain ischemic penumbra from rat middle carotid artery occlusion (MCAO) model, while similar results were also observed in cultured neurons under oxygen-glucose deprivation (OGD) insult. Knockdown of TUG1 decreased the ratio of apoptotic cells and promoted cells survival in vitro, which may be regulated by the elevated miRNA-9 expression and decreased Bcl2l11 protein. Furthermore, TUG1 could directly interact with miR-9 and down-regulating miR-9 could efficiently reverse the function of TUG1 on the Bcl2l11 expression. In summary, our result sheds light on the role of LncRNA TUG1 as a miRNA sponge for ischemic stroke, possibly providing a new therapeutic target in stroke. Copyright © 2017 Elsevier Inc. All rights reserved.
A gene expression signature associated with survival in metastatic melanoma
Mandruzzato, Susanna; Callegaro, Andrea; Turcatel, Gianluca; Francescato, Samuela; Montesco, Maria C; Chiarion-Sileni, Vanna; Mocellin, Simone; Rossi, Carlo R; Bicciato, Silvio; Wang, Ena; Marincola, Francesco M; Zanovello, Paola
2006-01-01
Background Current clinical and histopathological criteria used to define the prognosis of melanoma patients are inadequate for accurate prediction of clinical outcome. We investigated whether genome screening by means of high-throughput gene microarray might provide clinically useful information on patient survival. Methods Forty-three tumor tissues from 38 patients with stage III and stage IV melanoma were profiled with a 17,500 element cDNA microarray. Expression data were analyzed using significance analysis of microarrays (SAM) to identify genes associated with patient survival, and supervised principal components (SPC) to determine survival prediction. Results SAM analysis revealed a set of 80 probes, corresponding to 70 genes, associated with survival, i.e. 45 probes characterizing longer and 35 shorter survival times, respectively. These transcripts were included in a survival prediction model designed using SPC and cross-validation which allowed identifying 30 predicting probes out of the 80 associated with survival. Conclusion The longer-survival group of genes included those expressed in immune cells, both innate and acquired, confirming the interplay between immunological mechanisms and the natural history of melanoma. Genes linked to immune cells were totally lacking in the poor-survival group, which was instead associated with a number of genes related to highly proliferative and invasive tumor cells. PMID:17129373
A gene expression signature associated with survival in metastatic melanoma
Directory of Open Access Journals (Sweden)
Rossi Carlo R
2006-11-01
Full Text Available Abstract Background Current clinical and histopathological criteria used to define the prognosis of melanoma patients are inadequate for accurate prediction of clinical outcome. We investigated whether genome screening by means of high-throughput gene microarray might provide clinically useful information on patient survival. Methods Forty-three tumor tissues from 38 patients with stage III and stage IV melanoma were profiled with a 17,500 element cDNA microarray. Expression data were analyzed using significance analysis of microarrays (SAM to identify genes associated with patient survival, and supervised principal components (SPC to determine survival prediction. Results SAM analysis revealed a set of 80 probes, corresponding to 70 genes, associated with survival, i.e. 45 probes characterizing longer and 35 shorter survival times, respectively. These transcripts were included in a survival prediction model designed using SPC and cross-validation which allowed identifying 30 predicting probes out of the 80 associated with survival. Conclusion The longer-survival group of genes included those expressed in immune cells, both innate and acquired, confirming the interplay between immunological mechanisms and the natural history of melanoma. Genes linked to immune cells were totally lacking in the poor-survival group, which was instead associated with a number of genes related to highly proliferative and invasive tumor cells.
Ziedan, Noha I; Hamdy, Rania; Cavaliere, Alessandra; Kourti, Malamati; Prencipe, Filippo; Brancale, Andrea; Jones, Arwyn T; Westwell, Andrew D
2017-07-01
A new series of oxadiazoles were designed to act as inhibitors of the anti-apoptotic Bcl-2 protein. Virtual screening led to the discovery of new hits that interact with Bcl-2 at the BH3 binding pocket. Further study of the structure-activity relationship of the most active compound of the first series, compound 1, led to the discovery of a novel oxadiazole analogue, compound 16j, that was a more potent small-molecule inhibitor of Bcl-2. 16j had good in vitro inhibitory activity with submicromolar IC 50 values in a metastatic human breast cancer cell line (MDA-MB-231) and a human cervical cancer cell line (HeLa). The antitumour effect of 16j is concomitant with its ability to bind to Bcl-2 protein as shown by an enzyme-linked immunosorbent assay (IC 50 = 4.27 μm). Compound 16j has a great potential to develop into highly active anticancer agent. © 2017 John Wiley & Sons A/S.
PPAR-γ Silencing Inhibits the Apoptosis of A549 Cells by Upregulating Bcl-2
Directory of Open Access Journals (Sweden)
Jingyu YANG
2013-03-01
Full Text Available Background and objective Drug resistance is the one of primary causes of death in patients with lung cancer, PPAR-γ could induce the apoptosis and reverse drug resistance. The aim of this study is to investigate the expression of PPAR-γ on cisplatin sensitivity and apoptosis response of human lung cancer cell line A549. Methods Reconstruction of PPAR-γ silencing A549 cells (A549/PPAR-γ(- by siRNA. MTT assay was employed to determine the effect of cisplatin on the proliferation of A549/PPAR-γ(-, flow cytometry to determine the effect of cisplatin on the cell apoptosis, Western blot to determine the change of phosphorylation of Akt, caspase-3 and expression of bcl-2/bax. Finally, RT-PCR was employed to determine the transcriptional level of bcl-2. Results Two PPAR-γ silencing A549 cell clones were established successfully, and the expression of PPAR-γ was downregulated significantly as confirmed by RT-PCR and Western blot. After PPAR-γ silencing, the resistance of these two A549 clones to cisplatin was increased by 1.29-fold and 1.60-fold respectively. Flow cytometry showed that the apoptosis rate was decreased, and Western Blot showed that the phosphorylation of Akt and expression of bcl-2/bax were upregulated, caspase-3 was downregulated. Finally, RT-PCR showed that the transcriptional level of bcl-2 was upregulated as well. Conclusion Downregulation of PPAR-γ in A549 cells led to increase of cisplatin resistance. One of the mechanisms was upregulatin of phosphorylation of Akt and expression of bcl-2, which inhibited the apoptosis of cells. The downregulation of PPAR-γ is a possible mechanism that leads to the clinical drug resistance of cancer.
BCL11B is up-regulated by EWS/FLI and contributes to the transformed phenotype in Ewing sarcoma.
Directory of Open Access Journals (Sweden)
Elizabeth T Wiles
Full Text Available The EWS/FLI translocation product is the causative oncogene in Ewing sarcoma and acts as an aberrant transcription factor. EWS/FLI dysregulates gene expression during tumorigenesis by abnormally activating or repressing genes. The expression levels of thousands of genes are affected in Ewing sarcoma, however, it is unknown which of these genes contribute to the transformed phenotype. Here we characterize BCL11B as an up-regulated EWS/FLI target that is necessary for the maintenance of transformation in patient derived Ewing sarcoma cells lines. BCL11B, a zinc finger transcription factor, acts as a transcriptional repressor in Ewing's sarcoma and contributes to the EWS/FLI repressed gene signature. BCL11B repressive activity is mediated by the NuRD co-repressor complex. We further demonstrate that re-expression of SPRY1, a repressed target of BCL11B, limits the transformation capacity of Ewing sarcoma cells. These data define a new pathway downstream of EWS/FLI required for oncogenic maintenance in Ewing sarcoma.
Directory of Open Access Journals (Sweden)
Huan-Xin Lin
Full Text Available It has been suggested that autophagy-related Beclin 1 plays a critical role in the regulation of tumor development and/or progression, but its prognostic significance and relationship with Bcl-xL expression in ovarian carcinoma are unclear.In the present study, the methods of Western blotting and immunohistochemistry (IHC were utilized to investigate the expression status of Beclin 1 and Bcl-xL in fresh ovarian tissues and paraffin-embedded epithelial ovarian tumor tissues. Decreased expression of Beclin 1 was examined by IHC in 8.3% of normal ovaries, in 15.4% of cystadenomas, in 20.0% of borderline tumors, and in 55.6% of ovarian carcinomas, respectively. In ovarian carcinomas, decreased expression of Beclin 1 was correlated closely with ascending histological grade, later pT/pN/pM status and/or advanced clinical stage (P<0.05. In univariate survival analysis, a highly significant association between low-expressed Beclin 1 and shortened patient survival was evaluated in ovarian carcinoma patients (P<0.01, and Beclin 1 expression was an independent prognostic factor as evidenced by multivariate analysis (P = 0.013. In addition, decreased expression of Beclin 1 was inversely correlated with altered expression of Bcl-xL in ovarian carcinoma cohort, and combined analysis further showed that the low Beclin 1/high Bcl-xL group had the lowest survival rate.Our findings suggest that Beclin 1 expression, as examined by IHC, could be served as an additional tool in identifying ovarian carcinoma patients at risk of tumor progression, and predicting patient survival in ovarian carcinomas with increased expression of Bcl-xL.
THE EXPRESSION OF Bcl-2 AND PRO-CASPASE 3 IN HEAD AND NECK SQUAMOUS CELL CARCINOMA
Directory of Open Access Journals (Sweden)
Andrej Cör
2002-12-01
Full Text Available Background. Head and neck squamous cell carcinoma (HNSCC is the sixth most common cancer and accounts for 6% of cancers worldwide. A better understanding of its biology could lead to improved treatment options. Generally, the goal of cancer treatment is to abolish cell proliferation and to induce necrotic or aptoptotic cell death. Apoptosis has been recognized as a key mechanism of tumour cell elimination. Different apoptotic signals converge to induce caspase cascade activation. Caspase 3 is the central executioner caspase and is necessary for effective apoptotic cell death. Bcl-2 protein family regulates apoptosis. The Bcl-2 protein itself is a product of a proto-oncogene and has an antiapoptotic action.Methods. In our study, the expression of Bcl-2 and pro-caspase 3 by immunohistochemistry in 28 HNSCC graded into well, moderately and poorly differentiated cancers were investigated.Results. Our results of Bcl-2 expression confirm and extend previous reports in which Bcl-2 over-expression has been recognised as an important parameter in HNSCC biological behaviour. Three of 28 tumours (11% showed significant Bcl-2 expression. Two of them were poorly and one was moderately differentiated. Pro-caspase 3 immunoreactivity was confined mainly to the cytoplasm. Absent or low pro-caspase 3 immunoreactivity was found only in 1 of 6 well differentiated and in 1of 10 moderately differentiated tumours in contrast to 5 of 12 poorly differentiated tumours. In six of 12 poorly differentiated tumours procasapse 3 immunoreactivity was strongly positive. In two cases hyperplastic epithelium was strongly positive in contrast to adjacent HNSCC in the same slide which was completely negative for pro-caspase 3.Conclusions. Our results indicate downregulation of pro-caspase 3 expression, especially in poorly differentiated HNSCC. Further studies are needed to test whether this is related to HNSCC behaviour and predict treatment outcome.
Zhao, Xinkai; Ning, Qiaoming; Sun, Xiaoning; Tian, De'an
2011-06-01
To investigate the relationship among Pokemon, NF-κ B p65 and Bcl-2 in hepatoma cells. HCC cell HepG2, SMMC7721 and human fetal liver cell line LO2 cells were used, and expression of Pokemon, NF-κ B p65 and Bcl-2 in three cells were detected by real-time PCR and western blot. Then siRNA of Pokemon was applied to inhibit the expression of Pokemon and NF-κ B p65 and apoptotic rate was determined by flow cytometric analysis. Expressions of Pokemon, NF-κ B p65 and Bcl-2 in human hepatoma cell HepG2, SMMC7721 expression were significantly higher than those in human embryonic stem cells LO2. siRNA of Pokemon inhibited the expression of Pokemon, NF-κ B p65 and Bcl-2 in liver cancer cells, and significantly increased apoptosis of liver cells. While siRNA of NF-κ B p65 inhibited the expression of NF-κ B p65 and Bcl-2, but Pokemon expression in hepatoma cells had no significant change. The proto-oncogene Pokemon can inhibit P14ARF by specific transcription regulation of cell cycle and can induce tumors. In addition, Pokemon can regulate NF-κ B p65 through the expression of apoptosis repressor, and promote the development of liver cancer. It suggests signal network in the liver include the regulation of new non-classical NF-κ B regulatory pathway. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Thoulouze, Maria-Isabel; Lafage, Mireille; Yuste, Victor J.; Baloul, Leiela; Edelman, Lena; Kroemer, Guido; Israel, Nicole; Susin, Santos A.; Lafon, Monique
2003-01-01
We report here that rabies virus strains, currently used to immunize wildlife against rabies, induce not only caspase-dependent apoptosis in the human lymphoblastoid Jurkat T cell line (Jurkat-vect), but also a caspase-independent pathway involving the apoptosis-inducing factor (AIF). In contrast, a strain of neurotropic RV that does not induce apoptosis did not activate caspases or induce AIF translocation. Bcl-2 overproduction in Jurkat T cells (Jurkat-Bcl-2) abolished both pathways. ERA infection and production were similar in Jurkat-vect and Jurkat-Bcl-2 cells, indicating Bcl-2 has no direct antiviral effects. Bcl-2 production is naturally upregulated by day 3 in ERA-infected Jurkat-vect cultures. The increase in Bcl-2 levels seems to be controlled by the virus infection itself and results in the establishment of long-term, persistently infected cultures that continue to produce virus. Thus, in infections with live RV vaccine strains, infected cells may be productive reservoirs of virus in the long term. This may account for the high efficacy of live rabies vaccines
Integrative analysis of survival-associated gene sets in breast cancer.
Varn, Frederick S; Ung, Matthew H; Lou, Shao Ke; Cheng, Chao
2015-03-12
Patient gene expression information has recently become a clinical feature used to evaluate breast cancer prognosis. The emergence of prognostic gene sets that take advantage of these data has led to a rich library of information that can be used to characterize the molecular nature of a patient's cancer. Identifying robust gene sets that are consistently predictive of a patient's clinical outcome has become one of the main challenges in the field. We inputted our previously established BASE algorithm with patient gene expression data and gene sets from MSigDB to develop the gene set activity score (GSAS), a metric that quantitatively assesses a gene set's activity level in a given patient. We utilized this metric, along with patient time-to-event data, to perform survival analyses to identify the gene sets that were significantly correlated with patient survival. We then performed cross-dataset analyses to identify robust prognostic gene sets and to classify patients by metastasis status. Additionally, we created a gene set network based on component gene overlap to explore the relationship between gene sets derived from MSigDB. We developed a novel gene set based on this network's topology and applied the GSAS metric to characterize its role in patient survival. Using the GSAS metric, we identified 120 gene sets that were significantly associated with patient survival in all datasets tested. The gene overlap network analysis yielded a novel gene set enriched in genes shared by the robustly predictive gene sets. This gene set was highly correlated to patient survival when used alone. Most interestingly, removal of the genes in this gene set from the gene pool on MSigDB resulted in a large reduction in the number of predictive gene sets, suggesting a prominent role for these genes in breast cancer progression. The GSAS metric provided a useful medium by which we systematically investigated how gene sets from MSigDB relate to breast cancer patient survival. We used
Lagadinou, Eleni D.; Sach, Alexander; Callahan, Kevin; Rossi, Randall M.; Neering, Sarah J.; Minhajuddin, Mohammad; Ashton, John M.; Pei, Shanshan; Grose, Valerie; O’Dwyer, Kristen M.; Liesveld, Jane L.; Brookes, Paul S.; Becker, Michael W.; Jordan, Craig T.
2013-01-01
Summary Most forms of chemotherapy employ mechanisms involving induction of oxidative stress, a strategy that can be effective due to the elevated oxidative state commonly observed in cancer cells. However, recent studies have shown that relative redox levels in primary tumors can be heterogeneous, suggesting that regimens dependent on differential oxidative state may not be uniformly effective. To investigate this issue in hematological malignancies, we evaluated mechanisms controlling oxidative state in primary specimens derived from acute myelogenous leukemia (AML) patients. Our studies demonstrate three striking findings. First, the majority of functionally-defined leukemia stem cells (LSCs) are characterized by relatively low levels of reactive oxygen species (termed “ROS-low”). Second, ROS-low LSCs aberrantly over-express BCL-2. Third, BCL-2 inhibition reduced oxidative phosphorylation and selectively eradicated quiescent LSCs. Based on these findings, we propose a model wherein the unique physiology of ROS-low LSCs provides an opportunity for selective targeting via disruption of BCL-2-dependent oxidative phosphorylation. PMID:23333149
Increase of bcl-2 Protein Expression in Aggressive Basal Cell Carcinoma of Head and Neck
Cláudia CAZAL; Mariana Roesch ELY; Ana Paula Veras SOBRAL; Wilton Wilney Nascimento PADILHA
2006-01-01
Objective: The aim of this study was to verify the bcl-2 protein expression in 22 cutaneous basal cell carcinomas (BCC) of the head and neck, and to compare it with its aggressive behavior. Method: Tumors were histologically classified in non-aggressive (BCC 1) and aggressive (BCC 2) and then submitted to the immunohistochemistry technique with the streptavidin-biotin peroxidase method using the anti-bcl-2 antibody. Results: After proceeding to morphological analysis, sixteen tumors (72.7%) w...
Energy Technology Data Exchange (ETDEWEB)
Abrol, Ravinder, E-mail: abrol@wag.caltech.edu [Materials and Process Simulation Center, Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125 (United States); Edderkaoui, Mouad [Veterans Affairs Greater Los Angeles Healthcare System and UCLA, Los Angeles, CA 90073 (United States); Goddard, William A. [Materials and Process Simulation Center, Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125 (United States); Pandol, Stephen J., E-mail: stephen.pandol@va.gov [Veterans Affairs Greater Los Angeles Healthcare System and UCLA, Los Angeles, CA 90073 (United States)
2012-06-15
Highlights: Black-Right-Pointing-Pointer Direct role of Bcl-2 protein interactions in cell proliferation is not clear. Black-Right-Pointing-Pointer Designed Bcl-xL mutants show opposite effects on apoptosis and proliferation. Black-Right-Pointing-Pointer Disrupting Bcl-xL:Bim interaction increased apoptosis in pancreatic cancer. Black-Right-Pointing-Pointer Disrupting Bcl-xL:Bim interaction decreased proliferation in pancreatic cancer. Black-Right-Pointing-Pointer Bcl-xL:Bim interaction can control both apoptosis and proliferation. -- Abstract: A major mechanism through which cancer cells avoid apoptosis is by promoting the association of anti-apoptotic members of the pro-survival Bcl-2 protein family (like Bcl-2 and Bcl-xL) with BH{sub 3} domain-only proteins (like Bim and Bid). Apoptosis and cell proliferation have been shown to be linked for many cancers but the molecular basis for this link is far from understood. We have identified the Bcl-xL:Bim protein-protein interface as a direct regulator of proliferation and apoptosis in pancreatic cancer cells. We were able to predict and subsequently verify experimentally the effect of various Bcl-xL single-point mutants (at the position A142) on binding to Bim by structural analysis and computational modeling of the inter-residue interactions at the Bcl-xL:Bim protein-protein interface. The mutants A142N, A142Q, and A142Y decreased binding of Bim to Bcl-xL and A142S increased this binding. The Bcl-xL mutants, with decreased affinity for Bim, caused an increase in apoptosis and a corresponding decrease in cell proliferation. However, we could prevent these effects by introducing a small interfering RNA (siRNA) targeted at Bim. These results show a novel role played by the Bcl-xL:Bim interaction in regulating proliferation of pancreatic cancer cells at the expense of apoptosis. This study presents a physiologically relevant model of the Bcl-xL:Bim interface that can be used for rational therapeutic design for the
Directory of Open Access Journals (Sweden)
Tognon Raquel
2012-02-01
Full Text Available Abstract Background Essential Thrombocythemia (ET and Primary Myelofibrosis (PMF are Chronic Myeloproliferative Neoplasms (MPN characterized by clonal myeloproliferation/myeloaccumulation without cell maturation impairment. The JAK2 V617F mutation and PRV1 gene overexpression may contribute to MPN physiopathology. We hypothesized that deregulation of the apoptotic machinery may also play a role in the pathogenesis of ET and PMF. In this study we evaluated the apoptosis-related gene and protein expression of BCL2 family members in bone marrow CD34+ hematopoietic stem cells (HSC and peripheral blood leukocytes from ET and PMF patients. We also tested whether the gene expression results were correlated with JAK2 V617F allele burden percentage, PRV1 overexpression, and clinical and laboratory parameters. Results By real time PCR assay, we observed that A1, MCL1, BIK and BID, as well as A1, BCLW and BAK gene expression were increased in ET and PMF CD34+ cells respectively, while pro-apoptotic BAX and anti-apoptotic BCL2 mRNA levels were found to be lower in ET and PMF CD34+ cells respectively, in relation to controls. In patients' leukocytes, we detected an upregulation of anti-apoptotic genes A1, BCL2, BCL-XL and BCLW. In contrast, pro-apoptotic BID and BIMEL expression were downregulated in ET leukocytes. Increased BCL-XL protein expression in PMF leukocytes and decreased BID protein expression in ET leukocytes were observed by Western Blot. In ET leukocytes, we found a correlation between JAK2 V617F allele burden and BAX, BIK and BAD gene expression and between A1, BAX and BIK and PRV1 gene expression. A negative correlation between PRV1 gene expression and platelet count was observed, as well as a positive correlation between PRV1 gene expression and splenomegaly. Conclusions Our results suggest the participation of intrinsic apoptosis pathway in the MPN physiopathology. In addition, PRV1 and JAK2 V617F allele burden were linked to deregulation
Sutariya, Rakesh V; Manjunatha, Bhari Sharanesha
2016-11-01
Oral Squamous cell carcinoma (OSCC) results from genetic damage, leading to uncontrolled cell proliferation of damaged cells and the cell death. In the course of its progression, visible changes are taking place at the cellular level (atypical) and the resultant at the tissue level (epithelial dysplasia). The Aim of the present study was to evaluate and compare the expressions of intensity of p21 and Bcl-2 in Leukoplakia, oralsubmucous fibrosis (OSMF) and oral squamous cell carcinoma. Total 60 cases, 30 cases of oral squamous cell carcinoma, 15 cases of oral submucous fibrosis and 15 cases of Leukoplakia were evaluated immunohistochemically for p21 and Bcl-2 expression. p21 showed positive expression in 13 (86.67%) cases out of 15 cases of OSMF, 12 (80%) cases of leukoplakia out of 15 cases and 24 (80%) cases out of 30 cases of OSCC. The Bcl-2 expression was positive in 13 (86.67%) cases of OSMF, all cases of Leukoplakia and 25 (83.33%) cases of OSCC. No statistical significance was noted in the expression of p21 and Bcl-2 positive expression between OSMF, Leukoplakia and OSCC. Statistical analysis for comparison of intensity of p21 expression in different grades of OSCC showed no significance. Statistical significance difference was found between the expressions of Bcl-2 in moderately and poorly differentiated SCC. The intensity of p21 and Bcl-2 expressions in different grades of OSCC indicates a key role in progression of oral neoplasia.
International Nuclear Information System (INIS)
Wang, Chaoyun; He, Yanhao; Yang, Ming; Sun, Hongliu; Zhang, Shuping; Wang, Chunhua
2013-01-01
Intracellular reactive oxygen species (ROS) are derived from nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Angiotensin II (Ang II) can cause endothelial dysfunction by promoting intracellular ROS generation. Safflor yellow B (SYB) effectively inhibits ROS generation by upregulating Bcl-2 expression. In this study, we examined the effects of SYB on Ang II-induced injury to human umbilical vein endothelial cells (HUVECs), and elucidated the roles of NADPH oxidase and Bcl-2. We treated cultured HUVECs with Ang II, SYB, and Bcl-2 siRNA, and determined NADPH oxidase activity and ROS levels. Furthermore, cellular and mitochondrial physiological states were evaluated, and the expression levels of target proteins were analyzed. Ang II significantly enhanced intracellular ROS levels, caused mitochondrial membrane dysfunction, and decreased cell viability, leading to apoptosis. This was associated with increased expression of AT1R and p22 phox , increased NADPH oxidase activity, and an increased ratio of Bax/Bcl-2, leading to decreases in antioxidant enzyme activities, which were further strengthened after blocking Bcl-2. Compared to Ang II treatment alone, co-treatment with SYB significantly reversed HUVEC injury. Taken together, these results demonstrate that SYB could significantly protect endothelial cells from Ang II-induced cell damage, and that it does so by upregulating Bcl-2 expression and inhibiting ROS generation. - Highlights: • Angiotensin II depresses mitochondria physiological function. • Angiotensin II activates NADPH oxidase via up-regulating expresion of p22 phox . • Bcl-2 plays a pivotal role in improving mitochondria function and regulates ROS level. • Inhibitor of Bcl-2 promotes angiotensin II mediated HUVEC injury. • SYB attenuates angiotensin II mediated HUVEC injury via up regulating Bcl-2 expression
Discovery and molecular characterization of a Bcl-2–regulated cell death pathway in schistosomes
Lee, Erinna F.; Clarke, Oliver B.; Evangelista, Marco; Feng, Zhiping; Speed, Terence P.; Tchoubrieva, Elissaveta B.; Strasser, Andreas; Kalinna, Bernd H.; Colman, Peter M.; Fairlie, W. Douglas
2011-01-01
Schistosomiasis is an infectious disease caused by parasites of the phylum platyhelminthe. Here, we describe the identification and characterization of a Bcl-2–regulated apoptosis pathway in Schistosoma japonicum and S. mansoni. Genomic, biochemical, and cell-based mechanistic studies provide evidence for a tripartite pathway, similar to that in humans including BH3-only proteins that are inhibited by prosurvival Bcl-2–like molecules, and Bax/Bak-like proteins that facilitate mitochondrial ou...
Directory of Open Access Journals (Sweden)
Hsieh Fu-Chuan
2008-10-01
Full Text Available Abstract Background Constitutive activation of signal transducer and activator of transcription 3 (Stat3 signaling pathway plays an important role in several human cancers. Activation of Stat3 is dependent on the phosphorylation at the tyrosine residue 705 by upstream kinases and subsequent nuclear translocation after dimerization. It remains unclear whether oncogenic Stat3 signaling pathway is involved in the oncogenesis of bladder cancer. Results We found that elevated Stat3 phosphorylation in 19 of 100 (19% bladder cancer tissues as well as bladder cancer cell lines, WH, UMUC-3 and 253J. To explore whether Stat3 activation is associated with cell growth and survival of bladder cancer, we targeted the Stat3 signaling pathway in bladder cancer cells using an adenovirus-mediated dominant-negative Stat3 (Y705F and a small molecule compound, STA-21. Both prohibited cell growth and induction of apoptosis in these bladder cancer cell lines but not in normal bladder smooth muscle cell (BdSMC. The survival inhibition might be mediated through apoptotic caspase 3, 8 and 9 pathways. Moreover, down-regulation of anti-apoptotic genes (Bcl-2, Bcl-xL and survivin and a cell cycle regulating gene (cyclin D1 was associated with the cell growth inhibition and apoptosis. Conclusion These results indicated that activation of Stat3 is crucial for bladder cancer cell growth and survival. Therefore, interference of Stat3 signaling pathway emerges as a potential therapeutic approach for bladder cancer.
Directory of Open Access Journals (Sweden)
Ye Cheng
Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.
The role of BCL-2 and glutathione in an antioxidant pathway to prevent radiation-induced apoptosis
International Nuclear Information System (INIS)
Vlachaki, Maria T.; Meyn, Raymond E.
1997-01-01
Objective: The expression of the bcl-2 gene has been associated with resistance to radiation induced apoptosis. There is evidence that the bcl-2 protein acts in the antioxidant pathways to block the effects of reactive oxygen spieces that mediate apoptosis possibly by increasing the levels of intracellular glutathione. Our hypothesis is that pretreatment of radiation-sensitive cells, known to lack bcl-2 expression, with antioxidants will reduce radiation-induced apoptosis. For this purpose, the apoptotic response to radiation and the intracellular levels of glutathione were tested before and after pretreatment with antioxidants in two murine lymphoma cell lines, a radiation resistant-bcl-2 expressing (Ly-ar) line and a radiation sensitive (Ly-as) line. Methods and Materials: Ly-ar and Ly-as cells were irradiated at 0,1,2,3 and 4 hours before collection. The intracellular levels of reduced (GSH) and oxidized (GSSG) glutathione were determined by the use of the fluorescent dye ophthalaldehyde. Ly-as cells were pretreated with dihydrolipoic acid and lipoamide for 1 hour before irradiation. Apoptosis response was measured by the DNA fragmentation assay. The radiation dose was 2.5 Gy. Results: After irradiation, the apoptotic rate of Ly-ar and Ly-as cells is 11-19% and 66-87% respectively. Ly-ar cells have higher intracellular GSH and GSSG levels compared to Ly-as cells by 69.9% and 91.9% respectively and the GSH/GSSG ratio in Ly-ar and Ly-as cells is 17.09 and 15.09 respectively (a difference of 13.25%). GSH levels do not change during the first three hours after irradiation; however there is a 46% reduction at four hours after irradiation, a time at which the Ly-as cells have already fragmented their DNA. Pretreatment of cells with dihydrolipoic acid or lipoamide at concentrations of 4mM and 2mM respectively was toxic and resulted in cell death in the absence of irradiation. Conclusions: GSH and GSSG levels are elevated in radiation-resistant murine lymphoma cells
Shishkina, Galina T; Kalinina, Tatyana S; Bulygina, Veta V; Lanshakov, Dmitry A; Babluk, Ekaterina V; Dygalo, Nikolay N
2015-01-01
Anti-apoptotic proteins are suggested to be important for the normal health of neurons and synapses as well as for resilience to stress. In order to determine whether stressful events may influence the expression of anti-apoptotic protein Bcl-xL in the midbrain and specifically in the midbrain serotonergic (5-HT) neurons involved in neurobehavioral responses to adverse stimuli, adult male rats were subjected to short-term or chronic forced swim stress. A short-term stress rapidly increased the midbrain bcl-xl mRNA levels and significantly elevated Bcl-xL immunoreactivity in the midbrain 5-HT cells. Stress-induced increase in glucocorticoid secretion was implicated in the observed effect. The levels of bcl-xl mRNA were decreased after stress when glucocorticoid elevation was inhibited by metyrapone (MET, 150 mg/kg), and this decrease was attenuated by glucocorticoid replacement with dexamethasone (DEX; 0.2 mg/kg). Both short-term stress and acute DEX administration, in parallel with Bcl-xL, caused a significant increase in tph2 mRNA levels and slightly enhanced tryptophan hydroxylase immunoreactivity in the midbrain. The increasing effect on the bcl-xl expression was specific to the short-term stress. Forced swim repeated daily for 2 weeks led to a decrease in bcl-xl mRNA in the midbrain without any effects on the Bcl-xL protein expression in the 5-HT neurons. In chronically stressed animals, an increase in tph2 gene expression was not associated with any changes in tryptophan hydroxylase protein levels. Our findings are the first to demonstrate that both short-term stress and acute glucocorticoid exposures induce Bcl-xL protein expression in the midbrain 5-HT neurons concomitantly with the activation of the 5-HT synthesis pathway in these neurons.
Directory of Open Access Journals (Sweden)
Galina T Shishkina
Full Text Available Anti-apoptotic proteins are suggested to be important for the normal health of neurons and synapses as well as for resilience to stress. In order to determine whether stressful events may influence the expression of anti-apoptotic protein Bcl-xL in the midbrain and specifically in the midbrain serotonergic (5-HT neurons involved in neurobehavioral responses to adverse stimuli, adult male rats were subjected to short-term or chronic forced swim stress. A short-term stress rapidly increased the midbrain bcl-xl mRNA levels and significantly elevated Bcl-xL immunoreactivity in the midbrain 5-HT cells. Stress-induced increase in glucocorticoid secretion was implicated in the observed effect. The levels of bcl-xl mRNA were decreased after stress when glucocorticoid elevation was inhibited by metyrapone (MET, 150 mg/kg, and this decrease was attenuated by glucocorticoid replacement with dexamethasone (DEX; 0.2 mg/kg. Both short-term stress and acute DEX administration, in parallel with Bcl-xL, caused a significant increase in tph2 mRNA levels and slightly enhanced tryptophan hydroxylase immunoreactivity in the midbrain. The increasing effect on the bcl-xl expression was specific to the short-term stress. Forced swim repeated daily for 2 weeks led to a decrease in bcl-xl mRNA in the midbrain without any effects on the Bcl-xL protein expression in the 5-HT neurons. In chronically stressed animals, an increase in tph2 gene expression was not associated with any changes in tryptophan hydroxylase protein levels. Our findings are the first to demonstrate that both short-term stress and acute glucocorticoid exposures induce Bcl-xL protein expression in the midbrain 5-HT neurons concomitantly with the activation of the 5-HT synthesis pathway in these neurons.
Wang, Jiasheng; He, Gan; Yang, Qiang; Bai, Lian; Jian, Bin; Li, Qugang; Li, Zhongfu
2018-06-01
The development of biomarkers that accurately and reliably detect colorectal cancer is a promising approach for colorectal cancer screening. Therefore, the objective of the present study was to evaluate the protein expression of α-methylacyl-CoA racemase (P504S/AMACR), tumor protein p53 (p53), B-cell lymphoma 2 (Bcl-2) and Ki-67/mindbomb E3 ubiquitin protein ligase 1 (MIB-1) in a population of Chinese patients with colorectal carcinoma. Colorectal tumors with matched normal tissue margins were collected from 148 surgical patients, and the demographic and clinical characteristics were collected. Immunohistochemical staining and western blot analysis of P504S/AMACR, p53, Bcl-2 and Ki-67/MIB-1 were conducted. Statistical analyses were used to compare protein expression in the colorectal tumors and matched normal tissue margins and to identify any associations between them and various clinicopathological parameters. Survival analyses were performed using the Kaplan-Meier method. In the present study, immunohistochemistry and western blot analysis revealed significantly higher expression of all four proteins in colorectal tumors compared with matched normal tissue margins (Pcolorectal carcinoma [relative risk (95% CI), 0.703 (0.552-0.895); P55 years) and reduced overall survival (Pcolorectal carcinoma. In conclusion, low expression of Bcl-2 is significantly correlated with advanced pathological grade and TNM stage and is a prognostic indicator of reduced overall survival in young Chinese patients with colorectal carcinoma.
Energy Technology Data Exchange (ETDEWEB)
Phadnis-Moghe, Ashwini S.; Li, Jinpeng [Genetics Program, Michigan State University, East Lansing, MI 48824 (United States); Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Crawford, Robert B. [Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Kaminski, Norbert E., E-mail: kamins11@msu.edu [Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI 48824 (United States)
2016-11-01
The environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which is a strong AHR agonist, causes significant suppression of human B cell activation and differentiation. The current studies describe the identification of Src homology phosphatase 1 (SHP-1) encoded by the gene PTPN6 as a putative regulator of TCDD-mediated suppression of B cell activation. Shp-1 was initially identified through a genome-wide analysis of AHR binding in mouse B cells in the presence of TCDD. The binding of AHR to the PTPN6 promoter was further confirmed using electrophoretic mobility shift assays in which, specific binding of AHR was detected at four putative DRE sites within PTPN6 promoter. Time-course measurements performed in human B cells highlighted a significant increase in SHP-1 mRNA and protein levels in the presence of TCDD. The changes in the protein levels of SHP-1 were also observed in a TCDD concentration-dependent manner. The increase in SHP-1 levels was also seen to occur due to a change in early signaling events in the presence of TCDD. We have shown that BCL-6 regulates B cell activation by repressing activation marker CD80 in the presence of TCDD. TCDD-treatment led to a significant increase in the double positive (SHP-1{sup hi} BCL-6{sup hi}) population. Interestingly, treatment of naïve human B cells with SHP-1 inhibitor decreased BCL-6 protein levels suggesting possible regulation of BCL-6 by SHP-1 for the first time. Collectively, these results suggest that SHP-1 is regulated by AHR in the presence of TCDD and may, in part through BCL-6, regulate TCDD-mediated suppression of human B cell activation. - Highlights: • SHP-1 encoded by the gene PTPN6 is directly activated by the AHR. • AHR binds to dioxin response elements within the SHP-1 promoter in a TCDD-inducible manner. • TCDD-mediated increase in SHP-1 levels is observed in primary human B cells. • Higher SHP-1 levels help in maintaining high BCL-6 levels in the presence of TCDD. • In
Directory of Open Access Journals (Sweden)
Yannis Guillemin
Full Text Available BACKGROUND: The BCL-2 family of proteins includes pro- and antiapoptotic members acting by controlling the permeabilization of mitochondria. Although the association of these proteins with the outer mitochondrial membrane is crucial for their function, little is known about the characteristics of this interaction. METHODOLOGY/PRINCIPAL FINDINGS: Here, we followed a reductionist approach to clarify to what extent membrane-active regions of homologous BCL-2 family proteins contribute to their functional divergence. Using isolated mitochondria as well as model lipid Langmuir monolayers coupled with Brewster Angle Microscopy, we explored systematically and comparatively the membrane activity and membrane-peptide interactions of fragments derived from the central helical hairpin of BAX, BCL-xL and BID. The results show a connection between the differing abilities of the assayed peptide fragments to contact, insert, destabilize and porate membranes and the activity of their cognate proteins in programmed cell death. CONCLUSION/SIGNIFICANCE: BCL-2 family-derived pore-forming helices thus represent structurally analogous, but functionally dissimilar membrane domains.
