Surface diffusion of sorbed radionuclides
International Nuclear Information System (INIS)
Berry, J.A.; Bond, K.A.
1991-01-01
Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)
Ogieglo, Wojciech; Wormeester, Herbert; Wessling, Matthias; Benes, Nieck Edwin
2013-01-01
In situ time-resolved spectroscopic ellipsometry is used to study the dynamics of n-hexane diffusion into, and the corresponding induced swelling of, ultra-thin polystyrene films. The experimental conditions are carefully selected to facilitate the observation of anomalous Case II diffusion in the
Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates
Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador
Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.
The influence of the surface atomic structure on surface diffusion
International Nuclear Information System (INIS)
Ghaleb, Dominique
1984-03-01
This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr
Theory and experiments on surface diffusion
Energy Technology Data Exchange (ETDEWEB)
Silvestri, W.L.
1998-11-01
The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.
SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS
Directory of Open Access Journals (Sweden)
M. R. Monazzam
2006-10-01
Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.
Single atom self-diffusion on nickel surfaces
International Nuclear Information System (INIS)
Tung, R.T.; Graham, W.R.
1980-01-01
Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)
Sorption and diffusion of FE(II) in bentonite
International Nuclear Information System (INIS)
Muurinen, A.; Tournassat, C.; Hadi, J.; Greneche, J.-M.
2014-02-01
. Qualitatively, the sorption of the radioactive 55 Fe on all the clays shows the same type of behaviour, i.e. sorption increases with increasing pH. In the measurements with the bentonite purified at VTT, the sorption occurs at a higher pH than in the measurements carried out with bentonite purified at BRGM. The sorption experiments in the acetate buffer of pH 5 show decreasing sorption of 55 Fe as a function of the increasing concentration of the added Fe(II). A general model for the investigated clays is proposed where Fe sorption is due to adsorption on exchange sites, strong and weak complexation sites and electron transfer with the structural Fe. All mechanisms identified apply to all clay samples but with variations in CEC values, structural Fe redox potential and strong and weak sites' surface density. The measured diffusivities show rather low values (10 -15 - 10 -16 m 2 /s) at pH 8 and 5. At pH 8, the diffusion curve calculated with a reactive transport model on the basis of the sorption matches fairly well the experimental results. At pH 5, the model predicts a much longer diffusion distance than found in the experiment. The reason for this discrepancy is not yet understood. A possible explanation could be a slow redox/sorption process which does not appear in the short batch sorption measurements. (orig.)
Sorption and diffusion of FE(II) in bentonite
Energy Technology Data Exchange (ETDEWEB)
Muurinen, A. [VTT Technical Research Centre of Finland, Espoo (Finland); Tournassat, C.; Hadi, J. [BRGM, Orleans (France); Greneche, J.-M. [LPCE, Le Mans (France)
2014-02-15
. Qualitatively, the sorption of the radioactive {sup 55}Fe on all the clays shows the same type of behaviour, i.e. sorption increases with increasing pH. In the measurements with the bentonite purified at VTT, the sorption occurs at a higher pH than in the measurements carried out with bentonite purified at BRGM. The sorption experiments in the acetate buffer of pH 5 show decreasing sorption of {sup 55}Fe as a function of the increasing concentration of the added Fe(II). A general model for the investigated clays is proposed where Fe sorption is due to adsorption on exchange sites, strong and weak complexation sites and electron transfer with the structural Fe. All mechanisms identified apply to all clay samples but with variations in CEC values, structural Fe redox potential and strong and weak sites' surface density. The measured diffusivities show rather low values (10{sup -15} - 10{sup -16} m{sup 2}/s) at pH 8 and 5. At pH 8, the diffusion curve calculated with a reactive transport model on the basis of the sorption matches fairly well the experimental results. At pH 5, the model predicts a much longer diffusion distance than found in the experiment. The reason for this discrepancy is not yet understood. A possible explanation could be a slow redox/sorption process which does not appear in the short batch sorption measurements. (orig.)
Surface diffusion studies by optical diffraction techniques
International Nuclear Information System (INIS)
Xiao, X.D.
1992-11-01
The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect
Tracer surface diffusion on UO2
International Nuclear Information System (INIS)
Zhou, S.Y.; Olander, D.R.
1983-06-01
Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal
Diffusion and surface alloying of gradient nanostructured metals
Directory of Open Access Journals (Sweden)
Zhenbo Wang
2017-03-01
Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.
Surface complexation modeling calculation of Pb(II) adsorption onto the calcined diatomite
Ma, Shu-Cui; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia
2015-12-01
Removal of noxious heavy metal ions (e.g. Pb(II)) by surface adsorption of minerals (e.g. diatomite) is an important means in the environmental aqueous pollution control. Thus, it is very essential to understand the surface adsorptive behavior and mechanism. In this work, the Pb(II) apparent surface complexation reaction equilibrium constants on the calcined diatomite and distributions of Pb(II) surface species were investigated through modeling calculations of Pb(II) based on diffuse double layer model (DLM) with three amphoteric sites. Batch experiments were used to study the adsorption of Pb(II) onto the calcined diatomite as a function of pH (3.0-7.0) and different ionic strengths (0.05 and 0.1 mol L-1 NaCl) under ambient atmosphere. Adsorption of Pb(II) can be well described by Freundlich isotherm models. The apparent surface complexation equilibrium constants (log K) were obtained by fitting the batch experimental data using the PEST 13.0 together with PHREEQC 3.1.2 codes and there is good agreement between measured and predicted data. Distribution of Pb(II) surface species on the diatomite calculated by PHREEQC 3.1.2 program indicates that the impurity cations (e.g. Al3+, Fe3+, etc.) in the diatomite play a leading role in the Pb(II) adsorption and dominant formation of complexes and additional electrostatic interaction are the main adsorption mechanism of Pb(II) on the diatomite under weak acidic conditions.
International Nuclear Information System (INIS)
Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.
1979-01-01
Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys
Diffusion processes in bombardment-induced surface topography
International Nuclear Information System (INIS)
Robinson, R.S.
1984-01-01
A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs
Modifying glass surfaces via internal diffusion
DEFF Research Database (Denmark)
Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.
2010-01-01
leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....
Plasma diffusion in systems with disrupted magnetic surfaces
International Nuclear Information System (INIS)
Morozov, D.K.; Pogutse, O.P.
1982-01-01
Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form
Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria
Cox, Trevor John
Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field
Reactive solid surface morphology variation via ionic diffusion.
Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih
2012-08-14
In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.
SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS
M. R. Monazzam
2006-01-01
Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...
Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes
2014-05-01
measurements. To evaluate the obtained diffusion profiles we adapted the isolated grain boundary model, first proposed by Fisher (1951) to match several observations: (i) Anisotropic diffusion in forsterite, (ii) fast diffusion along the grain boundary, (iii) fast diffusion on the surface of the sample. The latter process is needed to explain an additional flux of material from the surface into the grain boundary. Surface and grain boundary diffusion coefficients are on the order of 10000 times faster than diffusion in the lattice. Another observation was that in some regions the diffusion profiles in the lattice were greatly extended. TEM observations suggest here that surface defects (nano-cracks, ect.) have been present, which apparently enhanced the diffusion through the bulk lattice. Dohmen, R., & Milke, R. (2010). Diffusion in Polycrystalline Materials: Grain Boundaries, Mathematical Models, and Experimental Data. Reviews in Mineralogy and Geochemistry, 72(1), 921-970. Fisher, J. C. (1951). Calculations of Diffusion Penetration Curves for Surface and Grain Boundary Diffusion. Journal of Applied Physics, 22(1), 74-77. Le Claire, A. D. (1951). Grain boundary diffusion in metals. Philosophical Magazine A, 42(328), 468-474.
Effect of strain on surface diffusion and nucleation
DEFF Research Database (Denmark)
Brune, Harald; Bromann, Karsten; Röder, Holger
1995-01-01
The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....
Polymer diffusion in the interphase between surface and solution.
Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin
2018-05-22
Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.
Chemical diffusion on solid surfaces. Final report
International Nuclear Information System (INIS)
Hudson, J.B.
1980-12-01
The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol
Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems
International Nuclear Information System (INIS)
Ma, Z.; Whitley, R.D.; Wang, N.H.L.
1996-01-01
A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute
Ku, Bon Ki; Kulkarni, Pramod
2012-05-01
We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.
Friction and diffusion dynamics of adsorbates at surfaces
Fusco, C.
2005-01-01
A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it
Diffusion processes in bombardment-induced surface topography
International Nuclear Information System (INIS)
Robinson, R.S.
1984-01-01
The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)
Fetal diffusion tensor quantification of brainstem pathology in Chiari II malformation
Energy Technology Data Exchange (ETDEWEB)
Woitek, Ramona; Prayer, Daniela; Weber, Michael; Schoepf, Veronika; Furtner, Julia; Asenbaum, Ulrika; Kasprian, Gregor [Medical University of Vienna, Department of Biomedical Imaging and Image-guided Therapy, Vienna (Austria); Amann, Gabriele [Medical University of Vienna, Department of Clinical Pathology, Vienna (Austria); Seidl, Rainer [Medical University of Vienna, Department of Paediatrics and Adolescent Medicine, Vienna (Austria); Bettelheim, Dieter [Medical University of Vienna, Department of Obstetrics and Gynecology, Vienna (Austria); Brugger, Peter C. [Medical University of Vienna, Center for Anatomy and Cell Biology, Vienna (Austria)
2016-05-15
This prenatal MRI study evaluated the potential of diffusion tensor imaging (DTI) metrics to identify changes in the midbrain of fetuses with Chiari II malformations compared to fetuses with mild ventriculomegaly, hydrocephalus and normal CNS development. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) were calculated from a region of interest (ROI) in the midbrain of 46 fetuses with normal CNS, 15 with Chiari II malformations, eight with hydrocephalus and 12 with mild ventriculomegaly. Fetuses with different diagnoses were compared group-wise after age-matching. Axial T2W-FSE sequences and single-shot echo planar DTI sequences (16 non-collinear diffusion gradient-encoding directions, b-values of 0 and 700 s/mm{sup 2}, 1.5 Tesla) were evaluated retrospectively. In Chiari II malformations, FA was significantly higher than in age-matched fetuses with a normal CNS (p =.003), while ADC was not significantly different. No differences in DTI metrics between normal controls and fetuses with hydrocephalus or vetriculomegaly were detected. DTI can detect and quantify parenchymal alterations of the fetal midbrain in Chiari II malformations. Therefore, in cases of enlarged fetal ventricles, FA of the fetal midbrain may contribute to the differentiation between Chiari II malformation and other entities. (orig.)
Fetal diffusion tensor quantification of brainstem pathology in Chiari II malformation
International Nuclear Information System (INIS)
Woitek, Ramona; Prayer, Daniela; Weber, Michael; Schoepf, Veronika; Furtner, Julia; Asenbaum, Ulrika; Kasprian, Gregor; Amann, Gabriele; Seidl, Rainer; Bettelheim, Dieter; Brugger, Peter C.
2016-01-01
This prenatal MRI study evaluated the potential of diffusion tensor imaging (DTI) metrics to identify changes in the midbrain of fetuses with Chiari II malformations compared to fetuses with mild ventriculomegaly, hydrocephalus and normal CNS development. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) were calculated from a region of interest (ROI) in the midbrain of 46 fetuses with normal CNS, 15 with Chiari II malformations, eight with hydrocephalus and 12 with mild ventriculomegaly. Fetuses with different diagnoses were compared group-wise after age-matching. Axial T2W-FSE sequences and single-shot echo planar DTI sequences (16 non-collinear diffusion gradient-encoding directions, b-values of 0 and 700 s/mm 2 , 1.5 Tesla) were evaluated retrospectively. In Chiari II malformations, FA was significantly higher than in age-matched fetuses with a normal CNS (p =.003), while ADC was not significantly different. No differences in DTI metrics between normal controls and fetuses with hydrocephalus or vetriculomegaly were detected. DTI can detect and quantify parenchymal alterations of the fetal midbrain in Chiari II malformations. Therefore, in cases of enlarged fetal ventricles, FA of the fetal midbrain may contribute to the differentiation between Chiari II malformation and other entities. (orig.)
A diffuse radar scattering model from Martian surface rocks
Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.
1987-01-01
Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.
Direct measurement of Cu surface self-diffusion on a checked surface
International Nuclear Information System (INIS)
Cousty, Jacques; Peix, Roger; Perraillon, Bernard.
1976-01-01
A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr
Laser-induced desorption determinations of surface diffusion on Rh(111)
International Nuclear Information System (INIS)
Seebauer, E.G.; Schmidt, L.D.
1987-01-01
Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab
International Nuclear Information System (INIS)
Cousty, J.P.
1981-12-01
In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr
Stochastic models for surface diffusion of molecules
Energy Technology Data Exchange (ETDEWEB)
Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)
2014-07-28
We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.
Nonthermal Effects of Photon Illumination on Surface Diffusion
International Nuclear Information System (INIS)
Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.
1998-01-01
Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society
Linear response theory of activated surface diffusion with interacting adsorbates
Energy Technology Data Exchange (ETDEWEB)
Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)
2010-05-12
Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.
Radiation induced diffusion as a method to protect surface
International Nuclear Information System (INIS)
Baumvol, I.J.R.
1980-01-01
Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt
Diffusion accessibility as a method for visualizing macromolecular surface geometry.
Tsai, Yingssu; Holton, Thomas; Yeates, Todd O
2015-10-01
Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.
Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets
International Nuclear Information System (INIS)
Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey
2014-01-01
We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0 = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.
Oxygen transport in waterlogged soils, Part II. Diffusion coefficients
International Nuclear Information System (INIS)
Obando Moncayo, F.H.
2004-01-01
Several equations are available for Oxygen Transport in Waterlogged Soils and have been used for soils and plants. All of them are some form of first Fick's law as given by dQ = - DA(dc/dx)/dt. This equation illustrates some important aspects of aeration in waterlogged soils; first, D is a property of the medium and the gas, and is affected by temperature T. Likewise, the amount of diffusing substance dQ in dt is a direct function of the cross sectional area A and inversely proportional to the distance x. In fact, increasing the water content of air-dry soil, drastically decreases A and creates a further resistance for the flow of oxygen through water films around root plants, soil micro organisms and soil aggregates. The solid phase is also limiting the cross-section of surface of the free gaseous diffusion and the length and tortuosity of diffusion path in soil. In most of cases, soil gas porosity and tortuosity of soil voids are expressed in the equations of diffusion as a broad 'diffusion coefficient' (apparent coefficient diffusion). The process of soil respiration is complicated, involves many parameters, and is difficult to realistically quantify. With regard to the oxygen supply, it is convenient to distinguish macro and micro models, and hence, the flux of oxygen is assumed to have two steps. The first step is related to oxygen diffusion from the atmosphere and the air-filled porosity. The second step is related to the oxygen diffusion through water-films in and around plant roots, soil micro organisms and aggregates. Because of these models we obtain coefficients of macro or micro diffusion, rates of macro or micro diffusion, etc. In the macro diffusion process oxygen is transferred in the soil profile, mainly from the soil surface to a certain depth of the root zone, while micro diffusion deals with the flux over very short distances. Both processes, macro and micro diffusion are highly influenced by soil water content. Of course, if water is added to
Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires
International Nuclear Information System (INIS)
Hou, W C; Hong, Franklin Chau-Nan
2009-01-01
This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.
II. Inhibited Diffusion Driven Surface Transmutations
Chubb, Talbot A.
2006-02-01
This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.
II. Inhibited diffusion driven surface transmutations
International Nuclear Information System (INIS)
Cubb, Talbot A.
2006-01-01
This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)
II. Inhibited diffusion driven surface transmutations
Energy Technology Data Exchange (ETDEWEB)
Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)
2006-07-01
This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)
Palladium diffusion into bulk copper via the (100) surface
Energy Technology Data Exchange (ETDEWEB)
Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)
2009-08-05
Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.
A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface
Energy Technology Data Exchange (ETDEWEB)
Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)
2016-08-15
In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.
A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface
Naderi, Ebadollah; Ghaisas, S. V.
2016-08-01
In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.
A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface
International Nuclear Information System (INIS)
Naderi, Ebadollah; Ghaisas, S. V.
2016-01-01
In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.
Diffusion of particles adsorbed on reconstructive surface
Czech Academy of Sciences Publication Activity Database
Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír
2005-01-01
Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005
Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors
DEFF Research Database (Denmark)
Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.
2012-01-01
This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....
Semiconductor surface diffusion: Nonthermal effects of photon illumination
International Nuclear Information System (INIS)
Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.
2000-01-01
Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society
Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces
Miller, Ryan A.; Larson, Amanda; Pohl, Karsten
2017-06-01
Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.
Diffusion effects on the line intensities of He I and He II in the solar transition region
International Nuclear Information System (INIS)
Shine, R.; Gerola, H.; Linsky, J.L.
1975-01-01
A heuristic treatment of diffusion in the solar chromosphere-corona transition region is developed. Diffusion becomes increasingly important with steeper temperature gradients, in active and quiet regions relative to coronal holes, and with increasing excitation potential. Numerical calculations are made for the resonance lines of He i and He ii and show that diffusion can enhance these lines. Thus the helium lines may appear relatively weak in coronal holes due to a weakening of the enhancement mechanism. Most transition region lines will be less affected by diffusion than He i or He ii
A desk study of surface diffusion and mass transport in clay
International Nuclear Information System (INIS)
Cook, A.J.
1988-09-01
The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)
Atomic diffusion in laser surface modified AISI H13 steel
Aqida, S. N.; Brabazon, D.; Naher, S.
2013-07-01
This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.
Bulk-mediated surface diffusion: non-Markovian desorption dynamics
International Nuclear Information System (INIS)
Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S
2005-01-01
Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations
Energy Technology Data Exchange (ETDEWEB)
Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi
1988-03-31
In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)
Diffusion of N adatoms on the Fe(100) surface
DEFF Research Database (Denmark)
Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen
2000-01-01
The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....
Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia
International Nuclear Information System (INIS)
El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.
2010-01-01
The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.
Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters
International Nuclear Information System (INIS)
Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A
2016-01-01
Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)
Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas
Lee, Myoung-Jae; Jung, Young-Dae
2017-02-01
The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.
Cholesterol enhances surface water diffusion of phospholipid bilayers
Energy Technology Data Exchange (ETDEWEB)
Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)
2014-12-14
Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in
A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface
International Nuclear Information System (INIS)
Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.
2016-01-01
The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.
Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure
Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.
2017-07-01
Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.
Classically exact surface diffusion constants at arbitrary temperature
International Nuclear Information System (INIS)
Voter, A.F.; Cohen, J.M.
1989-01-01
An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces
Nuclear surface diffuseness revealed in nucleon-nucleus diffraction
Hatakeyama, S.; Horiuchi, W.; Kohama, A.
2018-05-01
The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.
Influence of crystal structure on the CoII diffusion behavior in the Zn1-xCoxO system
International Nuclear Information System (INIS)
Peiteado, M.; Makovec, D.; Villegas, M.; Caballero, A.C.
2008-01-01
The solid state interaction of the Zn 1-x Co x O nominal system is investigated by means of diffusion couples and analysis of co-precipitated samples. The formation of a homogeneous Co:ZnO solid solution is found to be determined by the crystal structure from which Co II ions diffuse into the wurtzite lattice. No diffusion is observed whenever the CoO rock-salt structure is formed from the Co II precursor. On the contrary, the diffusion from the Co 3 O 4 spinel phase is feasible but has a limited temperature range defined by the reduction at a high temperature of Co III -Co II , since this process again leads to the formation of the rock-salt structure. However, when using a highly reactive and homogeneous co-precipitated starting powder, neither the spinel phase nor the rock-salt structure is formed, and a Co II :ZnO solid solution is obtained, which remains stable up to high temperatures. - Graphical abstract: Maximum diffusion distance for the ZnO-CoO x couple as a function of temperature. Dashed gray lines represent the temperature values at which the transformations between CoO and Co 3 O 4 compounds take place
The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces
International Nuclear Information System (INIS)
Durakanoglu, S.
2004-01-01
Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient
Chu, Khim Hoong
2017-11-09
Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6 cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.
Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface
International Nuclear Information System (INIS)
Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.
2007-01-01
Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings
Jump rates for surface diffusion of large molecules from first principles
Energy Technology Data Exchange (ETDEWEB)
Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)
2015-04-21
We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.
New sensitive micro-measurements of dynamic surface tension and diffusion coefficients
DEFF Research Database (Denmark)
Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David
2017-01-01
Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...
A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices
International Nuclear Information System (INIS)
Ionescu, M.
1977-01-01
An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)
Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.
Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter
2015-05-21
Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.
Coupling between diffusion and orientation of pentacene molecules on an organic surface.
Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor
2016-04-01
The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.
Investigation of ion diffusion towards plasmonic surfaces
International Nuclear Information System (INIS)
Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.
2013-01-01
Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)
Ochalek, M; Podhaisky, H; Ruettinger, H-H; Wohlrab, J; Neubert, R H H
2012-10-01
The barrier function of two quaternary stratum corneum (SC) lipid model membranes, which were previously characterized with regard to the lipid organization, was investigated based on diffusion studies of model drugs with varying lipophilicities. Diffusion experiments of a hydrophilic drug, urea, and more lipophilic drugs than urea (i.e. caffeine, diclofenac sodium) were conducted using Franz-type diffusion cells. The amount of permeated drug was analyzed using either HPLC or CE technique. The subjects of interest in the present study were the investigation of the influence of physicochemical properties of model drugs on their diffusion and permeation through SC lipid model membranes, as well as the study of the impact of the constituents of these artificial systems (particularly ceramide species) on their barrier properties. The diffusion through both SC lipid model membranes and the human SC of the most hydrophilic model drug, urea, was faster than the permeation of the more lipophilic drugs. The slowest rate of permeation through SC lipid systems occurred in the case of caffeine. The composition of SC lipid model membranes has a significant impact on their barrier function. Model drugs diffused and permeated faster through Membrane II (presence of Cer [EOS]). In terms of the barrier properties, Membrane II is much more similar to the human SC than Membrane I. Copyright © 2012 Elsevier B.V. All rights reserved.
On the diffusion and self-trapping of surface dimers
Kappus, W.
1982-03-01
The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.
Energy Technology Data Exchange (ETDEWEB)
Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry
1996-11-01
The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.
DEFF Research Database (Denmark)
Hjelt, T.; Vattulainen, Ilpo Tapio
2000-01-01
stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....
Convergence of surface diffusion parameters with model crystal size
Cohen, Jennifer M.; Voter, Arthur F.
1994-07-01
A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.
DEFF Research Database (Denmark)
Brown, P J; Wong, K K; Felce, S L
2016-01-01
The FOXP1 (forkhead box P1) transcription factor is a marker of poor prognosis in diffuse large B-cell lymphoma (DLBCL). Here microarray analysis of FOXP1-silenced DLBCL cell lines identified differential regulation of immune response signatures and major histocompatibility complex class II (MHC II......) genes as some of the most significant differences between germinal center B-cell (GCB)-like DLBCL with full-length FOXP1 protein expression versus activated B-cell (ABC)-like DLBCL expressing predominantly short FOXP1 isoforms. In an independent primary DLBCL microarray data set, multiple MHC II genes......, including human leukocyte antigen DR alpha chain (HLA-DRA), were inversely correlated with FOXP1 transcript expression (PABC-DLBCL cells led to increased cell-surface expression of HLA-DRA and CD74. In R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine and prednisone...
Diffusion of particles on a fluctuating surface
Czech Academy of Sciences Publication Activity Database
Tarasenko, Alexander; Jastrabík, Lubomír
2011-01-01
Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011
Collisional diffusion in a torus with imperfect magnetic surfaces
International Nuclear Information System (INIS)
White, R.B.
1983-03-01
A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains
Plateau diffusion coefficient for arbitrary flux surface geometry
International Nuclear Information System (INIS)
Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.
1981-03-01
A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime
A new approach to the problem of bulk-mediated surface diffusion.
Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M
2015-08-28
This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.
Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters
International Nuclear Information System (INIS)
Yang Jianyu; Hu Wangyu; Tang Jianfeng
2011-01-01
The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)
NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS
DEFF Research Database (Denmark)
Johannesson, Björn
2008-01-01
Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...
ISLSCP II Reanalysis Near-Surface Meteorology Data
National Aeronautics and Space Administration — This data set for the ISLSCP Initiative II data collection provides near surface meteorological variables, fluxes of heat, moisture and momentum at the surface, and...
A high 18F-FDOPA uptake is associated with a slow growth rate in diffuse Grade II-III gliomas.
Isal, Sibel; Gauchotte, Guillaume; Rech, Fabien; Blonski, Marie; Planel, Sophie; Chawki, Mohammad B; Karcher, Gilles; Marie, Pierre-Yves; Taillandier, Luc; Verger, Antoine
2018-04-01
In diffuse Grade II-III gliomas, a high 3,4-dihydroxy-6-( 18 F)-fluoro-L-phenylalanine ( 18 F-FDOPA) positron emission tomography (PET) uptake, with a standardized uptake value (SUV max )/contralateral brain tissue ratio greater than 1.8, was previously found to be consistently associated with the presence of an isocitrate dehydrogenase (IDH) mutation, whereas this mutation is typically associated with a better prognosis. This pilot study was aimed to ascertain the prognostic value of this high 18 F-FDOPA uptake in diffuse Grade II-III gliomas with regard to the velocity of diameter expansion (VDE), which represents an established landmark of better prognosis when below 4 mm per year. 20 patients (42 ± 10 years, 10 female) with newly-diagnosed diffuse Grade II-III gliomas (17 with IDH mutation) were retrospectively included. All had a 18 F-FDOPA PET, quantified with SUV max ratio, along with a serial MRI enabling VDE determination. SUV max ratio was above 1.8 in 5 patients (25%) all of whom had a VDE VDE <4 mm/year in the overall population (45 vs 0%, p = 0.04) and also in the subgroup of patients with IDH mutation (45 vs 0%, p = 0.10). This pilot study shows that in diffuse Grade II-III gliomas, a high 18 F-FDOPA uptake would be predictive of low tumour growth, with a different prognostic significance than IDH mutation. Advances in knowledge: 18 F-FDOPA PET in a single session imaging could have prognostic value in initial diagnosis of diffuse Grade II-III gliomas.
