WorldWideScience

Sample records for surfaces ii diffused

  1. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  2. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  3. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  4. Probing the surface swelling in ultra-thin supported polystyrene films during case II diffusion of n-hexane

    NARCIS (Netherlands)

    Ogieglo, Wojciech; Wormeester, Herbert; Wessling, Matthias; Benes, Nieck Edwin

    2013-01-01

    In situ time-resolved spectroscopic ellipsometry is used to study the dynamics of n-hexane diffusion into, and the corresponding induced swelling of, ultra-thin polystyrene films. The experimental conditions are carefully selected to facilitate the observation of anomalous Case II diffusion in the

  5. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  6. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  7. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  8. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  9. Shaping optimal zinc coating on the surface of high-quality ductile iron casting. Part II – Technological formula and value of diffusion coefficient

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2017-03-01

    Full Text Available The completed research presented in the first part of the article has allowed linking the manufacturing technology of ductile iron castings with the process of hot dip galvanizing. On the basis of these data simulations were carried out to examine the behaviour of zinc diffusion coefficient D in the galvanized coating. The adopted model of zinc coating growth helped to explain the cases of excessive growth of the intermetallic phases in this type of coating. The paper analyzes covered the relationship between the roughness and phase composition of the top layer of product and the thickness and kinetics of zinc coating growth referred to individual sub-layers of the intermetallic phases.Roughness and phase composition in the surface layer of product were next related to the diffusion coefficient D examined in respective sublayers of the intermetallic phases.

  10. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  11. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  12. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  13. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  14. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  15. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  16. Sorption and diffusion of FE(II) in bentonite

    International Nuclear Information System (INIS)

    Muurinen, A.; Tournassat, C.; Hadi, J.; Greneche, J.-M.

    2014-02-01

    . Qualitatively, the sorption of the radioactive 55 Fe on all the clays shows the same type of behaviour, i.e. sorption increases with increasing pH. In the measurements with the bentonite purified at VTT, the sorption occurs at a higher pH than in the measurements carried out with bentonite purified at BRGM. The sorption experiments in the acetate buffer of pH 5 show decreasing sorption of 55 Fe as a function of the increasing concentration of the added Fe(II). A general model for the investigated clays is proposed where Fe sorption is due to adsorption on exchange sites, strong and weak complexation sites and electron transfer with the structural Fe. All mechanisms identified apply to all clay samples but with variations in CEC values, structural Fe redox potential and strong and weak sites' surface density. The measured diffusivities show rather low values (10 -15 - 10 -16 m 2 /s) at pH 8 and 5. At pH 8, the diffusion curve calculated with a reactive transport model on the basis of the sorption matches fairly well the experimental results. At pH 5, the model predicts a much longer diffusion distance than found in the experiment. The reason for this discrepancy is not yet understood. A possible explanation could be a slow redox/sorption process which does not appear in the short batch sorption measurements. (orig.)

  17. Sorption and diffusion of FE(II) in bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Muurinen, A. [VTT Technical Research Centre of Finland, Espoo (Finland); Tournassat, C.; Hadi, J. [BRGM, Orleans (France); Greneche, J.-M. [LPCE, Le Mans (France)

    2014-02-15

    . Qualitatively, the sorption of the radioactive {sup 55}Fe on all the clays shows the same type of behaviour, i.e. sorption increases with increasing pH. In the measurements with the bentonite purified at VTT, the sorption occurs at a higher pH than in the measurements carried out with bentonite purified at BRGM. The sorption experiments in the acetate buffer of pH 5 show decreasing sorption of {sup 55}Fe as a function of the increasing concentration of the added Fe(II). A general model for the investigated clays is proposed where Fe sorption is due to adsorption on exchange sites, strong and weak complexation sites and electron transfer with the structural Fe. All mechanisms identified apply to all clay samples but with variations in CEC values, structural Fe redox potential and strong and weak sites' surface density. The measured diffusivities show rather low values (10{sup -15} - 10{sup -16} m{sup 2}/s) at pH 8 and 5. At pH 8, the diffusion curve calculated with a reactive transport model on the basis of the sorption matches fairly well the experimental results. At pH 5, the model predicts a much longer diffusion distance than found in the experiment. The reason for this discrepancy is not yet understood. A possible explanation could be a slow redox/sorption process which does not appear in the short batch sorption measurements. (orig.)

  18. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  19. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  20. Defects and diffusion, theory & simulation II

    CERN Document Server

    Fisher, David J

    2010-01-01

    This second volume in a new series covering entirely general results in the fields of defects and diffusion includes 356 abstracts of papers which appeared between the end of 2009 and the end of 2010. As well as the abstracts, the volume includes original papers on theory/simulation, semiconductors and metals: ""Predicting Diffusion Coefficients from First Principles ..."" (Mantina, Chen & Liu), ""Gouge Assessment for Pipes ..."" (Meliani, Pluvinage & Capelle), ""Simulation of the Impact Behaviour of ... Hollow Sphere Structures"" (Ferrano, Speich, Rimkus, Merkel & Öchsner), ""Elastic-Plastic

  1. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  2. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  3. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  4. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  5. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  6. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  7. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  8. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  9. The effect of radiation-thermal treatment on the physicochemical properties of the Ni-Mo/Al2O3 hydrotreatment catalyst. II. UV-Vis diffuse reflectance spectra of surface compounds after irradiation

    International Nuclear Information System (INIS)

    Solovetskii, Yu.I.; Miroshinichenko, I.I.; Lunin, V.V.

    1993-01-01

    Radiation-thermal damage of the surface and the active metal phases of hydrodesulfurization Ni-Mo/Al 2 O 3 catalysts by a fast electron beam of up to 2.0 MeV energy was studied. UV-Vis diffuse reflectance spectra of the industrial and model coked systems after radiation-thermal treatment were measured. 14 refs., 2 figs

  10. Oxygen transport in waterlogged soils, Part II. Diffusion coefficients

    International Nuclear Information System (INIS)

    Obando Moncayo, F.H.

    2004-01-01

    Several equations are available for Oxygen Transport in Waterlogged Soils and have been used for soils and plants. All of them are some form of first Fick's law as given by dQ = - DA(dc/dx)/dt. This equation illustrates some important aspects of aeration in waterlogged soils; first, D is a property of the medium and the gas, and is affected by temperature T. Likewise, the amount of diffusing substance dQ in dt is a direct function of the cross sectional area A and inversely proportional to the distance x. In fact, increasing the water content of air-dry soil, drastically decreases A and creates a further resistance for the flow of oxygen through water films around root plants, soil micro organisms and soil aggregates. The solid phase is also limiting the cross-section of surface of the free gaseous diffusion and the length and tortuosity of diffusion path in soil. In most of cases, soil gas porosity and tortuosity of soil voids are expressed in the equations of diffusion as a broad 'diffusion coefficient' (apparent coefficient diffusion). The process of soil respiration is complicated, involves many parameters, and is difficult to realistically quantify. With regard to the oxygen supply, it is convenient to distinguish macro and micro models, and hence, the flux of oxygen is assumed to have two steps. The first step is related to oxygen diffusion from the atmosphere and the air-filled porosity. The second step is related to the oxygen diffusion through water-films in and around plant roots, soil micro organisms and aggregates. Because of these models we obtain coefficients of macro or micro diffusion, rates of macro or micro diffusion, etc. In the macro diffusion process oxygen is transferred in the soil profile, mainly from the soil surface to a certain depth of the root zone, while micro diffusion deals with the flux over very short distances. Both processes, macro and micro diffusion are highly influenced by soil water content. Of course, if water is added to

  11. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  12. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  13. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  14. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  15. ISLSCP II Sea Surface Temperature

    Data.gov (United States)

    National Aeronautics and Space Administration — Sea surface temperature (SST) is an important indicator of the state of the earth climate system as well as a key variable in the coupling between the atmosphere and...

  16. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  17. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    measurements. To evaluate the obtained diffusion profiles we adapted the isolated grain boundary model, first proposed by Fisher (1951) to match several observations: (i) Anisotropic diffusion in forsterite, (ii) fast diffusion along the grain boundary, (iii) fast diffusion on the surface of the sample. The latter process is needed to explain an additional flux of material from the surface into the grain boundary. Surface and grain boundary diffusion coefficients are on the order of 10000 times faster than diffusion in the lattice. Another observation was that in some regions the diffusion profiles in the lattice were greatly extended. TEM observations suggest here that surface defects (nano-cracks, ect.) have been present, which apparently enhanced the diffusion through the bulk lattice. Dohmen, R., & Milke, R. (2010). Diffusion in Polycrystalline Materials: Grain Boundaries, Mathematical Models, and Experimental Data. Reviews in Mineralogy and Geochemistry, 72(1), 921-970. Fisher, J. C. (1951). Calculations of Diffusion Penetration Curves for Surface and Grain Boundary Diffusion. Journal of Applied Physics, 22(1), 74-77. Le Claire, A. D. (1951). Grain boundary diffusion in metals. Philosophical Magazine A, 42(328), 468-474.

  18. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  19. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  20. Flow, transport and diffusion in random geometries II: applications

    KAUST Repository

    Asinari, Pietro

    2015-01-07

    Multilevel Monte Carlo (MLMC) is an efficient and flexible solution for the propagation of uncertainties in complex models, where an explicit parametrization of the input randomness is not available or too expensive. We present several applications of our MLMC algorithm for flow, transport and diffusion in random heterogeneous materials. The absolute permeability and effective diffusivity (or formation factor) of micro-scale porous media samples are computed and the uncertainty related to the sampling procedures is studied. The algorithm is then extended to the transport problems and multiphase flows for the estimation of dispersion and relative permeability curves. The impact of water drops on random stuctured surfaces, with microfluidics applications to self-cleaning materials, is also studied and simulated. Finally the estimation of new drag correlation laws for poly-dispersed dilute and dense suspensions is presented.

  1. Flow, transport and diffusion in random geometries II: applications

    KAUST Repository

    Asinari, Pietro; Ceglia, Diego; Icardi, Matteo; Prudhomme, Serge; Tempone, Raul

    2015-01-01

    Multilevel Monte Carlo (MLMC) is an efficient and flexible solution for the propagation of uncertainties in complex models, where an explicit parametrization of the input randomness is not available or too expensive. We present several applications of our MLMC algorithm for flow, transport and diffusion in random heterogeneous materials. The absolute permeability and effective diffusivity (or formation factor) of micro-scale porous media samples are computed and the uncertainty related to the sampling procedures is studied. The algorithm is then extended to the transport problems and multiphase flows for the estimation of dispersion and relative permeability curves. The impact of water drops on random stuctured surfaces, with microfluidics applications to self-cleaning materials, is also studied and simulated. Finally the estimation of new drag correlation laws for poly-dispersed dilute and dense suspensions is presented.

  2. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  3. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  4. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  5. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  6. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  7. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  8. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  9. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  10. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  11. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  12. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  13. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  14. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  15. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  16. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  17. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  18. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  19. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  20. Experimental Electron Heat Diffusion in TJ-II ECRH Plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Vargas, V.I.; Lopez-Bruna, D.; Herranz, J.; Castejon, F.

    2006-07-01

    Interpretative transport has been used to revisit the global scalings of TJ-II ECRH plasmas from a local perspective. Density, rotational transform and ERCH power scans were analysed based upon Thomson Scattering data (electron density and temperature) in steady state discharges. A simple formula to obtain the thermal conductivity, assuming pure diffusion and negligible convective heat fluxes was used in a set of 161 discharges. All the analysis was performed with the ASTRA transport shell. The density scan indicates that inside n=0,4 there is no significant change of e with density in the range studied (0.4 (1019m-3) 1.0), while in 0,5 <0,8 approximately, e decreases with density. In the rotational transform scan it is found that the values of e when a low order rational of the rotational transform is present locally seem to be smaller for the corresponding range, although it is apparent a general beneficial effect of the corresponding change in magnetic structure. Finally, in the ECRH power scan, e is found to have an overall increment in 0,2

  1. Experimental Electron Heat Diffusion in TJ-II ECRH Plasmas

    International Nuclear Information System (INIS)

    Vargas, V.I.; Lopez-Bruna, D.; Herranz, J.; Castejon, F.

    2006-01-01

    Interpretative transport has been used to revisit the global scalings of TJ-II ECRH plasmas from a local perspective. Density, rotational transform and ERCH power scans were analysed based upon Thomson Scattering data (electron density and temperature) in steady state discharges. A simple formula to obtain the thermal conductivity, assuming pure diffusion and negligible convective heat fluxes was used in a set of 161 discharges. All the analysis was performed with the ASTRA transport shell. The density scan indicates that inside n=0,4 there is no significant change of e with density in the range studied (0.4 (1019m-3) 1.0), while in 0,5 <0,8 approximately, e decreases with density. In the rotational transform scan it is found that the values of e when a low order rational of the rotational transform is present locally seem to be smaller for the corresponding range, although it is apparent a general beneficial effect of the corresponding change in magnetic structure. Finally, in the ECRH power scan, e is found to have an overall increment in 0,2< n0,6 when QECH increases from 200 to 400 kW, although it is less significant in the density gradient region (n 0,7). (Author) 22 refs

  2. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  3. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  4. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  5. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  6. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  7. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  8. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  9. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  10. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  11. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  12. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  13. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  14. Advection endash diffusion past a strip. II. Oblique incidence

    International Nuclear Information System (INIS)

    Knessl, C.; Keller, J.B.

    1997-01-01

    Advection and diffusion of particles past an impenetrable strip is considered when the strip is oblique to the advection or drift velocity. The particle concentration p(x,y) is determined asymptotically for large values of vL/D, where v is the drift velocity, D is the diffusion coefficient, and 2L is the width of the strip. The results complement those of Part I, which treated a strip normal to the drift velocity. copyright 1997 American Institute of Physics

  15. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  16. FINELM: a multigroup finite element diffusion code. Part II

    International Nuclear Information System (INIS)

    Davierwalla, D.M.

    1981-05-01

    The author presents the axisymmetric case in cylindrical coordinates for the finite element multigroup neutron diffusion code, FINELM. The numerical acceleration schemes incorporated viz. the Lebedev extrapolations and the coarse mesh rebalancing, space collapsing, are discussed. A few benchmark computations are presented as validation of the code. (Auth.)

  17. [Measurement of CO diffusion capacity (II): Standardization and quality criteria].

    Science.gov (United States)

    Salcedo Posadas, A; Villa Asensi, J R; de Mir Messa, I; Sardón Prado, O; Larramona, H

    2015-08-01

    The diffusion capacity is the technique that measures the ability of the respiratory system for gas exchange, thus allowing a diagnosis of the malfunction of the alveolar-capillary unit. The most important parameter to assess is the CO diffusion capacity (DLCO). New methods are currently being used to measure the diffusion using nitric oxide (NO). There are other methods for measuring diffusion, although in this article the single breath technique is mainly referred to, as it is the most widely used and best standardized. Its complexity, its reference equations, differences in equipment, inter-patient variability and conditions in which the DLCO is performed, lead to a wide inter-laboratory variability, although its standardization makes this a more reliable and reproductive method. The practical aspects of the technique are analyzed, by specifying the recommendations to carry out a suitable procedure, the calibration routine, calculations and adjustments. Clinical applications are also discussed. An increase in the transfer of CO occurs in diseases in which there is an increased volume of blood in the pulmonary capillaries, such as in the polycythemia and pulmonary hemorrhage. There is a decrease in DLCO in patients with alveolar volume reduction or diffusion defects, either by altered alveolar-capillary membrane (interstitial diseases) or decreased volume of blood in the pulmonary capillaries (pulmonary embolism or primary pulmonary hypertension). Other causes of decreased or increased DLCO are also highlighted. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

  18. ISLSCP II Reanalysis Near-Surface Meteorology Data

    Data.gov (United States)

    National Aeronautics and Space Administration — This data set for the ISLSCP Initiative II data collection provides near surface meteorological variables, fluxes of heat, moisture and momentum at the surface, and...

  19. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  20. Statistical models of a gas diffusion electrode: II. Current resistent

    Energy Technology Data Exchange (ETDEWEB)

    Proksch, D B; Winsel, O W

    1965-07-01

    The authors describe an apparatus for measuring the flow resistance of gas diffusion electrodes which is a mechanical analog of the Wheatstone bridge for measuring electric resistance. The flow resistance of a circular DSK electrode sheet, consisting of two covering layers and a working layer between them, was measured as a function of the gas pressure. While the pressure first was increased and then decreased, a hysteresis occurred, which is discussed and explained by a statistical model of a porous electrode.

  1. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  2. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  3. Surface complexation modeling calculation of Pb(II) adsorption onto the calcined diatomite

    Science.gov (United States)

    Ma, Shu-Cui; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

    2015-12-01

    Removal of noxious heavy metal ions (e.g. Pb(II)) by surface adsorption of minerals (e.g. diatomite) is an important means in the environmental aqueous pollution control. Thus, it is very essential to understand the surface adsorptive behavior and mechanism. In this work, the Pb(II) apparent surface complexation reaction equilibrium constants on the calcined diatomite and distributions of Pb(II) surface species were investigated through modeling calculations of Pb(II) based on diffuse double layer model (DLM) with three amphoteric sites. Batch experiments were used to study the adsorption of Pb(II) onto the calcined diatomite as a function of pH (3.0-7.0) and different ionic strengths (0.05 and 0.1 mol L-1 NaCl) under ambient atmosphere. Adsorption of Pb(II) can be well described by Freundlich isotherm models. The apparent surface complexation equilibrium constants (log K) were obtained by fitting the batch experimental data using the PEST 13.0 together with PHREEQC 3.1.2 codes and there is good agreement between measured and predicted data. Distribution of Pb(II) surface species on the diatomite calculated by PHREEQC 3.1.2 program indicates that the impurity cations (e.g. Al3+, Fe3+, etc.) in the diatomite play a leading role in the Pb(II) adsorption and dominant formation of complexes and additional electrostatic interaction are the main adsorption mechanism of Pb(II) on the diatomite under weak acidic conditions.

  4. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  5. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  6. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  7. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  8. ISLSCP II Reanalysis Near-Surface Meteorology Data

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: This data set for the ISLSCP Initiative II data collection provides near surface meteorological variables, fluxes of heat, moisture and momentum at the...

  9. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  10. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  11. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  12. Fetal diffusion tensor quantification of brainstem pathology in Chiari II malformation

    Energy Technology Data Exchange (ETDEWEB)

    Woitek, Ramona; Prayer, Daniela; Weber, Michael; Schoepf, Veronika; Furtner, Julia; Asenbaum, Ulrika; Kasprian, Gregor [Medical University of Vienna, Department of Biomedical Imaging and Image-guided Therapy, Vienna (Austria); Amann, Gabriele [Medical University of Vienna, Department of Clinical Pathology, Vienna (Austria); Seidl, Rainer [Medical University of Vienna, Department of Paediatrics and Adolescent Medicine, Vienna (Austria); Bettelheim, Dieter [Medical University of Vienna, Department of Obstetrics and Gynecology, Vienna (Austria); Brugger, Peter C. [Medical University of Vienna, Center for Anatomy and Cell Biology, Vienna (Austria)

    2016-05-15

    This prenatal MRI study evaluated the potential of diffusion tensor imaging (DTI) metrics to identify changes in the midbrain of fetuses with Chiari II malformations compared to fetuses with mild ventriculomegaly, hydrocephalus and normal CNS development. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) were calculated from a region of interest (ROI) in the midbrain of 46 fetuses with normal CNS, 15 with Chiari II malformations, eight with hydrocephalus and 12 with mild ventriculomegaly. Fetuses with different diagnoses were compared group-wise after age-matching. Axial T2W-FSE sequences and single-shot echo planar DTI sequences (16 non-collinear diffusion gradient-encoding directions, b-values of 0 and 700 s/mm{sup 2}, 1.5 Tesla) were evaluated retrospectively. In Chiari II malformations, FA was significantly higher than in age-matched fetuses with a normal CNS (p =.003), while ADC was not significantly different. No differences in DTI metrics between normal controls and fetuses with hydrocephalus or vetriculomegaly were detected. DTI can detect and quantify parenchymal alterations of the fetal midbrain in Chiari II malformations. Therefore, in cases of enlarged fetal ventricles, FA of the fetal midbrain may contribute to the differentiation between Chiari II malformation and other entities. (orig.)

  13. Fetal diffusion tensor quantification of brainstem pathology in Chiari II malformation

    International Nuclear Information System (INIS)

    Woitek, Ramona; Prayer, Daniela; Weber, Michael; Schoepf, Veronika; Furtner, Julia; Asenbaum, Ulrika; Kasprian, Gregor; Amann, Gabriele; Seidl, Rainer; Bettelheim, Dieter; Brugger, Peter C.

    2016-01-01

    This prenatal MRI study evaluated the potential of diffusion tensor imaging (DTI) metrics to identify changes in the midbrain of fetuses with Chiari II malformations compared to fetuses with mild ventriculomegaly, hydrocephalus and normal CNS development. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) were calculated from a region of interest (ROI) in the midbrain of 46 fetuses with normal CNS, 15 with Chiari II malformations, eight with hydrocephalus and 12 with mild ventriculomegaly. Fetuses with different diagnoses were compared group-wise after age-matching. Axial T2W-FSE sequences and single-shot echo planar DTI sequences (16 non-collinear diffusion gradient-encoding directions, b-values of 0 and 700 s/mm 2 , 1.5 Tesla) were evaluated retrospectively. In Chiari II malformations, FA was significantly higher than in age-matched fetuses with a normal CNS (p =.003), while ADC was not significantly different. No differences in DTI metrics between normal controls and fetuses with hydrocephalus or vetriculomegaly were detected. DTI can detect and quantify parenchymal alterations of the fetal midbrain in Chiari II malformations. Therefore, in cases of enlarged fetal ventricles, FA of the fetal midbrain may contribute to the differentiation between Chiari II malformation and other entities. (orig.)

  14. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  15. Nonlinear current diffusion in type-II superconductors

    International Nuclear Information System (INIS)

    Beek, C.J. van der; Nieuwenhuys, G.J.; Kes, P.H.; Schnack, H.G.; Griessen, R.

    1992-01-01

    The temporal evolution of flux profiles in superconducting slabs and cylinders is investigated numerically for the situation where the flux-creep activation barrier U depends explicitly on current density j, e.g., U(j) ∝ [(j c /j) μ -1] or U(j)∝ln(j c /j). Both field-independent and field-dependent forms of the critical current density j c are considered. Exact numerical results for the time-dependent magnetization and relaxation time τ are compared to approximate analytical solutions. When the flux-creep activation barrier diverges as j → 0, flux- and current-density profiles evolve towards an asymptotic behaviour that is independent of initial conditions. The time-dependent magnetization in the case of full flux penetration is then well described by the appropriate form for the magnetization of the sample in the critical state, but with a time-dependent surface current density replacing the critical current density. The current-dependent flux-creep activation barrier may be obtained from low-temperature experiments using the analysis method of Maley et al., even when j c depends explicitly on B. (orig.)

  16. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  17. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  18. Interaction of slow electrons with surfaces. II

    International Nuclear Information System (INIS)

    Komolov, S.A.; Chadderton, L.T.

    1976-01-01

    Total current spectroscopy (TCS) has been used to study the growth of films of gold and silver on (100) vanadium surfaces. A slow transition from TCS curves characteristic of vanadium to curves characteristic of the noble metals is observed, accompanied by an increase in the net work function - more rapid for silver than for gold. Vanadium characteristics are lost from the TCS curves for mean overlayer thicknesses > approximately 15A, and a simple analysis shows that the thickness of the surface zone from which TCS signals originate is approximately given by the electron mean free path. Observations of progressive attenuation of a characteristic vanadium feature with increasing mean thickness of overlayer permits separation into stages of nucleation and growth. There is a critical nucleus size of approximately 2A for silver and approximately 4A for gold. (Auth.)

  19. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  20. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  1. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  2. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  3. Diffusion effects on the line intensities of He I and He II in the solar transition region

    International Nuclear Information System (INIS)

    Shine, R.; Gerola, H.; Linsky, J.L.

    1975-01-01

    A heuristic treatment of diffusion in the solar chromosphere-corona transition region is developed. Diffusion becomes increasingly important with steeper temperature gradients, in active and quiet regions relative to coronal holes, and with increasing excitation potential. Numerical calculations are made for the resonance lines of He i and He ii and show that diffusion can enhance these lines. Thus the helium lines may appear relatively weak in coronal holes due to a weakening of the enhancement mechanism. Most transition region lines will be less affected by diffusion than He i or He ii

  4. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  5. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  6. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  7. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  8. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  9. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  10. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  11. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  12. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  13. Removal of nickel(II and palladium(II from surface waters

    Directory of Open Access Journals (Sweden)

    V. Sharifzade

    2013-04-01

    Full Text Available A new sorbent was prepared using alumina and 5-Br-PADAP, and its adsorption ability for the removal of Ni(II and Pd(II from different waters was investigated. The procedure is based on retention of the analytes on the alumina load with 5-Br-PADAP at pH ~ 6. The separation/preconcentration conditions for the quantitative recoveries were investigated. The limit of detections (LOD based on three times the standard deviations of the blank, were 0.187 and 0.253 ng mL-1 for Ni(II and Pd(II, respectively. Obtained sorption capacities for 1 g sorbent were 6.0 mg Ni(II and 11.0 mg Pd(II. The linearity was maintained in the concentration range of 0.625 to 6.0 ng mL-1 for Ni(II and 0.416 to 7.0 ng mL-1 for Pd(II in the original solution. Eight replicate determinations of a mixture containing 2.0 µg mL-1 each of the elements in the final solution gave relative standard deviation of ±0.82 and ±1.12% for Ni(II and Pd(II, respectively. The proposed method was successfully applied to the determination trace amounts of Ni(II and Pd(II in the surface water samples.DOI: http://dx.doi.org/10.4314/bcse.v27i1.2

  14. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  15. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  16. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  17. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  18. RESEARCH OF KINETIC AND DIFFUSIVE MECHANISMS IN THE ADSORPTION OF Cu (II IN SUGAR CANE BAGASSE ASH

    Directory of Open Access Journals (Sweden)

    Julio Omar Prieto García

    2016-10-01

    Full Text Available In this paper a kinetic and diffusive study regarding adsorption of ions Cu (II on a sample of sugar cane bagasse ash is made. The results show that the second-order kinetic model better adjusts the experimental data than the Elovich and first-order kinetic model. The diffusive mechanism study shows that the diffusion in the liquid pellicle and in the micro-pores of the adsorbent prevail in the adsorption phenomenon.

  19. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  20. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  1. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  2. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  3. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  4. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  5. SC lipid model membranes designed for studying impact of ceramide species on drug diffusion and permeation--part II: diffusion and permeation of model drugs.

    Science.gov (United States)

    Ochalek, M; Podhaisky, H; Ruettinger, H-H; Wohlrab, J; Neubert, R H H

    2012-10-01

    The barrier function of two quaternary stratum corneum (SC) lipid model membranes, which were previously characterized with regard to the lipid organization, was investigated based on diffusion studies of model drugs with varying lipophilicities. Diffusion experiments of a hydrophilic drug, urea, and more lipophilic drugs than urea (i.e. caffeine, diclofenac sodium) were conducted using Franz-type diffusion cells. The amount of permeated drug was analyzed using either HPLC or CE technique. The subjects of interest in the present study were the investigation of the influence of physicochemical properties of model drugs on their diffusion and permeation through SC lipid model membranes, as well as the study of the impact of the constituents of these artificial systems (particularly ceramide species) on their barrier properties. The diffusion through both SC lipid model membranes and the human SC of the most hydrophilic model drug, urea, was faster than the permeation of the more lipophilic drugs. The slowest rate of permeation through SC lipid systems occurred in the case of caffeine. The composition of SC lipid model membranes has a significant impact on their barrier function. Model drugs diffused and permeated faster through Membrane II (presence of Cer [EOS]). In terms of the barrier properties, Membrane II is much more similar to the human SC than Membrane I. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  7. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  8. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  9. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  10. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  11. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  12. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  13. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  15. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  16. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  17. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  18. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  19. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  20. FOXP1 suppresses immune response signatures and MHC class II expression in activated B-cell-like diffuse large B-cell lymphomas

    DEFF Research Database (Denmark)

    Brown, P J; Wong, K K; Felce, S L

    2016-01-01

    The FOXP1 (forkhead box P1) transcription factor is a marker of poor prognosis in diffuse large B-cell lymphoma (DLBCL). Here microarray analysis of FOXP1-silenced DLBCL cell lines identified differential regulation of immune response signatures and major histocompatibility complex class II (MHC II......) genes as some of the most significant differences between germinal center B-cell (GCB)-like DLBCL with full-length FOXP1 protein expression versus activated B-cell (ABC)-like DLBCL expressing predominantly short FOXP1 isoforms. In an independent primary DLBCL microarray data set, multiple MHC II genes......, including human leukocyte antigen DR alpha chain (HLA-DRA), were inversely correlated with FOXP1 transcript expression (PABC-DLBCL cells led to increased cell-surface expression of HLA-DRA and CD74. In R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine and prednisone...

  1. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  2. Influence of crystal structure on the CoII diffusion behavior in the Zn1-xCoxO system

    International Nuclear Information System (INIS)

    Peiteado, M.; Makovec, D.; Villegas, M.; Caballero, A.C.

    2008-01-01

    The solid state interaction of the Zn 1-x Co x O nominal system is investigated by means of diffusion couples and analysis of co-precipitated samples. The formation of a homogeneous Co:ZnO solid solution is found to be determined by the crystal structure from which Co II ions diffuse into the wurtzite lattice. No diffusion is observed whenever the CoO rock-salt structure is formed from the Co II precursor. On the contrary, the diffusion from the Co 3 O 4 spinel phase is feasible but has a limited temperature range defined by the reduction at a high temperature of Co III -Co II , since this process again leads to the formation of the rock-salt structure. However, when using a highly reactive and homogeneous co-precipitated starting powder, neither the spinel phase nor the rock-salt structure is formed, and a Co II :ZnO solid solution is obtained, which remains stable up to high temperatures. - Graphical abstract: Maximum diffusion distance for the ZnO-CoO x couple as a function of temperature. Dashed gray lines represent the temperature values at which the transformations between CoO and Co 3 O 4 compounds take place

  3. Extraction of minority carrier diffusion length of MWIR Type-II superlattice nBp detector

    Science.gov (United States)

    Taghipour, Zahra; Kazemi, Alireza; Myers, Stephen; Wijewarnasuriya, Priyalal; Mathews, Sen; Steenbergen, Elizabeth H.; Morath, Christian; Cowan, Vincent M.; Ariyawansa, Gamini; Scheihing, John; Krishna, Sanjay

    2017-08-01

    We present a model for the spectral external quantum efficiency (EQE) to extract the minority carrier diffusion length (Ln) of a unipolar nBp InAs/GaSb Type-II superlattice (T2SL) mid-wave infrared (MWIR) detector. The detector consists of a 4 μm thick p-doped 10ML InAs/10ML GaSb SL absorber with a 50% cut-off wavelength of 5 μm at 80 K and zero bias. The n-type doped InAs/AlSb SL barrier in the structure was included to reduce the GR dark current. By fitting the experimentally measured EQE data to the theoretically calculated QE based on the solution of the drift-diffusion equation, the p-type absorber was found the have Ln = 10 +/- 0.5 μm at 80K, and Ln = 12 +/- 0.5 μm at 120K and 150K. We performed the absorption coefficient measurement at different temperatures of interest. Also, we estimated the reduced background concentration and the built-in potential by utilizing a capacitance-voltage measurement technique. We used time-resolved-photoluminescence (TRPL) to determine the lifetime at 80K. With the result of the model and the lifetime measurement, we calculated the diffusion coefficient and the mobility in the T2SL detector at various temperatures. Also, we studied the behavior of different dark current mechanisms by fitting the experimentally measured and simulated dark current density under different operating temperatures and biases.