Giordano, Roberta; Marzotti, Stefania; Berardelli, Rita; Karamouzis, Ioannis; Brozzetti, Annalisa; D'Angelo, Valentina; Mengozzi, Giulio; Mandrile, Giorgia; Giachino, Daniela; Migliaretti, Giuseppe; Bini, Vittorio; Falorni, Alberto; Ghigo, Ezio; Arvat, Emanuela
2012-12-01
Although glucocorticoids are essential for health, several studies have shown that glucocorticoids replacement in Addison's disease might be involved in anthropometric and metabolic impairment, with increased cardiovascular risk, namely if conventional doses are used. As the effects of glucocorticoids are mediated by the glucocorticoid receptor, encoded by NR3C1 gene, different polymorphisms in the NR3C1 gene have been linked to altered glucocorticoid sensitivity in general population as well as in patients with obesity or metabolic syndrome. We investigated the impact of glucocorticoid receptor gene polymorphisms, including the BclI, N363S and ER22/23EK variants, on anthropometric parameters (BMI and waist circumference), metabolic profile (HOMA, OGTT and serum lipids) and ACTH levels in 50 patients with Addison's disease (34 women and 16 men, age 20-82 year) under glucocorticoids replacement. Neither N363S nor ER22/23EK variants were significantly associated with anthropometric, metabolic or hormonal parameters, while patients carrying the homozygous BclI polymorphism GG (n = 4) showed higher (P Addison's disease and may contribute, along with other factors, to the increase in central adiposity, impaired glucose metabolism and dyslipidaemia. © 2012 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Hamada, Nobuyuki; Kataoka, Keiko; Sora, Sakura; Hara, Takamitsu; Omura-Minamisawa, Motoko; Funayama, Tomoo; Sakashita, Tetsuya; Nakano, Takashi; Kobayashi, Yasuhiko
2008-01-01
This is the first study to demonstrate that the small-molecule Bcl-2 inhibitor HA14-1 renders human cervical cancer cells and their Bcl-2 overexpressing radioresistant counterparts, but not normal fibroblasts, more susceptible to heavy ions. Thus, Bcl-2 may be an attractive target for improving the efficacy of heavy-ion therapy
International Nuclear Information System (INIS)
Wang, Feng; Shi, Yongli; Yadav, Santosh; Wang, He
2010-01-01
Arsenic is a well-recognized human carcinogen that causes a number of malignant diseases, including lung cancer. Previous studies have indicated that cyclin D1 is frequently over-expressed in many cancer types. It is also known that arsenite exposure enhances cyclin D1 expression, which involves NF-κB activation. However, the mechanism between cyclin D1 and the NF-κB pathway has not been well studied. This study was designed to characterize the underlying mechanism of induced cell growth and cyclin D1 expression in response to low concentration sodium arsenic (NaAsO 2 ) exposure through the NF-κB pathway. Cultured human bronchial epithelial cells, BEAS-2B, were exposed to low concentration sodium arsenite for the indicated durations, and cytotoxicity, gene expression, and protein activity were assessed. To profile the canonical and non-canonical NF-κB pathways involved in cell growth and cyclin D1 expression induced by low concentration arsenite, the NF-κB-specific inhibitor-phenethyl caffeate (CAPE) and NF-κB2 mRNA target sequences were used, and cyclin D1 expression in BEAS-2B cells was assessed. Our results demonstrated that exposure to low concentration arsenite enhanced BEAS-2B cells growth and cyclin D1 mRNA and protein expression. Activation and nuclear localization of p52 and Bcl3 in response to low concentration arsenite indicated that the non-canonical NF-κB pathway was involved in arsenite-induced cyclin D1 expression. Moreover, we further demonstrated that p52/Bcl3 complex formation enhanced cyclin D1 expression through the cyclin D1 gene promoter via its κB site. The up-regulation of cyclin D1 mediated by the p52-Bcl3 complex in response to low concentration arsenite might be important in assessing the health risk of low concentration arsenite and understanding the mechanisms of the harmful effects of arsenite.
Cadet, J L; Ordonez, S V; Ordonez, J V
1997-02-01
Methamphetamine (METH) is an amphetamine analog that produces degeneration of the dopaminergic system in mammals. The neurotoxic effects of the drug are thought to be mediated by oxygen-based free radicals. In the present report, we have used immortalized neural cells obtained from rat mesencephalon in order to further assess the role of oxidative stress in METH-induced neurotoxicity. We thus tested if the anti-death proto-oncogene, bcl-2 could protect against METH-induced cytotoxicity. METH caused dose-dependent loss of cellular viability in control cells while bcl-2-expressing cells were protected against these deleterious effects. Using flow cytometry, immunofluorescent staining, and DNA electrophoresis, we also show that METH exposure can cause DNA strand breaks, chromatin condensation, nuclear fragmentation, and DNA laddering. All these changes were prevented by bcl-2 expression. These observations provide further support for the involvement of oxidative stress in the toxic effects of amphetamine analogs. They also document that METH-induced cytotoxicity is secondary to apoptosis. These findings may be of relevance to the cause(s) of Parkinson's disease which involves degeneration of the nigrostriatal dopaminergic pathway.
Optical Properties of Some A2BCl4 Type Chlorides
D. H. Gahane; B. M. Bahirwar; S. V. Moharil
2013-01-01
Efficient luminescence is reported for the first time in Eu2+ activated double Chlorides A2BCl4 (A=Alkali metal, B=Alkaline earth element). A simple wet-chemical preparation is described. Emission intensities are comparable to that of the commercial phosphor. Excitation covers near UV region. These phosphors may be useful for applications like solid state lighting, scintillation detectors and X-ray storage using photo-stimulable phosphors.
Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs
Directory of Open Access Journals (Sweden)
Stevenson Christopher S
2010-02-01
Full Text Available Abstract Background Vascular endothelial growth factor (VEGF and VEGF receptor 2 (VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression. Previously, we have shown that CS down-regulated the VEGFR2 and its downstream signaling in mouse lungs. However, the VEGFR2-mediated survival signaling in response to oxidants/cigarette smoke (CS is not known. We hypothesized that CS exposure leads to disruption of VEGFR2-mediated endothelial survival signaling in rat lungs. Methods Adult male Sprague-Dawley rats were exposed CS for 3 days, 8 weeks and 6 months to investigate the effect of CS on VEGFR2-mediated survival signaling by measuring the Akt/PI3-kinase/eNOS downstream signaling in rat lungs. Results and Discussion We show that CS disrupts VEGFR2/PI3-kinase association leading to decreased Akt and eNOS phosphorylation. This may further alter the phosphorylation of the pro-apoptotic protein Bad and increase the Bad/Bcl-xl association. However, this was not associated with a significant lung cell death as evidenced by active caspase-3 levels. These data suggest that although CS altered the VEGFR2-mediated survival signaling in the rat lungs, but it was not sufficient to cause lung cell death. Conclusion The rat lungs exposed to CS in acute, sub-chronic and chronic levels may be representative of smokers where survival signaling is altered but was not associated with lung cell death whereas emphysema is known to be associated with lung cell apoptosis.
Karpel-Massler, Georg; Bâ, Maïmouna; Shu, Chang; Halatsch, Marc-Eric; Westhoff, Mike-Andrew; Bruce, Jeffrey N; Canoll, Peter; Siegelin, Markus D
2015-11-03
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma and likely accounts for its recurrence and resistance to treatment. Glioblastomas harbor a plethora of deregulated pathways driving tumor formation and growth. In this study, we show that TIC10/ONC201, a promising compound that is currently in planned clinical development, along with Bcl-2/Bcl-xL inhibition by ABT263 yields a strong synergistic antiproliferative effect on pediatric, adult, proneural glioblastoma and glioma stem-like cells. On the molecular level, treatment with TIC10/ONC201 results in a posttranslational decrease of the anti-apoptotic Bcl-2 family member, myeloid cell leukemia 1 (Mcl-1), through modulation of the chaperone Bag3 and the deubiquitinase Usp9X. Consistently, the combination treatment of TIC10/ONC201 and ABT263 required the presence of functional BAX and BAK to drive intrinsic apoptosis, but is surprisingly independent of the extrinsic apoptotic pathway. Moreover, the expression of Noxa protein was required for efficient apoptosis induction by TIC10/ONC201 and ABT263. Importantly, the drug combination of TIC10/ONC201 and the BH3-mimetic, ABT263, led to a regression of tumors in vivo, without any notable toxicity and side effects. Overall, TIC10/ONC201 along with Bcl-2/Bcl-xL inhibition holds significant promise as a novel potential approach for the treatment of recalcitrant tumors such as glioblastoma.
Boron neutron capture therapy induces apoptosis of glioma cells through Bcl-2/Bax
International Nuclear Information System (INIS)
Wang, Peng; Zhen, Haining; Jiang, Xinbiao; Zhang, Wei; Cheng, Xin; Guo, Geng; Mao, Xinggang; Zhang, Xiang
2010-01-01
Boron neutron capture therapy (BNCT) is an alternative treatment modality for patients with glioma. The aim of this study was to determine whether induction of apoptosis contributes to the main therapeutic efficacy of BNCT and to compare the relative biological effect (RBE) of BNCT, γ-ray and reactor neutron irradiation. The neutron beam was obtained from the Xi'an Pulsed Reactor (XAPR) and γ-rays were obtained from [ 60 Co] γ source of the Fourth Military Medical University (FMMU) in China. Human glioma cells (the U87, U251, and SHG44 cell lines) were irradiated by neutron beams at the XAPR or [ 60 Co] γ-rays at the FMMU with different protocols: Group A included control nonirradiated cells; Group B included cells treated with 4 Gy of [ 60 Co] γ-rays; Group C included cells treated with 8 Gy of [ 60 Co] γ-rays; Group D included cells treated with 4 Gy BPA (p-borono-phenylalanine)-BNCT; Group E included cells treated with 8 Gy BPA-BNCT; Group F included cells irradiated in the reactor for the same treatment period as used for Group D; Group G included cells irradiated in the reactor for the same treatment period as used for Group E; Group H included cells irradiated with 4 Gy in the reactor; and Group I included cells irradiated with 8 Gy in the reactor. Cell survival was determined using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium (MTT) cytotoxicity assay. The morphology of cells was detected by Hoechst33342 staining and transmission electron microscope (TEM). The apoptosis rate was detected by flow cytometer (FCM). The level of Bcl-2 and Bax protein was measured by western blot analysis. Proliferation of U87, U251, and SHG44 cells was much more strongly inhibited by BPA-BNCT than by irradiation with [ 60 Co] γ-rays (P < 0.01). Nuclear condensation was determined using both a fluorescence technique and electron microscopy in all cell lines treated with BPA-BNCT. Furthermore, the cellular apoptotic rates in Group D and Group E treated with
Onco-miR-24 regulates cell growth and apoptosis by targeting BCL2L11 in gastric cancer
Directory of Open Access Journals (Sweden)
Haiyang Zhang
2016-01-01
Full Text Available ABSTRACT Gastric cancer is one of the most common malignancies worldwide; however, the molecular mechanism in tumorigenesis still needs exploration. BCL2L11 belongs to the BCL-2 family, and acts as a central regulator of the intrinsic apoptotic cascade and mediates cell apoptosis. Although miRNAs have been reported to be involved in each stage of cancer development, the role of miR-24 in GC has not been reported yet. In the present study, miR-24 was found to be up-regulated while the expression of BCL2L11 was inhibited in tumor tissues of GC. Studies from both in vitro and in vivo shown that miR-24 regulates BCL2L11 expression by directly binding with 3′UTR of mRNA, thus promoting cell growth, migration while inhibiting cell apoptosis. Therefore, miR-24 is a novel onco-miRNA that can be potential drug targets for future clinical use.
Shinoda, K; Nakamura, Y; Matsushita, K; Shimoda, K; Okita, H; Fukuma, M; Yamada, T; Ohde, H; Oguchi, Y; Hata, J; Umezawa, A
2001-10-01
EAT/mcl-1 (EAT), an immediate early gene, functions in a similar way to bcl-2 in neutralising Bax mediated cytotoxicity, suggesting that EAT is a blocker of cell death. The aim of this study was to determine the effect of overexpression of the human EAT gene on light induced retinal cell apoptosis. EAT transgenic mice incorporating the EF-1alpha promoter were utilised, and expression of human EAT was detected by RT-PCR. Light damage was induced by raising mice under constant illumination. Two groups of animals, EAT transgenic mice (n=14) and littermates (n=13), were examined by ERG testing and histopathology at regular time points up to 20 weeks of constant light stimulation. Electrophysiological and histopathological findings were evaluated by established systems of arbitrary scoring as scores 0-2 and scores 0-3, respectively. The mean score (SD) of ERG response was significantly lower in EAT transgenic mice (0.79 (0.89)) than in littermates (1.69 (0.48)) (pstatistical significance (p=0.1156), the estimated incidence of electrophysiological retinal damage was higher in EAT mice (0.0495/mouse/week; 95% confidence interval (CI) 0.0347-0.0500) than in littermates (0. 0199/mouse/week; 95% CI 0.0035-0.0364). The mean scores (SD) for histopathological retinal degeneration were 2.31 (0.63) in littermates and 1.43 (1.22) in EAT transgenic mice (p=0.065). However, Kaplan-Meier curves for histopathological failure in two groups of mice showed that retinal photoreceptor cells were preserved significantly against constant light in the littermate compared with transgenic mice (p=0.0241). The estimated incidence of histopathological retinal damage was 0.0042/mouse/week in the littermates (95% CI 0-0.0120) and 0.0419/mouse/week in the EAT mice (95% CI 0.0286-0.0500). Retinal photoreceptor cell apoptosis under constant light stimulation is likely to be accelerated in transgenic retina overexpressing EAT.
A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO
Gu, Yingchun; Lin, Dayong; Tang, Yalin; Fei, Xuening; Wang, Cuihong; Zhang, Baolian; Zhou, Jianguo
2018-02-01
As its significant role, the selective recognition of G-quadruplex with specific structures and functions is important in biological and medicinal chemistry. Carbazole derivatives have been reported as a kind of fluorescent probe with many excellent optical properties. In the present study, the fluorescence of the dye (carbazole TO) increased almost 70 fold in the presence of bcl-2 2345 G4 compared to that alone in aqueous buffer condition with almost no fluorescence and 10-30 fold than those in the presence of other DNAs. The binding study results by activity inhibition of G4/Hemin peroxidase experiment, NMR titration and molecular docking simulation showed the high affinity and selectivity to bcl-2 2345 G4 arises from its end-stacking interaction with G-quartet. It is said that a facile approach with excellent sensitive, good selectivity and quick response for bcl-2 2345 G-quadruplex was developed and may be used for antitumor recognition or antitumor agents.
Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma.
Van Goethem, Alan; Yigit, Nurten; Moreno-Smith, Myrthala; Vasudevan, Sanjeev A; Barbieri, Eveline; Speleman, Frank; Shohet, Jason; Vandesompele, Jo; Van Maerken, Tom
2017-08-22
Wild-type p53 tumor suppressor activity in neuroblastoma tumors is hampered by increased MDM2 activity, making selective MDM2 antagonists an attractive therapeutic strategy for this childhood malignancy. Since monotherapy in cancer is generally not providing long-lasting clinical responses, we here aimed to identify small molecule drugs that synergize with idasanutlin (RG7388). To this purpose we evaluated 15 targeted drugs in combination with idasanutlin in three p53 wild type neuroblastoma cell lines and identified the BCL2 inhibitor venetoclax (ABT-199) as a promising interaction partner. The venetoclax/idasanutlin combination was consistently found to be highly synergistic in a diverse panel of neuroblastoma cell lines, including cells with high MCL1 expression levels. A more pronounced induction of apoptosis was found to underlie the synergistic interaction, as evidenced by caspase-3/7 and cleaved PARP measurements. Mice carrying orthotopic xenografts of neuroblastoma cells treated with both idasanutlin and venetoclax had drastically lower tumor weights than mice treated with either treatment alone. In conclusion, these data strongly support the further evaluation of dual BCL2/MDM2 targeting as a therapeutic strategy in neuroblastoma.
Matsui, Miyako; Kuwahara, Kenichi
2018-06-01
A cyclic process for highly selective SiO2 etching with atomic-scale precision over Si3N4 was developed by using BCl3 and fluorocarbon gas chemistries. This process consists of two alternately performed steps: a deposition step using BCl3 mixed-gas plasma and an etching step using CF4/Ar mixed-gas plasma. The mechanism of the cyclic process was investigated by analyzing the surface chemistry at each step. BCl x layers formed on both SiO2 and Si3N4 surfaces in the deposition step. Early in the etching step, the deposited BCl x layers reacted with CF x radicals by forming CCl x and BF x . Then, fluorocarbon films were deposited on both surfaces in the etching step. We found that the BCl x layers formed in the deposition step enhanced the formation of the fluorocarbon films in the CF4 plasma etching step. In addition, because F radicals that radiated from the CF4 plasma reacted with B atoms while passing through the BCl x layers, the BCl x layers protected the Si3N4 surface from F-radical etching. The deposited layers, which contained the BCl x , CCl x , and CF x components, became thinner on SiO2 than on Si3N4, which promoted the ion-assisted etching of SiO2. This is because the BCl x component had a high reactivity with SiO2, and the CF x component was consumed by the etching reaction with SiO2.
Ramalingam, R; Rafii, S; Worgall, S; Brough, D E; Crystal, R G
1999-05-01
Although endothelial cells are quiescent and long-lived in vivo, when they are removed from blood vessels and cultured in vitro they die within days to weeks. In studies of the interaction of E1(-)E4(+) replication-deficient adenovirus (Ad) vectors and human endothelium, the cells remained quiescent and were viable for prolonged periods. Evaluation of these cultures showed that E1(-)E4(+) Ad vectors provide an "antiapoptotic" signal that, in association with an increase in the ratio of Bcl2 to Bax levels, induces the endothelial cells to enter a state of "suspended animation," remaining viable for at least 30 days, even in the absence of serum and growth factors. Although the mechanisms initiating these events are unclear, the antiapoptoic signal requires the presence of E4 genes in the vector genome, suggesting that one or more E4 open reading frames of subgroup C Ad initiate a "pro-life" program that modifies cultured endothelial cells to survive for prolonged periods.
Energy Technology Data Exchange (ETDEWEB)
Yan, Chunlan [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Department of Physiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058 (China); Oh, Joon Seok; Yoo, Seung Hee; Lee, Jee Suk [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Yoon, Young Geol [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Department of Biomedical Science, Institute for Biomedical and Health Sciences, Jungwon University, Chungbuk, 367-805 (Korea, Republic of); Oh, Yoo Jin; Jang, Min Seok [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Lee, Sang Yeob [Department of Rheumatology, Dong-A University College of Medicine, Busan, 602-714 (Korea, Republic of); Yang, Jun [Department of Toxicology, Hangzhou Normal University School of Public Health, Hangzhou, Zhejiang, 310036 China (China); Lee, Sang Hwa [Department of Microbiology and, Dong-A University College of Medicine, Busan, 602-714 (Korea, Republic of); Kim, Hye Young [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of); Yoo, Young Hyun, E-mail: yhyoo@dau.ac.kr [Department of Anatomy and Cell Biology, Dong-A University College of Medicine and Mitochondria Hub Regulation Center, Busan, 602-714 (Korea, Republic of)
2013-01-01
Previous studies have reported that a Gamitrinib variant containing triphenylphosphonium (G-TPP) binds to mitochondrial Hsp90 and rapidly inhibits its activity, thus inducing the apoptotic pathway in the cells. Accordingly, G-TPP shows a potential as a promising drug for the treatment of cancer. A cell can die from different types of cell death such as apoptosis, necrosis, necroptosis, and autophagic cell death. In this study, we further investigated the mechanisms and modes of cell death in the G-TPP-treated Hep3B and U937 cell lines. We discovered that G-TPP kills the U937 cells through the apoptotic pathway and the overexpression of Bcl-2 significantly inhibits U937 cell death to G-TPP. We further discovered that G-TPP kills the Hep3B cells by activating necroptosis in combination with the partial activation of caspase-dependent apoptosis. Importantly, G-TPP overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. We also observed that G-TPP induces compensatory autophagy in the Hep3B cell line. We further found that whereas there is a Bcl-2-Beclin 1 interaction in response to G-TPP, silencing the beclin 1 gene failed to block LC3-II accumulation in the Hep3B cells, indicating that G-TPP triggers Beclin 1-independent protective autophagy in Hep3B cells. Taken together, these data reveal that G-TPP induces cell death through a combination of death pathways, including necroptosis and apoptosis, and overcomes the apoptosis resistance conferred by Bcl-2 in Hep3B cells via necroptosis. These findings are important for the therapeutic exploitation of necroptosis as an alternative cell death program to bypass the resistance to apoptosis. Highlights: ► G-TPP binds to mitochondrial Hsp90. ► G-TPP induces apoptosis in U937 human leukemia cancer cells. ► G-TPP induces combination of death pathways in Hep3B cell. ► G-TPP overcomes the resistance conferred by Bcl-2 in Hep3B cells via necroptosis. ► G-TPP triggers Beclin 1-independent
Directory of Open Access Journals (Sweden)
Southey Bruce R
2011-06-01
Full Text Available Abstract Background Glioblastoma is a complex multifactorial disorder that has swift and devastating consequences. Few genes have been consistently identified as prognostic biomarkers of glioblastoma survival. The goal of this study was to identify general and clinical-dependent biomarker genes and biological processes of three complementary events: lifetime, overall and progression-free glioblastoma survival. Methods A novel analytical strategy was developed to identify general associations between the biomarkers and glioblastoma, and associations that depend on cohort groups, such as race, gender, and therapy. Gene network inference, cross-validation and functional analyses further supported the identified biomarkers. Results A total of 61, 47 and 60 gene expression profiles were significantly associated with lifetime, overall, and progression-free survival, respectively. The vast majority of these genes have been previously reported to be associated with glioblastoma (35, 24, and 35 genes, respectively or with other cancers (10, 19, and 15 genes, respectively and the rest (16, 4, and 10 genes, respectively are novel associations. Pik3r1, E2f3, Akr1c3, Csf1, Jag2, Plcg1, Rpl37a, Sod2, Topors, Hras, Mdm2, Camk2g, Fstl1, Il13ra1, Mtap and Tp53 were associated with multiple survival events. Most genes (from 90 to 96% were associated with survival in a general or cohort-independent manner and thus the same trend is observed across all clinical levels studied. The most extreme associations between profiles and survival were observed for Syne1, Pdcd4, Ighg1, Tgfa, Pla2g7, and Paics. Several genes were found to have a cohort-dependent association with survival and these associations are the basis for individualized prognostic and gene-based therapies. C2, Egfr, Prkcb, Igf2bp3, and Gdf10 had gender-dependent associations; Sox10, Rps20, Rab31, and Vav3 had race-dependent associations; Chi3l1, Prkcb, Polr2d, and Apool had therapy-dependent associations
Joo, Min Cheol; Jang, Chul Hwan; Park, Jong Tae; Choi, Seung Won; Ro, Seungil; Kim, Min Seob; Lee, Moon Young
2018-02-01
Although electrical stimulation is therapeutically applied for neural regeneration in patients, it remains unclear how electrical stimulation exerts its effects at the molecular level on spinal cord injury (SCI). To identify the signaling pathway involved in electrical stimulation improving the function of injured spinal cord, 21 female Sprague-Dawley rats were randomly assigned to three groups: control (no surgical intervention, n = 6), SCI (SCI only, n = 5), and electrical simulation (ES; SCI induction followed by ES treatment, n = 10). A complete spinal cord transection was performed at the 10 th thoracic level. Electrical stimulation of the injured spinal cord region was applied for 4 hours per day for 7 days. On days 2 and 7 post SCI, the Touch-Test Sensory Evaluators and the Basso-Beattie-Bresnahan locomotor scale were used to evaluate rat sensory and motor function. Somatosensory-evoked potentials of the tibial nerve of a hind paw of the rat were measured to evaluate the electrophysiological function of injured spinal cord. Western blot analysis was performed to measure p38-RhoA and ERK1/2-Bcl-2 pathways related protein levels in the injured spinal cord. Rat sensory and motor functions were similar between SCI and ES groups. Compared with the SCI group, in the ES group, the latencies of the somatosensory-evoked potential of the tibial nerve of rats were significantly shortened, the amplitudes were significantly increased, RhoA protein level was significantly decreased, protein gene product 9.5 expression, ERK1/2, p38, and Bcl-2 protein levels in the spinal cord were significantly increased. These data suggest that ES can promote the recovery of electrophysiological function of the injured spinal cord through regulating p38-RhoA and ERK1/2-Bcl-2 pathway-related protein levels in the injured spinal cord.
Joo, Min Cheol; Jang, Chul Hwan; Park, Jong Tae; Choi, Seung Won; Ro, Seungil; Kim, Min Seob; Lee, Moon Young
2018-01-01
Although electrical stimulation is therapeutically applied for neural regeneration in patients, it remains unclear how electrical stimulation exerts its effects at the molecular level on spinal cord injury (SCI). To identify the signaling pathway involved in electrical stimulation improving the function of injured spinal cord, 21 female Sprague-Dawley rats were randomly assigned to three groups: control (no surgical intervention, n = 6), SCI (SCI only, n = 5), and electrical simulation (ES; SCI induction followed by ES treatment, n = 10). A complete spinal cord transection was performed at the 10th thoracic level. Electrical stimulation of the injured spinal cord region was applied for 4 hours per day for 7 days. On days 2 and 7 post SCI, the Touch-Test Sensory Evaluators and the Basso-Beattie-Bresnahan locomotor scale were used to evaluate rat sensory and motor function. Somatosensory-evoked potentials of the tibial nerve of a hind paw of the rat were measured to evaluate the electrophysiological function of injured spinal cord. Western blot analysis was performed to measure p38-RhoA and ERK1/2-Bcl-2 pathways related protein levels in the injured spinal cord. Rat sensory and motor functions were similar between SCI and ES groups. Compared with the SCI group, in the ES group, the latencies of the somatosensory-evoked potential of the tibial nerve of rats were significantly shortened, the amplitudes were significantly increased, RhoA protein level was significantly decreased, protein gene product 9.5 expression, ERK1/2, p38, and Bcl-2 protein levels in the spinal cord were significantly increased. These data suggest that ES can promote the recovery of electrophysiological function of the injured spinal cord through regulating p38-RhoA and ERK1/2-Bcl-2 pathway-related protein levels in the injured spinal cord. PMID:29557386
International Nuclear Information System (INIS)
Wei, Jun; Stebbins, John L.; Kitada, Shinichi; Dash, Rupesh; Zhai, Dayong; Placzek, William J.; Wu, Bainan; Rega, Michele F.; Zhang, Ziming; Barile, Elisa; Yang, Li; Dahl, Russell; Fisher, Paul B.; Reed, John C.; Pellecchia, Maurizio
2011-01-01
Our focus in the past several years has been on the identification of novel and effective pan-Bcl-2 antagonists. We have recently reported a series of Apogossypolone (ApoG2) derivatives, resulting in the chiral compound (±) BI97D6. We report here the synthesis and evaluation on its optically pure (−) and (+) atropisomers. Compound (−) BI97D6 potently inhibits the binding of BH3 peptides to Bcl-X L , Bcl-2, Mcl-1, and Bfl-1 with IC 50 values of 76 ± 5, 31 ± 2, 25 ± 8, and 122 ± 28 nM, respectively. In a cellular assay, compound (−) BI97D6 effectively inhibits cell growth in the PC-3 human prostate cancer and H23 human lung cancer cell lines with EC 50 values of 0.22 ± 0.08 and 0.14 ± 0.02 μM, respectively. Similarly, compound (−) BI97D6 effectively induces apoptosis in the BP3 human lymphoma cell line in a dose-dependent manner. The compound also shows little cytotoxicity against bax −/− /bak −/− cells, suggesting that it kills cancers cells predominantly via a Bcl-2 pathway. Moreover, compound (−) BI97D6 displays in vivo efficacy in both a Bcl-2-transgenic mouse model and in a prostate cancer xenograft model in mice. Therefore, compound (−) BI97D6 represents a promising drug lead for the development of novel apoptosis-based therapies for cancer.
Directory of Open Access Journals (Sweden)
Marcus Wallgren
Full Text Available The anti-apoptotic B-cell CLL/lymphoma-2 (Bcl-2 protein and its counterpart, the pro-apoptotic Bcl-2-associated X protein (Bax, are key players in the regulation of the mitochondrial pathway of apoptosis. However, how they interact at the mitochondrial outer membrane (MOM and there determine whether the cell will live or be sentenced to death remains unknown. Competing models have been presented that describe how Bcl-2 inhibits the cell-killing activity of Bax, which is common in treatment-resistant tumors where Bcl-2 is overexpressed. Some studies suggest that Bcl-2 binds directly to and sequesters Bax, while others suggest an indirect process whereby Bcl-2 blocks BH3-only proteins and prevents them from activating Bax. Here we present the results of a biophysical study in which we investigated the putative interaction of solubilized full-length human Bcl-2 with Bax and the scope for incorporating the former into a native-like lipid environment. Far-UV circular dichroism (CD spectroscopy was used to detect direct Bcl-2-Bax-interactions in the presence of polyoxyethylene-(23-lauryl-ether (Brij-35 detergent at a level below its critical micelle concentration (CMC. Additional surface plasmon resonance (SPR measurements confirmed this observation and revealed a high affinity between the Bax and Bcl-2 proteins. Upon formation of this protein-protein complex, Bax also prevented the binding of antimycin A2 (a known inhibitory ligand of Bcl-2 to the Bcl-2 protein, as fluorescence spectroscopy experiments showed. In addition, Bcl-2 was able to form mixed micelles with Triton X-100 solubilized neutral phospholipids in the presence of high concentrations of Brij-35 (above its CMC. Following detergent removal, the integral membrane protein was found to have been fully reconstituted into a native-like membrane environment, as confirmed by ultracentrifugation and subsequent SDS-PAGE experiments.
Wride, M A; Parker, E; Sanders, E J
1999-09-01
The optical clarity of the lens is ensured by the programmed removal of nuclei and other organelles from the lens fibre cells during development. The morphology of the degenerating nuclei is similar to that observed during apoptosis and is accompanied by DNA fragmentation. Proteins encoded by the bcl-2 proto-oncogene family are important in either promoting or inhibiting apoptosis, and caspases are involved in downstream proteolytic events. Here, the expression of bcl-2 family members (bcl-2, bax, bad, and bcl-x(s/l)) and caspases-1, -2, -3, -4, and -6 was investigated through a range of stages of chick lens development using immunocytochemistry, Western blotting, and affinity labelling for caspases using biotinylated caspase inhibitors. Using differentiating lens epithelial cell cultures, it was demonstrated that the addition to cultures of synthetic peptide inhibitors of caspases -1, -2, -4, -6, and -9 brought about a 50-70% reduction in the number of degenerating nuclei per unit area of culture, as assessed by image analysis. These effects were comparable to those seen when general inhibitors of caspases were added to cultures. On the other hand, inhibitors of caspases-3 and -8 were not effective in significantly reducing the number of TUNEL-labelled nuclei. Expression of the caspase substrates poly(ADP-ribose) polymerase (PARP) and the 45-kDa subunit of DNA fragmentation factor (DFF 45) was also observed in the developing lens. Western blots of cultures to which caspase inhibitors were added revealed alterations in the PARP cleavage pattern, but not in that of DFF. These results demonstrate a role for members of the bcl-2 family and caspases in the degeneration of lens fibre cell nuclei during chick secondary lens fibre development and support the proposal that this process has many characteristics in common with apoptosis. Copyright 1999 Academic Press.
Franco, Renato; Camacho, Francisca I; Fernández-Vázquez, Amalia; Algara, Patrocinio; Rodríguez-Peralto, José L; De Rosa, Gaetano; Piris, Miguel A
2004-06-01
Our understanding of the ontology of B-cell lymphomas (BCL) has been improved by the study of mutational status of IgV(H) and bcl6 genes, but only a few cases of cutaneous BCL have been examined for this status. We analyzed IgV(H) and bcl6 somatic mutations in 10 cutaneous BCL, classified as follicular (three primary and one secondary), primary marginal zone (two cases), and diffuse large BCL (three primary and one secondary). We observed a lower rate (IgV(H) mutation in all marginal zone lymphomas, and a preferential usage of V(H)2-70 (one primary follicular and two primary diffuse large BCL). Fewer than expected replacement mutations in framework regions (FR) were observed in three primary follicular lymphomas (FLs) and in all diffuse large BCL, indicating a negative antigen selection pressure. Ongoing mutations were observed in eight of 10 cases. Only two primary FLs and two diffuse large BCL showed bcl6 somatic mutation. These data support the heterogeneous nature of the different cutaneous BCL, and specifically the distinction between cutaneous follicular and marginal zone lymphomas. The biased usage of V(H)2-70, the low rate of replacement mutation in the FR, and the presence of ongoing mutation imply that local antigens could modulate the growth of primary cutaneous BCL.
High rate dry etching of InGaZnO by BCl3/O2 plasma
Park, Wanjae; Whang, Ki-Woong; Gwang Yoon, Young; Hwan Kim, Jeong; Rha, Sang-Ho; Seong Hwang, Cheol
2011-08-01
This paper reports the results of the high-rate dry etching of indium gallium zinc oxide (IGZO) at room temperature using BCl3/O2 plasma. We achieved an etch rate of 250 nm/min. We inferred from the x-ray photoelectron spectroscopy analysis that BOx or BOClx radicals generated from BCl3/O2 plasma cause the etching of the IGZO material. O2 initiates the etching of IGZO, and Ar removes nonvolatile byproducts from the surface during the etching process. Consequently, a smooth etched surface results when these gases are added to the etch gas.
Ortholog-based screening and identification of genes related to intracellular survival.
Yang, Xiaowen; Wang, Jiawei; Bing, Guoxia; Bie, Pengfei; De, Yanyan; Lyu, Yanli; Wu, Qingmin
2018-04-20
Bioinformatics and comparative genomics analysis methods were used to predict unknown pathogen genes based on homology with identified or functionally clustered genes. In this study, the genes of common pathogens were analyzed to screen and identify genes associated with intracellular survival through sequence similarity, phylogenetic tree analysis and the λ-Red recombination system test method. The total 38,952 protein-coding genes of common pathogens were divided into 19,775 clusters. As demonstrated through a COG analysis, information storage and processing genes might play an important role intracellular survival. Only 19 clusters were present in facultative intracellular pathogens, and not all were present in extracellular pathogens. Construction of a phylogenetic tree selected 18 of these 19 clusters. Comparisons with the DEG database and previous research revealed that seven other clusters are considered essential gene clusters and that seven other clusters are associated with intracellular survival. Moreover, this study confirmed that clusters screened by orthologs with similar function could be replaced with an approved uvrY gene and its orthologs, and the results revealed that the usg gene is associated with intracellular survival. The study improves the current understanding of intracellular pathogens characteristics and allows further exploration of the intracellular survival-related gene modules in these pathogens. Copyright © 2018. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Khor, L.-Y.; De Silvio, Michelle; Li, Rile; McDonnell, Timothy J.; Hammond, M. Elizabeth H.; Sause, William T.; Pilepich, Miljenko V.; Okunieff, Paul; Sandler, Howard M.; Pollack, Alan
2006-01-01
Purpose: Bcl-2 and bax are proteins with opposing roles in apoptosis regulation; yet abnormal expression of either has been associated with failure after radiotherapy (RT). In this study we examined bcl-2 and bax expression as predictive markers in men treated with radiotherapy ± androgen deprivation on Radiation Therapy Oncology Group (RTOG) protocol 86-10. Experimental Design: Suitable archival diagnostic tissue was obtained from 119 (26%) patients for bcl-2 analysis and 104 (23%) patients for bax analysis. Cox proportional hazards multivariate analysis was used to determine the relationship of abnormal bcl-2 and bax expression to the end points of local failure, distant metastasis, cause-specific mortality, and overall mortality. Bcl-2 overexpression was classified as any tumor cell cytoplasmic staining and altered bax expression was classified as greater or lesser cytoplasmic staining intensity of tumor cells as compared with adjacent normal prostate epithelium. Results: The study cohort exhibited bcl-2 overexpression in 26% (n = 30) of cases and abnormal bax expression in 47% (n = 49) of cases. A borderline significant relationship was observed between abnormal bax expression and higher Gleason score (p = 0.08). In univariate and multivariate analyses, there was no statistically significant relationship seen between abnormal bcl-2 or bax expression and outcome. Conclusions: Abnormal bcl-2 and bax expression were not related to any of the end points tested. The cohort examined was comprised of patients with locally advanced disease and it is possible that these markers may be of greater value in men with earlier-stage prostate cancer
Gao, Meili; Li, Yongfei; Ji, Xiaoying; Xue, Xiaochang; Chen, Lan; Feng, Guodong; Zhang, Huqin; Wang, Huichun; Shah, Walayat; Hou, Zhanwu; Kong, Yu
2016-03-01
Epidemiological studies have demonstrated that cigarette smoking is an important cofactor or an independent risk factor for the development of cervical cancer. Benzo(a)pyrene (BaP) is one of the most potent tobacco smoke carcinogens in tobacco smoke. BaP induced DNA damage and over expression in p53 cervical tissue of mice as demonstrated in our previous study. Here we present the findings of exposure to BaP on the expression of Bcl-2, C-myc, Ki-67, Caspase-3 and Bax genes in mouse cervix. Acute intraperitoneal administration of BaP (12.5, 25, 50, 100mg/kg body weight) to ICR female mice induced a significant increase in Bcl-2, C-myc, Ki-67 mRNA and protein level till 72h except in Bcl-2 at 24h with 12.5, 25, 50mg/kg as well as at 48h with 12.5mg/kg body weight post treatment. A significant increase was also seen in Caspase-3 and Bax mRNA and protein level with peak level at 24h and gradual decrease till 72h, however, the expression of caspase-3 increased while that of Bax decreased with increasing dose of Bap after 24h. In sub chronic intraperitoneal and oral gavage administration of BaP (2.5, 5, 10mg/kg body weight), similar significant increase was observed for all the examined genes as compared to the control and vehicle groups, however the expression of Bax decreased in a dose dependent manner. The findings of this study will help in further understanding the molecular mechanism of BaP induced carcinogenesis of cervical cancer. Copyright © 2015 Elsevier GmbH. All rights reserved.