M. C. Sagis, Leonard
2001-03-01
In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.
Surface migration in sorption processes
International Nuclear Information System (INIS)
Rasmuson, A.; Neretnieks, J.
1983-03-01
Diffusion rates of sorbing chemical species in granites and clays are in several experiments within the KBS study, higher than can be explained by pore diffusion only. One possible additional transport mechanism is transport of of sorbed molecules/ions along the intrapore surfaces. As a first step a literature investigation on on solid surfaces has been conducted. A lot of experimental evidence of the mobility of the sorbed molecules has been gathered through the years, particulary for metal surfaces and chemical engineering systems. For clays however, there are only a few articles, and for granites none. Two types of surface migration models have been proposed in the litterature: i) Surface flow as a result of a gradient in spreading pressure. ii) Surface diffusion as a result of a gradient in concentration. The surface flow model has only been applied to gaseous systems. However, it should be equally applicable to liquid systems. The models i) and ii) are conceptually very different. However, the resulting expressions for surface flux are complicated and it will not be an easy task to distinguish between them. There seem to be three ways of discriminating between the transport mechanisms: a) Temperature dependence. b) Concentration dependence. c) Order of magnitude. (Forf)
Dimer-flipping-assisted diffusion on a Si(001) surface
International Nuclear Information System (INIS)
Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.
2000-01-01
The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows
Removal of nickel(II and palladium(II from surface waters
Directory of Open Access Journals (Sweden)
V. Sharifzade
2013-04-01
Full Text Available A new sorbent was prepared using alumina and 5-Br-PADAP, and its adsorption ability for the removal of Ni(II and Pd(II from different waters was investigated. The procedure is based on retention of the analytes on the alumina load with 5-Br-PADAP at pH ~ 6. The separation/preconcentration conditions for the quantitative recoveries were investigated. The limit of detections (LOD based on three times the standard deviations of the blank, were 0.187 and 0.253 ng mL-1 for Ni(II and Pd(II, respectively. Obtained sorption capacities for 1 g sorbent were 6.0 mg Ni(II and 11.0 mg Pd(II. The linearity was maintained in the concentration range of 0.625 to 6.0 ng mL-1 for Ni(II and 0.416 to 7.0 ng mL-1 for Pd(II in the original solution. Eight replicate determinations of a mixture containing 2.0 µg mL-1 each of the elements in the final solution gave relative standard deviation of ±0.82 and ±1.12% for Ni(II and Pd(II, respectively. The proposed method was successfully applied to the determination trace amounts of Ni(II and Pd(II in the surface water samples.DOI: http://dx.doi.org/10.4314/bcse.v27i1.2
Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m
Energy Technology Data Exchange (ETDEWEB)
Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)
1976-08-01
The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.
Nitrogen diffusion in near-surface range of ion doped molybdenum
Zamalin, E Y
2001-01-01
The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them
Impurity diffusion, point defect engineering, and surface/interface passivation in germanium
Chroneos, Alexander I.
2012-01-26
In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Li, Xiaofan; Nie, Qing
2009-01-01
Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...
Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.
Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis
2017-09-01
Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.
International Nuclear Information System (INIS)
Singh, Gyanendra; Mehta, Dalip Singh
2013-01-01
We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)
RESEARCH OF KINETIC AND DIFFUSIVE MECHANISMS IN THE ADSORPTION OF Cu (II IN SUGAR CANE BAGASSE ASH
Directory of Open Access Journals (Sweden)
Julio Omar Prieto García
2016-10-01
Full Text Available In this paper a kinetic and diffusive study regarding adsorption of ions Cu (II on a sample of sugar cane bagasse ash is made. The results show that the second-order kinetic model better adjusts the experimental data than the Elovich and first-order kinetic model. The diffusive mechanism study shows that the diffusion in the liquid pellicle and in the micro-pores of the adsorbent prevail in the adsorption phenomenon.
Transient enhanced diffusion in preamorphized silicon: the role of the surface
Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.
1999-01-01
Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.
Diffusion of zinc into an unpassivated surface of indium phosphide
International Nuclear Information System (INIS)
Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.
1989-01-01
Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)
Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass
DEFF Research Database (Denmark)
Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng
2009-01-01
form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...
Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting
Directory of Open Access Journals (Sweden)
Szajnar J.
2014-10-01
Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.
Flow, transport and diffusion in random geometries II: applications
Asinari, Pietro
2015-01-07
Multilevel Monte Carlo (MLMC) is an efficient and flexible solution for the propagation of uncertainties in complex models, where an explicit parametrization of the input randomness is not available or too expensive. We present several applications of our MLMC algorithm for flow, transport and diffusion in random heterogeneous materials. The absolute permeability and effective diffusivity (or formation factor) of micro-scale porous media samples are computed and the uncertainty related to the sampling procedures is studied. The algorithm is then extended to the transport problems and multiphase flows for the estimation of dispersion and relative permeability curves. The impact of water drops on random stuctured surfaces, with microfluidics applications to self-cleaning materials, is also studied and simulated. Finally the estimation of new drag correlation laws for poly-dispersed dilute and dense suspensions is presented.
Flow, transport and diffusion in random geometries II: applications
Asinari, Pietro; Ceglia, Diego; Icardi, Matteo; Prudhomme, Serge; Tempone, Raul
2015-01-01
Multilevel Monte Carlo (MLMC) is an efficient and flexible solution for the propagation of uncertainties in complex models, where an explicit parametrization of the input randomness is not available or too expensive. We present several applications of our MLMC algorithm for flow, transport and diffusion in random heterogeneous materials. The absolute permeability and effective diffusivity (or formation factor) of micro-scale porous media samples are computed and the uncertainty related to the sampling procedures is studied. The algorithm is then extended to the transport problems and multiphase flows for the estimation of dispersion and relative permeability curves. The impact of water drops on random stuctured surfaces, with microfluidics applications to self-cleaning materials, is also studied and simulated. Finally the estimation of new drag correlation laws for poly-dispersed dilute and dense suspensions is presented.
Surface modifications by field induced diffusion.
Directory of Open Access Journals (Sweden)
Martin Olsen
Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.
Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.
2018-02-01
Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.
Modelling Ni diffusion in bentonite using different sorption models
International Nuclear Information System (INIS)
Pfingsten, W.; Baeyens, B.; Bradbury, M.
2010-01-01
) retardation on the Fe(II) concentration level in the bentonite pore water and the related Fe(II) sorption on exchange and surface complexation sites. The Ni(II) retardation is lower for higher Fe(II) concentrations. Generally, assuming that the Fe(II) background concentration in the bentonite is determined by saturation with siderite, Fe(II) competition reduces the Ni retardation by an order of magnitude compared to the case without competition. Since the Fe(II) concentration in the near-field of a high-level radioactive waste repository may change with time due to canister corrosion processes and mineral precipitation/dissolution reactions, the diffusion of Ni(II), and more generally also metals which are chemically similar (valence state, hydrolysis behaviour) e.g. Co, Zn, Mn.. should be modelled using mechanistic sorption models taking into account competitive sorption processes, i.e. using a more detailed reactive transport approach to describe radionuclide transport within the bentonite correctly. (authors)
Dynamics of an optically confined nanoparticle diffusing normal to a surface.
Schein, Perry; O'Dell, Dakota; Erickson, David
2016-06-01
Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.
Energy Technology Data Exchange (ETDEWEB)
Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)
2016-05-15
Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to
Diffusion of Na(I), Cs(I), Sr(II) and Eu(III) in smectite rich natural clay.
Kasar, Sharayu; Kumar, Sumit; Bajpai, R K; Tomar, B S
2016-01-01
Diffusion of Na(I), Cs(I), Sr(II) and Eu(III) in smectite rich natural clay, proposed as a backfill material in the Indian geological repository, was studied using the out-diffusion method. Radiotracers (22)Na, (137)Cs, (85)Sr and (154)Eu were used; the first three are carrier-free enabling experimental work at sub-micromolar metal ion concentration, and Eu(III) tracer (154)Eu was used at sub millimolar concentration. An out-diffusion methodology, wherein a thin planar source of radioactivity placed between two clay columns diffuses out, was used to obtain the apparent diffusion coefficient (Da) values. This methodology enabled determination of diffusion coefficient even for strongly sorbing (154)Eu. Da values for (22)Na, (137)Cs, (85)Sr and (154)Eu were 2.35 (±0.14) × 10(-11), 2.65 (±0.09) × 10(-12), 3.32 (±0.15) × 10(-11) and 1.23 (±0.15) × 10(-13) m(2) s(-1), respectively. Da values were found to be in fair agreement with literature data reported for similar mineralogical sediments. Sorption of radionuclides on the clay was also determined in the present study and differences in Da values were rationalized on the basis of sorption data. Distribution ratios (Kd) for Cs(I) and Eu(III) were higher than that for Sr(II), which in turn was higher than that for Na(I). Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Ferrieri, R.A.; Wolf, A.P.
1984-01-01
A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures
DEFF Research Database (Denmark)
Mejlbro, Leif
1996-01-01
Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...
Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A
2018-02-01
The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
María I. Vázquez
2015-12-01
Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.
Energy Technology Data Exchange (ETDEWEB)
Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)
2017-02-01
Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.
Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach
Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.
2015-01-01
We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574
Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface
Directory of Open Access Journals (Sweden)
Muhammad Qasim
2013-01-01
Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.
Zhan, Hanyu; Voelz, David G.
2016-12-01
The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.
DEFF Research Database (Denmark)
Liu, S.J.; Tao, H.Z.; Zhang, Y.F.
2015-01-01
We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....
Ion diffusion in compacted bentonite
Energy Technology Data Exchange (ETDEWEB)
Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)
1999-03-01
In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.
Ion diffusion in compacted bentonite
International Nuclear Information System (INIS)
Lehikoinen, J.
1999-03-01
In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)
International Nuclear Information System (INIS)
Olin, M.; Valkiainen, M.; Aalto, H.
1997-12-01
This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments
Energy Technology Data Exchange (ETDEWEB)
Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)
1997-12-01
This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.
Wet Oxidation of Maleic Acid by a Pumice Supported Copper (II ...
African Journals Online (AJOL)
Pumice supported Cu (II) Schiff base catalysts were prepared by surface chemical modification followed by complexation with Cu (II) acetate. The resulting materials were characterised by Diffuse Reflectance Fourier Transform Spectroscopy (DRIFTS) to confirm the modification. The materials were tested in a wet oxidation ...
ISLSCP II Reanalysis Near-Surface Meteorology Data
National Aeronautics and Space Administration — ABSTRACT: This data set for the ISLSCP Initiative II data collection provides near surface meteorological variables, fluxes of heat, moisture and momentum at the...
The effect of step thickness on the surface diffusion of a Pt adatom
International Nuclear Information System (INIS)
Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang
2009-01-01
The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature
Energy Technology Data Exchange (ETDEWEB)
Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)
2014-12-15
Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.
Energy Technology Data Exchange (ETDEWEB)
Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.
2012-06-08
Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.
Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection
Skoch, Gary J.
2002-01-01
Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the
Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.
Tränkle, B; Ruh, D; Rohrbach, A
2016-03-14
Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.
Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure
International Nuclear Information System (INIS)
Yang Jianyu; Hu Wangyu; Chen Shuguang
2010-01-01
Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.
Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons
Energy Technology Data Exchange (ETDEWEB)
Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)
2007-02-21
During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.
Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces
International Nuclear Information System (INIS)
Luniakov, Yu V
2013-01-01
A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)
Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study
Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.
2017-08-01
We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.
International Nuclear Information System (INIS)
Goddard, P.J.
1989-01-01
The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa
'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion
International Nuclear Information System (INIS)
Livadiotis, George
2007-01-01
The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers
International Nuclear Information System (INIS)
Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian
2012-01-01
The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)
Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system
International Nuclear Information System (INIS)
Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S
2005-01-01
We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed
Kapranov, Sergey V.; Kouzaev, Guennadi A.
2018-01-01
Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.
Fractional Diffusion Equations and Anomalous Diffusion
Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin
2018-01-01
Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.
International Nuclear Information System (INIS)
Kim, Sung Hoon
2001-01-01
Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices
Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)
Energy Technology Data Exchange (ETDEWEB)
Goldman, Nir; Browning, Nigel D.
2011-06-16
Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.
International Nuclear Information System (INIS)
Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi
2013-01-01
Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean
Novel exchange mechanisms in the surface diffusion of oxides
International Nuclear Information System (INIS)
Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A
2004-01-01
We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)
Directory of Open Access Journals (Sweden)
Kopyciński D.
2017-03-01
Full Text Available The completed research presented in the first part of the article has allowed linking the manufacturing technology of ductile iron castings with the process of hot dip galvanizing. On the basis of these data simulations were carried out to examine the behaviour of zinc diffusion coefficient D in the galvanized coating. The adopted model of zinc coating growth helped to explain the cases of excessive growth of the intermetallic phases in this type of coating. The paper analyzes covered the relationship between the roughness and phase composition of the top layer of product and the thickness and kinetics of zinc coating growth referred to individual sub-layers of the intermetallic phases.Roughness and phase composition in the surface layer of product were next related to the diffusion coefficient D examined in respective sublayers of the intermetallic phases.
International Nuclear Information System (INIS)
Abdel Razek, Ahmed Abdel Khalek; Abd El-Gaber, Nahed; Abdalla, Ahmed; Fathy, Abeer; Azab, Ahmed; Rahman, Ashraf Abdel
2009-01-01
The aim of this work is to assess the usefulness of apparent diffusion coefficient (ADC) value of the brain for diagnosis of patients with Gaucher's disease type II and type III. Prospective study was conducted upon 13 patients (nine boys and four girls aged 8 months-14 years: mean 6.1 years) with Gaucher's disease type II and III and for age-matched control group (n = 13). Diffusion-weighted magnetic resonance imaging using a single-shot echo-planar imaging with a diffusion-weighted factor b of 0, 500, and 1,000 s/mm 2 was done for all patients and volunteers. The ADC value was calculated in ten regions of the brain parenchyma and correlated with genotyping. There was significantly lower ADC value of the cortical frontal (P = 0.003), cortical temporal (P = 0.04), frontal subcortical white matter (P = 0.02), corticospinal tract (P = 0.001), cerebellum (P = 0.001), medulla (P = 0.002), and midbrain (P = 0.02) between patients and volunteers. There was significant difference in the ADC value of the frontal and temporal gray matter (P = 0.04 and 0.05, respectively) between patients with heterozygous and homozygous gene mutation. We concluded that ADC value is a new promising quantitative imaging parameter that can be used for the detection of brain abnormalities in patients with Gaucher's disease type II and type III and has a correlation with genotyping. (orig.)
Dulnee, Siriwan; Scheinost, Andreas C
2014-08-19
To elucidate the potential risk of (126)Sn migration from nuclear waste repositories, we investigated the surface reactions of Sn(II) on goethite as a function of pH and Sn(II) loading under anoxic condition with O2 level redox state and surface structure were investigated by Sn K edge X-ray absorption spectroscopy (XAS), goethite phase transformations were investigated by high-resolution transmission electron microscopy and selected area electron diffraction. The results demonstrate the rapid and complete oxidation of Sn(II) by goethite and formation of Sn(IV) (1)E and (2)C surface complexes. The contribution of (2)C complexes increases with Sn loading. The Sn(II) oxidation leads to a quantitative release of Fe(II) from goethite at low pH, and to the precipitation of magnetite at higher pH. To predict Sn sorption, we applied surface complexation modeling using the charge distribution multisite complexation approach and the XAS-derived surface complexes. Log K values of 15.5 ± 1.4 for the (1)E complex and 19.2 ± 0.6 for the (2)C complex consistently predict Sn sorption across pH 2-12 and for two different Sn loadings and confirm the strong retention of Sn(II) even under anoxic conditions.
Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion
Energy Technology Data Exchange (ETDEWEB)
Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.
2017-11-07
Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).
Energy Technology Data Exchange (ETDEWEB)
Amer, Hany; Moustafa, Wafaa M. [Nuclar Fuel Cycle Department, Nuclear and Radiological Regulatory Authority (NRRA), Naser City, Cairo (Egypt); Farghali, Ahmed A.; El Rouby, Waleed M.A. [Materials Science and Nanotechnology Department, Faculty of Postgraduate Studies for Advanced Sciences (PASA), Beni-Suef University (Egypt); Khalil, Waleed F. [Nuclar Fuel Cycle Department, Nuclear and Radiological Regulatory Authority (NRRA), Naser City, Cairo (Egypt); Materials Science and Nanotechnology Department, Faculty of Postgraduate Studies for Advanced Sciences (PASA), Beni-Suef University (Egypt)
2017-12-04
Graphene oxide (GO) with high specific surface area was prepared and functionalized with ethylene diamine tetra-acetic acid (EDTA). The as-prepared GO and the functionalized one (GO-EDTA) were characterized using high resolution transmission electron microscopy (HRTEM), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), and Raman spectroscopy. The as-prepared and EDTA functionalized GO were applied as adsorbent to remove strontium(II) and cobalt(II) from water. The results indicated that the prepared materials are efficient adsorbents for strontium(II) and cobalt(II) removal. The adsorption of Co{sup II} and Sr{sup II} under effects of contact time, temperature, and pH was investigated It is concluded that the maximum adsorption capacities of GO for Co{sup II} and Sr{sup II} were about 168 and 140 mg.g{sup -1}, whereas of GO-EDTA the values were about 197 and 158 mg.g{sup -1}, respectively. It is indicated that pH 6 and temperature 40 C are the best condition for Co{sup II} and Sr{sup II} removal from water. The application of Langmuir and Freundlich isotherms indicated that Langmuir isotherm is best fit for Co{sup II} and Sr{sup II} equilibrium adsorption. Adsorption kinetics were studied by applying pseudo first-order, pseudo second-order, and intraparticle diffusion models on the experimental data. The results proved that pseudo second-order model is the best represented adsorption kinetics. Appling the intraparticle diffusion regressions on the experimental data indicated that intraparticle diffusion involved in adsorption process, which was not the only rate-controlling step. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Speckle noise reduction for computer generated holograms of objects with diffuse surfaces
Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter
2016-04-01
Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.
O'Neill, Kelly C; Lee, Young Jin
2018-05-01
The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.
Cleaning of diffusion bonding surface by argon ion bombardment treatment
International Nuclear Information System (INIS)
Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru
2003-01-01
The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased
Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier
International Nuclear Information System (INIS)
Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.
2014-01-01
The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)
Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure
Energy Technology Data Exchange (ETDEWEB)
Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)
2010-05-03
Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.
Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion
Directory of Open Access Journals (Sweden)
N. Tsukahara
2012-01-01
Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.
International Nuclear Information System (INIS)
Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng
2014-01-01
Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces
Self-diffusion on copper surfaces
DEFF Research Database (Denmark)
Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel
1991-01-01
The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...
Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems
Czech Academy of Sciences Publication Activity Database
Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel
2008-01-01
Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008
Non-rigid registration of breast surfaces using the laplace and diffusion equations
Directory of Open Access Journals (Sweden)
Ou Jao J
2010-02-01
Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.
Free surface modelling with two-fluid model and reduced numerical diffusion of the interface
International Nuclear Information System (INIS)
Strubelj, Luka; Tiselj, Izrok
2008-01-01
Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening
Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies
Schoots, Koen
2007-01-01
This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer
A model for diffuse and global irradiation on horizontal surface
International Nuclear Information System (INIS)
Jain, P.C.
1984-01-01
The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory
Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)
DEFF Research Database (Denmark)
Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.
2002-01-01
We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...
International Nuclear Information System (INIS)
Lai, King C.; Liu, Da-Jiang; Evans, James W.
2017-01-01
For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.
International Nuclear Information System (INIS)
Melkior, T.; Motellier, S.; Yahiaoui, S.
2005-01-01
Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different
An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface
Directory of Open Access Journals (Sweden)
Yan-Zi Yu
2015-01-01
Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.
Transport and diffusion on crystalline surfaces under external forces
International Nuclear Information System (INIS)
Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H
2005-01-01
We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour
Directory of Open Access Journals (Sweden)
Ivan E Collier
Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.
International Nuclear Information System (INIS)
Vree, C; Mayr, S G
2010-01-01
The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.
Energy Technology Data Exchange (ETDEWEB)
Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)
2015-01-15
CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.
Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.
2015-01-01
CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.
International Nuclear Information System (INIS)
Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.
2015-01-01
CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth
Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V
2014-08-21
The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.
Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance
Boisvert, Ghyslain
Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la
Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao
2018-05-01
Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).
Energy Technology Data Exchange (ETDEWEB)
Manuel, Lozano [Iowa State Univ., Ames, IA (United States)
1996-01-12
The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.
International Nuclear Information System (INIS)
Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.
1976-01-01
Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated
Defects and diffusion, theory & simulation II
Fisher, David J
2010-01-01
This second volume in a new series covering entirely general results in the fields of defects and diffusion includes 356 abstracts of papers which appeared between the end of 2009 and the end of 2010. As well as the abstracts, the volume includes original papers on theory/simulation, semiconductors and metals: ""Predicting Diffusion Coefficients from First Principles ..."" (Mantina, Chen & Liu), ""Gouge Assessment for Pipes ..."" (Meliani, Pluvinage & Capelle), ""Simulation of the Impact Behaviour of ... Hollow Sphere Structures"" (Ferrano, Speich, Rimkus, Merkel & Öchsner), ""Elastic-Plastic
Energy Technology Data Exchange (ETDEWEB)
Abdel Razek, Ahmed Abdel Khalek; Abd El-Gaber, Nahed [Mansoura Faculty of Medicine, Department of Diagnostic Radiology, Mansoura (Egypt); Abdalla, Ahmed; Fathy, Abeer [Mansoura Faculty of Medicine, Department of Pediatric, Mansoura (Egypt); Azab, Ahmed [Mansoura Faculty of Medicine, Department of Neurology, Mansoura (Egypt); Rahman, Ashraf Abdel [Radiology Unit of Pediatric Hospital, Mansoura (Egypt)
2009-11-15
The aim of this work is to assess the usefulness of apparent diffusion coefficient (ADC) value of the brain for diagnosis of patients with Gaucher's disease type II and type III. Prospective study was conducted upon 13 patients (nine boys and four girls aged 8 months-14 years: mean 6.1 years) with Gaucher's disease type II and III and for age-matched control group (n = 13). Diffusion-weighted magnetic resonance imaging using a single-shot echo-planar imaging with a diffusion-weighted factor b of 0, 500, and 1,000 s/mm{sup 2} was done for all patients and volunteers. The ADC value was calculated in ten regions of the brain parenchyma and correlated with genotyping. There was significantly lower ADC value of the cortical frontal (P = 0.003), cortical temporal (P = 0.04), frontal subcortical white matter (P = 0.02), corticospinal tract (P = 0.001), cerebellum (P = 0.001), medulla (P = 0.002), and midbrain (P = 0.02) between patients and volunteers. There was significant difference in the ADC value of the frontal and temporal gray matter (P = 0.04 and 0.05, respectively) between patients with heterozygous and homozygous gene mutation. We concluded that ADC value is a new promising quantitative imaging parameter that can be used for the detection of brain abnormalities in patients with Gaucher's disease type II and type III and has a correlation with genotyping. (orig.)
Sorption and reduction of selenite on chlorite surfaces in the presence of Fe(II) ions.
Baik, Min Hoon; Lee, Seung Yeop; Jeong, Jongtae
2013-12-01
The sorption and reduction of selenite on chlorite surfaces in the presence of Fe(II) ions were investigated as a function of pH, Se(IV) concentration, and Fe(II) concentration under an anoxic condition. The sorption of Se(IV) onto chlorite surfaces followed the Langmuir isotherm regardless of the presence of Fe(II) ions in the solution. The Se(IV) sorption was observed to be very low at all pH values when the solution was Fe(II)-free or the concentration of Fe(II) ions was as low as 0.5 mg/L. However, the Se(IV) sorption was enhanced at a pH > 6.5 when the Fe(II) concentration was higher than 5 mg/L because of the increased sorption of Fe(II) onto the chlorite surfaces. XANES (X-ray absorption near edge structure) spectra of the Se K-edge showed that most of the sorbed Se(IV) was reduced to Se(0) by Fe(II) sorbed onto the chlorite surfaces, especially at pH > 9. The combined results of field-emission scanning electron microscopy (FE-SEM) and X-ray diffraction (XRD) also showed that elemental selenium and goethite were formed and precipitated on the chlorite surfaces during the sorption of selenite. Consequently it can be concluded that Se(IV) can be reduced to Se(0) in the presence of Fe(II) ions by the surface catalytic oxidation of Fe(II) into Fe(III) and the formation of goethite at neutral and particularly alkaline conditions. Thus the mobility of selenite in groundwater is expected to be reduced by the presence of a relatively higher concentration of Fe(II) in subsurface environments. Copyright © 2013 Elsevier Ltd. All rights reserved.
Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium
International Nuclear Information System (INIS)
R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein
2004-01-01
FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form
Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium
Energy Technology Data Exchange (ETDEWEB)
R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein
2004-12-14
FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.
Wang, Feng; Wang, Yuxiang; Zhou, Yan; Liu, Congrong; Xie, Lizhi; Zhou, Zhenyu; Liang, Dong; Shen, Yang; Yao, Zhihang; Liu, Jianyu
2017-12-01
To evaluate the utility of histogram analysis of monoexponential, biexponential, and stretched-exponential models to a dualistic model of epithelial ovarian cancer (EOC). Fifty-two patients with histopathologically proven EOC underwent preoperative magnetic resonance imaging (MRI) (including diffusion-weighted imaging [DWI] with 11 b-values) using a 3.0T system and were divided into two groups: types I and II. Apparent diffusion coefficient (ADC), true diffusion coefficient (D), pseudodiffusion coefficient (D*), perfusion fraction (f), distributed diffusion coefficient (DDC), and intravoxel water diffusion heterogeneity (α) histograms were obtained based on solid components of the entire tumor. The following metrics of each histogram were compared between two types: 1) mean; 2) median; 3) 10th percentile and 90th percentile. Conventional MRI morphological features were also recorded. Significant morphological features for predicting EOC type were maximum diameter (P = 0.007), texture of lesion (P = 0.001), and peritoneal implants (P = 0.001). For ADC, D, f, DDC, and α, all metrics were significantly lower in type II than type I (P histogram metrics of ADC, D, and DDC had significantly higher area under the receiver operating characteristic curve values than those of f and α (P histogram analysis. ADC, D, and DDC have better performance than f and α; f and α may provide additional information. 4 Technical Efficacy: Stage 1 J. Magn. Reson. Imaging 2017;46:1797-1809. © 2017 International Society for Magnetic Resonance in Medicine.
Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility
DEFF Research Database (Denmark)
Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes
1996-01-01
and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...
Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.
Directory of Open Access Journals (Sweden)
Sorenson Donna J
2009-12-01
Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.
Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence
Directory of Open Access Journals (Sweden)
Saiful Islam
2008-01-01
Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.
Assessing one-dimensional diffusion in nanoporous materials from transient concentration profiles
International Nuclear Information System (INIS)
Heinke, Lars; Kaerger, Joerg
2008-01-01
The use of interference microscopy has enabled the direct observation of transient concentration profiles generated by intracrystalline transport diffusion in nanoporous materials. The thus accessible intracrystalline concentration profiles contain a wealth of information which cannot be deduced by any macroscopic method. In this paper, we illustrate five different ways for determining the concentration-dependent diffusivity in one-dimensional systems and two for the surface permeability. These methods are discussed by application to concentration profiles evolving during the uptake of methanol by the zeolite ferrierite and of methanol by the metal organic framework (MOF) manganese(II) formate. We show that the diffusivity can be calculated most precisely by means of Fick's 1st law. As the circumstances permit, Boltzmann's integration method also yields very precise results. Furthermore, we present a simple procedure that enables the estimation of the influence of the surface barrier on the overall uptake process by plotting the boundary concentration versus the overall uptake
Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.
Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L
2017-01-01
The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.
Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.
2011-01-01
Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660
Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air
Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO
2018-01-01
Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.
A diffusive model for halo width growth during vertical displacement events
International Nuclear Information System (INIS)
Eidietis, N.W.; Humphreys, D.A.
2011-01-01
The electromagnetic loads produced by halo currents during vertical displacement events (VDEs) impose stringent requirements on the strength of ITER in-vessel components. A predictive understanding of halo current evolution is essential for ensuring the robust design of these components. A significant factor determining that evolution is the plasma resistance, which is a function of three quantities: the resistivities of the core and halo regions, and the halo region width. A diffusive model of halo width growth during VDEs has been developed, which provides one part of a physics basis for predictive halo current simulations. The diffusive model was motivated by DIII-D observations that VDEs with cold post-thermal quench plasma and a current decay time much faster than the vertical motion (type I VDE) possess much wider halo region widths than warmer plasma VDEs, where the current decay is much slower than the vertical motion (type II). A 2D finite element code is used to model the diffusion of toroidal halo current during selected type I and type II DIII-D VDEs. The model assumes a core plasma region within the last closed flux surface (LCFS) diffusing current into a halo plasma filling the vessel outside the LCFS. LCFS motion and plasma temperature are prescribed from experimental observations. The halo width evolution produced by this model compares favourably with experimental measurements of type I and type II toroidal halo current width evolution.
Effect of substrate surface on electromigration-induced sliding at hetero-interfaces
International Nuclear Information System (INIS)
Kumar, Praveen; Dutta, Indranath
2013-01-01
Electromigration (EM)-induced interfacial sliding between a metal film and Si substrate occurs when (i) only few grains exist across the width of the film and (ii) diffusivity through the interfacial region is significantly greater than diffusivity through the film. Here, the effect of the substrate surface layer on the kinetics of EM-induced interfacial sliding is assessed using Si substrates coated with various thin film interlayers. The kinetics of interfacial sliding, and therefore the EM-driven mass flow rate, strongly depends on the type of the interlayer (and hence the substrate surface composition), such that strongly bonded interfaces with slower interfacial diffusivity produce slower sliding. (paper)
Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.
Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian
2017-01-01
Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS
International Nuclear Information System (INIS)
Lou, D.C.; Solberg, J.K.; Borvik, T.
2009-01-01
This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.
Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.
2013-01-01
Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole
Energy Technology Data Exchange (ETDEWEB)
Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)
2013-12-14
The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.
International Nuclear Information System (INIS)
El-Shafey, E.I.
2010-01-01
A carbonaceous sorbent was prepared from rice husk via sulfuric acid treatment. Sorption of Zn(II) and Hg(II) from aqueous solution was studied varying time, pH, metal concentration, temperature and sorbent status (wet and dry). Zn(II) sorption was found fast reaching equilibrium within ∼2 h while Hg(II) sorption was slow reaching equilibrium within ∼120 h with better performance for the wet sorbent than for the dry. Kinetics data for both metals were found to follow pseudo-second order model. Sorption rate of both metals was enhanced with temperature rise. Activation energy, E a , for Zn(II) sorption, was ∼13.0 kJ/mol indicating a diffusion-controlled process ion exchange process, however, for Hg(II) sorption, E a was ∼54 kJ/mol indicating a chemically controlled process. Sorption of both metals was low at low pH and increased with pH increase. Sorption was much higher for Hg(II) than for Zn(II) with higher uptake for both metals by rising the temperature. Hg(II) was reduced to Hg(I) on the sorbent surface. This was confirmed from the identification of Hg 2 Cl 2 deposits on the sorbent surface by scanning electron microscopy and X-ray diffraction. However, no redox processes were observed in Zn(II) sorption. Sorption mechanism is discussed.
International Nuclear Information System (INIS)
Singh, Rajesh; Chadetrik, Rout; Kumar, Rajender; Bishnoi, Kiran; Bhatia, Divya; Kumar, Anil; Bishnoi, Narsi R.; Singh, Namita
2010-01-01
The present study was carried out to optimize the various environmental conditions for biosorption of Pb(II), Cd(II) and Cu(II) by investigating as a function of the initial metal ion concentration, temperature, biosorbent loading and pH using Trichoderma viride as adsorbent. Biosorption of ions from aqueous solution was optimized in a batch system using response surface methodology. The values of R 2 0.9716, 0.9699 and 0.9982 for Pb(II), Cd(II) and Cu(II) ions, respectively, indicated the validity of the model. The thermodynamic properties ΔG o , ΔH o , ΔE o and ΔS o by the metal ions for biosorption were analyzed using the equilibrium constant value obtained from experimental data at different temperatures. The results showed that biosorption of Pb(II) ions by T. viride adsorbent is more endothermic and spontaneous. The study was attempted to offer a better understating of representative biosorption isotherms and thermodynamics with special focuses on binding mechanism for biosorption using the FTIR spectroscopy.
Energy Technology Data Exchange (ETDEWEB)
Singh, Rajesh; Chadetrik, Rout; Kumar, Rajender; Bishnoi, Kiran; Bhatia, Divya; Kumar, Anil [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar 125001, Haryana (India); Bishnoi, Narsi R., E-mail: nrbishnoi@gmail.com [Department of Environmental Science and Engineering, Guru Jambheshwar University of Science and Technology, Hisar 125001, Haryana (India); Singh, Namita [Department of Bio and Nanotechnology, Guru Jambheshwar University of Science and Technology, Hisar 125001, Haryana (India)
2010-02-15
The present study was carried out to optimize the various environmental conditions for biosorption of Pb(II), Cd(II) and Cu(II) by investigating as a function of the initial metal ion concentration, temperature, biosorbent loading and pH using Trichoderma viride as adsorbent. Biosorption of ions from aqueous solution was optimized in a batch system using response surface methodology. The values of R{sup 2} 0.9716, 0.9699 and 0.9982 for Pb(II), Cd(II) and Cu(II) ions, respectively, indicated the validity of the model. The thermodynamic properties {Delta}G{sup o}, {Delta}H{sup o}, {Delta}E{sup o} and {Delta}S{sup o} by the metal ions for biosorption were analyzed using the equilibrium constant value obtained from experimental data at different temperatures. The results showed that biosorption of Pb(II) ions by T. viride adsorbent is more endothermic and spontaneous. The study was attempted to offer a better understating of representative biosorption isotherms and thermodynamics with special focuses on binding mechanism for biosorption using the FTIR spectroscopy.
International Nuclear Information System (INIS)
Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.
2014-01-01
Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments
International Nuclear Information System (INIS)
Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.
2009-01-01
Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces
Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System
DEFF Research Database (Denmark)
Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.
1999-01-01
in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...
Modeling diffuse sources of surface water contamination with plant protection products
Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David
2015-04-01
Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff
International Nuclear Information System (INIS)
Tertre, E.; Beaucaire, C.; Juery, A.; Ly, J.; Tertre, E.; Beaucaire, C.; Juery, A.; Ly, J.
2010-01-01
Sorption of inorganic elements onto carbonate minerals has been intensively described in the literature by two reaction steps: (1) a first one rapid and completed within a few hours and (2) a second one slower, eventually irreversible, and occurring at a constant rate. The first step is often attributed to an ion-exchange process, but its reversibility is rarely investigated. Consequently, discrimination of the global sorption phenomenon into two different mechanisms is not always justified. In this study, we investigated, by batch experiments, both sorption and desorption of Ca(II), HCO 3 - , and Zn(II), radiolabeled with isotopes 45 Ca(II), H 14 CO 3 - , and 65 Zn(II), respectively, onto synthetic pure calcite. Solutions were pre-equilibrated with atmospheric p(CO 2 ) and saturated with respect to calcite. Therefore, our purpose was to: (1) obtain experimental distribution coefficients of major elements (Ca(II) and HCO 3 - ) and a trace element (Zn(II)) onto calcite from sorption and desorption experiments, (2) test the validity of a first-occurring ion-exchange process generally noted in the literature, by calculating distribution coefficients for the 'sole' exchange process, and (3) quantify the amounts of Ca(II), HCO 3 - , and Zn(II) sorbed on the calcite surface by the sole 'exchange process' and compare them with surface crystallochemical data. Ca(II) or HCO 3 - sorption experimental data suggest that a significant fraction of these two elements was sorbed irreversibly onto or in the calcite. By using a method based on isotopic ratios, the Ca(II) or HCO 3 - concentrations, which are reversibly adsorbed on the calcite, have been quantified. These concentrations are respectively estimated at 4. 0 ± 2. 0 * 10 -4 and 7. 0 ± 1. 5 * 10 -4 mol/kg. The obtained Ca(II) surface concentration value is one order of magnitude lower than the one obtained from isotopic measurement by former authors [Geochim. Cosmochim. Acta 55 (1991) 1549; Geochim. Cosmochim. Acta 51
Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A
2014-02-01
Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.
International Nuclear Information System (INIS)
Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao
2014-01-01
We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance
International Nuclear Information System (INIS)
Seddeek, M.A.; Abdelmeguid, M.S.
2006-01-01
The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number
SURFACE BRIGHTNESS PROFILES OF DWARF GALAXIES. II. COLOR TRENDS AND MASS PROFILES
Energy Technology Data Exchange (ETDEWEB)
Herrmann, Kimberly A. [Penn State Mont Alto, 1 Campus Drive, Mont Alto, PA 17237 (United States); Hunter, Deidre A. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Elmegreen, Bruce G., E-mail: kah259@psu.edu, E-mail: dah@lowell.edu, E-mail: bge@us.ibm.com [IBM T. J. Watson Research Center, 1101 Kitchawan Road, Yorktown Heights, NY 10598 (United States)
2016-06-01
In this second paper of a series, we explore the B − V , U − B , and FUV−NUV radial color trends from a multi-wavelength sample of 141 dwarf disk galaxies. Like spirals, dwarf galaxies have three types of radial surface brightness profiles: (I) single exponential throughout the observed extent (the minority), (II) down-bending (the majority), and (III) up-bending. We find that the colors of (1) Type I dwarfs generally become redder with increasing radius, unlike spirals which have a blueing trend that flattens beyond ∼1.5 disk scale lengths, (2) Type II dwarfs come in six different “flavors,” one of which mimics the “U” shape of spirals, and (3) Type III dwarfs have a stretched “S” shape where the central colors are flattish, become steeply redder toward the surface brightness break, then remain roughly constant beyond, which is similar to spiral Type III color profiles, but without the central outward bluing. Faint (−9 > M{sub B} > −14) Type II dwarfs tend to have continuously red or “U” shaped colors and steeper color slopes than bright (−14 > M{sub B} > −19) Type II dwarfs, which additionally have colors that become bluer or remain constant with increasing radius. Sm dwarfs and BCDs tend to have at least some blue and red radial color trend, respectively. Additionally, we determine stellar surface mass density (Σ) profiles and use them to show that the break in Σ generally remains in Type II dwarfs (unlike Type II spirals) but generally disappears in Type III dwarfs (unlike Type III spirals). Moreover, the break in Σ is strong, intermediate, and weak in faint dwarfs, bright dwarfs, and spirals, respectively, indicating that Σ may straighten with increasing galaxy mass. Finally, the average stellar surface mass density at the surface brightness break is roughly 1−2 M {sub ⊙} pc{sup −2} for Type II dwarfs but higher at 5.9 M {sub ⊙} pc{sup −2} or 27 M {sub ⊙} pc{sup −2} for
Diffusion Influenced Adsorption Kinetics.
Miura, Toshiaki; Seki, Kazuhiko
2015-08-27
When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.
Spectroscopic evidence for ternary surface complexes in the lead(II)-malonic acid-hematite system
Lenhart, J.J.; Bargar, J.R.; Davis, J.A.
2001-01-01
Using extended X-ray absorption fine structure (EXAFS) and attenuated total reflectance Fourier-transform infrared (ATR-FTIR) measurements, we examined the sorption of Pb(II) to hematite in the presence of malonic acid. Pb LIII-edge EXAFS measurements performed in the presence of malonate indicate the presence of both Fe and C neighbors, suggesting that a major fraction of surface-bound malonate is bonded to adsorbed Pb(II). In the absence of Pb(II), ATR-FTIR measurements of sorbed malonate suggest the formation of more than one malonate surface complex. The dissimilarity of the IR spectrum of malonate sorbed on hematite to those for aqueous malonate suggest at least one of the sorbed malonate species is directly coordinated to surface Fe atoms in an inner-sphere mode. In the presence of Pb, little change is seen in the IR spectrum for sorbed malonate, indicating that geometry of malonate as it coordinates to sorbed Pb(II) adions is similar to the geometry of malonate as it coordinates to Fe in the hematite surface. Fits of the raw EXAFS spectra collected from pH 4 to pH 8 result in average Pb-C distances of 2.98 to 3.14 A??, suggesting the presence of both four- and six-membered Pb-malonate rings. The IR results are consistent with this interpretation. Thus, our results suggest that malonate binds to sorbed Pb(II) adions, forming ternary metal-bridging surface complexes. ?? 2001 Academic Press.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
CURVATURE-DRIVEN MOLECULAR FLOW ON MEMBRANE SURFACE.
Mikucki, Michael; Zhou, Y C
2017-01-01
This work presents a mathematical model for the localization of multiple species of diffusion molecules on membrane surfaces. Morphological change of bilayer membrane in vivo is generally modulated by proteins. Most of these modulations are associated with the localization of related proteins in the crowded lipid environments. We start with the energetic description of the distributions of molecules on curved membrane surface, and define the spontaneous curvature of bilayer membrane as a function of the molecule concentrations on membrane surfaces. A drift-diffusion equation governs the gradient flow of the surface molecule concentrations. We recast the energetic formulation and the related governing equations by using an Eulerian phase field description to define membrane morphology. Computational simulations with the proposed mathematical model and related numerical techniques predict (i) the molecular localization on static membrane surfaces at locations with preferred mean curvatures, and (ii) the generation of preferred mean curvature which in turn drives the molecular localization.
3D-CFD analysis of diffusion and emission of VOCs in a FLEC cavity.
Zhu, Q; Kato, S; Murakami, S; Ito, K
2007-06-01
This study is performed as a part of research that examines the emission and diffusion characteristics of volatile organic compounds (VOCs) from indoor building materials. In this paper, the flow field and the emission field of VOCs from the surface of building materials in a Field and Laboratory Emission Cell (FLEC) cavity are examined by 3D Computational Fluid Dynamics (CFD) analysis. The flow field within the FLEC cavity is laminar. With a total flow of 250 ml/min, the air velocity near the test material surface ranges from 0.1 to 4.5 cm/s. Three types of emission from building materials are studied here: (i) emission phenomena controlled by internal diffusion, (ii) emission phenomena controlled by external diffusion, and (iii) emission phenomena controlled by mixed diffusion (internal + external diffusion). In the case of internal diffusion material, with respect to the concentration distribution in the cavity, the local VOC emission rate becomes uniform and the FLEC works well. However, in the case of evaporation type (external diffusion) material, or mixed type materials (internal + external diffusion) when the resistance to transporting VOCs in the material is small, the FLEC is not suitable for emission testing because of the thin FLEC cavity. In this case, the mean emission rate is restricted to a small value, since the VOC concentration in the cavity rises to the same value as the surface concentration through molecular diffusion within the thin cavity, and the concentration gradient normal to the surface becomes small. The diffusion field and emission rate depend on the cavity concentration and on the Loading Factor. That is, when the testing material surface in the cavity is partially sealed to decrease the Loading Factor, the emission rate become higher with the decrease in the exposed area of the testing material. The flow field and diffusion field within the FLEC cavity are investigated by CFD method. After presenting a summary of the velocity
Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu
Energy Technology Data Exchange (ETDEWEB)
Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)
2014-02-28
A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.
Diffraction and diffusion in room acoustics
DEFF Research Database (Denmark)
Rindel, Jens Holger; Rasmussen, Birgit
1996-01-01
Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....
1992-11-01
is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987
Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.
2014-01-01
Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582
Energy Technology Data Exchange (ETDEWEB)
Lawrenz, M.
2007-10-30
In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)
International Nuclear Information System (INIS)
Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf
2016-01-01
We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)
Li, Xiaofan; Nie, Qing
2009-07-01
Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.
Syntheses and spectroscopic properties of mercury(II) and nickel(II ...
African Journals Online (AJOL)
Mercury(II) complex, [Hg2(BPTU-2H)Cl2] and nickel(II) complex, [Ni(BPTU-H)2] were prepared by reacting Bis(N-phenylthiourea), BPTU, with mercury(II) chloride and nickel(II) acetate respectively. The complexes were characterized by IR, diffuse reflectance, 1H NMR spectra and elemental analysis. BPTU acts as ...
International Nuclear Information System (INIS)
Imran, M; Nazir, S.; Latif, S.; Mahmood, Z.
2010-01-01
Cr(III), Co(II), Ni(II), Cu(II) and Zn(II) complexes of 2-(4-Nitrophenyl aminocarbonyl)benzoic acid were synthesized and characterized on the basis of physical, analytical and spectroscopic data. The ligands, as well as its metal complexes were checked for their in-vitro antimicrobial activity against three bacterial strains, Mycobacterium smegmatis, Escherichia coli, Pseudomonas aeuroginosa, and three fungal strains, Nigrospora oryzae, Aspergillus niger and Candida albicans. Disc diffusion method and Tube diffusion test were used for antibacterial and antifungal activities, respectively. The synthesized complexes only show significant antifungal activity but inactive for antibacterial, however, in general, the metal complexes were found to be more active against antimicrobial activities as compared to their un complexed ligand. (author)
International Nuclear Information System (INIS)
Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu
2014-01-01
First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.
Energy Technology Data Exchange (ETDEWEB)
Raja, Rajikha; Sinha, Neelam [International Institute of Information Technology-Bangalore, Bangalore (India); Saini, Jitender; Mahadevan, Anita; Rao, K.V.L. Narasinga; Swaminathan, Aarthi [National Institute of Mental Health and Neurosciences, Bangalore (India)
2016-12-15
In this work, we aim to assess the significance of diffusion tensor imaging (DTI) and diffusion kurtosis imaging (DKI) parameters in grading gliomas. Retrospective studies were performed on 53 subjects with gliomas belonging to WHO grade II (n = 19), grade III (n = 20) and grade IV (n = 14). Expert marked regions of interest (ROIs) covering the tumour on T2-weighted images. Statistical texture measures such as entropy and busyness calculated over ROIs on diffusion parametric maps were used to assess the tumour heterogeneity. Additionally, we propose a volume heterogeneity index derived from cross correlation (CC) analysis as a tool for grading gliomas. The texture measures were compared between grades by performing the Mann-Whitney test followed by receiver operating characteristic (ROC) analysis for evaluating diagnostic accuracy. Entropy, busyness and volume heterogeneity index for all diffusion parameters except fractional anisotropy and anisotropy of kurtosis showed significant differences between grades. The Mann-Whitney test on mean diffusivity (MD), among DTI parameters, resulted in the highest discriminability with values of P = 0.029 (0.0421) for grade II vs. III and P = 0.0312 (0.0415) for III vs. IV for entropy (busyness). In DKI, mean kurtosis (MK) showed the highest discriminability, P = 0.018 (0.038) for grade II vs. III and P = 0.022 (0.04) for III vs. IV for entropy (busyness). Results of CC analysis illustrate the existence of homogeneity in volume (uniformity across slices) for lower grades, as compared to higher grades. Hypothesis testing performed on volume heterogeneity index showed P values of 0.0002 (0.0001) and 0.0003 (0.0003) between grades II vs. III and III vs. IV, respectively, for MD (MK). In summary, the studies demonstrated great potential towards automating grading gliomas by employing tumour heterogeneity measures on DTI and DKI parameters. (orig.)
International Nuclear Information System (INIS)
Raja, Rajikha; Sinha, Neelam; Saini, Jitender; Mahadevan, Anita; Rao, K.V.L. Narasinga; Swaminathan, Aarthi
2016-01-01
In this work, we aim to assess the significance of diffusion tensor imaging (DTI) and diffusion kurtosis imaging (DKI) parameters in grading gliomas. Retrospective studies were performed on 53 subjects with gliomas belonging to WHO grade II (n = 19), grade III (n = 20) and grade IV (n = 14). Expert marked regions of interest (ROIs) covering the tumour on T2-weighted images. Statistical texture measures such as entropy and busyness calculated over ROIs on diffusion parametric maps were used to assess the tumour heterogeneity. Additionally, we propose a volume heterogeneity index derived from cross correlation (CC) analysis as a tool for grading gliomas. The texture measures were compared between grades by performing the Mann-Whitney test followed by receiver operating characteristic (ROC) analysis for evaluating diagnostic accuracy. Entropy, busyness and volume heterogeneity index for all diffusion parameters except fractional anisotropy and anisotropy of kurtosis showed significant differences between grades. The Mann-Whitney test on mean diffusivity (MD), among DTI parameters, resulted in the highest discriminability with values of P = 0.029 (0.0421) for grade II vs. III and P = 0.0312 (0.0415) for III vs. IV for entropy (busyness). In DKI, mean kurtosis (MK) showed the highest discriminability, P = 0.018 (0.038) for grade II vs. III and P = 0.022 (0.04) for III vs. IV for entropy (busyness). Results of CC analysis illustrate the existence of homogeneity in volume (uniformity across slices) for lower grades, as compared to higher grades. Hypothesis testing performed on volume heterogeneity index showed P values of 0.0002 (0.0001) and 0.0003 (0.0003) between grades II vs. III and III vs. IV, respectively, for MD (MK). In summary, the studies demonstrated great potential towards automating grading gliomas by employing tumour heterogeneity measures on DTI and DKI parameters. (orig.)
Syntheses and spectroscopic properties of mercury(II) and nickel(II ...
African Journals Online (AJOL)
Syntheses and spectroscopic properties of mercury(II) and nickel(II) ... The complexes were characterized by IR, diffuse reflectance, 1H NMR spectra and elemental ... coordinating through thiolato sulphur and hydrazinic nitrogen atoms.