  4. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  5. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  6. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    understanding of the underlying factors determining the optical quality of GaInNAs, such as composition, growth and annealing conditions. We are still far from establishing an understanding of the band structure and its dependence on composition. Fundamental electronic interactions such as electron-electron and electron-phonon scattering, dependence of effective mass on composition, strain and orientation, quantum confinement effects, effects of localized nitrogen states on high field transport and on galvanometric properties, and mechanisms for light emission in these materials, are yet to be fully understood. Nature and formation mechanisms of grown-in and processing-induced defects that are important for material quality and device performance are still unknown. Such knowledge is required in order to design strategies to efficiently control and eliminate harmful defects. For many potential applications (such as solar cells, HBTs) it is essential to get more information on the transport properties of dilute nitride materials. The mobility of minority carriers is known to be low in GaInNAs and related material. The experimental values are far from reaching the theoretical ones, due to defects and impurities introduced in the material during the growth. The role of the material inhomogeneities on the lateral carrier transport also needs further investigation. From the device's point of view most attention to date has been focused on the GaInNAs/GaAs system, mainly because of its potential for optoelectronic devices covering the 1.3-1.55 µm data and telecommunications wavelength bands. As is now widely appreciated, these GaAs-compatible structures allow monolithic integration of AlGaAs-based distributed Bragg reflector mirrors (DBRs) for vertical cavity surface-emitting lasers with low temperature sensitivity and compatibility with AlOx-based confinement techniques. In terms of conventional edge-emitting lasers (EELs), the next step is to extend the wavelength range for cw room

  7. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  8. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  9. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  10. PROBING THE LOCAL BUBBLE WITH DIFFUSE INTERSTELLAR BANDS. II. THE DIB PROPERTIES IN THE NORTHERN HEMISPHERE

    Energy Technology Data Exchange (ETDEWEB)

    Farhang, Amin; Khosroshahi, Habib G.; Javadi, Atefeh; Molaeinezhad, Alireza; Tavasoli, Saeed; Habibi, Farhang; Kourkchi, Ehsan; Rezaei, Sara; Saberi, Maryam [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), PO Box 19395-5746 Tehran (Iran, Islamic Republic of); Van Loon, Jacco Th.; Bailey, Mandy [Astrophysics Group, Lennard-Jones Laboratories, Keele University, Staffordshire ST5 5BG (United Kingdom); Hardy, Liam, E-mail: a.farhang@ipm.ir [Isaac Newton Group, Apartado 321, E-38700 Santa Cruz de La Palma (Spain)

    2015-02-10

    We present a new high signal-to-noise ratio spectroscopic survey of the Northern hemisphere to probe the Local Bubble and its surroundings using the λ5780 Å and λ5797 Å diffuse interstellar bands (DIBs). We observed 432 sightlines to a distance of 200 pc over a duration of three years. In this study, we establish the λ5780 and λ5797 correlations with Na I, Ca II and E {sub B-V}, for both inside and outside the Local Bubble. The correlations show that among all neutral and ionized atoms, the correlation between Ca II and λ5780 is stronger than its correlation with λ5797, suggesting that λ5780 is more associated with regions where Ca{sup +} is more abundant. We study the λ5780 correlation with λ5797, which shows a tight correlation within and outside the Local Bubble. In addition, we investigate the DIB properties in UV irradiated and UV shielded regions. We find that, within and beyond the Local Bubble, λ5797 is located in denser parts of clouds, protected from UV irradiation, while λ5780 is located in the low-density regions of clouds.

  11. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  12. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  13. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  14. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  15. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  16. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  17. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  18. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  19. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  20. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  1. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  2. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  3. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  4. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  5. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  7. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  8. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  9. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  10. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  11. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  12. Models of infrared emission from dusty and diffuse H II regions

    International Nuclear Information System (INIS)

    Aannestad, P.A.

    1978-01-01

    Models for the infrared emission from amorphous core-mantle dust within diffuse (n/sub e/ 3 cm -3 ) H II regions with neutral shells that are optically thin in the infrared have been calculated. The icy mantles sublimate only within a fractional radius of 0.2--0.5, affecting the overall gas-to-dust ratio only slightly. A region with variable grain composition may have a much smaller infrared luminosity than a similar region with uniform grain properties. Calculations of the total infrared luminosity, the relative contribution by Lα photons, the infrared spectral distribution, and the size of the dust-depleted regions are presented as functions of the ultraviolet optical depths in the ionized and neutral regions and for stellar temperatures of 35,000 and 48,000 K. Comparison with observations indicate that at least 20% of the Lyman-continuum photons are absorbed by the dust, and that the dust optical depth in the Lyman continuum is likely to be of the order of unity. For core-mantle grains most of the infrared energy is emitted between 30 and 70 μm, relatively independent of whether the dust is within or outside the H II region. Amorphous silicate particles tend to emit more energy below 30 μm, but also emit efficiently at far-infrared wavelengths. In order to illustrate the model calculations, we present infrared spectra for the Orion A region and compare them with observed fluxed, accounting for beam-width effects. A reasonable agreement is obtained with most of the near- to middle-infrared observations if the total ultraviolet optical depth is about unity and about equally divided between the ionized region and an outside neutral shell. Intensity profiles for Orion A are presented for wavelengths in the ragne 20--1000 μm, and show a strong increase in width beyond 20 μm

  13. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  14. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  15. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  16. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  17. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  18. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  19. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  20. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  1. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  2. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  3. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  4. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  5. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  6. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  7. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  8. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  9. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  10. Background rejection of n+ surface events in GERDA Phase II

    Science.gov (United States)

    Lehnert, Björn

    2016-05-01

    The GERDA experiment searches for neutrinoless double beta (0vββ) decay in 76Ge using an array of high purity germanium (HPGe) detectors immersed in liquid argon (LAr). Phase II of the experiment uses 30 new broad energy germanium (BEGe) detectors with superior pulse shape discrimination capabilities compared to the previously used semi-coaxial detector design. By far the largest background component for BEGe detectors in GERDA are n+-surface events from 42K β decays which are intrinsic in LAr. The β particles with up to 3.5 MeV can traverse the 0.5 to 0.9 mm thick electrode and deposit energy within the region of interest for the 0vββ decay. However, those events have particular pulse shape features allowing for a strong discrimination. The understanding and simulation of this background, showing a reduction by up to a factor 145 with pulse shape discrimination alone, is presented in this work.

  11. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  12. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  13. Study of diffuse H II regions potentially forming part of the gas streams around Sgr A*

    Science.gov (United States)

    Armijos-Abendaño, J.; López, E.; Martín-Pintado, J.; Báez-Rubio, A.; Aravena, M.; Requena-Torres, M. A.; Martín, S.; Llerena, M.; Aldás, F.; Logan, C.; Rodríguez-Franco, A.

    2018-05-01

    We present a study of diffuse extended ionized gas towards three clouds located in the Galactic Centre (GC). One line of sight (LOS) is towards the 20 km s-1 cloud (LOS-0.11) in the Sgr A region, another LOS is towards the 50 km s-1 cloud (LOS-0.02), also in Sgr A, while the third is towards the Sgr B2 cloud (LOS+0.693). The emission from the ionized gas is detected from Hnα and Hmβ radio recombination lines (RRLs). Henα and Hemβ RRL emission is detected with the same n and m as those from the hydrogen RRLs only towards LOS+0.693. RRLs probe gas with positive and negative velocities towards the two Sgr A sources. The Hmβ to Hnα ratios reveal that the ionized gas is emitted under local thermodynamic equilibrium conditions in these regions. We find a He to H mass fraction of 0.29±0.01 consistent with the typical GC value, supporting the idea that massive stars have increased the He abundance compared to its primordial value. Physical properties are derived for the studied sources. We propose that the negative velocity component of both Sgr A sources is part of gas streams considered previously to model the GC cloud kinematics. Associated massive stars with what are presumably the closest H II regions to LOS-0.11 (positive velocity gas), LOS-0.02, and LOS+0.693 could be the main sources of ultraviolet photons ionizing the gas. The negative velocity components of both Sgr A sources might be ionized by the same massive stars, but only if they are in the same gas stream.

  14. Diffusion of Na(I), Cs(I), Sr(II) and Eu(III) in smectite rich natural clay.

    Science.gov (United States)

    Kasar, Sharayu; Kumar, Sumit; Bajpai, R K; Tomar, B S

    2016-01-01

    Diffusion of Na(I), Cs(I), Sr(II) and Eu(III) in smectite rich natural clay, proposed as a backfill material in the Indian geological repository, was studied using the out-diffusion method. Radiotracers (22)Na, (137)Cs, (85)Sr and (154)Eu were used; the first three are carrier-free enabling experimental work at sub-micromolar metal ion concentration, and Eu(III) tracer (154)Eu was used at sub millimolar concentration. An out-diffusion methodology, wherein a thin planar source of radioactivity placed between two clay columns diffuses out, was used to obtain the apparent diffusion coefficient (Da) values. This methodology enabled determination of diffusion coefficient even for strongly sorbing (154)Eu. Da values for (22)Na, (137)Cs, (85)Sr and (154)Eu were 2.35 (±0.14) × 10(-11), 2.65 (±0.09) × 10(-12), 3.32 (±0.15) × 10(-11) and 1.23 (±0.15) × 10(-13) m(2) s(-1), respectively. Da values were found to be in fair agreement with literature data reported for similar mineralogical sediments. Sorption of radionuclides on the clay was also determined in the present study and differences in Da values were rationalized on the basis of sorption data. Distribution ratios (Kd) for Cs(I) and Eu(III) were higher than that for Sr(II), which in turn was higher than that for Na(I). Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  16. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  17. Apparent diffusion coefficient vale of the brain in patients with Gaucher's disease type II and type III

    International Nuclear Information System (INIS)

    Abdel Razek, Ahmed Abdel Khalek; Abd El-Gaber, Nahed; Abdalla, Ahmed; Fathy, Abeer; Azab, Ahmed; Rahman, Ashraf Abdel

    2009-01-01

    The aim of this work is to assess the usefulness of apparent diffusion coefficient (ADC) value of the brain for diagnosis of patients with Gaucher's disease type II and type III. Prospective study was conducted upon 13 patients (nine boys and four girls aged 8 months-14 years: mean 6.1 years) with Gaucher's disease type II and III and for age-matched control group (n = 13). Diffusion-weighted magnetic resonance imaging using a single-shot echo-planar imaging with a diffusion-weighted factor b of 0, 500, and 1,000 s/mm 2 was done for all patients and volunteers. The ADC value was calculated in ten regions of the brain parenchyma and correlated with genotyping. There was significantly lower ADC value of the cortical frontal (P = 0.003), cortical temporal (P = 0.04), frontal subcortical white matter (P = 0.02), corticospinal tract (P = 0.001), cerebellum (P = 0.001), medulla (P = 0.002), and midbrain (P = 0.02) between patients and volunteers. There was significant difference in the ADC value of the frontal and temporal gray matter (P = 0.04 and 0.05, respectively) between patients with heterozygous and homozygous gene mutation. We concluded that ADC value is a new promising quantitative imaging parameter that can be used for the detection of brain abnormalities in patients with Gaucher's disease type II and type III and has a correlation with genotyping. (orig.)

  18. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  19. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  20. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  1. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  2. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  3. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  4. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  5. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  6. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  7. Associations between identity diffusion, Axis II disorder, and psychopathology in inpatients with borderline personality disorder.

    Science.gov (United States)

    Sollberger, Daniel; Gremaud-Heitz, Daniela; Riemenschneider, Anke; Küchenhoff, Joachim; Dammann, Gerhard; Walter, Marc

    2012-01-01

    Patients with borderline personality disorder (BPD) suffer from instability in their relationships, their affectivity, and their identity. However, the associations between these dimensions are not clear. The purpose of the present study was to investigate the relation between identity diffusion and psychopathology in BPD. In the second week of inpatient treatment, 52 patients with BPD were assessed with the Inventory of Personality Organization (IPO) and questionnaires measuring general psychiatric symptoms, mood states, and negative affects (SCL-90-R, BDI, STAI, and STAXI). A median split was examined to differentiate BPD patients with high identity diffusion from those with low identity diffusion. BPD patients with high identity diffusion did not differ in their social data from BPD patients with low identity diffusion. However, BPD patients with high identity diffusion showed significantly higher levels of psychiatric symptoms, as well as higher anxiety, anger, and depression scores (p personality disorders (p identity diffusion with psychopathological symptoms and features of personality disorder and emphasize the clinical significance of identity diffusion for patients with BPD. Copyright © 2011 S. Karger AG, Basel.

  8. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  9. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  10. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  11. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  12. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  13. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  14. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  15. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  16. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    International Nuclear Information System (INIS)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-01-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.

  17. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  18. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  19. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  20. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  1. I. Surface properties of neutron-rich nuclei. II. Pion condensation at finite temperature

    International Nuclear Information System (INIS)

    Kolehmainen, K.A.

    1983-01-01

    In part I, the energy density formalism, the Thomas-Fermi approximation, and Skyrme-type interactions were used to describe the energy density of a semi-infinite slab of neturon-rich nuclear matter at zero temperature. The existence of a drip phase at low proton fractions is allowed in addition to the more dense nuclear phase, and various bulk properties of both phases are found when the system is in equilibrium. The usual definition of the surface energy is extended to apply to the case where drip is present. Assuming a Fermi function type density profile, a constrained variational calculation is performed to determine the neutron and proton surface diffuseness parameters, the thickness of the neutron skin, and the surface energy. Results are obtained for proton fractions reanging from 0.5 (symmetric nuclear matter) to zero (pure neutron matter) for most Skyrme-type interactions in common use. The results are in close agreement with the predictions of the droplet model, as well as with the results of more exact calculations in those cases where the more exact results exist (only for symmetric or nearly symmetric matter in most cases). Significantly different asymmetry dependences for different interactions are found. In part II, several simple but increasingly complex models are used to calculate the threshold for charged pion condensation in neutron-rich nuclear matter at finite temperature. Unlike in mean field theory descriptions of pion condensation, the effects of thermal excitations of the pion field are included. The thermal pion excitations have two important effects: first, to modify the phase diagram qualitatively from that predicted by mean field theory, and second, to make the phase transition to a spatially nonuniform condensed state at finite temperature always first, rather than second, order

  2. Thermophysical Properties of Te-based II-VI Semiconductors: Reduced Algorithms for Thermal Diffusivity Determination

    Science.gov (United States)

    Banish, R. Michael; Brantschen, Segolene; Pourpoint, Timothee L.; Wessling, Francis; Sekerka, Robert F.

    2003-01-01

    This paper presents methodologies for measuring the thermal diffusivity using the difference between temperatures measured at two, essentially independent, locations. A heat pulse is applied for an arbitrary time to one region of the sample; either the inner core or the outer wall. Temperature changes are then monitored versus time. The thermal diffusivity is calculated from the temperature difference versus time. No initial conditions are used directly in the final results.

  3. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  4. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  5. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  6. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  7. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  8. Vacuum system II; surface study on vacuum wall

    International Nuclear Information System (INIS)

    Chida, Katsuhisa; Mizobuchi, Akira; Miyahara, Akira.

    1982-01-01

    Ion scattering spectroscopy (ISS) was applied to observe surface of Al sample. Pulse counting by multi-scaling method was used for measurement of scattered ions. Reletion between outgassing treatment and cleanliness of surface is presented. (author)

  9. Surface Modification of Exfoliated Graphite Nano-Reinforcements, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Phase I results showed that two surface treatments, oxidative plasma and reactive finishes, are effective means of modifying the surface chemistry of exfoliated...

  10. Surface Operations Data Analysis and Adaptation Tool, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — This effort undertook the creation of a Surface Operations Data Analysis and Adaptation (SODAA) tool to store data relevant to airport surface research and...

  11. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  12. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  13. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  14. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  15. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  16. Chemical diffusion of Cr, Ni and Si in welded joints. II

    International Nuclear Information System (INIS)

    Kucera, J.; Ciha, K.

    1987-01-01

    The results are given of a study in chemical diffusion in welded joints P2/A and P3/A. P2 stands for the steel (Fe-17.48 Cr-8.15 Ni-0.14 Si), P3 for (Fe-18.52 Cr-8.20 Ni-1.78 Si) and A for the Fe-Arema. Triadic sandwiche-like samples were diffusion heated at temperatures from 920 to 1170 degC. The concentration distributions N(x,t) of the given elements were measured with microprobe JXA-3A. The evaluation of the experimental data was carried out either by Grube's method, or in some cases by the spline-polynomial method. The evaluated diffusivities D-bar satisfy the Arrhenius relation and yield the standard diffusion characteristics D 0 and H. The diffusivities D-bar of Cr, Ni and Si in P1/A, in P2/A and P3/A welded joints vary with Si content in P1, P2 and P3 alloys, similar to the Cr-51 and Ni-63 self-diffusivities in Fe-18 Cr-12 Ni-X Si steels, and tend to increase with increasing Si content. The values D-bar measured in the vicinity of grain boundaries are higher than the bulk diffusion coefficients. The most rapid diffusant is Si and the slowest one Ni. Thus, the relations D-bar Si :D-bar Cr :D-bar Ni ≅ 6:3:1 (P3/A) and D-bar Si :D-bar Cr :D-bar Ni ≅ 1.7:1.4:1 (P3/A) are valid at 1050 degC. Comparing the results with those published if can be noted that the Cr-51 and Ni-63 self-diffusion in Fe-18 Cr-12 Ni-X Si steels is faster than chemical diffusion of these elements in the said steel welded joints P2/A and P3/A; X varies from 0.14 to 1.98. (author). 7 tabs., 7 figs., 20 refs

  17. C ii RADIATIVE COOLING OF THE GALATIC DIFFUSE INTERSTELLAR MEDIUM: INSIGHT INTO THE STAR FORMATION IN DAMPED Ly α SYSTEMS

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Nirupam [Department of Physics and Centre for Theoretical Studies, Indian Institute of Technology, Kharagpur 721302 (India); Frank, Stephan; Mathur, Smita [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); Carilli, Christopher L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); Menten, Karl M. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Wolfe, Arthur M., E-mail: nroy@physics.iisc.ernet.in [Department of Physics and Center for Astrophysics and Space Sciences, University of California, San Diego, La Jolla, CA 92093 (United States)

    2017-01-10

    The far-infrared [C ii] 158 μ m fine structure transition is considered to be a dominant coolant in the interstellar medium (ISM). For this reason, under the assumption of a thermal steady state, it may be used to infer the heating rate and, in turn, the star formation rate (SFR) in local as well as in high redshift systems. In this work, radio and ultraviolet observations of the Galactic ISM are used to understand whether C ii is indeed a good tracer of the SFR. For a sample of high Galactic latitude sightlines, direct measurements of the temperature indicate the presence of C ii in both the cold and the warm phases of the diffuse interstellar gas. The cold gas fraction (∼10%–50% of the total neutral gas column density) is not negligible even at high Galactic latitude. It is shown that to correctly estimate the SFR, C ii cooling in both phases should hence be considered. The simple assumption, that the [C ii] line originates only from either the cold or the warm phase, significantly underpredicts or overpredicts the SFR, respectively. These results are particularly important in the context of Damped Ly α systems for which a similar method is often used to estimate the SFR. The derived SFRs in such cases may not be reliable if the temperature of the gas under consideration is not constrained independently.

  18. Apparent diffusion coefficient vale of the brain in patients with Gaucher's disease type II and type III

    Energy Technology Data Exchange (ETDEWEB)

    Abdel Razek, Ahmed Abdel Khalek; Abd El-Gaber, Nahed [Mansoura Faculty of Medicine, Department of Diagnostic Radiology, Mansoura (Egypt); Abdalla, Ahmed; Fathy, Abeer [Mansoura Faculty of Medicine, Department of Pediatric, Mansoura (Egypt); Azab, Ahmed [Mansoura Faculty of Medicine, Department of Neurology, Mansoura (Egypt); Rahman, Ashraf Abdel [Radiology Unit of Pediatric Hospital, Mansoura (Egypt)

    2009-11-15

    The aim of this work is to assess the usefulness of apparent diffusion coefficient (ADC) value of the brain for diagnosis of patients with Gaucher's disease type II and type III. Prospective study was conducted upon 13 patients (nine boys and four girls aged 8 months-14 years: mean 6.1 years) with Gaucher's disease type II and III and for age-matched control group (n = 13). Diffusion-weighted magnetic resonance imaging using a single-shot echo-planar imaging with a diffusion-weighted factor b of 0, 500, and 1,000 s/mm{sup 2} was done for all patients and volunteers. The ADC value was calculated in ten regions of the brain parenchyma and correlated with genotyping. There was significantly lower ADC value of the cortical frontal (P = 0.003), cortical temporal (P = 0.04), frontal subcortical white matter (P = 0.02), corticospinal tract (P = 0.001), cerebellum (P = 0.001), medulla (P = 0.002), and midbrain (P = 0.02) between patients and volunteers. There was significant difference in the ADC value of the frontal and temporal gray matter (P = 0.04 and 0.05, respectively) between patients with heterozygous and homozygous gene mutation. We concluded that ADC value is a new promising quantitative imaging parameter that can be used for the detection of brain abnormalities in patients with Gaucher's disease type II and type III and has a correlation with genotyping. (orig.)

  19. Sorption and reduction of selenite on chlorite surfaces in the presence of Fe(II) ions.

    Science.gov (United States)

    Baik, Min Hoon; Lee, Seung Yeop; Jeong, Jongtae

    2013-12-01

    The sorption and reduction of selenite on chlorite surfaces in the presence of Fe(II) ions were investigated as a function of pH, Se(IV) concentration, and Fe(II) concentration under an anoxic condition. The sorption of Se(IV) onto chlorite surfaces followed the Langmuir isotherm regardless of the presence of Fe(II) ions in the solution. The Se(IV) sorption was observed to be very low at all pH values when the solution was Fe(II)-free or the concentration of Fe(II) ions was as low as 0.5 mg/L. However, the Se(IV) sorption was enhanced at a pH > 6.5 when the Fe(II) concentration was higher than 5 mg/L because of the increased sorption of Fe(II) onto the chlorite surfaces. XANES (X-ray absorption near edge structure) spectra of the Se K-edge showed that most of the sorbed Se(IV) was reduced to Se(0) by Fe(II) sorbed onto the chlorite surfaces, especially at pH > 9. The combined results of field-emission scanning electron microscopy (FE-SEM) and X-ray diffraction (XRD) also showed that elemental selenium and goethite were formed and precipitated on the chlorite surfaces during the sorption of selenite. Consequently it can be concluded that Se(IV) can be reduced to Se(0) in the presence of Fe(II) ions by the surface catalytic oxidation of Fe(II) into Fe(III) and the formation of goethite at neutral and particularly alkaline conditions. Thus the mobility of selenite in groundwater is expected to be reduced by the presence of a relatively higher concentration of Fe(II) in subsurface environments. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  1. Spin diffusion in the Mn2+ ion system of II-VI diluted magnetic semiconductor heterostructures

    Science.gov (United States)

    Maksimov, A. A.; Yakovlev, D. R.; Debus, J.; Tartakovskii, I. I.; Waag, A.; Karczewski, G.; Wojtowicz, T.; Kossut, J.; Bayer, M.

    2010-07-01

    The magnetization dynamics in diluted magnetic semiconductor heterostructures based on (Zn,Mn)Se and (Cd,Mn)Te were studied optically and simulated numerically. In samples with inhomogeneous magnetic ion distribution, these dynamics are contributed by spin-lattice relaxation and spin diffusion in the Mn spin system. A spin-diffusion coefficient of 7×10-8cm2/s was evaluated for Zn0.99Mn0.01Se from comparison of experiment and theory. Calculations of the exciton giant Zeeman splitting and the magnetization dynamics in ordered alloys and digitally grown parabolic quantum wells show perfect agreement with the experimental data. In both structure types, spin diffusion contributes essentially to the magnetization dynamics.

  2. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  3. Simulation of the diffusion equation on a type-II quantum computer

    International Nuclear Information System (INIS)

    Berman, G.P.; Kamenev, D.I.; Ezhov, A.A.; Yepez, J.

    2002-01-01

    A lattice-gas algorithm for the one-dimensional diffusion equation is realized using radio frequency pulses in a one-dimensional spin system. The model is a large array of quantum two-qubit nodes interconnected by the nearest-neighbor classical communication channels. We present a quantum protocol for implementation of the quantum collision operator and a method for initialization and reinitialization of quantum states. Numerical simulations of the quantum-classical dynamics are in good agreement with the analytic solution for the diffusion equation

  4. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  5. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  6. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  7. Brownian motion in a field of force and the diffusion theory of chemical reactions. II

    NARCIS (Netherlands)

    Brinkman, H.C.

    1956-01-01

    H. A. Kramers has studied the rate of chemical reactions in view of the Brownian forces caused by a surrounding medium in temperature equilibrium. In a previous paper 3) the author gave a solution of Kramers' diffusion equation in phase space by systematic development. In this paper the general

  8. Concentration fluctuations in non-isothermal reaction-diffusion systems. II. The nonlinear case

    NARCIS (Netherlands)

    Bedeaux, D.; Ortiz de Zárate, J.M.; Pagonabarraga, I.; Sengers, J.V.; Kjelstrup, S.

    2011-01-01

    In this paper, we consider a simple reaction-diffusion system, namely, a binary fluid mixture with an association-dissociation reaction between two species. We study fluctuations at hydrodynamic spatiotemporal scales when this mixture is driven out of equilibrium by the presence of a temperature

  9. Metastability in reversible diffusion processes II. Precise asymptotics for small eigenvalues

    CERN Document Server

    Bovier, A; Klein, M

    2002-01-01

    We continue the analysis of the problem of metastability for reversible diffusion processes, initiated in \\cite{BEGK3}, with a precise analysis of the low-lying spectrum of the generator. Recall that we are considering processes with generators of the form $-\\e \\Delta +\

  10. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  11. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  12. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  13. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  14. Flexible and Safe Control of Mobile Surface Systems, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — The primary innovation of this work is a novel approach for flexible and safe control of highly capable mobile surface systems, such as long-duration science rovers,...

  15. ISLSCP II Surface Radiation Budget (SRB) Radiation Data

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: This data set contains global Surface Radiation Budget (SRB) and a few top-of-atmosphere (TOA) radiation budget parameters on a 1-degree x 1-degree spatial...

  16. Scalable Lunar Surface Networks and Adaptive Orbit Access, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Based on our proposed innovations and accomplished work in Phase I, we will focus on developing the new MAC protocol and hybrid routing protocol for lunar surface...

  17. Robust Prediction of High Lift Using Surface Vorticity, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — FlightStream has been developed a fast, accurate, aerodynamic prediction code based on vorticity computations on the surface of an aircraft. The code, though still a...

  18. Surface Optimization Techniques for Deployable Reflectors, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Under this and several other programs, CTD has developed TEMBOREG deployable solid-surface reflectors (TEMBOREG Reflectors) to provide future NASA and Air Force...

  19. Diffusion influence on Michaelis Menten kinetics: II. The low substrate concentration limit

    Science.gov (United States)

    Kim, Hyojoon; Shin, Kook Joe

    2007-02-01

    The diffusion-influenced Michaelis-Menten kinetics in the low substrate concentration limit is studied in one and three dimensions. For the initial pair distribution of enzyme and substrate, we obtain the exact analytical results. We find that at short times the diffusion effect can make the reaction rate faster. The concentration deviations of the substrate and enzyme show t-1/2 and t-3/2 power-law behaviours in one and three dimensions, respectively, at long times. On the other hand, the average lifetime of the intermediate is independent of the initial state in one dimension, while it depends on the initial state in three dimensions. The ultimate production yield approaches unity in one dimension but it reaches a different value depending on other parameters in three dimensions. We also obtain the analytical results for the initial random distribution.

  20. Diffusion influence on Michaelis-Menten kinetics: II. The low substrate concentration limit

    International Nuclear Information System (INIS)

    Kim, Hyojoon; Shin, Kook Joe

    2007-01-01

    The diffusion-influenced Michaelis-Menten kinetics in the low substrate concentration limit is studied in one and three dimensions. For the initial pair distribution of enzyme and substrate, we obtain the exact analytical results. We find that at short times the diffusion effect can make the reaction rate faster. The concentration deviations of the substrate and enzyme show t -1/2 and t -3/2 power-law behaviours in one and three dimensions, respectively, at long times. On the other hand, the average lifetime of the intermediate is independent of the initial state in one dimension, while it depends on the initial state in three dimensions. The ultimate production yield approaches unity in one dimension but it reaches a different value depending on other parameters in three dimensions. We also obtain the analytical results for the initial random distribution

  1. Fluids in micropores. II. Self-diffusion in a simple classical fluid in a slit pore

    International Nuclear Information System (INIS)

    Schoen, M.; Cushman, J.H.; Diestler, D.J.; Rhykerd, C.L. Jr.

    1988-01-01

    Self-diffusion coefficients D are computed for a model slit pore consisting of a rare-gas fluid confined between two parallel face-centered cubic (100) planes (walls) of rigidly fixed rare-gas atoms. By means of an optimally vectorized molecular-dynamics program for the CYBER 205, the dependence of D on the thermodynamic state (specified by the chemical potential μ, temperature T, and the pore width h) of the pore fluid has been explored. Diffusion is governed by Fick's law, even in pores as narrow as 2 or 3 atomic diameters. The diffusion coefficient oscillates as a function of h with fixed μ and T, vanishing at critical values of h, where fluid--solid phase transitions occur. A shift of the pore walls relative to one another in directions parallel with the walls can radically alter the structure of the pore fluid and consequently the magnitude of D. Since the pore fluid forms distinct layers parallel to the walls, a local diffusion coefficient D/sup (//sup i//sup )//sub parallel/ associated with a given layer i can be defined. D/sup (//sup i//sup )//sub parallel/ is least for the contact layer, even for pores as wide as 30 atomic diameters (∼100 A). Moreover, D/sup (//sup i//sup )//sub parallel/ increases with increasing distance of the fluid layer from the wall and, for pore widths between 16 and 30 atomic diameters, D/sup (//sup i//sup )//sub parallel/ is larger in the center of the pore than in the bulk fluid that is in equilibrium with the pore fluid. The opposite behavior is observed in corresponding smooth-wall pores, in which the discrete fluid--wall interactions have been averaged by smearing the wall atoms over the plane of the wall

  2. Diffusion of radioactively tagged penetrants through rubbery polymers. II. Dependence on molecular length of penetrant

    International Nuclear Information System (INIS)

    Rhee, C.K.; Ferry, J.D.; Fetters, L.J.

    1977-01-01

    The diffusion of radioactively tagged n-hexadecane, n-dotriacontane, and a polybutadiene oligomer with molecular weight 1600 has been studied in 12 rubbery polymers. Diffusion coefficients were obtained from the theory for the thin smear method: for n-hexadecane and for n-dotriacontane (with one exception), in the form appropriate for a completely miscible polymer-penetrant pair, and for the oligomer in the form appropriate for slow entry of the pentrant across the penetrant-polymer interface. For the four flexible linear penetrants, n-dodecane, n-hexadecane, n-dotriacontane, and oligomer, the ratios of diffusion coefficients (or translational friction coefficients) are nearly the same in every polymer. It is concluded that these penetrants travel with similar segmentwise motions, although that is not the case with bulkier, more rigid penetrants. For the three normal paraffins, the friction coefficient is approximately proportional to molecular weight, but that for the oligomer is smaller than would be predicted on this basis

  3. Optimization in the nuclear fuel cycle II: Surface contamination

    International Nuclear Information System (INIS)

    Pereira, W.S.; Silva, A.X.; Lopes, J.M.; Carmo, A.S.; Fernandes, T.S.; Mello, C.R.; Kelecom, A.