CD4+ lymphocytes control gut epithelial apoptosis and mediate survival in sepsis.
Stromberg, Paul E; Woolsey, Cheryl A; Clark, Andrew T; Clark, Jessica A; Turnbull, Isaiah R; McConnell, Kevin W; Chang, Katherine C; Chung, Chun-Shiang; Ayala, Alfred; Buchman, Timothy G; Hotchkiss, Richard S; Coopersmith, Craig M
2009-06-01
Lymphocytes help determine whether gut epithelial cells proliferate or differentiate but are not known to affect whether they live or die. Here, we report that lymphocytes play a controlling role in mediating gut epithelial apoptosis in sepsis but not under basal conditions. Gut epithelial apoptosis is similar in unmanipulated Rag-1(-/-) and wild-type (WT) mice. However, Rag-1(-/-) animals have a 5-fold augmentation in gut epithelial apoptosis following cecal ligation and puncture (CLP) compared to septic WT mice. Reconstitution of lymphocytes in Rag-1(-/-) mice via adoptive transfer decreases intestinal apoptosis to levels seen in WT animals. Subset analysis indicates that CD4(+) but not CD8(+), gammadelta, or B cells are responsible for the antiapoptotic effect of lymphocytes on the gut epithelium. Gut-specific overexpression of Bcl-2 in transgenic mice decreases mortality following CLP. This survival benefit is lymphocyte dependent since gut-specific overexpression of Bcl-2 fails to alter survival when the transgene is overexpressed in Rag-1(-/-) mice. Further, adoptively transferring lymphocytes to Rag-1(-/-) mice that simultaneously overexpress gut-specific Bcl-2 results in improved mortality following sepsis. Thus, sepsis unmasks CD4(+) lymphocyte control of gut apoptosis that is not present under homeostatic conditions, which acts as a key determinant of both cellular survival and host mortality.
Godoi, Paulo H C; Wilkie-Grantham, Rachel P; Hishiki, Asami; Sano, Renata; Matsuzawa, Yasuko; Yanagi, Hiroko; Munte, Claudia E; Chen, Ya; Yao, Yong; Marassi, Francesca M; Kalbitzer, Hans R; Matsuzawa, Shu-Ichi; Reed, John C
2016-07-01
B cell lymphoma gene 2 (Bcl-2) family proteins are key regulators of programmed cell death and important targets for drug discovery. Pro-apoptotic and anti-apoptotic Bcl-2 family proteins reciprocally modulate their activities in large part through protein interactions involving a motif known as BH3 (Bcl-2 homology 3). Nur77 is an orphan member of the nuclear receptor family that lacks a BH3 domain but nevertheless binds certain anti-apoptotic Bcl-2 family proteins (Bcl-2, Bfl-1, and Bcl-B), modulating their effects on apoptosis and autophagy. We used a combination of NMR spectroscopy-based methods, mutagenesis, and functional studies to define the interaction site of a Nur77 peptide on anti-apoptotic Bcl-2 family proteins and reveal a novel interaction surface. Nur77 binds adjacent to the BH3 peptide-binding crevice, suggesting the possibility of cross-talk between these discrete binding sites. Mutagenesis of residues lining the identified interaction site on Bcl-B negated the interaction with Nur77 protein in cells and prevented Nur77-mediated modulation of apoptosis and autophagy. The findings establish a new protein interaction site with the potential to modulate the apoptosis and autophagy mechanisms governed by Bcl-2 family proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Hahn, Peter J; Lai, Zhi-Wei; Nevaldine, Barbara; Schiff, Ninel; Fiore, Nancy C; Silverstone, Allen E
2003-11-01
We have quantified the emergence of early chromatin breaks during the signal transduction phase of apoptosis in mouse thymocytes after treatment with either ionizing radiation or dexamethasone. Dexamethasone at 1 microM can induce significant levels of DNA breaks (equivalent to the amount induced directly by 7.5 Gy ionizing radiation) within 0.5 h of treatment. The execution phase of apoptosis was not observed until 4-6 h after the same treatment. The presence of the Bcl2 transgene under the control of the p56lck promoter almost completely inhibited apoptosis up to 24 h after treatment, but it had virtually no effect on the early chromatin cleavage occurring in the first 6 h. Ionizing radiation induced chromatin cleavage both directly by damaging DNA and indirectly with kinetics similar to the induction of chromatin cleavage by dexamethasone. The presence of the Bcl2 transgene had no effect on the direct or indirect radiation-induced cleavage in the first 6 h, but after the first 6 h, the Bcl2 gene inhibited further radiation-induced chromatin cleavage. These results suggest that endonucleases are activated within minutes of treatment with either dexamethasone or ionizing radiation as part of the very early signal transduction phase of apoptosis, and prior to the irreversible commitment to cell death.
Common genetic polymorphisms of microRNA biogenesis pathway genes and breast cancer survival
International Nuclear Information System (INIS)
Sung, Hyuna; Ahn, Sei-Hyun; Kang, Daehee; Jeon, Sujee; Lee, Kyoung-Mu; Han, Sohee; Song, Minkyo; Choi, Ji-Yeob; Park, Sue K; Yoo, Keun-Young; Noh, Dong-Young
2012-01-01
Although the role of microRNA’s (miRNA’s) biogenesis pathway genes in cancer development and progression has been well established, the association between genetic variants of this pathway genes and breast cancer survival is still unknown. We used genotype data available from a previously conducted case–control study to investigate association between common genetic variations in miRNA biogenesis pathway genes and breast cancer survival. We investigated the possible associations between 41 germ-line single-nucleotide polymorphisms (SNPs) and both disease free survival (DFS) and overall survival (OS) among 488 breast cancer patients. During the median follow-up of 6.24 years, 90 cases developed disease progression and 48 cases died. Seven SNPs were significantly associated with breast cancer survival. Two SNPs in AGO2 (rs11786030 and rs2292779) and DICER1 rs1057035 were associated with both DFS and OS. Two SNPs in HIWI (rs4759659 and rs11060845) and DGCR8 rs9606250 were associated with DFS, while DROSHA rs874332 and GEMIN4 rs4968104 were associated with only OS. The most significant association was observed in variant allele of AGO2 rs11786030 with 2.62-fold increased risk of disease progression (95% confidence interval (CI), 1.41-4.88) and in minor allele homozygote of AGO2 rs2292779 with 2.94-fold increased risk of death (95% CI, 1.52-5.69). We also found cumulative effects of SNPs on DFS and OS. Compared to the subjects carrying 0 to 2 high-risk genotypes, those carrying 3 or 4–6 high-risk genotypes had an increased risk of disease progression with a hazard ratio of 2.16 (95% CI, 1.18- 3.93) and 4.47 (95% CI, 2.45- 8.14), respectively (P for trend, 6.11E-07). Our results suggest that genetic variants in miRNA biogenesis pathway genes may be associated with breast cancer survival. Further studies in larger sample size and functional characterizations are warranted to validate these results
Liu, Yanhong; Shete, Sanjay; Etzel, Carol J; Scheurer, Michael; Alexiou, George; Armstrong, Georgina; Tsavachidis, Spyros; Liang, Fu-Wen; Gilbert, Mark; Aldape, Ken; Armstrong, Terri; Houlston, Richard; Hosking, Fay; Robertson, Lindsay; Xiao, Yuanyuan; Wiencke, John; Wrensch, Margaret; Andersson, Ulrika; Melin, Beatrice S; Bondy, Melissa
2010-05-10
Glioblastoma (GBM) is the most common and aggressive type of glioma and has the poorest survival. However, a small percentage of patients with GBM survive well beyond the established median. Therefore, identifying the genetic variants that influence this small number of unusually long-term survivors may provide important insight into tumor biology and treatment. Among 590 patients with primary GBM, we evaluated associations of survival with the 100 top-ranking glioma susceptibility single nucleotide polymorphisms from our previous genome-wide association study using Cox regression models. We also compared differences in genetic variation between short-term survivors (STS; or= 36 months), and explored classification and regression tree analysis for survival data. We tested results using two independent series totaling 543 GBMs. We identified LIG4 rs7325927 and BTBD2 rs11670188 as predictors of STS in GBM and CCDC26 rs10464870 and rs891835, HMGA2 rs1563834, and RTEL1 rs2297440 as predictors of LTS. Further survival tree analysis revealed that patients >or= 50 years old with LIG4 rs7325927 (V) had the worst survival (median survival time, 1.2 years) and exhibited the highest risk of death (hazard ratio, 17.53; 95% CI, 4.27 to 71.97) compared with younger patients with combined RTEL1 rs2297440 (V) and HMGA2 rs1563834 (V) genotypes (median survival time, 7.8 years). Polymorphisms in the LIG4, BTBD2, HMGA2, and RTEL1 genes, which are involved in the double-strand break repair pathway, are associated with GBM survival.
High expression of the circadian gene mPer2 diminishes the radiosensitivity of NIH 3T3 cells
Energy Technology Data Exchange (ETDEWEB)
Chang, L.; Liu, Y.Y.; Zhu, B.; Li, Y.; Hua, H.; Wang, Y.H.; Zhang, J.; Jiang, Z.; Wang, Z.R. [Sichuan University, Chengdu (China). West China Medical Center. Health Ministry Key Lab. of Chronobiology], e-mail: wangzhengrong@126.com
2009-10-15
Period2 is a core circadian gene, which not only maintains the circadian rhythm of cells but also regulates some organic functions. We investigated the effects of mPeriod2 (mPer2) expression on radiosensitivity in normal mouse cells exposed to {sup 60}Co-{gamma}-rays. NIH 3T3 cells were treated with 12-O-tetradecanoyl phorbol-13-acetate (TPA) to induce endogenous mPer2 expression or transfected with pcDNA3.1(+)-mPer2 and irradiated with {sup 6}0Co-{gamma}-rays, and then analyzed by several methods such as flow cytometry, colony formation assay, RT-PCR, and immunohistochemistry. Flow cytometry and colony formation assay revealed that irradiated NIH 3T3 cells expressing high levels of mPer2 showed a lower death rate (TPA: 24 h 4.3% vs 12 h 6.8% and control 9.4%; transfection: pcDNA3.1-mPer2 3.7% vs pcDNA3.1 11.3% and control 8.2%), more proliferation and clonogenic survival (TPA: 121.7 {+-} 6.51 vs 66.0 {+-} 3.51 and 67.7 {+-} 7.37; transfection: 121.7 {+-} 6.50 vs 65.3 {+-} 3.51 and 69.0 {+-} 4.58) both when treated with TPA and transfected with mPer2. RT-PCR analysis showed an increased expression of bax, bcl-2, p53, cmyc, mre11, and nbs1, and an increased proportionality of bcl-2/bax in the irradiated cells at peak mPer2 expression compared with cells at trough mPer2 expression and control cells. However, no significant difference in rad50 expression was observed among the three groups of cells. Immunohistochemistry also showed increased protein levels of P53, BAX and proliferating cell nuclear antigen in irradiated cells with peak mPer2 levels. Thus, high expression of the circadian gene mPer2 may reduce the radiosensitivity of NIH 3T3 cells. For this effect, mPer2 may directly or indirectly regulate the expressions of cell proliferation- and apoptosis-related genes and DNA repair-related genes. (author)
High expression of the circadian gene mPer2 diminishes the radiosensitivity of NIH 3T3 cells
International Nuclear Information System (INIS)
Chang, L.; Liu, Y.Y.; Zhu, B.; Li, Y.; Hua, H.; Wang, Y.H.; Zhang, J.; Jiang, Z.; Wang, Z.R.
2009-01-01
Period2 is a core circadian gene, which not only maintains the circadian rhythm of cells but also regulates some organic functions. We investigated the effects of mPeriod2 (mPer2) expression on radiosensitivity in normal mouse cells exposed to 60 Co-γ-rays. NIH 3T3 cells were treated with 12-O-tetradecanoyl phorbol-13-acetate (TPA) to induce endogenous mPer2 expression or transfected with pcDNA3.1(+)-mPer2 and irradiated with 6 0Co-γ-rays, and then analyzed by several methods such as flow cytometry, colony formation assay, RT-PCR, and immunohistochemistry. Flow cytometry and colony formation assay revealed that irradiated NIH 3T3 cells expressing high levels of mPer2 showed a lower death rate (TPA: 24 h 4.3% vs 12 h 6.8% and control 9.4%; transfection: pcDNA3.1-mPer2 3.7% vs pcDNA3.1 11.3% and control 8.2%), more proliferation and clonogenic survival (TPA: 121.7 ± 6.51 vs 66.0 ± 3.51 and 67.7 ± 7.37; transfection: 121.7 ± 6.50 vs 65.3 ± 3.51 and 69.0 ± 4.58) both when treated with TPA and transfected with mPer2. RT-PCR analysis showed an increased expression of bax, bcl-2, p53, cmyc, mre11, and nbs1, and an increased proportionality of bcl-2/bax in the irradiated cells at peak mPer2 expression compared with cells at trough mPer2 expression and control cells. However, no significant difference in rad50 expression was observed among the three groups of cells. Immunohistochemistry also showed increased protein levels of P53, BAX and proliferating cell nuclear antigen in irradiated cells with peak mPer2 levels. Thus, high expression of the circadian gene mPer2 may reduce the radiosensitivity of NIH 3T3 cells. For this effect, mPer2 may directly or indirectly regulate the expressions of cell proliferation- and apoptosis-related genes and DNA repair-related genes. (author)
International Nuclear Information System (INIS)
Li Huixiang; Wang Yaohe; Shi Yonggang; Gao Dongling; Zhang Yunhan
2000-01-01
Objective: To observing the relationship between apoptosis-related genes bcl-2,c-myc, p53 and the radiosensitivity of esophageal squamous cell carcinoma. Methods: The expression levels of bcl-2, c-myc and p53 genes in 57 biopsy samples from patients of esophageal squamous cell carcinoma were detected with the LSAB immunohistochemistry method. All the patients were treated with radiotherapy. The radiotherapeutic effect in these patients was observed and the relation between gene expression and radiosensitivity was analyzed. Results: Compared with the bcl-2-negative group, the radiosensitivity of bcl-2-positive one was lower(P<0.01). The radiosensitivity of p53-positive group was slightly lower than that of the p53-negative one (P<0.05). The c-myc protein expression was not related to radiosensitivity. Conclusion: Detection and comprehensive analysis of bcl-2, c-myc and p53 protein expressions are useful in forecasting the radiotherapeutic effect on squamous cell carcinoma of esophagus
Ding, Wei; Ren, Jin; Ren, Hui; Wang, Dan
2017-12-08
LncRNA HOX transcript antisense RNA (HOTAIR) is involved in lots of cancers. The pro-survival protein Bcl-w is frequently found in cancer development. However, the effect of HOTAIR on Bcl-w in breast cancer is not well documented. In this study, we first evaluated the correlation between HOTAIR level and Bcl-w expression in clinical breast cancer tissues. We observed that the expression levels of Bcl-w were much higher in the breast cancer samples than that in their paired noncancerous tissues. Moreover, the levels of HOTAIR were positively associated with those of Bcl-w in clinical breast cancer samples. As expected, we observed that HOTAIR was able to up-regulate the expression of Bcl-w in breast cancer cells. Mechanistically, we found that miR-206 was capable of inhibiting the expression of Bcl-w by directly binding to the 3'UTR of Bcl-w mRNA. Interestingly, HOTAIR could increase the expression of Bcl-w through sequestering miR-206 at post-transcriptional level. Functionally, our data showed that HOTAIR-induced Bcl-w by miR-206 facilitated the proliferation of breast cancer cells. Thus, we conclude that HOTAIR up-regulates Bcl-w to enhance cell proliferation through sequestering miR-206 in breast cancer. Our finding provides new insights into the mechanism of breast cancer mediated by HOTAIR.
Pogmore, Justin P; Pemberton, James M; Chi, Xiaoke; Andrews, David W
2016-01-01
The Bcl-2 family of proteins regulates the process of mitochondrial outer membrane permeabilization, causing the release of cytochrome c and committing a cell to apoptosis. The majority of the functional interactions between these proteins occur at, on, or within the mitochondrial outer membrane, complicating structural studies of the proteins and complexes. As a result most in vitro studies of these protein-protein interactions use truncated proteins and/or detergents which can cause artificial interactions. Herein, we describe a detergent-free, fluorescence-based, in vitro technique to study binding between full-length recombinant Bcl-2 family proteins, particularly cleaved BID (cBID) and BCL-XL, on the membranes of purified mitochondria.
Combinatorial gene therapy renders increased survival in cirrhotic rats
Directory of Open Access Journals (Sweden)
Armendáriz-Borunda Juan S
2010-05-01
Full Text Available Abstract Background Liver fibrosis ranks as the second cause of death in México's productive-age population. This pathology is characterized by acummulation of fibrillar proteins in hepatic parenchyma causing synthetic and metabolic disfunction. Remotion of excessive fibrous proteins might result in benefit for subjects increasing survival index. The goal of this work was to find whether the already known therapeutical effect of human urokinase Plasminogen Activator and human Matrix Metalloprotease 8 extends survival index in cirrhotic animals. Methods Wistar rats (80 g underwent chronic intoxication with CCl4: mineral oil for 8 weeks. Cirrhotic animals were injected with a combined dose of Ad-delta-huPA plus Ad-MMP8 (3 × 1011 and 1.5 × 1011 vp/Kg, respectively or with Ad-beta-Gal (4.5 × 1011 and were killed after 2, 4, 6, 8 and 10 days. Then, liver and serum were collected. An additional set of cirrhotic animals injected with combined gene therapy was also monitored for their probability of survival. Results Only the cirrhotic animals treated with therapeutical genes (Ad-delta-huPA+Ad-MMP-8 showed improvement in liver fibrosis. These results correlated with hydroxyproline determinations. A significant decrement in alpha-SMA and TGF-beta1 gene expression was also observed. Cirrhotic rats treated with Ad-delta-huPA plus Ad-MMP8 had a higher probability of survival at 60 days with respect to Ad-beta-Gal-injected animals. Conclusion A single administration of Ad-delta-huPA plus Ad-MMP-8 is efficient to induce fibrosis regression and increase survival in experimental liver fibrosis.
Tumor gene expression and prognosis in breast cancer patients with 10 or more positive lymph nodes.
Cobleigh, Melody A; Tabesh, Bita; Bitterman, Pincas; Baker, Joffre; Cronin, Maureen; Liu, Mei-Lan; Borchik, Russell; Mosquera, Juan-Miguel; Walker, Michael G; Shak, Steven
2005-12-15
This study, along with two others, was done to develop the 21-gene Recurrence Score assay (Oncotype DX) that was validated in a subsequent independent study and is used to aid decision making about chemotherapy in estrogen receptor (ER)-positive, node-negative breast cancer patients. Patients with >or=10 nodes diagnosed from 1979 to 1999 were identified. RNA was extracted from paraffin blocks, and expression of 203 candidate genes was quantified using reverse transcription-PCR (RT-PCR). Seventy-eight patients were studied. As of August 2002, 77% of patients had distant recurrence or breast cancer death. Univariate Cox analysis of clinical and immunohistochemistry variables indicated that HER2/immunohistochemistry, number of involved nodes, progesterone receptor (PR)/immunohistochemistry (% cells), and ER/immunohistochemistry (% cells) were significantly associated with distant recurrence-free survival (DRFS). Univariate Cox analysis identified 22 genes associated with DRFS. Higher expression correlated with shorter DRFS for the HER2 adaptor GRB7 and the macrophage marker CD68. Higher expression correlated with longer DRFS for tumor protein p53-binding protein 2 (TP53BP2) and the ER axis genes PR and Bcl2. Multivariate methods, including stepwise variable selection and bootstrap resampling of the Cox proportional hazards regression model, identified several genes, including TP53BP2 and Bcl2, as significant predictors of DRFS. Tumor gene expression profiles of archival tissues, some more than 20 years old, provide significant information about risk of distant recurrence even among patients with 10 or more nodes.
Boron neutron capture therapy induces apoptosis of glioma cells through Bcl-2/Bax
Directory of Open Access Journals (Sweden)
Mao Xinggang
2010-12-01
Full Text Available Abstract Background Boron neutron capture therapy (BNCT is an alternative treatment modality for patients with glioma. The aim of this study was to determine whether induction of apoptosis contributes to the main therapeutic efficacy of BNCT and to compare the relative biological effect (RBE of BNCT, γ-ray and reactor neutron irradiation. Methods The neutron beam was obtained from the Xi'an Pulsed Reactor (XAPR and γ-rays were obtained from [60Co] γ source of the Fourth Military Medical University (FMMU in China. Human glioma cells (the U87, U251, and SHG44 cell lines were irradiated by neutron beams at the XAPR or [60Co] γ-rays at the FMMU with different protocols: Group A included control nonirradiated cells; Group B included cells treated with 4 Gy of [60Co] γ-rays; Group C included cells treated with 8 Gy of [60Co] γ-rays; Group D included cells treated with 4 Gy BPA (p-borono-phenylalanine-BNCT; Group E included cells treated with 8 Gy BPA-BNCT; Group F included cells irradiated in the reactor for the same treatment period as used for Group D; Group G included cells irradiated in the reactor for the same treatment period as used for Group E; Group H included cells irradiated with 4 Gy in the reactor; and Group I included cells irradiated with 8 Gy in the reactor. Cell survival was determined using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium (MTT cytotoxicity assay. The morphology of cells was detected by Hoechst33342 staining and transmission electron microscope (TEM. The apoptosis rate was detected by flow cytometer (FCM. The level of Bcl-2 and Bax protein was measured by western blot analysis. Results Proliferation of U87, U251, and SHG44 cells was much more strongly inhibited by BPA-BNCT than by irradiation with [60Co] γ-rays (P 60Co] γ-rays (P P Conclusions Compared with ��-ray and reactor neutron irradiation, a higher RBE can be achieved upon treatment of glioma cells with BNCT. Glioma cell apoptosis induced by
Molecular interactions of prodiginines with the BH3 domain of anti-apoptotic Bcl-2 family members.
Directory of Open Access Journals (Sweden)
Ali Hosseini
Full Text Available Prodigiosin and obatoclax, members of the prodiginines family, are small molecules with anti-cancer properties that are currently under preclinical and clinical trials. The molecular target(s of these agents, however, is an open question. Combining experimental and computational techniques we find that prodigiosin binds to the BH3 domain in some BCL-2 protein families, which play an important role in the apoptotic programmed cell death. In particular, our results indicate a large affinity of prodigiosin for MCL-1, an anti-apoptotic member of the BCL-2 family. In melanoma cells, we demonstrate that prodigiosin activates the mitochondrial apoptotic pathway by disrupting MCL-1/BAK complexes. Computer simulations with the PELE software allow the description of the induced fit process, obtaining a detailed atomic view of the molecular interactions. These results provide new data to understand the mechanism of action of these molecules, and assist in the development of more specific inhibitors of anti-apoptotic BCL-2 proteins.
Mutational analysis of Bax and Bcl-2 in childhood acute lymphoblastic leukaemia
Salomons, G. S.; Buitenhuis, C. K.; Martínez Muñoz, C.; Verwijs-Jassen, M.; Behrendt, H.; Zsiros, J.; Smets, L. A.
1998-01-01
In childhood acute lymphoblastic leukaemia there are large interpatient variations in levels of the apoptosis-regulating proteins Bax and Bcl-2, but the molecular basis for this variation is unknown. Point-mutations in bax have been reported in cell lines derived from haematological malignancies.
Analysis list: Bcl6 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Bcl6 Blood,Liver,Pancreas + mm9 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Bcl6.1.tsv http:...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Bcl6.5.tsv http://dbarchive.biosciencedb...c.jp/kyushu-u/mm9/target/Bcl6.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Bcl6.Blood.tsv,http:...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Bcl6.Liver.tsv,http://dbarchive.b...iosciencedbc.jp/kyushu-u/mm9/colo/Bcl6.Pancreas.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Blood.gml,http:
Okamoto, Toru; Campbell, Stephanie; Mehta, Ninad; Thibault, John; Colman, Peter M; Barry, Michele; Huang, David C S; Kvansakul, Marc
2012-11-01
Many viruses express inhibitors of programmed cell death (apoptosis), thereby countering host defenses that would otherwise rapidly clear infected cells. To counter this, viruses such as adenoviruses and herpesviruses express recognizable homologs of the mammalian prosurvival protein Bcl-2. In contrast, the majority of poxviruses lack viral Bcl-2 (vBcl-2) homologs that are readily identified by sequence similarities. One such virus, myxoma virus, which is the causative agent of myxomatosis, expresses a virulence factor that is a potent inhibitor of apoptosis. In spite of the scant sequence similarity to Bcl-2, myxoma virus M11L adopts an almost identical 3-dimensional fold. We used M11L as bait in a sequence similarity search for other Bcl-2-like proteins and identified six putative vBcl-2 proteins from poxviruses. Some are potent inhibitors of apoptosis, in particular sheeppox virus SPPV14, which inhibited cell death induced by multiple agents. Importantly, SPPV14 compensated for the loss of antiapoptotic F1L in vaccinia virus and acts to directly counter the cell death mediators Bax and Bak. SPPV14 also engages a unique subset of the death-promoting BH3-only ligands, including Bim, Puma, Bmf, and Hrk. This suggests that SPPV14 may have been selected for specific biological roles as a virulence factor for sheeppox virus.
DEFF Research Database (Denmark)
Liang, Y G; Jorgensen, A G; Kaestel, C G
2000-01-01
PURPOSE. The aim of this study was to determine the role of Bcl-2, Bcl-X L, Bax, and c-Fos in regulation of apoptosis, induced by ultraviolet-light A (UV-A) and daunorubicin (DNR), in retinal pigment epithelium (RPE) cells grown on bovine extracellular matrix (ECM)-coated or uncoated plastic dishes....... METHODS. Apoptosis in confluent RPE cells cultured on ECM-coated or uncoated dishes was induced by UV-A or DNR. Apoptosis was detected by 7-amino-actinomycin D labeling followed by flow cytometry and by terminal deoxy-transferase mediated X-dUTP nick end labeling (TUNEL). Cellular expression of Bcl-2, Bcl......-X L, Bax, and c-Fos was determined by the use of antibodies and flow cytometry, Western blot analysis, and immunocytochemical staining. RESULTS. Both UV-A and DNR induce apoptosis in human RPE cells in vitro. Human fetal RPE cells grown on ECM-coated dishes were significantly more resistant to UV...
Directory of Open Access Journals (Sweden)
Ryan C Thompson
Full Text Available BACKGROUND: Diffuse large B-cell lymphoma (DLBCL is a genetically heterogeneous disease and this variation can often be used to explain the response of individual patients to chemotherapy. One cancer therapeutic approach currently in clinical trials uses histone deacetylase inhibitors (HDACi's as monotherapy or in combination with other agents. METHODOLOGY/PRINCIPAL FINDINGS: We have used a variety of cell-based and molecular/biochemical assays to show that two pan-HDAC inhibitors, trichostatin A and vorinostat, induce apoptosis in seven of eight human DLBCL cell lines. Consistent with previous reports implicating the BCL-2 family in regulating HDACi-induced apoptosis, ectopic over-expression of anti-apoptotic proteins BCL-2 and BCL-XL or pro-apoptotic protein BIM in these cell lines conferred further resistance or sensitivity, respectively, to HDACi treatment. Additionally, BCL-2 family antgonist ABT-737 increased the sensitivity of several DLBCL cell lines to vorinostat-induced apoptosis, including one cell line (SUDHL6 that is resistant to vorinostat alone. Moreover, two variants of the HDACi-sensitive SUDHL4 cell line that have decreased sensitivity to vorinostat showed up-regulation of BCL-2 family anti-apoptotic proteins such as BCL-XL and MCL-1, as well as decreased sensitivity to ABT-737. These results suggest that the regulation and overall balance of anti- to pro-apoptotic BCL-2 family protein expression is important in defining the sensitivity of DLBCL to HDACi-induced apoptosis. However, the sensitivity of DLBCL cell lines to HDACi treatment does not correlate with expression of any individual BCL-2 family member. CONCLUSIONS/SIGNIFICANCE: These studies indicate that the sensitivity of DLBCL to treatment with HDACi's is dependent on the complex regulation of BCL-2 family members and that BCL-2 antagonists may enhance the response of a subset of DLBCL patients to HDACi treatment.
Vitrification affects nuclear maturation and gene expression of immature human oocytes
Directory of Open Access Journals (Sweden)
Abbas Shahedi
2017-02-01
Full Text Available Background: Vitrification of oocytes is a fast-freezing technique, which may affect the quality of the human oocyte, and consequently affects the embryo development, pregnancy and birth. The aim of the current study was to investigate the consequence of in-vitro vitrification on maturation status of immature human oocytes, additionally, expression levels of stress, and apoptosis related genes. Materials and Methods: The total of 213 human immature oocytes which routinely discarded from assisted reproduction clinics were collected and divided into two groups including: (I fresh germinal vesicle (GV oocytes (n=106 (matured in-vitro (fIVM , and (II GV oocytes (n=107 that initially vitrified, then matured in in-vitro (vIVM. After 36 hours of incubation, the oocytes were evaluated for nuclear maturation and expression level of DNA methyltransferase (DNMT1, stress related genes (Sod1 and Hsp70, and apoptotic related genes (Bax and Bcl-2 by quantitative Real-Time PCR. Results: Oocyte maturation rates were reduced in vIVM compared to fIVM oocytes (P=0.001. The expression of stress (Sod1 and Hsp70, and apoptotic-related genes (Bax and Bcl-2 in vIVM were significantly higher compared to the fIVM group. Additionally, pro-apoptotic gene up-regulated 4.3 times more than anti-apoptotic gene in vIVM oocyte. However, DNMT1 gene expression was reduced in vIVM oocyte (P = 0.047. Conclusions: The low survival rate of vitrified In-vitro matured GV oocytes could definitely be explained by the alterations of their gene expression profile.
BCL-x{sub L}/MCL-1 inhibition and RARγ antagonism work cooperatively in human HL60 leukemia cells
Energy Technology Data Exchange (ETDEWEB)
Perri, Mariarita; Yap, Jeremy L.; Yu, Jianshi [Department of Pharmaceutical Sciences, University of Maryland School of Pharmacy, 20 N Pine Street, Baltimore, MD 21201 (United States); Cione, Erika [Department of Pharmacy, Health and Nutritional Sciences, Ed. Polifunzionale, University of Calabria, 87036 Rende, CS (Italy); Fletcher, Steven [Department of Pharmaceutical Sciences, University of Maryland School of Pharmacy, 20 N Pine Street, Baltimore, MD 21201 (United States); Kane, Maureen A., E-mail: mkane@rx.umaryland.edu [Department of Pharmaceutical Sciences, University of Maryland School of Pharmacy, 20 N Pine Street, Baltimore, MD 21201 (United States)
2014-10-01
The acute promyelocytic leukemia (APL) subtype of acute myeloid leukemia (AML) is characterized by chromosomal translocations that result in fusion proteins, including the promyelocytic leukemia–retinoic acid receptor, alpha fusion protein (PML–RARα). All-trans retinoic acid (atRA) treatment is the standard drug treatment for APL yielding cure rates >80% by activating transcription and proteasomal degradation of retinoic acid receptor, alpha (RARα). Whereas combination therapy with As{sub 2}O{sub 3} has increased survival further, patients that experience relapse and are refractory to atRA and/or As{sub 2}O{sub 3} is a clinically significant problem. BCL-2 family proteins regulate apoptosis and over-expression of anti-apoptotic B-cell leukemia/lymphoma 2 (BCL-2) family proteins has been associated with chemotherapeutic resistance in APL including impairment of the ability of atRA to induce growth arrest and differentiation. Here we investigated the novel BH3 domain mimetic, JY-1-106, which antagonizes the anti-apoptotic BCL-2 family members B-cell lymphoma-extra large (BCL-x{sub L}) and myeloid cell leukemia-1 (MCL-1) alone and in combination with retinoids including atRA, AM580 (RARα agonist), and SR11253 (RARγ antagonist). JY-1-106 reduced cell viability in HL-60 cells alone and in combination with retinoids. The combination of JY-1-106 and SR11253 had the greatest impact on cell viability by stimulating apoptosis. These studies indicate that dual BCL-x{sub L}/MCL-1 inhibitors and retinoids could work cooperatively in leukemia treatment. - Highlights: • Novel Bcl-x{sub L}/Mcl-1 inhibitor JY-1-106 reduces HL60 cell viability. • JY-1-106 is investigated in combination with retinoic acid, AM580, and SR11253. • AM580 is an RARα agonist; SR11253 is an RARγ antagonist. • Combined use of JY-1-106/SR11253 exhibited the greatest cell viability reduction. • JY-1-106 alone or in combination with retinoids induces apoptosis.
Directory of Open Access Journals (Sweden)
Sara B Estruch
Full Text Available Nuclear orphan receptor TLX (NR2E1 functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1, a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9, a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.
Estruch, Sara B; Buzón, Víctor; Carbó, Laia R; Schorova, Lenka; Lüders, Jens; Estébanez-Perpiñá, Eva
2012-01-01
Nuclear orphan receptor TLX (NR2E1) functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs) of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H) screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1), a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9), a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.
Pan, Yundan; Wang, Na; Xia, Pingping; Wang, E; Guo, Qulian; Ye, Zhi
2018-02-01
Although the neuroprotective effects of Rac1 inhibition have been reported in various cerebral ischemic models, the molecular mechanisms of action have not yet been fully elucidated. In this study, we investigated whether the inhibition of Rac1 provided neuroprotection in a diabetic rat model of focal cerebral ischemia and hyperglycemia-exposed PC-12 cells. Intracerebroventricular administration of lentivirus expressing the Rac1 small hairpin RNA (shRNA) and specific Rac1 inhibitor NSC23766 not only decreased the infarct volumes and improved neurologic deficits with a correlated significant activation of mitochondrial DNA specific proteins, such as OGG1 and POLG, but also elevated Bcl-2 S70 phosphorylation in mitochondria. Furthermore, the levels of p-PI3K, p-Akt and p-mTOR increased, while 8-OHdG, ROS production and Bcl-2/Rac1 complex formation in mitochondria reduced in both Rac1-shRNA- and NSC23766-treated rats. Moreover, to confirm our in vivo observations, inhibition of Rac1 activity by NSC23766 suppressed the interactions between Bcl-2 and Rac1 in the mitochondria of PC-12 cells cultured in high glucose conditions and protected PC-12 cells from high glucose-induced neurotoxicity. More importantly, these beneficial effects of Rac1 inhibition were abolished by PI3K inhibitor LY294002. In contrast to NSC23766 treatment, LY294002 had little effect on the decrement of p-PTEN level. Taken together, these findings revealed novel neuroprotective roles of Rac1 inhibition against cerebral ischemic reperfusion injury in vivo and high glucose-induced neurotoxicity in PC-12 cells in vitro, by reducing Bcl-2/Rac1 complex formation in mitochondria through the activation of PI3K/Akt/mTOR survival pathway. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
FX Ady Soesetijo
2012-12-01
Full Text Available Background: Restoration of NiCr may undergo corrosion process in artificial saliva. Corrosion product is soluble Ni substances in salivary electrolytes. Ni2+ may freely enter the cells through passive transport DMT-1. Ni2+ in the cell causes initiation of the ROS formation,which subsequently can conduct the redoxs reactions leading to DNA damage. The damage DNA affects the genetic expression, especially bcl-2, and even triggers apoptosis. Purpose: The aim of this study was to reveal the mechanism of Ni toxicity as a corrosion product of NiCr restoration on gingival fibroblasts through expression analysis of Bcl-2. Methods: Cells with a density of 105 planted on each coverslip in 72 wells to the treatment group and 24 wells to the control group (24 hours incubation. In the treatment groups, each well exposed with 20 μL artificial saliva containing Ni concentration results immerse each restoration, whereas the control group was exposed to 20 μL artificial saliva (incubation 1, 3, and 7 days. The data collected were subsequently analyzed using two-ways ANOVA, followed by one-way ANOVA. Comparing between experimental groups after one-way ANOVA was conducted using Fisher’s LSD. Whereas, the calculation and documentation of Bcl-2 expression was performed camera of Olympus Microscope BX-50 Japan. Results: Statistical analysis of two-ways ANOVA showed the presence of interaction between the increasing Ni concentration and exposure duration on the expression of Bcl-2 gingival fibroblasts (p=0.021Bcl-2 expression.Latar belakang: Restorasi NiCr dapat mengalami proses korosi di dalam saliva artificial. Produk korosi yang dihasilkan adalah substansi Ni yang terlarut di dalam elektrolit saliva. Ni2+ bebas dapat memasuki sel (fibroblas gingiva melalui transport pasif DMT-1. Ni2+ di dalam sel
Osteocalcin protects pancreatic beta cell function and survival under high glucose conditions
Energy Technology Data Exchange (ETDEWEB)
Kover, Karen, E-mail: kkover@cmh.edu [Division of Endocrine/Diabetes, Children' s Mercy Hospital & Clinics, Kansas City, MO 64108 (United States); University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108 (United States); Yan, Yun; Tong, Pei Ying; Watkins, Dara; Li, Xiaoyu [Division of Endocrine/Diabetes, Children' s Mercy Hospital & Clinics, Kansas City, MO 64108 (United States); University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108 (United States); Tasch, James; Hager, Melissa [Kansas City University Medical Biosciences, Kansas City, MO (United States); Clements, Mark; Moore, Wayne V. [Division of Endocrine/Diabetes, Children' s Mercy Hospital & Clinics, Kansas City, MO 64108 (United States); University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108 (United States)
2015-06-19
Diabetes is characterized by progressive beta cell dysfunction and loss due in part to oxidative stress that occurs from gluco/lipotoxicity. Treatments that directly protect beta cell function and survival in the diabetic milieu are of particular interest. A growing body of evidence suggests that osteocalcin, an abundant non-collagenous protein of bone, supports beta cell function and proliferation. Based on previous gene expression data by microarray, we hypothesized that osteocalcin protects beta cells from glucose-induced oxidative stress. To test our hypothesis we cultured isolated rat islets and INS-1E cells in the presence of normal, high, or high glucose ± osteocalcin for up to 72 h. Oxidative stress and viability/mitochondrial function were measured by H{sub 2}O{sub 2} assay and Alamar Blue assay, respectively. Caspase 3/7 activity was also measured as a marker of apoptosis. A functional test, glucose stimulated insulin release, was conducted and expression of genes/protein was measured by qRT-PCR/western blot/ELISA. Osteocalcin treatment significantly reduced high glucose-induced H{sub 2}O{sub 2} levels while maintaining viability/mitochondrial function. Osteocalcin also significantly improved glucose stimulated insulin secretion and insulin content in rat islets after 48 h of high glucose exposure compared to untreated islets. As expected sustained high glucose down-regulated gene/protein expression of INS1 and BCL2 while increasing TXNIP expression. Interestingly, osteocalcin treatment reversed the effects of high glucose on gene/protein expression. We conclude that osteocalcin can protect beta cells from the negative effects of glucose-induced oxidative stress, in part, by reducing TXNIP expression, thereby preserving beta cell function and survival. - Highlights: • Osteocalcin reduces glucose-induced oxidative stress in beta cells. • Osteocalcin preserves beta cell function and survival under stress conditions. • Osteocalcin reduces glucose
Osteocalcin protects pancreatic beta cell function and survival under high glucose conditions
International Nuclear Information System (INIS)
Kover, Karen; Yan, Yun; Tong, Pei Ying; Watkins, Dara; Li, Xiaoyu; Tasch, James; Hager, Melissa; Clements, Mark; Moore, Wayne V.