Extraction of minority carrier diffusion length of MWIR Type-II superlattice nBp detector
Taghipour, Zahra; Kazemi, Alireza; Myers, Stephen; Wijewarnasuriya, Priyalal; Mathews, Sen; Steenbergen, Elizabeth H.; Morath, Christian; Cowan, Vincent M.; Ariyawansa, Gamini; Scheihing, John; Krishna, Sanjay
2017-08-01
We present a model for the spectral external quantum efficiency (EQE) to extract the minority carrier diffusion length (Ln) of a unipolar nBp InAs/GaSb Type-II superlattice (T2SL) mid-wave infrared (MWIR) detector. The detector consists of a 4 μm thick p-doped 10ML InAs/10ML GaSb SL absorber with a 50% cut-off wavelength of 5 μm at 80 K and zero bias. The n-type doped InAs/AlSb SL barrier in the structure was included to reduce the GR dark current. By fitting the experimentally measured EQE data to the theoretically calculated QE based on the solution of the drift-diffusion equation, the p-type absorber was found the have Ln = 10 +/- 0.5 μm at 80K, and Ln = 12 +/- 0.5 μm at 120K and 150K. We performed the absorption coefficient measurement at different temperatures of interest. Also, we estimated the reduced background concentration and the built-in potential by utilizing a capacitance-voltage measurement technique. We used time-resolved-photoluminescence (TRPL) to determine the lifetime at 80K. With the result of the model and the lifetime measurement, we calculated the diffusion coefficient and the mobility in the T2SL detector at various temperatures. Also, we studied the behavior of different dark current mechanisms by fitting the experimentally measured and simulated dark current density under different operating temperatures and biases.
Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers
Directory of Open Access Journals (Sweden)
N. Javid Rouzi
2009-04-01
Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly high performance, is achieved by covering the top surface of the barrier closed to the receiver by just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted insertion loss in this barrier is predicted to be 16.3 dB (A.
International Nuclear Information System (INIS)
Anderson, R.C.
1976-01-01
A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions
Advection and diffusion in random media implications for sea surface temperature anomalies
Piterbarg, Leonid I
1997-01-01
The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.
Surface oxidization-reduction reactions in Columbia Plateau basalts
International Nuclear Information System (INIS)
White, A.F.; Yee, A.
1984-01-01
Results are presented which define principal oxidation-reduction reactions expected between ground water and iron in the Umtanum and Cohassett basalt flows of south central Washington. Data include kinetics of aqueous iron speciation, rates of O 2 uptake and nature of oxyhydroxide precipitates. Such data are important in predicting behavior of radionuclides in basalt aquifers including determination of valence states, speciation, solubility, sorption, and coprecipitation on iron oxyhydroxide substrates and colloids. Analyses of the basalt by XPS indicates that ferrous iron is oxidized to ferric iron on the surface and that the total iron decreases as a function of pH during experimental weathering. Iron oxyhydroxide phases did not form surface coating on basalt surfaces but rather nucleated as separate plases in solution. No significant increases in Cs or Sr sorption were observed with increased weathering of the basalt. Concurrent increases in Fe(II) and decreases in Fe(III) in slightly to moderately acid solutions indicated continued oxidization of ferrous iron in the basalt. At neutral to basic pH, Fe(II) was strongly sorbed onto the basalt surface (Kd = 6.5 x 10 -3 1 x m 2 ) resulting in low dissolved concentrations even under anoxic conditions. The rate of O 2 uptake increased with decreasing pH. Diffusion rates (-- 10 -14 cm 2 x s -1 ), calculated using a one-dimensional analytical model, indicate grain boundary diffusion. Comparisons of Eh values calculated by Pt electrode, dissolved O 2 and Fe(II)/Fe(III) measurements showed considerable divergence, with the ferric-ferrous couple being the preferred method of estimating Eh
Experimental Electron Heat Diffusion in TJ-II ECRH Plasmas
Energy Technology Data Exchange (ETDEWEB)
Vargas, V.I.; Lopez-Bruna, D.; Herranz, J.; Castejon, F.
2006-07-01
Interpretative transport has been used to revisit the global scalings of TJ-II ECRH plasmas from a local perspective. Density, rotational transform and ERCH power scans were analysed based upon Thomson Scattering data (electron density and temperature) in steady state discharges. A simple formula to obtain the thermal conductivity, assuming pure diffusion and negligible convective heat fluxes was used in a set of 161 discharges. All the analysis was performed with the ASTRA transport shell. The density scan indicates that inside n=0,4 there is no significant change of e with density in the range studied (0.4
Experimental Electron Heat Diffusion in TJ-II ECRH Plasmas
International Nuclear Information System (INIS)
Vargas, V.I.; Lopez-Bruna, D.; Herranz, J.; Castejon, F.
2006-01-01
Interpretative transport has been used to revisit the global scalings of TJ-II ECRH plasmas from a local perspective. Density, rotational transform and ERCH power scans were analysed based upon Thomson Scattering data (electron density and temperature) in steady state discharges. A simple formula to obtain the thermal conductivity, assuming pure diffusion and negligible convective heat fluxes was used in a set of 161 discharges. All the analysis was performed with the ASTRA transport shell. The density scan indicates that inside n=0,4 there is no significant change of e with density in the range studied (0.4 (1019m-3) 1.0), while in 0,5 <0,8 approximately, e decreases with density. In the rotational transform scan it is found that the values of e when a low order rational of the rotational transform is present locally seem to be smaller for the corresponding range, although it is apparent a general beneficial effect of the corresponding change in magnetic structure. Finally, in the ECRH power scan, e is found to have an overall increment in 0,2< n0,6 when QECH increases from 200 to 400 kW, although it is less significant in the density gradient region (n 0,7). (Author) 22 refs
International Nuclear Information System (INIS)
Woznicki, Z.
1979-06-01
This report presents the AGA two-sweep iterative methods belonging to the family of factorization techniques in their practical application in the HEXAGA-II two-dimensional programme to obtain the numerical solution to the multi-group, time-independent, (real and/or adjoint) neutron diffusion equations for a fine uniform triangular mesh. An arbitrary group scattering model is permitted. The report written for the users provides the description of input and output. The use of HEXAGA-II is illustrated by two sample reactor problems. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)
2016-09-15
Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.
Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations
Energy Technology Data Exchange (ETDEWEB)
Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)
2013-09-30
Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with
First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion
International Nuclear Information System (INIS)
Wu, M H; Liu, X H; Gu, J F; Jin, Z H
2013-01-01
Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)
Models of diffuse solar radiation
Energy Technology Data Exchange (ETDEWEB)
Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)
2008-04-15
For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)
I. Surface properties of neutron-rich nuclei. II. Pion condensation at finite temperature
International Nuclear Information System (INIS)
Kolehmainen, K.A.
1983-01-01
In part I, the energy density formalism, the Thomas-Fermi approximation, and Skyrme-type interactions were used to describe the energy density of a semi-infinite slab of neturon-rich nuclear matter at zero temperature. The existence of a drip phase at low proton fractions is allowed in addition to the more dense nuclear phase, and various bulk properties of both phases are found when the system is in equilibrium. The usual definition of the surface energy is extended to apply to the case where drip is present. Assuming a Fermi function type density profile, a constrained variational calculation is performed to determine the neutron and proton surface diffuseness parameters, the thickness of the neutron skin, and the surface energy. Results are obtained for proton fractions reanging from 0.5 (symmetric nuclear matter) to zero (pure neutron matter) for most Skyrme-type interactions in common use. The results are in close agreement with the predictions of the droplet model, as well as with the results of more exact calculations in those cases where the more exact results exist (only for symmetric or nearly symmetric matter in most cases). Significantly different asymmetry dependences for different interactions are found. In part II, several simple but increasingly complex models are used to calculate the threshold for charged pion condensation in neutron-rich nuclear matter at finite temperature. Unlike in mean field theory descriptions of pion condensation, the effects of thermal excitations of the pion field are included. The thermal pion excitations have two important effects: first, to modify the phase diagram qualitatively from that predicted by mean field theory, and second, to make the phase transition to a spatially nonuniform condensed state at finite temperature always first, rather than second, order
A desk study of surface diffusion and mass transport in clay
International Nuclear Information System (INIS)
Cook, A.J.
1989-01-01
Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues
Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface
Energy Technology Data Exchange (ETDEWEB)
Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)
2009-08-15
Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.
Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut
2016-03-01
Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.
NMR diffusion and relaxation measurements of organic molecules adsorbed in porous media
International Nuclear Information System (INIS)
Gjerdaaker, Lars
2002-01-01
The work in this thesis can be divided into two parts. The first part is focused on dynamic investigations of plastic crystals, both in bulk phases but also confined in porous materials (paper 1-3). This part was done together with professor Liudvikas Kimtys, Vilnius, Lithuania. The second part, with emphasis on diffusion, employed PFG NMR to measure the true intra-crystalline diffusivity, including development of a new pulse sequence with shorter effective diffusion time. This work was performed in collaboration with Dr. Geir H. Soerland, Trondheim, Norway and has resulted in three papers (paper 4-6). Paper 1-3: In these papers the dynamics of three organic compounds confined within mesoporous silica have been studied, and the results are discussed with reference to the bulk material. The three investigated compounds form disordered (plastic) phases of high symmetry on solidification (solid I). Thus, bulk cyclohexane exhibits a disordered phase between the solid-solid phase transition at 186 K and the melting point at 280 K. X-ray diffraction measurements have shown that solid I is face-centred cubic (Z=4, a=0.861 nm at 195 K), while the ordered solid II is monoclinic. Tert-butyl cyanide exhibits a plastic phase between the solid-solid transition point at 233 K and the melting point at 292 K. Neutron scattering techniques have established that solid I is tetragonal (Z=2, a=b=0.683 nm, c=0.674 nm, beta=90 deg at 234 K), while solid II is monoclinic. Finally, the disordered phase of pivalic acid melts at 310 K and undergoes a solid-solid phase transition at 280 K. The disordered phase is face-centred cubic, (Z=4, a=0.887 nm), while the low temperature phase (solid II) is triclinic. Paper 4-6; If one is aiming to measure true intra-crystallite diffusivities in porous media the distance travelled by the molecules during the pulse must be shorter than the size of the crystallite. The length of the diffusion time is therefore important. Working with heterogeneous media
Energy Technology Data Exchange (ETDEWEB)
Wang, Qiang; Kong, Xiang-Ping; Zhang, Bao-Hua; Wang, Juan, E-mail: juaner80@163.com
2017-08-31
Highlights: • Zn(II) adsorption on two types of neutral kaolinite(001) surfaces is investigated. • Surface “Ou” is found the preferred site for mono- and bi-dentate complexes. • Both Zn(II) and surface oxygen accept electrons from aqua oxygens. • Coupling of O 2p with Zn sp{sup 3}d{sup 2} (or sp{sup 3}) hybridization states is the bonding nature. - Abstract: Adsorption of Zn(II) on two types of neutral (001) surfaces of kaolinite, tetrahedral Si(t) and octahedral Al(o), was studied by means of DFT calculations and classical molecular dynamics simulations. The position and structure for both outer-sphere and mono-/bi-dentate inner-sphere complexes of Zn(II) in aqueous environment were examined, with binding energy and radial distribution function calculated. Outer-sphere complex on the Si(t) surface, monodentate inner-sphere complex of “O{sub u}” (surface oxygen with “upright” hydrogen) site and bidentate complex of “O{sub u}-O{sub u}” site of neighboring Al centers on the Al(o) surface are considered to be the dominant adsorption species. The outer-sphere complex is found six-coordinated with distorted octahedral geometry, while both the inner-sphere complexes exhibit the tetrahedral structure with coordination number of four. Hydrogen bonding interactions between oxygen or hydrogen of the kaolinite(001) surfaces and the aqua ligands of Zn(II) act as the key role for the structure and stability of adsorption complexes. Upon the Mulliken population analysis and partial density of states, both Zn(II) and surface oxygen accept electrons from aqua oxygens, and coupling of O 2p with the sp{sup 3}d{sup 2} or sp{sup 3} hybridization states of Zn(II) is the primary bonding nature of Zn(II) with oxygen in outer- and inner-sphere complexes, respectively.
Surface diffusion driven morphological instability in free-standing nickel nanorod arrays
Energy Technology Data Exchange (ETDEWEB)
Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)
2014-07-28
Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.
International Nuclear Information System (INIS)
Solovetskii, Yu.I.; Miroshinichenko, I.I.; Lunin, V.V.
1993-01-01
Radiation-thermal damage of the surface and the active metal phases of hydrodesulfurization Ni-Mo/Al 2 O 3 catalysts by a fast electron beam of up to 2.0 MeV energy was studied. UV-Vis diffuse reflectance spectra of the industrial and model coked systems after radiation-thermal treatment were measured. 14 refs., 2 figs
Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface
International Nuclear Information System (INIS)
Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua
2010-01-01
Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3 cm 2 s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory
Diffusion-controlled regime of surface-wave-produced plasmas in helium gas
International Nuclear Information System (INIS)
Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A
2002-01-01
The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown
Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.
2018-01-01
Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.
Large-scale Validation of AMIP II Land-surface Simulations: Preliminary Results for Ten Models
Energy Technology Data Exchange (ETDEWEB)
Phillips, T J; Henderson-Sellers, A; Irannejad, P; McGuffie, K; Zhang, H
2005-12-01
This report summarizes initial findings of a large-scale validation of the land-surface simulations of ten atmospheric general circulation models that are entries in phase II of the Atmospheric Model Intercomparison Project (AMIP II). This validation is conducted by AMIP Diagnostic Subproject 12 on Land-surface Processes and Parameterizations, which is focusing on putative relationships between the continental climate simulations and the associated models' land-surface schemes. The selected models typify the diversity of representations of land-surface climate that are currently implemented by the global modeling community. The current dearth of global-scale terrestrial observations makes exacting validation of AMIP II continental simulations impractical. Thus, selected land-surface processes of the models are compared with several alternative validation data sets, which include merged in-situ/satellite products, climate reanalyses, and off-line simulations of land-surface schemes that are driven by observed forcings. The aggregated spatio-temporal differences between each simulated process and a chosen reference data set then are quantified by means of root-mean-square error statistics; the differences among alternative validation data sets are similarly quantified as an estimate of the current observational uncertainty in the selected land-surface process. Examples of these metrics are displayed for land-surface air temperature, precipitation, and the latent and sensible heat fluxes. It is found that the simulations of surface air temperature, when aggregated over all land and seasons, agree most closely with the chosen reference data, while the simulations of precipitation agree least. In the latter case, there also is considerable inter-model scatter in the error statistics, with the reanalyses estimates of precipitation resembling the AMIP II simulations more than to the chosen reference data. In aggregate, the simulations of land-surface latent and
Energy Technology Data Exchange (ETDEWEB)
Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)
2015-02-14
Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.
Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng
2015-02-14
Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.
Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments
DEFF Research Database (Denmark)
Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter
2017-01-01
) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...
Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun
2012-09-24
We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.
Electrolyte diffusion in compacted montmorillonite engineered barriers
International Nuclear Information System (INIS)
Jahnke, F.M.; Radke, C.J.
1985-09-01
The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab
Li, Kun-Quan; Wang, Yan-Jin; Yang, Mei-Rong; Zhu, Zhi-Qiang; Zheng, Zheng
2014-08-01
Bagasse mesoporous carbon was prepared by microwave assisted H3 PO4 activation. Amido and imido groups were modified with ethanediamine on the channels' surface of mesoporous carbon through nitric oxidation and amide reaction. The influence of Pb(II) concentration, adsorption time on Pb(II) adsorption on the ethanediamine-modified mesoporous carbon (AC-EDA) was investigated. The adsorption kinetics and mechanism were also discussed. The results showed that AC-EDA had a great performance for Pb(II) adsorption, and more than 70% of Pb(II) was adsorbed in 5 minutes. The adsorption amount of Pb(II) on the carbon increased with the increase of solution pH in acidic conditions. It was found that AC-EDA had different binding energies on different adsorption sites for Pb(II) separation. The Pb(II) adsorption process on AC-EDA was controlled by intra-particle diffusion in the first 3 min, and then film diffusion played the important pole on the adsorption. The adsorption amount increased with the increase of temperature, indicating the adsorption was an endothermic reaction. The high adsorption energy (> 11 kJ x mol(-1)) implied that the) adsorption was a chemical adsorption. The XPS of AC-EDA before and after Pb(II) adsorption showed that the polyamine group was involved in the adsorption, and should be a main factor of the high efficient adsorption.
International Nuclear Information System (INIS)
Bremier, Stephane
1997-01-01
This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive
Bodsgard, Brett R; Clark, Robert W; Ehrbar, Anthony W; Burstyn, Judith N
2009-04-07
A series of silica-bound Cu(ii) triazacyclononane materials was prepared to study the effect of linker length and surface hydrophobicity on the hydrolysis of phosphate esters. The general synthetic approach for these heterogeneous reagents was rhodium-catalyzed hydrosilation between an alkenyl-modified triazacyclononane and hydride-modified silica followed by metallation with a Cu(ii) salt. Elemental analysis confirmed that organic functionalization of the silica gel was successful and provided an estimate of the surface concentration of triazacyclononane. EPR spectra were consistent with square pyramidal Cu(ii), indicating that Cu(ii) ions were bound to the immobilized macrocycles. The hydrolytic efficacies of these heterogeneous reagents were tested with bis(p-nitrophenyl)phosphate (BNPP) and diethyl 4-nitrophenyl phosphate (paraoxon). The agent that performed best was an octyl-linked, propanol-blocked material. This material had the most hydrophilic surface and the most accessible active site, achieving a rate maximum on par with the other materials, but in fewer cycles and without an induction period.
Fractional diffusion equations and anomalous diffusion
Evangelista, Luiz Roberto
2018-01-01
Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.
Carbon out-diffusion mechanism for direct graphene growth on a silicon surface
International Nuclear Information System (INIS)
Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok
2015-01-01
Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications
Bläckberg, Lisa
2014-01-01
This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...
Directory of Open Access Journals (Sweden)
Wojciech Szmyt
2017-01-01
Full Text Available In this work we modelled the diffusive transport of a dilute gas along arrays of randomly distributed, vertically aligned nanocylinders (nanotubes or nanowires as opposed to gas diffusion in long pores, which is described by the well-known Knudsen theory. Analytical expressions for (i the gas diffusion coefficient inside such arrays, (ii the time between collisions of molecules with the nanocylinder walls (mean time of flight, (iii the surface impingement rate, and (iv the Knudsen number of such a system were rigidly derived based on a random-walk model of a molecule that undergoes memoryless, diffusive reflections from nanocylinder walls assuming the molecular regime of gas transport. It can be specifically shown that the gas diffusion coefficient inside such arrays is inversely proportional to the areal density of cylinders and their mean diameter. An example calculation of a diffusion coefficient is delivered for a system of titanium isopropoxide molecules diffusing between vertically aligned carbon nanotubes. Our findings are important for the correct modelling and optimisation of gas-based deposition techniques, such as atomic layer deposition or chemical vapour deposition, frequently used for surface functionalisation of high-aspect-ratio nanocylinder arrays in solar cells and energy storage applications. Furthermore, gas sensing devices with high-aspect-ratio nanocylinder arrays and the growth of vertically aligned carbon nanotubes need the fundamental understanding and precise modelling of gas transport to optimise such processes.
International Nuclear Information System (INIS)
Posadillo, R.; Lopez Luque, R.
2009-01-01
The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.
Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.
2014-01-01
Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both
Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface
Energy Technology Data Exchange (ETDEWEB)
Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)
2009-09-15
Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.
Surface mobilities on solid materials
International Nuclear Information System (INIS)
Binh, V.T.
1983-01-01
This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)
NMR studies of hydrogen diffusion in hydrogen uranyl phosphate tetrahydrate (HUP)
International Nuclear Information System (INIS)
Metcalfe, K.
1988-01-01
1 H NMR spin-lattice relaxation times, T 1 (Zeeman) and T 1p (rotating frame) and spin-spin relaxation times, T 2 , and 31 P NMR solid-echoes are reported for phase I and II of hydrogen uranyl phosphate tetrahydrate (HUP) at temperatures in the range 200-323 K. The spectral density functions extracted from the measured relaxation times for phases I and II are consistent with a 2D diffusion mechanism for hydrogen motion. 31 P second moments determined from the solid-echoes show that all the hydrogens diffuse rapidly in phase I, and that the hydrogen-bond site nearest to the phosphate oxygen is not occupied in phase II. The mechanism for diffusion in phase II is discussed. 30 refs.; 6 figs.; 2 tabs
Energy Technology Data Exchange (ETDEWEB)
Wei, C.Y.; Seidman, D.N.
1976-11-01
Direct and visible evidence was obtained for long-range migration of self-interstitial atoms (SIAs) in Stage II of three different ion-irradiated platinum (gold) alloys. Field-ion microscope (FIM) specimens of Pt--0.10, 0.62 and 4.0 at. percent Au alloys were irradiated in-situ with 30-keV W/sup +/ or Pt/sup +/ ions at a tip temperature of 35 to 41 K at 2 x 10/sup -9/ torr. Direct observation of the surfaces of the FIM specimens during isochronal warming experiments to 100 K showed that a flux of SIAs crossed the surfaces of the specimens between 40 to 100 K. The spectrum for each alloy consisted of two recovery peaks (substages II/sub B/ and II/sub C/). The results are explained on the basis of an impurity-delayed diffusion mechanism employing a two-level trapping model. The application of this diffusion model to the isochronal recovery spectra yielded a dissociation enthalpy (DELTAh/sub li-Au//sup diss/) and an effective diffusion coefficient for each substage; for substage II/sub B/ DELTAh/sub li-Au//sup diss/ (II/sub B/) = 0.15 eV and for substage II/sub C/ DELTAh/sub li-Au//sup diss/ (II/sub C/) = 0.24 eV. A series of detailed control experiments was also performed to show that the imaging electric field had not caused the observed long-range migration of SIAs and that the observed effects were not the result of surface artifacts. 14 figures, 6 tables.
Czech Academy of Sciences Publication Activity Database
Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.
2015-01-01
Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015
Diffusion of Ti in α-Zr single crystals
International Nuclear Information System (INIS)
Hood, G.M.; Zou, H.; Schultz, R.J.; Jackman, J.A.
1994-11-01
Ti diffusion coefficients (D) have been measured in nominally pure αZr single crystals (773-1124 K) in directions both parallel (D pa ) and perpendicular (D pe , few data) to the c-axis: tracer techniques and secondary ion mass spectrometry were used to determine the diffusion profiles. The results show a temperature dependence which suggests two regions of diffusion behaviour. Above 1035 K, region I, diffusion conforms to the expectations of intrinsic behaviour with normal Arrhenius law constants: D pa = 1.7 x 10 -3 exp(-2.93 ± 0.08 eV/kΤ) m 2 /s. Below 1035 K, region II, D's are enhanced with respect to an extrapolation of region I behaviour. The region II data are associated with extrinsic effects. (author). 13 refs., 1 tab., 3 figs
Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T
2001-11-01
The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.
Energy Technology Data Exchange (ETDEWEB)
Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)
2017-11-01
In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)
Energy Technology Data Exchange (ETDEWEB)
Goshima, Satoshi [Department of Radiology, Gifu University Hospital, 1-1 Yanagido, Gifu 501-1194 (Japan)], E-mail: gossy@par.odn.ne.jp; Kanematsu, Masayuki [Department of Radiology, Gifu University Hospital, 1-1 Yanagido, Gifu 501-1194 (Japan); Department of Radiology Services, Gifu University Hospital, 1-1 Yanagido, Gifu 501-1194 (Japan); Kondo, Hiroshi [Department of Radiology, Gifu University Hospital, 1-1 Yanagido, Gifu 501-1194 (Japan); Yokoyama, Ryujiro; Kajita, Kimihiro [Department of Radiology Services, Gifu University Hospital, 1-1 Yanagido, Gifu 501-1194 (Japan); Tsuge, Yusuke [Department of Radiology, Gifu University Hospital, 1-1 Yanagido, Gifu 501-1194 (Japan); Shiratori, Yoshimune [Department of Medical Informatics, Gifu University School of Medicine, Gifu (Japan); Onozuka, Minoru [Department of Physiology and Neuroscience, Kanagawa Dental College, Yokosuka (Japan); Moriyama, Noriyuki [Research Center for Cancer Prevention and Screening, National Cancer Center Hospital, Tsukiji (Japan)
2009-05-15
Purpose: To correlate hepatic hemangioma enhancement types in gadolinium-enhanced magnetic resonance (MR) images with diffusion-weighted MR findings and apparent diffusion coefficients (ADCs). Materials and methods: Respiratory-triggered diffusion-weighted MR images (TR/TE, 2422/46 ms; parallel imaging factor, 2; b factor, 500 s/mm{sup 2}; number of averaging, 6) obtained in 35 patients with 44 hepatic hemangiomas diagnosed by gadolinium-enhanced MR and by follow-up imaging were retrospectively evaluated. Hemangiomas were classified into three enhancement types based on gadolinium-enhanced MR imaging findings: type I, early-enhancement type; type II, peripheral nodular enhancement type; type III, delayed enhancement type. Two blinded readers qualitatively assessed lesion sizes and signal intensities on T2-weighted turbo spin-echo and diffusion-weighted images. The ADCs of hemangiomas were also measured. Results: No significant difference was observed between the three enhancement types in terms of signal intensities on T2-weighted images. Signal intensities on diffusion-weighted images were lower in the order type I to III (P < .01), and mean ADCs were 2.18 x 10{sup -3}, 1.86 x 10{sup -3}, and 1.71 x 10{sup -3} mm{sup 2}/s for types I, II, and III, respectively (P < .01). No correlation was found between lesion sizes and ADCs. Conclusion: Hepatic hemangiomas were found to have enhancement type dependent signal intensities and ADCs on diffusion-weighted MR images. Further studies will have to substantiate that these diffusion patterns might reflect intratumoral blood flow or perfusion.