    2017-01-01

    Optimization is one of the bases of radioprotection and aims to move doses away from the dose limit that is the borderline of acceptable radiological risk. This work aims to use the monitoring of surface contamination as a tool of the optimization process. 53 surface contamination points were analyzed at a nuclear fuel cycle facility. Three sampling points were identified with monthly mean values of contamination higher than 1 Bq ∙ cm -2 , points 28, 42 and 47. These points were indicated for the beginning of the optimization process

  4. Biosorption optimization of lead(II), cadmium(II) and copper(II) using response surface methodology and applicability in isotherms and thermodynamics modeling

    International Nuclear Information System (INIS)

    Singh, Rajesh; Chadetrik, Rout; Kumar, Rajender; Bishnoi, Kiran; Bhatia, Divya; Kumar, Anil; Bishnoi, Narsi R.; Singh, Namita

    2010-01-01

    The present study was carried out to optimize the various environmental conditions for biosorption of Pb(II), Cd(II) and Cu(II) by investigating as a function of the initial metal ion concentration, temperature, biosorbent loading and pH using Trichoderma viride as adsorbent. Biosorption of ions from aqueous solution was optimized in a batch system using response surface methodology. The values of R 2 0.9716, 0.9699 and 0.9982 for Pb(II), Cd(II) and Cu(II) ions, respectively, indicated the validity of the model. The thermodynamic properties ΔG o , ΔH o , ΔE o and ΔS o by the metal ions for biosorption were analyzed using the equilibrium constant value obtained from experimental data at different temperatures. The results showed that biosorption of Pb(II) ions by T. viride adsorbent is more endothermic and spontaneous. The study was attempted to offer a better understating of representative biosorption isotherms and thermodynamics with special focuses on binding mechanism for biosorption using the FTIR spectroscopy.

  5. Biosorption optimization of lead(II), cadmium(II) and copper(II) using response surface methodology and applicability in isotherms and thermodynamics modeling

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Rajesh; Chadetrik, Rout; Kumar, Rajender; Bishnoi, Kiran; Bhatia, Divya; Kumar, Anil [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar 125001, Haryana (India); Bishnoi, Narsi R., E-mail: nrbishnoi@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar 125001, Haryana (India); Singh, Namita [Department of Bio and Nanotechnology, Guru Jambheshwar University of Science and Technology, Hisar 125001, Haryana (India)

    2010-02-15

    The present study was carried out to optimize the various environmental conditions for biosorption of Pb(II), Cd(II) and Cu(II) by investigating as a function of the initial metal ion concentration, temperature, biosorbent loading and pH using Trichoderma viride as adsorbent. Biosorption of ions from aqueous solution was optimized in a batch system using response surface methodology. The values of R{sup 2} 0.9716, 0.9699 and 0.9982 for Pb(II), Cd(II) and Cu(II) ions, respectively, indicated the validity of the model. The thermodynamic properties {Delta}G{sup o}, {Delta}H{sup o}, {Delta}E{sup o} and {Delta}S{sup o} by the metal ions for biosorption were analyzed using the equilibrium constant value obtained from experimental data at different temperatures. The results showed that biosorption of Pb(II) ions by T. viride adsorbent is more endothermic and spontaneous. The study was attempted to offer a better understating of representative biosorption isotherms and thermodynamics with special focuses on binding mechanism for biosorption using the FTIR spectroscopy.

  6. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  7. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  8. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  9. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  10. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  11. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  12. Local Group dSph radio survey with ATCA - II. Non-thermal diffuse emission

    Science.gov (United States)

    Regis, Marco; Richter, Laura; Colafrancesco, Sergio; Profumo, Stefano; de Blok, W. J. G.; Massardi, Marcella

    2015-04-01

    Our closest neighbours, the Local Group dwarf spheroidal (dSph) galaxies, are extremely quiescent and dim objects, where thermal and non-thermal diffuse emissions lack, so far, of detection. In order to possibly study the dSph interstellar medium, deep observations are required. They could reveal non-thermal emissions associated with the very low level of star formation, or to particle dark matter annihilating or decaying in the dSph halo. In this work, we employ radio observations of six dSphs, conducted with the Australia Telescope Compact Array in the frequency band 1.1-3.1 GHz, to test the presence of a diffuse component over typical scales of few arcmin and at an rms sensitivity below 0.05 mJy beam-1. We observed the dSph fields with both a compact array and long baselines. Short spacings led to a synthesized beam of about 1 arcmin and were used for the extended emission search. The high-resolution data mapped background sources, which in turn were subtracted in the short-baseline maps, to reduce their confusion limit. We found no significant detection of a diffuse radio continuum component. After a detailed discussion on the modelling of the cosmic ray (CR) electron distribution and on the dSph magnetic properties, we present bounds on several physical quantities related to the dSphs, such that the total radio flux, the angular shape of the radio emissivity, the equipartition magnetic field, and the injection and equilibrium distributions of CR electrons. Finally, we discuss the connection to far-infrared and X-ray observations.

  13. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  14. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  15. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  16. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  17. Diffusion of an effective tobacco prevention program. Part II: Evaluation of the adoption phase.

    Science.gov (United States)

    Parcel, G S; O'Hara-Tompkins, N M; Harrist, R B; Basen-Engquist, K M; McCormick, L K; Gottlieb, N H; Eriksen, M P

    1995-09-01

    This paper presents the results of theory-based intervention strategies to increase the adoption of a tobacco prevention program. The adoption intervention followed a series of dissemination intervention strategies targeted at 128 school districts in Texas. Informed by Social Cognitive Theory, the intervention provided opportunities for districts to learn about and model themselves after 'successful' school districts that had adopted the program, and to see the potential for social reinforcement through the knowledge that the program had the potential to have an important influence on students' lives. The proportion of districts in the Intervention condition that adopted the program was significantly greater than in the Comparison condition (P teacher attitudes toward the innovation and organizational considerations of administrators. Recommendations for the development of effective strategies for the diffusion of innovations are presented.

  18. VARIATIONS BETWEEN DUST AND GAS IN THE DIFFUSE INTERSTELLAR MEDIUM. II. SEARCH FOR COLD GAS

    Energy Technology Data Exchange (ETDEWEB)

    Reach, William T. [Universities Space Research Association, MS 232-11, Moffett Field, CA 94035 (United States); Heiles, Carl [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Bernard, Jean-Philippe, E-mail: wreach@sofia.usra.edu [Université de Toulouse, Institut de Recherche en Astrophysique et Planétologie, F-31028 Toulouse cedex 4 (France)

    2017-01-01

    The content of interstellar clouds, in particular the inventory of diffuse molecular gas, remains uncertain. We identified a sample of isolated clouds, approximately 100 M {sub ⊙} in size, and used the dust content to estimate the total amount of gas. In Paper I, the total inferred gas content was found significantly larger than that seen in 21 cm emission measurements of H i. In this paper we test the hypothesis that the apparent excess “dark” gas is cold H i, which would be evident in absorption but not in emission due to line saturation. The results show that there is not enough 21 cm absorption toward the clouds to explain the total amount of “dark” gas.

  19. Diffusive propagation of cosmic rays from supernova remnants in the Galaxy. II: anisotropy

    Energy Technology Data Exchange (ETDEWEB)

    Blasi, Pasquale; Amato, Elena, E-mail: blasi@arcetri.astro.it, E-mail: amato@arcetri.astro.it [INAF/Osservatorio Astrofisico di Arcetri, Largo E. Fermi, 5 — 50125 Firenze (Italy)

    2012-01-01

    In this paper we investigate the effects of stochasticity in the spatial and temporal distribution of supernova remnants on the anisotropy of cosmic rays observed at Earth. The calculations are carried out for different choices of the diffusion coefficient D(E) experienced by cosmic rays during propagation in the Galaxy. The propagation and spallation of nuclei (with charge 1 ≤ Z ≤ 26) are taken into account. At high energies (E > 1 TeV) we assume that D(E)∝(E/Z){sup δ}, with δ = 1/3 and δ = 0.6 being the reference scenarios. The large scale distribution of supernova remnants in the Galaxy is modeled following the distribution of pulsars with and without accounting for the spiral structure of the Galaxy. Our calculations allow us to determine the contribution to anisotropy resulting from both the large scale distribution of SNRs in the Galaxy and the random distribution of the nearest remnants. The naive expectation that the anisotropy amplitude scales as δ{sub A}∝D(E) is shown to be a wild oversimplification of reality which does not reflect in the predicted anisotropy for any realistic distribution of the sources. The fluctuations in the anisotropy pattern are dominated by nearby sources, so that predicting or explaining the observed anisotropy amplitude and phase becomes close to impossible. Nevertheless, the results of our calculations, when compared to the data, allow us to draw interesting conclusions in terms of the propagation scenario to be preferred both in terms of the energy dependence of the diffusion coefficient and of the size of the halo. We find that the very weak energy dependence of the anisotropy amplitude below 10{sup 5} GeV, as observed by numerous experiments, as well as the rise at higher energies, can best be explained if the diffusion coefficient is D(E)∝E{sup 1/3}. Faster diffusion, for instance with δ = 0.6, leads in general to an exceedingly large anisotropy amplitude. The spiral structure introduces interesting trends in

  20. Diffusive propagation of cosmic rays from supernova remnants in the Galaxy. II: anisotropy

    International Nuclear Information System (INIS)

    Blasi, Pasquale; Amato, Elena

    2012-01-01

    In this paper we investigate the effects of stochasticity in the spatial and temporal distribution of supernova remnants on the anisotropy of cosmic rays observed at Earth. The calculations are carried out for different choices of the diffusion coefficient D(E) experienced by cosmic rays during propagation in the Galaxy. The propagation and spallation of nuclei (with charge 1 ≤ Z ≤ 26) are taken into account. At high energies (E > 1 TeV) we assume that D(E)∝(E/Z) δ , with δ = 1/3 and δ = 0.6 being the reference scenarios. The large scale distribution of supernova remnants in the Galaxy is modeled following the distribution of pulsars with and without accounting for the spiral structure of the Galaxy. Our calculations allow us to determine the contribution to anisotropy resulting from both the large scale distribution of SNRs in the Galaxy and the random distribution of the nearest remnants. The naive expectation that the anisotropy amplitude scales as δ A ∝D(E) is shown to be a wild oversimplification of reality which does not reflect in the predicted anisotropy for any realistic distribution of the sources. The fluctuations in the anisotropy pattern are dominated by nearby sources, so that predicting or explaining the observed anisotropy amplitude and phase becomes close to impossible. Nevertheless, the results of our calculations, when compared to the data, allow us to draw interesting conclusions in terms of the propagation scenario to be preferred both in terms of the energy dependence of the diffusion coefficient and of the size of the halo. We find that the very weak energy dependence of the anisotropy amplitude below 10 5 GeV, as observed by numerous experiments, as well as the rise at higher energies, can best be explained if the diffusion coefficient is D(E)∝E 1/3 . Faster diffusion, for instance with δ = 0.6, leads in general to an exceedingly large anisotropy amplitude. The spiral structure introduces interesting trends in the energy

  1. Diffuse Reflectance Spectroscopy of Hidden Objects. Part II: Recovery of a Target Spectrum.

    Science.gov (United States)

    Pomerantsev, Alexey L; Rodionova, Oxana Ye; Skvortsov, Alexej N

    2017-08-01

    In this study, we consider the reconstruction of a diffuse reflectance near-infrared spectrum of an object (target spectrum) in case the object is covered by an interfering absorbing and scattering layer. Recovery is performed using a new empirical method, which was developed in our previous study. We focus on a system, which consists of several layers of polyethylene (PE) film and underlayer objects with different spectral features. The spectral contribution of the interfering layer is modeled by a three-component two-parameter multivariate curve resolution (MCR) model, which was built and calibrated using spectrally flat objects. We show that this model is applicable to real objects with non-uniform spectra. Ultimately, the target spectrum can be reconstructed from a single spectrum of the covered target. With calculation methods, we are able to recover quite accurately the spectrum of a target even when the object is covered by 0.7 mm of PE.

  2. Structural brain alterations in bipolar disorder II: a combined voxel-based morphometry (VBM) and diffusion tensor imaging (DTI) study.

    Science.gov (United States)

    Ambrosi, Elisa; Rossi-Espagnet, Maria Camilla; Kotzalidis, Georgios D; Comparelli, Anna; Del Casale, Antonio; Carducci, Filippo; Romano, Andrea; Manfredi, Giovanni; Tatarelli, Roberto; Bozzao, Alessandro; Girardi, Paolo

    2013-09-05

    Brain structural changes have been described in bipolar disorder (BP), but usually studies focused on both I and II subtypes indiscriminately and investigated changes in either brain volume or white matter (WM) integrity. We used combined voxel-based morphometry (VBM) and diffusion tensor imaging (DTI) analysis to track changes in the grey matter (GM) and WM in the brains of patients affected by BPII, as compared to healthy controls. Using VBM and DTI, we scanned 20 DSM-IV-TR BPII patients in their euthymic phase and 21 healthy, age- and gender-matched volunteers with no psychiatric history. VBM showed decreases in GM of BPII patients, compared to controls, which were diffuse in nature and most prominent in the right middle frontal gyrus and in the right superior temporal gurus. DTI showed significant and widespread FA reduction in BPII patients in all major WM tracts, including cortico-cortical association tracts. The small sample size limits the generalisability of our findings. Reduced GM volumes and WM integrity changes in BPII patients are not prominent like those previously reported in bipolar disorder type-I and involve cortical structures and their related association tracts. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Surface grafted chitosan gels. Part II. Gel formation and characterization

    DEFF Research Database (Denmark)

    Liu, Chao; Thormann, Esben; Claesson, Per M.

    2014-01-01

    Responsive biomaterial hydrogels attract significant attention due to their biocompatibility and degradability. In order to make chitosan based gels, we first graft one layer of chitosan to silica, and then build a chitosan/poly(acrylic acid) multilayer using the layer-by-layer approach. After...... cross-linking the chitosan present in the polyelectrolyte multilayer, poly(acrylic acid) is partly removed by exposing the multilayer structure to a concentrated carbonate buffer solution at a high pH, leaving a surface-grafted cross-linked gel. Chemical cross-linking enhances the gel stability against...... detachment and decomposition. The chemical reaction between gluteraldehyde, the cross-linking agent, and chitosan was followed in situ using total internal reflection Raman (TIRR) spectroscopy, which provided a molecular insight into the complex reaction mechanism, as well as the means to quantify the cross...

  4. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  5. The distribution of stars around the Milky Way's central black hole. II. Diffuse light from sub-giants and dwarfs

    Science.gov (United States)

    Schödel, R.; Gallego-Cano, E.; Dong, H.; Nogueras-Lara, F.; Gallego-Calvente, A. T.; Amaro-Seoane, P.; Baumgardt, H.

    2018-01-01

    Context. This is the second of three papers that search for the predicted stellar cusp around the Milky Way's central black hole, Sagittarius A*, with new data and methods. Aims: We aim to infer the distribution of the faintest stellar population currently accessible through observations around Sagittarius A*. Methods: We used adaptive optics assisted high angular resolution images obtained with the NACO instrument at the ESO VLT. Through optimised PSF fitting we removed the light from all detected stars above a given magnitude limit. Subsequently we analysed the remaining, diffuse light density. Systematic uncertainties were constrained by the use of data from different observing epochs and obtained with different filters. We show that it is necessary to correct for the diffuse emission from the mini-spiral, which would otherwise lead to a systematically biased light density profile. We used a Paschen α map obtained with the Hubble Space Telescope for this purpose. Results: The azimuthally averaged diffuse surface light density profile within a projected distance of R ≲ 0.5 pc from Sagittarius A* can be described consistently by a single power law with an exponent of Γ = 0.26 ± 0.02stat ± 0.05sys, similar to what has been found for the surface number density of faint stars in Paper I. Conclusions: The analysed diffuse light arises from sub-giant and main-sequence stars with Ks ≈ 19-22 with masses of 0.8-1.5 M⊙. These stars can be old enough to be dynamically relaxed. The observed power-law profile and its slope are consistent with the existence of a relaxed stellar cusp around the Milky Way's central black hole. We find that a Nuker law provides an adequate description of the nuclear cluster's intrinsic shape (assuming spherical symmetry). The 3D power-law slope near Sgr A* is γ = 1.13 ± 0.03model ± 0.05sys. The stellar density decreases more steeply beyond a break radius of about 3 pc, which corresponds roughly to the radius of influence of the

  6. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  7. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  8. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  9. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  10. Origins of ultra-diffuse galaxies in the Coma cluster - II. Constraints from their stellar populations

    Science.gov (United States)

    Ferré-Mateu, Anna; Alabi, Adebusola; Forbes, Duncan A.; Romanowsky, Aaron J.; Brodie, Jean; Pandya, Viraj; Martín-Navarro, Ignacio; Bellstedt, Sabine; Wasserman, Asher; Stone, Maria B.; Okabe, Nobuhiro

    2018-06-01

    In this second paper of the series we study, with new Keck/DEIMOS spectra, the stellar populations of seven spectroscopically confirmed ultra-diffuse galaxies (UDGs) in the Coma cluster. We find intermediate to old ages (˜ 7 Gyr), low metallicities ([Z/H]˜ - 0.7 dex) and mostly super-solar abundance patterns ([Mg/Fe] ˜ 0.13 dex). These properties are similar to those of low-luminosity (dwarf) galaxies inhabiting the same area in the cluster and are mostly consistent with being the continuity of the stellar mass scaling relations of more massive galaxies. These UDGs' star formation histories imply a relatively recent infall into the Coma cluster, consistent with the theoretical predictions for a dwarf-like origin. However, considering the scatter in the resulting properties and including other UDGs in Coma, together with the results from the velocity phase-space study of the Paper I in this series, a mixed-bag of origins is needed to explain the nature of all UDGs. Our results thus reinforce a scenario in which many UDGs are field dwarfs that become quenched through their later infall onto cluster environments, whereas some UDGs could be be genuine primordial galaxies that failed to develop due to an early quenching phase. The unknown proportion of dwarf-like to primordial-like UDGs leaves the enigma of the nature of UDGs still open.

  11. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  12. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  13. DYNAMIC S0 GALAXIES. II. THE ROLE OF DIFFUSE HOT GAS

    International Nuclear Information System (INIS)

    Li Jiangtao; Chen Yang; Daniel Wang, Q.; Li Zhiyuan

    2011-01-01

    Cold gas loss is thought to be important in star formation quenching and morphological transition during the evolution of S0 galaxies. In high-density environments, this gas loss can be achieved via many external mechanisms. However, in relatively isolated environments, where these external mechanisms cannot be efficient, the gas loss must then be dominated by some internal processes. We have performed Chandra analysis of hot gas in five nearby isolated S0 galaxies, based on the quantitative subtraction of various stellar contributions. We find that all the galaxies studied in the present work are X-ray faint, with the luminosity of the hot gas (L X ) typically accounting for ∼ X at the low-mass end (typically with K-band luminosity L K ∼ 11 L sun,K ). However, at the high-mass end, S0 galaxies tend to have significantly lower L X than elliptical galaxies of the same stellar masses, as already shown in previous observational and theoretical works. We further discuss the potential relationship of the diffuse X-ray emission with the cold (atomic and molecular) gas content in the S0 and elliptical galaxies included in our study. We find that L X /L 2 K tends to correlate positively with the total cold gas mass (M H 2 +H i ) for cold-gas-poor galaxies with M H 2 +H i ∼ 8 M sun , while they anti-correlate with each other for cold-gas-rich galaxies. This cold-hot gas relationship can be explained in a scenario of early-type galaxy evolution, with the leftover cold gas from the precursor star-forming galaxy mainly removed by the long-lasting Type Ia supernova (SN) feedback. The two different trends for cold-gas-rich and cold-gas-poor galaxies may be the results of the initial fast decreasing SN rate and the later fast decreasing mass loading to hot gas, respectively.

  14. Synthesis and characterization of a surface-grafted Cd(II) ion-imprinted polymer for selective separation of Cd(II) ion from aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Li, Min [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Feng, Changgen, E-mail: cgfeng@cast.org.cn [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Li, Mingyu; Zeng, Qingxuan; Gan, Qiang [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Yang, Haiyan [Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China)

    2015-03-30

    Highlights: • Cd(II) ion-imprinted polymer (Cd(II)-IIP) is prepared. • Cd(II)-IIP shows high stability, good selectivity and reusability. • Cd(II)-IIP can be used as a sorbent for selective removal of Cd(II) ion. - Abstract: A novel Cd(II) ion-imprinted polymer (Cd(II)-IIP) was prepared with surface imprinting technology by using cadmium chloride as a template and allyl thiourea (ATU) as a functional monomer for on-line solid-phase extraction of trace Cd(II) ion and selective separation Cd(II) ion in water samples. The Cd(II)-IIP exhibited good chemical performance and thermal stability. Kinetics studies showed that the equilibrium adsorption was achieved within 8.0 min and the adsorption process can be described by pseudo-second-order kinetic model. Compared to the Cd(II) non-imprinted polymer (Cd(II)-NIP), the Cd(II)-IIP had a higher adsorption capacity and selectivity for Cd(II) ion. The maximum adsorption capacities of the Cd(II)-IIP and Cd(II)-NIP for Cd(II) were 38.30 and 13.21 mg g{sup −1}, respectively. The relative selectivity coefficients of the adsorbent for Cd(II) in the presence of Cu{sup 2+}, Ni{sup 2+}, Co{sup 2+}, Pb{sup 2+} and Zn{sup 2+} were 2.86, 6.42, 11.50, 9.46 and 3.73, respectively. In addition, the Cd(II) ion adsorbed was easy to remove from sorbent and the Cd(II)-IIP exhibited good stability and reusability. The adsorption capacity had no obvious decrease after being used six times. The accuracy of this method was verified by the standard reference material, it was then applied for cadmium ion determination in different types of water samples.

  15. Boron Neutron Capture Therapy activity of diffused tumors at TRIGA Mark II in Pavia

    Energy Technology Data Exchange (ETDEWEB)

    Bortolussi, S.; Stella, S.; De Bari, A.; Altieri, S. [Department of Nuclear and Theoretical Physics, University of Pavia, Pavia (Italy)]|[National Institute of Nuclear Physics (INFN), Pavia (Italy); Bruschi, P.; Bakeine, J.G. [Department of Nuclear and Theoretical Physics, University of Pavia, Pavia (Italy); Clerici, A.; Ferrari, C.; Zonta, C.; Zonta, A. [Department of Surgery, University of Pavia, Pavia (Italy); Nano, R. [Department of Animal Biology, University of Pavia, Pavia (Italy)

    2008-10-29

    The Boron neutron Capture Therapy research in Pavia has a long tradition: it begun more than 20 years ago at the TRIGA Mark II reactor of the University. A technique for the treatment of the hepatic metastases was developed, consisting in explanting the liver treated with {sup 10}B, irradiating it in the thermal column of the reactor, and re-implanting the organ in the patient. In the last years, the possibility of applying BNCT to the lung tumours using epithermal collimated neutron beams and without explanting the organ, is being explored. The principal obtained results of the BNCT research will be presented, with particular emphasis on the following aspects: a) the project of a new thermal column configuration to make the thermal neutron flux more uniform inside the explanted liver, b) the Monte Carlo study by means of the MCNP code of the thermal neutron flux distribution inside a patient's thorax irradiated with epithermal neutrons, and c) the measurement of the boron concentration in tissues by (n,{alpha}) spectroscopy and neutron autoradiography. (authors)

  16. Boron Neutron Capture Therapy activity of diffused tumors at TRIGA Mark II in Pavia

    International Nuclear Information System (INIS)

    Bortolussi, S.; Stella, S.; De Bari, A.; Altieri, S.; Bruschi, P.; Bakeine, J.G.; Clerici, A.; Ferrari, C.; Zonta, C.; Zonta, A.; Nano, R.

    2008-01-01

    The Boron neutron Capture Therapy research in Pavia has a long tradition: it begun more than 20 years ago at the TRIGA Mark II reactor of the University. A technique for the treatment of the hepatic metastases was developed, consisting in explanting the liver treated with 10 B, irradiating it in the thermal column of the reactor, and re-implanting the organ in the patient. In the last years, the possibility of applying BNCT to the lung tumours using epithermal collimated neutron beams and without explanting the organ, is being explored. The principal obtained results of the BNCT research will be presented, with particular emphasis on the following aspects: a) the project of a new thermal column configuration to make the thermal neutron flux more uniform inside the explanted liver, b) the Monte Carlo study by means of the MCNP code of the thermal neutron flux distribution inside a patient's thorax irradiated with epithermal neutrons, and c) the measurement of the boron concentration in tissues by (n,α) spectroscopy and neutron autoradiography. (authors)

  17. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  18. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  19. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  20. Microscale anechoic architecture: acoustic diffusers for ultra low power microparticle separation via traveling surface acoustic waves.

    Science.gov (United States)

    Behrens, Jan; Langelier, Sean; Rezk, Amgad R; Lindner, Gerhard; Yeo, Leslie Y; Friend, James R

    2015-01-07

    We present a versatile and very low-power traveling SAW microfluidic sorting device able to displace and separate particles of different diameter in aqueous suspension; the travelling wave propagates through the fluid bulk and diffuses via a Schröder diffuser, adapted from its typical use in concert hall acoustics to be the smallest such diffuser to be suitable for microfluidics. The effective operating power range is two to three orders of magnitude less than current SAW devices, uniquely eliminating the need for amplifiers, and by using traveling waves to impart forces directly upon suspended microparticles, they can be separated by size.

  1. A high 18F-FDOPA uptake is associated with a slow growth rate in diffuse Grade II-III gliomas.

    Science.gov (United States)

    Isal, Sibel; Gauchotte, Guillaume; Rech, Fabien; Blonski, Marie; Planel, Sophie; Chawki, Mohammad B; Karcher, Gilles; Marie, Pierre-Yves; Taillandier, Luc; Verger, Antoine

    2018-04-01

    In diffuse Grade II-III gliomas, a high 3,4-dihydroxy-6-( 18 F)-fluoro-L-phenylalanine ( 18 F-FDOPA) positron emission tomography (PET) uptake, with a standardized uptake value (SUV max )/contralateral brain tissue ratio greater than 1.8, was previously found to be consistently associated with the presence of an isocitrate dehydrogenase (IDH) mutation, whereas this mutation is typically associated with a better prognosis. This pilot study was aimed to ascertain the prognostic value of this high 18 F-FDOPA uptake in diffuse Grade II-III gliomas with regard to the velocity of diameter expansion (VDE), which represents an established landmark of better prognosis when below 4 mm per year. 20 patients (42 ± 10 years, 10 female) with newly-diagnosed diffuse Grade II-III gliomas (17 with IDH mutation) were retrospectively included. All had a 18 F-FDOPA PET, quantified with SUV max ratio, along with a serial MRI enabling VDE determination. SUV max ratio was above 1.8 in 5 patients (25%) all of whom had a VDE VDE <4 mm/year in the overall population (45 vs 0%, p = 0.04) and also in the subgroup of patients with IDH mutation (45 vs 0%, p = 0.10). This pilot study shows that in diffuse Grade II-III gliomas, a high 18 F-FDOPA uptake would be predictive of low tumour growth, with a different prognostic significance than IDH mutation. Advances in knowledge: 18 F-FDOPA PET in a single session imaging could have prognostic value in initial diagnosis of diffuse Grade II-III gliomas.

  2. Sum-frequency spectroscopic studies: I. Surface melting of ice, II. Surface alignment of polymers

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Xing [Univ. of California, Berkeley, CA (United States)

    2000-01-01

    Surface vibrational spectroscopy via infrared-visible sum-frequency generation (SFG) has been established as a useful tool to study the structures of different kinds of surfaces and interfaces. This technique was used to study the (0001) face of hexagonal ice (Ih). SFG spectra in the O-H stretch frequency range were obtained at various sample temperatures. For the vapor(air)/ice interface, the degree of orientational order of the dangling OH bonds at the surface was measured as a function of temperature. Disordering sets in around 200 K and increases dramatically with temperature, which is strong evidence of surface melting of ice. For the other ice interfaces (silica/OTS/ice and silica/ice), a similar temperature dependence of the hydrogen bonded OH stretch peak was observed; the free OH stretch mode, however, appears to be different from that of the vapor (air)/ice interface due to interactions at the interfaces. The technique was also used to measure the orientational distributions of the polymer chains on a rubbed polyvinyl alcohol surface. Results show that the polymer chains at the surface appear to be well aligned by rubbing, and the adsorbed liquid crystal molecules are aligned, in turn, by the surface polymer chains. A strong correlation exists between the orientational distributions of the polymer chains and the liquid crystal molecules, indicating that the surface-induced bulk alignment of a liquid crystal film by rubbed polymer surfaces is via an orientational epitaxy-like mechanism. This thesis also contains studies on some related issues that are crucial to the above applications. An experiment was designed to measure SFG spectra in both reflection and transmission. The result confirms that SFG in reflection is generally dominated by the surface contribution. Another issue is the motional effect due to fast orientational motion of molecules at a surface or interface. Calculations show that the effect is significant if the molecular orientation varies

  3. Nitrile versus isonitrile adsorption at interstellar grain surfaces. II. Carbonaceous aromatic surfaces

    Science.gov (United States)

    Bertin, M.; Doronin, M.; Michaut, X.; Philippe, L.; Markovits, A.; Fillion, J.-H.; Pauzat, F.; Ellinger, Y.; Guillemin, J.-C.

    2017-12-01

    Context. Almost 20% of the 200 different species detected in the interstellar and circumstellar media present a carbon atom linked to nitrogen by a triple bond. Of these 37 molecules, 30 are nitrile R-CN compounds, the remaining 7 belonging to the isonitrile R-NC family. How these species behave in their interactions with the grain surfaces is still an open question. Aims: In a previous work, we have investigated whether the difference between nitrile and isonitrile functional groups may induce differences in the adsorption energies of the related isomers at the surfaces of interstellar grains of various nature and morphologies. This study is a follow up of this work, where we focus on the adsorption on carbonaceous aromatic surfaces. Methods: The question is addressed by means of a concerted experimental and theoretical approach of the adsorption energies of CH3CN and CH3NC on the surface of graphite (with and without surface defects). The experimental determination of the molecule and surface interaction energies is carried out using temperature-programmed desorption in an ultra-high vacuum between 70 and 160 K. Theoretically, the question is addressed using first-principle periodic density functional theory to represent the organised solid support. Results: The adsorption energy of each compound is found to be very sensitive to the structural defects of the aromatic carbonaceous surface: these defects, expected to be present in a large numbers and great diversity on a realistic surface, significantly increase the average adsorption energies to more than 50% as compared to adsorption on perfect graphene planes. The most stable isomer (CH3CN) interacts more efficiently with the carbonaceous solid support than the higher energy isomer (CH3NC), however.

  4. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  5. Spectroscopic evidence for ternary surface complexes in the lead(II)-malonic acid-hematite system

    Science.gov (United States)

    Lenhart, J.J.; Bargar, J.R.; Davis, J.A.

    2001-01-01

    Using extended X-ray absorption fine structure (EXAFS) and attenuated total reflectance Fourier-transform infrared (ATR-FTIR) measurements, we examined the sorption of Pb(II) to hematite in the presence of malonic acid. Pb LIII-edge EXAFS measurements performed in the presence of malonate indicate the presence of both Fe and C neighbors, suggesting that a major fraction of surface-bound malonate is bonded to adsorbed Pb(II). In the absence of Pb(II), ATR-FTIR measurements of sorbed malonate suggest the formation of more than one malonate surface complex. The dissimilarity of the IR spectrum of malonate sorbed on hematite to those for aqueous malonate suggest at least one of the sorbed malonate species is directly coordinated to surface Fe atoms in an inner-sphere mode. In the presence of Pb, little change is seen in the IR spectrum for sorbed malonate, indicating that geometry of malonate as it coordinates to sorbed Pb(II) adions is similar to the geometry of malonate as it coordinates to Fe in the hematite surface. Fits of the raw EXAFS spectra collected from pH 4 to pH 8 result in average Pb-C distances of 2.98 to 3.14 A??, suggesting the presence of both four- and six-membered Pb-malonate rings. The IR results are consistent with this interpretation. Thus, our results suggest that malonate binds to sorbed Pb(II) adions, forming ternary metal-bridging surface complexes. ?? 2001 Academic Press.