2015-01-01
Diabetes is characterized by progressive beta cell dysfunction and loss due in part to oxidative stress that occurs from gluco/lipotoxicity. Treatments that directly protect beta cell function and survival in the diabetic milieu are of particular interest. A growing body of evidence suggests that osteocalcin, an abundant non-collagenous protein of bone, supports beta cell function and proliferation. Based on previous gene expression data by microarray, we hypothesized that osteocalcin protects beta cells from glucose-induced oxidative stress. To test our hypothesis we cultured isolated rat islets and INS-1E cells in the presence of normal, high, or high glucose ± osteocalcin for up to 72 h. Oxidative stress and viability/mitochondrial function were measured by H 2 O 2 assay and Alamar Blue assay, respectively. Caspase 3/7 activity was also measured as a marker of apoptosis. A functional test, glucose stimulated insulin release, was conducted and expression of genes/protein was measured by qRT-PCR/western blot/ELISA. Osteocalcin treatment significantly reduced high glucose-induced H 2 O 2 levels while maintaining viability/mitochondrial function. Osteocalcin also significantly improved glucose stimulated insulin secretion and insulin content in rat islets after 48 h of high glucose exposure compared to untreated islets. As expected sustained high glucose down-regulated gene/protein expression of INS1 and BCL2 while increasing TXNIP expression. Interestingly, osteocalcin treatment reversed the effects of high glucose on gene/protein expression. We conclude that osteocalcin can protect beta cells from the negative effects of glucose-induced oxidative stress, in part, by reducing TXNIP expression, thereby preserving beta cell function and survival. - Highlights: • Osteocalcin reduces glucose-induced oxidative stress in beta cells. • Osteocalcin preserves beta cell function and survival under stress conditions. • Osteocalcin reduces glucose-induced TXNIP
Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong
2015-01-01
Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.
Gene expression in triple-negative breast cancer in relation to survival.
Wang, Shuyang; Beeghly-Fadiel, Alicia; Cai, Qiuyin; Cai, Hui; Guo, Xingyi; Shi, Liang; Wu, Jie; Ye, Fei; Qiu, Qingchao; Zheng, Ying; Zheng, Wei; Bao, Ping-Ping; Shu, Xiao-Ou
2018-05-10
The identification of biomarkers related to the prognosis of triple-negative breast cancer (TNBC) is critically important for improved understanding of the biology that drives TNBC progression. We evaluated gene expression in total RNA isolated from formalin-fixed paraffin-embedded tumor samples using the NanoString nCounter assay for 469 TNBC cases from the Shanghai Breast Cancer Survival Study. We used Cox regression to quantify Hazard Ratios (HR) and corresponding confidence intervals (CI) for overall survival (OS) and disease-free survival (DFS) in models that included adjustment for breast cancer intrinsic subtype. Of 302 genes in our discovery analysis, 22 were further evaluated in relation to OS among 134 TNBC cases from the Nashville Breast Health Study and the Southern Community Cohort Study; 16 genes were further evaluated in relation to DFS in 335 TNBC cases from four gene expression omnibus datasets. Fixed-effect meta-analysis was used to combine results across data sources. Twofold higher expression of EOMES (HR 0.90, 95% CI 0.83-0.97), RASGRP1 (HR 0.89, 95% CI 0.82-0.97), and SOD2 (HR 0.80, 95% CI 0.66-0.96) was associated with better OS. Twofold higher expression of EOMES (HR 0.89, 95% CI 0.81-0.97) and RASGRP1 (HR 0.87, 95% CI 0.81-0.95) was also associated with better DFS. On the contrary, a doubling of FA2H (HR 1.14, 95% CI 1.06-1.22) and GSPT1 (HR 1.33, 95% CI 1.14-1.55) expression was associated with shorter DFS. We identified five genes (EOMES, FA2H, GSPT1, RASGRP1, and SOD2) that may serve as potential prognostic biomarkers and/or therapeutic targets for TNBC.
Xu, Li; Fu, Yingya; Li, Youlun; Han, Xiaoli
2017-08-01
Change of multidrug resistance-related genes (e.g., lung resistance protein, LRP) and overexpression of anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are responsible for cisplatin resistance. In our study, we investigated the mechanism by which cisplatin induces LRP, Bcl-2, Bcl-xL, XIAP, and Survivin expression in human lung adenocarcinoma A549 cells and human H446 small cell lung cancer cells at mRNA and protein levels. In our study, cell proliferation was assessed with CCK-8 assays, and cell apoptosis was assessed with flow cytometric analysis and Annexin-V/PI staining. qPCR was used to complete RNA experiments. Protein expression was assessed with Western blotting. Cisplatin increased Bcl-2, LRP, and Survivin expression, but decreased Bcl-xL and XIAP expression in a dose-dependent manner. Preincubation with JNK-specific inhibitor, SP600125, significantly inhibited these genes' expression at mRNA and protein levels, enhanced chemosensitivity of lung cancer cells to cisplatin, and promoted cisplatin-induced apoptosis. Our data suggest that the JNK signaling pathway plays an important role in cisplatin resistance. Lung resistance protein (LRP) and anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are involved in the process. The results reminded us of a novel therapy target for lung cancer treatment.
Directory of Open Access Journals (Sweden)
M Zamani
2012-12-01
Full Text Available Introduction : Preliminary studies confirmed reduction in cell death following treatment with antioxidants. According to this finding we study the relationship between consumption of CoQ10 and expression of bax and bcl2 in hippocampus following ischemia/reperfusion as proteins involved in cell programmed death or apoptosis.Material & methods : We studied the protective role of CoQ10 against Ischemia-Reperfusion. Experimental design includes four groups: intact, ischemic control, sham control and treatment groups with CoQ10. The mice treated with CoQ10 as Pre - Treatment for a week. Then, ischemia induced by common carotid artery ligation and following the reduction in inflammation (a week the mice post-treated with CoQ10.Nissl staining applied to counting necrotic cells of hippocampus and the western blotting performed to measurement the bax and bcl2 expression.Results :. Cell death was significantly lower when mice treated with CoQ10. Bax expression was significantly high in ischemic group but in treatment group was less and reversely the bcl2 expression in ischemic group was lower than treatment and vehicle groups.Conclusion : Ischemia for 15 minutes induced cell death in hippocampus with more potent effect on CA1. CoQ10 intake significantly reduced cell death and prevented the expression of bax while inducing an increase in expression of bcl2.
Werner, Tamara V.; Hart, Martin; Nickels, Ruth; Kim, Yoo-Jin; Menger, Michael D.; Bohle, Rainer M.; Keller, Andreas; Ludwig, Nicole; Meese, Eckart
2017-01-01
Micro (mi)RNAs are short, noncoding RNAs and deregulation of miRNAs and their targets are implicated in tumor generation and progression in many cancers. Meningiomas are mostly benign, slow growing tumors of the central nervous system with a small percentage showing a malignant phenotype. Following in silico prediction of potential targets of miR-34a-3p, SMAD4, FRAT1, and BCL2 have been confirmed as targets by dual luciferase assays with co-expression of miR-34a-3p and reporter gene constructs containing the respective 3'UTRs. Disruption of the miR-34a-3p binding sites in the 3'UTRs resulted in loss of responsiveness to miR-34a-3p overexpression. In meningioma cells, overexpression of miR-34a-3p resulted in decreased protein levels of SMAD4, FRAT1 and BCL2, while inhibition of miR-34a-3p led to increased levels of these proteins as confirmed by Western blotting. Furthermore, deregulation of miR-34a-3p altered cell proliferation and apoptosis of meningioma cells in vitro. We show that SMAD4, FRAT1 and BCL2 are direct targets of miR-34a-3p and that deregulation of miR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro. As part of their respective signaling pathways, which are known to play a role in meningioma genesis and progression, deregulation of SMAD4, FRAT1 and BCL2 might contribute to the aberrant activation of these signaling pathways leading to increased proliferation and inhibition of apoptosis in meningiomas. PMID:28340489
Cho, Eun Na; Kim, Eun Young; Jung, Ji Ye; Kim, Arum; Oh, In Jae; Kim, Young Chul; Chang, Yoon Soo
2015-10-01
BCL2-Like 11(BIM), which encodes a BH3-only protein, is a major pro-apoptotic molecule that facilitates cell death. We hypothesized that a BIM intron 2 deletion polymorphism increases lung cancer risk and predicts poor prognosis in non-small lung cancer (NSCLC) patients. We prospectively recruited 450 lung cancer patients and 1:1 age, sex, and smoking status matched control subjects from February 2013 to April 2014 among patients treated at Severance, Gangnam Severance, and Chonnam Hwasoon Hospital. The presence of a 2903-bp genomic DNA deletion polymorphism of intron 2 of BIM was analyzed by PCR and validated by sequencing. Odds ratios were calculated by chi-square tests and survival analysis with Kaplan-Meier estimation. Sixty-nine out of 450 (15.3%) lung cancer patients carried the BIM deletion polymorphism, while 66 out of 450 (14.7%) control subjects carried the BIM deletion polymorphism, with an odds ratio of for lung cancer of 1.054 (95% CI; 0.731-1.519). We categorized 406 NSCLC patients according to the presence of the polymorphism and found that there were no statistically significant differences in age, sex, histologic type, or stage between subjects with and without the deletion polymorphism. The BIM deletion polymorphism did not influence overall survival (OS) or progression free survival (PFS) in our sample (OS; 37.6 vs 34.4 months (P=0.759), PFS; 49.6 vs 26.0 months (P=0.434)). These findings indicate that the BIM deletion polymorphism is common in Korean NSCLC patients but does not significantly affect the intrinsic biologic function of BH3-only protein. Furthermore, the BIM deletion polymorphism did not predict clinical outcomes in patients with NSCLC. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
[Effects of blueberry on apoptosis and expression of Bcl-2 and Bax in HSC-T6].
Lu, Shuang; Cheng, Mingliang; Yang, Demeng; Liu, Yang; Guan, Li; Wu, Jun
2015-08-18
To investigate the effects of blueberry on the apoptosis, expression of Bcl-2 and Bax in rat hepatic stellate cell (HSC-T6). 10% blueberry serum at low, middle and high dose, 10% Fu-Fang-Bie-Jia-Ruan-Gan tablet serum and 10% saline serum were prepared by method of serum pharmacology. Subcultured HSC-T6 was divided into saline serum control group, blueberry serum at low, middle, high dose and Fu-Fang-Bie-Jia-Ruan-Gan tablet serum group, and then was respectively incubated at different dose of 10% blueberry serum, 10% Fu-Fang-Bie-Jia-Ruan-Gan tablet serum and 10% saline serum for 72 hours.Apoptosis of HSC-T6 was detected using flow cytometry with annexin V FITC/PI double staining. The expression of Bcl-2 and Bax in HSC-T6 were examined using immunocytochemistry and Western blotting, respectively. There was no significant difference for HSC-T6 Bax protein expression in the low, middle and high dose blueberry serum groups, compared with saline serum control group, respectively.In the high-dose blueberry serum group HSC-T6 early and total apoptosis rate increased significantly compared with the saline serum control group (5.55% ± 0.98% vs 2.53% ± 0.46%, 7.01% ± 1.05% vs 2.96% ± 0.81%, both Pblueberry serum group showed no significant difference with the saline serum control group. Blueberry can induce HSC-T6 apoptosis by down-regulating Bcl-2 expression and decreasing the ratio of Bcl-2/Bax in HSC-T6 cells, so it may have potential interference effects on hepatic fibrosis.
Zerumbone induced apoptosis in liver cancer cells via modulation of Bax/Bcl-2 ratio
Directory of Open Access Journals (Sweden)
Azimahtol Hawariah LP
2007-04-01
Full Text Available Abstract Background Zerumbone is a cytotoxic component isolated from Zingiber zerumbet Smith, a herbal plant which is also known as lempoyang. This new anticancer bioactive compound from Z. zerumbet was investigated for its activity and mechanism in human liver cancer cell lines. Results Zerumbone significantly showed an antiproliferative activity upon HepG2 cells with an IC50 of 3.45 ± 0.026 μg/ml. Zerumbone was also found to inhibit the proliferation of non-malignant Chang Liver and MDBK cell lines. However the IC50 obtained was higher compared to the IC50 for HepG2 cells (> 10 μg/ml. The extent of DNA fragmentation was evaluated by the Tdt-mediated dUTP nick end labelling assay which showed that, zerumbone significantly increased apoptosis in HepG2 cells in a time-course manner. In detail, the apoptotic process triggered by zerumbone involved the up-regulation of pro-apoptotic Bax protein and the suppression of anti-apoptotic Bcl-2 protein expression. The changes that occurred in the levels of this antagonistic proteins Bax/Bcl-2, was independent of p53 since zerumbone did not affect the levels of p53 although this protein exists in a functional form. Western blotting analysis for Bax protein was further confirmed qualitatively with an immunoassay that showed the distribution of Bax protein in zerumbone-treated cells. Conclusion Therefore, zerumbone was found to induce the apoptotic process in HepG2 cells through the up and down regulation of Bax/Bcl-2 protein independently of functional p53 activity.
Permatasari, Happy Kurnia; Nakahata, Shingo; Ichikawa, Tomonaga; Morishita, Kazuhiro
2017-08-26
Human T-cell leukemia virus type 1 (HTLV-1) is a causative agent of adult T-cell leukemia-lymphoma (ATLL). The HTLV-1-encoded protein Tax plays important roles in the proliferation of HTLV-1-infected T-cells by affecting cellular proteins. In this study, we showed that Tax transcriptionally and post-transcriptionally downregulates the expression of the tumor suppressor gene B-cell leukemia/lymphoma 11B (BCL11B), which encodes a lymphoid-related transcription factor. BCL11B expression was downregulated in HTLV-1-infected T-cell lines at the mRNA and protein levels, and forced expression of BCL11B suppressed the proliferation of these cells. The proteasomal inhibitor MG132 increased BCL11B expression in HTLV-1-infected cell lines, and colocalization of Tax with BCL11B was detected in the cytoplasm of HTLV-1-infected T-cells following MG132 treatment. shRNA knock-down of Tax expression also increased the expression of BCL11B in HTLV-1-infected cells. Moreover, we found that Tax physically binds to BCL11B protein and induces the polyubiquitination of BCL11B and proteasome-dependent degradation of BCL11B. Thus, inactivation of BCL11B by Tax protein may play an important role in the Tax-mediated leukemogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Genetic variants in fanconi anemia pathway genes BRCA2 and FANCA predict melanoma survival.
Yin, Jieyun; Liu, Hongliang; Liu, Zhensheng; Wang, Li-E; Chen, Wei V; Zhu, Dakai; Amos, Christopher I; Fang, Shenying; Lee, Jeffrey E; Wei, Qingyi
2015-02-01
Cutaneous melanoma (CM) is the most lethal skin cancer. The Fanconi anemia (FA) pathway involved in DNA crosslink repair may affect CM susceptibility and prognosis. Using data derived from published genome-wide association study, we comprehensively analyzed the associations of 2,339 common single-nucleotide polymorphisms (SNPs) in 14 autosomal FA genes with overall survival (OS) in 858 CM patients. By performing false-positive report probability corrections and stepwise Cox proportional hazards regression analyses, we identified significant associations between CM OS and four putatively functional SNPs: BRCA2 rs10492396 (AG vs. GG: adjusted hazard ratio (adjHR)=1.85, 95% confidence interval (CI)=1.16-2.95, P=0.010), rs206118 (CC vs. TT+TC: adjHR=2.44, 95% CI=1.27-4.67, P=0.007), rs3752447 (CC vs. TT+TC: adjHR=2.10, 95% CI=1.38-3.18, P=0.0005), and FANCA rs62068372 (TT vs. CC+CT: adjHR=1.85, 95% CI=1.27-2.69, P=0.001). Moreover, patients with an increasing number of unfavorable genotypes (NUG) of these loci had markedly reduced OS and melanoma-specific survival (MSS). The final model incorporating with NUG, tumor stage, and Breslow thickness showed an improved discriminatory ability to classify both 5-year OS and 5-year MSS. Additional investigations, preferably prospective studies, are needed to validate our findings.
van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P
2005-06-10
To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.
Energy Technology Data Exchange (ETDEWEB)
Champagne, Devin P., E-mail: devin.champagne@uvm.edu; Shockett, Penny E., E-mail: pshockett@selu.edu
2014-03-15
Highlights: • Examines illegitimate V(D)J deletion junctions in Notch1 and Bcl11b. • Suggests little influence of deletions alone on clonal outgrowth in wild-type mice. • No age or sex biases in frequency, clonality, or junctional processing observed. • Contrasts with previous results at TCRβ and HPRT1 loci. • Deletions in Bcl11b may be tolerated more easily than those in Notch1. - Abstract: Illegitimate V(D)J recombination at oncogenes and tumor suppressor genes is implicated in formation of several T cell malignancies. Notch1 and Bcl11b, genes involved in developing T cell specification, selection, proliferation, and survival, were previously shown to contain hotspots for deletional illegitimate V(D)J recombination associated with radiation-induced thymic lymphoma. Interestingly, these deletions were also observed in wild-type animals. In this study, we conducted frequency, clonality, and junctional processing analyses of Notch1 and Bcl11b deletions during mouse development and compared results to published analyses of authentic V(D)J rearrangements at the T cell receptor beta (TCRβ) locus and illegitimate V(D)J deletions observed at the human, nonimmune HPRT1 locus not involved in T cell malignancies. We detect deletions in Notch1 and Bcl11b in thymic and splenic T cell populations, consistent with cells bearing deletions in the circulating lymphocyte pool. Deletions in thymus can occur in utero, increase in frequency between fetal and postnatal stages, are detected at all ages examined between fetal and 7 months, exhibit only limited clonality (contrasting with previous results in radiation-sensitive mouse strains), and consistent with previous reports are more frequent in Bcl11b, partially explained by relatively high Recombination Signal Information Content (RIC) scores. Deletion junctions in Bcl11b exhibit greater germline nucleotide loss, while in Notch1 palindromic (P) nucleotides are more abundant, although average P nucleotide length is
Effect of JTV1 gene on the proliferation and apoptosis of K562 cells and its mechanism
Directory of Open Access Journals (Sweden)
Yan WU
2011-05-01
Full Text Available Objective To investigate the effect of tumor-suppressing gene JTV1 on proliferation and apoptosis of leukemic K562 cells,and the changes in apoptosis factors Bcl-2,C-myc and Bax genes.Methods The recombinate vector pcDNA3.1-JTV1,and the empty vector pcDNA3.1 were transfected into K562 cells as control.The cell proliferation of K562 cells was evaluated by colony formation assay;the cell cycle and apoptosis rate were assessed by flow cytometry(FCM;the mRNA levels of apoptosis related genes Bax,Bcl-2 and C-myc were determined by RT-PCR;the protein levels of Bax,Bcl-2 and C-myc were assayed by Western Blotting.Results The colony formation assay showed that the proliferation of K562 cells decreased when the expression of JTV1 gene was up-regulated.FCM assay showed that the G phase cells in pcDNA3.1-JTV1 positive transfection group increased compared with that of the control group and the pcDNA3.1 empty vector transfected group,and the differences were statistically significant(P < 0.05.Compared with the control group and the empty vector group,the mRNA transcription level and the protein translation level of Bax gene increased significantly,and the mRNA transcription level and the protein translation level of Bcl-2 and C-myc gene were reduced significantly(P < 0.05.Conclusions The expressions of Bcl-2 and C-myc gene are inhibited when the gene JTV1 is up-regulated,leading to an increase in Bax gene expression,inhibition of K562 cell proliferation,and promotion of tumor cells apoptosis.Over expression of JTV1 gene can inhibit the proliferation of K562 cells and promote cell apoptosis by inhibiting Bcl-2 and C-myc expression and up-regulating that of Bax.
International Nuclear Information System (INIS)
Yadav, Santosh; Shi Yongli; Wang Feng; Wang He
2010-01-01
Purpose: Environmental exposure to arsenic is an important public health issue. The effects of arsenic on different tissues and organs have been intensively studied. However, the effects of arsenic on bone marrow mesenchymal stem cells (MSCs) have not been reported. This study is designed to investigate the cell death process caused by arsenite and its related underlying mechanisms on MSCs. The rationale is that absorbed arsenic in the blood circulation can reach to the bone marrow and may affect the cell survival of MSCs. Methods: MSCs of passage 1 were purchased from Tulane University, grown till 70% confluency level and plated according to the experimental requirements followed by treatment with arsenite at various concentrations and time points. Arsenite (iAs III ) induced cytotoxic effects were confirmed by cell viability and cell cycle analysis. For the presence of canonic apoptosis markers; DNA damage, exposure of intramembrane phosphotidylserine, protein and m-RNA expression levels were analyzed. Results: iAs III induced growth inhibition, G2-M arrest and apoptotic cell death in MSCs, the apoptosis induced by iAs III in the cultured MSCs was, via altering Bcl-2 family proteins and by involving intrinsic pathway. Conclusion: iAs III can induce apoptosis in bone marrow-derived MSCs via Bcl-2 family proteins, regulating intrinsic apoptotic pathway. Due to the multipotency of MSC, acting as progenitor cells for a variety of connective tissues including bone, adipose, cartilage and muscle, these effects of arsenic may be important in assessing the health risk of the arsenic compounds and understanding the mechanisms of arsenic-induced harmful effects.
International Nuclear Information System (INIS)
Deerberg, Andrea; Sosna, Justyna; Thon, Lutz; Belka, Claus; Adam, Dieter
2009-01-01
Programmed cell death (PCD) is essential for development and homeostasis of multicellular organisms and can occur by caspase-dependent apoptosis or alternatively, by caspase-independent PCD (ciPCD). Bcl-2, a central regulator of apoptosis, localizes to both mitochondria and the endoplasmic reticulum (ER). Whereas a function of mitochondrial and ER-specific Bcl-2 in apoptosis has been established in multiple studies, corresponding data for ciPCD do not exist. We utilized Bcl-2 constructs specifically localizing to mitochondria (Bcl-2 ActA), the ER (Bcl-2 cb5), both (Bcl-2 WT) or the cytosol/nucleus (Bcl-2 ΔTM) and determined their protective effect on ceramide-mediated ciPCD in transiently and stably transfected Jurkat cells. Expression of the constructs was verified by immunoblots. Ceramide-mediated ciPCD was induced by treatment with human recombinant tumor necrosis factor and determined by flow cytometric measurement of propidium iodide uptake as well as by optical analysis of cell morphology. Only wildtype Bcl-2 had the ability to efficiently protect from ceramide-mediated ciPCD, whereas expression of Bcl-2 solely at mitochondria, the ER, or the cytosol/nucleus did not prevent ceramide-mediated ciPCD. Our data suggest a combined requirement for both mitochondria and the ER in the induction and the signaling pathways of ciPCD mediated by ceramide
Directory of Open Access Journals (Sweden)
Belka Claus
2009-10-01
Full Text Available Abstract Background Programmed cell death (PCD is essential for development and homeostasis of multicellular organisms and can occur by caspase-dependent apoptosis or alternatively, by caspase-independent PCD (ciPCD. Bcl-2, a central regulator of apoptosis, localizes to both mitochondria and the endoplasmic reticulum (ER. Whereas a function of mitochondrial and ER-specific Bcl-2 in apoptosis has been established in multiple studies, corresponding data for ciPCD do not exist. Methods We utilized Bcl-2 constructs specifically localizing to mitochondria (Bcl-2 ActA, the ER (Bcl-2 cb5, both (Bcl-2 WT or the cytosol/nucleus (Bcl-2 ΔTM and determined their protective effect on ceramide-mediated ciPCD in transiently and stably transfected Jurkat cells. Expression of the constructs was verified by immunoblots. Ceramide-mediated ciPCD was induced by treatment with human recombinant tumor necrosis factor and determined by flow cytometric measurement of propidium iodide uptake as well as by optical analysis of cell morphology. Results Only wildtype Bcl-2 had the ability to efficiently protect from ceramide-mediated ciPCD, whereas expression of Bcl-2 solely at mitochondria, the ER, or the cytosol/nucleus did not prevent ceramide-mediated ciPCD. Conclusion Our data suggest a combined requirement for both mitochondria and the ER in the induction and the signaling pathways of ciPCD mediated by ceramide.
International Nuclear Information System (INIS)
Ibrahim, N.S.; Hanna, M.O.F.; Farid, R.J.; Zayed, N.A.; Hunter, S.S.; Esmat, J.
2007-01-01
It has been suggested that t(14; 18) translocation of bcl-2 to the immunoglobulin heavy chain (IgH) locus may contribute to the pathogenesis of lymphoproliferative disorders (LPD) related to hepatitis C virus (HCV) infection. The present study aimed to assess the prevalence of bcl-2 translocation in Egyptian chronic HCV patients and to investigate the effect of combination antiviral therapy of interferon a and ribavirin on t(14;18). Fifty five chronic HCV patients were studied for the prevalence of t(l4; 18). These patients were classified into 2 groups, 33 non treated HCV patients and 22 treated HCV patients with antiviral therapy as well as control group of age and sex matched individuals. The bcl-2/IgH rearrangement was detected in peripheral blood mononuclear cells (PBMCs) by nested polymerase chain reaction. All patients have undergone HCV viral determination by real time PCR. Bcl-2/IgH translocation was detected in 21 (38.2%) of all 55 chronically infected HCV patients. Considering all patients with chronic HCV-infection, bcl-2 rearrangement was slightly more frequent in the non treated group than in those who underwent treatment with interferon plus ribavirin but the difference was not statistically significant, although treated patients showed biochemical and virologic response at the end of 6 months of antiviral therapy. In conclusion, t(l4;18) in PBMCs is a frequent finding in chronic HCV infection
Directory of Open Access Journals (Sweden)
Rao Nagesha AS
2009-09-01
Full Text Available Abstract Background Gene expression profiling of spontaneous tumors in the dog offers a unique translational opportunity to identify prognostic biomarkers and signaling pathways that are common to both canine and human. Osteosarcoma (OS accounts for approximately 80% of all malignant bone tumors in the dog. Canine OS are highly comparable with their human counterpart with respect to histology, high metastatic rate and poor long-term survival. This study investigates the prognostic gene profile among thirty-two primary canine OS using canine specific cDNA microarrays representing 20,313 genes to identify genes and cellular signaling pathways associated with survival. This, the first report of its kind in dogs with OS, also demonstrates the advantages of cross-species comparison with human OS. Results The 32 tumors were classified into two prognostic groups based on survival time (ST. They were defined as short survivors (dogs with poor prognosis: surviving fewer than 6 months and long survivors (dogs with better prognosis: surviving 6 months or longer. Fifty-one transcripts were found to be differentially expressed, with common upregulation of these genes in the short survivors. The overexpressed genes in short survivors are associated with possible roles in proliferation, drug resistance or metastasis. Several deregulated pathways identified in the present study, including Wnt signaling, Integrin signaling and Chemokine/cytokine signaling are comparable to the pathway analysis conducted on human OS gene profiles, emphasizing the value of the dog as an excellent model for humans. Conclusion A molecular-based method for discrimination of outcome for short and long survivors is useful for future prognostic stratification at initial diagnosis, where genes and pathways associated with cell cycle/proliferation, drug resistance and metastasis could be potential targets for diagnosis and therapy. The similarities between human and canine OS makes the
Shvarts, A.; Brummelkamp, T.; Koh, E.; Daley, G.Q.; Bernards, R.A.
2002-01-01
Senescence limits the proliferative capacity of primary cells in culture. We describe here a genetic screen to identify genes that allow bypass of this checkpoint. Using retroviral cDNA expression libraries, we identify BCL6 as a potent inhibitor of senescence. BCL6 is frequently activated in
Shvarts, Avi; Brummelkamp, Thijn R.; Scheeren, Ferenc; Koh, Eugene; Daley, George Q.; Spits, Hergen; Bernards, René
2002-01-01
Senescence limits the proliferative capacity of primary cells in culture. We describe here a genetic screen to identify genes that allow bypass of this checkpoint. Using retroviral cDNA expression libraries, we identify BCL6 as a potent inhibitor of senescence. BCL6 is frequently activated in
Role of reactive oxygen species and Bcl-2 family proteins in TNF-α-induced apoptosis of lymphocytes.
Ryazanceva, N V; Novickiy, V V; Zhukova, O B; Biktasova, A K; Chechina, O E; Sazonova, E V; Belkina, M V; Chasovskih, N Yu; Khaitova, Z K
2010-08-01
We studied the in vitro apoptosis-inducing effect of recombinant TNF-α (rTNF-α) on blood lymphocytes from healthy donors. rTNF-α-induced apoptosis was accompanied by an increase in the number of cells with low mitochondrial transmembrane potential, increased intracellular content of reactive oxygen species, reduced content of Bcl-2, Bcl-xL, and Bax proteins, and elevated Bad content. The molecular mechanisms of these changes are discussed.
International Nuclear Information System (INIS)
Nikonorov, A.P.; Moskvitina, E.N.; Kuzyakov, Yu.Ya.; Stepanov, P.I.
1983-01-01
Luminescence in BCl 3 is investigated. The results of measurements of gas temperature, BCl molecules concentration, and luminescence absolute intensity at boron trichloride presure of 40 mm pH and density of laser pulse energy from 1.7 up to 4.0 J/cm 2 are obtained. Nature of uninterrupted spectrum is considered. It is established that luminescence appearing in the BCl 3 under action of pulse CO 2 -laser is caused by reaction of emitting recombination of BCl molecules with chlorine atoms. Rate constant of this reaction in the range of 2300-3100 K is determined
Directory of Open Access Journals (Sweden)
Mohammad Zamani
2012-09-01
Full Text Available Introduction: Preliminary studies have con.rmed reduction in cell death following treatment with antioxidants. According to this .nding we study the relationship between consumption of CoQ10 and expression of Bax and Bcl2 in hippocampus following ischemia/reperfusion as proteins involved in cell programmed death or apoptosis. Methods: We studied the protective role of CoQ10 against ischemia-reperfusion. Experimental design includes four groups: intact, ischemic control, sham control and treatment group with CoQ10. The mice were pre-treated with CoQ10 for a week, then ischemia was induced by common carotid artery ligation and following the reduction in in.ammation (a week the mice was treated with CoQ10. Nissl staining was applied for counting the necrotic cells of hippocampus and the western blot was performed to measure the Bax and Bcl2 expression.Results: Cell death was signi.cantly lower when mice were treated with CoQ10. Bax expression was signi.cantly high in the ischemic group but low in the treatment group, and the bcl2 expression was lower in the ischemic group than the treatment and the vehicle groups.Discussion: Ischemia for 15 minutes induced cell death in hippocampus with more potent effect on CA1. CoQ10 intake signi.cantly reduced cell death and prevented the expression of Bax while inducing an increase in expression of bcl2.
DEFF Research Database (Denmark)
Engström, Maria; Karlsson, Richard; Jönsson, Jan-Ingvar
2003-01-01
OBJECTIVE: Kit ligand (KL) is a major survival factor for hematopoietic stem cells. Although anti-apoptotic bcl-2 family members are expressed in these cells, the survival effects by KL appear to involve other mechanisms. Survival signals can also be elicited by the activation of phosphatidylinos......OBJECTIVE: Kit ligand (KL) is a major survival factor for hematopoietic stem cells. Although anti-apoptotic bcl-2 family members are expressed in these cells, the survival effects by KL appear to involve other mechanisms. Survival signals can also be elicited by the activation......, immunofluorescence, and subcellular fractionation, we analyzed the effects of KL on PKB and different forkhead family members in two factor-dependent cell lines, FDCP-mix and FDC-P1, as well as primary mouse bone marrow-derived Lin(-) progenitors. Forced overexpression of triple mutated form of FoxO3 by retroviral...
Directory of Open Access Journals (Sweden)
Haryono Yuniarto
2017-06-01
Full Text Available Kanker kolorektal menempati urutan kejadian kanker ketiga di seluruh dunia, dengan lebih dari 1 juta angka kejadian tiap tahunnya. Berbagai strategi terapi pengobatan kanker kolorektal tetapi relatif belum optimal. Oleh karena itu, terdapat kebutuhan mengembangkan terapi alternatif sebagai pendamping. Propolis menunjukkan aktivitas proapoptosis pada berbagai jenis sel kanker. Mengetahui pengaruh pemberian propolis yang berasal dari Kerjo, Karanganyar, Indonesia terhadap induksi proses apoptosis dan aktivitas antiproliferasi, terutama terkait dengan penekanan ekspresi protein Bcl 2 dan cyclin D1 pada kultur sel WiDr (cell line kanker kolon. Penelitian eksperimental laboratorik menggunakan post test with control group design. Penelitian dilakukan pada kultur sel WiDr (sel kanker kolon dengan pemberian propolis. Pengamatan ekspresi protein Cyclin D1 dan Bcl2 dilakukan dengan metode imunositokimia, sedangkan pengamatan induksi apoptosis dilakukan dengan flowcytometry. Analisis statistik dengan uji Kruskal-Wallis, signifikan bila p <0,05. Rata-rata ekspresi Bcl2 pada kelima kelompok yaitu kontrol 83.40 ± 0.69 μg/ml, EEP 1/2 IC50 60.63 ± 0.40, EEP IC50 33.77 ± 1.08 μg/ml, EEP 2 IC50 24.28 ± 1.91 μg/ml, 5fluorouracil 12.74 ± 2.19 μg/ml. Terdapat perbedaan bermakna ekspresi Bcl2 antara kelompok uji dibandingkan kelompok kontrol (p < 0,001. Rata-rata ekspresi cyclin D1 pada kelima kelompok yaitu kontrol 83.77 ± 0.39 μg/ml, EEP 1/2 IC50 61.44 ± 0.41, EEP IC50 36.67 ± 1.18 μg/ml, EEP 2 IC50 24.50 ± 0.38 μg/ml, 5fluorouracil 13.42 ± 1.04μg/ml. Terdapat perbedaan bermakna ekspresi cyclin D1 antara kelompok uji dibandingkan kelompok kontrol (p < 0,001. Pemberian ekstrak etanol propolis mempunyai pengaruh menekan ekspresi Bcl2, cyclin D1, dan menginduksi apoptosis pada kultur sel kanker kolon (WiDr Cell Line. Kata Kunci: Ekstrak Ethanol Propolis, Bcl2, cyclin D1, Sel WiDr
Directory of Open Access Journals (Sweden)
Dennie T Frederick
Full Text Available While response rates to BRAF inhibitiors (BRAFi are high, disease progression emerges quickly. One strategy to delay the onset of resistance is to target anti-apoptotic proteins such as BCL-2, known to be associated with a poor prognosis. We analyzed BCL-2 family member expression levels of 34 samples from 17 patients collected before and 10 to 14 days after treatment initiation with either vemurafenib or dabrafenib/trametinib combination. The observed changes in mRNA and protein levels with BRAFi treatment led us to hypothesize that combining BRAFi with a BCL-2 inhibitor (the BH3-mimetic navitoclax would improve outcome. We tested this hypothesis in cell lines and in mice. Pretreatment mRNA levels of BCL-2 negatively correlated with maximal tumor regression. Early increases in mRNA levels were seen in BIM, BCL-XL, BID and BCL2-W, as were decreases in MCL-1 and BCL2A. No significant changes were observed with BCL-2. Using reverse phase protein array (RPPA, significant increases in protein levels were found in BIM and BID. No changes in mRNA or protein correlated with response. Concurrent BRAF (PLX4720 and BCL2 (navitoclax inhibition synergistically reduced viability in BRAF mutant cell lines and correlated with down-modulation of MCL-1 and BIM induction after PLX4720 treatment. In xenograft models, navitoclax enhanced the efficacy of PLX4720. The combination of a selective BRAF inhibitor with a BH3-mimetic promises to be an important therapeutic strategy capable of enhancing the clinical efficacy of BRAF inhibition in many patients that might otherwise succumb quickly to de novo resistance. Trial registrations: ClinicalTrials.gov NCT01006980; ClinicalTrials.gov NCT01107418; ClinicalTrials.gov NCT01264380; ClinicalTrials.gov NCT01248936; ClinicalTrials.gov NCT00949702; ClinicalTrials.gov NCT01072175.