Water Vapor Diffusion and Adsorption of Sandstones: Influence of Rock Texture and Composition
Directory of Open Access Journals (Sweden)
Martin Keppert
2016-01-01
Full Text Available The term sandstone is used for wide range of rocks containing quartz clasts which can be cemented by secondary precipitated quartz or calcite; moreover the space between clasts can be filled by matrix. These facts result in existence of numerous rocks having highly various properties. Sandstones have been used as construction materials due to their good accessibility and workability. Since most of sandstones are porous, water vapor can penetrate through sandstone constructions. The rate of water vapor diffusion, as well as the vapor sorption isotherm, was determined for range of sandstone types. The diffusion resistance factor was found to be dependent on the total porosity of sandstone but the sorption behavior was strongly influenced by nature of the particular sandstone; the specific surface area of stone and presence of clay matrix are determining its sorption isotherm. The published data enable estimating (i diffusion resistance factor of a sandstone via knowledge of its total porosity and (ii the sorption isotherm via knowledge of the stone’s nature and specific surface area. This approach can significantly reduce the time necessary to acquire vapor-related properties of a sandstone.
Matrane, I.; Mazroui, M.; Sbiaai, K.
2018-03-01
We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.
Equilibrium and kinetic studies of Pb(II, Cd(II and Zn(II sorption by Lagenaria vulgaris shell
Directory of Open Access Journals (Sweden)
Mitić-Stojanović Dragana-Linda
2012-01-01
Full Text Available The sorption of lead, cadmium and zinc ions from aqueous solution by Lagenaria vulgaris shell biosorbent (LVB in batch system was investigated. The effect of relevant parameters such as contact time, biosorbent dosage and initial metal ions concentration was evaluated. The Pb(II, Cd(II and Zn(II sorption equilibrium (when 98% of initial metal ions were sorbed was attained within 15, 20 and 25 min, respectively. The pseudo first, pseudo-second order, Chrastil’s and intra-particle diffusion models were used to describe the kinetic data. The experimental data fitted the pseudo-second order kinetic model and intra-particle diffusion model. Removal efficiency of lead(II, cadmium(II and zinc(II ions rapidly increased with increasing biosorbent dose from 0.5 to 8.0 g dm-3. Optimal biosorbent dose was set to 4.0 g dm-3. An increase in the initial metal concentration increases the sorption capacity. The sorption data of investigated metal ions are fitted to Langmuir, Freundlich and Temkin isotherm models. Langmuir model best fitted the equilibrium data (r2 > 0.99. Maximal sorption capacities of LVB for Pb(II, Cd(II and Zn(II at 25.0±0.5°C were 0.130, 0.103 and 0.098 mM g-1, respectively. The desorption experiments showed that the LVB could be reused for six cycles with a minimum loss of the initial sorption capacity.
Chemical diffusion of Cr, Ni and Si in welded joints. II
International Nuclear Information System (INIS)
Kucera, J.; Ciha, K.
1987-01-01
The results are given of a study in chemical diffusion in welded joints P2/A and P3/A. P2 stands for the steel (Fe-17.48 Cr-8.15 Ni-0.14 Si), P3 for (Fe-18.52 Cr-8.20 Ni-1.78 Si) and A for the Fe-Arema. Triadic sandwiche-like samples were diffusion heated at temperatures from 920 to 1170 degC. The concentration distributions N(x,t) of the given elements were measured with microprobe JXA-3A. The evaluation of the experimental data was carried out either by Grube's method, or in some cases by the spline-polynomial method. The evaluated diffusivities D-bar satisfy the Arrhenius relation and yield the standard diffusion characteristics D 0 and H. The diffusivities D-bar of Cr, Ni and Si in P1/A, in P2/A and P3/A welded joints vary with Si content in P1, P2 and P3 alloys, similar to the Cr-51 and Ni-63 self-diffusivities in Fe-18 Cr-12 Ni-X Si steels, and tend to increase with increasing Si content. The values D-bar measured in the vicinity of grain boundaries are higher than the bulk diffusion coefficients. The most rapid diffusant is Si and the slowest one Ni. Thus, the relations D-bar Si :D-bar Cr :D-bar Ni ≅ 6:3:1 (P3/A) and D-bar Si :D-bar Cr :D-bar Ni ≅ 1.7:1.4:1 (P3/A) are valid at 1050 degC. Comparing the results with those published if can be noted that the Cr-51 and Ni-63 self-diffusion in Fe-18 Cr-12 Ni-X Si steels is faster than chemical diffusion of these elements in the said steel welded joints P2/A and P3/A; X varies from 0.14 to 1.98. (author). 7 tabs., 7 figs., 20 refs
Results on positron diffusion in Si
International Nuclear Information System (INIS)
Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.
1984-10-01
Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface
Measurements of cesium and strontium diffusion in biotite gneiss
International Nuclear Information System (INIS)
Skagius, K.; Neretnieks, I.
1988-01-01
A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel
Diffusion measurements of cesium and strontium in biotite gneiss
International Nuclear Information System (INIS)
Skagius, K.; Neretnieks, I.
1985-01-01
A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)
Study of surface modifications for improved selected metal (II-VI) semiconductor based devices
Blomfield, Christopher James
Metal-semiconductor contacts are of fundamental importance to the operation of all semiconductor devices. There are many competing theories of Schottky barrier formation but as yet no quantitative predictive model exists to adequately explain metal-semiconductor interfaces. The II-VI compound semiconductors CdTe, CdS and ZnSe have recently come to the fore with the advent of high efficiency photovoltaic cells and short wavelength light emitters. Major problems still exist however in forming metal contacts to these materials with the desired properties. This work presents results which make a significant contribution to the theory of metal/II-VI interface behaviour in terms of Schottky barriers to n-type CdTe, CdS and ZnSe.Predominantly aqueous based wet chemical etchants were applied to the surfaces of CdTe, CdS and ZnSe which were subsequently characterised by X-ray photoelectron spectroscopy. The ionic nature of these II-VI compounds meant that they behaved as insoluble salts of strong bases and weak acids. Acid etchants induced a stoichiometric excess of semiconductor anion at the surface which appeared to be predominantly in the elemental or hydrogenated state. Alkaline etchants conversely induced a stoichiometric excess of semiconductor cation at the surface which appeared to be in an oxidised state.Metal contacts were vacuum-evaporated onto these etched surfaces and characterised by current-voltage and capacitance-voltage techniques. The surface preparation was found to have a clear influence upon the electrical properties of Schottky barriers formed to etched surfaces. Reducing the native surface oxide produced near ideal Schottky diodes. An extended study of Au, Ag and Sb contacts to [mathematical formula] substrates again revealed the formation of several discrete Schottky barriers largely independent of the metal used; for [mathematical formula]. Deep levels measured within this study and those reported in the literature led to the conclusion that Fermi
Directory of Open Access Journals (Sweden)
K.A. Widi
2016-09-01
Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.
Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A
2017-05-17
A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.
Models of infrared emission from dusty and diffuse H II regions
International Nuclear Information System (INIS)
Aannestad, P.A.
1978-01-01
Models for the infrared emission from amorphous core-mantle dust within diffuse (n/sub e/ 3 cm -3 ) H II regions with neutral shells that are optically thin in the infrared have been calculated. The icy mantles sublimate only within a fractional radius of 0.2--0.5, affecting the overall gas-to-dust ratio only slightly. A region with variable grain composition may have a much smaller infrared luminosity than a similar region with uniform grain properties. Calculations of the total infrared luminosity, the relative contribution by Lα photons, the infrared spectral distribution, and the size of the dust-depleted regions are presented as functions of the ultraviolet optical depths in the ionized and neutral regions and for stellar temperatures of 35,000 and 48,000 K. Comparison with observations indicate that at least 20% of the Lyman-continuum photons are absorbed by the dust, and that the dust optical depth in the Lyman continuum is likely to be of the order of unity. For core-mantle grains most of the infrared energy is emitted between 30 and 70 μm, relatively independent of whether the dust is within or outside the H II region. Amorphous silicate particles tend to emit more energy below 30 μm, but also emit efficiently at far-infrared wavelengths. In order to illustrate the model calculations, we present infrared spectra for the Orion A region and compare them with observed fluxed, accounting for beam-width effects. A reasonable agreement is obtained with most of the near- to middle-infrared observations if the total ultraviolet optical depth is about unity and about equally divided between the ionized region and an outside neutral shell. Intensity profiles for Orion A are presented for wavelengths in the ragne 20--1000 μm, and show a strong increase in width beyond 20 μm
Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning
2013-06-01
In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.
International Nuclear Information System (INIS)
Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.
1985-06-01
A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples
Simple computation of reaction–diffusion processes on point clouds
Macdonald, Colin B.
2013-05-20
The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.
Simple computation of reaction–diffusion processes on point clouds
Macdonald, Colin B.; Merriman, Barry; Ruuth, Steven J.
2013-01-01
The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.
Advection endash diffusion past a strip. II. Oblique incidence
International Nuclear Information System (INIS)
Knessl, C.; Keller, J.B.
1997-01-01
Advection and diffusion of particles past an impenetrable strip is considered when the strip is oblique to the advection or drift velocity. The particle concentration p(x,y) is determined asymptotically for large values of vL/D, where v is the drift velocity, D is the diffusion coefficient, and 2L is the width of the strip. The results complement those of Part I, which treated a strip normal to the drift velocity. copyright 1997 American Institute of Physics
Diffusion Under Geometrical Constraint
Ogawa, Naohisa
2014-01-01
Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...
Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y
2004-07-05
Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.
Michaud, Georges; Richer, Jacques
2015-01-01
This book gives an overview of atomic diffusion, a fundamental physical process, as applied to all types of stars, from the main sequence to neutron stars. The superficial abundances of stars as well as their evolution can be significantly affected. The authors show where atomic diffusion plays an essential role and how it can be implemented in modelling. In Part I, the authors describe the tools that are required to include atomic diffusion in models of stellar interiors and atmospheres. An important role is played by the gradient of partial radiative pressure, or radiative acceleration, which is usually neglected in stellar evolution. In Part II, the authors systematically review the contribution of atomic diffusion to each evolutionary step. The dominant effects of atomic diffusion are accompanied by more subtle effects on a large number of structural properties throughout evolution. One of the goals of this book is to provide the means for the astrophysicist or graduate student to evaluate the importanc...
International Nuclear Information System (INIS)
Schrof, Julian; Müller, Ralph; Benick, Jan; Hermle, Martin; Reedy, Robert C.
2015-01-01
Boron diffusivity reduction in extrinsically doped silicon was investigated in the context of a process combination consisting of BBr 3 furnace diffusion and preceding Phosphorus ion implantation. The implantation of Phosphorus leads to a substantial blocking of Boron during the subsequent Boron diffusion. First, the influences of ion implantation induced point defects as well as the initial P doping on B diffusivity were studied independently. Here, it was found that not the defects created during ion implantation but the P doping itself results in the observed B diffusion retardation. The influence of the initial P concentration was investigated in more detail by varying the P implantation dose. A secondary ion mass spectrometry (SIMS) analysis of the BSG layer after the B diffusion revealed that the B diffusion retardation is not due to potential P content in the BSG layer but rather caused by the n-type doping of the crystalline silicon itself. Based on the observations the B diffusion retardation was classified into three groups: (i) no reduction of B diffusivity, (ii) reduced B diffusivity, and (iii) blocking of the B diffusion. The retardation of B diffusion can well be explained by the phosphorus doping level resulting in a Fermi level shift and pairing of B and P ions, both reducing the B diffusivity. Besides these main influences, there are probably additional transient phenomena responsible for the blocking of boron. Those might be an interstitial transport mechanism caused by P diffusion that reduces interstitial concentration at the surface or the silicon/BSG interface shift due to oxidation during the BBr 3 diffusion process. Lifetime measurements revealed that the residual (non-blocked) B leads to an increased dark saturation current density in the P doped region. Nevertheless, electrical quality is on a high level and was further increased by reducing the B dose as well as by removing the first few nanometers of the silicon surface after the BBr 3
Jong, Tony; Parry, David L
2004-07-01
The adsorption of Pb(II), Cu(II), Cd(II), Zn(II), Ni(II), Fe(II) and As(V) onto bacterially produced metal sulfide (BPMS) material was investigated using a batch equilibrium method. It was found that the sulfide material had adsorptive properties comparable with those of other adsorbents with respect to the specific uptake of a range of metals and, the levels to which dissolved metal concentrations in solution can be reduced. The percentage of adsorption increased with increasing pH and adsorbent dose, but decreased with increasing initial dissolved metal concentration. The pH of the solution was the most important parameter controlling adsorption of Cd(II), Cu(II), Fe(II), Ni(II), Pb(II), Zn(II), and As(V) by BPMS. The adsorption data were successfully modeled using the Langmuir adsorption isotherm. Desorption experiments showed that the reversibility of adsorption was low, suggesting high-affinity adsorption governed by chemisorption. The mechanism of adsorption for the divalent metals was thought to be the formation of strong, inner-sphere complexes involving surface hydroxyl groups. However, the mechanism for the adsorption of As(V) by BPMS appears to be distinct from that of surface hydroxyl exchange. These results have important implications to the management of metal sulfide sludge produced by bacterial sulfate reduction.
Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays
International Nuclear Information System (INIS)
Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya
2016-01-01
A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)
Energy Technology Data Exchange (ETDEWEB)
Hu, J.; Wang, X.K. [School of Nuclear Science and Engineering, North China Electric Power Univ., BJ (China); Key Lab. of Novel Thin Film Solar Cells, Inst. of Plasma Physics, Chinese Academy of Sciences, Hefei (China); Chen, C.L.; Sheng, G.D.; Li, J.X. [Key Lab. of Novel Thin Film Solar Cells, Inst. of Plasma Physics, Chinese Academy of Sciences, Hefei (China); Chen, Y.X. [School of Nuclear Science and Engineering, North China Electric Power Univ., BJ (China)
2010-07-01
The surface charge characteristics of Na-rectorite (NaAl{sub 4}[Si,Al]{sub 8}O{sub 20}(OH){sub 4}.nH{sub 2}O;) were studied by potentiometric acid-base titrations. Sr(II) and Eu(III) adsorptions on Na-rectorite as a function of pH, ionic strength, and Sr(II)/Eu(III) concentrations were carried out to investigate the surface interactions between Sr(II)/Eu(III) with Na-rectorite. The results indicated that the adsorptions of Sr(II) and Eu(III) on Na-rectorite increased with increasing pH and decreased with increasing ionic strength and initial Sr(II)/Eu(III) concentrations, and that the affinity of Na-rectorite for Eu(III) was much higher than for Sr(II). The experimental data of Sr(II)/Eu(III) adsorption were simulated by the diffuse-layer model (DLM) well with the aid of FITEQL 3.2. Simultaneous adsorptions of Sr(II) and Eu(III) on Na-rectorite were also modeled using the DLM. The adsorption mechanisms of Sr(II) and Eu(III) on Na-rectorite may be dominated by ion exchange interaction at low pH or moderate pH, and by surface complexation interaction at high pH. (orig.)
Manjuladevi, M.; Anitha, R.; Manonmani, S.
2018-03-01
The adsorption of Cr(VI), Ni(II), Cd(II) and Pb(II), ions from aqueous solutions by Cucumis melo peel-activated carbon was investigated under laboratory conditions to assess its potential in removing metal ions. The adsorption behavior of metal ions onto CMAC was analyzed with Elovich, intra-particle diffusion rate equations and pseudo-first-order model. The rate constant of Elovich and intra-particle diffusion on CMAC increased in the sequence of Cr(VI) > Ni(II) > Cd(II) > Pb(II). According to the regression coefficients, it was observed that the kinetic adsorption data can fit better by the pseudo-first-order model compared to the second-order Lagergren's model with R 2 > 0.957. The maximum adsorption of metal ions onto the CMAC was found to be 97.95% for Chromium(VI), 98.78% for Ni(II), 98.55% for Pb(II) and 97.96% for Cd(II) at CMAC dose of 250 mg. The adsorption capacities followed the sequence Ni(II) ≈ Pb(II) > Cr(VI) ≈ Cd(II) and Ni(II) > Pb(II) > Cd(II) > Cr(VI). The optimum adsorption conditions selected were adsorbent dosage of 250 mg, pH of 3.0 for Cr(VI) and 6.0 for Ni(II), Cd(II) and Pb(II), adsorption concentration of 250 mg/L and contact time of 180.
Energy Technology Data Exchange (ETDEWEB)
Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie
1990-04-01
A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.
Au nanowire junction breakup through surface atom diffusion
Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur
2018-01-01
Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.
Injection moulding of plastic parts with laser textured surfaces with optical applications
Pina-Estany, J.; García-Granada, A. A.; Corull-Massana, E.
2018-05-01
The purpose of this work is to manufacture micro and nanotextured surfaces on plastic injection moulds with the aim of replicating them and obtaining plastic parts with optical applications. Different patterns are manufactured with nanosecond and femtosecond lasers in order to obtain three different optical applications: (i) homogeneous light diffusion (ii) 1D light directionality and (iii) 2D light directionality. Induction heating is used in the injections in order to improve the textures degree of replication. The steel mould and the plastic parts are analyzed with a confocal/focus variation microscope and with a surface roughness tester. A mock-up and a luminance camera are used to evaluate the homogeneity and luminance of the homogeneous light diffusion application in comparison with the current industrial solutions.
Directory of Open Access Journals (Sweden)
Kaewploy Somsak
2015-01-01
Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa
Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.
2005-09-01
We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.
International Nuclear Information System (INIS)
Woznicki, Z.
1976-05-01
This report presents the AGA two-sweep iterative methods belonging to the family of factorization techniques in their practical application in the HEXAGA-II two-dimensional programme to obtain the numerical solution to the multi-group, time-independent, (real and/or adjoint) neutron diffusion equations for a fine uniform triangular mesh. An arbitrary group scattering model is permitted. The report written for the users provides the description of input and output. The use of HEXAGA-II is illustrated by two sample reactor problems. (orig.) [de
[Measurement of CO diffusion capacity (II): Standardization and quality criteria].
Salcedo Posadas, A; Villa Asensi, J R; de Mir Messa, I; Sardón Prado, O; Larramona, H
2015-08-01
The diffusion capacity is the technique that measures the ability of the respiratory system for gas exchange, thus allowing a diagnosis of the malfunction of the alveolar-capillary unit. The most important parameter to assess is the CO diffusion capacity (DLCO). New methods are currently being used to measure the diffusion using nitric oxide (NO). There are other methods for measuring diffusion, although in this article the single breath technique is mainly referred to, as it is the most widely used and best standardized. Its complexity, its reference equations, differences in equipment, inter-patient variability and conditions in which the DLCO is performed, lead to a wide inter-laboratory variability, although its standardization makes this a more reliable and reproductive method. The practical aspects of the technique are analyzed, by specifying the recommendations to carry out a suitable procedure, the calibration routine, calculations and adjustments. Clinical applications are also discussed. An increase in the transfer of CO occurs in diseases in which there is an increased volume of blood in the pulmonary capillaries, such as in the polycythemia and pulmonary hemorrhage. There is a decrease in DLCO in patients with alveolar volume reduction or diffusion defects, either by altered alveolar-capillary membrane (interstitial diseases) or decreased volume of blood in the pulmonary capillaries (pulmonary embolism or primary pulmonary hypertension). Other causes of decreased or increased DLCO are also highlighted. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.
Surface Structures Formed by a Copper(II Complex of Alkyl-Derivatized Indigo
Directory of Open Access Journals (Sweden)
Akinori Honda
2016-10-01
Full Text Available Assembled structures of dyes have great influence on their coloring function. For example, metal ions added in the dyeing process are known to prevent fading of color. Thus, we have investigated the influence of an addition of copper(II ion on the surface structure of alkyl-derivatized indigo. Scanning tunneling microscope (STM analysis revealed that the copper(II complexes of indigo formed orderly lamellar structures on a HOPG substrate. These lamellar structures of the complexes are found to be more stable than those of alkyl-derivatized indigos alone. Furthermore, 2D chirality was observed.
Ksouri, Ayoub; Ghedira, Kais; Ben Abderrazek, Rahma; Shankar, B A Gowri; Benkahla, Alia; Bishop, Ozlem Tastan; Bouhaouala-Zahar, Balkiss
2018-02-19
Scorpion envenoming and its treatment is a public health problem in many parts of the world due to highly toxic venom polypeptides diffusing rapidly within the body of severely envenomed victims. Recently, 38 AahII-specific Nanobody sequences (Nbs) were retrieved from which the performance of NbAahII10 nanobody candidate, to neutralize the most poisonous venom compound namely AahII acting on sodium channels, was established. Herein, structural computational approach is conducted to elucidate the Nb-AahII interactions that support the biological characteristics, using Nb multiple sequence alignment (MSA) followed by modeling and molecular docking investigations (RosettaAntibody, ZDOCK software tools). Sequence and structural analysis showed two dissimilar residues of NbAahII10 CDR1 (Tyr27 and Tyr29) and an inserted polar residue Ser30 that appear to play an important role. Indeed, CDR3 region of NbAahII10 is characterized by a specific Met104 and two negatively charged residues Asp115 and Asp117. Complex dockings reveal that NbAahII17 and NbAahII38 share one common binding site on the surface of the AahII toxin divergent from the NbAahII10 one's. At least, a couple of NbAahII10 - AahII residue interactions (Gln38 - Asn44 and Arg62, His64, respectively) are mainly involved in the toxic AahII binding site. Altogether, this study gives valuable insights in the design and development of next generation of antivenom. Copyright © 2018 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)
2016-04-15
We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.
Directory of Open Access Journals (Sweden)
Louena Shtrepi
2017-02-01
Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.
Energy Technology Data Exchange (ETDEWEB)
Farhang, Amin; Khosroshahi, Habib G.; Javadi, Atefeh; Molaeinezhad, Alireza; Tavasoli, Saeed; Habibi, Farhang; Kourkchi, Ehsan; Rezaei, Sara; Saberi, Maryam [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), PO Box 19395-5746 Tehran (Iran, Islamic Republic of); Van Loon, Jacco Th.; Bailey, Mandy [Astrophysics Group, Lennard-Jones Laboratories, Keele University, Staffordshire ST5 5BG (United Kingdom); Hardy, Liam, E-mail: a.farhang@ipm.ir [Isaac Newton Group, Apartado 321, E-38700 Santa Cruz de La Palma (Spain)
2015-02-10
We present a new high signal-to-noise ratio spectroscopic survey of the Northern hemisphere to probe the Local Bubble and its surroundings using the λ5780 Å and λ5797 Å diffuse interstellar bands (DIBs). We observed 432 sightlines to a distance of 200 pc over a duration of three years. In this study, we establish the λ5780 and λ5797 correlations with Na I, Ca II and E {sub B-V}, for both inside and outside the Local Bubble. The correlations show that among all neutral and ionized atoms, the correlation between Ca II and λ5780 is stronger than its correlation with λ5797, suggesting that λ5780 is more associated with regions where Ca{sup +} is more abundant. We study the λ5780 correlation with λ5797, which shows a tight correlation within and outside the Local Bubble. In addition, we investigate the DIB properties in UV irradiated and UV shielded regions. We find that, within and beyond the Local Bubble, λ5797 is located in denser parts of clouds, protected from UV irradiation, while λ5780 is located in the low-density regions of clouds.
The effects of heterogeneities on memory-dependent diffusion
Adib, Farhad; Neogi, P.
1993-07-01
Case II diffusion is often seen in glassy polymers, where the mass uptake in sorption is proportional to time t instead of sqrt{t}. A memory dependent diffusion is needed to explain such effects, where the relaxation function used to describe the memory effect has a characteristic time. The ratio of this time to the overall diffusion times is the diffusional Deborah number. Simple models show that case II results when the Deborah number is around one, that is, when the two time scales are comparable. Under investigation are the possible effects of the fact that the glassy polymers are heterogeneous over molecular scales. The averaging form given by DiMarzio and Sanchez has been used to obtain the averaged response. The calculated dynamics of sorption show that whereas case II is still observed, the long term tails change dramatically from the oscillatory to torpid, to chaotic, which are all observed in the experiments. The Deborah number defined here in a self-consistent manner collapses in those cases, but causes no other ill-effects.
Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru
2017-11-01
Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.
International Nuclear Information System (INIS)
Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.
1997-01-01
The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics
Symmetries and modelling functions for diffusion processes
International Nuclear Information System (INIS)
Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G
2009-01-01
A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.