  6. Analytical mass formula and nuclear surface properties in the ETF approximation. Part II: asymmetric nuclei

    Science.gov (United States)

    Aymard, François; Gulminelli, Francesca; Margueron, Jérôme

    2016-08-01

    We have recently addressed the problem of the determination of the nuclear surface energy for symmetric nuclei in the framework of the extended Thomas-Fermi (ETF) approximation using Skyrme functionals. We presently extend this formalism to the case of asymmetric nuclei and the question of the surface symmetry energy. We propose an approximate expression for the diffuseness and the surface energy. These quantities are analytically related to the parameters of the energy functional. In particular, the influence of the different equation of state parameters can be explicitly quantified. Detailed analyses of the different energy components (local/non-local, isoscalar/isovector, surface/curvature and higher order) are also performed. Our analytical solution of the ETF integral improves previous models and leads to a precision of better than 200 keV per nucleon in the determination of the nuclear binding energy for dripline nuclei.

  7. Atomic-Scale Visualization of Quasiparticle Interference on a Type-II Weyl Semimetal Surface.

    Science.gov (United States)

    Zheng, Hao; Bian, Guang; Chang, Guoqing; Lu, Hong; Xu, Su-Yang; Wang, Guangqiang; Chang, Tay-Rong; Zhang, Songtian; Belopolski, Ilya; Alidoust, Nasser; Sanchez, Daniel S; Song, Fengqi; Jeng, Horng-Tay; Yao, Nan; Bansil, Arun; Jia, Shuang; Lin, Hsin; Hasan, M Zahid

    2016-12-23

    We combine quasiparticle interference simulation (theory) and atomic resolution scanning tunneling spectromicroscopy (experiment) to visualize the interference patterns on a type-II Weyl semimetal Mo_{x}W_{1-x}Te_{2} for the first time. Our simulation based on first-principles band topology theoretically reveals the surface electron scattering behavior. We identify the topological Fermi arc states and reveal the scattering properties of the surface states in Mo_{0.66}W_{0.34}Te_{2}. In addition, our result reveals an experimental signature of the topology via the interconnectivity of bulk and surface states, which is essential for understanding the unusual nature of this material.

  8. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  10. Comparison between types I and II epithelial ovarian cancer using histogram analysis of monoexponential, biexponential, and stretched-exponential diffusion models.

    Science.gov (United States)

    Wang, Feng; Wang, Yuxiang; Zhou, Yan; Liu, Congrong; Xie, Lizhi; Zhou, Zhenyu; Liang, Dong; Shen, Yang; Yao, Zhihang; Liu, Jianyu

    2017-12-01

    To evaluate the utility of histogram analysis of monoexponential, biexponential, and stretched-exponential models to a dualistic model of epithelial ovarian cancer (EOC). Fifty-two patients with histopathologically proven EOC underwent preoperative magnetic resonance imaging (MRI) (including diffusion-weighted imaging [DWI] with 11 b-values) using a 3.0T system and were divided into two groups: types I and II. Apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudodiffusion coefficient (D*), perfusion fraction (f), distributed diffusion coefficient (DDC), and intravoxel water diffusion heterogeneity (α) histograms were obtained based on solid components of the entire tumor. The following metrics of each histogram were compared between two types: 1) mean; 2) median; 3) 10th percentile and 90th percentile. Conventional MRI morphological features were also recorded. Significant morphological features for predicting EOC type were maximum diameter (P = 0.007), texture of lesion (P = 0.001), and peritoneal implants (P = 0.001). For ADC, D, f, DDC, and α, all metrics were significantly lower in type II than type I (P histogram metrics of ADC, D, and DDC had significantly higher area under the receiver operating characteristic curve values than those of f and α (P histogram analysis. ADC, D, and DDC have better performance than f and α; f and α may provide additional information. 4 Technical Efficacy: Stage 1 J. Magn. Reson. Imaging 2017;46:1797-1809. © 2017 International Society for Magnetic Resonance in Medicine.

  11. Potentially hazardous substances in surface waters. II. Cholinesterase inhibitors in Dutch surface waters

    NARCIS (Netherlands)

    Greve, P.A.; Freudenthal, J.; Wit, S.L.

    1972-01-01

    Several analytical methods were employed to determine the concentrations of cholinesterase inhibitors in several Dutch surface waters. An Auto-Analyzer method was used for screening purposes; thin-layer chromatography and gas-liquid chromatography-mass spectrometry were used for identification and

  12. Effects of fluctuations and noise on the neutron monitor diurnal anisotropy. II. Non-field-aligned diffusion

    International Nuclear Information System (INIS)

    Owens, A.J.

    1977-01-01

    The effects of non-field-aligned diffusion (i.e., terms in the diffusion tensor proportional to the antisymmetric coefficient kappa/sub A/) on the observed day-to-day deviation of the diffusive diurnal anisotropy from the daily average magnetic field direction are considered. Using reasonable parameters for the diffusion of cosmic rays in interplanetary space, I show that these terms give a natural explanation for the angular difference between the anisotropy and field directions during normal quiet interplanetary epochs

  13. Surface Structures Formed by a Copper(II Complex of Alkyl-Derivatized Indigo

    Directory of Open Access Journals (Sweden)

    Akinori Honda

    2016-10-01

    Full Text Available Assembled structures of dyes have great influence on their coloring function. For example, metal ions added in the dyeing process are known to prevent fading of color. Thus, we have investigated the influence of an addition of copper(II ion on the surface structure of alkyl-derivatized indigo. Scanning tunneling microscope (STM analysis revealed that the copper(II complexes of indigo formed orderly lamellar structures on a HOPG substrate. These lamellar structures of the complexes are found to be more stable than those of alkyl-derivatized indigos alone. Furthermore, 2D chirality was observed.

  14. SURFACE BRIGHTNESS PROFILES OF DWARF GALAXIES. II. COLOR TRENDS AND MASS PROFILES

    Energy Technology Data Exchange (ETDEWEB)

    Herrmann, Kimberly A. [Penn State Mont Alto, 1 Campus Drive, Mont Alto, PA 17237 (United States); Hunter, Deidre A. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Elmegreen, Bruce G., E-mail: kah259@psu.edu, E-mail: dah@lowell.edu, E-mail: bge@us.ibm.com [IBM T. J. Watson Research Center, 1101 Kitchawan Road, Yorktown Heights, NY 10598 (United States)

    2016-06-01

    In this second paper of a series, we explore the B  −  V , U  −  B , and FUV−NUV radial color trends from a multi-wavelength sample of 141 dwarf disk galaxies. Like spirals, dwarf galaxies have three types of radial surface brightness profiles: (I) single exponential throughout the observed extent (the minority), (II) down-bending (the majority), and (III) up-bending. We find that the colors of (1) Type I dwarfs generally become redder with increasing radius, unlike spirals which have a blueing trend that flattens beyond ∼1.5 disk scale lengths, (2) Type II dwarfs come in six different “flavors,” one of which mimics the “U” shape of spirals, and (3) Type III dwarfs have a stretched “S” shape where the central colors are flattish, become steeply redder toward the surface brightness break, then remain roughly constant beyond, which is similar to spiral Type III color profiles, but without the central outward bluing. Faint (−9 >  M{sub B}  > −14) Type II dwarfs tend to have continuously red or “U” shaped colors and steeper color slopes than bright (−14 >  M{sub B}  > −19) Type II dwarfs, which additionally have colors that become bluer or remain constant with increasing radius. Sm dwarfs and BCDs tend to have at least some blue and red radial color trend, respectively. Additionally, we determine stellar surface mass density (Σ) profiles and use them to show that the break in Σ generally remains in Type II dwarfs (unlike Type II spirals) but generally disappears in Type III dwarfs (unlike Type III spirals). Moreover, the break in Σ is strong, intermediate, and weak in faint dwarfs, bright dwarfs, and spirals, respectively, indicating that Σ may straighten with increasing galaxy mass. Finally, the average stellar surface mass density at the surface brightness break is roughly 1−2  M {sub ⊙} pc{sup −2} for Type II dwarfs but higher at 5.9  M {sub ⊙} pc{sup −2} or 27  M {sub ⊙} pc{sup −2} for

  15. Large-scale Validation of AMIP II Land-surface Simulations: Preliminary Results for Ten Models

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, T J; Henderson-Sellers, A; Irannejad, P; McGuffie, K; Zhang, H

    2005-12-01

    This report summarizes initial findings of a large-scale validation of the land-surface simulations of ten atmospheric general circulation models that are entries in phase II of the Atmospheric Model Intercomparison Project (AMIP II). This validation is conducted by AMIP Diagnostic Subproject 12 on Land-surface Processes and Parameterizations, which is focusing on putative relationships between the continental climate simulations and the associated models' land-surface schemes. The selected models typify the diversity of representations of land-surface climate that are currently implemented by the global modeling community. The current dearth of global-scale terrestrial observations makes exacting validation of AMIP II continental simulations impractical. Thus, selected land-surface processes of the models are compared with several alternative validation data sets, which include merged in-situ/satellite products, climate reanalyses, and off-line simulations of land-surface schemes that are driven by observed forcings. The aggregated spatio-temporal differences between each simulated process and a chosen reference data set then are quantified by means of root-mean-square error statistics; the differences among alternative validation data sets are similarly quantified as an estimate of the current observational uncertainty in the selected land-surface process. Examples of these metrics are displayed for land-surface air temperature, precipitation, and the latent and sensible heat fluxes. It is found that the simulations of surface air temperature, when aggregated over all land and seasons, agree most closely with the chosen reference data, while the simulations of precipitation agree least. In the latter case, there also is considerable inter-model scatter in the error statistics, with the reanalyses estimates of precipitation resembling the AMIP II simulations more than to the chosen reference data. In aggregate, the simulations of land-surface latent and

  16. Continuum theory of the mixed-state and surface Joule effects in type-II superconductors

    International Nuclear Information System (INIS)

    Hocquet, T.; Mathieu, P.; Simon, Y.

    1992-01-01

    A phenomenological theory of vortex motion, where the mixed state is regarded as a continuum, has been proposed by two of the authors in a short previous letter. Its outlines are recalled in this paper with further comments and arguments; in particular the basic equations and their implications are discussed at some length. This theory leads to a model of pinning, from which we argue that critical currents I c , in soft type-II samples of standard bulk homogeneity, should be governed essentially by surface defects. I c is interpreted as a physically well-defined part of the total transport current I, which is flowing over a small depth close to the surface. Thus, on the scale of an ordinary sample, this part of the transport current is superficial, the remaining part I-I c being uniformly distributed over the cross section. Coherently, an analysis of the dissipation in such samples predicts that the part VI c of the total Joule effect VI must arise as surface heat sources, while the Joule effect V(I-I c ), usually associated with the steady viscous flow of vortices, is uniformly distributed in the bulk. As a proof, we present a method, using second-sound acoustics, to detect and separate surface and volume heat sources. Experimental results give clear evidence of a surface Joule effect, and support the validity of our model of surface pinning in soft materials

  17. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  18. Exciton diffusion length in some thermocleavable polythiophenes by the surface photovoltage method

    DEFF Research Database (Denmark)

    Tousek, J.; Touskova, J.; Remes, Z.

    2012-01-01

    property is that P3MHOCT can serve as a precursor which, after thermal annealing, converts into more rigid and insoluble P3CT and further thermal treatment produces native unsubstituted PT. Ellipsometric measurement yielded data on the thickness of the spin coated layers; absorption coefficients were...... be ascribed to the increase of the crystalline fraction. The highest diffusion length was found in P3CT polymer but its large resistivity represents a disadvantage in application in solar cells. Taking into account just these parameters, relatively low resistivity together with quite high diffusion length (13...

  19. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  20. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  1. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  2. Diffusion Coefficient in the Zinc Coating Shaped on the Surface of Cast Iron and Steel Alloys

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2015-06-01

    Full Text Available The article presents the method to assess the diffusion coefficient D in the sub-layer of intermetallic phases formed during hot-dip galvanizing “Armco” iron and ductile cast iron EN-GJS-500-7. Hot-dip galvanizing is one of the most popular forms of long-term protection of Fe-C alloys against corrosion. The process for producing a protective layer of sufficient quality is closely related to diffusion of atoms of zinc and iron. The simulation consist in performed a hot-dip galvanizing in laboratory condition above Fe-C alloys, in the Department of Engineering of Cast Alloys and Composites. Galvanizing time ranged from 15 to 300 seconds. Then metallographic specimens were prepared, intermetallic layers were measured and diffusion coefficient (D were calculated. It was found that the diffusion coefficient obtained during hot-dip galvanizing “Armco” iron and zinc is about two orders of magnitude less than the coefficient obtained on ductile cast iron EN-GJS-500-7.

  3. HEXAGA-II-120, -60, -30 two-dimensional multi-group neutron diffusion programmes for a uniform triangular mesh with arbitrary group scattering

    International Nuclear Information System (INIS)

    Woznicki, Z.

    1979-06-01

    This report presents the AGA two-sweep iterative methods belonging to the family of factorization techniques in their practical application in the HEXAGA-II two-dimensional programme to obtain the numerical solution to the multi-group, time-independent, (real and/or adjoint) neutron diffusion equations for a fine uniform triangular mesh. An arbitrary group scattering model is permitted. The report written for the users provides the description of input and output. The use of HEXAGA-II is illustrated by two sample reactor problems. (orig.) [de

  4. Selective solid-phase extraction of Hg(II) using silica gel surface - imprinting technique

    International Nuclear Information System (INIS)

    Zheng, H.; Geng, T.; Hu, L.

    2008-01-01

    A new ion-imprinted amino-functionalized silica gel sorbent was synthesized by surface-imprinting technique for preconcentration and separation of Hg(II) prior to its determination by inductively coupled plasma optical emission spectrometry (ICP-OES). Compared to the traditional solid sorbents and non-imprinted polymer particles, the ion-imprinted polymers (IIPs) have higher adsorption capacity and selectivity for Hg(II). The maximum static adsorption capacity of the imprinted and non-imprinted sorbent for Hg(II) was 29.89 mg g -1 and 11.21 mg g -1 , respectively. The highest selectivity coefficient for Hg(II) in the presence of Zn(II) exceeded 230. The detection limit (3σ) of the method was 0.25 μg L -1 . The relative standard deviation of the method was 2.5% for eight replicate determinations of 10 μg of Hg 2+ in 200 mL-in-volume water sample. The procedure was validated by performing the analysis of the certified river sediment sample (GBW 08603, China) using the standard addition method. The developed method was also successfully applied to the determination of trace mercury in Chinese traditional medicine and water samples with satisfactory results. (authors)

  5. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  6. Velocity-resolved [{\\rm{C}}\\,{\\rm{II}}] Emission from Cold Diffuse Clouds in the Interstellar Medium

    Science.gov (United States)

    Goldsmith, Paul F.; Pineda, Jorge L.; Neufeld, David A.; Wolfire, Mark G.; Risacher, Christophe; Simon, Robert

    2018-04-01

    We have combined emission from the 158 μm fine structure transition of C+ observed with the GREAT and upGREAT instruments on SOFIA with 21 cm absorption spectra and visual extinction to characterize the diffuse interstellar clouds found along the lines of sight. The weak [C II] emission is consistent in velocity and line width with the strongest H I component produced by the cold neutral medium. The H I column density and kinetic temperature are known from the 21 cm data and, assuming a fractional abundance of ionized carbon, we calculate the volume density and thermal pressure of each source, which vary considerably, with 27 {cm}}-3≤slant n({{{H}}}0) ≤slant 210 cm‑3 considering only the atomic hydrogen along the lines of sight to be responsible for the C+, while 13 {cm}}-3≤slant n({{{H}}}0+{{{H}}}2)≤slant 190 cm‑3 including the hydrogen in both forms. The thermal pressure varies widely with 1970 cm‑3 K ≤slant {P}th}/k≤slant 10,440 cm‑3 K for H0 alone and 750 cm‑3 K ≤ P th/k ≤ 9360 cm‑3 K including both H0 and H2. The molecular hydrogen fraction varies between 0.10 and 0.67. Photoelectric heating is the dominant heating source, supplemented by a moderately enhanced cosmic ray ionization rate, constrained by the relatively low 45 K to 73 K gas temperatures of the clouds. The resulting thermal balance for the two lower-density clouds is satisfactory, but for the two higher-density clouds, the combined heating rate is insufficient to balance the observed C+ cooling.

  7. Effect of TiO2 additive on the sintering of nuclear fuel (U,Pu)O2. Contribution of surface diffusion to plutonium distribution

    International Nuclear Information System (INIS)

    Bremier, Stephane

    1997-01-01

    This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive

  8. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

    2012-01-01

    in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

  9. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  10. Diffusion coefficients-surface and interfacial tensions - Particular study of some lauryl compounds

    International Nuclear Information System (INIS)

    Morel, Jean-Emile

    1969-01-01

    Two important results of the double lipophilic and hydrophilic character of some heavy organic compounds with a polar group at the end of the chain, were studied: - In a first part, molecular diffusion coefficients were measured in order to prove the micellar aggregation of tri-laurylammonium nitrate in some organic solutions; - In a second part, the tensioactivity of some lauryl compounds (lauric acid, lauric alcohol, mono-laurylamine, etc.), was studied. (author) [fr

  11. Reflection Matrix Method for Controlling Light After Reflection From a Diffuse Scattering Surface

    Science.gov (United States)

    2016-12-22

    of Philosophy Kenneth W. Burgi, BS, MS Major, USAF 22 December 2016 DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT...refocusing light through thin films of a turbid medium. When coherent light is trans- mitted through a stationary diffuser (i.e. a turbid medium), a fine...resultant light scatter [14, 15, 21, 23]. Transmission matrices were measured with microscopic objectives and thin films of turbid media, resulting in

  12. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  13. CD4+ T cell-mediated cytotoxicity is associated with MHC class II expression on malignant CD19+ B cells in diffuse large B cell lymphoma.

    Science.gov (United States)

    Zhou, Yong; Zha, Jie; Lin, Zhijuan; Fang, Zhihong; Zeng, Hanyan; Zhao, Jintao; Luo, Yiming; Li, Zhifeng; Xu, Bing

    2018-01-15

    Diffuse large B cell lymphoma (DLBCL) is a common B cell malignancy with approximately 30% of patients present relapsed or refractory disease after first-line therapy. Research of further treatment options is needed. Cytotoxic CD4 + T cells express cytolytic molecules and have potential antitumor function. Here, we showed that the CD19 + cells from DLBCL patients presented significantly reduced expression of MHC II molecules than those from healthy controls. Three years after the first-line treatment, patients that presented relapsed disease had significantly lower MHC II expression on their CD19 + cells than patients who did not show recurrence. Examining cytotoxic CD4 + T cells show that DLBCL patients presented significantly elevated frequencies of granzyme A-, granzyme B-, and/or perforin-expressing cytotoxic CD4 + T cells. Also, frequency of cytotoxic CD4 + T cells in DLBCL patients was positively correlated with the MHC II expression level. Subsequently, the cytotoxic potential of CD4 + T cells against autologous CD19 + cells was investigated. We found that the cytotoxic potential of CD4 + T cells was highest in MHC II-high, intermediate in MHC II-mid, and lowest in MHC II-low patients. The percentage of MHC II-expressing viable CD19 + cells presented a significant reduction after longer incubation with cytotoxic CD4 + T cells, suggesting that cytotoxic CD4 + T cells preferentially eliminated MHC II-expressing CD19 + cells. Blocking MHC II on CD19 + cells significantly reduced the cytolytic capacity of CD4 + T cells. Despite these discoveries, the frequency of cytotoxic CD4 + T cells did not predict the clinical outcome of DLBCL patients. Together, these results demonstrated that cytotoxic CD4 + T cells presented an MHC II-dependent cytotoxic potential against autologous CD19 + cells and could potentially represent a future treatment option for DLBCL. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Methodology to obtain exchange properties of the calcite surface-Application to major and trace elements: Ca(II), HCO3-, and Zn(II)

    International Nuclear Information System (INIS)

    Tertre, E.; Beaucaire, C.; Juery, A.; Ly, J.; Tertre, E.; Beaucaire, C.; Juery, A.; Ly, J.

    2010-01-01

    Sorption of inorganic elements onto carbonate minerals has been intensively described in the literature by two reaction steps: (1) a first one rapid and completed within a few hours and (2) a second one slower, eventually irreversible, and occurring at a constant rate. The first step is often attributed to an ion-exchange process, but its reversibility is rarely investigated. Consequently, discrimination of the global sorption phenomenon into two different mechanisms is not always justified. In this study, we investigated, by batch experiments, both sorption and desorption of Ca(II), HCO 3 - , and Zn(II), radiolabeled with isotopes 45 Ca(II), H 14 CO 3 - , and 65 Zn(II), respectively, onto synthetic pure calcite. Solutions were pre-equilibrated with atmospheric p(CO 2 ) and saturated with respect to calcite. Therefore, our purpose was to: (1) obtain experimental distribution coefficients of major elements (Ca(II) and HCO 3 - ) and a trace element (Zn(II)) onto calcite from sorption and desorption experiments, (2) test the validity of a first-occurring ion-exchange process generally noted in the literature, by calculating distribution coefficients for the 'sole' exchange process, and (3) quantify the amounts of Ca(II), HCO 3 - , and Zn(II) sorbed on the calcite surface by the sole 'exchange process' and compare them with surface crystallochemical data. Ca(II) or HCO 3 - sorption experimental data suggest that a significant fraction of these two elements was sorbed irreversibly onto or in the calcite. By using a method based on isotopic ratios, the Ca(II) or HCO 3 - concentrations, which are reversibly adsorbed on the calcite, have been quantified. These concentrations are respectively estimated at 4. 0 ± 2. 0 * 10 -4 and 7. 0 ± 1. 5 * 10 -4 mol/kg. The obtained Ca(II) surface concentration value is one order of magnitude lower than the one obtained from isotopic measurement by former authors [Geochim. Cosmochim. Acta 55 (1991) 1549; Geochim. Cosmochim. Acta 51

  15. Coherent quantum transport in disordered systems: II. Temperature dependence of carrier diffusion coefficients from the time-dependent wavepacket diffusion method

    International Nuclear Information System (INIS)

    Zhong, Xinxin; Zhao, Yi; Cao, Jianshu

    2014-01-01

    The time-dependent wavepacket diffusion method for carrier quantum dynamics (Zhong and Zhao 2013 J. Chem. Phys. 138 014111), a truncated version of the stochastic Schrödinger equation/wavefunction approach that approximately satisfies the detailed balance principle and scales well with the size of the system, is applied to investigate the carrier transport in one-dimensional systems including both the static and dynamic disorders on site energies. The predicted diffusion coefficients with respect to temperature successfully bridge from band-like to hopping-type transport. As demonstrated in paper I (Moix et al 2013 New J. Phys. 15 085010), the static disorder tends to localize the carrier, whereas the dynamic disorder induces carrier dynamics. For the weak dynamic disorder, the diffusion coefficients are temperature-independent (band-like property) at low temperatures, which is consistent with the prediction from the Redfield equation, and a linear dependence of the coefficient on temperature (hopping-type property) only appears at high temperatures. In the intermediate regime of dynamic disorder, the transition from band-like to hopping-type transport can be easily observed at relatively low temperatures as the static disorder increases. When the dynamic disorder becomes strong, the carrier motion can follow the hopping-type mechanism even without static disorder. Furthermore, it is found that the memory time of dynamic disorder is an important factor in controlling the transition from the band-like to hopping-type motions. (paper)

  16. Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

    Science.gov (United States)

    Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

    2014-03-01

    Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

  17. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  18. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  19. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  20. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  1. Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

    Directory of Open Access Journals (Sweden)

    Goyal M.

    2017-12-01

    Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

  2. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  3. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  4. TAF(II)170 interacts with the concave surface of TATA-binding protein to inhibit its DNA binding activity.

    Science.gov (United States)

    Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T

    2001-11-01

    The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.

  5. Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2001-01-01

    in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

  6. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  7. Study of surface modifications for improved selected metal (II-VI) semiconductor based devices

    Science.gov (United States)

    Blomfield, Christopher James

    Metal-semiconductor contacts are of fundamental importance to the operation of all semiconductor devices. There are many competing theories of Schottky barrier formation but as yet no quantitative predictive model exists to adequately explain metal-semiconductor interfaces. The II-VI compound semiconductors CdTe, CdS and ZnSe have recently come to the fore with the advent of high efficiency photovoltaic cells and short wavelength light emitters. Major problems still exist however in forming metal contacts to these materials with the desired properties. This work presents results which make a significant contribution to the theory of metal/II-VI interface behaviour in terms of Schottky barriers to n-type CdTe, CdS and ZnSe.Predominantly aqueous based wet chemical etchants were applied to the surfaces of CdTe, CdS and ZnSe which were subsequently characterised by X-ray photoelectron spectroscopy. The ionic nature of these II-VI compounds meant that they behaved as insoluble salts of strong bases and weak acids. Acid etchants induced a stoichiometric excess of semiconductor anion at the surface which appeared to be predominantly in the elemental or hydrogenated state. Alkaline etchants conversely induced a stoichiometric excess of semiconductor cation at the surface which appeared to be in an oxidised state.Metal contacts were vacuum-evaporated onto these etched surfaces and characterised by current-voltage and capacitance-voltage techniques. The surface preparation was found to have a clear influence upon the electrical properties of Schottky barriers formed to etched surfaces. Reducing the native surface oxide produced near ideal Schottky diodes. An extended study of Au, Ag and Sb contacts to [mathematical formula] substrates again revealed the formation of several discrete Schottky barriers largely independent of the metal used; for [mathematical formula]. Deep levels measured within this study and those reported in the literature led to the conclusion that Fermi

  8. Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

    Science.gov (United States)

    Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

    2010-01-01

    This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

  9. Investigation on a TEA-CO II laser with surface corona pre-ionization

    Science.gov (United States)

    Behjat, A.; Aram, M.; Soltanmoradi, F.; Shabanzadeh, M.

    2006-05-01

    The construction of a surface corona UV pre-ionized TEA CO II laser is described and dependence of its average output energy of the laser to gas mixture, discharge voltage and repetition rate is investigated. The electric circuit diagram and geometry of the pre-ionization system are presented. Configuration of circuit has been designed to produce only impulsive voltage difference between the laser electrodes. Also, the triggering configuration of trigatron is prepared for fast operation to minimize the arc occurrence as much as possible. Some data of current, voltage, laser pulses and average output energy versus gas mixture and applied voltages are given. IR spectrometer is used for measurements of central output wavelength of the laser. Operation of the laser on two adjacent vibrational-rotational transitions of CO II molecule has been observed that shows the ability of this laser for working on multi-line in a same time for special applications.

  10. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  11. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Development of CDMS-II Surface Event Rejection Techniques and Their Extensions to Lower Energy Thresholds

    Energy Technology Data Exchange (ETDEWEB)

    Hofer, Thomas James [Univ. of Minnesota, Minneapolis, MN (United States)

    2014-12-01

    The CDMS-II phase of the Cryogenic Dark Matter Search, a dark matter direct-detection experiment, was operated at the Soudan Underground Laboratory from 2003 to 2008. The full payload consisted of 30 ZIP detectors, totaling approximately 1.1 kg of Si and 4.8 kg of Ge, operated at temperatures of 50 mK. The ZIP detectors read out both ionization and phonon pulses from scatters within the crystals; channel segmentation and analysis of pulse timing parameters allowed e ective ducialization of the crystal volumes and background rejection su cient to set world-leading limits at the times of their publications. A full re-analysis of the CDMS-II data was motivated by an improvement in the event reconstruction algorithms which improved the resolution of ionization energy and timing information. The Ge data were re-analyzed using three distinct background-rejection techniques; the Si data from runs 125 - 128 were analyzed for the rst time using the most successful of the techniques from the Ge re-analysis. The results of these analyses prompted a novel \\mid-threshold" analysis, wherein energy thresholds were lowered but background rejection using phonon timing information was still maintained. This technique proved to have signi cant discrimination power, maintaining adequate signal acceptance and minimizing background leakage. The primary background for CDMS-II analyses comes from surface events, whose poor ionization collection make them di cult to distinguish from true nuclear recoil events. The novel detector technology of SuperCDMS, the successor to CDMS-II, uses interleaved electrodes to achieve full ionization collection for events occurring at the top and bottom detector surfaces. This, along with dual-sided ionization and phonon instrumentation, allows for excellent ducialization and relegates the surface-event rejection techniques of CDMS-II to a secondary level of background discrimination. Current and future SuperCDMS results hold great promise for mid- to low

  13. Surface reaction of SnII on goethite (α-FeOOH): surface complexation, redox reaction, reductive dissolution, and phase transformation.

    Science.gov (United States)

    Dulnee, Siriwan; Scheinost, Andreas C

    2014-08-19

    To elucidate the potential risk of (126)Sn migration from nuclear waste repositories, we investigated the surface reactions of Sn(II) on goethite as a function of pH and Sn(II) loading under anoxic condition with O2 level redox state and surface structure were investigated by Sn K edge X-ray absorption spectroscopy (XAS), goethite phase transformations were investigated by high-resolution transmission electron microscopy and selected area electron diffraction. The results demonstrate the rapid and complete oxidation of Sn(II) by goethite and formation of Sn(IV) (1)E and (2)C surface complexes. The contribution of (2)C complexes increases with Sn loading. The Sn(II) oxidation leads to a quantitative release of Fe(II) from goethite at low pH, and to the precipitation of magnetite at higher pH. To predict Sn sorption, we applied surface complexation modeling using the charge distribution multisite complexation approach and the XAS-derived surface complexes. Log K values of 15.5 ± 1.4 for the (1)E complex and 19.2 ± 0.6 for the (2)C complex consistently predict Sn sorption across pH 2-12 and for two different Sn loadings and confirm the strong retention of Sn(II) even under anoxic conditions.

  14. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  15. Operable Unit 3-13, Group 3, Other Surface Soils (Phase II) Field Sampling Plan

    Energy Technology Data Exchange (ETDEWEB)

    G. L. Schwendiman

    2006-07-27

    This Field Sampling Plan describes the Operable Unit 3-13, Group 3, Other Surface Soils, Phase II remediation field sampling activities to be performed at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory Site. Sampling activities described in this plan support characterization sampling of new sites, real-time soil spectroscopy during excavation, and confirmation sampling that verifies that the remedial action objectives and remediation goals presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13 have been met.

  16. Surface morphology and molecular bonding of CaCO3 nanocrystallites by gas diffusion method

    Science.gov (United States)

    Sulimai, N. H.; Rani, Rozina Abdul; Khusaimi, Z.; Abdullah, S.; Salifairus, M. J.; Alrokayan, Salman; Khan, Haseeb; Rusop, M.

    2018-05-01

    Calcium carbonate with the chemical formula of (CaCO3) is the most abundant element in the world. Its usage on certain applications is largely affected by its properties. The best means to control its properties is through controlled preparation of CaCO3. This study uses diffusion method between the precursors Calcium Chloride and Ammonium Carbonate. Instead of using water, ethanol was used to prepare the salt. Reaction was done in room temperature (RT) for 6h-24h. Smallest average crystallite size measured by FESEM micrograph is 500nm produced by synthesis of CaCO3 reacted for 168 hours. From energy-dispersive X-ray spectrum also indicated the smallest particle size is by CaCO3 reacted for 168 hours. Changes was seen for element Ca at 3.7keV.

  17. Diffusion of Tritiated Water (HTO) and 22Na+-Ions through Non-Degraded Hardened Cement Pastes - II. Modelling Results

    International Nuclear Information System (INIS)

    Jakob, A.