Haque, Abedul; Rahman, Mohammad Aminur; Chen, Zhuo Georgia; Saba, Nabil F; Khuri, Fadlo R; Shin, Dong M; Ruhul Amin, A R M
2015-07-01
Combinatorial approaches using two or more compounds are gaining increasing attention for cancer therapy. We have previously reported that the combination of the EGFR-TKI erlotinib and epigallocatechin-3-gallate (EGCG) exhibited synergistic chemopreventive effects in head and neck cancers by inducing the expression of Bim, p21, p27, and by inhibiting the phosphorylation of ERK and AKT and expression of Bcl-2. In the current study, we further investigated the mechanism of regulation of Bim, Bcl-2, p21 and p27, and their role in apoptosis. shRNA-mediated silencing of Bim significantly inhibited apoptosis induced by the combination of erlotinib and EGCG (p = 0.005). On the other hand, overexpression of Bcl-2 markedly protected cells from apoptosis (p = 0.003), whereas overexpression of constitutively active AKT only minimally protected cells from apoptosis induced by the combination of the two compounds. Analysis of mRNA expression by RT-PCR revealed that erlotinib, EGCG and their combination had no significant effects on the mRNA expression of Bim, p21, p27 or Bcl-2 suggesting the post-transcriptional regulation of these molecules. Furthermore, we found that erlotinib or the combination of EGCG and erlotinib inhibited the phosphorylation of Bim and stabilized Bim after inhibition of protein translation by cycloheximide. Taken together, our results strongly suggest that the combination of erlotinib and EGCG induces apoptosis of SCCHN cells by regulating Bim and Bcl-2 at the posttranscriptional level.
Molecular basis of Bcl-X(L-p53 interaction: insights from molecular dynamics simulations.
Directory of Open Access Journals (Sweden)
Nagakumar Bharatham
Full Text Available Bcl-X(L, an antiapoptotic Bcl-2 family protein, plays a central role in the regulation of the apoptotic pathway. Heterodimerization of the antiapoptotic Bcl-2 family proteins with the proapoptotic family members such as Bad, Bak, Bim and Bid is a crucial step in the apoptotic regulation. In addition to these conventional binding partners, recent evidences reveal that the Bcl-2 family proteins also interact with noncanonical binding partners such as p53. Our previous NMR studies showed that Bcl-X(L: BH3 peptide and Bcl-X(L: SN15 peptide (a peptide derived from residues S15-N29 of p53 complex structures share similar modes of bindings. To further elucidate the molecular basis of the interactions, here we have employed molecular dynamics simulations coupled with MM/PBSA approach. Bcl-X(L and other Bcl-2 family proteins have 4 hydrophobic pockets (p1-p4, which are occupied by four systematically spaced hydrophobic residues (h1-h4 of the proapoptotic Bad and Bak BH3 peptides. We observed that three conserved hydrophobic residues (F19, W23 and L26 of p53 (SN15 peptide anchor into three hydrophobic pockets (p2-p4 of Bcl-X(L in a similar manner as BH3 peptide. Our results provide insights into the novel molecular recognition by Bcl-X(L with p53.
Cheng, Hongwei; Wu, Zhixian; Wu, Caisheng; Wang, Xiaoyuan; Liow, Sing Shy; Li, Zibiao; Wu, Yun-Long
2018-02-01
Stanniocalcin 2 (STC2) overexpression in hepatocellular carcinoma (HCC) could lead to poor prognosis, which might be due to its induced P-glycoprotein and Bcl-2 protein expression level increase. P-glycoprotein or membrane pump induced drug efflux and altered prosurvival Bcl-2 expression are key mechanisms for drug resistance leading to failure of chemotherapy in HCC. However, current strategy to overcome both P-glycoprotein and Bcl-2 protein induced drug resistance was rarely reported. In this work, we utilized an amphiphilic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) cationic polyester to encapsulate chemotherapeutic paclitaxel (PTX) in hydrophobic PHB domain and Bcl-2 convertor Nur77/ΔDBD gene (Nur77 without DNA binding domain for mitochondria localization) by formation of polyplex due to cationic PDMAEMA segment, to effectively inhibit the drug resistant HepG2/STC2 and SMCC7721/STC2 liver cancer cell growth. Thanks to the cationic nanoparticle complex formation ability and high transfection efficiency to express Bcl-2 conversion proteins, PHB-PDMAEMA/PTX@polyplex could partially impair P-glycoprotein induced PTX efflux and activate the apoptotic function of previous prosurvival Bcl-2 protein. This is the pioneer report of cationic amphiphilic polyester PHB-PDMAEMA to codeliver anticancer drug and therapeutic plasmid to overcome both pump and non-pump mediated chemotherapeutic resistance in liver cancer cells, which might be inspiring for the application of polyester in personalized cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Ming-Yang; Chen, Pai-Sheng; Prakash, Ekambaranellore; Hsu, Hsing-Chih; Huang, Hsin-Yi; Lin, Ming-Tsan; Chang, King-Jen; Kuo, Min-Liang
2009-04-15
Connective tissue growth factor (CTGF) expression is elevated in advanced breast cancer and promotes metastasis. Chemotherapy response is only transient in most metastatic diseases. In the present study, we examined whether CTGF expression could confer drug resistance in human breast cancer. In breast cancer patients who received neoadjuvant chemotherapy, CTGF expression was inversely associated with chemotherapy response. Overexpression of CTGF in MCF7 cells (MCF7/CTGF) enhanced clonogenic ability, cell viability, and resistance to apoptosis on exposure to doxorubicin and paclitaxel. Reducing the CTGF level in MDA-MB-231 (MDA231) cells by antisense CTGF cDNA (MDA231/AS cells) mitigated this drug resistance capacity. CTGF overexpression resulted in resistance to doxorubicin- and paclitaxel-induced apoptosis by up-regulation of Bcl-xL and cellular inhibitor of apoptosis protein 1 (cIAP1). Knockdown of Bcl-xL or cIAP1 with specific small interfering RNAs abolished the CTGF-mediated resistance to apoptosis induced by the chemotherapeutic agents in MCF7/CTGF cells. Inhibition of extracellular signal-regulated kinase (ERK)-1/2 effectively reversed the resistance to apoptosis as well as the up-regulation of Bcl-xL and cIAP1 in MCF7/CTGF cells. A neutralizing antibody against integrin alpha(v)beta(3) significantly attenuated CTGF-mediated ERK1/2 activation and up-regulation of Bcl-xL and cIAP1, indicating that the integrin alpha(v)beta(3)/ERK1/2 signaling pathway is essential for CTGF functions. The Bcl-xL level also correlated with the CTGF level in breast cancer patients. We also found that a COOH-terminal domain peptide from CTGF could exert activities similar to full-length CTGF, in activation of ERK1/2, up-regulation of Bcl-xL/cIAP1, and resistance to apoptosis. We conclude that CTGF expression could confer resistance to chemotherapeutic agents through augmenting a survival pathway through ERK1/2-dependent Bcl-xL/cIAP1 up-regulation.
Directory of Open Access Journals (Sweden)
Álvaro Cuesta-Domínguez
Full Text Available Chromosomal translocations in tumors frequently produce fusion genes coding for chimeric proteins with a key role in oncogenesis. Recent reports described a BCR-JAK2 fusion gene in fatal chronic and acute myeloid leukemia, but the functional behavior of the chimeric protein remains uncharacterized. We used fluorescence in situ hybridization and reverse transcription polymerase chain reaction (RT-PCR assays to describe a BCR-JAK2 fusion gene from a patient with acute lymphoblastic leukemia. The patient has been in complete remission for six years following treatment and autologous transplantation, and minimal residual disease was monitored by real-time RT-PCR. BCR-JAK2 codes for a protein containing the BCR oligomerization domain fused to the JAK2 tyrosine-kinase domain. In vitro analysis of transfected cells showed that BCR-JAK2 is located in the cytoplasm. Transduction of hematopoietic Ba/F3 cells with retroviral vectors carrying BCR-JAK2 induced IL-3-independent cell growth, constitutive activation of the chimeric protein as well as STAT5 phosphorylation and translocation to the nuclei, where Bcl-xL gene expression was elicited. Primary mouse progenitor cells transduced with BCR-JAK2 also showed increased proliferation and survival. Treatment with the JAK2 inhibitor TG101209 abrogated BCR-JAK2 and STAT5 phosphorylation, decreased Bcl-xL expression and triggered apoptosis of transformed Ba/F3 cells. Therefore, BCR-JAK2 is a novel tyrosine-kinase with transforming activity. It deregulates growth factor-dependent proliferation and cell survival, which can be abrogated by the TG101209 inhibitor. Moreover, transformed Ba/F3 cells developed tumors when injected subcutaneously into nude mice, thus proving the tumorigenic capacity of BCR-JAK2 in vivo. Together these findings suggest that adult and pediatric patients with BCR-ABL-negative leukemia and JAK2 overexpression may benefit from targeted therapies.
International Nuclear Information System (INIS)
Damodaran, T.V.; Attia, M.K.; Abou-Donia, M.B.
2011-01-01
Organophosphorus-ester induced delayed neurotoxicity (OPIDN) is a neurodegenerative disorder characterized by ataxia progressing to paralysis with a concomitant central and peripheral, distal axonapathy. Diisopropylphosphorofluoridate (DFP) produces OPIDN in the chicken that results in mild ataxia in 7–14 days and severe paralysis as the disease progresses with a single dose. White leghorn layer hens were treated with DFP (1.7 mg/kg, sc) after prophylactic treatment with atropine (1 mg/kg, sc) in normal saline and eserine (1 mg/kg, sc) in dimethyl sulfoxide. Control groups were treated with vehicle propylene glycol (0.1 ml/kg, sc), atropine in normal saline and eserine in dimethyl sulfoxide. The hens were euthanized at different time points such as 1, 2, 5, 10 and 20 days, and the tissues from cerebrum, midbrain, cerebellum, brainstem and spinal cord were quickly dissected and frozen for mRNA (northern) studies. Northern blots were probed with BCL2, GADD45, beta actin, and 28S RNA to investigate their expression pattern. Another set of hens was treated for a series of time points and perfused with phosphate buffered saline and fixative for histological studies. Various staining protocols such as Hematoxylin and Eosin (H and E); Sevier-Munger; Cresyl echt Violet for Nissl substance; and Gallocynin stain for Nissl granules were used to assess various patterns of cell death and degenerative changes. Complex cell death mechanisms may be involved in the neuronal and axonal degeneration. These data indicate altered and differential mRNA expressions of BCL2 (anti apoptotic gene) and GADD45 (DNA damage inducible gene) in various tissues. Increased cell death and other degenerative changes noted in the susceptible regions (spinal cord and cerebellum) than the resistant region (cerebrum), may indicate complex molecular pathways via altered BCL2 and GADD45 gene expression, causing the homeostatic imbalance between cell survival and cell death mechanisms. Semi quantitative
International Nuclear Information System (INIS)
Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato
2004-01-01
To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment
International Nuclear Information System (INIS)
Vlachaki, Maria T.; Meyn, Raymond E.
1998-01-01
Purpose: The expression of the bcl-2 proto-oncogene has been associated with resistance to radiation-induced apoptosis. There is evidence that the bcl-2 protein acts in an antioxidant pathway to block the effects of reactive oxygen species that mediate apoptosis possibly by increasing the levels of intracellular glutathione. Our hypothesis is that pretreatment of radiation-sensitive cells, known to lack bcl-2 expression, with antioxidants will reduce radiation-induced apoptosis. For this purpose, the apoptotic response to radiation and the intracellular levels of GSH were tested before and after pretreatment with antioxidants in two murine lymphoma cell lines, a radiation-resistant, bcl-2- expressing (LY-ar) line and a radiation-sensitive, non-bcl-2-expressing (LY-as) line. Methods and Materials: LY-ar and LY-as cells were irradiated at 0,1,2,3, and 4 hours before collection. The intracellular levels of reduced (GSH) and oxidized (GSSG) glutathione were determined by the use of the fluorescent dye o-phthalaldehyde. LY-as cells were treated with GSH ethyl-ester for 1 and 2 hours after irradiation. Apoptotic response was measured by the DNA fragmentation assay. The radiation dose was 2.5 Gy. Results: After irradiation, the apoptotic rate of LY-ar and LY-as cells was 10-20% and 50-70% respectively. LY-ar cells had higher intracellular GSH and GSSG levels compared to LY-as cells by 69.9% and 91.9% respectively and the GSH/GSSG ratio in LY-ar and LY-as cells was 15.09 and 17.09 respectively. GSH levels did not change during the first 2 hours after irradiation; however, there was a 49% and 84% reduction at 3 and 4 hours after irradiation, respectively, times at which the LY-as cells have already fragmented their DNA. Treatment of LY-as cells with GSH ethyl-ester at a concentration of 7 mM for 1 and 2 hours resulted in 70% and 231% increases in the intracellular GSH levels respectively. Treatment of LY-as cells with GSH ethyl-ester for 1 and 2 hours also conferred a 25
Directory of Open Access Journals (Sweden)
Bo Ram Seo
Full Text Available The PI3K/Akt and mTOR signaling pathways are important for cell survival and growth, and they are highly activated in cancer cells compared with normal cells. Therefore, these signaling pathways are targets for inducing cancer cell death. The dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 completely inhibited both signaling pathways. However, NVP-BEZ235 had no effect on cell death in human renal carcinoma Caki cells. We tested whether combined treatment with natural compounds and NVP-BEZ235 could induce cell death. Among several chemopreventive agents, curcumin, a natural biologically active compound that is extracted from the rhizomes of Curcuma species, markedly induced apoptosis in NVP-BEZ235-treated cells. Co-treatment with curcumin and NVP-BEZ235 led to the down-regulation of Mcl-1 protein expression but not mRNA expression. Ectopic expression of Mcl-1 completely inhibited curcumin plus NVP-NEZ235-induced apoptosis. Furthermore, the down-regulation of Bcl-2 was involved in curcumin plus NVP-BEZ235-induced apoptosis. Curcumin or NVP-BEZ235 alone did not change Bcl-2 mRNA or protein expression, but co-treatment reduced Bcl-2 mRNA and protein expression. Combined treatment with NVP-BEZ235 and curcumin reduced Bcl-2 expression in wild-type p53 HCT116 human colon carcinoma cells but not p53-null HCT116 cells. Moreover, Bcl-2 expression was completely reversed by treatment with pifithrin-α, a p53-specific inhibitor. Ectopic expression of Bcl-2 also inhibited apoptosis in NVP-BE235 plus curcumin-treated cells. In contrast, NVP-BEZ235 combined with curcumin did not have a synergistic effect on normal human skin fibroblasts and normal human mesangial cells. Taken together, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level.
microRNA-10b Is Overexpressed and Critical for Cell Survival and Proliferation in Medulloblastoma.
Directory of Open Access Journals (Sweden)
Rekha Pal
Full Text Available This study demonstrates the effects of miRNA-10b on medulloblastoma proliferation through transcriptional induction of the anti-apoptotic protein BCL2. Using a cancer specific miRNA-array, high expression of miRNA-10b in medulloblastoma cell lines compared to a normal cerebellar control was shown, and this was confirmed with real time PCR (RT-PCR. Two medulloblastoma cell lines (DAOY and UW228 were transiently transfected with control miRNA, miRNA-10b inhibitor or miRNA-10b mimic and subjected to RT-PCR, MTT, apoptosis, clonogenic assay and western blot analysis. Transfection of miRNA-10b inhibitor induced a significant down-regulation of miRNA-10b expression, inhibited proliferation, and induced apoptosis, while miRNA-10b mimic exerted an opposite effect. Inhibition of miRNA-10b abrogated the colony-forming capability of medulloblastoma cells, and markedly down-regulated the expression of BCL2. Down-regulation of BCL2 by antisense oligonucleotides or siRNA also significantly down-regulated miRNA-10b, suggesting that BCL2 is a major mediator of the effects of miRNA-10b. ABT-737 and ABT-199, potent inhibitors of BCL2, downregulated the expression of miRNA-10b and increased apoptosis. Analysis of miRNA-10b levels in 13 primary medulloblastoma samples revealed that the 2 patients with the highest levels of miRNA-10b had multiple recurrences (4.5 and died within 8 years of diagnosis, compared with the 11 patients with low levels of miRNA-10b who had a mean of 1.2 recurrences and nearly 40% long-term survival. The data presented here indicate that miRNA-10b may act as an oncomir in medulloblastoma tumorigenesis, and reveal a previously unreported mechanism with Bcl-2 as a mediator of the effects of miRNA-10b upon medulloblastoma cell survival.
Jiang, Xiaoyu; Tao, Huiren; Qiu, Cuiting; Ma, Xiaolei; Li, Shan; Guo, Xian; Lv, Anlin; Li, Huan
2016-09-05
The aim of this study was to investigate the effect of vitamin K2 on aortic calcification induced by warfarin via Gas6/Axl survival pathway in rats. A calcification model was established by administering 3mg/g warfarin to rats. Rats were divided into 9 groups: control group (0W, 4W, 6W and 12W groups), 4W calcification group, 6W calcification group, 12W calcification group, 6W calcification+6W normal group and 6W calcification+6W vitamin K2 group. Alizarin red S staining measured aortic calcium depositions; alkaline phosphatase activity in serum was measured by a kit; apoptosis was evaluated by TUNEL assay; protein expression levels of Gas6, Axl, phosphorylated Akt (p-Akt), and Bcl-2 were determined by western blotting. The calcium content, calcium depositions, ALP activity and apoptosis were significantly higher in the calcification groups than control group. Gas6, Axl, p-Akt and Bcl-2 expression was lower in the calcification group than control group. 100μg/g vitamin K2 treatment decreased calcium depositions, ALP activity and apoptosis significantly, but increased Gas6, Axl, p-Akt and Bcl-2 expression. 100μg/g vitamin K2 reversed 44% calcification. Pearson correlation analysis showed a positive correlation between formation calcification and apoptosis (R(2)=0.8853, PK2 can inhibit warfarin-induced aortic calcification and apoptosis. The regression of aortic calcification by vitamin K2 involved the Gas6/Axl axis. This data may provide a theoretical basis for future clinical treatments for aortic calcification. Copyright © 2016 Elsevier B.V. All rights reserved.
Núñez, Manuel Antonio Gordón; de Matos, Felipe Rodrigues; Freitas, Roseana de Almeida; Galvão, Hébel Cavalcanti
2013-07-01
The objective of this study was to compare the immunoexpression of integrin α₅β₁, fibronectin, and the Bcl-2 protein in normal oral mucosa (NOM), inflammatory fibroepithelial hyperplasia (IFH), oral epithelial dysplasia (OED), and oral squamous cell carcinoma (OSCC). Eleven cases of NOM, 16 IFH, 20 OED, and 27 OSCC were selected for analysis of the immunoexpression of integrin α₅β₁, fibronectin, and bcl-2 protein. There was an association between the intensity and location of the integrin α₅β₁ expression, especially in the OSCC, that 48.1% of cases showed weak immunoreactivity and 40.7% in the suprabasal layer (P < 0.05). There was an association between the pattern and distribution of fibronectin expression in basement membrane, where 90% of NOM showed a pattern of linear continuous and 80% of OED exhibited focal distribution (P < 0.05). The fibronectin expression in connective tissue was predominantly intense with an association of staining pattern among the different specimens, where 37% of OSCC showed a reticular pattern (P < 0.05). There was an association of bcl-2 protein among the types of specimens, especially in IFH and OSCC, where 100% of the cases exhibited scores 1 of staining (P < 0.05). Within this context, the interaction of integrin α₅β₁ with its main ligand in the extracellular matrix, fibronectin, is suggested to influence the survival of tumor cells and to favor their proliferation by modulating apoptosis through the upregulation of antiapoptotic proteins or the suppression of apoptotic mediators.
Gonzalez, Laura E; Juknat, A Ana; Venosa, Andrea J; Verrengia, Noemi; Kotler, Mónica L
2008-12-01
Manganese induces the central nervous system injury leading to manganism, by mechanisms not completely understood. Chronic exposure to manganese generates oxidative stress and induces the mitochondrial permeability transition. In the present study, we characterized apoptotic cell death mechanisms associated with manganese toxicity in rat cortical astrocytes and demonstrated that (i) Mn treatment targets the mitochondria and induces mitochondrial membrane depolarization followed by cytochrome c release to the cytoplasm, (ii) Mn induces both effector caspases 3/7 and 6 as well as PARP-1 cleavage and (iii) Mn shifts the balance of cell death/survival of Bcl-2 family proteins to favor the apoptotic demise of astrocytes. Our model system using cortical rat astrocytes treated with Mn would emerge as a good tool for investigations aimed to elucidate the role of apoptosis in manganism.
Effect of Bcl11b genotypes and γ-radiation on the development of mouse thymic lymphomas
International Nuclear Information System (INIS)
Yoshikai, Yoshihiro; Sato, Toshihiro; Morita, Shinichi; Kohara, Yuki; Takagi, Ritsuo; Mishima, Yukio; Kominami, Ryo
2008-01-01
Bcl11b is a haploinsufficient tumor suppressor gene and expressed in many tissues such as thymus, brain and skin. Irradiated Bcl11b +/- heterozygous mice mostly develop thymic lymphomas, but the preference of Bcl11b inactivation for thymic lymphomas remains to be addressed. We produced Bcl11b +/- heterozygous and Bcl11b wild-type mice of p53 +/- background and compared their incidence of γ-ray induced thymic lymphomas. Majority of the tumors in p53 +/- mice were skin tumors, and only 5 (36%) of the 14 tumors were thymic lymphomas. In contrast, Bcl11b +/- p53 +/- doubly heterozygous mice developed thymic lymphomas at the frequency of 27 (79%) of the 34 tumors developed (P = 0.008). This indicates the preference of Bcl11b impairment for thymic lymphoma development. We also analyzed loss of the wild-type alleles in the 27 lymphomas, a predicted consequence given by γ-irradiation. However, the loss frequency was low, only six (22%) for Bcl11b and five (19%) for p53. The frequencies did not differ from those of spontaneously developed thymic lymphomas in the doubly heterozygous mice, though the latency of lymphoma development markedly differed between them. This suggests that the main contribution of irradiation at least in those mice is not for the tumor initiation by inducing allelic losses but probably for the promotion of thymic lymphoma development
Automated microinjection of recombinant BCL-X into mouse zygotes enhances embryo development.
Directory of Open Access Journals (Sweden)
Xinyu Liu
Full Text Available Progression of fertilized mammalian oocytes through cleavage, blastocyst formation and implantation depends on successful implementation of the developmental program, which becomes established during oogenesis. The identification of ooplasmic factors, which are responsible for successful embryo development, is thus crucial in designing possible molecular therapies for infertility intervention. However, systematic evaluation of molecular targets has been hampered by the lack of techniques for efficient delivery of molecules into embryos. We have developed an automated robotic microinjection system for delivering cell impermeable compounds into preimplantation embryos with a high post-injection survival rate. In this paper, we report the performance of the system on microinjection of mouse embryos. Furthermore, using this system we provide the first evidence that recombinant BCL-XL (recBCL-XL protein is effective in preventing early embryo arrest imposed by suboptimal culture environment. We demonstrate that microinjection of recBCL-XL protein into early-stage embryos repairs mitochondrial bioenergetics, prevents reactive oxygen species (ROS accumulation, and enhances preimplantation embryo development. This approach may lead to a possible treatment option for patients with repeated in vitro fertilization (IVF failure due to poor embryo quality.
Haftmann, Claudia; Stittrich, Anna-Barbara; Zimmermann, Jakob; Fang, Zhuo; Hradilkova, Kristyna; Bardua, Markus; Westendorf, Kerstin; Heinz, Gitta A; Riedel, René; Siede, Julia; Lehmann, Katrin; Weinberger, Esther E; Zimmel, David; Lauer, Uta; Häupl, Thomas; Sieper, Joachim; Backhaus, Marina; Neumann, Christian; Hoffmann, Ute; Porstner, Martina; Chen, Wei; Grün, Joachim R; Baumgrass, Ria; Matz, Mareen; Löhning, Max; Scheffold, Alexander; Wittmann, Jürgen; Chang, Hyun-Dong; Rajewsky, Nikolaus; Jäck, Hans-Martin; Radbruch, Andreas; Mashreghi, Mir-Farzin
2015-04-01
Repeatedly activated T helper 1 (Th1) cells present during chronic inflammation can efficiently adapt to the inflammatory milieu, for example, by expressing the transcription factor Twist1, which limits the immunopathology caused by Th1 cells. Here, we show that in repeatedly activated murine Th1 cells, Twist1 and T-bet induce expression of microRNA-148a (miR-148a). miR-148a regulates expression of the proapoptotic gene Bim, resulting in a decreased Bim/Bcl2 ratio. Inhibition of miR-148a by antagomirs in repeatedly activated Th1 cells increases the expression of Bim, leading to enhanced apoptosis. Knockdown of Bim expression by siRNA in miR-148a antagomir-treated cells restores viability of the Th1 cells, demonstrating that miR-148a controls survival by regulating Bim expression. Thus, Twist1 and T-bet not only control the differentiation and function of Th1 cells, but also their persistence in chronic inflammation. © 2014 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Noha Sharafeldin
2017-09-01
Full Text Available Characterization of gene-environment interactions (GEIs in cancer is limited. We aimed at identifying GEIs in rectal cancer focusing on a relevant biologic process involving the angiogenesis pathway and relevant environmental exposures: cigarette smoking, alcohol consumption, and animal protein intake. We analyzed data from 747 rectal cancer cases and 956 controls from the Diet, Activity and Lifestyle as a Risk Factor for Rectal Cancer study. We applied a 3-step analysis approach: first, we searched for interactions among single nucleotide polymorphisms on the pathway genes; second, we searched for interactions among the genes, both steps using Logic regression; third, we examined the GEIs significant at the 5% level using logistic regression for cancer risk and Cox proportional hazards models for survival. Permutation-based test was used for multiple testing adjustment. We identified 8 significant GEIs associated with risk among 6 genes adjusting for multiple testing: TNF (OR = 1.85, 95% CI: 1.10, 3.11, TLR4 (OR = 2.34, 95% CI: 1.38, 3.98, and EGR2 (OR = 2.23, 95% CI: 1.04, 4.78 with smoking; IGF1R (OR = 1.69, 95% CI: 1.04, 2.72, TLR4 (OR = 2.10, 95% CI: 1.22, 3.60 and EGR2 (OR = 2.12, 95% CI: 1.01, 4.46 with alcohol; and PDGFB (OR = 1.75, 95% CI: 1.04, 2.92 and MMP1 (OR = 2.44, 95% CI: 1.24, 4.81 with protein. Five GEIs were associated with survival at the 5% significance level but not after multiple testing adjustment: CXCR1 (HR = 2.06, 95% CI: 1.13, 3.75 with smoking; and KDR (HR = 4.36, 95% CI: 1.62, 11.73, TLR2 (HR = 9.06, 95% CI: 1.14, 72.11, EGR2 (HR = 2.45, 95% CI: 1.42, 4.22, and EGFR (HR = 6.33, 95% CI: 1.95, 20.54 with protein. GEIs between angiogenesis genes and smoking, alcohol, and animal protein impact rectal cancer risk. Our results support the importance of considering the biologic hypothesis to characterize GEIs associated with cancer outcomes.
Analysis of DNA repair gene polymorphisms and survival in low-grade and anaplastic gliomas
DEFF Research Database (Denmark)
Berntsson, Shala Ghaderi; Wibom, Carl; Sjöström, Sara
2011-01-01
different DNA repair genes (ATM, NEIL1, NEIL2, ERCC6 and RPA4) which were associated with survival. Finally, these eight genetic variants were adjusted for treatment, malignancy grade, patient age and gender, leaving one variant, rs4253079, mapped to ERCC6, with a significant association to survival (OR 0...
Shah, O Jameel; Lin, Xiaoyu; Li, Leiming; Huang, Xiaoli; Li, Junling; Anderson, Mark G; Tang, Hua; Rodriguez, Luis E; Warder, Scott E; McLoughlin, Shaun; Chen, Jun; Palma, Joann; Glaser, Keith B; Donawho, Cherrie K; Fesik, Stephen W; Shen, Yu
2010-07-13
Aurora kinase B inhibitors induce apoptosis secondary to polyploidization and have entered clinical trials as an emerging class of neocytotoxic chemotherapeutics. We demonstrate here that polyploidization neutralizes Mcl-1 function, rendering cancer cells exquisitely dependent on Bcl-XL/-2. This "addiction" can be exploited therapeutically by combining aurora kinase inhibitors and the orally bioavailable BH3 mimetic, ABT-263, which inhibits Bcl-XL, Bcl-2, and Bcl-w. The combination of ABT-263 with aurora B inhibitors produces a synergistic loss of viability in a range of cell lines of divergent tumor origin and exhibits more sustained tumor growth inhibition in vivo compared with aurora B inhibitor monotherapy. These data demonstrate that Bcl-XL/-2 is necessary to support viability during polyploidization in a variety of tumor models and represents a druggable molecular vulnerability with potential therapeutic utility.
Gene expression of the mismatch repair gene MSH2 in primary colorectal cancer
DEFF Research Database (Denmark)
Jensen, Lars Henrik; Kuramochi, Hidekazu; Crüger, Dorthe Gylling
2011-01-01
promoter was only detected in 14 samples and only at a low level with no correlation to gene expression. MSH2 gene expression was not a prognostic factor for overall survival in univariate or multivariate analysis. The gene expression of MSH2 is a potential quantitative marker ready for further clinical...
The prognosis of MYC translocation positive diffuse large B-cell lymphoma depends on the second hit.
Clipson, Alexandra; Barrans, Sharon; Zeng, Naiyan; Crouch, Simon; Grigoropoulos, Nicholas F; Liu, Hongxiang; Kocialkowski, Sylvia; Wang, Ming; Huang, Yuanxue; Worrillow, Lisa; Goodlad, John; Buxton, Jenny; Neat, Michael; Fields, Paul; Wilkins, Bridget; Grant, John W; Wright, Penny; Ei-Daly, Hesham; Follows, George A; Roman, Eve; Watkins, A James; Johnson, Peter W M; Jack, Andrew; Du, Ming-Qing
2015-07-01
A proportion of MYC translocation positive diffuse large B-cell lymphomas (DLBCL) harbour a BCL2 and/or BCL6 translocation, known as double-hit DLBCL, and are clinically aggressive. It is unknown whether there are other genetic abnormalities that cooperate with MYC translocation and form double-hit DLBCL, and whether there is a difference in clinical outcome between the double-hit DLBCL and those with an isolated MYC translocation. We investigated TP53 gene mutations along with BCL2 and BCL6 translocations in a total of 234 cases of DLBCL, including 81 with MYC translocation. TP53 mutations were investigated by PCR and sequencing, while BCL2 and BCL6 translocation was studied by interphase fluorescence in situ hybridization. The majority of MYC translocation positive DLBCLs (60/81 = 74%) had at least one additional genetic hit. In MYC translocation positive DLBCL treated by R-CHOP ( n = 67), TP53 mutation and BCL2, but not BCL6 translocation had an adverse effect on patient overall survival. In comparison with DLBCL with an isolated MYC translocation, cases with MYC/TP53 double-hits had the worst overall survival, followed by those with MYC/BCL2 double-hits. In MYC translocation negative DLBCL treated by R-CHOP ( n = 101), TP53 mutation, BCL2 and BCL6 translocation had no impact on patient survival. The prognosis of MYC translocation positive DLBCL critically depends on the second hit, with TP53 mutations and BCL2 translocation contributing to an adverse prognosis. It is pivotal to investigate both TP53 mutations and BCL2 translocations in MYC translocation positive DLBCL, and to distinguish double-hit DLBCLs from those with an isolated MYC translocation.
Mensink, Mark; Anstee, Natasha S; Robati, Mikara; Schenk, Robyn L; Herold, Marco J; Cory, Suzanne; Vandenberg, Cassandra J
2018-03-01
The transcription factor c-MYC regulates a multiplicity of genes involved in cellular growth, proliferation, metabolism and DNA damage response and its overexpression is a hallmark of many tumours. Since MYC promotes apoptosis under conditions of stress, such as limited availability of nutrients or cytokines, MYC-driven cells are very much dependent on signals that inhibit cell death. Stress signals trigger apoptosis via the pathway regulated by opposing fractions of the BCL-2 protein family and previous genetic studies have shown that the development of B lymphoid tumours in Eµ-Myc mice is critically dependent on expression of pro-survival BCL-2 relatives MCL-1, BCL-W and, to a lesser extent, BCL-X L , but not BCL-2 itself, and that sustained growth of these lymphomas is dependent on MCL-1. Using recently developed mice that lack expression of all three functional pro-survival A1 genes, we show here that the kinetics of lymphoma development in Eµ-Myc mice and the competitive repopulation capacity of Eµ-Myc haemopoietic stem and progenitor cells is unaffected by the absence of A1. However, conditional loss of a single remaining functional A1 gene from transplanted A1-a -/- A1-b fl/fl A1-c -/- Eµ-Myc lymphomas slowed their expansion, significantly extending the life of the transplant recipients. Thus, A1 contributes to the survival of malignant Eµ-Myc-driven B lymphoid cells. These results strengthen the case for BFL-1, the human homologue of A1, being a valid target for drug development for MYC-driven tumours.
Gautam, S; Kirschnek, S; Gentle, I E; Kopiniok, C; Henneke, P; Häcker, H; Malleret, L; Belaaouaj, A; Häcker, G
2013-08-01
Differentiation of neutrophil granulocytes (neutrophils) occurs through several steps in the bone marrow and requires a coordinate regulation of factors determining survival and lineage-specific development. A number of genes are known whose deficiency disrupts neutrophil generation in humans and in mice. One of the proteins encoded by these genes, glucose-6-phosphatase-β (G6PC3), is involved in glucose metabolism. G6PC3 deficiency causes neutropenia in humans and in mice, linked to enhanced apoptosis and ER stress. We used a model of conditional Hoxb8 expression to test molecular and functional differentiation as well as survival defects in neutrophils from G6PC3(-/-) mice. Progenitor lines were established and differentiated into neutrophils when Hoxb8 was turned off. G6PC3(-/-) progenitor cells underwent substantial apoptosis when differentiation was started. Transgenic expression of Bcl-XL rescued survival; however, Bcl-XL-protected differentiated cells showed reduced proliferation, immaturity and functional deficiency such as altered MAP kinase signaling and reduced cytokine secretion. Impaired glucose utilization was found and was associated with ER stress and apoptosis, associated with the upregulation of Bim and Bax; downregulation of Bim protected against apoptosis during differentiation. ER-stress further caused a profound loss of expression and secretion of the main neutrophil product neutrophil elastase during differentiation. Transplantation of wild-type Hoxb8-progenitor cells into irradiated mice allowed differentiation into neutrophils in the bone marrow in vivo. Transplantation of G6PC3(-/-) cells yielded few mature neutrophils in bone marrow and peripheral blood. Transgenic Bcl-XL permitted differentiation of G6PC3(-/-) cells in vivo. However, functional deficiencies and differentiation abnormalities remained. Differentiation of macrophages from Hoxb8-dependent progenitors was only slightly disturbed. A combination of defects in differentiation
Directory of Open Access Journals (Sweden)
Guodong Liu
2018-02-01
Full Text Available Background/Aims: Ischemia-reperfusion (I/R injury is an unavoidable event occurring during heart transplantation and is a key factor in graft failure and the long-term survival rate of recipients. Therefore, there is an urgent need for the development of new therapies to prevent I/R injury. Clusterin is a hetero-dimeric glycoprotein with an antiapoptotic function. In this study, we investigated whether clusterin was cardioprotective in heart transplantation against I/R injury using an in vivo rat model and an in vitro cell culture system, and examined the underlying mechanisms of I/R injury. Methods: Heart grafts from wild-type C57BL/6 mice were preserved in UW solution (control or UW solution containing recombinant human apolipoprotein-J (hr clusterin for 24 h. The preserved hearts were implanted into recipient mice of the same strain as the donors for 72 h, and the heart grafts were then taken for histopathological and gene expression analyses. An in vitro ischemia reperfusion model using H9C2 cells or H9C2/clusterin cDNA cells was constructed. The expression of clusterin, p65, Bax, Bcl-xL, IL-1β, and TNF-α protein and mRNA in heart tissue and H9C2 cells was detected by western blot, reverse transcription-polymerase chain reaction (RT-PCR, and quantitative RT-PCR assays; IL-1β and TNF-α protein was detected by enzyme-linked immunosorbent assays; NF-kB activity was detected by an electrophoretic mobility shift assay; cell apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling and flow cytometric analyses. Results: Cold I/R caused severe morphologic myocardial injury to heart grafts from wild-type C57BL/6 mice, whereas grafts from hr clusterin preservation showed less damage, as demonstrated by decreased cell apoptosis/death, decreased neutrophil infiltration, and the preservation of the normal structure of the heart. Clusterin reduced the expression of p65, pre-inflammatory IL-1β, and TNF-α, and
Liu, Guodong; Zhang, Hongmei; Hao, Fengyun; Hao, Jing; Pan, Lixiao; Zhao, Qing; Wo, Jinshan
2018-01-01
Ischemia-reperfusion (I/R) injury is an unavoidable event occurring during heart transplantation and is a key factor in graft failure and the long-term survival rate of recipients. Therefore, there is an urgent need for the development of new therapies to prevent I/R injury. Clusterin is a hetero-dimeric glycoprotein with an antiapoptotic function. In this study, we investigated whether clusterin was cardioprotective in heart transplantation against I/R injury using an in vivo rat model and an in vitro cell culture system, and examined the underlying mechanisms of I/R injury. Heart grafts from wild-type C57BL/6 mice were preserved in UW solution (control) or UW solution containing recombinant human apolipoprotein-J (hr clusterin) for 24 h. The preserved hearts were implanted into recipient mice of the same strain as the donors for 72 h, and the heart grafts were then taken for histopathological and gene expression analyses. An in vitro ischemia reperfusion model using H9C2 cells or H9C2/clusterin cDNA cells was constructed. The expression of clusterin, p65, Bax, Bcl-xL, IL-1β, and TNF-α protein and mRNA in heart tissue and H9C2 cells was detected by western blot, reverse transcription-polymerase chain reaction (RT-PCR), and quantitative RT-PCR assays; IL-1β and TNF-α protein was detected by enzyme-linked immunosorbent assays; NF-kB activity was detected by an electrophoretic mobility shift assay; cell apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling and flow cytometric analyses. Cold I/R caused severe morphologic myocardial injury to heart grafts from wild-type C57BL/6 mice, whereas grafts from hr clusterin preservation showed less damage, as demonstrated by decreased cell apoptosis/death, decreased neutrophil infiltration, and the preservation of the normal structure of the heart. Clusterin reduced the expression of p65, pre-inflammatory IL-1β, and TNF-α, and the pro-apoptotic gene Bax, while it enhanced the
DEFF Research Database (Denmark)
Havelund, Birgitte Mayland; Sørensen, Flemming Brandt; Pløen, John
2013-01-01
receiving preoperative CRT (>50.4 Gy and Uracil/Tegafur). Immunohistological expressions of HIF-1α, GLUT-1, Bcl-2 and Ki-67 were investigated in biopsies taken before treatment, after 2, 4 and 6 weeks of CRT and in specimens from the operation. Decreasing expressions of HIF-1α, Bcl-2 and Ki-67 were observed...