Energy Technology Data Exchange (ETDEWEB)
Li, Min [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Feng, Changgen, E-mail: cgfeng@cast.org.cn [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Li, Mingyu; Zeng, Qingxuan; Gan, Qiang [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Yang, Haiyan [Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China)
2015-03-30
Highlights: • Cd(II) ion-imprinted polymer (Cd(II)-IIP) is prepared. • Cd(II)-IIP shows high stability, good selectivity and reusability. • Cd(II)-IIP can be used as a sorbent for selective removal of Cd(II) ion. - Abstract: A novel Cd(II) ion-imprinted polymer (Cd(II)-IIP) was prepared with surface imprinting technology by using cadmium chloride as a template and allyl thiourea (ATU) as a functional monomer for on-line solid-phase extraction of trace Cd(II) ion and selective separation Cd(II) ion in water samples. The Cd(II)-IIP exhibited good chemical performance and thermal stability. Kinetics studies showed that the equilibrium adsorption was achieved within 8.0 min and the adsorption process can be described by pseudo-second-order kinetic model. Compared to the Cd(II) non-imprinted polymer (Cd(II)-NIP), the Cd(II)-IIP had a higher adsorption capacity and selectivity for Cd(II) ion. The maximum adsorption capacities of the Cd(II)-IIP and Cd(II)-NIP for Cd(II) were 38.30 and 13.21 mg g{sup −1}, respectively. The relative selectivity coefficients of the adsorbent for Cd(II) in the presence of Cu{sup 2+}, Ni{sup 2+}, Co{sup 2+}, Pb{sup 2+} and Zn{sup 2+} were 2.86, 6.42, 11.50, 9.46 and 3.73, respectively. In addition, the Cd(II) ion adsorbed was easy to remove from sorbent and the Cd(II)-IIP exhibited good stability and reusability. The adsorption capacity had no obvious decrease after being used six times. The accuracy of this method was verified by the standard reference material, it was then applied for cadmium ion determination in different types of water samples.
Measuring methods of matrix diffusion
International Nuclear Information System (INIS)
Muurinen, A.; Valkiainen, M.
1988-03-01
In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability
Bläckberg, Lisa
2011-01-01
This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...
Diffuse solar radiation estimation models for Turkey's big cities
International Nuclear Information System (INIS)
Ulgen, Koray; Hepbasli, Arif
2009-01-01
A reasonably accurate knowledge of the availability of the solar resource at any place is required by solar engineers, architects, agriculturists, and hydrologists in many applications of solar energy such as solar furnaces, concentrating collectors, and interior illumination of buildings. For this purpose, in the past, various empirical models (or correlations) have been developed in order to estimate the solar radiation around the world. This study deals with diffuse solar radiation estimation models along with statistical test methods used to statistically evaluate their performance. Models used to predict monthly average daily values of diffuse solar radiation are classified in four groups as follows: (i) From the diffuse fraction or cloudness index, function of the clearness index, (ii) From the diffuse fraction or cloudness index, function of the relative sunshine duration or sunshine fraction, (iii) From the diffuse coefficient, function of the clearness index, and (iv) From the diffuse coefficient, function of the relative sunshine duration or sunshine fraction. Empirical correlations are also developed to establish a relationship between the monthly average daily diffuse fraction or cloudness index (K d ) and monthly average daily diffuse coefficient (K dd ) with the monthly average daily clearness index (K T ) and monthly average daily sunshine fraction (S/S o ) for the three big cities by population in Turkey (Istanbul, Ankara and Izmir). Although the global solar radiation on a horizontal surface and sunshine duration has been measured by the Turkish State Meteorological Service (STMS) over all country since 1964, the diffuse solar radiation has not been measured. The eight new models for estimating the monthly average daily diffuse solar radiation on a horizontal surface in three big cites are validated, and thus, the most accurate model is selected for guiding future projects. The new models are then compared with the 32 models available in the
Atmospheric turbulence and diffusion research
International Nuclear Information System (INIS)
Hosker, R.P. Jr.
1993-01-01
The Atmospheric Turbulence and Diffusion Division (well known in the atmospheric dispersion community as the Atmospheric Turbulence and Diffusion Laboratory, ATDL) is one of several field facilities of NOAAs Air Resources Laboratory, headquartered in Silver Spring, Maryland. The laboratory conducts research on matters of atmospheric diffusion and turbulent exchange, concerning air quality. ATDD focuses attention on the physics of the lower atmosphere, with special emphasis on the processes contributing to atmospheric transport, dispersion, deposition, and air-surface exchange, and on the development of predictive capabilities using the results of this research. Research is directed toward issues of national and global importance related to the missions of DOE, to DOE's Oak Ridge Field Office, and to NOAA. The program is divided into four major projects: plume transport and diffusion in the planetary boundary layer, complex topography, canopy micrometeorology, and air-surface exchange
Effect of diffusion from a lateral surface on the rate of GaN nanowire growth
International Nuclear Information System (INIS)
Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.
2012-01-01
The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.
Density functional theory prediction for diffusion of lithium on boron-doped graphene surface
International Nuclear Information System (INIS)
Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan
2011-01-01
The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.
Second generation diffusion model of interacting gravity waves on the surface of deep fluid
Directory of Open Access Journals (Sweden)
A. Pushkarev
2004-01-01
Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.
Atomic defects and diffusion in metals
International Nuclear Information System (INIS)
Siegel, R.W.
1981-11-01
The tracer self-diffusion data for fcc and refractory bcc metals are briefly reviewed with respect to (i) the available monovacancy formation and migration properties and (ii) the high-temperature diffusion enhancement above that expected for mass transport via atomic exchange with monovacancies. While the atomic-defect mechanism for low-temperature self-diffusion can be reliably attributed to monovacancies, the mechanisms responsible for high-temperature mass transport are not so easily defined at this time; both divacancies and interstitials must be seriously considered. Possibilities for improving our understanding in this area are discussed. 68 references, 7 figures
Studies of ionic diffusion in crystalline rock
International Nuclear Information System (INIS)
Ohlsson, Yvonne
2001-01-01
Matrix diffusion is of great importance in delaying radionuclides escaping from a deep geologic repository, on their way to the biosphere. There are, however, poorly understood mechanisms related to transport in pores with charged pore surfaces. Ions are affected by this charge and may be repelled or attracted by it. The rate of transport may be reduced, or even enhanced, as a result of this. Transport of ions is studied by traditional diffusion experiments, but mainly by a faster electrical conductivity method. With this method the pore connectivity, the formation factor variability and its relation to the porosity, as well as the surface conductivity are investigated. The method is compared. with traditional diffusion experiments, and an in-situ application is suggested and qualitatively tested. Furthermore, surface diffusion is studied by evaluating literature data and recently developed diffusion models. The pore connectivity reached to a depth of at least 15 cm in the rocks studied. The formation factor did not generally decrease with increasing sample length. It was also found that not only cations in the free pore water add to the electrical conductivity, but also at least part of those sorbed to the pore surfaces of the minerals. This surface conductivity influences the determination of the formation factor in low ionic strength pore waters, and was also found to be a function of the formation factor. It was furthermore dependent on the type of ion at the surface, giving for example a higher conductivity for Na + than for Cs + . It is not fully understood which part of the sorbed ions that are mobile. A simple model was developed assigning the mobile ions to the diffuse layer, and this model explained experimental data for diffusion of Cs + in clay well. This is contradicted by surface conductivity measurements that have shown that most mobile ions are found behind the Stern layer. The in-situ formation factor determination method seems promising. The most
International Nuclear Information System (INIS)
Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu
2010-01-01
This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)
Quantification of chemical transport processes from the soil to surface runoff.
Tian, Kun; Huang, Chi-Hua; Wang, Guang-Qian; Fu, Xu-Dong; Parker, Gary
2013-01-01
There is a good conceptual understanding of the processes that govern chemical transport from the soil to surface runoff, but few studies have actually quantified these processes separately. Thus, we designed a laboratory flow cell and experimental procedures to quantify the chemical transport from soil to runoff water in the following individual processes: (i) convection with a vertical hydraulic gradient, (ii) convection via surface flow or the Bernoulli effect, (iii) diffusion, and (iv) soil loss. We applied different vertical hydraulic gradients by setting the flow cell to generate different seepage or drainage conditions. Our data confirmed the general form of the convection-diffusion equation. However, we now have additional quantitative data that describe the contribution of each individual chemical loading process in different surface runoff and soil hydrological conditions. The results of this study will be useful for enhancing our understanding of different geochemical processes in the surface soil mixing zone. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.
Langevin diffusions on the torus
DEFF Research Database (Denmark)
García-Portugués, Eduardo; Sørensen, Michael; Mardia, Kanti V.
2018-01-01
We introduce stochastic models for continuous-time evolution of angles and develop their estimation. We focus on studying Langevin diffusions with stationary distributions equal to well-known distributions from directional statistics, since such diffusions can be regarded as toroidal analogues......) a likelihood based on the stationary distribution; (ii) toroidal adaptations of the Euler and Shoji–Ozaki pseudo-likelihoods; (iii) a likelihood based on a specific approximation to the transition density of the wrapped normal process. A simulation study compares, in dimensions one and two, the approximate...
Energy Technology Data Exchange (ETDEWEB)
Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)
2014-09-15
An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.
Diffusion mechanisms of strontium, cesium and cobalt in compacted sodium bentonite
International Nuclear Information System (INIS)
Muurinen, A.; Rantanen, J.; Penttilae-Hiltunen, P.
1986-01-01
For a porous water-saturated material where diffusion in the porewater, sorption on the solid material and diffusion of the sorbed ions (surface diffusion) occur, a diffusion equation can be derived where the apparent diffusivity includes two terms. One represents diffusion in the pore-water, the other surface diffusion. In this research diffusion mechanisms were studied. The apparent diffusivities of strontium, cesium and cobalt in compacted sodium bentonite were measured by a non-steady state method. The sorption factors were adjusted using different sodium chloride solutions, groundwater and addition of EDTA for saturation of the bentonite samples. The corresponding sorption factors were measured by a batch method. The results suggest that cations diffuse also while being sorbed. A combined pore diffusion-surface diffusion model has been used to explain the transport and the corresponding diffusivities have been evaluated. The surface diffusivities (D/sub s/) of Sr and Cs were 8-9 x 10 -12 m 2 /s and 4-7 x 10 -13 m 2 /s respectively. The pore diffusivity epsilon D/sub p/ of Cs was 3.5 x 10 -11 m 2 /s which has been used also for Sr. The sorption mechanisms of Co seems to be different from that of Sr or Cs and the results allow no specific conclusions of the diffusion mechanisms of Co. The apparent diffusivity of Co ranged from 2 x 10 -14 to 7 x 10 -14 m 2 /s. The anionic Co-EDTA seems to follow some other diffusion mechanism than the cations
Continuum theory of the mixed-state and surface Joule effects in type-II superconductors
International Nuclear Information System (INIS)
Hocquet, T.; Mathieu, P.; Simon, Y.
1992-01-01
A phenomenological theory of vortex motion, where the mixed state is regarded as a continuum, has been proposed by two of the authors in a short previous letter. Its outlines are recalled in this paper with further comments and arguments; in particular the basic equations and their implications are discussed at some length. This theory leads to a model of pinning, from which we argue that critical currents I c , in soft type-II samples of standard bulk homogeneity, should be governed essentially by surface defects. I c is interpreted as a physically well-defined part of the total transport current I, which is flowing over a small depth close to the surface. Thus, on the scale of an ordinary sample, this part of the transport current is superficial, the remaining part I-I c being uniformly distributed over the cross section. Coherently, an analysis of the dissipation in such samples predicts that the part VI c of the total Joule effect VI must arise as surface heat sources, while the Joule effect V(I-I c ), usually associated with the steady viscous flow of vortices, is uniformly distributed in the bulk. As a proof, we present a method, using second-sound acoustics, to detect and separate surface and volume heat sources. Experimental results give clear evidence of a surface Joule effect, and support the validity of our model of surface pinning in soft materials
Method of coating the interior surface of hollow objects with a diffusion coating
Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.
2005-03-15
A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.
Energy Technology Data Exchange (ETDEWEB)
Roy, Nirupam [Department of Physics and Centre for Theoretical Studies, Indian Institute of Technology, Kharagpur 721302 (India); Frank, Stephan; Mathur, Smita [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); Carilli, Christopher L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); Menten, Karl M. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Wolfe, Arthur M., E-mail: nroy@physics.iisc.ernet.in [Department of Physics and Center for Astrophysics and Space Sciences, University of California, San Diego, La Jolla, CA 92093 (United States)
2017-01-10
The far-infrared [C ii] 158 μ m fine structure transition is considered to be a dominant coolant in the interstellar medium (ISM). For this reason, under the assumption of a thermal steady state, it may be used to infer the heating rate and, in turn, the star formation rate (SFR) in local as well as in high redshift systems. In this work, radio and ultraviolet observations of the Galactic ISM are used to understand whether C ii is indeed a good tracer of the SFR. For a sample of high Galactic latitude sightlines, direct measurements of the temperature indicate the presence of C ii in both the cold and the warm phases of the diffuse interstellar gas. The cold gas fraction (∼10%–50% of the total neutral gas column density) is not negligible even at high Galactic latitude. It is shown that to correctly estimate the SFR, C ii cooling in both phases should hence be considered. The simple assumption, that the [C ii] line originates only from either the cold or the warm phase, significantly underpredicts or overpredicts the SFR, respectively. These results are particularly important in the context of Damped Ly α systems for which a similar method is often used to estimate the SFR. The derived SFRs in such cases may not be reliable if the temperature of the gas under consideration is not constrained independently.
Development of neutron diffuse scattering analysis code by thin film and multilayer film
International Nuclear Information System (INIS)
Soyama, Kazuhiko
2004-01-01
To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering by thin film, roughness of surface of thin film, correlation function, neutron propagation by thin film, diffuse scattering by DWBA theory, measurement model, SDIFFF (neutron diffuse scattering analysis program by thin film) and simulation results are explained. On neutron diffuse scattering by multilayer film, roughness of multilayer film, principle of diffuse scattering, measurement method and simulation examples by MDIFF (neutron diffuse scattering analysis program by multilayer film) are explained. (S.Y.)To research surface structure of thin film and multilayer film by neutron, a neutron diffuse scattering analysis code using DWBA (Distorted-Wave Bron Approximation) principle was developed. Subjects using this code contain the surface and interface properties of solid/solid, solid/liquid, liquid/liquid and gas/liquid, and metal, magnetism and polymer thin film and biomembran. The roughness of surface and interface of substance shows fractal self-similarity and its analytical model is based on DWBA theory by Sinha. The surface and interface properties by diffuse scattering are investigated on the basis of the theoretical model. The calculation values are proved to be agreed with the experimental values. On neutron diffuse scattering
Lai, King C.; Liu, Da-Jiang; Evans, James W.
2017-12-01
For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.
Mechanisms of self-diffusion on Pt(110)
DEFF Research Database (Denmark)
Lorensen, Henrik Qvist; Nørskov, Jens Kehlet; Jacobsen, Karsten Wedel
1999-01-01
The self-diffusion of Pt on the missing row reconstructed Pt(110) surface is discussed based on density functional calculations of activation energy barriers. Different competing diffusion mechanisms are considered and we show that several different diffusion paths along the reconstruction troughs...
Bicarbonate diffusion through mucus.
Livingston, E H; Miller, J; Engel, E
1995-09-01
The mucus layer overlying duodenal epithelium maintains a pH gradient against high luminal acid concentrations. Despite these adverse conditions, epithelial surface pH remains close to neutrality. The exact nature of the gradient-forming barrier remains unknown. The barrier consists of mucus into which HCO3- is secreted. Quantification of the ability of HCO3- to establish and maintain the gradient depends on accurate measurement of this ion's diffusion coefficient through mucus. We describe new experimental and mathematical methods for diffusion measurement and report diffusion coefficients for HCO3- diffusion through saline, 5% mucin solutions, and rat duodenal mucus. The diffusion coefficients were 20.2 +/- 0.10, 3.02 +/- 0.31, and 1.81 +/- 0.12 x 10(-6) cm2/s, respectively. Modeling of the mucobicarbonate layer with this latter value suggests that for conditions of high luminal acid strength the neutralization of acid by HCO3- occurs just above the epithelial surface. Under these conditions the model predicts that fluid convection toward the lumen could be important in maintaining the pH gradient. In support of this hypothesis we were able to demonstrate a net luminal fluid flux of 5 microliters.min-1.cm-2 after perfusion of 0.15 N HCl in the rat duodenum.
Atomic-Scale Visualization of Quasiparticle Interference on a Type-II Weyl Semimetal Surface.
Zheng, Hao; Bian, Guang; Chang, Guoqing; Lu, Hong; Xu, Su-Yang; Wang, Guangqiang; Chang, Tay-Rong; Zhang, Songtian; Belopolski, Ilya; Alidoust, Nasser; Sanchez, Daniel S; Song, Fengqi; Jeng, Horng-Tay; Yao, Nan; Bansil, Arun; Jia, Shuang; Lin, Hsin; Hasan, M Zahid
2016-12-23
We combine quasiparticle interference simulation (theory) and atomic resolution scanning tunneling spectromicroscopy (experiment) to visualize the interference patterns on a type-II Weyl semimetal Mo_{x}W_{1-x}Te_{2} for the first time. Our simulation based on first-principles band topology theoretically reveals the surface electron scattering behavior. We identify the topological Fermi arc states and reveal the scattering properties of the surface states in Mo_{0.66}W_{0.34}Te_{2}. In addition, our result reveals an experimental signature of the topology via the interconnectivity of bulk and surface states, which is essential for understanding the unusual nature of this material.
Rapid determination of ions by combined solid-phase extraction--diffuse reflectance spectroscopy
Fritz, James S.; Arena, Matteo P.; Steiner, Steven A.; Porter, Marc D.
2003-01-01
We introduce colorimetric solid-phase extraction (C-SPE) for the rapid determination of selected ions. This new technique links the exhaustive concentration of an analyte by SPE onto a membrane disk surface for quantitative measurement with a hand-held diffuse reflectance spectrometer. The concentration/measurement procedure is complete in approximately 1 min and can be performed almost anywhere. This method has been used to monitor iodine and iodide in spacecraft water in the 0.1-5.0 ppm range and silver(I) in the range of 5.0-1000 microg/l. Applications to the trace analysis of copper(II), nickel(II), iron(III) and chromium(VI) are described. Studies on the mechanism of extraction showed that impregnation of the disk with a surfactant as well as a complexing reagent results in uptake of additional water, which markedly improves the extraction efficiency.
Selective solid-phase extraction of Hg(II) using silica gel surface - imprinting technique
International Nuclear Information System (INIS)
Zheng, H.; Geng, T.; Hu, L.
2008-01-01
A new ion-imprinted amino-functionalized silica gel sorbent was synthesized by surface-imprinting technique for preconcentration and separation of Hg(II) prior to its determination by inductively coupled plasma optical emission spectrometry (ICP-OES). Compared to the traditional solid sorbents and non-imprinted polymer particles, the ion-imprinted polymers (IIPs) have higher adsorption capacity and selectivity for Hg(II). The maximum static adsorption capacity of the imprinted and non-imprinted sorbent for Hg(II) was 29.89 mg g -1 and 11.21 mg g -1 , respectively. The highest selectivity coefficient for Hg(II) in the presence of Zn(II) exceeded 230. The detection limit (3σ) of the method was 0.25 μg L -1 . The relative standard deviation of the method was 2.5% for eight replicate determinations of 10 μg of Hg 2+ in 200 mL-in-volume water sample. The procedure was validated by performing the analysis of the certified river sediment sample (GBW 08603, China) using the standard addition method. The developed method was also successfully applied to the determination of trace mercury in Chinese traditional medicine and water samples with satisfactory results. (authors)
Surface-Assisted Dynamic Search Processes.
Shin, Jaeoh; Kolomeisky, Anatoly B
2018-03-01
Many chemical and biological systems exhibit intermittent search phenomena when participating particles alternate between dynamic regimes with different dimensionalities. Here we investigate theoretically a dynamic search process of finding a small target on a two-dimensional surface starting from a bulk solution, which is an example of such an intermittent search process. Both continuum and discrete-state stochastic descriptions are developed. It is found that depending on the scanning length λ, which describes the area visited by the reacting molecule during one search cycle, the system can exhibit three different search regimes: (i) For small λ values, the reactant finds the target mostly via three-dimensional bulk diffusion; (ii) for large λ values, the reactant molecule associates to the target mostly via surface diffusion; and (iii) for intermediate λ values, the reactant reaches the target via a combination of three-dimensional and two-dimensional search cycles. Our analysis also shows that the mean search times have different scalings as a function of the size of the surface segment depending on the nature of the dynamic search regime. Search dynamics are also sensitive to the position of the target for large scanning lengths. In addition, it is argued that the continuum description underestimates mean search times and does not always correctly describe the most optimal conditions for the surface-assisted dynamic processes. The importance of our findings for real natural systems is discussed.
International Nuclear Information System (INIS)
Gupta, Vinod Kumar; Yola, Mehmet Lütfi; Atar, Necip; Ustundag, Zafer; Solak, Ali Osman
2013-01-01
Graphical abstract: - Highlights: • We electrochemically prepared sensor based on graphene oxide. • The prepared electrode was characterized by using various techniques. • The proposed nanosensor showed good stability, selectivity and high sensitivity. • The proposed nanosensor electrode was used for the analysis of Cd(II) and Cu(II). - Abstract: Graphene oxide (GO) based glassy carbon (GC) electrode has been prepared. Firstly, p-nitrophenyl (NP) modified GC (NP/GC) electrode was prepared via the electrochemical reduction of its tetraflouroborate diazonium salt. After the formation of NP/GC electrode, the negative potential was applied to NP/GC electrode to reduce the nitro groups to amine. p-Aminophenyl (AP) modified GC (AP/GC) electrode was immersed into a graphene oxide solution containing 1-ethyl-3(3-(dimethlyamino)propyl)-carbodiimide. Hence, we constructed GO terminated AP modified GC (GO/AP/GC) electrode. NP/GC, AP/GC and GO/AP/GC electrodes were characterized sequentially using cyclic voltammetry (CV) in the presence of 1.0 mM of potassium ferricyanide in 0.1 M KCl. In addition, GO and GO/AP/GC surfaces were characterized by transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM). The GO/AP/GC electrode was used for the analysis of Cd(II) and Cu(II) ions by adsorptive stripping voltammetry. The linearity range and the detection limit of Cd(II) and Cu(II) ions were 1.0 × 10 −11 –5.0 × 10 −10 M and 3.3 × 10 −12 M (S/N = 3), respectively
Theoretical study of heavy metal Cd, Cu, Hg, and Ni(II) adsorption on the kaolinite(0 0 1) surface
Energy Technology Data Exchange (ETDEWEB)
Zhao, Jian, E-mail: zhaojian0209@aliyun.com [Institute of Applied Physics and Computational Mathematics, PO Box 8009, Beijing 100088 (China); State Key Laboratory of Geomechanics and Deep Underground Engineering, China University of Mining and Technology, Beijing 100083 (China); He, Man-Chao [State Key Laboratory of Geomechanics and Deep Underground Engineering, China University of Mining and Technology, Beijing 100083 (China)
2014-10-30
Highlights: • We investigated the adsorption of Cd, Cu, Hg, and Ni(II) on kaolinite(0 0 1) surface. • The adsorption capabilities of the kaolinite for HM atoms were Ni > Cu > Cd > Hg(II). • The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms. • The adsorption energy decreases with the coverage for Ni(II) atoms. - Abstract: Heavy metal pollution is currently of great concern because it has been recognized as a potential threat to air, water, and soil. Adsorption was one of the most popular methods for the removal of heavy metal. The adsorption of heavy metal Cd, Cu, Hg, and Ni(II) atoms on the hydroxylated (0 0 1) surface of kaolinite was investigated using density-functional theory within the generalized gradient approximation and a supercell approach. The coverage dependence of the adsorption structures and energetics were systematically studied for a wide range of coverage Θ [from 0.11 to 1.0 monolayers (ML)] and adsorption sites. The most stable among all possible adsorption sites for Cd(II) atom was the two-fold bridge site followed by the one-fold top site, and the top site was the most favorite adsorption site for Cu and Ni(II) atoms, while the three-fold hollow site was the most stable adsorption site for Hg(II) atom followed by the two-fold bridge site. The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms, thus indicating the higher stability of surface adsorption and a tendency to the formation of adsorbate islands (clusters) with increasing the coverage. However, the adsorption energy of Ni(II) atoms decreases when increasing the coverage. The adsorption capabilities of the kaolinite clay for the heavy metal atoms were in the order of Ni > Cu > Cd > Hg(II). The other properties of the Cd, Cu, Hg, and Ni(II)/kaolinite(0 0 1) system including the different charge distribution, the lattice relaxation, and the electronic density of states were also studied and discussed in detail.