    2002-12-01

    In this report, the procedure and the results of an inverse modelling study on the through-diffusion of tritiated water (HTO) and 2 2Na + -ions are presented using high-porous hardened cement pastes with a water/cement ratio of 1.3 in the first stage of the cement degradation. For the analysis two alternative models were applied: 1) a diffusion model where a possible sorption of the tracer was entirely neglected, and 2) a diffusion model with linear sorption. The analysis of the through-diffusion phase allowed extracting values for the effective diffusion coefficient (D e ) and the rock-capacity factor (α). Both models could fit the breakthrough curves equally well, and also mass-balance considerations did not allow to clearly preferring one of the two competing models to the other. But blind-predictions for tracer out-diffusion using the best-fit parameter values deduced from analysing the former through-diffusion phase gave a clear indication that linear sorption had to be included in the diffusion model. The extracted K d values for HTO are in excellent agreement with values from batch sorption experiments and are of the order of 0.8. 10 -3 m 3 /kg. Those for 2 2Na + are of the order of 1.0. 10 -3 m 3 /kg and are by a factor of two larger than values from batch sorption experiments. The values for the effective diffusion coefficients for HTO are of the order of (2-3).10 -1 0 m 2 /s, and those for sodium are roughly by a factor of two smaller than values for HTO. On the one hand, the observed tracer uptake could only partially be addressed to isotope exchange; the most obvious process which could account for the remaining part of the uptaken tracer mass is diffusion into a second type of porosity, the dead-end pores. On the other hand, the results and conclusions drawn are encouraging for future investigations; therefore no major deficiency concerning the applied equipment and the modelling methodology could be detected. In the report, however, some suggestions

  18. Reconstructing solar magnetic fields from historical observations. II. Testing the surface flux transport model

    Science.gov (United States)

    Virtanen, I. O. I.; Virtanen, I. I.; Pevtsov, A. A.; Yeates, A.; Mursula, K.

    2017-07-01

    Aims: We aim to use the surface flux transport model to simulate the long-term evolution of the photospheric magnetic field from historical observations. In this work we study the accuracy of the model and its sensitivity to uncertainties in its main parameters and the input data. Methods: We tested the model by running simulations with different values of meridional circulation and supergranular diffusion parameters, and studied how the flux distribution inside active regions and the initial magnetic field affected the simulation. We compared the results to assess how sensitive the simulation is to uncertainties in meridional circulation speed, supergranular diffusion, and input data. We also compared the simulated magnetic field with observations. Results: We find that there is generally good agreement between simulations and observations. Although the model is not capable of replicating fine details of the magnetic field, the long-term evolution of the polar field is very similar in simulations and observations. Simulations typically yield a smoother evolution of polar fields than observations, which often include artificial variations due to observational limitations. We also find that the simulated field is fairly insensitive to uncertainties in model parameters or the input data. Due to the decay term included in the model the effects of the uncertainties are somewhat minor or temporary, lasting typically one solar cycle.

  19. Poisson-Nernst-Planck Equations for Simulating Biomolecular Diffusion-Reaction Processes II: Size Effects on Ionic Distributions and Diffusion-Reaction Rates

    Science.gov (United States)

    Lu, Benzhuo; Zhou, Y.C.

    2011-01-01

    The effects of finite particle size on electrostatics, density profiles, and diffusion have been a long existing topic in the study of ionic solution. The previous size-modified Poisson-Boltzmann and Poisson-Nernst-Planck models are revisited in this article. In contrast to many previous works that can only treat particle species with a single uniform size or two sizes, we generalize the Borukhov model to obtain a size-modified Poisson-Nernst-Planck (SMPNP) model that is able to treat nonuniform particle sizes. The numerical tractability of the model is demonstrated as well. The main contributions of this study are as follows. 1), We show that an (arbitrarily) size-modified PB model is indeed implied by the SMPNP equations under certain boundary/interface conditions, and can be reproduced through numerical solutions of the SMPNP. 2), The size effects in the SMPNP effectively reduce the densities of highly concentrated counterions around the biomolecule. 3), The SMPNP is applied to the diffusion-reaction process for the first time, to our knowledge. In the case of low substrate density near the enzyme reactive site, it is observed that the rate coefficients predicted by SMPNP model are considerably larger than those by the PNP model, suggesting both ions and substrates are subject to finite size effects. 4), An accurate finite element method and a convergent Gummel iteration are developed for the numerical solution of the completely coupled nonlinear system of SMPNP equations. PMID:21575582

  20. Heater test planning for the Near Surface Test Facility at the Hanford reservation. Volume II. Appendix

    International Nuclear Information System (INIS)

    DuBois, A.; Binnall, E.; Chan, T.; McEvoy, M.; Nelson, P.; Remer, J.

    1979-04-01

    Volume II contains the following information: theoretical support for radioactive waste storage projects - development of data analysis methods and numerical models; injectivity temperature profiling as a means of permeability characterization; geophysical holes at the Near Surface Test Facility (NSTF), Hanford; proposed geophysical and hydrological measurements at NSTF; suggestions for characterization of the discontinuity system at NSTF; monitoring rock property changes caused by radioactive waste storage using the electrical resistivity method; microseismic detection system for heated rock; Pasco Basin groundwater contamination study; a letter to Mark Board on Gable Mountain Faulting; report on hydrofracturing tests for in-situ stress measurement, NSTF, Hole DC-11, Hanford Reservation; and borehole instrumentation layout for Hanford Near Surface Test Facility

  1. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  2. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  3. Surface complexation modeling of Cu(II adsorption on mixtures of hydrous ferric oxide and kaolinite

    Directory of Open Access Journals (Sweden)

    Schaller Melinda S

    2008-09-01

    Full Text Available Abstract Background The application of surface complexation models (SCMs to natural sediments and soils is hindered by a lack of consistent models and data for large suites of metals and minerals of interest. Furthermore, the surface complexation approach has mostly been developed and tested for single solid systems. Few studies have extended the SCM approach to systems containing multiple solids. Results Cu adsorption was measured on pure hydrous ferric oxide (HFO, pure kaolinite (from two sources and in systems containing mixtures of HFO and kaolinite over a wide range of pH, ionic strength, sorbate/sorbent ratios and, for the mixed solid systems, using a range of kaolinite/HFO ratios. Cu adsorption data measured for the HFO and kaolinite systems was used to derive diffuse layer surface complexation models (DLMs describing Cu adsorption. Cu adsorption on HFO is reasonably well described using a 1-site or 2-site DLM. Adsorption of Cu on kaolinite could be described using a simple 1-site DLM with formation of a monodentate Cu complex on a variable charge surface site. However, for consistency with models derived for weaker sorbing cations, a 2-site DLM with a variable charge and a permanent charge site was also developed. Conclusion Component additivity predictions of speciation in mixed mineral systems based on DLM parameters derived for the pure mineral systems were in good agreement with measured data. Discrepancies between the model predictions and measured data were similar to those observed for the calibrated pure mineral systems. The results suggest that quantifying specific interactions between HFO and kaolinite in speciation models may not be necessary. However, before the component additivity approach can be applied to natural sediments and soils, the effects of aging must be further studied and methods must be developed to estimate reactive surface areas of solid constituents in natural samples.

  4. Response surface methodology optimization of nickel (II) removal using pigeon pea pod bio sorbent

    International Nuclear Information System (INIS)

    Aravind, J.; Lenin, C.; Nancyflavia, C.; Rashika, P.; Saravanan, S.

    2015-01-01

    Pod of pigeon pea (Cajanus cajan), a cellulose rich agricultural residue, was investigated for its nickel binding efficiency. The influence of key physicochemical parameters such as contact time, initial metal ion concentration, adsorbent dosage and p H on nickel (II) removal was studied. The equilibrium time was found to be 45 min. The optimum Ni (II) removal was obtained at an initial metal ion concentration of 80 mg/l, p H of 9.0 and an adsorbent dose of 400 mg/100 ml. A search for optimal combination of key variables was studied by response surface methodology for maximum removal of nickel. The experiment encompassing 17 runs was established with the aid of Box–Behnken design. Owing to the reasonable agreement between predicted and adjusted R2 value (0.9714), the corresponding quadratic model gives the most appropriate relationship between the variables and response. The optimal point obtained was located in the valid region and the optimum adsorption parameters were predicted as an initial Ni (II) concentration of 60 mg/l, p H value of 9.0 and contact time of 75 min. Under these adsorption conditions, a maximum removal of 96.54 % of initial metal concentration was demonstrated.

  5. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  6. Surface tension phenomena in the xylem sap of three diffuse porous temperate tree species

    Science.gov (United States)

    K. K. Christensen-Dalsgaard; M. T. Tyree; P. G. Mussone

    2011-01-01

    In plant physiology models involving bubble nucleation, expansion or elimination, it is typically assumed that the surface tension of xylem sap is equal to that of pure water, though this has never been tested. In this study we collected xylem sap from branches of the tree species Populus tremuloides, Betula papyrifera and Sorbus...

  7. Modification of the glass surface induced by redox reactions and internal diffusion processes

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    In this paper we report a novel way to modify the glass surface in favor of some physical performances. The main step is to perform iso-thermal treatments on the selected silicate glasses containing transition metal at temperatures near the glass transition temperature for various durations under...

  8. Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

    Directory of Open Access Journals (Sweden)

    H. Hammami

    2017-08-01

    Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

  9. Synthesis and application of surface-imprinted activated carbon sorbent for solid-phase extraction and determination of copper (II)

    Science.gov (United States)

    Li, Zhenhua; Li, Jingwen; Wang, Yanbin; Wei, Yajun

    2014-01-01

    A new Cu(II)-imprinted amino-functionalized activated carbon sorbent was prepared by a surface imprinting technique for selective solid-phase extraction (SPE) of Cu(II) prior to its determination by inductively coupled plasma atomic emission spectrometry (ICP-AES). Experimental conditions for effective adsorption of Cu(II) were optimized with respect to different experimental parameters using static and dynamic procedures in detail. Compared with non-imprinted sorbent, the ion-imprinted sorbent had higher selectivity and adsorption capacity for Cu(II). The maximum static adsorption capacity of the ion-imprinted and non-imprinted sorbent for Cu(II) was 26.71 and 6.86 mg g-1, respectively. The relatively selectivity factor values (αr) of Cu(II)/Zn(II), Cu(II)/Ni(II), Cu(II)/Co(II) and Cu(II)/Pb(II) were 166.16, 50.77, 72.26 and 175.77, respectively, which were greater than 1. Complete elution of the adsorbed Cu(II) from Cu(II)-imprinted sorbent was carried out using 2 mL of 0.1 mol L-1 EDTA solution. The relative standard deviation of the method was 2.4% for eleven replicate determinations. The method was validated for the analysis by two certified reference materials (GBW 08301, GBW 08303), the results obtained is in good agreement with standard values. The developed method was also successfully applied to the determination of trace copper in natural water samples with satisfactory results.

  10. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  11. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  12. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  13. Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

    Energy Technology Data Exchange (ETDEWEB)

    Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

    2009-07-01

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  14. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  15. Effect of TiO{sub 2} additive on the sintering of nuclear fuel (U,Pu)O{sub 2}. Contribution of surface diffusion to plutonium distribution; Influence de l`ajout de TiO{sub 2} sur l`aptitude au frittage du combustible nucleaire (U,Pu)O{sub 2}. Contribution de la diffusion de surface a la repartition du plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Bremier, Stephane [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)

    1997-12-19

    This thesis has as objective the study of the effect of TiO{sub 2} additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO{sub 2} in the presence of TiO{sub 2} has been established and the influence of the PuO{sub 2} distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO{sub 2} and UO{sub 2}-PuO{sub 2}. The results concerning the influence of TiO{sub 2} upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO{sub 2} alone or in the presence of TiO{sub 2} are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO{sub 2}-PuO{sub 2} preparation upon the initial microstructure of the materials and the role played by the PuO{sub 2} grains in sintering. The potentiality of surface diffusion as a means of PuO{sub 2} spreading in the UO{sub 2} is evaluated and correlated with the reduced capacity of sintering the UO{sub 2} ceramics containing PuO{sub 2}. The last chapter deals with the influence of TiO{sub 2} on the development of microstructure in UO{sub 2}-PuO{sub 2} ceramics. While at temperatures below 1500 deg.C the TiO{sub 2} additive affects the surface diffusion and so the plutonium distribution, at values T{>=} 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO{sub 2}, PuO{sub 2} and titanium oxide. Thus the objective is

  16. Mode-coupling theory of self-diffusion in diblock copolymers. II. Model calculations and experimental comparisons

    International Nuclear Information System (INIS)

    Guenza, M.; Schweizer, K.S.

    1998-01-01

    The predictions of polymer-mode-coupling theory for self-diffusion in entangled structurally and interaction symmetric diblock copolymer fluids are illustrated by explicit numerical calculations. We find that retardation of translational motion emerges near and somewhat below the order endash disorder transition (ODT) in an approximately exponential and/or thermally activated manner. At fixed reduced temperature, suppression of diffusion is enhanced with increasing diblock molecular weight, compositional symmetry, and/or copolymer concentration. At very low temperatures, a new entropic-like regime of mobility suppression is predicted based on an isotropic supercooled liquid description of the copolymer structure. Preliminary generalization of the theory to treat diblock tracer diffusion is also presented. Quantitative applications to recent self and tracer diffusion measurements on compositionally symmetric polyolefin diblock materials have been carried out, and very good agreement between theory and experiment is found. Asymmetry in block local friction constants is predicted to significantly influence mobility suppression, with the largest effects occurring when the minority block is also the high friction species. New experiments to further test the predictions of the theory are suggested. copyright 1998 American Institute of Physics

  17. Ocular surface changes in type II diabetic patients with proliferative diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Yan Gao

    2015-04-01

    Full Text Available AIM: To detect and analyze the changes on ocular surface and tear function in type II diabetic patients with proliferative diabetic retinopathy (PDR, an advanced stage of diabetic retinopathy (DR, using conventional ophthalmic tests and the high-resolution laser scanning confocal microscopy. METHODS: Fifty-eight patients with type II diabetes were selected. Based on the diagnostic criteria and stage classification of DR, the patients were divided into the non-DR (NDR group and the PDR group. Thirty-six patients with cataract but no other ocular and systemic disease were included as non-diabetic controls. All the patients were subjected to the conventional clinical tests of corneal sensitivity, Schirmer I Test, and corneal fluorescein staining. The non-invasive tear film break-up time (NIBUT and tear interferometry were conducted by a Tearscope Plus. The morphology of corneal epithelia and nerve fibers was examined using the high-resolution confocal microscopy. RESULTS: The NDR group exhibited significantly declined corneal sensitivity and Schirmer I test value, as compared to the non-diabetic controls (P< 0.001. The PDR group showed significantly reduced corneal sensitivity, Schirmer I test value, and NIBUT in comparison to the non-diabetic controls (P < 0.001. Corneal fluorescein staining revealed the progressively injured corneal epithelia in the PDR patients. Moreover, significant decrease in the corneal epithelial density and morphological abnormalities in the corneal epithelia and nerve fibers were also observed in the PDR patients. CONCLUSION: Ocular surface changes, including blunted corneal sensitivity, reduced tear secretion, tear film dysfunction, progressive loss of corneal epithelia and degeneration of nerve fibers, are common in type II diabetic patients, particularly in the diabetic patients with PDR. The corneal sensitivity, fluorescein staining scores, and the density of corneal epithelial cells and nerve fibers in the diabetic

  18. Ocular surface changes in type II diabetic patients with proliferative diabetic retinopathy

    Institute of Scientific and Technical Information of China (English)

    Yan; Gao; Yan; Zhang; Yu-Sha; Ru; Xiao-Wu; Wang; Ji-Zhong; Yang; Chun-Hui; Li; Hong-Xing; Wang; Xiao-Rong; Li; Bing; Li

    2015-01-01

    AIM: To detect and analyze the changes on ocular surface and tear function in type II diabetic patients with proliferative diabetic retinopathy(PDR), an advanced stage of diabetic retinopathy(DR), using conventional ophthalmic tests and the high-resolution laser scanning confocal microscopy.METHODS: Fifty-eight patients with type II diabetes were selected. Based on the diagnostic criteria and stage classification of DR, the patients were divided into the non-DR(NDR) group and the PDR group. Thirty-six patients with cataract but no other ocular and systemic disease were included as non-diabetic controls. All the patients were subjected to the conventional clinical tests of corneal sensitivity, Schirmer I test, and corneal fluorescein staining. The non-invasive tear film break-up time(NIBUT) and tear interferometry were conducted by a Tearscope Plus. The morphology of corneal epithelia and nerve fibers was examined using the high-resolution confocal microscopy.RESULTS: The NDR group exhibited significantly declined corneal sensitivity and Schirmer I test value, as compared to the non-diabetic controls(P <0.001). The PDR group showed significantly reduced corneal sensitivity, Schirmer I test value, and NIBUT in comparison to the non-diabetic controls(P <0.001).Corneal fluorescein staining revealed the progressively injured corneal epithelia in the PDR patients. Moreover,significant decrease in the corneal epithelial density andmorphological abnormalities in the corneal epithelia and nerve fibers were also observed in the PDR patients.CONCLUSION: Ocular surface changes, including blunted corneal sensitivity, reduced tear secretion, tear film dysfunction, progressive loss of corneal epithelia and degeneration of nerve fibers, are common in type II diabetic patients, particularly in the diabetic patients with PDR. The corneal sensitivity, fluorescein staining scores,and the density of corneal epithelial cells and nerve fibers in the diabetic patients correlate with the

  19. Field limit and nano-scale surface topography of superconducting radio-frequency cavity made of extreme type II superconductor

    OpenAIRE

    Kubo, Takayuki

    2014-01-01

    The field limit of superconducting radio-frequency cavity made of type II superconductor with a large Ginzburg-Landau parameter is studied with taking effects of nano-scale surface topography into account. If the surface is ideally flat, the field limit is imposed by the superheating field. On the surface of cavity, however, nano-defects almost continuously distribute and suppress the superheating field everywhere. The field limit is imposed by an effective superheating field given by the pro...

  20. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  1. Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)

    2014-07-01

    Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.

  2. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  3. A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

    Science.gov (United States)

    Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

    2017-07-01

    Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

  4. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  5. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  6. Investigation of detection limits for diffuse optical tomography systems: II. Analysis of slab and cup geometry for breast imaging.

    Science.gov (United States)

    Ziegler, Ronny; Brendel, Bernhard; Rinneberg, Herbert; Nielsen, Tim

    2009-01-21

    Using a statistical (chi-square) test on simulated data and a realistic noise model derived from the system's hardware we study the performance of diffuse optical tomography systems for fluorescence imaging. We compare the predicted smallest size of detectable lesions at various positions in slab and cup geometry and model how detection sensitivity depends on breast compression and lesion fluorescence contrast. Our investigation shows that lesion detection is limited by relative noise in slab geometry and by absolute noise in cup geometry.

  7. Sorption and catalytic oxidation of Fe(II) at the surface of calcite

    NARCIS (Netherlands)

    Mettler, S.; Wolthers, M.; Charlet, L.; Von Gunten, U.

    The effect of sorption and coprecipitation of Fe(II) with calcite on the kinetics of Fe(II) oxidation was investigated. The interaction of Fe(II) with calcite was studied experimentally in the absence and presence of oxygen. The sorption of Fe(II) on calcite occurred in two distinguishable steps:

  8. Adsorption of Zn(II) on the kaolinite(001) surfaces in aqueous environment: A combined DFT and molecular dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qiang; Kong, Xiang-Ping; Zhang, Bao-Hua; Wang, Juan, E-mail: juaner80@163.com

    2017-08-31

    Highlights: • Zn(II) adsorption on two types of neutral kaolinite(001) surfaces is investigated. • Surface “Ou” is found the preferred site for mono- and bi-dentate complexes. • Both Zn(II) and surface oxygen accept electrons from aqua oxygens. • Coupling of O 2p with Zn sp{sup 3}d{sup 2} (or sp{sup 3}) hybridization states is the bonding nature. - Abstract: Adsorption of Zn(II) on two types of neutral (001) surfaces of kaolinite, tetrahedral Si(t) and octahedral Al(o), was studied by means of DFT calculations and classical molecular dynamics simulations. The position and structure for both outer-sphere and mono-/bi-dentate inner-sphere complexes of Zn(II) in aqueous environment were examined, with binding energy and radial distribution function calculated. Outer-sphere complex on the Si(t) surface, monodentate inner-sphere complex of “O{sub u}” (surface oxygen with “upright” hydrogen) site and bidentate complex of “O{sub u}-O{sub u}” site of neighboring Al centers on the Al(o) surface are considered to be the dominant adsorption species. The outer-sphere complex is found six-coordinated with distorted octahedral geometry, while both the inner-sphere complexes exhibit the tetrahedral structure with coordination number of four. Hydrogen bonding interactions between oxygen or hydrogen of the kaolinite(001) surfaces and the aqua ligands of Zn(II) act as the key role for the structure and stability of adsorption complexes. Upon the Mulliken population analysis and partial density of states, both Zn(II) and surface oxygen accept electrons from aqua oxygens, and coupling of O 2p with the sp{sup 3}d{sup 2} or sp{sup 3} hybridization states of Zn(II) is the primary bonding nature of Zn(II) with oxygen in outer- and inner-sphere complexes, respectively.

  9. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  10. Adsorption of lead(II) and copper(II) on activated carbon by complexation with surface functional groups

    International Nuclear Information System (INIS)

    Pesavento, Maria; Profumo, Antonella; Alberti, Giancarla; Conti, Fabio

    2003-01-01

    The adsorption of lead(II) and copper(II) on an activated carbon (Filtrasorb 300, Chemviron) was characterized assuming that it takes place by formation of complexes with functional groups, present in the activated carbon. Their concentration and conditional adsorption coefficients were determined for each metal by titration of the carbon in suspension in aqueous phase, at constant acidity, with the metal itself. For each titration point, the concentration of the metal in the solution phase after equilibration was determined, and the data were processed by the Ruzic linearization method, to obtain the concentration of the active sites involved in the sorption, and the conditional constant. The effect of the pH was also examined, in the range 4-6, obtaining that the adsorption increases at increasing pH. The protonation and adsorption constants were determined from the conditional adsorption coefficients obtained at the different acidities. The concentration of the active sites is 0.023 and 0.042 mmol g -1 , and the protonation constants are 1.0x10 6 and 4.6x10 4 M -1 for Pb(II) and Cu(II). The corresponding adsorption constants are respectively 1.4x10 5 and 6.3x10 3 M -1 . All the parameters are affected by a large uncertainty, probably due to the heterogeneity of the active groups in the activated carbon. Even if so, these parameters make it possible a good prediction of the adsorption in a wide range of conditions. Other sorption mechanism can be set up at different conditions, in particular at different pH, as it has been demonstrated in the case of copper(II)

  11. Adsorption of lead(II) and copper(II) on activated carbon by complexation with surface functional groups

    Energy Technology Data Exchange (ETDEWEB)

    Pesavento, Maria; Profumo, Antonella; Alberti, Giancarla; Conti, Fabio

    2003-03-17

    The adsorption of lead(II) and copper(II) on an activated carbon (Filtrasorb 300, Chemviron) was characterized assuming that it takes place by formation of complexes with functional groups, present in the activated carbon. Their concentration and conditional adsorption coefficients were determined for each metal by titration of the carbon in suspension in aqueous phase, at constant acidity, with the metal itself. For each titration point, the concentration of the metal in the solution phase after equilibration was determined, and the data were processed by the Ruzic linearization method, to obtain the concentration of the active sites involved in the sorption, and the conditional constant. The effect of the pH was also examined, in the range 4-6, obtaining that the adsorption increases at increasing pH. The protonation and adsorption constants were determined from the conditional adsorption coefficients obtained at the different acidities. The concentration of the active sites is 0.023 and 0.042 mmol g{sup -1}, and the protonation constants are 1.0x10{sup 6} and 4.6x10{sup 4} M{sup -1} for Pb(II) and Cu(II). The corresponding adsorption constants are respectively 1.4x10{sup 5} and 6.3x10{sup 3} M{sup -1}. All the parameters are affected by a large uncertainty, probably due to the heterogeneity of the active groups in the activated carbon. Even if so, these parameters make it possible a good prediction of the adsorption in a wide range of conditions. Other sorption mechanism can be set up at different conditions, in particular at different pH, as it has been demonstrated in the case of copper(II)

  12. AN IN-DEPTH VIEW OF THE MID-INFRARED PROPERTIES OF POINT SOURCES AND THE DIFFUSE ISM IN THE SMC GIANT H II REGION, N66

    International Nuclear Information System (INIS)

    Whelan, David G.; Johnson, Kelsey E.; Indebetouw, Rémy; Lebouteiller, Vianney; Galliano, Frédéric; Peeters, Els; Bernard-Salas, Jeronimo; Brandl, Bernhard R.

    2013-01-01

    The focus of this work is to study mid-infrared point sources and the diffuse interstellar medium (ISM) in the low-metallicity (∼0.2 Z ☉ ) giant H II region N66 in order to determine properties that may shed light on star formation in these conditions. Using the Spitzer Space Telescope's Infrared Spectrograph, we study polycyclic aromatic hydrocarbon (PAH), dust continuum, silicate, and ionic line emission from 14 targeted infrared point sources as well as spectra of the diffuse ISM that is representative of both the photodissociation regions (PDRs) and the H II regions. Among the point source spectra, we spectroscopically confirm that the brightest mid-infrared point source is a massive embedded young stellar object, we detect silicates in emission associated with two young stellar clusters, and we see spectral features of a known B[e] star that are commonly associated with Herbig Be stars. In the diffuse ISM, we provide additional evidence that the very small grain population is being photodestroyed in the hard radiation field. The 11.3 μm PAH complex emission exhibits an unexplained centroid shift in both the point source and ISM spectra that should be investigated at higher signal-to-noise and resolution. Unlike studies of other regions, the 6.2 μm and 7.7 μm band fluxes are decoupled; the data points cover a large range of I 7.7 /I 11.3 PAH ratio values within a narrow band of I 6.2 /I 11.3 ratio values. Furthermore, there is a spread in PAH ionization, being more neutral in the dense PDR where the radiation field is relatively soft, but ionized in the diffuse ISM/PDR. By contrast, the PAH size distribution appears to be independent of local ionization state. Important to unresolved studies of extragalactic low-metallicity star-forming regions, we find that emission from the infrared-bright point sources accounts for only 20%-35% of the PAH emission from the entire region. These results make a comparative data set to other star-forming regions with

  13. Improved age-diffusion model for low-energy electron transport in solids. II. Application to secondary emission from aluminum

    International Nuclear Information System (INIS)

    Dubus, A.; Devooght, J.; Dehaes, J.C.

    1987-01-01

    The ''improved age-diffusion'' model for secondary-electron transport is applied to aluminum. Electron cross sections for inelastic collisions with the free-electron gas using the Lindhard dielectric function and for elastic collisions with the randomly distributed ionic cores are used in the calculations. The most important characteristics of backward secondary-electron emission induced by low-energy electrons on polycrystalline Al targets are calculated and compared to experimental results and to Monte Carlo calculations. The model appears to predict the electronic yield, the energy spectra, and the spatial dependence of secondary emission with reasonable accuracy

  14. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  15. Theoretical study of heavy metal Cd, Cu, Hg, and Ni(II) adsorption on the kaolinite(0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jian, E-mail: zhaojian0209@aliyun.com [Institute of Applied Physics and Computational Mathematics, PO Box 8009, Beijing 100088 (China); State Key Laboratory of Geomechanics and Deep Underground Engineering, China University of Mining and Technology, Beijing 100083 (China); He, Man-Chao [State Key Laboratory of Geomechanics and Deep Underground Engineering, China University of Mining and Technology, Beijing 100083 (China)

    2014-10-30

    Highlights: • We investigated the adsorption of Cd, Cu, Hg, and Ni(II) on kaolinite(0 0 1) surface. • The adsorption capabilities of the kaolinite for HM atoms were Ni > Cu > Cd > Hg(II). • The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms. • The adsorption energy decreases with the coverage for Ni(II) atoms. - Abstract: Heavy metal pollution is currently of great concern because it has been recognized as a potential threat to air, water, and soil. Adsorption was one of the most popular methods for the removal of heavy metal. The adsorption of heavy metal Cd, Cu, Hg, and Ni(II) atoms on the hydroxylated (0 0 1) surface of kaolinite was investigated using density-functional theory within the generalized gradient approximation and a supercell approach. The coverage dependence of the adsorption structures and energetics were systematically studied for a wide range of coverage Θ [from 0.11 to 1.0 monolayers (ML)] and adsorption sites. The most stable among all possible adsorption sites for Cd(II) atom was the two-fold bridge site followed by the one-fold top site, and the top site was the most favorite adsorption site for Cu and Ni(II) atoms, while the three-fold hollow site was the most stable adsorption site for Hg(II) atom followed by the two-fold bridge site. The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms, thus indicating the higher stability of surface adsorption and a tendency to the formation of adsorbate islands (clusters) with increasing the coverage. However, the adsorption energy of Ni(II) atoms decreases when increasing the coverage. The adsorption capabilities of the kaolinite clay for the heavy metal atoms were in the order of Ni > Cu > Cd > Hg(II). The other properties of the Cd, Cu, Hg, and Ni(II)/kaolinite(0 0 1) system including the different charge distribution, the lattice relaxation, and the electronic density of states were also studied and discussed in detail.

  16. Theoretical study of heavy metal Cd, Cu, Hg, and Ni(II) adsorption on the kaolinite(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhao, Jian; He, Man-Chao

    2014-01-01

    Highlights: • We investigated the adsorption of Cd, Cu, Hg, and Ni(II) on kaolinite(0 0 1) surface. • The adsorption capabilities of the kaolinite for HM atoms were Ni > Cu > Cd > Hg(II). • The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms. • The adsorption energy decreases with the coverage for Ni(II) atoms. - Abstract: Heavy metal pollution is currently of great concern because it has been recognized as a potential threat to air, water, and soil. Adsorption was one of the most popular methods for the removal of heavy metal. The adsorption of heavy metal Cd, Cu, Hg, and Ni(II) atoms on the hydroxylated (0 0 1) surface of kaolinite was investigated using density-functional theory within the generalized gradient approximation and a supercell approach. The coverage dependence of the adsorption structures and energetics were systematically studied for a wide range of coverage Θ [from 0.11 to 1.0 monolayers (ML)] and adsorption sites. The most stable among all possible adsorption sites for Cd(II) atom was the two-fold bridge site followed by the one-fold top site, and the top site was the most favorite adsorption site for Cu and Ni(II) atoms, while the three-fold hollow site was the most stable adsorption site for Hg(II) atom followed by the two-fold bridge site. The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms, thus indicating the higher stability of surface adsorption and a tendency to the formation of adsorbate islands (clusters) with increasing the coverage. However, the adsorption energy of Ni(II) atoms decreases when increasing the coverage. The adsorption capabilities of the kaolinite clay for the heavy metal atoms were in the order of Ni > Cu > Cd > Hg(II). The other properties of the Cd, Cu, Hg, and Ni(II)/kaolinite(0 0 1) system including the different charge distribution, the lattice relaxation, and the electronic density of states were also studied and discussed in detail

  17. Influence of vibrations and rotations of diatomic molecules on their physical properties: II. Refractive index, reactivity and diffusion coefficients

    International Nuclear Information System (INIS)

    Sharipov, Alexander S; Loukhovitski, Boris I; Starik, Alexander M

    2016-01-01

    The influence of the excitation of vibrational and rotational states of diatomic molecules (H 2 , N 2 , O 2 , NO, OH, CO, CH, HF and HCl) on refractive index, reactivity and transport coefficients was analyzed by using ab initio calculated data on the effective state-specific dipole moment and static polarizability obtained in the preceding paper of the present series. It has been revealed that, for non-polar molecules, the excitation both of vibrational and rotational degrees of freedom increases the averaged polarizability and, as a consequence, the refractive index. Meanwhile, for polar molecules, the effect of molecule excitation is more complex: it can either increase or decrease the refractive index. It was also shown that the excitation of molecules slightly influences the rate constants of barrierless chemical reactions between neutral particles; whereas, for ion–molecule reactions, this effect can be more pronounced. Analysis of the variation of diffusion coefficients, taking into account the effect of molecule excitation both on the collision diameter and on the well depth of intermolecular potential, exhibited that, for non-polar molecules, the effect associated with the change of collision diameter prevails. However, for polar molecules, the effect of the excitation of vibrational states on the well depth of intermolecular potential can compensate or even exceed the decrease of diffusion coefficient due to the averaged collision diameter rise. (paper)

  18. The charge effect on the hindrance factors for diffusion and convection of a solute in pores: II

    Energy Technology Data Exchange (ETDEWEB)

    Akinaga, Takeshi; O-tani, Hideyuki; Sugihara-Seki, Masako, E-mail: r091077@kansai-u.ac.jp [Department of Pure and Applied Physics, Kansai University, Yamate-cho, Suita, Osaka 564-8680 (Japan)

    2012-10-15

    The diffusion and convection of a solute suspended in a fluid across porous membranes are known to be reduced compared to those in a bulk solution, owing to the fluid mechanical interaction between the solute and the pore wall as well as steric restriction. If the solute and the pore wall are electrically charged, the electrostatic interaction between them could affect the hindrance to diffusion and convection. In this study, the transport of charged spherical solutes through charged circular cylindrical pores filled with an electrolyte solution containing small ions was studied numerically by using a fluid mechanical and electrostatic model. Based on a mean field theory, the electrostatic interaction energy between the solute and the pore wall was estimated from the Poisson-Boltzmann equation, and the charge effect on the solute transport was examined for the solute and pore wall of like charge. The results were compared with those obtained from the linearized form of the Poisson-Boltzmann equation, i.e. the Debye-Hueckel equation. (paper)

  19. Transitions to improved core electron heat confinement triggered by low order rational magnetic surfaces in the stellarator TJ-II

    International Nuclear Information System (INIS)

    Estrada, T.; Medina, F.; Lopez-Bruna, D.; AscasIbar, E.; BalbIn, R.; Cappa, A.; Castejon, F.; Eguilior, S.; Fernandez, A.; Guasp, J.; Hidalgo, C.; Petrov, S.