Energy Technology Data Exchange (ETDEWEB)
Sargentini, Neil J., E-mail: nsargentini@atsu.edu; Gularte, Nicholas P.; Hudman, Deborah A.
2016-11-15
Highlights: • 3907 Keio knockout mutants of E. coli screened for UV and X-radiation sensitivity. • 76 mutants showed significantly increased radiation sensitivity. • A database of 9 screening studies listed 352 genes only once; 103 genes, 2–7 times. • 33 genes from this study are uncommon and potentially novel. • Common and uncommon genes differ in gene function profile. - Abstract: A set of 3907 single-gene knockout (Keio collection) strains of Escherichia coli K-12 was examined for strains with increased susceptibility to killing by X- or UV-radiation. After screening with a high-throughput resazurin-based assay and determining radiation survival with triplicate clonogenic assays, we identified 76 strains (and associated deleted genes) showing statistically-significant increased radiation sensitivity compared to a control strain. To determine gene novelty, we constructed a reference database comprised of genes found in nine similar studies including ours. This database contains 455 genes comprised of 103 common genes (found 2–7 times), and 352 uncommon genes (found once). Our 76 genes includes 43 common genes and 33 uncommon (potentially novel) genes, i.e., appY, atoS, betB, bglJ, clpP, cpxA, cysB, cysE, ddlA, dgkA, dppF, dusB, elfG, eutK, fadD, glnA, groL, guaB, intF, prpR, queA, rplY, seqA, sufC,yadG, yagJ, yahD, yahO, ybaK, ybfA, yfaL, yhjV, and yiaL. Of our 33 uncommon gene mutants, 4 (12%) were sensitive only to UV-radiation, 10 (30%) only to X-radiation, and 19 (58%) to both radiations. Our uncommon mutants vs. our common mutants showed more radiation specificity, i.e., 12% vs. 9% (sensitive only to UV-); 30% vs. 16% (X-) and 58% vs. 74% (both radiations). Considering just our radiation-sensitive mutants, the median UV-radiation survival (75 J m{sup −2}) for 23 uncommon mutants was 6.84E-3 compared to 1.85E-3 for 36 common mutants (P = 0.025). Similarly, the average X-radiation survival for 29 uncommon mutants was 1.08E-2, compared to 6.19E
Influence of p53 and bcl-2 on chemosensitivity in benign and malignant prostatic cell lines.
Serafin, Antonio M; Bohm, Lothar
2005-01-01
The administration of cancer chemotherapeutic agents results in an increase in the apoptotic cells in the tumor: therefore, it has been assumed that anticancer drugs exhibit their cytotoxic effects via apoptotic signaling pathways. Characteristics that confer sensitivity to drug-induced apoptosis are, a functional p53 protein and expression of the apoptosis-promoting protein, bax. The role of p53 and bax/bcl-2 in drug-induced apoptosis was assessed in six prostate cell lines, 1532T, 1535T, 1542T, 1542N, BPH-1 and LNCaP using TD(50) concentrations of etoposide, vinblastine and estramustine. Cell death was monitored morphologically by fluorescent microscopy, and by flow cytometry (Annexin-V assay). Apoptotic morphology was rather low and ranged from 0.1% to 12.1%, 3.0% to 6.0% and 0.1% to 8.5% for etoposide, estramustine and vinblastine, respectively. Annexin-V binding and flow cytometry indicated apoptotic propensities of 0% to 4%, 0% to 3% and 0% to 5%, respectively. The percentage of cells responding to drug-induced apoptosis was, on average, higher in the tumor cell lines than in the normal cell lines, but showed no correlation with p53 status. The percentage of cells showing necrosis, assessed by Annexin binding and Propidium Iodide permeability in aqueous medium, tended to be much higher, and was found to be at the level of 5% to 30%. Immunoblotting demonstrated that bax and bcl-2 proteins were expressed at a basal level in all cell lines, but did not increase after exposure to TD(50) doses of the three drugs. The ratio of bax and bcl-2, measured by laser scanning densitometry, was not altered by the drug-induced DNA damage. The results suggest that apoptosis is not a major mechanism of drug-induced cell death in prostate cell lines and appears to be independent of p53 status and bax/bcl-2 expression.
International Nuclear Information System (INIS)
Banu, Sakhila K.; Stanley, Jone A.; Lee, JeHoon; Stephen, Sam D.; Arosh, Joe A.; Hoyer, Patricia B.; Burghardt, Robert C.
2011-01-01
Hexavalent chromium (CrVI) has been widely used in industries throughout the world. Increased usage of CrVI and atmospheric emission of CrVI from catalytic converters of automobiles, and its improper disposal causes various health hazards including female infertility. Recently we have reported that lactational exposure to CrVI induced a delay/arrest in follicular development at the secondary follicular stage. In order to investigate the underlying mechanism, primary cultures of rat granulosa cells were treated with 10 μM potassium dichromate (CrVI) for 12 and 24 h, with or without vitamin C pre-treatment for 24 h. The effects of CrVI on intrinsic apoptotic pathway(s) were investigated. Our data indicated that CrVI: (i) induced DNA fragmentation and increased apoptosis, (ii) increased cytochrome c release from the mitochondria to cytosol, (iii) downregulated anti-apoptotic Bcl-2, Bcl-XL, HSP70 and HSP90; upregulated pro-apoptotic BAX and BAD, (iv) altered translocation of Bcl-2, Bcl-XL, BAX, BAD, HSP70 and HSP90 to the mitochondria, (v) upregulated p-ERK and p-JNK, and selectively translocated p-ERK to the mitochondria and nucleus, (vi) activated caspase-3 and PARP, and (vii) increased phosphorylation of p53 at ser-6, ser-9, ser-15, ser-20, ser-37, ser-46 and ser-392, increased p53 transcriptional activation, and downregulated MDM-2. Vitamin C pre-treatment mitigated CrVI effects on apoptosis and related pathways. Our study, for the first time provides a clear insight into the effect of CrVI on multiple pathways that lead to apoptosis of granulosa cells which could be mitigated by vitamin C.
DEFF Research Database (Denmark)
Jiang, Lingli; Olesen, Inger; Andersen, Thomas
2010-01-01
-related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...
Association of MTHFR gene polymorphisms with breast cancer survival
International Nuclear Information System (INIS)
Martin, Damali N; Boersma, Brenda J; Howe, Tiffany M; Goodman, Julie E; Mechanic, Leah E; Chanock, Stephen J; Ambs, Stefan
2006-01-01
Two functional single nucleotide polymorphisms (SNPs) in the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, lead to decreased enzyme activity and affect chemosensitivity of tumor cells. We investigated whether these MTHFR SNPs were associated with breast cancer survival in African-American and Caucasian women. African-American (n = 143) and Caucasian (n = 105) women, who had incident breast cancer with surgery, were recruited between 1993 and 2003 from the greater Baltimore area, Maryland, USA. Kaplan-Meier survival and multivariate Cox proportional hazards regression analyses were used to examine the relationship between MTHFR SNPs and disease-specific survival. We observed opposite effects of the MTHFR polymorphisms A1298C and C677T on breast cancer survival. Carriers of the variant allele at codon 1298 (A/C or C/C) had reduced survival when compared to homozygous carriers of the common A allele [Hazard ratio (HR) = 2.05; 95% confidence interval (CI), 1.05–4.00]. In contrast, breast cancer patients with the variant allele at codon 677 (C/T or T/T) had improved survival, albeit not statistically significant, when compared to individuals with the common C/C genotype (HR = 0.65; 95% CI, 0.31–1.35). The effects were stronger in patients with estrogen receptor-negative tumors (HR = 2.70; 95% CI, 1.17–6.23 for A/C or C/C versus A/A at codon 1298; HR = 0.36; 95% CI, 0.12–1.04 for C/T or T/T versus C/C at codon 677). Interactions between the two MTHFR genotypes and race/ethnicity on breast cancer survival were also observed (A1298C, p interaction = 0.088; C677T, p interaction = 0.026). We found that the MTHFR SNPs, C677T and A1298C, were associated with breast cancer survival. The variant alleles had opposite effects on disease outcome in the study population. Race/ethnicity modified the association between the two SNPs and breast cancer survival
Homologous recombination control by the anti-apoptotic onco-protein Bcl-2
International Nuclear Information System (INIS)
Dumay, A.
2003-12-01
This research thesis deals with the different biological mechanisms, notably the repair and apoptosis mechanisms induced by irradiation in cells. After a presentation of the genotoxic stress and DNA repair mechanisms, the author discusses the cellular response to a DNA double-strand break, and the regulation of these response mechanisms (how a cellular response emerges: life or death). The next part deals with the apoptosis (cell death by necrosis or apoptosis), and presents the BCL-2 protein family. Results are then reported on laboratory studies of the effect of this protein family
Minakata, Daisuke; Sato, Kazuya; Ikeda, Takashi; Toda, Yumiko; Ito, Shoko; Mashima, Kiyomi; Umino, Kento; Nakano, Hirofumi; Yamasaki, Ryoko; Morita, Kaoru; Kawasaki, Yasufumi; Sugimoto, Miyuki; Yamamoto, Chihiro; Ashizawa, Masahiro; Hatano, Kaoru; Oh, Iekuni; Fujiwara, Shin-Ichiro; Ohmine, Ken; Kawata, Hirotoshi; Muroi, Kazuo; Miura, Ikuo; Kanda, Yoshinobu
2018-01-01
Double-hit lymphoma (DHL) is defined as lymphoma with concurrent BCL2 and MYC translocations. While the most common histological subtype of DHL is diffuse large B-cell lymphoma, the present patient had leukemic follicular lymphoma (FL). A 52-year-old man was admitted to our hospital due to general fatigue and cervical and inguinal lymph node swelling. The patient was leukemic and the pathological diagnosis of the inguinal lymph node was FL grade 1. Chromosomal analysis revealed a complex karyotype including a rare three-way translocation t(8;14;18)(q24;q32;q21) involving the BCL2, MYC, and IGH genes. Based on a combination of fluorescence in situ hybridization (FISH), using BCL2, MYC and IGH, and spectral karyotyping (SKY), the karyotype was interpreted as being the result of a multistep mechanism in which the precursor B-cell gained t(14;18) in the bone marrow and acquired a translocation between der(14)t(14;18) and chromosome 8 in the germinal center, resulting in t(8;14;18). The pathological diagnosis was consistently FL, not only at presentation but even after a second relapse. The patient responded well to standard chemotherapies but relapsed after a short remission. This patient is a unique case of leukemic DH-FL with t(8;14;18) that remained in FL even at a second relapse. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Fang-Hui Li
2014-01-01
Full Text Available Objective. This study aimed to analyze the effects of low level laser irradiation (LLLI on Bax and IGF-1 and Bcl-2 protein contents and SIRT1/PGC-1α axis mRNA expression levels to prevent sarcopenia in aged rats. Material and Methods. Twenty female Sprague Dawley rats (18 months old were randomly divided into two groups (n=10 per group: control (CON and LLLI groups. The gallium-aluminum-arsenium (GaAlAs laser irradiation at 810 nm was used in the single point contact mode (3.75 J/cm2; 0.4 cm2; 125 mW/cm2; 30 s. Bax, Bcl-2, and IGF-1 proteins and SIRT1/PGC-1α axis mRNA expression were assessed 24 h after LLLI on gastrocnemius in aged rat. Results. Gastrocnemius muscle weights, gastrocnemius mass/body mass, Bcl-2/BAX ratio, Bcl-2 protein, IGF-1 protein, and the mRNA contents in SIRT1, PGC-1α, NRF1, TMF, and SOD2 were significantly (P<0.05 increased by LLLI compared to CON group without LLLI. However, levels of BAX protein and caspase 3 mRNA were significantly attenuated by LLLI compared to CON group (P<0.05. Conclusion. LLLI at 810 nm inhibits sarcopenia associated with upregulation of Bcl-2/BAX ratio and IGF-1 and SIRT1/PGC-1α axis mRNA expression in aged rats. This indicates that LLLI has potential to decrease progression of myocyte apoptosis in sarcopenic muscles.
Li, Shuwei; Xie, Lisheng; Du, Mulong; Xu, Kaili; Zhu, Lingjun; Chu, Haiyan; Chen, Jinfei; Wang, Meilin; Zhang, Zhengdong; Gu, Dongying
2018-05-16
Although studies have investigated the association of genetic variants and the abnormal expression of estrogen-related genes with colorectal cancer risk, the evidence remains inconsistent. We clarified the relationship of genetic variants in estrogen metabolic pathway genes with colorectal cancer risk and survival. A case-control study was performed to assess the association of single-nucleotide polymorphisms (SNPs) in ten candidate genes with colorectal cancer risk in a Chinese population. A logistic regression model and Cox regression model were used to calculate SNP effects on colorectal cancer susceptibility and survival, respectively. Expression quantitative trait loci (eQTL) analysis was conducted using the Genotype-Tissue Expression (GTEx) project dataset. The sequence kernel association test (SKAT) was used to perform gene-set analysis. Colorectal cancer risk and rs3760806 in SULT2B1 were significantly associated in both genders [male: OR = 1.38 (1.15-1.66); female: OR = 1.38 (1.13-1.68)]. Two SNPs in SULT1E1 were related to progression-free survival (PFS) [rs1238574: HR = 1.24 (1.02-1.50), P = 2.79 × 10 -2 ; rs3822172: HR = 1.30 (1.07-1.57), P = 8.44 × 10 -3 ] and overall survival (OS) [rs1238574: HR = 1.51 (1.16-1.97), P = 2.30 × 10 -3 ; rs3822172: HR = 1.53 (1.67-2.00), P = 2.03 × 10 -3 ]. Moreover, rs3760806 was an eQTL for SULT2B1 in colon samples (transverse: P = 3.6 × 10 -3 ; sigmoid: P = 1.0 × 10 -3 ). SULT2B1 expression was significantly higher in colorectal tumor tissues than in normal tissues in the Cancer Genome Atlas (TCGA) database (P colorectal cancer susceptibility and survival.
Sadek, Kadry; Abouzed, Tarek; Nasr, Sherif
2016-04-01
The effect of monosodium glutamate (MSG) on brain tissue and the relative ability of lycopene to avert these neurotoxic effects were investigated. Thirty-two male Wistar rats were distributed into 4 groups: group I, untreated (placebo); group II, injected with MSG (5 mg·kg(-1)) s.c.; group III, gastrogavaged with lycopene (10 mg·kg(-1)) p.o.; and group IV received MSG with lycopene with the same mentioned doses for 30 days. The results showed that MSG induced elevation in lipid peroxidation marker and perturbation in the antioxidant homeostasis and increased the levels of brain and serum cholinesterase (ChE), total creatine phosphokinase (CPK), creatine phosphokinase isoenzymes BB (CPK-BB), and lactate dehydrogenase (LDH). Glutathione S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT) activities and gene expression were increased and glutathione content was reduced in the MSG-challenged rats, and these effects were ameliorated by lycopene. Furthermore, MSG induced apoptosis in brain tissues reflected in upregulation of pro-apoptotic Bax while lycopene upregulated the anti-apoptotic Bcl-2. Our results indicate that lycopene appears to be highly effective in relieving the toxic effects of MSG by inhibiting lipid peroxidation and inducing modifications in the activity of cholinesterase and antioxidant pathways. Interestingly, lycopene protects brain tissue by inhibiting apoptosis signaling induced by MSG.
Xu, Lijuan; Podok, Patarida; Xie, Jun; Lu, Liqun
2014-08-01
Cyprinid herpesvirus 2 (CyHV-2) has recently been associated with high mortality of cultured crucian carp (Carassius auratus gibelio) in eastern China. In this study, we established a real-time PCR method to confirm viral infection of crucian carp and to quantify CyHV-2 particles obtained by sucrose gradient centrifugation from diseased fish. Virus-free crucian carp were artificially infected with CyHV-2 using an injection method, which resulted in a dose-dependent death rate. In situ hybridization analysis indicated that there was extensive viral replication and lysis in the kidneys of moribund fish, in contrast to very limited replication in surviving fish. To probe the host immune response to viral infection at the level of gene expression, we identified virus-responsive genes using suppression subtractive hybridization (SSH) in head kidney tissues, the principal immune organ of fish, from moribund and surviving crucian carps after viral challenge. From the moribund SSH library, 363 expressed sequence tags (ESTs) were clustered to 234 unigenes (including 15 singletons and 45 contigs). From the survivor SSH library, 599 ESTs was clustered to 549 unigenes (including 107 singletons and 105 contigs). We further analyzed the transcriptional levels of all immune-related genes by quantitative real-time RT-PCR, which confirmed the upregulation of 90.48 % of these genes. The significantly upregulated immune-related genes identified in this study can serve as candidate marker genes for acute CyHV-2 infection.
C. Orelio; K.N. Harvey; C. Miles; R.A. Oostendorp (Robert); K. van der Horn; E.A. Dzierzak (Elaine)
2004-01-01
textabstractApoptosis is an essential process in embryonic tissue remodeling and adult tissue homeostasis. Within the adult hematopoietic system, it allows for tight regulation of hematopoietic cell subsets. Previously, it was shown that B-cell leukemia 2 (Bcl-2) overexpression in
Correlation and role of nitric oxide (NO) and BCL-2 in duchenne muscular dystrophy (DMD) patients
International Nuclear Information System (INIS)
Moawed, F.S.M.
2009-01-01
Duchenne muscular dystrophy (DMD) is a lethal, degenerative muscle disease caused by a genetic mutation that leads to the complete absence of the cytoskeletal protein dystrophin in muscle fibers. Although the mechanisms underlying muscle degeneration are still uncertain, oxidative-damage and regenerating aging have been proposed to play a key role. The aim of the present study was to test for these two theories, and to evaluate the possible ameliorative effect of He;Ne laser on them. Subjects and Methods: twenty-two duchenne muscular dystrophy boys (7-15 years old ) with proven dystrophin gene mutation, together with twenty-two normal males, who served as controls, were enrolled for this study. Initial blood samples were taken for the determinations of creatine kinase (CK), markers of replicative aging; in terms of plasma and lymphocyte Bcl-2 protein and apoptosis percentage in circulating mononuclear cells, along with those of oxidative stress in terms of lipid peroxidation (as plasma malondialdehyde MDA), catalase activity, cholesterol, triacylglycerol and nitric oxide. Whole blood samples were then irradiated with 2.5 j/cm 2 by He-Ne laser at wave length 632.8 nm and power output 10 MW.
Booth, Laurence; Roberts, Jane L; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Poklepovic, Andrew; Dent, Paul
2018-03-04
The irreversible ERBB1/2/4 inhibitor, neratinib, down-regulates the expression of ERBB1/2/4 as well as the levels of MCL-1 and BCL-XL. Venetoclax (ABT199) is a BCL-2 inhibitor. At physiologic concentrations neratinib interacted in a synergistic fashion with venetoclax to kill HER2 + and TNBC mammary carcinoma cells. This was associated with the drug-combination: reducing the expression and phosphorylation of ERBB1/2/3; in an eIF2α-dependent fashion reducing the expression of MCL-1 and BCL-XL and increasing the expression of Beclin1 and ATG5; and increasing the activity of the ATM-AMPKα-ULK1 S317 pathway which was causal in the formation of toxic autophagosomes. Although knock down of BAX or BAK reduced drug combination lethality, knock down of BAX and BAK did not prevent the drug combination from increasing autophagosome and autolysosome formation. Knock down of ATM, AMPKα, Beclin1 or over-expression of activated mTOR prevented the induction of autophagy and in parallel suppressed tumor cell killing. Knock down of ATM, AMPKα, Beclin1 or cathepsin B prevented the drug-induced activation of BAX and BAK whereas knock down of BID was only partially inhibitory. A 3-day transient exposure of established estrogen-independent HER2 + BT474 mammary tumors to neratinib or venetoclax did not significantly alter tumor growth whereas exposure to [neratinib + venetoclax] caused a significant 7-day suppression of growth by day 19. The drug combination neither altered animal body mass nor behavior. We conclude that venetoclax enhances neratinib lethality by facilitating toxic BH3 domain protein activation via autophagy which enhances the efficacy of neratinib to promote greater levels of cell killing.
Qin, Tao; Lei, Ling-Yan; Li, Nuo; Shi, Fangying Ruan; Chen, Meng-Hua; Xie, Lu
2016-10-01
Overproduction of free radicals is a main factor contributing to cerebral injury after cardiac arrest (CA)/cardiopulmonary resuscitation (CPR). We sought to evaluate the impact of edaravone on the survival and neurological outcomes after CA/CPR in rats. Rats were subjected to CA following CPR. For survival study, the rats with restoration of spontaneous circulation (ROSC) were randomly allocated to one of the two groups (edaravone and saline group, n=20/each group) to received Edaravone (3 mg/kg) or normal saline. Another 10 rats without experiencing CA and CPR served as the sham group. Survival was observed for 72 hours and the neurological deficit score (NDS) was calculated at 12, 24, 48, and 72 hours after ROSC. For the neurological biochemical analysis study, rats were subjected to the same experimental procedures. Then, edaravone group (n=24), saline group (n=24) and sham group (n=16) were further divided into 4 subgroups according to the different time intervals (12, 24, 48, and 72 hours following ROSC). Brain tissues were harvested at relative time intervals for evaluation of oxidative stress, TUNEL staining and apoptotic gene expression. Edaravone improved postresuscitative survival time and neurological deficit, decreased brain malonylaldehyde level, increased superoxide dismutase activities, decreased proapoptotic gene expression of capase-8, capase-3, and Bax, and increased antiapoptotic Bcl-2 expression at 12, 24, 48, and 72 hours after ROSC. Edaravone improves survival and neurological outcomes following CPR via antioxidative and antiapoptotic effects in rats. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
van Oosterwijk, Jolieke G; Meijer, Danielle; van Ruler, Maayke A J H
2013-01-01
. As in conventional chondrosarcoma, antiapoptotic proteins (Bcl-2, and/or Bcl-xl) were highly expressed in all subtypes. Inhibition with the BH-3 mimetic ABT-737 rendered dedifferentiated chondrosarcoma cell lines sensitive to doxorubicin or cisplatin. Our data indicate that antiapoptotic proteins may play...
Czech Academy of Sciences Publication Activity Database
Klanova, M.; Anděra, Ladislav; Bražina, Jan; Švadlenka, Jan; Benešová, Simona; Soukup, J.; Průková, D.; Vejmelkova, D.; Jaksa, R.; Helman, K.; Vockova, P.; Lateckova, L.; Molinsky, J.; Maswabi, B.C.; Alam, M.; Kodet, R.; Pytlik, R.; Trneny, M.; Klener, P.
2016-01-01
Roč. 22, č. 5 (2016), s. 1138-1149 ISSN 1078-0432 R&D Projects: GA ČR GA14-19590S Institutional support: RVO:68378050 Keywords : NON-HODGKINS-LYMPHOMA * PROGNOSTIC-SIGNIFICANCE * OMACETAXINE MEPESUCCINATE * GENE-EXPRESSION * APOPTOSIS * REARRANGEMENT * SURVIVAL * LEUKEMIA * CANCER * AGENTS Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 9.619, year: 2016
Zanotto-Filho, Alfeu; Dashnamoorthy, Ravi; Loranc, Eva; de Souza, Luis H T; Moreira, José C F; Suresh, Uthra; Chen, Yidong; Bishop, Alexander J R
2016-01-01
Alkylating agents are a key component of cancer chemotherapy. Several cellular mechanisms are known to be important for its survival, particularly DNA repair and xenobiotic detoxification, yet genomic screens indicate that additional cellular components may be involved. Elucidating these components has value in either identifying key processes that can be modulated to improve chemotherapeutic efficacy or may be altered in some cancers to confer chemoresistance. We therefore set out to reevaluate our prior Drosophila RNAi screening data by comparison to gene expression arrays in order to determine if we could identify any novel processes in alkylation damage survival. We noted a consistent conservation of alkylation survival pathways across platforms and species when the analysis was conducted on a pathway/process level rather than at an individual gene level. Better results were obtained when combining gene lists from two datasets (RNAi screen plus microarray) prior to analysis. In addition to previously identified DNA damage responses (p53 signaling and Nucleotide Excision Repair), DNA-mRNA-protein metabolism (transcription/translation) and proteasome machinery, we also noted a highly conserved cross-species requirement for NRF2, glutathione (GSH)-mediated drug detoxification and Endoplasmic Reticulum stress (ER stress)/Unfolded Protein Responses (UPR) in cells exposed to alkylation. The requirement for GSH, NRF2 and UPR in alkylation survival was validated by metabolomics, protein studies and functional cell assays. From this we conclude that RNAi/gene expression fusion is a valid strategy to rapidly identify key processes that may be extendable to other contexts beyond damage survival.
Directory of Open Access Journals (Sweden)
Alfeu Zanotto-Filho
Full Text Available Alkylating agents are a key component of cancer chemotherapy. Several cellular mechanisms are known to be important for its survival, particularly DNA repair and xenobiotic detoxification, yet genomic screens indicate that additional cellular components may be involved. Elucidating these components has value in either identifying key processes that can be modulated to improve chemotherapeutic efficacy or may be altered in some cancers to confer chemoresistance. We therefore set out to reevaluate our prior Drosophila RNAi screening data by comparison to gene expression arrays in order to determine if we could identify any novel processes in alkylation damage survival. We noted a consistent conservation of alkylation survival pathways across platforms and species when the analysis was conducted on a pathway/process level rather than at an individual gene level. Better results were obtained when combining gene lists from two datasets (RNAi screen plus microarray prior to analysis. In addition to previously identified DNA damage responses (p53 signaling and Nucleotide Excision Repair, DNA-mRNA-protein metabolism (transcription/translation and proteasome machinery, we also noted a highly conserved cross-species requirement for NRF2, glutathione (GSH-mediated drug detoxification and Endoplasmic Reticulum stress (ER stress/Unfolded Protein Responses (UPR in cells exposed to alkylation. The requirement for GSH, NRF2 and UPR in alkylation survival was validated by metabolomics, protein studies and functional cell assays. From this we conclude that RNAi/gene expression fusion is a valid strategy to rapidly identify key processes that may be extendable to other contexts beyond damage survival.
DEFF Research Database (Denmark)
Daugaard, Søren; Christensen, Lise H; Høgdall, Estrid
2009-01-01
(s) for the different subgroups. Archival material from three extraskeletal myxoid chondrosarcomas, five chordomas, five chondromyxoid fibromas, five chondroblastomas and 25 chondrosarcomas was stained with antibodies against osteonectin, bcl-2, cox-2, actin, calponin, D2-40 (podoplanin), mdm-2, CD117 (c-kit) and YKL......-40. All 25 chondrosarcomas showed a positive staining reaction for D2-40, none for actin and CD117, and a partial reactivity for bcl-2 (36%). Chondroblastomas (5/5) and chondromyxoid fibromas (2/5) were the only tumors with a positive reaction for actin, and all chondroblastomas (n=5...... chondrosarcomas. A convincing immunoreactivity for calponin and/or actin in chondromyxoid fibromas and chondroblastomas may also be helpful in differentiating these tumors from chondrosarcomas....
Han, Cho Rong; Jun, Do Youn; Kim, Yoon Hee; Lee, Ji Young; Kim, Young Ho
2013-10-01
In Jurkat T cell clone (JT/Neo), G2/M arrest, apoptotic sub-G1 peak, mitochondrial membrane potential (Δψm) loss, and TUNEL-positive DNA fragmentation were induced following exposure to 17α-estradiol (17α-E2), whereas none of these events (except for G2/M arrest) were induced in Jurkat cells overexpressing Bcl-2 (JT/Bcl-2). Under these conditions, phosphorylation at Thr161 and dephosphorylation at Tyr15 of Cdk1, upregulation of cyclin B1 level, histone H1 phosphorylation, Cdc25C phosphorylation at Thr-48, Bcl-2 phosphorylation at Thr-56 and Ser-70, Mcl-1 phosphorylation, and Bim phosphorylation were detected in the presence of Bcl-2 overexpression. However, the 17α-E2-induced upregulation of Bak levels, activation of Bak, activation of caspase-3, and PARP degradation were abrogated by Bcl-2 overexpression. In the presence of the G1/S blocking agent hydroxyurea, 17α-E2 failed to induce G2/M arrest and all apoptotic events including Cdk1 activation and phosphorylation of Bcl-2, Mcl-1 and Bim. The 17α-E2-induced phosphorylation of Bcl-2 family proteins and mitochondrial apoptotic events were suppressed by a Cdk1 inhibitor but not by aurora A and aurora B kinase inhibitors. Immunofluorescence microscopic analysis showed that an aberrant bipolar microtubule array, incomplete chromosome congression at the metaphase plate, and prometaphase arrest, which was reversible, were the underlying factors for 17α-E2-induced mitotic arrest. The in vitro microtubule polymerization assay showed that 17α-E2 could directly inhibit microtubule formation. These results show that the apoptogenic activity of 17α-E2 was due to the impaired mitotic spindle assembly causing prometaphase arrest and prolonged Cdk1 activation, the phosphorylation of Bcl-2, Mcl-1 and Bim, and the activation of Bak and mitochondria-dependent caspase cascade. Copyright © 2013 Elsevier B.V. All rights reserved.
Hassig, Christian A; Zeng, Fu-Yue; Kung, Paul; Kiankarimi, Mehrak; Kim, Sylvia; Diaz, Paul W; Zhai, Dayong; Welsh, Kate; Morshedian, Shana; Su, Ying; O'Keefe, Barry; Newman, David J; Rusman, Yudi; Kaur, Harneet; Salomon, Christine E; Brown, Susan G; Baire, Beeraiah; Michel, Andrew R; Hoye, Thomas R; Francis, Subhashree; Georg, Gunda I; Walters, Michael A; Divlianska, Daniela B; Roth, Gregory P; Wright, Amy E; Reed, John C
2014-09-01
Antiapoptotic Bcl-2 family proteins are validated cancer targets composed of six related proteins. From a drug discovery perspective, these are challenging targets that exert their cellular functions through protein-protein interactions (PPIs). Although several isoform-selective inhibitors have been developed using structure-based design or high-throughput screening (HTS) of synthetic chemical libraries, no large-scale screen of natural product collections has been reported. A competitive displacement fluorescence polarization (FP) screen of nearly 150,000 natural product extracts was conducted against all six antiapoptotic Bcl-2 family proteins using fluorochrome-conjugated peptide ligands that mimic functionally relevant PPIs. The screens were conducted in 1536-well format and displayed satisfactory overall HTS statistics, with Z'-factor values ranging from 0.72 to 0.83 and a hit confirmation rate between 16% and 64%. Confirmed active extracts were orthogonally tested in a luminescent assay for caspase-3/7 activation in tumor cells. Active extracts were resupplied, and effort toward the isolation of pure active components was initiated through iterative bioassay-guided fractionation. Several previously described altertoxins were isolated from a microbial source, and the pure compounds demonstrate activity in both Bcl-2 FP and caspase cellular assays. The studies demonstrate the feasibility of ultra-high-throughput screening using natural product sources and highlight some of the challenges associated with this approach. © 2014 Society for Laboratory Automation and Screening.
Phospho-Bcl-xL(Ser62) influences spindle assembly and chromosome segregation during mitosis.
Wang, Jianfang; Beauchemin, Myriam; Bertrand, Richard
2014-01-01
Functional analysis of a series of phosphorylation mutants reveals that Bcl-xL(Ser62Ala) influences cell entry into anaphase and mitotic exit in taxol-exposed cells compared with cells expressing wild-type Bcl-xL or a series of other phosphorylation mutants, an effect that appears to be independent of its anti-apoptotic activity. During normal mitosis progression, Bcl-xL(Ser62) is strongly phosphorylated by PLK1 and MAPK14/SAPKp38α at the prometaphase, metaphase, and the anaphase boundaries, while it is de-phosphorylated at telophase and cytokinesis. Phospho-Bcl-xL(Ser62) localizes in centrosomes with γ-tubulin and in the mitotic cytosol with some spindle-assembly checkpoint signaling components, including PLK1, BubR1, and Mad2. In taxol- and nocodazole-exposed cells, phospho-Bcl-xL(Ser62) also binds to Cdc20- Mad2-, BubR1-, and Bub3-bound complexes, while Bcl-xL(Ser62Ala) does not. Silencing Bcl-xL expression and expressing the phosphorylation mutant Bcl-xL(Ser62Ala) lead to an increased number of cells harboring mitotic spindle defects including multipolar spindle, chromosome lagging and bridging, aneuploidy with micro-, bi-, or multi-nucleated cells, and cells that fail to resolve undergo mitosis within 6 h. Together, the data indicate that during mitosis, Bcl-xL(Ser62) phosphorylation impacts on spindle assembly and chromosome segregation, influencing chromosome stability. Observations of mitotic cells harboring aneuploidy with micro-, bi-, or multi-nucleated cells, and cells that fail to resolve undergo mitosis within 6 h were also made with cells expressing the phosphorylation mutant Bcl-xL(Ser49Ala) and dual mutant Bcl-xL(Ser49/62Ala).
Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan
2017-12-01
Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alina M Bischin
2017-02-01
Full Text Available Most commonly, histologic transformation (HT from follicular lymphoma (FL manifests as a diffuse large B-cell lymphoma, not otherwise specified (DLBCL, NOS. Less frequently, HT may result in a high-grade B-cell lymphoma (HGBL with MYC and B-cell lymphoma protein 2 (BCL2 and/or BCL6 gene rearrangements, also known as “double-hit” or “triple-hit” lymphomas. In the 2016 revision of the World Health Organization (WHO classification of lymphoid neoplasms, the category B-cell lymphoma, unclassifiable was eliminated due to its vague criteria and limiting diagnostic benefit. Instead, the WHO introduced the HGBL category, characterized by MYC and BCL2 and/or BCL6 rearrangements. Cases that present as an intermediate phenotype of DLBCL and Burkitt lymphoma (BL will fall within this HGBL category. Very rarely, HT results in both the intermediate DLBCL and BL phenotypes and exhibits lymphoblastic features, in which case the WHO recommends that this morphologic appearance should be noted. In comparison with de novo patients with DLBCL, NOS, those with MYC and BCL2 and/or BCL6 gene rearrangements have a worse prognosis. A 63-year-old woman presented with left neck adenopathy. Laboratory assessments, including complete blood count, complete metabolic panel, serum lactate dehydrogenase, and β 2 -microglobulin, were all normal. A whole-body computerized tomographic (CT scan revealed diffuse adenopathy above and below the diaphragm. An excisional node biopsy showed grade 3A nodular FL. The Ki67 labeling index was 40% to 50%. A bone marrow biopsy showed a small focus of paratrabecular CD20+ lymphoid aggregates. She received 6 cycles of bendamustine (90 mg/m 2 on days +1 and +2 and rituximab (375 mg/m 2 on day +2, with each cycle delivered every 4 weeks. A follow-up CT scan at completion of therapy showed a partial response with resolution of axillary adenopathy and a dramatic shrinkage of the large retroperitoneal nodes. After 18 months, she had crampy
LENUS (Irish Health Repository)
Wang, Jiang Huai
2012-02-03
BACKGROUND: Hypoxia in solid tumors potentially stimulates angiogenesis by promoting vascular endothelial growth factor (VEGF) production and upregulating VEGF receptor expression. However, it is unknown whether hypoxia can modulate the effect of anti-angiogenic treatment on tumor-derived endothelium. METHODS: Human tumor-derived endothelial cells (HTDEC) were freshly isolated from surgically removed human colorectal tumors by collagenase\\/DNase digestion and Percol gradient sedimentation. Cell proliferation was assessed by measuring BrdU incorporation, and capillary tube formation was measured using Matrigel. Cell apoptosis was assessed by flow cytometry and ELISA, and Bcl-2 expression was detected by Western blot analysis. RESULTS: Under aerobic culture conditions (5% CO2 plus 21% O2) HTDEC expressed less Bcl-2 and were more susceptible to IFN-gamma-induced apoptosis with significant reductions in both cell proliferation and capillary tube formation, when compared with normal human macrovascular and microvascular EC. Following exposure of HTDEC to hypoxia (5% CO2 plus 2% O2), IFN-gamma-induced cell apoptosis, and antiangiogenic activity (i.e. an inhibition in cell proliferation and capillary tube formation) in HTDEC were markedly attenuated. This finding correlated with hypoxia-induced upregulation of Bcl-2 expression in HTDEC. CONCLUSIONS: These results indicate that hypoxia can protect HTDEC against IFN-gamma-mediated cell death and antiangiogenic activity, and suggest that improvement of tumor oxygenation may potentiate the efficacy of anti-cancer therapies specifically targeting the inhibition of tumor angiogenesis.