Theoretical study of heavy metal Cd, Cu, Hg, and Ni(II) adsorption on the kaolinite(0 0 1) surface
International Nuclear Information System (INIS)
Zhao, Jian; He, Man-Chao
2014-01-01
Highlights: • We investigated the adsorption of Cd, Cu, Hg, and Ni(II) on kaolinite(0 0 1) surface. • The adsorption capabilities of the kaolinite for HM atoms were Ni > Cu > Cd > Hg(II). • The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms. • The adsorption energy decreases with the coverage for Ni(II) atoms. - Abstract: Heavy metal pollution is currently of great concern because it has been recognized as a potential threat to air, water, and soil. Adsorption was one of the most popular methods for the removal of heavy metal. The adsorption of heavy metal Cd, Cu, Hg, and Ni(II) atoms on the hydroxylated (0 0 1) surface of kaolinite was investigated using density-functional theory within the generalized gradient approximation and a supercell approach. The coverage dependence of the adsorption structures and energetics were systematically studied for a wide range of coverage Θ [from 0.11 to 1.0 monolayers (ML)] and adsorption sites. The most stable among all possible adsorption sites for Cd(II) atom was the two-fold bridge site followed by the one-fold top site, and the top site was the most favorite adsorption site for Cu and Ni(II) atoms, while the three-fold hollow site was the most stable adsorption site for Hg(II) atom followed by the two-fold bridge site. The adsorption energy increases with the coverage for Cd, Cu, and Hg(II) atoms, thus indicating the higher stability of surface adsorption and a tendency to the formation of adsorbate islands (clusters) with increasing the coverage. However, the adsorption energy of Ni(II) atoms decreases when increasing the coverage. The adsorption capabilities of the kaolinite clay for the heavy metal atoms were in the order of Ni > Cu > Cd > Hg(II). The other properties of the Cd, Cu, Hg, and Ni(II)/kaolinite(0 0 1) system including the different charge distribution, the lattice relaxation, and the electronic density of states were also studied and discussed in detail
Diffuse sound field: challenges and misconceptions
DEFF Research Database (Denmark)
Jeong, Cheol-Ho
2016-01-01
Diffuse sound field is a popular, yet widely misused concept. Although its definition is relatively well established, acousticians use this term for different meanings. The diffuse sound field is defined by a uniform sound pressure distribution (spatial diffusion or homogeneity) and uniform...... tremendously in different chambers because the chambers are non-diffuse in variously different ways. Therefore, good objective measures that can quantify the degree of diffusion and potentially indicate how to fix such problems in reverberation chambers are needed. Acousticians often blend the concept...... of mixing and diffuse sound field. Acousticians often refer diffuse reflections from surfaces to diffuseness in rooms, and vice versa. Subjective aspects of diffuseness have not been much investigated. Finally, ways to realize a diffuse sound field in a finite space are discussed....
Energy Technology Data Exchange (ETDEWEB)
Bremier, Stephane [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)
1997-12-19
This thesis has as objective the study of the effect of TiO{sub 2} additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO{sub 2} in the presence of TiO{sub 2} has been established and the influence of the PuO{sub 2} distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO{sub 2} and UO{sub 2}-PuO{sub 2}. The results concerning the influence of TiO{sub 2} upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO{sub 2} alone or in the presence of TiO{sub 2} are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO{sub 2}-PuO{sub 2} preparation upon the initial microstructure of the materials and the role played by the PuO{sub 2} grains in sintering. The potentiality of surface diffusion as a means of PuO{sub 2} spreading in the UO{sub 2} is evaluated and correlated with the reduced capacity of sintering the UO{sub 2} ceramics containing PuO{sub 2}. The last chapter deals with the influence of TiO{sub 2} on the development of microstructure in UO{sub 2}-PuO{sub 2} ceramics. While at temperatures below 1500 deg.C the TiO{sub 2} additive affects the surface diffusion and so the plutonium distribution, at values T{>=} 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO{sub 2}, PuO{sub 2} and titanium oxide. Thus the objective is
Speciation of neptunium after diffusion in Opalinus Clay
Energy Technology Data Exchange (ETDEWEB)
Reich, Tobias; Amayri, Samer; Drebert, Jakob; Froehlich, Daniel R.; Grolimund, Daniel; Rosemann, Jonathan [Mainz Univ. (Germany). Inst. of Nuclear Chemistry; Kaplan, Ugras [Paul Scherrer Institut, Villigen (Switzerland). Swiss Light Source
2015-07-01
Argillaceous rock formations are under consideration as a potential host rock for the construction of high-level nuclear waste repositories. Under environmental conditions the most stable oxidation states of {sup 237}Np (t{sub 1/2}=2.1 x 10{sup 6} a) are Np(IV) and Np(V). We have investigated the sorption and diffusion of the more mobile Np(V) in Opalinus Clay (OPA, Mont Terri, Switzerland) (Wu et al. 2009, Froehlich et al. 2011 and 2012 a). OPA, which is present in Switzerland and southern Germany, possesses a micro-scale heterogeneity and is composed of several types of clay minerals, but also of calcite, quartz and iron(II)-bearing minerals. In our previous diffusion (Wu et al. 2009) and anaerobic sorption experiments (Froehlich et al. 2011), we observed higher distribution coefficients, K{sub d}, than expected from batch experiments performed in air, indicating that a partial reduction of Np(V) to Np(IV) had occurred. To test this hypothesis, different sorption and diffusion samples with Np(V) were prepared at pH 7.6 for spatially resolved molecular-level investigations at the microXAS beamline at the Swiss Light Source (PSI, Villigen, Switzerland) (Froehlich et al. 2012 b). Elemental distributions of Ca, Fe and Np have been determined by μ-XRF mapping. Regions of high Np concentration were subsequently investigated by Np L{sub III}-edge μ-XANES. In most samples Np spots with considerable amounts of tetravalent Np could be found, even when the experiments were performed under ambient-air conditions. In some cases, almost pure Np(IV) L{sub III}-edge XANES spectra were recorded. In case of the anaerobic sorption sample, a clear correlation between Np and Fe was observed by μ-XRF, indicating that iron(II)-bearing minerals could be responsible for the reduction of Np(V). μ-XRD measurements of this sample showed that pyrite is at least one of the redox-active phases determining the speciation of Np in OPA. In this case, Np was accumulated on pyrite, indicating
International Nuclear Information System (INIS)
Hanna, S.R.
1976-01-01
It is hoped that urban diffusion models of air pollutants can eventually confidently be used to make major decisions, such as in planning the layout of a new industrial park, determining the effects of a new highway on air quality, or estimating the results of a new automobile emissions exhaust system. The urban diffusion model itself should be able to account for point, line, and area sources, and the local aerodynamic effects of street canyons and building wakes. Removal or transformations due to dry or wet deposition and chemical reactions are often important. It would be best if the model included meteorological parameters such as wind speed and temperature as dependent variables, since these parameters vary significantly when air passes from rural surfaces over urban surfaces
Wang, Z. B.; Lu, K.; Wilde, G.; Divinski, S.
2008-09-01
Room temperature diffusion of Ni63 in Cu with a gradient microstructure prepared by surface mechanical attrition treatment (SMAT) was investigated by applying the radiotracer technique. The results reveal significant penetration of Ni into the nanostructured layer. The relevant diffusivity is higher than that along the conventional high-angle grain boundaries by about six orders of magnitude. This behavior is associated with a higher energy state of internal interfaces produced via plastic deformation. The diffusivity in the top surface layer is somewhat smaller than that in the subsurface layer. This fact is related to nanotwin formation in the former during SMAT.
Yamamoto, Takehiro; Emura, Chie; Oya, Masashi
2016-12-01
The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.
Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)
International Nuclear Information System (INIS)
Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.
2013-01-01
In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)
International Nuclear Information System (INIS)
Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko
2010-01-01
Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.
Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko
2010-09-29
Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.
Modeling dendrite density from magnetic resonance diffusion measurements
DEFF Research Database (Denmark)
Jespersen, Sune Nørhøj; Kroenke, CD; Østergaard, Leif
2007-01-01
in this model: (i) the dendrites and axons, which are modeled as long cylinders with two diffusion coefficients, parallel (DL) and perpendicular (DT) to the cylindrical axis, and (ii) an isotropic monoexponential diffusion component describing water diffusion within and across all other structures, i.......e., in extracellular space and glia cells. The model parameters are estimated from 153 diffusion-weighted images acquired from a formalin-fixed baboon brain. A close correspondence between the data and the signal model is found, with the model parameters consistent with literature values. The model provides......Diffusion-weighted imaging (DWI) provides a noninvasive tool to probe tissue microstructure. We propose a simplified model of neural cytoarchitecture intended to capture the essential features important for water diffusion as measured by NMR. Two components contribute to the NMR signal...
Crystal Structure of Rat Carnitine Palmitoyltransferase II (CPT-II)
Energy Technology Data Exchange (ETDEWEB)
Hsiao,Y.; Jogl, G.; Esser, V.; Tong, L.
2006-01-01
Carnitine palmitoyltransferase II (CPT-II) has a crucial role in the {beta}-oxidation of long-chain fatty acids in mitochondria. We report here the crystal structure of rat CPT-II at 1.9 Angstroms resolution. The overall structure shares strong similarity to those of short- and medium-chain carnitine acyltransferases, although detailed structural differences in the active site region have a significant impact on the substrate selectivity of CPT-II. Three aliphatic chains, possibly from a detergent that is used for the crystallization, were found in the structure. Two of them are located in the carnitine and CoA binding sites, respectively. The third aliphatic chain may mimic the long-chain acyl group in the substrate of CPT-II. The binding site for this aliphatic chain does not exist in the short- and medium-chain carnitine acyltransferases, due to conformational differences among the enzymes. A unique insert in CPT-II is positioned on the surface of the enzyme, with a highly hydrophobic surface. It is likely that this surface patch mediates the association of CPT-II with the inner membrane of the mitochondria.
Energy Technology Data Exchange (ETDEWEB)
Zarzycki, Piotr [Energy; Institute; Rosso, Kevin M. [Pacific Northwest
2017-06-15
Understanding Fe(II)-catalyzed transformations of Fe(III)- (oxyhydr)oxides is critical for correctly interpreting stable isotopic distributions and for predicting the fate of metal ions in the environment. Recent Fe isotopic tracer experiments have shown that goethite undergoes rapid recrystallization without phase change when exposed to aqueous Fe(II). The proposed explanation is oxidation of sorbed Fe(II) and reductive Fe(II) release coupled 1:1 by electron conduction through crystallites. Given the availability of two tracer exchange data sets that explore pH and particle size effects (e.g., Handler et al. Environ. Sci. Technol. 2014, 48, 11302-11311; Joshi and Gorski Environ. Sci. Technol. 2016, 50, 7315-7324), we developed a stochastic simulation that exactly mimics these experiments, while imposing the 1:1 constraint. We find that all data can be represented by this model, and unifying mechanistic information emerges. At pH 7.5 a rapid initial exchange is followed by slower exchange, consistent with mixed surface- and diffusion-limited kinetics arising from prominent particle aggregation. At pH 5.0 where aggregation and net Fe(II) sorption are minimal, that exchange is quantitatively proportional to available particle surface area and the density of sorbed Fe(II) is more readily evident. Our analysis reveals a fundamental atom exchange rate of ~10-5 Fe nm-2 s-1, commensurate with some of the reported reductive dissolution rates of goethite, suggesting Fe(II) release is the rate-limiting step in the conduction mechanism during recrystallization.
Energy Technology Data Exchange (ETDEWEB)
Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)
2012-10-01
To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.
Energy Technology Data Exchange (ETDEWEB)
Wang, Chi-Jen [Iowa State Univ., Ames, IA (United States)
2013-01-01
In this thesis, we analyze both the spatiotemporal behavior of: (A) non-linear “reaction” models utilizing (discrete) reaction-diffusion equations; and (B) spatial transport problems on surfaces and in nanopores utilizing the relevant (continuum) diffusion or Fokker-Planck equations. Thus, there are some common themes in these studies, as they all involve partial differential equations or their discrete analogues which incorporate a description of diffusion-type processes. However, there are also some qualitative differences, as shall be discussed below.
An inverse diffusivity problem for the helium production–diffusion equation
International Nuclear Information System (INIS)
Bao, Gang; Xu, Xiang
2012-01-01
Thermochronology is a technique for the extraction of information about the thermal history of rocks. Such information is crucial for determining the depth below the surface at which rocks were located at a given time (Bao G et al 2011 Commun. Comput. Phys. 9 129). Mathematically, extracting the time–temperature path can be formulated as an inverse diffusivity problem for the helium production–diffusion equation which is the underlying process of thermochronology. In this paper, to reconstruct the diffusivity which depends on space only and accounts for the structural information of rocks, a local Hölder conditional stability is obtained by a Carleman estimate. A uniqueness result is also proven for extracting the thermal history, i.e. identifying the time-dependant part of the diffusion coefficient, provided that it is analytical with respect to time. Numerical examples are presented to illustrate the validity and effectiveness of the proposed regularization scheme. (paper)
Zhang, Zhen; Zhang, Zhongming; Chen, Hong; Liu, Jin; Liu, Chang; Ni, Hong; Zhao, Changsong; Ali, Muhammad; Liu, Fan; Li, Lin
2015-06-03
In this manuscript, we report that a bacterial multicopper oxidase (MCO266) catalyzes Mn(II) oxidation on the cell surface, resulting in the surface deposition of Mn(III) and Mn(IV) oxides and the gradual formation of bulky oxide aggregates. These aggregates serve as nucleation centers for the formation of Mn oxide micronodules and Mn-rich sediments. A soil-borne Escherichia coli with high Mn(II)-oxidizing activity formed Mn(III)/Mn(IV) oxide deposit layers and aggregates under laboratory culture conditions. We engineered MCO266 onto the cell surfaces of both an activity-negative recipient and wild-type strains. The results confirmed that MCO266 governs Mn(II) oxidation and initiates the formation of deposits and aggregates. By contrast, a cell-free substrate, heat-killed strains, and intracellularly expressed or purified MCO266 failed to catalyze Mn(II) oxidation. However, purified MCO266 exhibited Mn(II)-oxidizing activity when combined with cell outer membrane component (COMC) fractions in vitro. We demonstrated that Mn(II) oxidation and aggregate formation occurred through an oxygen-dependent biotic transformation process that requires a certain minimum Mn(II) concentration. We propose an approximate electron transfer pathway in which MCO266 transfers only one electron to convert Mn(II) to Mn(III) and then cooperates with other COMC electron transporters to transfer the other electron required to oxidize Mn(III) to Mn(IV).
Consistency in the description of diffusion in compacted bentonite
International Nuclear Information System (INIS)
Lehikoinen, J.; Muurinen, A.
2009-01-01
A macro-level diffusion model, which aims to provide a unifying framework for explaining the experimentally observed co-ion exclusion and greatly controversial counter-ion surface diffusion in a consistent fashion, is presented. It is explained in detail why a term accounting for the non-zero mobility of the counter-ion surface excess is required in the mathematical form of the macroscopic diffusion flux. The prerequisites for the consistency of the model and the problems associated with the interpretation of diffusion in such complex pore geometries as in compacted smectite clays are discussed. (author)
Modelling water fluxes for the analysis of diffuse pollution at the river basin scale
Wit, de M.; Meinardi, C.R.; Wendland, F.; Kunkel, R.
2000-01-01
Diffuse pollution is a significant and sometimes even major component of surface water pollution. Diffuse inputs of pollutants to the surface water are related to runoff of precipitation. This means that the analysis of diffuse pollutant fluxes from the land surface to the surface water requires an
International Nuclear Information System (INIS)
Helander, P.; Hazeltine, R.D.; Catto, P.J.
1996-01-01
The orderings in the kinetic equations commonly used to study the plasma core of a tokamak do not allow a balance between parallel ion streaming and radial diffusion, and are, therefore, inappropriate in the plasma edge. Different orderings are required in the edge region where radial transport across the steep gradients associated with the scrape-off layer is large enough to balance the rapid parallel flow caused by conditions close to collecting surfaces (such as the Bohm sheath condition). In the present work, we derive and solve novel kinetic equations, allowing for such a balance, and construct distinctive transport laws for impure, collisional, edge plasmas in which the perpendicular transport is (i) due to Coulomb collisions of ions with heavy impurities, or (ii) governed by anomalous diffusion driven by electrostatic turbulence. In both the collisional and anomalous radial transport cases, we find that one single diffusion coefficient determines the radial transport of particles, momentum and heat. The parallel transport laws and parallel thermal force in the scrape-off layer assume an unconventional form, in which the relative ion-impurity flow is driven by a combination of the conventional parallel gradients, and new (i) collisional or (ii) anomalous terms involving products of radial derivatives of the temperature and density with the radial shear of the parallel velocity. Thus, in the presence of anomalous radial diffusion, the parallel ion transport cannot be entirely classical, as usually assumed in numerical edge computations. The underlying physical reason is the appearance of a novel type of parallel thermal force resulting from the combined action of anomalous diffusion and radial temperature and velocity gradients. In highly sheared flows the new terms can modify impurity penetration into the core plasma
Energy Technology Data Exchange (ETDEWEB)
Hofer, Thomas James [Univ. of Minnesota, Minneapolis, MN (United States)
2014-12-01
The CDMS-II phase of the Cryogenic Dark Matter Search, a dark matter direct-detection experiment, was operated at the Soudan Underground Laboratory from 2003 to 2008. The full payload consisted of 30 ZIP detectors, totaling approximately 1.1 kg of Si and 4.8 kg of Ge, operated at temperatures of 50 mK. The ZIP detectors read out both ionization and phonon pulses from scatters within the crystals; channel segmentation and analysis of pulse timing parameters allowed e ective ducialization of the crystal volumes and background rejection su cient to set world-leading limits at the times of their publications. A full re-analysis of the CDMS-II data was motivated by an improvement in the event reconstruction algorithms which improved the resolution of ionization energy and timing information. The Ge data were re-analyzed using three distinct background-rejection techniques; the Si data from runs 125 - 128 were analyzed for the rst time using the most successful of the techniques from the Ge re-analysis. The results of these analyses prompted a novel \\mid-threshold" analysis, wherein energy thresholds were lowered but background rejection using phonon timing information was still maintained. This technique proved to have signi cant discrimination power, maintaining adequate signal acceptance and minimizing background leakage. The primary background for CDMS-II analyses comes from surface events, whose poor ionization collection make them di cult to distinguish from true nuclear recoil events. The novel detector technology of SuperCDMS, the successor to CDMS-II, uses interleaved electrodes to achieve full ionization collection for events occurring at the top and bottom detector surfaces. This, along with dual-sided ionization and phonon instrumentation, allows for excellent ducialization and relegates the surface-event rejection techniques of CDMS-II to a secondary level of background discrimination. Current and future SuperCDMS results hold great promise for mid- to low
Pecan nutshell as biosorbent to remove Cu(II), Mn(II) and Pb(II) from aqueous solutions.
Vaghetti, Julio C P; Lima, Eder C; Royer, Betina; da Cunha, Bruna M; Cardoso, Natali F; Brasil, Jorge L; Dias, Silvio L P
2009-02-15
In the present study we reported for the first time the feasibility of pecan nutshell (PNS, Carya illinoensis) as an alternative biosorbent to remove Cu(II), Mn(II) and Pb(II) metallic ions from aqueous solutions. The ability of PNS to remove the metallic ions was investigated by using batch biosorption procedure. The effects such as, pH, biosorbent dosage on the adsorption capacities of PNS were studied. Four kinetic models were tested, being the adsorption kinetics better fitted to fractionary-order kinetic model. Besides that, the kinetic data were also fitted to intra-particle diffusion model, presenting three linear regions, indicating that the kinetics of adsorption should follow multiple sorption rates. The equilibrium data were fitted to Langmuir, Freundlich, Sips and Redlich-Peterson isotherm models. Taking into account a statistical error function, the data were best fitted to Sips isotherm model. The maximum biosorption capacities of PNS were 1.35, 1.78 and 0.946mmolg(-1) for Cu(II), Mn(II) and Pb(II), respectively.
Aymard, François; Gulminelli, Francesca; Margueron, Jérôme
2016-08-01
We have recently addressed the problem of the determination of the nuclear surface energy for symmetric nuclei in the framework of the extended Thomas-Fermi (ETF) approximation using Skyrme functionals. We presently extend this formalism to the case of asymmetric nuclei and the question of the surface symmetry energy. We propose an approximate expression for the diffuseness and the surface energy. These quantities are analytically related to the parameters of the energy functional. In particular, the influence of the different equation of state parameters can be explicitly quantified. Detailed analyses of the different energy components (local/non-local, isoscalar/isovector, surface/curvature and higher order) are also performed. Our analytical solution of the ETF integral improves previous models and leads to a precision of better than 200 keV per nucleon in the determination of the nuclear binding energy for dripline nuclei.
International Nuclear Information System (INIS)
Lee, Gun Do; Wang, C. Z.; Lu, Z. Y.; Ho, K. M.
1999-01-01
The diffusion pathways along the trough and between the trough and the dimer row on the Si(100) surface are investigated by tight-binding molecular dynamics calculations using the environment dependent tight-binding silicon potential and by ab initio calculations using the Car-Parrinello method. The studies discover new diffusion pathways consisting of rotation of addimer. The calculated energy barrier are in excellent agreement with experiment. The rotational diffusion pathway between the trough and the dimer row is much more energetically favorable than other diffusion pathways by parallel and perpendicular addimer. The new pathway along the trough is nearly same as the energy barrier of the diffusion pathway by dissociation of the addimer
Influence of Diffusivity in Room on its Acoustic Response
Directory of Open Access Journals (Sweden)
D. Šumarac Pavlović
2010-11-01
Full Text Available Diffusivity is a geometrical feature of the room which is proportional to the dimension of relief on its interior surfaces. This paper presents the results of analysis which investigates the correlation between diffusivity in a room and parameters calculated from a recorded impulse response. The analysis was performed using a specially prepared physical model of a parallelepipedic room with different combinations of flat and diffusive interior surfaces.
Ocular surface changes in type II diabetic patients with proliferative diabetic retinopathy
Directory of Open Access Journals (Sweden)
Yan Gao
2015-04-01
Full Text Available AIM: To detect and analyze the changes on ocular surface and tear function in type II diabetic patients with proliferative diabetic retinopathy (PDR, an advanced stage of diabetic retinopathy (DR, using conventional ophthalmic tests and the high-resolution laser scanning confocal microscopy. METHODS: Fifty-eight patients with type II diabetes were selected. Based on the diagnostic criteria and stage classification of DR, the patients were divided into the non-DR (NDR group and the PDR group. Thirty-six patients with cataract but no other ocular and systemic disease were included as non-diabetic controls. All the patients were subjected to the conventional clinical tests of corneal sensitivity, Schirmer I Test, and corneal fluorescein staining. The non-invasive tear film break-up time (NIBUT and tear interferometry were conducted by a Tearscope Plus. The morphology of corneal epithelia and nerve fibers was examined using the high-resolution confocal microscopy. RESULTS: The NDR group exhibited significantly declined corneal sensitivity and Schirmer I test value, as compared to the non-diabetic controls (P< 0.001. The PDR group showed significantly reduced corneal sensitivity, Schirmer I test value, and NIBUT in comparison to the non-diabetic controls (P < 0.001. Corneal fluorescein staining revealed the progressively injured corneal epithelia in the PDR patients. Moreover, significant decrease in the corneal epithelial density and morphological abnormalities in the corneal epithelia and nerve fibers were also observed in the PDR patients. CONCLUSION: Ocular surface changes, including blunted corneal sensitivity, reduced tear secretion, tear film dysfunction, progressive loss of corneal epithelia and degeneration of nerve fibers, are common in type II diabetic patients, particularly in the diabetic patients with PDR. The corneal sensitivity, fluorescein staining scores, and the density of corneal epithelial cells and nerve fibers in the diabetic
Ocular surface changes in type II diabetic patients with proliferative diabetic retinopathy
Institute of Scientific and Technical Information of China (English)
Yan; Gao; Yan; Zhang; Yu-Sha; Ru; Xiao-Wu; Wang; Ji-Zhong; Yang; Chun-Hui; Li; Hong-Xing; Wang; Xiao-Rong; Li; Bing; Li
2015-01-01
AIM: To detect and analyze the changes on ocular surface and tear function in type II diabetic patients with proliferative diabetic retinopathy(PDR), an advanced stage of diabetic retinopathy(DR), using conventional ophthalmic tests and the high-resolution laser scanning confocal microscopy.METHODS: Fifty-eight patients with type II diabetes were selected. Based on the diagnostic criteria and stage classification of DR, the patients were divided into the non-DR(NDR) group and the PDR group. Thirty-six patients with cataract but no other ocular and systemic disease were included as non-diabetic controls. All the patients were subjected to the conventional clinical tests of corneal sensitivity, Schirmer I test, and corneal fluorescein staining. The non-invasive tear film break-up time(NIBUT) and tear interferometry were conducted by a Tearscope Plus. The morphology of corneal epithelia and nerve fibers was examined using the high-resolution confocal microscopy.RESULTS: The NDR group exhibited significantly declined corneal sensitivity and Schirmer I test value, as compared to the non-diabetic controls(P <0.001). The PDR group showed significantly reduced corneal sensitivity, Schirmer I test value, and NIBUT in comparison to the non-diabetic controls(P <0.001).Corneal fluorescein staining revealed the progressively injured corneal epithelia in the PDR patients. Moreover,significant decrease in the corneal epithelial density andmorphological abnormalities in the corneal epithelia and nerve fibers were also observed in the PDR patients.CONCLUSION: Ocular surface changes, including blunted corneal sensitivity, reduced tear secretion, tear film dysfunction, progressive loss of corneal epithelia and degeneration of nerve fibers, are common in type II diabetic patients, particularly in the diabetic patients with PDR. The corneal sensitivity, fluorescein staining scores,and the density of corneal epithelial cells and nerve fibers in the diabetic patients correlate with the
Energy Technology Data Exchange (ETDEWEB)
Souza, Adilson P.; Escobedo, Joao F. [Universidade Estadual Paulista (UNESP), Botucatu, SP (Brazil)], E-mail: pachecopgid@yahoo.com.br
2010-07-01
This study evaluated the monthly and annual total radiation global, direct and diffuse on horizontal surfaces and tilted surfaces to 12.85 deg (|L|-10 deg), 22.85 deg (|L|) and 32.85 deg (|L|+10 deg), with the north face, in Botucatu, SP. The measures occurred in the following dates: 04/1998 to 07/2001 at 22.85 deg; 08/2001 to 02/2003 at 12.85 deg, and 03/2003 to 12/2007 in 32.85. In all periods occurred concurrent measures in the horizontal plane (reference). The total annual global radiation equal to 6500.87; 7044.21; 7193.24 and 6854.99 MJ m{sup -2}, for horizontal surfaces, 12.85 deg, 22.85 deg e 32.85 deg. The change of the angles of inclination throughout the year enabled gains of 324.92 MJ m{sup -2} (4.74%) in global radiation in relation to 22,85 deg, distributed as follows: I) horizontal: December, January and February; II) of 12.85: March and October; III) of 22.85: April, May, September and November, IV) of 32.85: June-August. In 22.85 were recorded the annual radiation directly (4367.40 MJ m{sup -2}), exceeding 12.85 deg, 32.85 deg and horizontal, 72.40, 284.67 and 718.03 MJ m{sup -2}, however, were achieved gains 16.82% compared to 22.85 deg. For diffuse radiation, annual earnings totaled 226.57 MJ m{sup -2} (compared with 22.85 deg), with differences of less than 103.00 MJ m{sup -2} between 12.85 deg, 22.85 deg and 32.85 deg. (author)
1979-01-01
A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.