    2007-01-01

    Transitions to improved core electron heat confinement are triggered by low order rational magnetic surfaces in TJ-II electron cyclotron heated (ECH) plasmas. Experiments are performed changing the magnetic shear around the rational surface n = 3/m = 2 to study its influence on the transition; ECH power modulation is used to look at transport properties. The improvement in the electron heat confinement shows no obvious dependence on the magnetic shear. Transitions triggered by the rational surface n = 4/m = 2 show, in addition, an increase in the ion temperature synchronized with the increase in the electron temperature. Ion temperature changes had not been previously observed either in TJ-II or in any other helical device. SXR measurements demonstrate that, under certain circumstances, the rational surface positioned inside the plasma core region precedes and provides a trigger for the transition

  20. Past surface temperatures at the NorthGRIP drill site from the difference in firn diffusion of water isotopes

    DEFF Research Database (Denmark)

    Simonsen, Sebastian Bjerregaard; Johnsen, S. J.; Popp, T. J.

    2011-01-01

    A new ice core paleothermometer is introduced based on the temperature dependent diffusion of the stable water isotopes in the firn. A new parameter called differential diffusion length is defined as the difference between the diffusion length of the two stable water isotopologues 2H1H16O and 1H218......O. A model treatment of the diffusion process of the firn and the ice is presented along with a method of retrieving the diffusion signal from the ice core record of water isotopes using spectral methods. The model shows how the diffusion process is highly dependent on the inter-annual variations...... warmer than observed in other ice core based temperature reconstructions. The mechanisms behind this behaviour are not fully understood. The method shows the need of an expansion of high resolution stable water isotope datasets from ice cores. However, the new ice core paleothermometer presented here...

  1. Coverage dependent desorption dynamics of deuterium on Si(100) surfaces: interpretation with a diffusion-promoted desorption model.

    Science.gov (United States)

    Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A

    2005-01-08

    We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.

  2. Application of Fe(II)/peroxymonosulfate for improving ultrafiltration membrane performance in surface water treatment: Comparison with coagulation and ozonation.

    Science.gov (United States)

    Cheng, Xiaoxiang; Liang, Heng; Ding, An; Zhu, Xuewu; Tang, Xiaobin; Gan, Zhendong; Xing, Jiajian; Wu, Daoji; Li, Guibai

    2017-11-01

    Coagulation and ozonation have been widely used as pretreatments for ultrafiltration (UF) membrane in drinking water treatment. While beneficial, coagulation or ozonation alone is unable to both efficiently control membrane fouling and product water quality in many cases. Thus, in this study an emerging alternative of ferrous iron/peroxymonosulfate (Fe(II)/PMS), which can act as both an oxidant and a coagulant was employed prior to UF for treatment of natural surface water, and compared with conventional coagulation and ozonation. The results showed that the Fe(II)/PMS-UF system exhibited the best performance for dissolved organic carbon removal, likely due to the dual functions of coagulation and oxidation in the single process. The fluorescent and UV-absorbing organic components were more susceptible to ozonation than Fe(II)/PMS treatment. Fe(II)/PMS and ozonation pretreatments significantly increased the removal efficiency of atrazine, p-chloronitrobenzene and sulfamethazine by 12-76% and 50-94%, respectively, whereas coagulation exerted a minor influence. The Fe(II)/PMS pretreatment also showed the best performance for the reduction of both reversible and irreversible membrane fouling, and the performance was hardly affected by membrane pore size and surface hydrophobicity. In addition, the characterization of hydraulic irreversible organic foulants confirmed its effectiveness. These results demonstrate the potential advantages of applying Fe(II)/PMS as a pretreatment for UF to simultaneously control membrane fouling and improve the permeate quality. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Sunitinib in relapsed or refractory diffuse large B-cell lymphoma: a clinical and pharmacodynamic phase II multicenter study of the NCIC Clinical Trials Group.

    Science.gov (United States)

    Buckstein, Rena; Kuruvilla, John; Chua, Neil; Lee, Christina; Macdonald, David A; Al-Tourah, Abdulwahab J; Foo, Alison H; Walsh, Wendy; Ivy, S Percy; Crump, Michael; Eisenhauer, Elizabeth A

    2011-05-01

    There are limited effective therapies for most patients with relapsed diffuse large B-cell lymphoma (DLBCL). We conducted a phase II trial of the multi-targeted vascular endothelial growth factor receptor (VEGFR) kinase inhibitor, sunitinib, 37.5 mg given orally once daily in adult patients with relapsed or refractory DLBCL. Of 19 enrolled patients, 17 eligible patients were evaluable for toxicity and 15 for response. No objective responses were seen and nine patients achieved stable disease (median duration 3.4 months). As a result, the study was closed at the end of the first stage. Grades 3-4 neutropenia and thrombocytopenia were observed in 29% and 35%, respectively. There was no relationship between change in circulating endothelial cell numbers (CECs) and bidimensional tumor burden over time. Despite some activity in solid tumors, sunitinib showed no evidence of response in relapsed/refractory DLBCL and had greater than expected hematologic toxicity.

  4. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

    1985-06-01

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  5. IDH mutation is paradoxically associated with higher {sup 18}F-FDOPA PET uptake in diffuse grade II and grade III gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Verger, A. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Lorraine University, Department of Nuclear Medicine and Nancyclotep Imaging Platform, CHRU Nancy, Nancy (France); Lorraine University, IADI, INSERM, UMR 947, Nancy (France); Metellus, P. [Centre Hospitalier Prive Clairval, Department of Neurosurgery, Marseille (France); Aix-Marseille University, INSERM, UMR 911, Marseille (France); Sala, Q. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Colin, C. [Aix-Marseille University, INSERM, UMR 911, Marseille (France); Bialecki, E. [Centre Hospitalier Prive Clairval, Department of Neurosurgery, Marseille (France); Taieb, D. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Aix-Marseille University, CERIMED, Marseille (France); Chinot, O. [Aix-Marseille University, INSERM, UMR 911, Marseille (France); APHM, La Timone Hospital, Department of Neuro-Oncology, Marseille (France); Figarella-Branger, D. [Aix-Marseille University, INSERM, UMR 911, Marseille (France); APHM, La Timone Hospital, Department of Anatomopathology, Marseille (France); Guedj, E. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Aix-Marseille University, CERIMED, Marseille (France); Aix-Marseille University, Institut de Neurosciences de la Timone, CNRS, UMR 7289, Marseille (France); Hopital de la Timone, Service Central de Biophysique et Medecine Nucleaire, Marseille (France)

    2017-08-15

    The World Health Organization Classification of Tumors of the Central Nervous System has recently been updated by the integration of diagnostic and prognostic molecular parameters, giving pivotal attention to IDH mutation as a favourable factor. Amino acid PET is increasingly used in the management of gliomas, but its prognostic value is a matter of debate. The aim of this study was to assess the relationship between IDH mutation and {sup 18}F-FDOPA uptake on PET in newly diagnosed gliomas. A total of 43 patients, presenting with diffuse astrocytic and oligodendroglial grade II and III gliomas, reclassified according to the 2016 WHO classification of tumours of the CNS, were retrospectively included. They had all undergone {sup 18}F-FDOPA PET at an initial stage before surgery and histological diagnosis. {sup 18}F-FDOPA uptake values were compared between patients with and without IDH mutation in terms of maximum standardized uptake value (SUVmax) ratios between tumour and normal contralateral brain (T/N), and between tumour and striatum (T/S). Patients with IDH mutation showed higher {sup 18}F-FDOPA T/N SUVmax ratios (1.6 vs. 1.2) and T/S SUVmax ratios (0.9 vs. 0.6) than patients without IDH mutation (p < 0.05). This study showed paradoxically higher {sup 18}F-FDOPA uptake in diffuse grade II and III gliomas with IDH mutation. Despite evident interest in the management of gliomas, and especially in relation to posttherapy evaluation, our findings raise the question of the prognostic value of {sup 18}F-FDOPA uptake on PET uptake in this group of patients. This may be related to differences in amino acid integration, metabolism, or cell differentiation. (orig.)

  6. High sensitive detection of copper II ions using D-penicillamine-coated gold nanorods based on localized surface plasmon resonance

    Science.gov (United States)

    Hong, Yoochan; Jo, Seongjae; Park, Joohyung; Park, Jinsung; Yang, Jaemoon

    2018-05-01

    In this paper, we describe the development of a nanoplasmonic biosensor based on the localized surface plasmon resonance (LSPR) effect that enables a sensitive and selective recognition of copper II ions. First, we fabricated the nanoplasmonics as LSPR substrates using gold nanorods (GNR) and the nano-adsorption method. The LSPR sensitivity of the nanoplasmonics was evaluated using various solvents with different refractive indexes. Subsequently, D-penicillamine (DPA)—a chelating agent of copper II ions—was conjugated to the surface of the GNR. The limit of detection (LOD) for the DPA-conjugated nanoplasmonics was 100 pM. Furthermore, selectivity tests were conducted using various divalent cations, and sensitivity tests were conducted on the nanoplasmonics under blood-like environments. Finally, the developed nanoplasmonic biosensor based on GNR shows great potential for the effective recognition of copper II ions, even in human blood conditions.

  7. Culture of normal human blood cells in a diffusion chamber system II. Lymphocyte and plasma cell kinetics

    International Nuclear Information System (INIS)

    Chikkappa, G.; Carsten, A.L.; Chanana, A.D.; Cronkite, E.P.

    1979-01-01

    Normal human blood leukocytes were cultured in Millipore diffusion chambers implanted into the peritoneal cavities of irradiated mice. The evaluation of survival and proliferation kinetics of cells in lymphyocytic series suggested that the lymphoid cells are formed from transition of small and/or large lymphocytes, and the lymphoblasts from the lymphoid cells. There was also evidence indicating that some of the cells in these two compartments are formed by proliferation. The evaluation of plasmacytic series suggested that the plasma cells are formed from plasmacytoid-lymphocytes by transition, and the latter from the transition of lymphocytes. In addition, relatively a small fraction of cells in these two compartments are formed by proliferation. mature plasma cells do not and immature plasma cells do proliferate. Estimation of magnitude of plasma cells formed in the cultures at day 18 indicated that at least one plasma cell is formed for every 6 normal human blood lymphocytes introduced into the culture

  8. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  9. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  10. A novel sensitive Cu(II) and Cd(II) nanosensor platform: Graphene oxide terminated p-aminophenyl modified glassy carbon surface

    International Nuclear Information System (INIS)

    Gupta, Vinod Kumar; Yola, Mehmet Lütfi; Atar, Necip; Ustundag, Zafer; Solak, Ali Osman

    2013-01-01

    Graphical abstract: - Highlights: • We electrochemically prepared sensor based on graphene oxide. • The prepared electrode was characterized by using various techniques. • The proposed nanosensor showed good stability, selectivity and high sensitivity. • The proposed nanosensor electrode was used for the analysis of Cd(II) and Cu(II). - Abstract: Graphene oxide (GO) based glassy carbon (GC) electrode has been prepared. Firstly, p-nitrophenyl (NP) modified GC (NP/GC) electrode was prepared via the electrochemical reduction of its tetraflouroborate diazonium salt. After the formation of NP/GC electrode, the negative potential was applied to NP/GC electrode to reduce the nitro groups to amine. p-Aminophenyl (AP) modified GC (AP/GC) electrode was immersed into a graphene oxide solution containing 1-ethyl-3(3-(dimethlyamino)propyl)-carbodiimide. Hence, we constructed GO terminated AP modified GC (GO/AP/GC) electrode. NP/GC, AP/GC and GO/AP/GC electrodes were characterized sequentially using cyclic voltammetry (CV) in the presence of 1.0 mM of potassium ferricyanide in 0.1 M KCl. In addition, GO and GO/AP/GC surfaces were characterized by transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM). The GO/AP/GC electrode was used for the analysis of Cd(II) and Cu(II) ions by adsorptive stripping voltammetry. The linearity range and the detection limit of Cd(II) and Cu(II) ions were 1.0 × 10 −11 –5.0 × 10 −10 M and 3.3 × 10 −12 M (S/N = 3), respectively

  11. Cryodeposition of nitrogen gas on a surface cooled by helium II

    International Nuclear Information System (INIS)

    Dhuley, R. C.; Bosque, E. S.; Van Sciver, S. W.

    2014-01-01

    Catastrophic loss of beam tube vacuum in a superconducting particle accelerator can be simulated by sudden venting of a long high vacuum channel cooled on its outer surface by He II. The rapid rush of atmospheric air in such an event shows an interesting propagation effect, which is much slower than the shock wave that occurs with vacuum loss at ambient conditions. This is due to flash frosting/deposition of air on the cold walls of the channel. Hence to characterize the propagation as well as the associated heat transfer, it is first necessary to understand the deposition process. Here we attempt to model the growth of nitrogen frost layer on a cold plate in order to estimate its thickness with time. The deposition process can be divided into two regimes- free molecular and continuum. It is shown that in free molecular regime, the frost growth can be modeled reasonably well using cryopump theory and general heat transfer relations. The continuum regime is more complex to model, given the higher rate of gas incident on cryosurface causing a large heat load on helium bath and changing cryosurface temperature. Results from the continuum regime are discussed in the context of recent experiments performed in our laboratory

  12. Cryodeposition of nitrogen gas on a surface cooled by helium II

    Energy Technology Data Exchange (ETDEWEB)

    Dhuley, R. C.; Bosque, E. S.; Van Sciver, S. W. [Cryogenics Group, National High Magnetic Field Laboratory, Tallahassee, FL 32310 USA and Mechanical Engineering Department, FAMU-FSU College of Engineering, Tallahassee, FL 32310 (United States)

    2014-01-29

    Catastrophic loss of beam tube vacuum in a superconducting particle accelerator can be simulated by sudden venting of a long high vacuum channel cooled on its outer surface by He II. The rapid rush of atmospheric air in such an event shows an interesting propagation effect, which is much slower than the shock wave that occurs with vacuum loss at ambient conditions. This is due to flash frosting/deposition of air on the cold walls of the channel. Hence to characterize the propagation as well as the associated heat transfer, it is first necessary to understand the deposition process. Here we attempt to model the growth of nitrogen frost layer on a cold plate in order to estimate its thickness with time. The deposition process can be divided into two regimes- free molecular and continuum. It is shown that in free molecular regime, the frost growth can be modeled reasonably well using cryopump theory and general heat transfer relations. The continuum regime is more complex to model, given the higher rate of gas incident on cryosurface causing a large heat load on helium bath and changing cryosurface temperature. Results from the continuum regime are discussed in the context of recent experiments performed in our laboratory.

  13. A multi-wavelength analysis of the diffuse H II region G25.8700+0.1350

    Science.gov (United States)

    Cichowolski, S.; Duronea, N. U.; Suad, L. A.; Reynoso, E. M.; Dorda, R.

    2018-02-01

    We present a multi-wavelength investigation of the H II region G25.8700+0.1350, located in the inner part of the Galaxy. In radio continuum emission, the region is seen as a bright arc-shaped structure. An analysis of the H I line suggests that G25.8700+0.1350 lies at a distance of 6.5 kpc. The ionized gas is bordered by a photodissociation region, which is encircled by a molecular structure where four molecular clumps are detected. At infrared wavelengths, the region is also very conspicuous. Given the high level of visual absorption in the region, the exciting stars should be searched for in the infrared band. In this context, we found in the literature one Wolf-Rayet and one red supergiant, which, together with 37 2MASS sources that are candidate O-type stars, could be related to the origin of G25.8700+0.1350. Finally, as expanding H II regions are hypothesized to trigger star formation, we used different infrared point source catalogues to search for young stellar object candidates (cYSOs). A total of 45 cYSOs were identified projected on to the molecular clouds.

  14. Nickel(II) and copper(II) complexes of N,N-dialkyl-N‧-3-chlorobenzoylthiourea: Synthesis, characterization, crystal structures, Hirshfeld surfaces and antimicrobial activity

    Science.gov (United States)

    Binzet, Gun; Gumus, Ilkay; Dogen, Aylin; Flörke, Ulrich; Kulcu, Nevzat; Arslan, Hakan

    2018-06-01

    We synthesized four new N,N-dialkyl-N‧-3-chlorobenzoylthiourea ligands (Alkyl: Dimethyl, diethyl, di-n-propyl and di-n-butyl) and their metal complexes with copper and nickel atoms. The structure of all synthesized compounds was fully characterized by physicochemical, spectroscopic and single crystal X-ray diffraction analysis techniques. The physical, spectral and analytical data of the newly synthesized metal complexes have shown the formation of 1:2 (metal:ligand) ratio. The benzoylthiourea ligands coordinate with metal atoms through oxygen and sulphur atoms. The metal atoms are in slightly distorted square-planar coordination geometry in Ni(II) or Cu(II) complex. Two oxygen and two sulphur atoms are mutually cis to each other in Ni(II) or Cu(II) complex. The intermolecular contacts in the compounds, which are HL1 and HL3, were examined by Hirshfeld surfaces and fingerprint plots using the data obtained from X-ray single crystal diffraction measurement. Besides these, their antimicrobial activities against Gram-positive bacteria (Bacillus subtilis, Staphylococcus aureus, Streptococcus pyogenes and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) and anti-yeast activity (Candida glabrata, Candida parapsilosis and Candida albicans) were investigated. This exhibited some promising results towards testing organism. Among all the compounds, Ni(L1)2 complex showed high activity against Bacillus subtilis with MIC values at 7.81 μg/mL.

  15. Ion diffusion in compacted bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)

    1999-03-01

    In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.

  16. Ion diffusion in compacted bentonite

    International Nuclear Information System (INIS)

    Lehikoinen, J.

    1999-03-01

    In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)

  17. RESIDENCE TIMES OF PARTICLES IN DIFFUSIVE PROTOPLANETARY DISK ENVIRONMENTS. II. RADIAL MOTIONS AND APPLICATIONS TO DUST ANNEALING

    International Nuclear Information System (INIS)

    Ciesla, F. J.

    2011-01-01

    The origin of crystalline grains in comets and the outer regions of protoplanetary disks remains a mystery. It has been suggested that such grains form via annealing of amorphous precursors in the hot, inner region of a protoplanetary disk, where the temperatures needed for such transformations were found, and were then transported outward by some dynamical means. Here we develop a means of tracking the paths that dust grains would have taken through a diffusive protoplanetary disk and examine the types and ranges of environments that particles would have seen over a 10 6 yr time period in the dynamic disk. We then combine this model with three annealing laws to examine how the dynamic evolution of amorphous grains would have led to their physical restructuring and their delivery to various regions of the disk. It is found that 'sibling particles' - those particles that reside at the same location at a given period of time-take a wide range of unique and independent paths through the disk to arrive there. While high temperatures can persist in the disk for very long time periods, we find that those grains that are delivered to the cold outer regions of the disk are largely annealed in the first few x10 5 yr of disk history. This suggests that the crystallinity of grains in the outer disk would be determined early and remain unchanged for much of disk history, in agreement with recent astronomical observations.

  18. Silica-bound copper(II)triazacyclononane as a phosphate esterase: effect of linker length and surface hydrophobicity.

    Science.gov (United States)

    Bodsgard, Brett R; Clark, Robert W; Ehrbar, Anthony W; Burstyn, Judith N

    2009-04-07

    A series of silica-bound Cu(ii) triazacyclononane materials was prepared to study the effect of linker length and surface hydrophobicity on the hydrolysis of phosphate esters. The general synthetic approach for these heterogeneous reagents was rhodium-catalyzed hydrosilation between an alkenyl-modified triazacyclononane and hydride-modified silica followed by metallation with a Cu(ii) salt. Elemental analysis confirmed that organic functionalization of the silica gel was successful and provided an estimate of the surface concentration of triazacyclononane. EPR spectra were consistent with square pyramidal Cu(ii), indicating that Cu(ii) ions were bound to the immobilized macrocycles. The hydrolytic efficacies of these heterogeneous reagents were tested with bis(p-nitrophenyl)phosphate (BNPP) and diethyl 4-nitrophenyl phosphate (paraoxon). The agent that performed best was an octyl-linked, propanol-blocked material. This material had the most hydrophilic surface and the most accessible active site, achieving a rate maximum on par with the other materials, but in fewer cycles and without an induction period.

  19. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    Science.gov (United States)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-12-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.

  20. The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

    2016-04-15

    We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

  1. RIA Quick, AUSRIA II-125, AUSAB. Comparative study on isolated and simultaneous radioimmunoassay of hepatitis B surface antigen and antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Kselikova, M; Urbankova, J [Institut fuer Haematologie und Bluttransfusion, Prag (Czechoslovakia)

    1983-01-01

    The surface antigen of hepatitis B (HBsAg) and the antibodies against HBsAg can be determined separately by the radioimmunoassay (RIA) test kits AUSRIA II-125 and AUSAB, respectively. Using the test kit RIA Quick (IMMUNO, Wien) it is possible to perform both the determinations in one preparation simultaneously. The sensitivity of RIA Quick for HBsAg corresponds to that of AUSRIA II-125 and for HBsAB it is considerably lower than that of AUSAB. RIA Quick is of excellent technical design and is by a quarter cheaper than the kits for isolated determination of HBsAg and HBsAb.

  2. Role of rational surfaces on fluctuations and transport in the plasma edge of the TJ-II stellarator

    International Nuclear Information System (INIS)

    Pedrosa, M.A.; Hidalgo, C.; Lopez-Fraguas, A.

    2000-01-01

    It has been shown that transport barriers in toroidal magnetically confined plasmas tend to be linked to regions of unique magnetic topology such as the location of a minimum in the safety factor, rational surfaces or the boundary between closed and open flux surfaces. In the absence of E x B sheared flows, fluctuations are expected to show maximum amplitude near rational surfaces, and plasma confinement might tend to deteriorate. On the other hand, if the generation of E x B sheared flows were linked to low order rational surfaces, these would be beneficial to confinement. Experimental evidence of E x B sheared flows linked to rational surfaces has been obtained in the plasma edge region of the TJ-II stellarator. (author)

  3. Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

    Science.gov (United States)

    Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

    2015-10-01

    Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

  4. Changes in upwelling and surface productivity in the Eastern Pacific during Terminations I and II

    Science.gov (United States)

    Erdem, Z.; De Bar, M.; Stolwijk, D.; Schneider, R. R.; S Sinninghe Damsté, J.; Schouten, S.

    2017-12-01

    The Eastern Pacific coastal system is characterized by intense upwelling and consequently by an enhanced surface primary productivity. Combination of this high organic matter flux with sluggish bottom water ventilation results in one of the most pronounced oxygen minimum zones reaching from offshore California in the North to offshore Chile in the South. As a result of this process, the region is particularly interesting in view of nutrient and carbon cycling as well as ecosystem dynamics. The dynamics of the upwelling and oxygen concentrations are closely related to climatic conditions. Therefore, paleo-reconstructions of different settings are crucial in order to improve our understanding of the response of these nutrient-rich, oxygen-deficient, environments in relation to the recent global ocean warming, acidification and deoxygenation. In this study, we present downcore results from three different sites in the Eastern Pacific: offshore California (IODP site 1012), Peru (M77/2-52-2) and Chile (IODP site 1234). We applied different biomarkers as proxies to decipher changes in phytoplankton community composition, including the upwelling index based on long chain diols, and other common productivity indicators such as bulk organic carbon, carbonate and biogenic opal. In addition, application of carbon and nitrogen isotope ratios of total organic carbon and benthic foraminifera complement our multiproxy approach. Herewith we aim to compare at least two glacial-interglacial transitions with different magnitudes of deglacial warming along the Eastern Pacific upwelling systems at different latitudes. The data presented will cover the last 160 ka BP offshore California and Chile, and 30 ka BP offshore Peru enabling comparison between glacial Terminations I and II.

  5. Two earth years of Moessbauer studies of the surface of Mars with MIMOS II

    International Nuclear Information System (INIS)

    Klingelhoefer, G.; Morris, R. V.; De Souza, P. A.; Rodionov, D.; Schroeder, C.

    2006-01-01

    The element iron plays a crucial role in the study of the evolution of matter from an interstellar cloud to the formation and evolution of the planets. In the Solar System iron is the most abundant metallic element. It occurs in at least three different oxidation states: Fe(0) (metallic iron), Fe(II) and Fe(III). Fe(IV) and Fe(VI) compounds are well known on Earth, and there is a possibility for their occurrence on Mars. In January 2004 the USA space agency NASA landed two rovers on the surface of Mars, both carrying the Mainz Moessbauer spectrometer MIMOS II. They performed for the first time in-situ measurements of the mineralogy of the Martian surface, at two different places on Mars, Meridiani Planum and Gusev crater, respectively, the landing sites of the Mars-Exploration-Rovers (MER) Opportunity and Spirit. After about two Earth years or one Martian year of operation the Moessbauer (MB) spectrometers on both rovers have acquired data from more than 150 targets (and more than thousand MB spectra) at each landing site. The scientific measurement objectives of the Moessbauer investigation are to obtain for rock, soil, and dust (1) the mineralogical identification of iron-bearing phases (e.g., oxides, silicates, sulfides, sulfates, and carbonates), (2) the quantitative measurement of the distribution of iron among these iron-bearing phases (e.g., the relative proportions of iron in olivine, pyroxenes, ilmenite and magnetite in a basalt), (3) the quantitative measurement of the distribution of iron among its oxidation states (e.g., Fe 2+ , Fe 3+ , and Fe 6+ ), and (4) the characterization of the size distribution of magnetic particles. Special geologic targets of the Moessbauer investigation are dust collected by the Athena magnets and interior rock and soil surfaces exposed by the Athena Rock Abrasion Tool and by trenching with rover wheels. The Moessbauer spectrometer on Opportunity at Meridiani Planum, identified eight Fe-bearing phases: jarosite (K,Na,H3O

  6. Boron Neutron Capture Therapy at the TRIGA Mark II of Pavia, Italy - The BNCT of the diffuse tumours

    Energy Technology Data Exchange (ETDEWEB)

    Altieri, S.; Bortolussi, S.; Stella, S.; Bruschi, P.; Gadan, M.A. [University of Pavia (Italy); INFN - National Institute for Nuclear Physics, of Pavia (Italy)

    2008-10-29

    The selectivity based on the B distribution rather than on the irradiation field makes Boron neutron Capture Therapy (BNCT) a valid option for the treatment of the disseminated tumours. As the range of the high LET particles is shorter than a cell diameter, the normal cells around the tumour are not damaged by the reactions occurring in the tumoral cells. PAVIA 2001: first treatment of multiple hepatic metastases from colon ca by BNCT and auto-transplantation technique: TAOrMINA project. The liver was extracted after BPA infusion, irradiated in the Thermal Column of the Pavia TRIGA Mark II reactor, and re-implanted in the patient. Two patients were treated, demonstrating the feasibility of the therapy and the efficacy in destroying the tumoral nodules sparing the healthy tissues. In the last years, the possibility of applying BNCT to the lung tumours using epithermal collimated neutron beams and without explanting the organ, is being explored. The principal obtained results of the BNCT research are presented, with particular emphasis on the following aspects: a) the project of a new thermal column configuration to make the thermal neutron flux more uniform inside the explanted liver, b) the Monte Carlo study by means of the MCNP code of the thermal neutron flux distribution inside a patient's thorax irradiated with epithermal neutrons, and c) the measurement of the boron concentration in tissues by (n,{alpha}) spectroscopy and neutron autoradiography. The dose distribution in the thorax are simulated using MCNP and the anthropomorphic model ADAM. To have a good thermal flux distribution inside the lung epithermal neutrons must be used, which thermalize crossing the first tissue layers. Thermal neutrons do not penetrate and the obtained uniformity is poor. In the future, the construction of a PGNAA facility using a horizontal channel of the TRIGA Mark II is planned. With this method the B concentration can be measured also in liquid samples (blood, urine) and

  7. Biosorption of Cd(II), Ni(II) and Pb(II) from aqueous solution by dried biomass of aspergillus niger: application of response surface methodology to the optimization of process parameters

    Energy Technology Data Exchange (ETDEWEB)

    Amini, Malihe; Younesi, Habibollah [Department of Environmental Science, Faculty of Natural Resources and Marine Sciences, Tarbiat Modares University, Noor (Iran)

    2009-10-15

    In this study, the biosorption of Cd(II), Ni(II) and Pb(II) on Aspergillus niger in a batch system was investigated, and optimal condition determined by means of central composite design (CCD) under response surface methodology (RSM). Biomass inactivated by heat and pretreated by alkali solution was used in the determination of optimal conditions. The effect of initial solution pH, biomass dose and initial ion concentration on the removal efficiency of metal ions by A. niger was optimized using a design of experiment (DOE) method. Experimental results indicated that the optimal conditions for biosorption were 5.22 g/L, 89.93 mg/L and 6.01 for biomass dose, initial ion concentration and solution pH, respectively. Enhancement of metal biosorption capacity of the dried biomass by pretreatment with sodium hydroxide was observed. Maximal removal efficiencies for Cd(II), Ni(III) and Pb(II) ions of 98, 80 and 99% were achieved, respectively. The biosorption capacity of A. niger biomass obtained for Cd(II), Ni(II) and Pb(II) ions was 2.2, 1.6 and 4.7 mg/g, respectively. According to these observations the fungal biomass of A. niger is a suitable biosorbent for the removal of heavy metals from aqueous solutions. Multiple response optimization was applied to the experimental data to discover the optimal conditions for a set of responses, simultaneously, by using a desirability function. (Abstract Copyright [2009], Wiley Periodicals, Inc.)

  8. Oxygen tracer diffusion and surface exchange kinetics in Ba0.5Sr0.5Co0.8Fe0.2O3-δ

    NARCIS (Netherlands)

    Berenov, A.; Atkinson, A.; Kilner, J.; Ananyev, M.; Eremin, V.; Porotnikova, N.; Farlenkov, A.; Kurumchin, E.; Bouwmeester, Henricus J.M.; Bucher, E.; Sitte, W.

    2014-01-01

    The oxygen tracer diffusion coefficient, Db⁎, and the oxygen tracer surface exchange coefficient, k, were measured in Ba0.5Sr0.5Co0.8Fe0.2O3 − δ (BSCF5582) over the temperature range of 310–800 °C and the oxygen partial pressure range of 1.3 × 10−3–0.21 bar. Several measurement techniques were used:

  9. Transient behaviour in the plasma core of TJ-II stellarator and its relation with rational surfaces

    International Nuclear Information System (INIS)

    Estrada, T.; Luna, E. de la; Ascasibar, E; Jimenez, J.A.; Castejon, F.; Garcia-Cortes, I.; Lopez-Fraguas, A.; Sanchez, J.; Tribaldos, V.