He, Miaoxia; Chen, Keting; Li, Suhong; Zhang, Shimin; Zheng, Jianming; Hu, Xiaoxia; Gao, Lei; Chen, Jie; Song, Xianmin; Zhang, Weiping; Wang, Jianmin; Yang, Jianmin
2016-01-01
Primary gastric B-cell lymphoma is the second most common malignancy of the stomach. There are many controversial issues about its diagnosis, treatment and clinical management. "Double-hit" and "double-protein" involving gene rearrangement and protein expression of c-Myc and bcl2/bcl6 are the most used terms to describe DLBCL poor prognostic factors in recent years. However, very little is known about the role of these prognostic factors in primary gastric B-cell lymphomas. This study aims to obtain a molecular pathology prognostic model of gastric B-cell lymphoma for clinical stratified management by evaluating how the "double-hit" and "double-protein" in tumor cells as well as microenvironmental reaction of tumor stromal tissue affect clinical outcome in primary gastric B-cell lymphomas. Data and tissues of 188 cases diagnosed with gastric B-cell lymphomas were used in this study. Tumor tissue microarray (TMA) of formalin fixed and paraffin embedded (FFPE) tissues was constructed for fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) analysis with a serial of biomarkers containing MYC, BCL2, BCL6, CD31, SPARC, CD10, MUM1 and Ki-67. Modeled period analysis was used to estimate 3-year and 5-year overall survival (OS) and disease-free survival (DFS) distributions. There was no definite "double-hit" case though the gene rearrangement of c-Myc (5.9%), bcl2 (0.1%) and bcl6 (7.4%) was found in gastric B-cell lymphomas. The gene amplification or copy gains of c-Myc (10.1%), bcl-2 (17.0%) and bcl-6 (0.9%) were present in these lymphomas. There were 12 cases of the lymphomas with the "double-protein" expression of MYC and BCL2/BCL6. All patients with "double-protein" gastric B-cell lymphomas had poor outcome compared with those without. More importantly, "MYC-BCL2-BCL6" negative group of gastric B-cell lymphoma patients had favorable clinical outcome regardless clinical stage, pathological types and therapeutic modalities. And the similar better
Phosphorylation of Rad9 at serine 328 by cyclin A-Cdk2 triggers apoptosis via interfering Bcl-xL.
Directory of Open Access Journals (Sweden)
Zhuo Zhan
Full Text Available Cyclin A-Cdk2, a cell cycle regulated Ser/Thr kinase, plays important roles in a variety of apoptoticprocesses. However, the mechanism of cyclin A-Cdk2 regulated apoptosis remains unclear. Here, we demonstrated that Rad9, a member of the BH3-only subfamily of Bcl-2 proteins, could be phosphorylated by cyclin A-Cdk2 in vitro and in vivo. Cyclin A-Cdk2 catalyzed the phosphorylation of Rad9 at serine 328 in HeLa cells during apoptosis induced by etoposide, an inhibitor of topoisomeraseII. The phosphorylation of Rad9 resulted in its translocation from the nucleus to the mitochondria and its interaction with Bcl-xL. The forced activation of cyclin A-Cdk2 in these cells by the overexpression of cyclin A,triggered Rad9 phosphorylation at serine 328 and thereby promoted the interaction of Rad9 with Bcl-xL and the subsequent initiation of the apoptotic program. The pro-apoptotic effects regulated by the cyclin A-Cdk2 complex were significantly lower in cells transfected with Rad9S328A, an expression vector that encodes a Rad9 mutant that is resistant to cyclin A-Cdk2 phosphorylation. These findings suggest that cyclin A-Cdk2 regulates apoptosis through a mechanism that involves Rad9phosphorylation.
Liu, Qing-Shan; Deng, Ran; Li, Shuran; Li, Xu; Li, Keqin; Kebaituli, Gulibanumu; Li, Xueli; Liu, Rui
2017-08-01
An oxygen-glucose deprivation and reoxygenation model in primary cultured rat cortical neurons was developed for this study to investigate the effects of ellagic acid (EA), a low-molecular-weight polyphenol, on neuron cells and their function, and to evaluate whether EA can be safely utilized by humans as a functional food or therapeutic agent. Administration of EA significantly decreased the volume of cerebrum infarction and the neurological deficit scores of the rats; EA treatment also increased the number of Bcl-2-positive cells and the ratio of Bcl-2-positive to Bax-positive neurons in the semidarkness zone near the brain ischemic focus in the photothrombotic cerebral ischemia model. Treatment of EA resulted in increased neuron viability, cell nuclear integrity, and the ratio of Bcl-2/Bax expression in the primary cultured neuron model; EA treatment also lead to a decrease in the number of apoptotic cells. Our results therefore suggest a specific mechanism for the beneficial effects of EA, providing new insights into how it provides neuroprotection. To the best of our knowledge, these results represent new insights on the mechanisms of the brain cell protective activity of EA. Thus, EA may be used in functional foods or medicines to help treat nerve dysfunction, neurodegenerative disease, and aging.
Alternation of apoptotic and implanting genes expression of mouse embryos after re-vitrification
Majidi Gharenaz, Nasrin; Movahedin, Mansoureh; Mazaheri, Zohreh; Pour beiranvand, Shahram
2016-01-01
Background: Nowadays, oocytes and embryos vitrification has become a routine technique. Based on clinical judgment, re-vitrification maybe required. But little is known about re-vitrification impact on genes expression. Objective: The impact of re-vitrification on apoptotic and implanting genes, Bax, Bcl-2 and ErbB4, at compaction stage embryos were evaluated in this study. Materials and Methods: In this experimental study, 8 cell embryos (n=240) were collected from female mature mice, 60-62 hr post HCG injection. The embryos were divided randomly to 3 groups included: fresh (n=80), vitrified at 8 cell stage (n=80), vitrified at 8 cell stage thawed and re-vitrified at compaction stage (n=80). Embryos were vitrified by using cryolock, (open system) described by Kuwayama. Q-PCR was used to examine the expression of Bax, Bcl2 ErbB4 genes in derived blastocysts. Results: Our result showed that expanded blastocyst rate was similar between vitrified and re-vitrified groups, while re-vitrified embryos showed significant decrease in expanded blastocyst rate comparing with fresh embryos (p=0.03). In addition, significant difference was observed on apoptotic gene expression when comparing re-vitrified and fresh embryos (p=0.004), however expression of Bax and Bcl-2 (apoptotic) genes didn't demonstrate a significant difference between re-vitrified and vitrified groups. The expression rate of ErbB4, an implantation gene was decreased in re-vitrified embryos comparing with fresh embryos (p=0.003), but it was similar between re-vitrified and vitrified embryos. Conclusion: Re-vitrification can alter the expression of Bax, Bcl-2 and ErbB4 genes and developmental rate of mouse embryos in compaction stage. PMID:27679826
Assessment of the relationship between ACE I/D gene polymorphism and renal allograft survival.
Yang, Chun-Hua; Lu, Yi; Chen, Xue-Xia; Xian, Wen-Feng; Tu, Wei-Feng; Li, Hong-Yan
2015-12-01
The relationship between the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and renal allograft survival after renal transplantation from the published reports are still debatable. This study was performed to evaluate the relationship between the ACE I/D gene polymorphism and renal allograft survival after renal transplantation using meta-analysis. Eligible studies were identified from PubMed and Cochrane Library on 1 November 2014, and eligible studies were recruited and synthesized using a meta-analysis methodology. Twelve investigations were included in this meta-analysis for the assessment of the relationship between the ACE I/D gene polymorphism and renal allograft survival. In this meta-analysis, the ACE I/D gene polymorphism was not associated with renal allograft survival after renal transplantation for overall populations, Caucasians, Brazilians and Africans. Interestingly, the ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. However, more studies should be performed to confirm this association. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Jalal Hassanshahi
2013-10-01
Full Text Available Introduction: Preliminary studies confirmed reduction of cell death following treatment with antioxidants. According to this finding we investigated the relationship between consumption of CoQ10 and expression of bax and bcl2 in hippocampus ischemia that this expression related to cell programmed death.Material and Methods: We studied the protective role of CoQ10 against ischemia-reperfusion. Experimental design includes four groups: intact (N=7, ischemic control (N=7, sham control (N=7 and treatment groups with CoQ10 (N=7. The mice (treatment group treated with CoQ10 as Pre-Treatment for a week. Then, ischemia induced by common carotid artery ligation and following the reduction in inflammation (a week the treatment group post-treated with CoQ10 for a week. Nissl staining applied to counting necrotic cells of hippocampus and the western blotting performed to measurement the bax and bcl2 expression. Tunnel kit was used to quantify apoptotic cell death while to short term memory scale, we apply Y-maze.Results: Cell death was significantly lower when mice treated with CoQ10. Bax expression was significantly high in ischemic group but in treatment group was less and reversely the bcl2 expression in ischemic group was lower than treatment and vehicle groups. The memory test results were consistent with cell death results. Conclusion: Ischemia for 15 minutes induced cell death in hippocampus with more potent effect on CA1. CoQ10 intake significantly reduced cell death and decreased memory loss. with prevent of expression of bax and increase in expression of bcl2.
Directory of Open Access Journals (Sweden)
R.V.M. López
2011-10-01
Full Text Available The association of education, tobacco smoking, alcohol consumption, and interleukin-2 (IL-2 +114 and -384 and -6 (IL-6 -174 DNA polymorphisms with head and neck squamous cell carcinoma (HNSCC was investigated in a cohort study of 445 subjects. IL-2 and IL-6 genotypes were determined by real-time PCR. Cox regression was used to estimate hazard ratios (HR and 95% confidence intervals (95%CI of disease-specific survival according to anatomical sites of the head and neck. Mean age was 56 years and most patients were males (87.6%. Subjects with 5 or more years of schooling had better survival in larynx cancer. Smoking had no effect on HNSCC survival, but alcohol consumption had a statistically significant effect on larynx cancer. IL-2 gene +114 G/T (HR = 0.52; 95%CI = 0.15-1.81 and T/T (HR = 0.22; 95%CI = 0.02-3.19 genotypes were associated with better survival in hypopharynx cancer. IL-2 +114 G/T was a predictor of poor survival in oral cavity/oropharynx cancer and larynx cancer (HR = 1.32; 95%CI = 0.61-2.85. IL-2 -384 G/T was associated with better survival in oral cavity/oropharynx cancer (HR = 0.80; 95%CI = 0.45-1.42 and hypopharynx cancer (HR = 0.68; 95%CI = 0.21-2.20, but an inverse relationship was observed for larynx cancer. IL-6 -174 G/C was associated with better survival in hypopharynx cancer (HR = 0.68; 95%CI = 0.26-1.78 and larynx cancer (HR = 0.93; 95%CI = 0.42-2.07, and C/C reduced mortality in larynx cancer. In general, our results are similar to previous reports on the value of education, smoking, alcohol consumption, and IL-2 and IL-6 genetic polymorphisms for the prognosis of HNSCC, but the risks due to these variables are small and estimates imprecise.
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Directory of Open Access Journals (Sweden)
Taufiqurrachman Nasihun
2015-04-01
Full Text Available Background: Treatment with buceng combination of Eurycoma longifolia Jack and Pimpinella alpine Molk has been proven to increase testosterone level, decrease apoptosis and caspase3 expression. Bcl2 is an antiapoptotic protein found in cytoplasm which inhibits cells apoptosis. This study was aimed to investigate the effect of buceng on Bcl2 expression on penile and prostate tissues of the rats. Methods: In this experimental study, 24 male Sprague Dawley rats of 90 days old, weighing ± 300 grams, were randomly assigned into four groups. Group A, normal rats. Group B, castrated rats and treated with buceng 100 mg/day, per oral (Cast-Bcg; Group C, castrated rats and treated with 2 ml of water as placebo against buceng (Cast-Plac. Group D, castrated rats, treated with mesterolone 6.75 mg/day, per oral, as exogenous testosterone (Cast-Mest. All rats were treated for 30 days. Manova test was used to analyze the different expression of Bcl2 among groups with significance level at p ≤ 0.05. Results: Castration was associated with significant decrease of Bcl2 expression in the penile and prostate tissues (53.0 and 50.9%, respectively compared to normal rats (82.6 and 84.2%, respectively, p < 0.001. Treatment with mesterolone reversed Bcl2 expression (77.1 and 78.1% to a near normal level. The same level of Bcl2 expression was also observed with buceng treatment (73.8 and 78.2%.Conclusion: The treatment with buceng could enhance Bcl2 expression in penile and prostate tissues, comparable to normal rats and mesterolone treated rats.
Riazantseva, N V; Kaĭgorodova, E V; Maroshkina, A N; Belkina, M V; Novitskiĭ, V V
2012-01-01
The in vitro phosphorylated and non-phosphorylated Hsp27 forms concentrations and Bcl-2 proteins affected by Hsp27 inhibition were studied in Jurkat-line tumor cells and healthy donor mononuclear lymphocytes by Western blotting technique. The Hsp27 inhibition causes the increase of intracellular Bax protein concentration and the decrease of Bcl-2 level leading to an increase of apoptotic changes in Jurkat line cells.
Directory of Open Access Journals (Sweden)
Ana Paula Percicote
2013-02-01
Full Text Available INTRODUCTION: Nephroblastoma or Wilms' tumor is the most frequent renal cancer in children. Although its prognosis is favorable for most patients, it may relapse or have a fatal outcome. The characterization of risk groups by applying immunohistochemical biomarkers aims to adapt the treatment to its corresponding group as well as to reduce relapses and fatal outcome. p53, B-cell lymphoma 2 (BCL-2, BCL-2 associated protein X (BAX and vascular endothelial growth factor receptor 1 (VEGFR1 are among the most widely studied biomarkers, which are related to the apoptotic pathway, DNA repair and neovascularization. OBJECTIVE: The objective of this study is to assess the immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 in samples of human nephroblastoma and to correlate them with clinicopathological prognostic factors. MATERIAL AND METHODS: Twenty-nine surgical specimens of nephroblastoma diagnosed from 1994 to 2007 were selected from the Anatomopathological Service of two hospitals in Curitiba. The immunohistochemical analysis of tissue microarrays was performed through immunoperoxidase staining and the yielded results were compared with clinicopathological prognostic factors. RESULTS: The major immunohistochemical expression of VEGFR1 in blastema and epithelium presented positive association with the risk group. Hence this may be related to higher vascular neoplastic invasion apparently caused by the endothelial growth factor, which maximizes the chances of metastasis and ultimately changes tumor staging, risk group and clinical evolution. CONCLUSIONS: The immunohistochemical expression of VEGFR1 substantiated a directly proportional association with the nephroblastoma risk group.INTRODUÇÃO: O nefroblastoma, ou tumor de Wilms, é a neoplasia renal mais frequente na infância. Embora o prognóstico seja favorável para a maioria dos pacientes, muitos evoluem para recidiva ou óbito. A caracterização de grupos de risco por meio de
MRP- and BCL-2-mediated drug resistance in human SCLC: effects of apoptotic sphingolipids in vitro.
Khodadadian, M; Leroux, M E; Auzenne, E; Ghosh, S C; Farquhar, D; Evans, R; Spohn, W; Zou, Y; Klostergaard, J
2009-10-01
Multidrug-resistance-associated protein (MRP) and BCL-2 contribute to drug resistance expressed in SCLC. To establish whether MRP-mediated drug resistance affects sphingolipid (SL)-induced apoptosis in SCLC, we first examined the human SCLC cell line, UMCC-1, and its MRP over-expressing, drug-resistant subline, UMCC-1/VP. Despite significantly decreased sensitivity to doxorubicin (Dox) and to the etoposide, VP-16, the drug-selected line was essentially equally as sensitive to treatment with exogenous ceramide (Cer), sphingosine (Sp) or dimethyl-sphingosine (DMSP) as the parental line. Next, we observed that high BCL-2-expressing human H69 SCLC cells, that were approximately 160-fold more sensitive to Dox than their combined BCL-2 and MRP-over-expressing (H69AR) counterparts, were only approximately 5-fold more resistant to DMSP. Time-lapse fluorescence microscopy of either UMCC cell line treated with DMSP-Coumarin revealed comparable extents and kinetics of SL uptake, further ruling out MRP-mediated effects on drug uptake. DMSP potentiated the cytotoxic activity of VP-16 and Taxol, but not Dox, in drug-resistant UMCC-1/VP cells. However, this sensitization did not appear to involve DMSP-mediated effects on the function of MRP in drug export; nor did DMSP strongly shift the balance of pro-apoptotic Sps and anti-apoptotic Sp-1-Ps in these cells. We conclude that SL-induced apoptosis markedly overcomes or bypasses MRP-mediated drug resistance relevant to SCLC and may suggest a novel therapeutic approach to chemotherapy for these tumors.
Vasselli, James R; Shih, Joanna H; Iyengar, Shuba R; Maranchie, Jodi; Riss, Joseph; Worrell, Robert; Torres-Cabala, Carlos; Tabios, Ray; Mariotti, Andra; Stearman, Robert; Merino, Maria; Walther, McClellan M; Simon, Richard; Klausner, Richard D; Linehan, W Marston
2003-06-10
To identify potential molecular determinants of tumor biology and possible clinical outcomes, global gene-expression patterns were analyzed in the primary tumors of patients with metastatic renal cell cancer by using cDNA microarrays. We used grossly dissected tumor masses that included tumor, blood vessels, connective tissue, and infiltrating immune cells to obtain a gene-expression "profile" from each primary tumor. Two patterns of gene expression were found within this uniformly staged patient population, which correlated with a significant difference in overall survival between the two patient groups. Subsets of genes most significantly associated with survival were defined, and vascular cell adhesion molecule-1 (VCAM-1) was the gene most predictive for survival. Therefore, despite the complex biological nature of metastatic cancer, basic clinical behavior as defined by survival may be determined by the gene-expression patterns expressed within the compilation of primary gross tumor cells. We conclude that survival in patients with metastatic renal cell cancer can be correlated with the expression of various genes based solely on the expression profile in the primary kidney tumor.
Yang, Ting; Xu, Feifei; Sheng, Yuan; Zhang, Wen; Chen, Yun
2016-10-01
Apoptosis suppression caused by overexpression of anti-apoptotic proteins is a central factor to the acquisition of multi-drug resistance (MDR) in breast cancer. As a highly conserved anti-apoptotic protein, Bcl-2 can initiate an anti-apoptosis response via an ERK1/2-mediated pathway. However, the details therein are still far from completely understood and a quantitative description of the associated proteins in the biological context may provide more insights into this process. Following our previous attempts in the quantitative analysis of MDR mechanisms, liquid chromatography-tandem mass spectrometry (LC-MS/MS)-based targeted proteomics was continually employed here to describe ERK/Bcl-2-mediated anti-apoptosis. A targeted proteomics assay was developed and validated first for the simultaneous quantification of ERK1/2 and Bcl-2. In particular, ERK isoforms (i.e., ERK1 and ERK2) and their differential phosphorylated forms including isobaric ones were distinguished. Using this assay, differential protein levels and site-specific phosphorylation stoichiometry were observed in parental drug-sensitive MCF-7/WT cancer cells and drug-resistant MCF-7/ADR cancer cells and breast tissue samples from two groups of patients who were either suspected or diagnosed to have drug resistance. In addition, quantitative analysis of the time course of both ERK1/2 and Bcl-2 in doxorubicin (DOX)-treated MCF-7/WT cells confirmed these findings. Overall, we propose that targeted proteomics can be used generally to resolve more complex cellular events.
Gu, Ruiping; Tang, Wenyi; Lei, Boya; Ding, Xinyi; Jiang, Cheng; Xu, Gezhi
2017-07-01
The aim of the present study was to investigate the neuroprotective effects of glucocorticoid-induced leucine zipper (GILZ) in a light-induced retinal degeneration model and to explore the underlying mechanisms. Intravitreal injection of recombinant GILZ-overexpressing lentivirus (OE-GILZ-rLV) and short hairpin RNA targeting GILZ recombinant lentivirus (shRNA-GILZ-rLV) was performed to up- and downregulate retinal GILZ, respectively. Three days after stable transduction, rats were exposed to continuous bright light (5000 lux) for 2 days. Retinal function was assessed by full-field electroretinography (ERG), and the retinal structure was examined for photoreceptor survival and death in rats kept under a 12-hour light:2-hour dark cycle following light exposure. The expression levels of retinal Bcl-xL, caspase-9, and caspase-3 were examined by Western blotting or real-time PCR at 1, 3, 5, and 7 days after light exposure. Exposure to bright light downregulated retinal GILZ in parallel with the downregulation of Bcl-xL and the upregulation of active caspase-3. Overexpression of retinal GILZ attenuated the decrease of Bcl-xL and the activation of caspase-9 and caspase-3 at 1, 3, 5, and 7 days after bright light exposure, respectively. GILZ silencing aggravated the downregulation of Bcl-xL induced by bright light exposure. Bright light exposure reduced the amplitude of ERG, increased the number of apoptotic photoreceptor cells, and decreased retinal thickness; and GILZ overexpression could attenuate all these effects. Overexpression of GILZ by OE-GILZ-rLV transduction protected the retina from light-induced cellular damage by activating antiapoptotic pathways.
Vered, M; Peleg, O; Taicher, S; Buchner, A
2009-08-01
The aggressive biological behavior of odontogenic keratocysts (OKCs), unlike that of other odontogenic cysts, has argued for its recent re-classification as a neoplasm, 'keratocystic odontogenic tumor'. Identification of mutations in the PTCH gene in some of the OKCs that were expected to produce truncated proteins, resulting in loss of control of the cell cycle, provided additional support for OKCs having a neoplastic nature. We investigated the immunohistochemical expression of the sonic hedgehog (SHH) signaling pathway-related proteins, PTCH, smoothened (SMO) and GLI-1, and of the SHH-induced bcl-2 oncoprotein in a series of primary OKC (pOKC), recurrent OKC (rOKC) and nevoid basal cell carcinoma syndrome-associated OKCs (NBCCS-OKCs), and compared them to solid ameloblastomas (SAMs), unicystic ameloblastomas (UAMs), 'orthokeratinized' OKCs (oOKCs), dentigerous cysts (DCs) and radicular cysts (RCs). All studied lesions expressed the SHH pathway-related proteins in a similar pattern. The expression of bcl-2 in OKCs (pOKCs and NBCCS-OKCs) and SAMs was significantly higher than in oOKCs, DCs and RCs (P < 0.001). The present results of the immunoprofile of OKCs (that includes the expression of the SHH-related proteins and the SHH-induced bcl-2 oncoprotein) further support the notion of OKC having a neoplastic nature. As OKCs vary considerably in their biologic behavior, it is suggested that the quality and quantity of interactions between the SHH and other cell cycle regulatory pathways are likely to work synergistically to define the individual phenotype and corresponding biological behavior of this lesion.
Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke
2009-11-01
Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.
Directory of Open Access Journals (Sweden)
Javad Baharara
2015-02-01
Full Text Available Silver nanoparticles (Ag-NPs, the most popular nanoparticles, possess unique properties. Achillea biebersteinii is a plant of the Asteraceae family rich in active antitumor components. The aim of this research was the characterization and investigation of the cytotoxic properties of Ag-NPs synthesized using A. biebersteinii flower extract, on a human breast cancer cell line. The Ag-NPs were synthesized after approximately 180 min of reaction at 40 °C, then they were characterized by UV-visible spectroscopy, Fourier transform infrared spectroscopy (FTIR, transmission electron microscopy (TEM and dynamic light scattering (DLS. The anti-apoptosis effect of Ag-NPs on the MCF-7 cell line was investigated by MTT assay, DAPI and acridine orange staining and caspase activity. The transcriptional expression of bax, bcl-2, caspase-3, -8 and -9 were also evaluated by RT-PCR. The TEM images revealed that the Ag-NPs morphology had a different shape. The DLS indicated that the average hydrodynamic diameter of the biosynthesized Ag-NPs was around 12 nm. By UV-visible spectroscopy the strongest absorbance peak was observed at 460 nm. The FTIR results also showed interaction between the plant extract and Ag-NPs due to the similarity in the peak patterns. The EDS results showed that Ag-NPs display an absorption peak at 3 keV, indicating the presence of the element silver. The Ag-NPs caused a dose-dependent decrease in cell viability, fragmentation in nucleic acid, inhibited the proliferation and induction of apoptosis on MCF-7 by suppressing specific cell cycle genes, and simulation programmed cell dead genes. Further investigation is required to establish the potential of this novel and promising approach in cancer therapy.
Directory of Open Access Journals (Sweden)
Jose C Garcia-Garcia
2009-06-01
Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.
International Nuclear Information System (INIS)
Koschny, Ronald; Schemmer, Peter; Schirmacher, Peter; Ganten, Tom M; Brost, Sylvia; Hinz, Ulf; Sykora, Jaromir; Batke, Emanuela M; Singer, Stephan; Breuhahn, Kai; Stremmel, Wolfgang; Walczak, Henning
2013-01-01
An imbalance between proliferation and apoptosis is one of the main features of carcinogenesis. TRAIL (TNF-related apoptosis-inducing ligand) induces apoptosis upon binding to the TRAIL death receptors, TRAIL receptor 1 (TRAIL-R1) and TRAIL-R2, whereas binding to TRAIL-R3 and TRAIL-R4 might promote cell survival and proliferation. The anti-tumor activity of TRAIL-R1 and TRAIL-R2 agonists is currently investigated in clinical trials. To gain further insight into the regulation of apoptosis in hepatocellular carcinoma (HCC), we investigated the TRAIL pathway and the regulators of apoptosis caspase-8, Bcl-xL and Mcl-1 in patients with HCC regarding patient survival. We analyzed 157 hepatocellular carcinoma patients who underwent partial liver resection or orthotopic liver transplantation and healthy control liver tissue using immunohistochemistry on tissue microarrays for the expression of TRAIL-R1 to TRAIL-R4, caspase-8, Bcl-xL and Mcl-1. Immunohistochemical data were evaluated for potential associations with clinico-pathological parameters and survival. Whereas TRAIL-R1 was downregulated in HCC in comparison to normal liver tissue, TRAIL-R2 and –R4 were upregulated in HCC, especially in G2 and G3 tumors. TRAIL-R1 downregulation and upregulation of TRAIL-R2 and TRAIL-R4 correlated with tumor dedifferentiation (G2/G3). TRAIL-R3, Bcl-xL and Mcl-1 showed no differential expression in tumor tissue compared to normal tissue. The expression levels of TRAIL receptors did not correlate with patient survival after partial hepatectomy. Interestingly, in tumor tissue, but not in normal hepatocytes, caspase-8 showed a strong nuclear staining. Low cytosolic and high nuclear staining intensity of caspase-8 significantly correlated with impaired survival after partial hepatectomy, which, for cytosolic caspase-8, was independent from tumor grade. Assessment of TRAIL-receptor expression patterns may have therapeutic implications for the use of TRAIL receptor agonists in HCC therapy
Bcl-xL stimulates Bax relocation to mitochondria and primes cells to ABT-737.
Renault, Thibaud T; Teijido, Oscar; Missire, Florent; Ganesan, Yogesh Tengarai; Velours, Gisèle; Arokium, Hubert; Beaumatin, Florian; Llanos, Raul; Athané, Axel; Camougrand, Nadine; Priault, Muriel; Antonsson, Bruno; Dejean, Laurent M; Manon, Stéphen
2015-07-01
Bax cytosol-to-mitochondria translocation is a central event of the intrinsic pathway of apoptosis. Bcl-xL is an important regulator of this event and was recently shown to promote the retrotranslocation of mitochondrial Bax to the cytosol. The present study identifies a new aspect of the regulation of Bax localization by Bcl-xL: in addition to its role in Bax inhibition and retrotranslocation, we found that, like with Bcl-2, an increase of Bcl-xL expression levels led to an increase of Bax mitochondrial content. This finding was substantiated both in pro-lymphocytic FL5.12 cells and a yeast reporting system. Bcl-xL-dependent increase of mitochondrial Bax is counterbalanced by retrotranslocation, as we observed that Bcl-xLΔC, which is unable to promote Bax retrotranslocation, was more efficient than the full-length protein in stimulating Bax relocation to mitochondria. Interestingly, cells overexpressing Bcl-xL were more sensitive to apoptosis upon treatment with the BH3-mimetic ABT-737, suggesting that despite its role in Bax inhibition, Bcl-xL also primes mitochondria to permeabilization and cytochrome c release. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nikdel, K; Aminafshar, M; Mohammadi-Sangcheshmeh, A; EmamJomeh-Kashan, N; Seyedjafari, E
2017-05-20
In this study, in vitro maturation was performed in presence of various concentrations (0, 10, 100, or 1000 µM) of H2O2. The intracellular glutathione (GSH) level, fertilization, cleavage, and blastocyst rates, total cell number, and apoptotic cell number and expression of Bax, Bcl-2, and p53 genes in blastocyst-stage embryos were studied. At 10 μM H2O2 concentration, a higher GSH level was detected in comparison to the other groups while oocytes exposed to 1000 μM H2O2 had the lowest GSH level. Treatment of oocytes with 1000 μM H2O2 decreased the rate of two pronuclei formation as compared with other groups. A higher rate of blastocyst formation was seen in 100 μM H2O2 group as compared with the control group. However, exogenous H2O2 in maturation medium did not affect total cell numbers and apoptotic cell ratio at the blastocyst stage. Moreover, mRNA transcript abundance of Bax, Bcl-2, and p53 genes was similar between blastocysts derived from H2O2-induced oocytes and control blastocysts. Treatment of oocytes with H2O2 at mild level during in vitro maturation had a positive effect on GSH level and this, in turn, may lead to improvement in preimplantation embryonic development.
Directory of Open Access Journals (Sweden)
Hunaldo Lima de Menezes
2010-06-01
Full Text Available CONTEXT: Search of tumors markers that allow treatment with higher survival rates, and indicate the response to treatment and recurrence of cancer OBJECTIVE: To analyze the immunoexpression of the proteins p53, bcl-2 and Ki-67 in colorectal adenocarcinoma and correlate them with the clinical-pathological prognostic factors. METHOD: Tissue microarray paraffin blocks were made from colorectal adenocarcinoma tissue resected from 82 patients who had undergone surgery but not chemotherapy or radiotherapy, at "Hospital São Paulo", São Paulo, SP, Brazil, between 2002 and 2005. Thin sections (4 µm were subjected to immunohistochemical reactions, and immunoexpression staining scores were obtained. The scores were correlated with the degree of cell differentiation, staging, disease-free interval, recurrence, survival and specific mortality. The study variables were analyzed using the chi-square and Kaplan-Meier tests to investigate associations with the markers. The significance of the differences between the curves of the disease-free interval and survival was analyzed using the Logrank and Wilcoxon tests. RESULTS: The immunohistochemical expression of p53 was positive in 70 tumors (85.4% and negative in 12 (14.6%. The expression of bcl-2 was positive in 26 (31.7% and negative in 56 (68.3%. The expression of Ki-67 was positive in 62 (75.6% and negative in 20 (24.4%. There was no statistically significant correlation between the expressions of these markers separately or in conjunction, in relation to the degree of cell differentiation, staging, disease-free interval, survival and specific mortality. In relation to recurrence, there was a statistically significant correlation with positive expression of Ki-67 (P = 0.035. CONCLUSION: The immunohistochemical expression of Ki-67 in colorectal cancer is associated with recurrence of this disease.CONTEXTO: Pesquisa de marcadores tumorais que permitam tratamento com maiores índices de sobrevida, além de
Directory of Open Access Journals (Sweden)
Lincoln Douglas
2006-06-01
Full Text Available Abstract Background Increased expression of Eph receptor tyrosine kinases and their ephrin ligands has been implicated in tumor progression in a number of malignancies. This report describes aberrant expression of these genes in ovarian cancer, the commonest cause of death amongst gynaecological malignancies. Methods Eph and ephrin expression was determined using quantitative real time RT-PCR. Correlation of gene expression was measured using Spearman's rho statistic. Survival was analysed using log-rank analysis and (was visualised by Kaplan-Meier survival curves. Results Greater than 10 fold over-expression of EphA1 and a more modest over-expression of EphA2 were observed in partially overlapping subsets of tumors. Over-expression of EphA1 strongly correlated (r = 0.801; p Conclusion These data imply that increased levels of ephrins A1 and A5 in the presence of high expression of Ephs A1 and A2 lead to a more aggressive tumor phenotype. The known functions of Eph/ephrin signalling in cell de-adhesion and movement may explain the observed correlation of ephrin expression with poor prognosis.
A Combinatory Approach for Selecting Prognostic Genes in Microarray Studies of Tumour Survivals
Directory of Open Access Journals (Sweden)
Qihua Tan
2009-01-01
Full Text Available Different from significant gene expression analysis which looks for genes that are differentially regulated, feature selection in the microarray-based prognostic gene expression analysis aims at finding a subset of marker genes that are not only differentially expressed but also informative for prediction. Unfortunately feature selection in literature of microarray study is predominated by the simple heuristic univariate gene filter paradigm that selects differentially expressed genes according to their statistical significances. We introduce a combinatory feature selection strategy that integrates differential gene expression analysis with the Gram-Schmidt process to identify prognostic genes that are both statistically significant and highly informative for predicting tumour survival outcomes. Empirical application to leukemia and ovarian cancer survival data through-within- and cross-study validations shows that the feature space can be largely reduced while achieving improved testing performances.
Sharma, Ruchi; George, Aman; Chauhan, Manmohan S; Singla, Suresh; Manik, Radhey S; Palta, Prabhat
2013-01-01
This study investigated the effects of supplementation of culture medium with 10 μM Y-27632, a specific inhibitor of Rho kinase activity, for 6 days on self-renewal of buffalo embryonic stem (ES) cell-like cells at Passage 50-80. Y-27632 increased mean colony area (P<0.05) although it did not improve their survival. It decreased OCT4 expression (P<0.05), increased NANOG expression (P<0.05), but had no effect on SOX2 expression. It also increased expression of anti-apoptotic gene BCL-2 (P<0.05) and decreased that of pro-apoptotic genes BAX and BID (P<0.05). It increased plating efficiency of single-cell suspensions of ES cells (P<0.05). Following vitrification, the presence of Y-27632 in the vitrification solution or thawing medium or both did not improve ES cell colony survival. However, following seeding of clumps of ES cells transfected with pAcGFP1N1 carrying green fluorescent protein (GFP), Y-27632 increased colony formation rate (P<0.01). ES cell colonies that formed in all Y-27632-supplemented groups were confirmed for expression of pluripotency markers alkaline phosphatase, SSEA-4 and TRA-1-60, and for their ability to generate embryoid bodies containing cells that expressed markers of ectoderm, mesoderm and endoderm. In conclusion, Y-27632 improves survival of buffalo ES cells under unfavourable conditions such as enzymatic dissociation to single cells or antibiotic-assisted selection after transfection, without compromising their pluripotency.
Directory of Open Access Journals (Sweden)
Paola Altieri
Full Text Available Senescence and apoptosis are two distinct cellular programs that are activated in response to a variety of stresses. Low or high doses of the same stressor, i.e., the anticancer drug doxorubicin, may either induce apoptosis or senescence, respectively, in cardiac muscle cells. We have demonstrated that PPARδ, a ligand-activated transcriptional factor that controls lipid metabolism, insulin sensitivity and inflammation, is also involved in the doxorubicin-induced senescence program. This occurs through its interference with the transcriptional repressor protein B cell lymphoma-6 (Bcl6. Low doses of doxorubicin increase the expression of PPARδ that sequesters Bcl6, thus preventing it from exerting its anti-senescent effects. We also found that L-165041, a specific PPARδ activator, is highly effective in protecting cardiomyocytes from doxorubicin-induced senescence through a Bcl6 related mechanism. In fact, L-165041 increases Bcl6 expression via p38, JNK and Akt activation, and at the same time it induces the release of Bcl6 from PPARδ, thereby enabling Bcl6 to bind to its target genes. L-165041 also prevented apoptosis induced by higher doses of doxorubicin. However, while experiments performed with siRNA analysis techniques very clearly showed the weight of Bcl6 in the cellular senescence program, no role was found for Bcl6 in the anti-apoptotic effects of L-165041, thus confirming that senescence and apoptosis are two very distinct stress response cellular programs. This study increases our understanding of the molecular mechanism of anthracycline cardiotoxicity and suggests a potential role for PPARδ agonists as cardioprotective agents.