    2002-01-01

    A transient behaviour is observed in the plasma core of TJ-II stellarator with fast drops in the electron temperature. Changes in the line-averaged density are observed synchronized with temperature drops. This phenomenon appears in plasmas created and heated using 300 kW of electron cyclotron heating with high power density. The transient behaviour resembles both, the electric pulsation discovered in CHS and the 'electron root' feature reported by the W7-AS team. The flexibility and low magnetic shear of TJ-II have permitted the identification of the plasma current as the control parameter for the appearance of this phenomenon. The results obtained during the magnetic configuration scans carried out in TJ-II points to the hypothesis that the transient behaviour is connected with the presence of a rational surface close to the plasma centre. Equilibrium calculations performed with the VMEC code reinforce this hypothesis. (author)

  10. Diffusion Under Geometrical Constraint

    OpenAIRE

    Ogawa, Naohisa

    2014-01-01

    Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

  11. Gemini NIFS survey of feeding and feedback processes in nearby active galaxies - II. The sample and surface mass density profiles

    Science.gov (United States)

    Riffel, R. A.; Storchi-Bergmann, T.; Riffel, R.; Davies, R.; Bianchin, M.; Diniz, M. R.; Schönell, A. J.; Burtscher, L.; Crenshaw, M.; Fischer, T. C.; Dahmer-Hahn, L. G.; Dametto, N. Z.; Rosario, D.

    2018-02-01

    We present and characterize a sample of 20 nearby Seyfert galaxies selected for having BAT 14-195 keV luminosities LX ≥ 1041.5 erg s-1, redshift z ≤ 0.015, being accessible for observations with the Gemini Near-Infrared Field Spectrograph (NIFS) and showing extended [O III]λ5007 emission. Our goal is to study Active Galactic Nucleus (AGN) feeding and feedback processes from near-infrared integral-field spectra, which include both ionized (H II) and hot molecular (H2) emission. This sample is complemented by other nine Seyfert galaxies previously observed with NIFS. We show that the host galaxy properties (absolute magnitudes MB, MH, central stellar velocity dispersion and axial ratio) show a similar distribution to those of the 69 BAT AGN. For the 20 galaxies already observed, we present surface mass density (Σ) profiles for H II and H2 in their inner ˜500 pc, showing that H II emission presents a steeper radial gradient than H2. This can be attributed to the different excitation mechanisms: ionization by AGN radiation for H II and heating by X-rays for H2. The mean surface mass densities are in the range (0.2 ≤ ΣH II ≤ 35.9) M⊙ pc-2, and (0.2 ≤ ΣH2 ≤ 13.9)× 10-3 M⊙ pc-2, while the ratios between the H II and H2 masses range between ˜200 and 8000. The sample presented here will be used in future papers to map AGN gas excitation and kinematics, providing a census of the mass inflow and outflow rates and power as well as their relation with the AGN luminosity.

  12. Optimization of the irradiations global, direct and diffuse in function of slop angle of the surface; Otimizacao das irradiacoes global, direta e difusa em funcao do angulo de inclinacao da superficie

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Adilson P.; Escobedo, Joao F. [Universidade Estadual Paulista (UNESP), Botucatu, SP (Brazil)], E-mail: pachecopgid@yahoo.com.br

    2010-07-01

    This study evaluated the monthly and annual total radiation global, direct and diffuse on horizontal surfaces and tilted surfaces to 12.85 deg (|L|-10 deg), 22.85 deg (|L|) and 32.85 deg (|L|+10 deg), with the north face, in Botucatu, SP. The measures occurred in the following dates: 04/1998 to 07/2001 at 22.85 deg; 08/2001 to 02/2003 at 12.85 deg, and 03/2003 to 12/2007 in 32.85. In all periods occurred concurrent measures in the horizontal plane (reference). The total annual global radiation equal to 6500.87; 7044.21; 7193.24 and 6854.99 MJ m{sup -2}, for horizontal surfaces, 12.85 deg, 22.85 deg e 32.85 deg. The change of the angles of inclination throughout the year enabled gains of 324.92 MJ m{sup -2} (4.74%) in global radiation in relation to 22,85 deg, distributed as follows: I) horizontal: December, January and February; II) of 12.85: March and October; III) of 22.85: April, May, September and November, IV) of 32.85: June-August. In 22.85 were recorded the annual radiation directly (4367.40 MJ m{sup -2}), exceeding 12.85 deg, 32.85 deg and horizontal, 72.40, 284.67 and 718.03 MJ m{sup -2}, however, were achieved gains 16.82% compared to 22.85 deg. For diffuse radiation, annual earnings totaled 226.57 MJ m{sup -2} (compared with 22.85 deg), with differences of less than 103.00 MJ m{sup -2} between 12.85 deg, 22.85 deg and 32.85 deg. (author)

  13. Coexistence and competition of surface diffusion and geometric shielding in the growth of 1D bismuth nanostructures and their ohmic contact

    International Nuclear Information System (INIS)

    Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang

    2014-01-01

    We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)

  14. Investigation of interaction between the Pt(II) ions and aminosilane-modified silica surface in heterogeneous system

    Science.gov (United States)

    Nowicki, Waldemar; Gąsowska, Anna; Kirszensztejn, Piotr

    2016-05-01

    UV-vis spectroscopy measurements confirmed the reaction in heterogeneous system between Pt(II) ions and ethylenediamine type ligand, n-(2-aminoethyl)-3-aminopropyl-trimethoxysilane, immobilized at the silica surface. The formation of complexes is a consequence of interaction between the amine groups from the ligand grafted onto SiO2 and ions of platinum. A potentiometric titration technique was to determine the stability constants of complexes of Pt(II) with immobilized insoluble ligand (SG-L), on the silica gel. The results show the formation of three surface complexes of the same type (PtHSG-L, Pt(HSG-L)2, PtSG-L) with SG-L ligand, in a wide range of pH for different Debye length. The concentration distribution of the complexes in a heterogeneous system is evaluated.

  15. Surface recombination of oxygen atoms in O2 plasma at increased pressure: II. Vibrational temperature and surface production of ozone

    Science.gov (United States)

    Lopaev, D. V.; Malykhin, E. M.; Zyryanov, S. M.

    2011-01-01

    Ozone production in an oxygen glow discharge in a quartz tube was studied in the pressure range of 10-50 Torr. The O3 density distribution along the tube diameter was measured by UV absorption spectroscopy, and ozone vibrational temperature TV was found comparing the calculated ab initio absorption spectra with the experimental ones. It has been shown that the O3 production mainly occurs on a tube surface whereas ozone is lost in the tube centre where in contrast the electron and oxygen atom densities are maximal. Two models were used to analyse the obtained results. The first one is a kinetic 1D model for the processes occurring near the tube walls with the participation of the main particles: O(3P), O2, O2(1Δg) and O3 molecules in different vibrational states. The agreement of O3 and O(3P) density profiles and TV calculated in the model with observed ones was reached by varying the single model parameter—ozone production probability (\\gamma_{O_{3}}) on the quartz tube surface on the assumption that O3 production occurs mainly in the surface recombination of physisorbed O(3P) and O2. The phenomenological model of the surface processes with the participation of oxygen atoms and molecules including singlet oxygen molecules was also considered to analyse \\gamma_{O_{3}} data obtained in the kinetic model. A good agreement between the experimental data and the data of both models—the kinetic 1D model and the phenomenological surface model—was obtained in the full range of the studied conditions that allowed consideration of the ozone surface production mechanism in more detail. The important role of singlet oxygen in ozone surface production was shown. The O3 surface production rate directly depends on the density of physisorbed oxygen atoms and molecules and can be high with increasing pressure and energy inputted into plasma while simultaneously keeping the surface temperature low enough. Using the special discharge cell design, such an approach opens up the

  16. Surface recombination of oxygen atoms in O2 plasma at increased pressure: II. Vibrational temperature and surface production of ozone

    International Nuclear Information System (INIS)

    Lopaev, D V; Malykhin, E M; Zyryanov, S M

    2011-01-01

    Ozone production in an oxygen glow discharge in a quartz tube was studied in the pressure range of 10-50 Torr. The O 3 density distribution along the tube diameter was measured by UV absorption spectroscopy, and ozone vibrational temperature T V was found comparing the calculated ab initio absorption spectra with the experimental ones. It has been shown that the O 3 production mainly occurs on a tube surface whereas ozone is lost in the tube centre where in contrast the electron and oxygen atom densities are maximal. Two models were used to analyse the obtained results. The first one is a kinetic 1D model for the processes occurring near the tube walls with the participation of the main particles: O( 3 P), O 2 , O 2 ( 1 Δ g ) and O 3 molecules in different vibrational states. The agreement of O 3 and O( 3 P) density profiles and T V calculated in the model with observed ones was reached by varying the single model parameter-ozone production probability (γ O 3 ) on the quartz tube surface on the assumption that O 3 production occurs mainly in the surface recombination of physisorbed O( 3 P) and O 2 . The phenomenological model of the surface processes with the participation of oxygen atoms and molecules including singlet oxygen molecules was also considered to analyse γ O 3 data obtained in the kinetic model. A good agreement between the experimental data and the data of both models-the kinetic 1D model and the phenomenological surface model-was obtained in the full range of the studied conditions that allowed consideration of the ozone surface production mechanism in more detail. The important role of singlet oxygen in ozone surface production was shown. The O 3 surface production rate directly depends on the density of physisorbed oxygen atoms and molecules and can be high with increasing pressure and energy inputted into plasma while simultaneously keeping the surface temperature low enough. Using the special discharge cell design, such an approach opens up

  17. Ultrasound-assisted xanthation of cellulose from lignocellulosic biomass optimized by response surface methodology for Pb(II) sorption.

    Science.gov (United States)

    Wang, Chongqing; Wang, Hui; Gu, Guohua

    2018-02-15

    Alkali treatment of lignocellulosic biomass is conducted to remove hemi-cellulose and lignin, further increasing the reactivity and accessibility of cellulose. Ultrasound-assisted xanthation of alkali cellulose is optimized by response surface methodology (RSM) with a Box-Behnken design. A predicting mathematical model is obtained by fitting experimental data, and it is verified by analysis of variance. Response surface plots and the contour plots obtained from the model are applied to determine the interactions of experimental variables. The optimum conditions are NaOH concentration 1.3mol/L, ultrasonic time 71.6min and CS 2 dosage 1.5mL. FTIR, SEM and XPS characterizations confirm the synthesis and sorption mechanism of cellulose xanthate (CX). Biosorption of Pb (II) onto CX obeys pseudo-second order model and Langmuir model. The sorption mechanism is attributed to surface complexation or ion exchange. CX shows good reusability for Pb (II) sorption. The maximum sorption capacity of Pb(II) is 134.41mg/g, higher than that of other biosorbents. CX has great potential as an efficient and low-cost biosorbent for wastewater treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. An Instrument for Inspecting Aspheric Optical Surfaces and Components, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — This is a Phase II SBIR proposal to develop an extremely versatile optical inspection tool for aspheric optical components and optics that are not easily inspected...

  19. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

    International Nuclear Information System (INIS)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-01-01

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

  20. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

    Science.gov (United States)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-09-29

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

  1. Prediction of the moments in advection-diffusion lattice Boltzmann method. II. Attenuation of the boundary layers via double-Λ bounce-back flux scheme

    Science.gov (United States)

    Ginzburg, Irina

    2017-01-01

    Impact of the unphysical tangential advective-diffusion constraint of the bounce-back (BB) reflection on the impermeable solid surface is examined for the first four moments of concentration. Despite the number of recent improvements for the Neumann condition in the lattice Boltzmann method-advection-diffusion equation, the BB rule remains the only known local mass-conserving no-flux condition suitable for staircase porous geometry. We examine the closure relation of the BB rule in straight channel and cylindrical capillary analytically, and show that it excites the Knudsen-type boundary layers in the nonequilibrium solution for full-weight equilibrium stencil. Although the d2Q5 and d3Q7 coordinate schemes are sufficient for the modeling of isotropic diffusion, the full-weight stencils are appealing for their advanced stability, isotropy, anisotropy and anti-numerical-diffusion ability. The boundary layers are not covered by the Chapman-Enskog expansion around the expected equilibrium, but they accommodate the Chapman-Enskog expansion in the bulk with the closure relation of the bounce-back rule. We show that the induced boundary layers introduce first-order errors in two primary transport properties, namely, mean velocity (first moment) and molecular diffusion coefficient (second moment). As a side effect, the Taylor-dispersion coefficient (second moment), skewness (third moment), and kurtosis (fourth moment) deviate from their physical values and predictions of the fourth-order Chapman-Enskog analysis, even though the kurtosis error in pure diffusion does not depend on grid resolution. In two- and three-dimensional grid-aligned channels and open-tubular conduits, the errors of velocity and diffusion are proportional to the diagonal weight values of the corresponding equilibrium terms. The d2Q5 and d3Q7 schemes do not suffer from this deficiency in grid-aligned geometries but they cannot avoid it if the boundaries are not parallel to the coordinate lines. In order

  2. Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

    Science.gov (United States)

    Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

    2017-11-01

    Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

  3. Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

    Science.gov (United States)

    Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

    2012-09-01

    The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Field limit and nano-scale surface topography of superconducting radio-frequency cavity made of extreme type II superconductor

    Science.gov (United States)

    Kubo, Takayuki

    2015-06-01

    The field limit of a superconducting radio-frequency cavity made of a type II superconductor with a large Ginzburg-Landau parameter is studied, taking the effects of nano-scale surface topography into account. If the surface is ideally flat, the field limit is imposed by the superheating field. On the surface of cavity, however, nano-defects almost continuously distribute and suppress the superheating field everywhere. The field limit is imposed by an effective superheating field given by the product of the superheating field for an ideal flat surface and a suppression factor that contains the effects of nano-defects. A nano-defect is modeled by a triangular groove with a depth smaller than the penetration depth. An analytical formula for the suppression factor of bulk and multilayer superconductors is derived in the framework of the London theory. As an immediate application, the suppression factor of the dirty Nb processed by electropolishing is evaluated by using results of surface topographic study. The estimated field limit is consistent with the present record field of nitrogen-doped Nb cavities. Suppression factors of surfaces of other bulk and multilayer superconductors, and those after various surface processing technologies, can also be evaluated by using the formula.

  5. Self-diffusion on (100), (110), and (111) surfaces of Ni and Cu: A detailed study of prefactors and activation energies

    International Nuclear Information System (INIS)

    Ku'rpick, Ulrike

    2001-01-01

    We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values

  6. Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

    International Nuclear Information System (INIS)

    Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

    2016-01-01

    Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

  7. Impact of the structural anisotropy of La{sub 2}NiO{sub 4+δ} on on high temperature surface modifications and diffusion of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Gauquelin, Nicolas

    2010-11-29

    La{sub 2}NiO{sub 4+δ} was first studied due to its structural similarities with the High Temperature superconductor La{sub 2}NiO{sub 4+δ} and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K{sub 2}NiF{sub 4} layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La{sub 2}NiO{sub 4+δ} were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new {sup 18}O-{sup 18}O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  8. Impact of the structural anisotropy of La2NiO4+δ on on high temperature surface modifications and diffusion of oxygen

    International Nuclear Information System (INIS)

    Gauquelin, Nicolas

    2010-01-01

    La 2 NiO 4+δ was first studied due to its structural similarities with the High Temperature superconductor La 2 NiO 4+δ and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K 2 NiF 4 layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La 2 NiO 4+δ were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new 18 O- 18 O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  9. The Importance Of Surface Topography For The Biological Properties Of Nitrided Diffusion Layers Produced On Ti6Al4V Titanium Alloy

    Directory of Open Access Journals (Sweden)

    Wierzchoń T.

    2015-09-01

    Full Text Available Diffusion nitrided layers produced on titanium and its alloys are widely studied in terms of their application for cardiac and bone implants. The influence of the structure, the phase composition, topography and surface morphology on their biological properties is being investigated. The article presents the results of a study of the topography (nanotopography of the surface of TiN+Ti2N+αTi(N nitrided layers produced in low-temperature plasma on Ti6Al4V titanium alloy and their influence on the adhesion of blood platelets and their aggregates. The TEM microstructure of the produced layers have been examined and it was demonstrated that the interaction between platelets and the surface of the titanium implants subjected to glow-discharge nitriding can be shaped via modification of the roughness parameters of the external layer of the TiN titanium nitride nanocrystalline zone.

  10. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Surface phase transformations, surface complexation and solubilities of hydroxyapatite in the absence/presence of Cd(II) and EDTA

    International Nuclear Information System (INIS)

    Viipsi, Karin; Sjöberg, Staffan; Shchukarev, Andrey; Tõnsuaadu, Kaia

    2012-01-01

    The removal of Cd from aqueous solutions by hydroxyapatite (HAP) was investigated with and without EDTA being present. Batch experiments were carried out using synthetic hydroxyapatite with Ca/P 1.57 and a specific surface area of 37.5 m 2 /g in the pH range 4–9 (25 °C; 0.1 M KNO 3 ). The surface composition of the solid phases were analysed by X-ray Photoelectron Spectroscopy (XPS). The surface layer of HAP was found to undergo a phase transformation with a (Ca + Cd)/P atomic ratio of 1.4 and the involvement of an ion exchange process (Ca 2+ ↔ Cd 2+ ). The amount of Cd removed from the solution increased with increasing pH, reaching ≈100% at pH 9. In the presence of EDTA Cd removal was reduced due to the formation of [CdEDTA] 2− in solution. The solubility of HAP increases in the presence of EDTA at pH values above 5, mainly due to the formation of [CaEDTA] 2− . In contrast to this, the solubility was found to decrease in the presence of Cd 2+ and CdEDTA 2− . Using XPS the formation of a Cd-enriched HAP surface was found, which was interpreted as the formation of a solid solution of the general composition: Ca 8.4-x Cd x (HPO 4 ) 1.6 (PO 4 ) 4.4 (OH) 0.4 . The information from the chemical analyses and XPS data was used to design an equilibrium model that takes into account dissolution, solution and surface complexation, as well as possible phase transformations. The total concentration of Ca, phosphate, EDTA, and Cd in solution were used in the equilibrium analysis. In the calculations the computer code WinSGW, which is based on the SOLGASWATER algorithm, was used. The following equilibria and compositions of the solid solutions were found to give the best fit to experimental data: logK s (Ca 7.6 Cd 0.8 (HPO 4 ) 1.6 (PO 4 ) 4.4 (OH) 0.4 (s)+4.8H + ⇋7.6Ca 2+ +0.8Cd 2+ +6HPO 4 2- +0.4H 2 O)=-28.03±0.07. The corresponding value for the composition Ca 5.6 Cd 2.8 (HPO 4 ) 1.6 (PO 4 ) 4.4 (OH) 0.4 (s) is −27.39 ± 0.06. The proposed model can be used

  12. Microscopic modeling of gas-surface scattering: II. Application to argon atom adsorption on a platinum (111) surface

    Science.gov (United States)

    Filinov, A.; Bonitz, M.; Loffhagen, D.

    2018-06-01

    A new combination of first principle molecular dynamics (MD) simulations with a rate equation model presented in the preceding paper (paper I) is applied to analyze in detail the scattering of argon atoms from a platinum (111) surface. The combined model is based on a classification of all atom trajectories according to their energies into trapped, quasi-trapped and scattering states. The number of particles in each of the three classes obeys coupled rate equations. The coefficients in the rate equations are the transition probabilities between these states which are obtained from MD simulations. While these rates are generally time-dependent, after a characteristic time scale t E of several tens of picoseconds they become stationary allowing for a rather simple analysis. Here, we investigate this time scale by analyzing in detail the temporal evolution of the energy distribution functions of the adsorbate atoms. We separately study the energy loss distribution function of the atoms and the distribution function of in-plane and perpendicular energy components. Further, we compute the sticking probability of argon atoms as a function of incident energy, angle and lattice temperature. Our model is important for plasma-surface modeling as it allows to extend accurate simulations to longer time scales.

  13. Analysis of serum from type II diabetes mellitus and diabetic complication using surface-enhanced Raman spectra (SERS)

    Science.gov (United States)

    Han, H. W.; Yan, X. L.; Dong, R. X.; Ban, G.; Li, K.

    2009-03-01

    In this paper, we show surface-enhanced Raman spectra (SERS) of serums from type II diabetes mellitus and diabetic complication (coronary disease, glaucoma and cerebral infarction), and analyze the SERS through the multivariate statistical methods of principal component analysis (PCA). In particular, we find that there exist many adenines in these serums, which maybe come from DNA (RNA) damage. The relative intensity of the band at 725±2 cm-1 assigned to adenine is higher for patients than for the healthy volunteers; therefore, it can be used as an important ‘fingerprint’ in order to diagnose these diseases. It is also shown that serums from type II diabetes mellitus group, diabetic complication group and healthy volunteers group can be discriminated by PCA.

  14. A numerical assessment of rough surface scattering theories. I - Horizontal polarization. II - Vertical polarization

    Science.gov (United States)

    Rodriguez, Ernesto; Kim, Yunjin; Durden, Stephen L.

    1992-01-01

    A numerical evaluation is presented of the regime of validity for various rough surface scattering theories against numerical results obtained by employing the method of moments. The contribution of each theory is considered up to second order in the perturbation expansion for the surface current. Considering both vertical and horizontal polarizations, the unified perturbation method provides best results among all theories weighed.

  15. Migration of the guinea pig sperm membrane protein PH-20 from one localized surface domain to another does not occur by a simple diffusion-trapping mechanism.

    Science.gov (United States)

    Cowan, A E; Myles, D G; Koppel, D E

    1991-03-01

    The redistribution of membrane proteins on the surface of cells is a prevalent feature of differentiation in a variety of cells. In most cases the mechanism responsible for such redistribution is poorly understood. Two potential mechanisms for the redistribution of surface proteins are: (1) passive diffusion coupled with trapping, and (2) active translocation. We have studied the process of membrane protein redistribution for the PH-20 protein of guinea pig sperm, a surface protein required for sperm binding to the egg zona pellucida (P. Primakoff, H. Hyatt, and D. G. Myles (1985). J. Cell Biol. 101, 2239-2244). PH-20 protein is localized to the posterior head plasma menbrane of the mature sperm cell. Following the exocytotic acrosome reaction, PH-20 protein moves into the newly incorporated inner acrosomal membrane (IAM), placing it in a position favorable for a role in binding sperm to the egg zona pellucida (D. G. Myles, and P. Primakoff (1984), J. Cell Biol. 99, 1634-1641). To analyze the mechanistic basis for this protein migration, we have used fluorescence microscopy and digital image processing to characterize PH-20 protein migration in individual cells. PH-20 protein was observed to move against a concentration gradient in the posterior head plasma membrane. This result argues strongly against a model of passive diffusion followed by trapping in the IAM, and instead suggests that an active process serves to concentrate PH-20 protein toward the boundary separating the posterior head and IAM regions. A transient gradient of PH-20 concentration observed in the IAM suggests that once PH-20 protein reaches the IAM, it is freely diffusing. Additionally, we observed that migration of PH-20 protein was calcium dependent.

  16. HEXAGA-II. A two-dimensional multi-group neutron diffusion programme for a uniform triangular mesh with arbitrary group scattering for the IBM/370-168 computer

    International Nuclear Information System (INIS)

    Woznicki, Z.

    1976-05-01

    This report presents the AGA two-sweep iterative methods belonging to the family of factorization techniques in their practical application in the HEXAGA-II two-dimensional programme to obtain the numerical solution to the multi-group, time-independent, (real and/or adjoint) neutron diffusion equations for a fine uniform triangular mesh. An arbitrary group scattering model is permitted. The report written for the users provides the description of input and output. The use of HEXAGA-II is illustrated by two sample reactor problems. (orig.) [de

  17. Radionuclide diffusion in soils. II

    International Nuclear Information System (INIS)

    Barinkova-Cipakova, A.; Szabova, T.

    1986-01-01

    Specimens of different types of soil, namely chernozem, brown soil and illimerized soil were taken in the environs of the nuclear power plant construction site. 0.0285 MBq of 85 Sr in chloride form was added. Solutions of NaNO 3 , KNO 3 and Ca(NO 3 ) 2 of different concentrations and their mixtures were used in studying the effect of salts on strontium sorption. The sorption was studied under steady-state conditions. The eluate samples were measured with an NZQ 201 spectrometer. The 85 Sr sorption by soils in the presence of the individual salts and their mixtures was found to depend on the type of soil. The highest 85 Sr sorption value was found for chernozem while a low radiostrontium sorption was observed for brown soil. The reducing effect was confirmed of elevated salt content in the soil on 85 Sr sorption. The results obtained are discussed in detail. (E.S.) 1 tab., 2 figs., 6 refs

  18. Electromagnetic backscattering from one-dimensional drifting fractal sea surface II: Electromagnetic backscattering model

    International Nuclear Information System (INIS)

    Xie Tao; Zhao Shang-Zhuo; Fang He; Yu Wen-Jin; He Yi-Jun; Perrie, William

    2016-01-01

    Sea surface current has a significant influence on electromagnetic (EM) backscattering signals and may constitute a dominant synthetic aperture radar (SAR) imaging mechanism. An effective EM backscattering model for a one-dimensional drifting fractal sea surface is presented in this paper. This model is used to simulate EM backscattering signals from the drifting sea surface. Numerical results show that ocean currents have a significant influence on EM backscattering signals from the sea surface. The normalized radar cross section (NRCS) discrepancies between the model for a coupled wave-current fractal sea surface and the model for an uncoupled fractal sea surface increase with the increase of incidence angle, as well as with increasing ocean currents. Ocean currents that are parallel to the direction of the wave can weaken the EM backscattering signal intensity, while the EM backscattering signal is intensified by ocean currents propagating oppositely to the wave direction. The model presented in this paper can be used to study the SAR imaging mechanism for a drifting sea surface. (paper)

  19. Synthesis, Hirshfeld surface analyses and magnetism of a 1D Mn(II ...

    African Journals Online (AJOL)

    A new Mn-based complex of {[Mn(L)2(mi)]·H2O}n (1) (HL = p-hydroxy phenylacetic acid; mi = 1,1'-(1,4-butanediyl)bis(imidazole)), has been synthesized and structurally characterized. Single-crystal X-ray analyses reveal that compound 1 has a dinuclear Mn(II) unit linking by four carboxylate groups. The bridging N-donor ...

  20. Operable Unit 3-13, Group 3, Other Surface Soils Remediation Sets 4-6 (Phase II) Waste Management Plan

    International Nuclear Information System (INIS)

    G. L. Schwendiman

    2006-01-01

    This Waste Management Plan describes waste management and waste minimization activities for Group 3, Other Surface Soils Remediation Sets 4-6 (Phase II) at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory. The waste management activities described in this plan support the selected response action presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13. This plan identifies the waste streams that will be generated during implementation of the remedial action and presents plans for waste minimization, waste management strategies, and waste disposition

  1. Insights into Surface Interactions between Metal Organic Frameworks and Gases during Transient Adsorption and Diffusion by In-Situ Small Angle X-ray Scattering

    Directory of Open Access Journals (Sweden)

    Ludovic F. Dumée

    2016-09-01

    Full Text Available The fabrication of molecular gas sieving materials with specific affinities for a single gas species and able to store large quantities of materials at a low or atmospheric pressure is desperately required to reduce the adverse effects of coal and oil usage in carbon capture. Fundamental understanding of the dynamic adsorption of gas, the diffusion mechanisms across thin film membranes, and the impact of interfaces play a vital role in developing these materials. In this work, single gas permeation tests across micro-porous membrane materials, based on metal organic framework crystals grown on the surface of carbon nanotubes (ZiF-8@CNT, were performed for the first time in-situ at the Australian Synchrotron on the small angle X-ray scattering beamline in order to reveal molecular sieving mechanisms and gas adsorption within the material. The results show that specific chemi-sorption of CO2 across the ZiF-8 crystal lattices affected the morphology and unit cell parameters, while the sieving of other noble or noble like gases across the ZiF-8@CNT membranes was found to largely follow Knudsen diffusion. This work demonstrates for the first time a novel and effective technique to assess molecular diffusion at the nano-scale across sub-nano-porous materials by probing molecular flexibility across crystal lattice and single cell units.

  2. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  3. High Surface Area Iridium Anodes and Melt Containers for Molten Oxide Electrolysis, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Direct electrochemical reduction of molten regolith is the most attractive method of oxygen production on the lunar surface, because no additional chemical reagents...

  4. Investigation of Corrosion and Cathodic Protection in Reinforced Concrete. II : Properties of Steel Surface Layers

    NARCIS (Netherlands)

    Koleva, D.A.; De Wit, J.H.W.; Van Breugel, K.; Lodhi, Z.F.; Ye, G.

    2007-01-01

    The present study explores the formation of corrosion products on the steel surface (using as-received low carbon construction steel) in reinforced concrete in conditions of corrosion and subsequent transformation of these layers in conditions of cathodic protection (CP).

  5. High Efficiency, High Temperature Foam Core Heat Exchanger for Fission Surface Power Systems, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Fission-based power systems with power levels of 30 to ≥100 kWe will be needed for planetary surface bases. Development of high temperature, high efficiency heat...

  6. Solar Wind Implantation into Lunar Regolith II: Monte Carlo Simulations of Hydrogen Retention in a Surface with Defects and the Hydrogen (H, H2) Exosphere

    Science.gov (United States)

    Tucker, O. J.; Farrell, W. M.; Killen, R. M.; Hurley, D. M.

    2018-01-01

    Recently, the near-infrared observations of the OH veneer on the lunar surface by the Moon Mineralogy Mapper (M3) have been refined to constrain the OH content to 500-750 parts per million (ppm). The observations indicate diurnal variations in OH up to 200 ppm possibly linked to warmer surface temperatures at low latitude. We examine the M3 observations using a statistical mechanics approach to model the diffusion of implanted H in the lunar regolith. We present results from Monte Carlo simulations of the diffusion of implanted solar wind H atoms and the subsequently derived H and H2 exospheres.

  7. MHD heat and mass diffusion flow by natural convection past a surface embedded in a porous medium

    Directory of Open Access Journals (Sweden)

    Chaudhary R.C.

    2009-01-01

    Full Text Available This paper presents an analytical study of the transient hydromagnetic natural convection flow past a vertical plate embedded in a porous medium, taking account of the presence of mass diffusion and fluctuating temperature about time at the plate. The governing equations are solved in closed form by the Laplace-transform technique. The results are obtained for temperature, velocity, penetration distance, Nusselt number and skin-friction. The effects of various parameters are discussed on the flow variables and presented by graphs.

  8. Electro-oxidation of methanol diffused through proton exchange membrane on Pt surface: crossover rate of methanol

    International Nuclear Information System (INIS)

    Jung, Inhwa; Kim, Doyeon; Yun, Yongsik; Chung, Suengyoung; Lee, Jaeyoung; Tak, Yongsug

    2004-01-01

    Methanol crossover rate through proton exchange membrane (Nafion 117) was investigated with a newly designed electrochemical stripping cell. Nanosize Pt electrode was prepared by the electroless deposition. Distinct electrocatalytic oxidation behaviors of methanol inside membrane were similar to the methanol oxidation in aqueous electrolyte, except adsorption/desorption of hydrogen. The amount of methanol diffused through membrane was calculated from the charge of methanol oxidation during repetitive cyclic voltammetry (CV) and methanol crossover rate was estimated to be 0.69 nmol/s

  9. Influence of low-order rational magnetic surfaces on heat transport in TJ-II heliac ECRH plasmas

    International Nuclear Information System (INIS)

    Castejon, F.; Lopez-Bruna, D.; Estrada, T.; Ascasibar, E.; Zurro, B.; Baciero, A.

    2004-01-01

    We study the effect of low-order rational surfaces on electron heat transport in plasmas confined in the TJ-II stellarator (Alejaldre et al 1990 Fusion Technol. 17 131) and heated by electron cyclotron waves. Enhancement of core electron heat confinement is observed when the rational surface is placed in the vicinity of the power deposition zone, either by performing a magnetic configuration scan or by inducing Ohmic current in a single discharge. The key to improving heat confinement seems to be a locally strong positive radial electric field, which is made possible by a synergistic effect between enhanced electron heat fluxes through radial positions around low-order rationals and pump out mechanisms in the heat deposition zone. (author)

  10. Adsorption of cobalt (II) octaethylporphyrin and 2H-octaethylporphyrin on Ag(111): new insight into the surface coordinative bond

    International Nuclear Information System (INIS)

    Bai Yun; Buchner, Florian; Kellner, Ina; Schmid, Martin; Vollnhals, Florian; Steinrueck, Hans-Peter; Marbach, Hubertus; Michael Gottfried, J

    2009-01-01

    The adsorption of cobalt (II) octaethylporphyrin (CoOEP) and 2H-octaethylporphyrin (2HOEP) on Ag(111) was investigated with scanning tunneling microscopy (STM) and photoelectron spectroscopy (XPS/UPS), in order to achieve a detailed mechanistic understanding of the surface chemical bond of coordinated metal ions. Previous studies of related systems, especially cobalt (II) tetraphenylporphyrin (CoTPP) on Ag(111), have revealed adsorption-induced changes of the oxidation state of the Co ion and the appearance of a new valence state. These effects were attributed to a covalent interaction of the Co ion with the silver substrate. However, recent studies show that the porphyrin ligand of adsorbed CoTPP undergoes a pronounced saddle-shape distortion, which could alter the electronic structure and thus provide an alternative explanation for the new valence state previously attributed to the formation of a surface coordinative bond. With the octaethylporphyrins investigated here, which were found to adsorb in a flat, undistorted conformation on Ag(111), the effects of geometric distortion can be separated from those of the electronic interaction with the substrate. The CoOEP monolayer gives rise to an adsorption-induced shift of the Co 2p signal (-1.9 eV relative to the multilayer), a new valence state at 0.6 eV below the Fermi energy, and a work-function shift of -0.84 eV (2HOEP: -0.44 eV) relative to the clean surface. Comparison with data for the distorted CoTPP confirms the existence of a covalent ion-surface interaction that is insensitive to the conformation of the ligand.

  11. Does one-dimensional (1D) adatom and cluster diffusion of Pt on the Pt(110)-(1 x 2) surface lead to 1D ripening?

    International Nuclear Information System (INIS)

    Linderoth, T R; Horch, S; Petersen, L; Laegsgaard, E; Stensgaard, I; Besenbacher, F

    2005-01-01

    The technique of scanning tunnelling microscopy (STM) uniquely allows dynamic processes on surfaces to be followed directly in real space and at atomic resolution. Results for the 551225 surface diffusion of Pt adatoms and clusters on the anisotropic, missing row reconstructed Pt(110)-(1 x 2) surface are briefly reviewed. Mass transport in this system is entirely one-dimensional (1D) since, at low adatom coverage, atoms and clusters are confined to the missing row troughs. In this paper, we therefore address the question if Pt/Pt(110)-(1 x 2) is a 1D model system to study late stage growth phenomena such as island ripening? From STM measurements, we quantify the morphology changes resulting from annealing a surface configuration with small 1D Pt islands in the missing row troughs to temperatures in the interval 369-395 K. Interestingly, the resulting increase in island sizes (ripening) cannot be accounted for by the known island and adatom mobilities within a 1D model. An explanation is provided from dynamic, time-resolved 'STM-movies' that directly reveal two novel island-mediated mechanisms for inter-trough mass transport which cause the Pt/Pt(110)-(1 x 2) system not to be purely 1D at the higher surface coverage used in the annealing experiments

  12. Lagrangian and Eulerian diffusion study in the coastal surface layers. Progress report, July 1, 1979-June 30, 1980

    International Nuclear Information System (INIS)

    Carter, H.H.; Okubo, A.; Wilson, R.E.; Sanderson, B.; Pritchard, D.W.

    1980-07-01

    This research project addresses a fundamental problem in turbulence theory, the relation between Lagrangian and Eulerian statistics, by carrying out, analyzing, and interpreting a set of field experiments in the coastal waters off the south shore of Long Island. The study will not only provide information on the relation between the Lagrangian and Eulerian autocorrelations but also between the various experimental methods for quantitatively estimating turbulent diffusion. Two experiments, one in summer and one in winter, consisting of simultaneous measurements of dye diffusion, drogue dispersion, and Eulerian current velocities in a typical coastal locale were planned. In order to ensure a match between the Lagrangian (drogues, dye) scales of motion and the Eulerian (current meters) scales, however, a preliminary experiment, consisting of a 6 mooring current meter array and a short (approx. 3 hours) drogue experiment, was conducted during March 1980. Results of this preliminary experiment and their implications to the experimental program are discussed. The principal results were an improved design of our current meter array, and a wider variety of drogue experiments, i.e., multi-level, multi-scale, and continuous source simulation

  13. The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

    Science.gov (United States)

    Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

    2017-06-01

    Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

  14. Adsorption, Desorption, Surface Diffusion, Lattice Defect Formation, and Kink Incorporation Processes of Particles on Growth Interfaces of Colloidal Crystals with Attractive Interactions

    Directory of Open Access Journals (Sweden)

    Yoshihisa Suzuki

    2016-07-01

    Full Text Available Good model systems are required in order to understand crystal growth processes because, in many cases, precise incorporation processes of atoms or molecules cannot be visualized easily at the atomic or molecular level. Using a transmission-type optical microscope, we have successfully observed in situ adsorption, desorption, surface diffusion, lattice defect formation, and kink incorporation of particles on growth interfaces of colloidal crystals of polystyrene particles in aqueous sodium polyacrylate solutions. Precise surface transportation and kink incorporation processes of the particles into the colloidal crystals with attractive interactions were observed in situ at the particle level. In particular, contrary to the conventional expectations, the diffusion of particles along steps around a two-dimensional island of the growth interface was not the main route for kink incorporation. This is probably due to the number of bonds between adsorbed particles and particles in a crystal; the number exceeds the limit at which a particle easily exchanges its position to the adjacent one along the step. We also found novel desorption processes of particles from steps to terraces, attributing them to the assistance of attractive forces from additionally adsorbing particles to the particles on the steps.

  15. Structural characterization and Hirshfeld surface analysis of a CoII complex with imidazo[1,2-a]pyridine

    Directory of Open Access Journals (Sweden)

    Saikat Kumar Seth

    2018-05-01

    Full Text Available A new mononuclear tetrahedral CoII complex, dichloridobis(imidazo[1,2-a]pyridine-κN1cobalt(II, [CoCl2(C7H6N22], has been synthesized using a bioactive imidazopyridine ligand. X-ray crystallography reveals that the solid-state structure of the title complex exhibits both C—H...Cl and π–π stacking interactions in building supramolecular assemblies. Indeed, the molecules are linked by C—H...Cl interactions into a two-dimensional framework, with finite zero-dimensional dimeric units as building blocks, whereas π–π stacking plays a crucial role in building a supramolecular layered network. An exhaustive investigation of the diverse intermolecular interactions via Hirshfeld surface analysis enables contributions to the crystal packing of the title complex to be quantified. The fingerprint plots associated with the Hirshfeld surface clearly display each significant interaction involved in the structure, by quantifying them in an effective visual manner.

  16. Surface Mn(II) oxidation actuated by a multicopper oxidase in a soil bacterium leads to the formation of manganese oxide minerals.

    Science.gov (United States)

    Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin

    2015-06-03

    In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV).

  17. Numerical modelling of flexible pavement incorporating cross-anisotropic material properties. Part II: Surface rectangular loading

    OpenAIRE

    Maina, J W; Kawana, F; Matsui, K

    2017-01-01

    In order to better understand the impact of increased loading on roads, studies on tyre-road interaction have gained prominence in recent years. Tyres form an essential interface between vehicles and road pavement surfaces. These are the only parts of the vehicle that are in contact with the road and transmit the vehicle loading to the road surface. The use of the Cartesian coordinate system is convenient in dealing with a uniform/non-uniform tyre load acting over a rectangular area, but few ...

  18. Quantitative surface studies of protein adsorption by infrared spectroscopy. II. Quantification of adsorbed and bulk proteins

    International Nuclear Information System (INIS)

    Fink, D.J.; Hutson, T.B.; Chittur, K.K.; Gendreau, R.M.

    1987-01-01

    Attenuated total reflectance Fourier transform infrared spectra of surface-adsorbed proteins are correlated with concentration measurements determined by 125 I-labeled proteins. This paper demonstrates that linear correlations between the intensity of the major bands of proteins and the quantity of proteins can be obtained for human albumin and immunoglobulin G up to surface concentrations of approximately 0.25 microgram/cm2. A poorer correlation was observed for human fibrinogen. A linear correlation was also observed between the concentration in the bulk solution and the major bands of albumin up to a concentration of 60 mg/ml

  19. Synthesis of high-surface-area γ-Al2O3 from aluminum scrap and its use for the adsorption of metals: Pb(II), Cd(II) and Zn(II)

    International Nuclear Information System (INIS)

    Asencios, Yvan J.O.; Sun-Kou, María R.

    2012-01-01

    Highlights: ► Aluminum hydroxide obtained from aluminum scrap led to the formation of gamma alumina. ► Acidic pH of precipitation favored the formation of small particles of high surface areas. ► Higher aging temperature favored the formation of large structures of large pore sizes. ► Higher aging temperature generated symmetrical solids of regular hexagonal prism forms. ► Aluminas of large pores adsorbed metals as following: Pb (1.75 Å) > Cd (1.54 Å) > Zn (1.38 Å). - Abstract: Several types of alumina were synthesized from sodium aluminate (NaAlO 2 ) by precipitation with sulfuric acid (H 2 SO 4 ) and subsequently calcination at 500 °C to obtain γ-Al 2 O 3 . The precursor aluminate was derived from aluminum scrap. The various γ-Al 2 O 3 synthesized were characterized by Fourier-transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), adsorption–desorption of N 2 (S BET ) and scanning electron microscopy (SEM). XRD revealed that distinct phases of Al 2 O 3 were formed during thermal treatment. Moreover, it was observed that conditions of synthesis (pH, aging time and temperature) strongly affect the physicochemical properties of the alumina. A high-surface-area alumina (371 m 2 g −1 ) was synthesized under mild conditions, from inexpensive raw materials. These aluminas were tested for the adsorption of Cd(II), Zn(II) and Pb(II) from aqueous solution at toxic metal concentrations, and isotherms were determined.

  20. A Handbook for Public Playground Safety. Volume II: Technical Guidelines for Equipment and Surfacing.

    Science.gov (United States)

    Consumer Product Safety Commission, Washington, DC.

    This handbook suggests safety guidelines for public playground equipment and describes various surfaces used under the equipment and possible injuries resulting from falls. The handbook is intended for use mainly by manufacturers, installers, school and park officials, and others interested in technical criteria for public playground equipment.…

  1. Surface diffusion and coverage effect of Li atom on graphene as studied by several density functional theory methods

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Zhi [Instituto de Ciencias Físicas, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa, 62210 Cuernavaca, Morelos (Mexico); Contreras-Torres, Flavio F., E-mail: flavioc@nucleares.unam.mx [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, Circuito Exterior, Ciudad Universitaria, 04510 México, DF (Mexico); Jalbout, Abraham F.; Ramírez-Treviño, Alberto [Instituto Tecnológico de Estudios Superiores de Cajeme, Ciudad Obregon, Sonora (Mexico)

    2013-11-15

    The adsorption of Li atom on graphene is examined using density functional theory methods. Three different adsorption sites are considered, including the on top of a carbon atom (OT), on top of a C-C bond (Bri), and on top of a hexagon (Hol), as well as Li adsorbed at different coverage. The Hol site is found to be the most stable, followed by the Bri and OT sites. The order of stabilization is independent of coverage. The localization of Li–graphene interaction at all sites has reverse order with stabilization. The localization will cause different repulsive interaction between Li atoms which is believed to take responsibility for the difference between the charge transfer order and adsorption energy order of Li adsorption at all possible sites. Repulsive interaction also causes the decreasing of adsorption energies of Li at Hol site with increasing coverage, but the corresponding influence is bigger at low coverage range (0.020–0.056 monolayers) than that at high coverage range (0.056–0.250 monolayers). The trend of charge transfer and dipole moment with increasing coverage is also in agreement with that of adsorption energy. It is also found that the distance of Li above graphene will increase with increasing coverage, but a so-called “zigzag” curve appears, which exhibits an oscillatory behavior as a function of increasing coverage. The diffusion of Li atom on graphene is also studied. Li atom migrates from a Hol site to a neighboring Hol site through the Bri site between them is found to be the minimum energy path. Within the studied coverage range, the diffusion barrier decreases with increasing coverage which can be ascribed to the phenomenon of different repulsion interactions when Li atom adsorbs at different sites. The increasing coverage amplified the phenomenon.

  2. Hybrid Type II fuzzy system & data mining approach for surface finish

    Directory of Open Access Journals (Sweden)

    Tzu-Liang (Bill Tseng

    2015-07-01

    Full Text Available In this study, a new methodology in predicting a system output has been investigated by applying a data mining technique and a hybrid type II fuzzy system in CNC turning operations. The purpose was to generate a supplemental control function under the dynamic machining environment, where unforeseeable changes may occur frequently. Two different types of membership functions were developed for the fuzzy logic systems and also by combining the two types, a hybrid system was generated. Genetic algorithm was used for fuzzy adaptation in the control system. Fuzzy rules are automatically modified in the process of genetic algorithm training. The computational results showed that the hybrid system with a genetic adaptation generated a far better accuracy. The hybrid fuzzy system with genetic algorithm training demonstrated more effective prediction capability and a strong potential for the implementation into existing control functions.

  3. Surface-based vertexwise analysis of morphometry and microstructural integrity for white matter tracts in diffusion tensor imaging: With application to the corpus callosum in Alzheimer's disease.

    Science.gov (United States)

    Tang, Xiaoying; Qin, Yuanyuan; Zhu, Wenzhen; Miller, Michael I

    2017-04-01

    In this article, we present a unified statistical pipeline for analyzing the white matter (WM) tracts morphometry and microstructural integrity, both globally and locally within the same WM tract, from diffusion tensor imaging. Morphometry is quantified globally by the volumetric measurement and locally by the vertexwise surface areas. Meanwhile, microstructural integrity is quantified globally by the mean fractional anisotropy (FA) and trace values within the specific WM tract and locally by the FA and trace values defined at each vertex of its bounding surface. The proposed pipeline consists of four steps: (1) fully automated segmentation of WM tracts in a multi-contrast multi-atlas framework; (2) generation of the smooth surface representations for the WM tracts of interest; (3) common template surface generation on which the localized morphometric and microstructural statistics are defined and a variety of statistical analyses can be conducted; (4) multiple comparison correction to determine the significance of the statistical analysis results. Detailed herein, this pipeline has been applied to the corpus callosum in Alzheimer's disease (AD) with significantly decreased FA values and increased trace values, both globally and locally, being detected in patients with AD when compared to normal aging populations. A subdivision of the corpus callosum in both hemispheres revealed that the AD pathology primarily affects the body and splenium of the corpus callosum. Validation analyses and two multiple comparison correction strategies are provided. Hum Brain Mapp 38:1875-1893, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

    International Nuclear Information System (INIS)

    Schaden, M.; Zhao, K. F.; Wu, Z.

    2007-01-01

    In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

  5. Temporal code in the vibrissal system-Part II: Roughness surface discrimination

    Energy Technology Data Exchange (ETDEWEB)

    Farfan, F D [Departamento de BioingenierIa, FACET, Universidad Nacional de Tucuman, INSIBIO - CONICET, CC 327, Postal Code CP 4000 (Argentina); AlbarracIn, A L [Catedra de Neurociencias, Facultad de Medicina, Universidad Nacional de Tucuman (Argentina); Felice, C J [Departamento de BioingenierIa, FACET, Universidad Nacional de Tucuman, INSIBIO - CONICET, CC 327, Postal Code CP 4000 (Argentina)

    2007-11-15

    Previous works have purposed hypotheses about the neural code of the tactile system in the rat. One of them is based on the physical characteristics of vibrissae, such as frequency of resonance; another is based on discharge patterns on the trigeminal ganglion. In this work, the purpose is to find a temporal code analyzing the afferent signals of two vibrissal nerves while vibrissae sweep surfaces of different roughness. Two levels of pressure were used between the vibrissa and the contact surface. We analyzed the afferent discharge of DELTA and GAMMA vibrissal nerves. The vibrissae movements were produced using electrical stimulation of the facial nerve. The afferent signals were analyzed using an event detection algorithm based on Continuous Wavelet Transform (CWT). The algorithm was able to detect events of different duration. The inter-event times detected were calculated for each situation and represented in box plot. This work allowed establishing the existence of a temporal code at peripheral level.

  6. Temporal code in the vibrissal system-Part II: Roughness surface discrimination

    International Nuclear Information System (INIS)

    Farfan, F D; AlbarracIn, A L; Felice, C J

    2007-01-01

    Previous works have purposed hypotheses about the neural code of the tactile system in the rat. One of them is based on the physical characteristics of vibrissae, such as frequency of resonance; another is based on discharge patterns on the trigeminal ganglion. In this work, the purpose is to find a temporal code analyzing the afferent signals of two vibrissal nerves while vibrissae sweep surfaces of different roughness. Two levels of pressure were used between the vibrissa and the contact surface. We analyzed the afferent discharge of DELTA and GAMMA vibrissal nerves. The vibrissae movements were produced using electrical stimulation of the facial nerve. The afferent signals were analyzed using an event detection algorithm based on Continuous Wavelet Transform (CWT). The algorithm was able to detect events of different duration. The inter-event times detected were calculated for each situation and represented in box plot. This work allowed establishing the existence of a temporal code at peripheral level

  7. Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

    2015-10-07

    We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

  8. Tests of Parameterized Langmuir Circulation Mixing in the Oceans Surface Mixed Layer II

    Science.gov (United States)

    2017-08-11

    inertial oscillations in the ocean are governed by three-dimensional processes that are not accounted for in a one-dimensional simulation , and it was...Unlimited 52 Paul Martin (228) 688-5447 Recent large-eddy simulations (LES) of Langmuir circulation (LC) within the surface mixed layer (SML) of...used in the Navy Coastal Ocean Model (NCOM) and tested for (a) a simple wind-mixing case, (b) simulations of the upper ocean thermal structure at Ocean

  9. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Directory of Open Access Journals (Sweden)

    Murat Kuscu

    Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  10. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Science.gov (United States)

    Kuscu, Murat; Akan, Ozgur B

    2018-01-01

    We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  11. The diffusion mechanism and convective transport in the formation of surface anomalies of RADON-222 generated at depth

    International Nuclear Information System (INIS)

    Pereira, E.B.; Hamza, V.M.

    1982-01-01

    A preliminar study on the importance of a thermally-activated convective transport of radon is made in order to explain radon anomalies at surface generated at great depth. It is theoretically shown that convective currents should be of the order of 10 μm/s or larger to explain such anomalies. The influence of surface temperature changes on the convective transport is also discussed. Seasonal changes in temperature typical of climates such as that of southern Brazil can develop thermal inversion layers at depths up to 20 metres. The optimum period of the year for the employment of surface emanometric techniques is during the second and the third months after the winter peak when the thermal inversion barriers are less intense. (Author) [pt

  12. Surface complexation modeling of Cd(II) sorption to montmorillonite, bacteria, and their composite

    Science.gov (United States)

    Wang, Ning; Du, Huihui; Huang, Qiaoyun; Cai, Peng; Rong, Xingmin; Feng, Xionghan; Chen, Wenli

    2016-10-01

    Surface complexation modeling (SCM) has emerged as a powerful tool for simulating heavy metal adsorption processes on the surface of soil solid components under different geochemical conditions. The component additivity (CA) approach is one of the strategies that have been widely used in multicomponent systems. In this study, potentiometric titration, isothermal adsorption, zeta potential measurement, and extended X-ray absorption fine-structure (EXAFS) spectra analysis were conducted to investigate Cd adsorption on 2 : 1 clay mineral montmorillonite, on Gram-positive bacteria Bacillus subtilis, and their mineral-organic composite. We developed constant capacitance models of Cd adsorption on montmorillonite, bacterial cells, and mineral-organic composite. The adsorption behavior of Cd on the surface of the composite was well explained by CA-SCM. Some deviations were observed from the model simulations at pH SCM closely coincided with the estimated value of EXAFS at pH 6. The model could be useful for the prediction of heavy metal distribution at the interface of multicomponents and their risk evaluation in soils and associated environments.

  13. Atomic diffusion in stars

    CERN Document Server

    Michaud, Georges; Richer, Jacques

    2015-01-01

    This book gives an overview of atomic diffusion, a fundamental physical process, as applied to all types of stars, from the main sequence to neutron stars. The superficial abundances of stars as well as their evolution can be significantly affected. The authors show where atomic diffusion plays an essential role and how it can be implemented in modelling.  In Part I, the authors describe the tools that are required to include atomic diffusion in models of stellar interiors and atmospheres. An important role is played by the gradient of partial radiative pressure, or radiative acceleration, which is usually neglected in stellar evolution. In Part II, the authors systematically review the contribution of atomic diffusion to each evolutionary step. The dominant effects of atomic diffusion are accompanied by more subtle effects on a large number of structural properties throughout evolution. One of the goals of this book is to provide the means for the astrophysicist or graduate student to evaluate the importanc...

  14. Tailored Formation of N-Doped Nanoarchitectures by Diffusion-Controlled on-Surface (Cyclo)-Dehydrogenation of Heteroaromatics

    Czech Academy of Sciences Publication Activity Database

    Pinardi, A. L.; Otero-Irurueta, G.; Palacio, I.; Martinez, J. I.; Sánchez-Sánchez, C.; Tello, M.; Rogero, C.; Cossaro, A.; Preobrajenski, A.; Gomez-Lor, B.; Jančařík, Andrej; Stará, Irena G.; Starý, Ivo; Lopez, M. F.; Méndez, J.; Martin-Gago, J. A.

    2013-01-01

    Roč. 7, č. 4 (2013), s. 3676-3684 ISSN 1936-0851 R&D Projects: GA ČR(CZ) GAP207/10/2207 Institutional support: RVO:61388963 Keywords : surface-assisted dehydrogenation * dibenzo[5]helicene * N-doped nanographene * heteroaromatic polymer Subject RIV: CC - Organic Chemistry Impact factor: 12.033, year: 2013

  15. [Experimental studies on the diffusion of excitation on the right ventricular surface in the dog, during normal and stimulated beats].

    Science.gov (United States)

    Arisi, G; Macchi, E; Baruffi, S; Musso, E; Spaggiari, S; Stilli, D; Taccardi, B

    1982-01-01

    Previous work on the spread of excitation on the dog's ventricular surface enabled us to locate up to 30 breakthrough points (BKTPs) where excitation reaches the ventricular surface. In particular the equipotential contour maps enabled us to detect 3 to 5 BKTPs on the anterior right ventricular surface, near the a-v groove when a large part of ventricular surface was still at rest. With a view to investigating the mechanism underlying the early excitation of these basal regions, we stimulated the heart at several right ventricular BKTPs and in other points located at a distance from the BKTPs. The instantaneous equipotential maps showed that after stimulation most right ventricular BKTPs remained in the same position as observed the normal beats. The early appearance of epicardial wavefronts in the basal region and generally in other areas of the right ventricle was attributed to the rapid propagation of excitation waves through the Purkinje network, probably associated to a short transmural crossing time, due to a local thinness of the ventricular wall.

  16. Ammonia, phosphate, phenol, and copper(II) removal from aqueous solution by subsurface and surface flow constructed wetland.

    Science.gov (United States)

    Mojiri, Amin; Ahmad, Zakiah; Tajuddin, Ramlah Mohd; Arshad, Mohd Fadzil; Gholami, Ali

    2017-07-01

    Water pollution is a global problem. During current study, ammonia, phosphate, phenol, and copper(II) were removed from aqueous solution by subsurface and surface flow constructed wetland. In current investigation, distilled water was polluted with four contaminants including ammonia, phosphate, copper (Cu), and phenol. Response surface methodology and central composite design were applied to optimize pollutant removal during treatment by subsurface flow constructed wetland (SSFCW). Contact time (12 to 80 h) and initial pollutant concentration (20 to 85 mg/L) were selected as independent factors; some upper and lower ranges were also monitored for accuracy. In SSFCW, water hyacinth transplanted in two substrate layers, namely zeolite and cockle shell. SSFCW removed 87.7, 81.4, 74.7, and 54.9% of ammonia, phosphate, Cu, and phenol, respectively, at optimum contact time (64.5 h) and initial pollutant concentration (69.2 mg/L). Aqueous solution was moved to a surface flow constructed wetland (SFCW) after treating via SSFCW at optimum conditions. In SFCW, Typha was transplanted to a fixed powdered substrate layer, including bentonite, zeolite, and cockle shell. SFCW could develop performance of this combined system and could improve elimination efficacy of the four contaminants to 99.99%. So this combined CW showed a good performance in removing pollutants. Graphical abstract Wetlands arrangement for treating aqueous solution in current study.

  17. A detector module with highly efficient surface-alpha event rejection operated in CRESST-II Phase 2

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, R. [Max-Planck-Institut fuer Physik, Munich (Germany); Technische Universitaet Muenchen, Physik-Department, Garching (Germany); Angloher, G.; Ferreiro, N.; Hauff, D.; Kiefer, M.; Petricca, F.; Proebst, F.; Reindl, F.; Seidel, W.; Stodolsky, L.; Tanzke, A.; Wuestrich, M. [Max-Planck-Institut fuer Physik, Munich (Germany); Bento, A. [Universidade de Coimbra, CIUC, Departamento de Fisica, Coimbra (Portugal); Bucci, C.; Canonica, L.; Gorla, P.; Schaeffner, K. [Laboratori Nazionali del Gran Sasso, INFN, Assergi (Italy); Erb, A. [Technische Universitaet Muenchen, Physik-Department, Garching (Germany); Walther-Meissner-Institut fuer Tieftemperaturforschung, Garching (Germany); Feilitzsch, F. von; Guetlein, A.; Lanfranchi, J.C.; Muenster, A.; Potzel, W.; Roth, S.; Schoenert, S.; Stanger, M.; Ulrich, A.; Wawoczny, S.; Willers, M.; Zoeller, A. [Technische Universitaet Muenchen, Physik-Department, Garching (Germany); Jochum, J.; Loebell, J.; Rottler, K.; Sailer, C.; Scholl, S.; Strandhagen, C.; Uffinger, M.; Usherov, I. [Eberhard-Karls-Universitaet Tuebingen, Physikalisches Institut, Tuebingen (Germany); Kluck, H. [Institut fuer Hochenergiephysik der Oesterreichischen Akademie der Wissenschaften, Wien (Austria); Vienna University of Technology, Atominstitut, Wien (Austria); Kraus, H. [University of Oxford, Department of Physics, Oxford (United Kingdom); Schieck, J. [Institut fuer Hochenergiephysik der Oesterreichischen Akademie der Wissenschaften, Wien (Austria); Sivers, M. von [Technische Universitaet Muenchen, Physik-Department, Garching (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Bern (Switzerland)

    2015-08-15

    The cryogenic dark matter experiment CRESSTII aims at the direct detection of WIMPs via elastic scattering off nuclei in scintillating CaWO{sub 4} crystals. We present a new, highly improved, detector design installed in the current run of CRESST-II Phase 2 with an efficient active rejection of surface-alpha backgrounds. Using CaWO{sub 4} sticks instead of metal clamps to hold the target crystal, a detector housing with fully-scintillating inner surface could be realized. The presented detector (TUM40) provides an excellent threshold of ∝0.60 keV and a resolution of σ ∼ 0.090 keV (at 2.60 keV).With significantly reduced background levels, TUM40 sets stringent limits on the spin-independent WIMP nucleon scattering cross section and probes a new region of parameter space for WIMP masses below 3GeV/c{sup 2}. In this paper, we discuss the novel detector design and the surface-alpha event rejection in detail. (orig.)

  18. Wet Oxidation of Maleic Acid by a Pumice Supported Copper (II ...

    African Journals Online (AJOL)

    Pumice supported Cu (II) Schiff base catalysts were prepared by surface chemical modification followed by complexation with Cu (II) acetate. The resulting materials were characterised by Diffuse Reflectance Fourier Transform Spectroscopy (DRIFTS) to confirm the modification. The materials were tested in a wet oxidation ...

  19. Impact of implanted phosphorus on the diffusivity of boron and its applicability to silicon solar cells

    International Nuclear Information System (INIS)

    Schrof, Julian; Müller, Ralph; Benick, Jan; Hermle, Martin; Reedy, Robert C.

    2015-01-01

    Boron diffusivity reduction in extrinsically doped silicon was investigated in the context of a process combination consisting of BBr 3 furnace diffusion and preceding Phosphorus ion implantation. The implantation of Phosphorus leads to a substantial blocking of Boron during the subsequent Boron diffusion. First, the influences of ion implantation induced point defects as well as the initial P doping on B diffusivity were studied independently. Here, it was found that not the defects created during ion implantation but the P doping itself results in the observed B diffusion retardation. The influence of the initial P concentration was investigated in more detail by varying the P implantation dose. A secondary ion mass spectrometry (SIMS) analysis of the BSG layer after the B diffusion revealed that the B diffusion retardation is not due to potential P content in the BSG layer but rather caused by the n-type doping of the crystalline silicon itself. Based on the observations the B diffusion retardation was classified into three groups: (i) no reduction of B diffusivity, (ii) reduced B diffusivity, and (iii) blocking of the B diffusion. The retardation of B diffusion can well be explained by the phosphorus doping level resulting in a Fermi level shift and pairing of B and P ions, both reducing the B diffusivity. Besides these main influences, there are probably additional transient phenomena responsible for the blocking of boron. Those might be an interstitial transport mechanism caused by P diffusion that reduces interstitial concentration at the surface or the silicon/BSG interface shift due to oxidation during the BBr 3 diffusion process. Lifetime measurements revealed that the residual (non-blocked) B leads to an increased dark saturation current density in the P doped region. Nevertheless, electrical quality is on a high level and was further increased by reducing the B dose as well as by removing the first few nanometers of the silicon surface after the BBr 3

  20. A new top boundary condition for modeling surface diffusive exchange of a generic volatile tracer: theoretical analysis and application to soil evaporation

    Directory of Open Access Journals (Sweden)

    J. Y. Tang

    2013-02-01

    Full Text Available We describe a new top boundary condition (TBC for representing the air–soil diffusive exchange of a generic volatile tracer. This new TBC (1 accounts for the multi-phase flow of a generic tracer; (2 accounts for effects of soil temperature, pH, solubility, sorption, and desorption processes; (3 enables a smooth transition between wet and dry soil conditions; (4 is compatible with the conductance formulation for modeling air–water volatile tracer exchange; and (5 is applicable to site, regional, and global land models.

    Based on the new TBC, we developed new formulations for bare-soil resistance and corresponding soil evaporation efficiency. The new soil resistance is predicted as the reciprocal of the harmonic sum of two resistances: (1 gaseous and aqueous molecular diffusion and (2 liquid mass flow resulting from the hydraulic pressure gradient between the soil surface and center of the topsoil control volume. We compared the predicted soil evaporation efficiency with those from several field and laboratory soil evaporation measurements and found good agreement with the typically observed two-stage soil evaporation curves. Comparison with the soil evaporation efficiency equation of Lee and Pielke (1992; hereafter LP92 indicates that their equation can overestimate soil evaporation when the atmospheric resistance is low and underestimate soil evaporation when the soil is dry. Using a synthetic inversion experiment, we demonstrated that using inverted soil resistance data from field measurements to derive empirical soil resistance formulations resulted in large uncertainty because (1 the inverted soil resistance data are always severely impacted by measurement error and (2 the derived empirical equation is very sensitive to the number of data points and the assumed functional form of the resistance.

    We expect the application of our new TBC in land models will provide a consistent representation for the diffusive tracer