DEFF Research Database (Denmark)
Pedersen, Mette Ø; Gang, Anne O; Poulsen, Tim S
2012-01-01
Concurrent BCL2 and MYC translocations, so called double hit (DH), are a rare finding in large B-cell lymphoma (LBCL). Based on data from retrospective series, DH has been correlated with aggressive clinical behaviour and poor outcome. We conducted a consecutive study of DH incidence and correlat......Concurrent BCL2 and MYC translocations, so called double hit (DH), are a rare finding in large B-cell lymphoma (LBCL). Based on data from retrospective series, DH has been correlated with aggressive clinical behaviour and poor outcome. We conducted a consecutive study of DH incidence...
International Nuclear Information System (INIS)
Del Vecchio, Silvana; Zannetti, Antonella; Aloj, Luigi; Caraco, Corradina; Ciarmiello, Andrea; Salvatore, Marco
2003-01-01
Lack of technetium-99m methoxyisobutylisonitrile ( 99m Tc-MIBI) uptake is consistently reported to predict poor response to subsequent chemotherapy in a variety of human malignant tumours. Since 99m Tc-MIBI accumulates within mitochondria, which also play a central role in apoptosis through the integration of death signals by Bcl-2 family members, we tested whether early 99m Tc-MIBI uptake is affected by alterations of the apoptotic pathway. Forty-two breast cancer patients were intravenously injected with 740 MBq of 99m Tc-MIBI and planar images were obtained 10 min post injection with the patients in the prone lateral position. Ten carcinomas failed to accumulate 99m Tc-MIBI and could not be visualised on scintigraphic images despite being larger than 1.8 cm (MIBI negative). Thirty-two of the 42 breast carcinomas showed focal uptake of 99m Tc-MIBI (MIBI positive), and 10 min tumour-to-background ratios (T/B) varied between 1.14 and 6.93. The apoptotic index, the rate of proliferation, and the expression of the anti-apoptotic Bcl-2 protein and pro-apoptotic Bax protein were assessed in surgically excised tumours. All MIBI-negative carcinomas showed a dramatic and statistically significant reduction in the apoptotic index as compared with MIBI-positive lesions (mean±SD, 0.14±0.15 vs 1.28±0.83, P 99m Tc-MIBI in breast carcinomas is affected by alterations of apoptotic pathway. High levels of Bcl-2, despite the stabilisation of mitochondrial membrane potentials, prevent accumulation of 99m Tc-MIBI in tumour cells. In conclusion, absent or reduced early 99m Tc-MIBI uptake in large tumours may indicate a Bcl-2-mediated resistance to chemo- and radiotherapy. (orig.)
Directory of Open Access Journals (Sweden)
Elham Tafsiri
2016-01-01
Conclusion: The significant differential expression level of these miRNAs made them as candidate biomarkers in NSCLC tumor tissues of patients. Perhaps Bcl-2 down-regulation and Akt-3 up-regulation can be linked with survival signals in A549 cell line. We can conclude that Bcl-2 and Akt-3 might be therapeutic targets to inhibit cell proliferation in NSCLC.
International Nuclear Information System (INIS)
Yu Hongsheng; Fei Conghe; Shen Fangzhen; Liang Jun
2003-01-01
Objective: To study the effect of low dose radiation (LDR) on tumor apoptosis, cell cycle progression and changes of apoptosis-related protein bcl-2 in tumor-bearing mice. Methods: Kunming stain male mice were implanted with S180 sarcoma cells in the left inguen subcutaneously as an in situ experimental animal model. Seven days after implantation, the mice were given 75 mGy whole-body γ-irradiation. At 24 and 48 h after irradiation, all mice were sacrificed to measure the tumor volume, and tumor cell apoptosis, cell cycle progression were analyzed by flow cytometry. The expression of apoptosis-related protein bcl-2 and the apoptotic rate of tumor cells were observed by immunohistochemistry and electron microscopy. Results: Tumor growth was significantly slowed down after LDR (P 1 phase and the expression of bcl-2 protein decreased at 24 h. Apoptotic rate of tumor cells increased significantly at 48 h after LDR. Conclusion: LDR could cause a G 1 -phase arrest and increase the apoptosis of tumor cells through the low level of apoptosis-related protein bcl-2 in the tumor-bearing mice. The organized immune function and anti-tumor ability are markedly increased after LDR. The study provides practical evidence of clinical application to cancer treatment
International Nuclear Information System (INIS)
Gao Linlu; Cui Yufang; Yang Hong; Xia Guowei; Peng Ruiyun; Gao Yabin; Wang Dewen
2000-01-01
Objective: To investigate the expressions of Fas and Bcl-2 and their significance in apoptosis of spleen lymphocyte of mice after large dose γ-ray irradiation. Methods: At 3,6,12,24 h, 3, 7, 14 and 28 d after 6-20 Gy γ-ray irradiation mice were sacrificed and their spleens were removed. The expressions of Fas and Bcl-2 oncoprotein were analysed by LSAB immunohistochemical method. Results: The expression of Fas was strongly positive at 6 h after irradiation, especially in 6-12 Gy groups. It become less obvious along with prolongation of time after irradiation and almost disappeared on d 7 after irradiation. The expression of Bcl-2 was nearly negative at 6 h after irradiation, especially in 12-20 Gy groups, and did not recover on d 28 after irradiation. Conclusion: After large dose γ-ray irradiation the expression of Fas in mouse spleen lymphocytes shows a better relationship to lymphocyte apoptosis; in other words, Fas can prompt apoptosis. On the other hand, the action of Bcl-2 is reduced or even disappeared. Both of them play an important role in spleen lymphocyte apoptosis after large dose of γ-irradiation
Alternation of apoptotic and implanting genes expression of mouse embryos after re-vitrification
Directory of Open Access Journals (Sweden)
Nasrin Majidi Gharenaz
2016-08-01
Full Text Available Background: Nowadays, oocytes and embryos vitrification has become a routine technique. Based on clinical judgment, re-vitrification maybe required. But little is known about re-vitrification impact on genes expression. Objective: The impact of re-vitrification on apoptotic and implanting genes, Bax, Bcl-2 and ErbB4, at compaction stage embryos were evaluated in this study. Materials and Methods: In this experimental study, 8 cell embryos (n=240 were collected from female mature mice, 60-62 hr post HCG injection. The embryos were divided randomly to 3 groups included: fresh (n=80, vitrified at 8 cell stage (n=80, vitrified at 8 cell stage thawed and re-vitrified at compaction stage (n=80. Embryos were vitrified by using cryolock, (open system described by Kuwayama. Q-PCR was used to examine the expression of Bax, Bcl2 ErbB4 genes in derived blastocysts. Results: Our result showed that expanded blastocyst rate was similar between vitrified and re-vitrified groups, while re-vitrified embryos showed significant decrease in expanded blastocyst rate comparing with fresh embryos (p=0.03. In addition, significant difference was observed on apoptotic gene expression when comparing re-vitrified and fresh embryos (p=0.004, however expression of Bax and Bcl-2 (apoptotic genes didn't demonstrate a significant difference between re-vitrified and vitrified groups. The expression rate of ErbB4, an implantation gene was decreased in re-vitrified embryos comparing with fresh embryos (p=0.003, but it was similar between re-vitrified and vitrified embryos. Conclusion: Re-vitrification can alter the expression of Bax, Bcl-2 and ErbB4 genes and developmental rate of mouse embryos in compaction stage
Juhásová, Barbora; Mentel, Marek; Bhatia-Kiššová, Ingrid; Zeman, Igor; Kolarov, Jordan; Forte, Michael; Polčic, Peter
2011-09-02
Proteins of the Bcl-2 family regulate programmed cell death in mammals by promoting the release of cytochrome c from mitochondria in response to various proapoptotic stimuli. The mechanism by which BH3-only members of the family activate multidomain proapoptotic proteins Bax and Bak to form a pore in mitochondrial membranes remains under dispute. We report that cell death promoting activity of BH3-only protein Bim can be reconstituted in yeast when both Bax and antiapoptotic protein Bcl-X(L) are present, suggesting that Bim likely activates Bax indirectly by inhibiting antiapoptotic proteins. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
A six-gene signature predicts survival of patients with localized pancreatic ductal adenocarcinoma.
Directory of Open Access Journals (Sweden)
Jeran K Stratford
2010-07-01
Full Text Available Pancreatic ductal adenocarcinoma (PDAC remains a lethal disease. For patients with localized PDAC, surgery is the best option, but with a median survival of less than 2 years and a difficult and prolonged postoperative course for most, there is an urgent need to better identify patients who have the most aggressive disease.We analyzed the gene expression profiles of primary tumors from patients with localized compared to metastatic disease and identified a six-gene signature associated with metastatic disease. We evaluated the prognostic potential of this signature in a training set of 34 patients with localized and resected PDAC and selected a cut-point associated with outcome using X-tile. We then applied this cut-point to an independent test set of 67 patients with localized and resected PDAC and found that our signature was independently predictive of survival and superior to established clinical prognostic factors such as grade, tumor size, and nodal status, with a hazard ratio of 4.1 (95% confidence interval [CI] 1.7-10.0. Patients defined to be high-risk patients by the six-gene signature had a 1-year survival rate of 55% compared to 91% in the low-risk group.Our six-gene signature may be used to better stage PDAC patients and assist in the difficult treatment decisions of surgery and to select patients whose tumor biology may benefit most from neoadjuvant therapy. The use of this six-gene signature should be investigated in prospective patient cohorts, and if confirmed, in future PDAC clinical trials, its potential as a biomarker should be investigated. Genes in this signature, or the pathways that they fall into, may represent new therapeutic targets. Please see later in the article for the Editors' Summary.
Room temperature inductively coupled plasma etching of InAs/InSb in BCl 3/Cl 2/Ar
Sun, Jian; Kosel, Jü rgen
2012-01-01
Inductively coupled plasma (ICP) etching of InAs and InSb at room temperature has been investigated using BCl 3/Cl 2/Ar plasma. Specifically, the etch rate and post-etching surface morphology were investigated as functions of the gas composition
Nguyen, AnhThu; Rauch, Tibor A.; Pfeifer, Gerd P.; Hu, Valerie W.
2010-01-01
Autism is currently considered a multigene disorder with epigenetic influences. To investigate the contribution of DNA methylation to autism spectrum disorders, we have recently completed large-scale methylation profiling by CpG island microarray analysis of lymphoblastoid cell lines derived from monozygotic twins discordant for diagnosis of autism and their nonautistic siblings. Methylation profiling revealed many candidate genes differentially methylated between discordant MZ twins as well as between both twins and nonautistic siblings. Bioinformatics analysis of the differentially methylated genes demonstrated enrichment for high-level functions including gene transcription, nervous system development, cell death/survival, and other biological processes implicated in autism. The methylation status of 2 of these candidate genes, BCL-2 and retinoic acid-related orphan receptor alpha (RORA), was further confirmed by bisulfite sequencing and methylation-specific PCR, respectively. Immunohistochemical analyses of tissue arrays containing slices of the cerebellum and frontal cortex of autistic and age- and sex-matched control subjects revealed decreased expression of RORA and BCL-2 proteins in the autistic brain. Our data thus confirm the role of epigenetic regulation of gene expression via differential DNA methylation in idiopathic autism, and furthermore link molecular changes in a peripheral cell model with brain pathobiology in autism.—Nguyen, A., Rauch, T. A., Pfeifer, G. P., Hu, V. W. Global methylation profiling of lymphoblastoid cell lines reveals epigenetic contributions to autism spectrum disorders and a novel autism candidate gene, RORA, whose protein product is reduced in autistic brain. PMID:20375269
Transcriptional profiles of SHH pathway genes in keratocystic odontogenic tumor and ameloblastoma.
Gurgel, Clarissa Araújo Silva; Buim, Marcilei Eliza Cavichiolli; Carvalho, Kátia Cândido; Sales, Caroline Brandi Schlaepfer; Reis, Mitermayer Galvão; de Souza, Renata Oliveira; de Faro Valverde, Ludmila; de Azevedo, Roberto Almeida; Dos Santos, Jean Nunes; Soares, Fernando Augusto; Ramos, Eduardo Antônio Gonçalves
2014-09-01
Sonic hedgehog (SHH) pathway activation has been identified as a key factor in the development of many types of tumors, including odontogenic tumors. Our study examined the expression of genes in the SHH pathway to characterize their roles in the pathogenesis of keratocystic odontogenic tumors (KOT) and ameloblastomas (AB). We quantified the expression of SHH, SMO, PTCH1, SUFU, GLI1, CCND1, and BCL2 genes by qPCR in a total of 23 KOT, 11 AB, and three non-neoplastic oral mucosa (NNM). We also measured the expression of proteins related to this pathway (CCND1 and BCL2) by immunohistochemistry. We observed overexpression of SMO, PTCH1, GLI1, and CCND1 genes in both KOT (23/23) and AB (11/11). However, we did not detect expression of the SHH gene in 21/23 KOT and 10/11 AB tumors. Low levels of the SUFU gene were expressed in KOT (P = 0.0199) and AB (P = 0.0127) relative to the NNM. Recurrent KOT exhibited high levels of SMO (P = 0.035), PTCH1 (P = 0.048), CCND1 (P = 0.048), and BCL2 (P = 0.045) transcripts. Using immunolabeling of CCND1, we observed no statistical difference between primary and recurrent KOT (P = 0.8815), sporadic and NBCCS-KOT (P = 0.7688), and unicystic and solid AB (P = 0.7521). Overexpression of upstream (PTCH1 and SMO) and downstream (GLI1, CCND1 and BCL2) genes in the SHH pathway leads to the constitutive activation of this pathway in KOT and AB and may suggest a mechanism for the development of these types of tumors. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Ismail Adam Arbab
2012-01-01
Full Text Available This study was set to investigate antiproliferative potential of dentatin (a natural coumarin isolated from Clausena excavata Burm. F against prostate cancer and to delineate the underlying mechanism of action. Treatment with dentatin dose-dependently inhibited cell growth of PC-3 and LNCaP prostate cancer cell lines, whereas it showed less cytotoxic effects on normal prostate epithelial cell line (RWPE-1. The inhibitory effect of dentatin on prostate cancer cell growth was due to induction of apoptosis as evidenced by Annexin V staining and cell shrinkage. We found that dentatin-mediated accumulation of reactive oxygen species (ROS and downregulated expression levels of antiapoptotic molecules (Bcl-2, Bcl-xL, and Survivin, leading to disruption of mitochondrial membrane potential (MMP, cell membrane permeability, and release of cytochrome c from the mitochondria into the cytosol. These effects were associated with induction of caspase-9, -3/7 activities, and subsequent DNA fragmentation. In addition, we found that dentatin inhibited TNF-α-induced nuclear translocation of p65, suggesting dentatin as a potential NF-κB inhibitor. Thus, we suggest that dentatin may have therapeutic value in prostate cancer treatment worthy of further development.
Insulin receptor substrate-3, interacting with Bcl-3, enhances p50 NF-{kappa}B activity
Energy Technology Data Exchange (ETDEWEB)
Kabuta, Tomohiro [Departments of Animal Sciences and Applied Biological Chemistry, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo 113-8657 (Japan); Department of Degenerative Neurological Diseases, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Kodaira, Tokyo 187-8502 (Japan); Hakuno, Fumihiko; Cho, Yoshitake; Yamanaka, Daisuke; Chida, Kazuhiro [Departments of Animal Sciences and Applied Biological Chemistry, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo 113-8657 (Japan); Asano, Tomoichiro [Graduate School of Biomedical Science, Hiroshima University, Hiroshima 734-8551 (Japan); Wada, Keiji [Department of Degenerative Neurological Diseases, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Kodaira, Tokyo 187-8502 (Japan); Takahashi, Shin-Ichiro, E-mail: atkshin@mail.ecc.u-tokyo.ac.jp [Departments of Animal Sciences and Applied Biological Chemistry, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo 113-8657 (Japan)
2010-04-09
The insulin receptor substrate (IRS) proteins are major substrates of both insulin receptor and insulin-like growth factor (IGF)-I receptor tyrosine kinases. Previously, we reported that IRS-3 is localized to both cytosol and nucleus, and possesses transcriptional activity. In the present study, we identified Bcl-3 as a novel binding protein to IRS-3. Bcl-3 is a nuclear protein, which forms a complex with the homodimer of p50 NF-{kappa}B, leading to enhancement of transcription through p50 NF-{kappa}B. We found that Bcl-3 interacts with the pleckstrin homology domain and the phosphotyrosine binding domain of IRS-3, and that IRS-3 interacts with the ankyrin repeat domain of Bcl-3. In addition, IRS-3 augmented the binding activity of p50 to the NF-{kappa}B DNA binding site, as well as the tumor necrosis factor (TNF)-{alpha}-induced transcriptional activity of NF-{kappa}B. Lastly, IRS-3 enhanced NF-{kappa}B-dependent anti-apoptotic gene induction and consequently inhibited TNF-{alpha}-induced cell death. This series of results proposes a novel function for IRS-3 as a transcriptional regulator in TNF-{alpha} signaling, distinct from its function as a substrate of insulin/IGF receptor kinases.
International Nuclear Information System (INIS)
Øyan, Anne Margrete; Ånensen, Nina; Bø, Trond Hellem; Stordrange, Laila; Jonassen, Inge; Bruserud, Øystein; Kalland, Karl-Henning; Gjertsen, Bjørn Tore
2009-01-01
The molecular changes in vivo in acute myeloid leukemia cells early after start of conventional genotoxic chemotherapy are incompletely understood, and it is not known if early molecular modulations reflect clinical response. The gene expression was examined by whole genome 44 k oligo microarrays and 12 k cDNA microarrays in peripheral blood leukocytes collected from seven leukemia patients before treatment, 2–4 h and 18–24 h after start of chemotherapy and validated by real-time quantitative PCR. Statistically significantly upregulated genes were classified using gene ontology (GO) terms. Parallel samples were examined by flow cytometry for apoptosis by annexin V-binding and the expression of selected proteins were confirmed by immunoblotting. Significant differential modulation of 151 genes were found at 4 h after start of induction therapy with cytarabine and anthracycline, including significant overexpression of 31 genes associated with p53 regulation. Within 4 h of chemotherapy the BCL2/BAX and BCL2/PUMA ratio were attenuated in proapoptotic direction. FLT3 mutations indicated that non-responders (5/7 patients, 8 versus 49 months survival) are characterized by a unique gene response profile before and at 4 h. At 18–24 h after chemotherapy, the gene expression of p53 target genes was attenuated, while genes involved in chemoresistance, cytarabine detoxification, chemokine networks and T cell receptor were prominent. No signs of apoptosis were observed in the collected cells, suggesting the treated patients as a physiological source of pre-apoptotic cells. Pre-apoptotic gene expression can be monitored within hours after start of chemotherapy in patients with acute myeloid leukemia, and may be useful in future determination of therapy responders. The low number of patients and the heterogeneity of acute myeloid leukemia limited the identification of gene expression predictive of therapy response. Therapy-induced gene expression reflects the complex
Graaf, A.O. de; Meijerink, J.P.P.; Heuvel, L.P.W.J. van den; Abreu, R.A. de; Witte, T.J.M. de; Jansen, J.H.; Smeitink, J.A.M.
2002-01-01
Several studies indicate that mitochondrial ATP production as well as ADP/ATP exchange across mitochondrial membranes are impaired during apoptosis. We investigated whether Bcl-2 could protect against cell death under conditions in which ATP metabolism is inhibited. Inhibition of ATP production
Thermodynamic study on co-deposition of ZrB2–SiC from ZrCl4–BCl3–CH3SiCl3–H2–Ar system
International Nuclear Information System (INIS)
Deng, Juanli; Cheng, Laifei; Zheng, Guopeng; Su, Kehe; Zhang, Litong
2012-01-01
Thermodynamics phase diagram of ZrB 2 –SiC co-deposited from precursors of ZrCl 4 –BCl 3 –CH 3 SiCl 3 (methyltrichlorosilane, MTS)–H 2 –Ar has been investigated in detail by using the FactSage code and its embedded database (130 species being involved). The yields of condensed phases in the co-deposition process have been examined as the functions of the inject reactant ratios of BCl 3 / (BCl 3 + MTS) and H 2 / (ZrCl 4 + BCl 3 + MTS), and the temperature at a fixed pressure of 5 kPa. The results show that their yields strongly depend on the molar ratios of the inject reactants and the temperature. Consequently, the pure ZrB 2 –SiC composite without free C, B 4 C, ZrC and ZrSi can be co-deposited under the ideal condition by adjusting the reactant ratios and the temperature. The gas-phase equilibrium concentration distribution shows that the high input amount of H 2 is favorable for the co-deposition of ZrB 2 and SiC at a fixed ratio of ZrCl 4 :BCl 3 :MTS:Ar. In the end, the theoretical results can lay down guidelines for increasing the experimental yields of ZrB 2 and SiC. - Highlights: ► The exact ratio of ZrB 2 and SiC could be obtained by adjusting input gas ratios. ► The other condensed phase species could appear under some suitable conditions ► The H 2 acting as reaction species directly influences the deposition process. ► The high H 2 input amount is favorable for the co-deposition of ZrB 2 and SiC. ► The flow rate range of the H 2 pump should be increased in the experimental study.
Bcl-2–associated athanogene 3 protects the heart from ischemia/reperfusion injury
Su, Feifei; Myers, Valerie D.; Knezevic, Tijana; Wang, JuFang; Gao, Erhe; Madesh, Muniswamy; Tahrir, Farzaneh G.; Gupta, Manish K.; Gordon, Jennifer; Rabinowitz, Joseph; Ramsey, Frederick V.; Tilley, Douglas G.; Khalili, Kamel; Cheung, Joseph Y.; Feldman, Arthur M.
2016-01-01
Bcl-2–associated athanogene 3 (BAG3) is an evolutionarily conserved protein expressed at high levels in the heart and the vasculature and in many cancers. While altered BAG3 expression has been associated with cardiac dysfunction, its role in ischemia/reperfusion (I/R) is unknown. To test the hypothesis that BAG3 protects the heart from reperfusion injury, in vivo cardiac function was measured in hearts infected with either recombinant adeno-associated virus serotype 9–expressing (rAAV9-expre...
Directory of Open Access Journals (Sweden)
Li Bie
Full Text Available Identification of gene expression changes that improve prediction of survival time across all glioma grades would be clinically useful. Four Affymetrix GeneChip datasets from the literature, containing data from 771 glioma samples representing all WHO grades and eight normal brain samples, were used in an ANOVA model to screen for transcript changes that correlated with grade. Observations were confirmed and extended using qPCR assays on RNA derived from 38 additional glioma samples and eight normal samples for which survival data were available. RNA levels of eight major mitotic spindle assembly checkpoint (SAC genes (BUB1, BUB1B, BUB3, CENPE, MAD1L1, MAD2L1, CDC20, TTK significantly correlated with glioma grade and six also significantly correlated with survival time. In particular, the level of BUB1B expression was highly correlated with survival time (p<0.0001, and significantly outperformed all other measured parameters, including two standards; WHO grade and MIB-1 (Ki-67 labeling index. Measurement of the expression levels of a small set of SAC genes may complement histological grade and other clinical parameters for predicting survival time.
Directory of Open Access Journals (Sweden)
Rosa Rafael
2012-06-01
Full Text Available Abstract Background The complex balance between environmental and host factors is an important determinant of susceptibility to infection. Disturbances of this equilibrium may result in multifactorial diseases as illustrated by the summer mortality syndrome, a worldwide and complex phenomenon that affects the oysters, Crassostrea gigas. The summer mortality syndrome reveals a physiological intolerance making this oyster species susceptible to diseases. Exploration of genetic basis governing the oyster resistance or susceptibility to infections is thus a major goal for understanding field mortality events. In this context, we used high-throughput genomic approaches to identify genetic traits that may characterize inherent survival capacities in C. gigas. Results Using digital gene expression (DGE, we analyzed the transcriptomes of hemocytes (immunocompetent cells of oysters able or not able to survive infections by Vibrio species shown to be involved in summer mortalities. Hemocytes were nonlethally collected from oysters before Vibrio experimental infection, and two DGE libraries were generated from individuals that survived or did not survive. Exploration of DGE data and microfluidic qPCR analyses at individual level showed an extraordinary polymorphism in gene expressions, but also a set of hemocyte-expressed genes whose basal mRNA levels discriminate oyster capacity to survive infections by the pathogenic V. splendidus LGP32. Finally, we identified a signature of 14 genes that predicted oyster survival capacity. Their expressions are likely driven by distinct transcriptional regulation processes associated or not associated to gene copy number variation (CNV. Conclusions We provide here for the first time in oyster a gene expression survival signature that represents a useful tool for understanding mortality events and for assessing genetic traits of interest for disease resistance selection programs.
Nonsyndromic cleft lip with or without cleft palate: New BCL3 information
Energy Technology Data Exchange (ETDEWEB)
Amos, C.; Hecht, J.T. [Univ. of Texas Medical School, Houston, TX (United States); Gasser, D. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)
1996-09-01
We did not previously provide LOD scores for linkage assuming heterogeneity, as suggested by Ott for the linkage analysis of cleft lip with or without cleft palate (CL/P) and BCL3, ApoC2, and D19S178 in the paper by Stein et al. The results from analysis using the HOMOG program, allowing for heterogeneity under the reduced penetrance model, gave a maximum LOD score of 1.85 for ApoC2, 0.41 for BCL3, 0.03 for D19S178, and 1.72 for multipoint analysis in the interval. For the affecteds-only model, the values are 1.96 for ApoC2, 0.41 for BCL3, 0.01 for D19S178, and 1.44 for the multipoint analysis. 8 refs.
Role of BRCA2 mutation status on overall survival among breast cancer patients from Sardinia
International Nuclear Information System (INIS)
Budroni, Mario; Palmieri, Giuseppe; Cesaraccio, Rosaria; Coviello, Vincenzo; Sechi, Ornelia; Pirino, Daniela; Cossu, Antonio; Tanda, Francesco; Pisano, Marina; Palomba, Grazia
2009-01-01
Germline mutations in BRCA1 or BRCA2 genes have been demonstrated to increase the risk of developing breast cancer. Conversely, the impact of BRCA mutations on prognosis and survival of breast cancer patients is still debated. In this study, we investigated the role of such mutations on breast cancer-specific survival among patients from North Sardinia. Among incident cases during the period 1997–2002, a total of 512 breast cancer patients gave their consent to undergo BRCA mutation screening by DHPLC analysis and automated DNA sequencing. The Hakulinen, Kaplan-Meier, and Cox regression methods were used for both relative survival assessment and statistical analysis. In our series, patients carrying a germline mutation in coding regions and splice boundaries of BRCA1 and BRCA2 genes were 48/512 (9%). Effect on overall survival was evaluated taking into consideration BRCA2 carriers, who represented the vast majority (44/48; 92%) of mutation-positive patients. A lower breast cancer-specific overall survival rate was observed in BRCA2 mutation carriers after the first two years from diagnosis. However, survival rates were similar in both groups after five years from diagnosis. No significant difference was found for age of onset, disease stage, and primary tumour histopathology between the two subsets. In Sardinian breast cancer population, BRCA2 was the most affected gene and the effects of BRCA2 germline mutations on patients' survival were demonstrated to vary within the first two years from diagnosis. After a longer follow-up observation, breast cancer-specific rates of death were instead similar for BRCA2 mutation carriers and non-carriers
Price, Alexander M; Dai, Joanne; Bazot, Quentin; Patel, Luv; Nikitin, Pavel A; Djavadian, Reza; Winter, Peter S; Salinas, Cristina A; Barry, Ashley Perkins; Wood, Kris C; Johannsen, Eric C; Letai, Anthony; Allday, Martin J; Luftig, Micah A
2017-04-20
Latent Epstein-Barr virus (EBV) infection is causally linked to several human cancers. EBV expresses viral oncogenes that promote cell growth and inhibit the apoptotic response to uncontrolled proliferation. The EBV oncoprotein LMP1 constitutively activates NFκB and is critical for survival of EBV-immortalized B cells. However, during early infection EBV induces rapid B cell proliferation with low levels of LMP1 and little apoptosis. Therefore, we sought to define the mechanism of survival in the absence of LMP1/NFκB early after infection. We used BH3 profiling to query mitochondrial regulation of apoptosis and defined a transition from uninfected B cells (BCL-2) to early-infected (MCL-1/BCL-2) and immortalized cells (BFL-1). This dynamic change in B cell survival mechanisms is unique to virus-infected cells and relies on regulation of MCL-1 mitochondrial localization and BFL-1 transcription by the viral EBNA3A protein. This study defines a new role for EBNA3A in the suppression of apoptosis with implications for EBV lymphomagenesis.
Tsang, Jason C H; Yu, Yong; Burke, Shannon; Buettner, Florian; Wang, Cui; Kolodziejczyk, Aleksandra A; Teichmann, Sarah A; Lu, Liming; Liu, Pentao
2015-09-21
Hematopoietic stem cells (HSCs) are a rare cell type with the ability of long-term self-renewal and multipotency to reconstitute all blood lineages. HSCs are typically purified from the bone marrow using cell surface markers. Recent studies have identified significant cellular heterogeneities in the HSC compartment with subsets of HSCs displaying lineage bias. We previously discovered that the transcription factor Bcl11a has critical functions in the lymphoid development of the HSC compartment. In this report, we employ single-cell transcriptomic analysis to dissect the molecular heterogeneities in HSCs. We profile the transcriptomes of 180 highly purified HSCs (Bcl11a (+/+) and Bcl11a (-/-)). Detailed analysis of the RNA-seq data identifies cell cycle activity as the major source of transcriptomic variation in the HSC compartment, which allows reconstruction of HSC cell cycle progression in silico. Single-cell RNA-seq profiling of Bcl11a (-/-) HSCs reveals abnormal proliferative phenotypes. Analysis of lineage gene expression suggests that the Bcl11a (-/-) HSCs are constituted of two distinct myeloerythroid-restricted subpopulations. Remarkably, similar myeloid-restricted cells could also be detected in the wild-type HSC compartment, suggesting selective elimination of lymphoid-competent HSCs after Bcl11a deletion. These defects are experimentally validated in serial transplantation experiments where Bcl11a (-/-) HSCs are myeloerythroid-restricted and defective in self-renewal. Our study demonstrates the power of single-cell transcriptomics in dissecting cellular process and lineage heterogeneities in stem cell compartments, and further reveals the molecular and cellular defects in the Bcl11a-deficient HSC compartment.
Identification of repaglinide as a therapeutic drug for glioblastoma multiforme
International Nuclear Information System (INIS)
Xiao, Zui Xuan; Chen, Ruo Qiao; Hu, Dian Xing; Xie, Xiao Qiang; Yu, Shang Bin; Chen, Xiao Qian
2017-01-01
Glioblastoma multiforme (GBM) is a highly aggressive brain tumor with a median survival time of only 14 months after treatment. It is urgent to find new therapeutic drugs that increase survival time of GBM patients. To achieve this goal, we screened differentially expressed genes between long-term and short-term survived GBM patients from Gene Expression Omnibus database and found gene expression signature for the long-term survived GBM patients. The signaling networks of all those differentially expressed genes converged to protein binding, extracellular matrix and tissue development as revealed in BiNGO and Cytoscape. Drug repositioning in Connectivity Map by using the gene expression signature identified repaglinide, a first-line drug for diabetes mellitus, as the most promising novel drug for GBM. In vitro experiments demonstrated that repaglinide significantly inhibited the proliferation and migration of human GBM cells. In vivo experiments demonstrated that repaglinide prominently prolonged the median survival time of mice bearing orthotopic glioma. Mechanistically, repaglinide significantly reduced Bcl-2, Beclin-1 and PD-L1 expression in glioma tissues, indicating that repaglinide may exert its anti-cancer effects via apoptotic, autophagic and immune checkpoint signaling. Taken together, repaglinide is likely to be an effective drug to prolong life span of GBM patients. - Highlights: • Gene expression signarue in long-term survived GBM patients are identified from Gene Expression Omnibus database. • Repaglinide is identified as a survival-related drug for GBM via drug repositioning in CMap. • Repaglinide effectively kills GBM cells, inhibits GBM cell migration and increases survival of mice bearing orthotopic glioma. • Repaglinide reduces Bcl-2, Beclin-1 and PD-L1 in GBM tissues.
Anti-inflammatory heat shock protein 70 genes are positively associated with human survival
DEFF Research Database (Denmark)
Singh, Ripudaman; Kølvraa, Steen; Bross, Peter Gerd
2010-01-01
A positive relationship between stress tolerance and longevity has been observed in several model systems. That the same correlation is applicable in humans and that it may be open to experimental manipulation for extending human lifespan requires studies on association of stress genes with longe......A positive relationship between stress tolerance and longevity has been observed in several model systems. That the same correlation is applicable in humans and that it may be open to experimental manipulation for extending human lifespan requires studies on association of stress genes...... the opportunity to perform survival analysis on these subjects. Haplotype relative risk, and genotype relative risk were calculated to measure the effects of haplotypes and genotypes on human survival in a sex-specific manner. A significant association of HSPA1A-AA (RR=3.864; p=0.016) and HSPA1B-AA (RR=2.764; p=0...
Nitric oxide and bcl-2 mediated the apoptosis induced by nickel(II) in human T hybridoma cells
International Nuclear Information System (INIS)
Guan Fuqin; Zhang Dongmei; Wang Xinchang; Chen Junhui
2007-01-01
Although effects of nickel(II) on the immune system have long been recognized, little is known about the effects of nickel(II) on the induction of apoptosis and related signaling events in T cells. In the present study, we investigated the roles and signaling pathways of nickel(II) in the induction of apoptosis in a human T cell line jurkat. The results showed that the cytotoxic effects of Ni involved significant morphological changes and chromosomal condensation (Hoechst 33258 staining). Analyses of hypodiploid cells and FITC-Annexin V and PI double staining showed significant increase of apoptosis in jurkat cells 6, 12 and 24 h after nickel(II) treatment. Flow cytometry analysis also revealed that the loss of mitochondrial membrane potential (MMP) occurred concomitantly with the onset of NiCl 2 -induced apoptosis. Induction of apoptotic cell death by nickel was mediated by reduction of bcl-2 expression. Furthermore, nickel stimulated the generation of nitric oxide (NO). These results suggest that nickel(II) chloride induces jurkat cells apoptosis via nitric oxide generation, mitochondrial depolarization and bcl-2 suppression
Directory of Open Access Journals (Sweden)
K.K.O.L. Meça
2010-04-01
Full Text Available Apoptose e seus mecanismos reguladores são eventos fisiológicos cruciais para a manutenção da homeostase placentária, e o desequilíbrio desses processos pode comprometer a função placentária e, consequentemente, o sucesso da gravidez. Neste estudo, investigou-se a apoptose utilizando-se histomorfometria em lâminas coradas em HE e submetidas à reação de TUNEL. Além disso, avaliou-se a expressão de Bcl-2 e das caspases 8 e 3, pela reação de polimerase em cadeia em tempo real, em placentas saudáveis em diferentes estádios de gestação. Amostras de placentônios de vacas com quatro, seis e nove meses de gestação foram colhidas e processadas. O índice apoptótico aumentou progressivamente com o avanço da gestação. Tanto o Bcl-2 quanto as caspases 3 e 8 foram expressas nos três períodos estudados, sendo a expressão de Bcl-2 menor que a de caspase 8, que é menor que a de caspase 3. Estes resultados indicam que essas moléculas estão envolvidas na via apoptótica ativada na maturação placentária, exibindo um padrão de expressão ao longo da gestação e contribuindo para o equilíbrio fisiológico da celularidade e renovação celular na placenta bovina.Apoptosis and its regulating mechanisms are crucial physiological events for the maintenance of the placental homostasis; and disequilibrium of these processes may compromise placental function and the success of the pregnancy. In this study, apoptosis was investigated by histomorphometry using slides stained with HE and TUNEL reaction. Besides that, Bcl-2 and caspases 8 and 3 expression were evaluated by real time polymerase chain reaction in healthy placentas under different gestacional ages. Samples of placentones of cows at 4th, 6th, and 9th months of gestation were harvested and processed. The apoptotic index gradually increased with the advance of the gestation. Bcl-2 and caspases 3 and 8 were expressed in all the studied periods, being the expression of Bcl-2
Directory of Open Access Journals (Sweden)
Han Mingbo
2006-08-01
Full Text Available Abstract Background Cognitive performance declines with increasing age. Possible cellular mechanisms underlying this age-related functional decline remain incompletely understood. Early studies attributed this functional decline to age-related neuronal loss. Subsequent studies using unbiased stereological techniques found little or no neuronal loss during aging. However, studies using specific cellular markers found age-related loss of specific neuronal types. To test whether there is age-related loss of specific neuronal populations in the hippocampus, and subsequently, whether over-expression of the B-cell lymphoma protein-2 (Bcl-2 in these neurons could delay possible age-related neuronal loss, we examined calretinin (CR positive neurons in the mouse dentate gyrus during aging. Result In normal mice, there was an age-related loss of CR positive cells in the dentate gyrus. At the same region, there was no significant decrease of total numbers of neurons, which suggested that age-related loss of CR positive cells was due to the decrease of CR expression in these cells instead of cell death. In the transgenic mouse line over-expressing Bcl-2 in neurons, there was an age-related loss of CR positive cells. Interestingly, there was also an age-related neuronal loss in this transgenic mouse line. Conclusion These data suggest an age-related loss of CR positive neurons but not total neuronal loss in normal mice and this age-related neuronal change is not prevented by Bcl-2 over-expression.