Czech Academy of Sciences Publication Activity Database
Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander
2016-01-01
Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016
Hydrotreating catalyst deactivation by coke from SRC-II oil
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Y.; Kumata, F.; Massoth, F.E.
1988-10-01
Samples of a CoMo/Al/sub 2/O/sub 3/ catalyst were partially deactivated with SRC-II feed in an autoclave reactor to give coked samples of 5 to 18% C. The coked catalysts were analyzed for surface area, pore volume, coronene adsorption and diffusivity, and their catalytic activity determined for hydrodesulfurization (HDS), hydrodeoxygenation (HDO) and C-N hydrogenolysis (CNH) using model compounds. All of the above measurements decreased with increase in coke content. Property data indicate that some pores are blocked by coke and diffusivity results show narrowing of pore mouths with increasing coke content. Catalyst deactivation versus coke level was identical for HDS and HDO, but less for CNH. A simple model of coke deactivation was developed to relate activity to coke content. Coke is envisioned as forming wedge-like deposits in the catalyst pores. 11 refs., 5 figs., 3 tabs.
Physical bases for diffusion welding processes optimization
International Nuclear Information System (INIS)
Bulygina, S.M.; Berber, N.N.; Mukhambetov, D.G.
1999-01-01
One of wide-spread method of different materials joint is diffusion welding. It has being brought off at the expense of mutual diffusion of atoms of contacting surfaces under long-duration curing at its heating and compression. Welding regime in dependence from properties of welding details is defining of three parameters: temperature, pressure, time. Problem of diffusion welding optimization concludes in determination less values of these parameters, complying with requirements for quality of welded joint. In the work experiments on diffusion welding for calculated temperature and for given surface's roughness were carried out. Tests conduct on samples of iron and iron-nickel alloy with size 1·1·1 cm 3 . Optimal regime of diffusion welding of examined samples in vacuum is defined. It includes compression of welding samples, heating, isothermal holding at temperature 650 deg C during 0.5 h and affords the required homogeneity of joint
Nuclear diffuseness as a degree of freedom
Myers, W. D.; ŚwiaŢecki, W. J.
1998-12-01
The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Süssmann width b.
Nuclear diffuseness as a degree of freedom
International Nuclear Information System (INIS)
Myers, W.D.; Swiatecki, W.J.
1998-01-01
The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Suessmann width b. copyright 1998 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Amini, Malihe; Younesi, Habibollah [Department of Environmental Science, Faculty of Natural Resources and Marine Sciences, Tarbiat Modares University, Noor (Iran)
2009-10-15
In this study, the biosorption of Cd(II), Ni(II) and Pb(II) on Aspergillus niger in a batch system was investigated, and optimal condition determined by means of central composite design (CCD) under response surface methodology (RSM). Biomass inactivated by heat and pretreated by alkali solution was used in the determination of optimal conditions. The effect of initial solution pH, biomass dose and initial ion concentration on the removal efficiency of metal ions by A. niger was optimized using a design of experiment (DOE) method. Experimental results indicated that the optimal conditions for biosorption were 5.22 g/L, 89.93 mg/L and 6.01 for biomass dose, initial ion concentration and solution pH, respectively. Enhancement of metal biosorption capacity of the dried biomass by pretreatment with sodium hydroxide was observed. Maximal removal efficiencies for Cd(II), Ni(III) and Pb(II) ions of 98, 80 and 99% were achieved, respectively. The biosorption capacity of A. niger biomass obtained for Cd(II), Ni(II) and Pb(II) ions was 2.2, 1.6 and 4.7 mg/g, respectively. According to these observations the fungal biomass of A. niger is a suitable biosorbent for the removal of heavy metals from aqueous solutions. Multiple response optimization was applied to the experimental data to discover the optimal conditions for a set of responses, simultaneously, by using a desirability function. (Abstract Copyright [2009], Wiley Periodicals, Inc.)
Boron Diffusion in Surface-Treated Framing Lumber
Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson
2013-01-01
The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...
Wang, Chongqing; Wang, Hui; Gu, Guohua
2018-02-15
Alkali treatment of lignocellulosic biomass is conducted to remove hemi-cellulose and lignin, further increasing the reactivity and accessibility of cellulose. Ultrasound-assisted xanthation of alkali cellulose is optimized by response surface methodology (RSM) with a Box-Behnken design. A predicting mathematical model is obtained by fitting experimental data, and it is verified by analysis of variance. Response surface plots and the contour plots obtained from the model are applied to determine the interactions of experimental variables. The optimum conditions are NaOH concentration 1.3mol/L, ultrasonic time 71.6min and CS 2 dosage 1.5mL. FTIR, SEM and XPS characterizations confirm the synthesis and sorption mechanism of cellulose xanthate (CX). Biosorption of Pb (II) onto CX obeys pseudo-second order model and Langmuir model. The sorption mechanism is attributed to surface complexation or ion exchange. CX shows good reusability for Pb (II) sorption. The maximum sorption capacity of Pb(II) is 134.41mg/g, higher than that of other biosorbents. CX has great potential as an efficient and low-cost biosorbent for wastewater treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H
2015-06-03
Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Diffusion time scales and accretion in the sun
International Nuclear Information System (INIS)
Michaud, G.
1977-01-01
It is thought that surface abundances in the Sun could be due largely to accretion either of comets or grains, and it has been suggested that if surface convection zones were smaller than is usually indicated by model calculations, accretion would be especially important. Unless the zone immediately below the surface convection zone is sufficiently stable for diffusion to be important, other transport processes, such as turbulence and meridional circulation, more efficient than diffusion, will tend to homogenise the Sun. Diffusion is the slowest of the transport processes and will become important when other transport processes become inoperative. Using diffusion theory the minimum mass of the convection zone can be determined in order that transport processes at the bottom of the zone are not to influence abundances in the convection zone. If diffusion time scales are shorter than the life of the star (Sun) diffusion will modify the abundances in the convection zone. The mass in the convection zone for which diffusion time scales are equal to the life of the star on the main sequence then determines the minimum mass in the convection zone that justifies neglect of transport processes at the bottom of the convection zone. It is calculated here that, for the Sun, this mass is between 3 x 10 -3 and 10 -2 solar mass, and a general explosion is derived for the diffusion time scale as a function of the mass of the convection zone. (U.K.)
Diffusion and sorption properties of radionuclides in compacted bentonite
Energy Technology Data Exchange (ETDEWEB)
Yu Ji-Wei; Neretnieks, I. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Chemical Engineering and Technology
1997-07-01
In this report, recent studies on sorption and diffusion of radionuclides in compacted bentonite have been reviewed. The sorption distribution coefficient and diffusion coefficient data obtained from experiments in the literature have been compiled. Based on these experimental data and the report SKB-TR--91-16 (Brandberg and Skagius, 1991), this report proposes a set of sorption distribution coefficient and diffusion coefficient values for modelling purpose for safety analysis of nuclear waste repositories. The variability and uncertainty of the diffusivity data span somewhat more than an order or magnitude up and down. Most of the nuclides have an effective diffusivity in around 10{sup -10} m{sup 2}/s. Ion exclusion effects are observed for C, Cl and for Tc in oxidizing waters. Effective diffusivities are nearly tow orders of magnitude lower for these elements and of the order of 10{sup -12} m{sup 2}/s. Surface diffusion effects are found for Cs, Ni, Pa, Pb, Ra, Sn, Sr and Zr. Effective diffusivities for these elements are of the order of 10{sup -8} m{sup 2}/s. The surface diffusion effect should decrease in saline waters which is seen for Cs and Sr where there are data available. It is also deemed that Ra will have this effect because of its similarity with Sr. The other nuclides should also show this decrease but no data is available. Sorption and diffusion mechanisms in compacted bentonite are discussed in the report. In highly compacted bentonite, sorption and hence its distribution coefficient is not well defined, and a pore diffusion coefficient or a surface diffusion coefficient is not well defined either. Therefore, an apparent diffusion coefficient and a total concentration gradient should be more relevant in describing the diffusion process in compacted bentonite. 99 refs.
Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V
2018-04-01
The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.
Slaved diffusion in phospholipid bilayers
Zhang, Liangfang; Granick, Steve
2005-01-01
The translational diffusion of phospholipids in supported fluid bilayers splits into two populations when polyelectrolytes adsorb at incomplete surface coverage. Spatially resolved measurements using fluorescence correlation spectroscopy show that a slow mode, whose magnitude scales inversely with the degree of polymerization of the adsorbate, coexists with a fast mode characteristic of naked lipid diffusion. Inner and outer leaflets of the bilayer are affected nearly equally. Mobility may vary from spot to spot on the membrane surface, despite the lipid composition being the same. This work offers a mechanism to explain how nanosized domains with reduced mobility arise in lipid membranes. PMID:15967988
Chen, Gong; Kong, Xian; Lu, Diannan; Wu, Jianzhong; Liu, Zheng
2017-05-10
Molecular dynamics (MD) simulations, in combination with the Markov-state model (MSM), were applied to probe CO 2 diffusion from an aqueous solution into the active site of human carbonic anhydrase II (hCA-II), an enzyme useful for enhanced CO 2 capture and utilization. The diffusion process in the hydrophobic pocket of hCA-II was illustrated in terms of a two-dimensional free-energy landscape. We found that CO 2 diffusion in hCA-II is a rate-limiting step in the CO 2 diffusion-binding-reaction process. The equilibrium distribution of CO 2 shows its preferential accumulation within a hydrophobic domain in the protein core region. An analysis of the committors and reactive fluxes indicates that the main pathway for CO 2 diffusion into the active site of hCA-II is through a binding pocket where residue Gln 136 contributes to the maximal flux. The simulation results offer a new perspective on the CO 2 hydration kinetics and useful insights toward the development of novel biochemical processes for more efficient CO 2 sequestration and utilization.
Sequestration of Cu(II), Ni(II), and Co(II) by ethyleneimine immobilized on silica
International Nuclear Information System (INIS)
Arakaki, Luiza N.H.; Alves, Ana Paula M.; Silva Filho, Edson C. da; Fonseca, Maria G.; Oliveira, Severino F.; Espinola, Jose Geraldo P.; Airoldi, Claudio
2007-01-01
Thermodynamic data on interaction of Cu(II), Ni(II), and Co(II) with silica modified with ethyleneimine are obtained by calorimetric titration. The amount of ethyleneimine anchored on silica surface was estimated to be 0.70 mmol g -1 . The enthalpies of binding Ni(II), Cu(II) and Co(II), are -3.59 ± 0.001, -4.88 ± 0.001, and -7.75 ± 0.003 kJ mol -1 , respectively
Simulation of the diffusion equation on a type-II quantum computer
International Nuclear Information System (INIS)
Berman, G.P.; Kamenev, D.I.; Ezhov, A.A.; Yepez, J.
2002-01-01
A lattice-gas algorithm for the one-dimensional diffusion equation is realized using radio frequency pulses in a one-dimensional spin system. The model is a large array of quantum two-qubit nodes interconnected by the nearest-neighbor classical communication channels. We present a quantum protocol for implementation of the quantum collision operator and a method for initialization and reinitialization of quantum states. Numerical simulations of the quantum-classical dynamics are in good agreement with the analytic solution for the diffusion equation
Degradation of TCE by TEOS Coated nZVI in the Presence of Cu(II) for Groundwater Remediation
International Nuclear Information System (INIS)
Ramamurthy, A.S.; Eglal, M.M.
2014-01-01
The removal of TCE by nanofer zero valent iron (nanofer ZVI) coated with tetraethyl orthosilicate (TEOS) in the presence of Cu(II) at different environmental conditions was studied. The kinetics of TCE degradation by nanofer ZVI was determined. At a dosage of 10 mg of nanofer ZVI, almost 63% of TCE was removed, when Cu(II) and TCE were present. It contrasts with 42% degradation of TCE in the absence of Cu(II). SEM/EDS images indicated that Cu(II) is reduced to form Cu 0 and Cu 2 O. These formations are considered to be responsible for enhancing TCE degradation. Direct reduction involves hydrogenolysis and β-elimination in the transformation of TCE, while indirect reduction involves atomic hydrogen and no direct electron transfer from the metal to reactants. The reduction of activation energy was also noted indicating that the rate limiting step for TCE degradation in the presence of Cu(II) is surface chemical reaction rather than diffusion. Most of iron present in nanofer ZVI get dissolved causing the generation of localized positive charge regions and form metal chlorides. Local accumulation of hydrochloric acid inside the pits regenerates new reactive surfaces to serve as sources of continuous electron generation. No significant effect of TCE was noticed for Cu(II) sequestration.
Directory of Open Access Journals (Sweden)
Nahid Nishat
2016-09-01
Full Text Available A biodegradable polymer was synthesized by the modification reaction of polymeric starch with thiourea which is further modified by transition metals, Mn(II, Co(II, Ni(II, Cu(II and Zn(II. All the polymeric compounds were characterized by (FT-IR spectroscopy, 1H NMR spectroscopy, 13C NMR spectroscopy, UV–visible spectra, magnetic moment measurements, thermogravimetric analysis (TGA and antibacterial activities. Polymer complexes of Mn(II, Co(II and Ni(II show octahedral geometry, while polymer complexes of Cu(II and Zn(II show square planar and tetrahedral geometry, respectively. The TGA revealed that all the polymer metal complexes are more thermally stable than their parental ligand. In addition, biodegradable studies of all the polymeric compounds were also carried out through ASTM-D-5338-93 standards of biodegradable polymers by CO2 evolution method which says that coordination decreases biodegradability. The antibacterial activity was screened with the agar well diffusion method against some selected microorganisms. Among all the complexes, the antibacterial activity of the Cu(II polymer–metal complex showed the highest zone of inhibition because of its higher stability constant.
Ambrosi, Elisa; Rossi-Espagnet, Maria Camilla; Kotzalidis, Georgios D; Comparelli, Anna; Del Casale, Antonio; Carducci, Filippo; Romano, Andrea; Manfredi, Giovanni; Tatarelli, Roberto; Bozzao, Alessandro; Girardi, Paolo
2013-09-05
Brain structural changes have been described in bipolar disorder (BP), but usually studies focused on both I and II subtypes indiscriminately and investigated changes in either brain volume or white matter (WM) integrity. We used combined voxel-based morphometry (VBM) and diffusion tensor imaging (DTI) analysis to track changes in the grey matter (GM) and WM in the brains of patients affected by BPII, as compared to healthy controls. Using VBM and DTI, we scanned 20 DSM-IV-TR BPII patients in their euthymic phase and 21 healthy, age- and gender-matched volunteers with no psychiatric history. VBM showed decreases in GM of BPII patients, compared to controls, which were diffuse in nature and most prominent in the right middle frontal gyrus and in the right superior temporal gurus. DTI showed significant and widespread FA reduction in BPII patients in all major WM tracts, including cortico-cortical association tracts. The small sample size limits the generalisability of our findings. Reduced GM volumes and WM integrity changes in BPII patients are not prominent like those previously reported in bipolar disorder type-I and involve cortical structures and their related association tracts. Copyright © 2013 Elsevier B.V. All rights reserved.
FINELM: a multigroup finite element diffusion code. Part II
International Nuclear Information System (INIS)
Davierwalla, D.M.
1981-05-01
The author presents the axisymmetric case in cylindrical coordinates for the finite element multigroup neutron diffusion code, FINELM. The numerical acceleration schemes incorporated viz. the Lebedev extrapolations and the coarse mesh rebalancing, space collapsing, are discussed. A few benchmark computations are presented as validation of the code. (Auth.)
The influence of excess vacancy generation on the diffusion of ion implanted phosphorus into silicon
International Nuclear Information System (INIS)
Bakowski, A.
1985-01-01
The diffusion of ion implanted phosphorus in silicon has been studied. It was found that the diffusion coefficient is not only dependent on the phosphorus surface concentration (the concentration effect) but also on the conditions at the silicon surface (the surface effect). The phosphorus diffusion coefficient is considerably lower when the silicon surface during annealing is covered with a CVD oxide layer. It is suggested that excess vacancies generated at the surface are reponsible for both the concentration and surface effects. Enhanced phosphorus diffusion is attributed to the disturbance of thermodynamic equilibrium in the crystal through phosphorus-vacancy part formation by vacancies introduced into silicon at the surface. On the basis of the data presented, it can be concluded that two mechanisms for excess vacancy generation are involved. Assuming that phosphorus diffuses via E-centers, calculations of the concentration profiles and the diffusion coefficient were performed for different concentrations and surface conditions. (orig.)
Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi
2016-04-05
Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.
Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi
2016-01-01
Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216
Kailasanathan, Ranjith Kumar Abhinavam
2014-05-20
Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.
Schödel, R.; Gallego-Cano, E.; Dong, H.; Nogueras-Lara, F.; Gallego-Calvente, A. T.; Amaro-Seoane, P.; Baumgardt, H.
2018-01-01
Context. This is the second of three papers that search for the predicted stellar cusp around the Milky Way's central black hole, Sagittarius A*, with new data and methods. Aims: We aim to infer the distribution of the faintest stellar population currently accessible through observations around Sagittarius A*. Methods: We used adaptive optics assisted high angular resolution images obtained with the NACO instrument at the ESO VLT. Through optimised PSF fitting we removed the light from all detected stars above a given magnitude limit. Subsequently we analysed the remaining, diffuse light density. Systematic uncertainties were constrained by the use of data from different observing epochs and obtained with different filters. We show that it is necessary to correct for the diffuse emission from the mini-spiral, which would otherwise lead to a systematically biased light density profile. We used a Paschen α map obtained with the Hubble Space Telescope for this purpose. Results: The azimuthally averaged diffuse surface light density profile within a projected distance of R ≲ 0.5 pc from Sagittarius A* can be described consistently by a single power law with an exponent of Γ = 0.26 ± 0.02stat ± 0.05sys, similar to what has been found for the surface number density of faint stars in Paper I. Conclusions: The analysed diffuse light arises from sub-giant and main-sequence stars with Ks ≈ 19-22 with masses of 0.8-1.5 M⊙. These stars can be old enough to be dynamically relaxed. The observed power-law profile and its slope are consistent with the existence of a relaxed stellar cusp around the Milky Way's central black hole. We find that a Nuker law provides an adequate description of the nuclear cluster's intrinsic shape (assuming spherical symmetry). The 3D power-law slope near Sgr A* is γ = 1.13 ± 0.03model ± 0.05sys. The stellar density decreases more steeply beyond a break radius of about 3 pc, which corresponds roughly to the radius of influence of the
A Study on the Characteristics of Design Variables for IRSS Diffuser
Cho, Yong-Jin; Ko, Dae-Eun
2017-11-01
In modern naval ships, infrared signature suppression systems (IRSS) are installed to decrease the temperature of waste gas generated in propulsion engine and the metallic surface temperature of heated exhaust pipes. Generally, IRSS is composed of eductor, mixing tube, and diffuser. Diffuser serves to reduce the temperature by creating an air film using the pressure difference between internal gas and external air. In this study, design variables were selected by analyzing the diffuser and the characteristics of design variables that affect the performance of diffuser were examined using Taguchi experiment method. For the diffuser performance analysis, a heat flow analysis technique established in previous research was used. The IRSS performance evaluation was carried out based on the average area value of the metal surface temperature and the temperature of the exhaust gas at the outlet of the diffuser, which are variables directly related to the intensity of infrared signature in naval ships. It was verified that the exhaust gas temperature is greatly affected by changes in the diameter of the diffuser outlet, and the metal surface temperature of diffuser is greatly affected by changes in the number of diffuser rings.
Atmospheric diffusion of large clouds
Energy Technology Data Exchange (ETDEWEB)
Crawford, T. V. [Univ. of California, Lawrence Radiation Lab., Livermore, California (United States)
1967-07-01
Clouds of pollutants travel within a coordinate system that is fixed to the earth's surface, and they diffuse and grow within a coordinate system fixed to the cloud's center. This paper discusses an approach to predicting the cloud's properties, within the latter coordinate system, on space scales of a few hundred meters to a few hundred kilometers and for time periods of a few days. A numerical cloud diffusion model is presented which starts with a cloud placed arbitrarily within the troposphere. Similarity theories of atmospheric turbulence are used to predict the horizontal diffusivity as a function of initial cloud size, turbulent atmospheric dissipation, and time. Vertical diffusivity is input as a function of time and height. Therefore, diurnal variations of turbulent diffusion in the boundary layer and effects of temperature inversions, etc. can be modeled. Nondiffusive cloud depletion mechanisms, such as dry deposition, washout, and radioactive decay, are also a part of this numerical model. An effluent cloud, produced by a reactor run at the Nuclear Rocket Development Station, Nevada, is discussed in this paper. Measurements on this cloud, for a period of two days, are compared to calculations with the above numerical cloud diffusion model. In general, there is agreement. within a factor of two, for airborne concentrations, cloud horizontal area, surface air concentrations, and dry deposition as airborne concentration decreased by seven orders of magnitude during the two-day period. (author)
International Nuclear Information System (INIS)
Asencios, Yvan J.O.; Sun-Kou, María R.
2012-01-01
Highlights: ► Aluminum hydroxide obtained from aluminum scrap led to the formation of gamma alumina. ► Acidic pH of precipitation favored the formation of small particles of high surface areas. ► Higher aging temperature favored the formation of large structures of large pore sizes. ► Higher aging temperature generated symmetrical solids of regular hexagonal prism forms. ► Aluminas of large pores adsorbed metals as following: Pb (1.75 Å) > Cd (1.54 Å) > Zn (1.38 Å). - Abstract: Several types of alumina were synthesized from sodium aluminate (NaAlO 2 ) by precipitation with sulfuric acid (H 2 SO 4 ) and subsequently calcination at 500 °C to obtain γ-Al 2 O 3 . The precursor aluminate was derived from aluminum scrap. The various γ-Al 2 O 3 synthesized were characterized by Fourier-transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), adsorption–desorption of N 2 (S BET ) and scanning electron microscopy (SEM). XRD revealed that distinct phases of Al 2 O 3 were formed during thermal treatment. Moreover, it was observed that conditions of synthesis (pH, aging time and temperature) strongly affect the physicochemical properties of the alumina. A high-surface-area alumina (371 m 2 g −1 ) was synthesized under mild conditions, from inexpensive raw materials. These aluminas were tested for the adsorption of Cd(II), Zn(II) and Pb(II) from aqueous solution at toxic metal concentrations, and isotherms were determined.
Creep effects in diffusion bonding of oxygen-free copper
Moilanen, Antti
Diffusion is the transport of atoms or particles through the surrounding material. Various microstructural changes in metals are based on the diffusion phenomena. In solid metals the diffusion is closely related to crystallographic defects. In single-component metals the dominant mechanism of diffusion is the vacancy mechanism. Diffusion bonding is a direct technological application of diffusion. It is an advanced solidstate joining process in which the surfaces of two components are brought to contact with each other and heated under a pressing load in a controlled environment. During the process, the contact surfaces are bonded by atomic diffusion across the interface and as a result, one solid piece is formed. The condition of high temperature and low applied stress combined with relatively long process duration enables the creep effects to take place in bonded metals. Furthermore, creep causes unwanted permanent deformations in the bonded components. Some authors suggest that there could be a threshold fo...
International Nuclear Information System (INIS)
Xue Yongjie; Hou Haobo; Zhu Shujing
2009-01-01
Polluted and contaminated water can often contain more than one heavy metal species. It is possible that the behavior of a particular metal species in a solution system will be affected by the presence of other metals. In this study, we have investigated the adsorption of Cd(II), Cu(II), Pb(II), and Zn(II) onto basic oxygen furnace slag (BOF slag) in single- and multi-element solution systems as a function of pH and concentration, in a background solution of 0.01 M NaNO 3 . In adsorption edge experiments, the pH was varied from 2.0 to 13.0 with total metal concentration 0.84 mM in the single element system and 0.21 mM each of Cd(II), Cu(II), Pb(II), and Zn(II) in the multi-element system. The value of pH 50 (the pH at which 50% adsorption occurs) was found to follow the sequence Zn > Cu > Pb > Cd in single-element systems, but Pb > Cu > Zn > Cd in the multi-element system. Adsorption isotherms at pH 6.0 in the multi-element systems showed that there is competition among various metals for adsorption sites on BOF slag. The adsorption and potentiometric titrations data for various slag-metal systems were modeled using an extended constant-capacitance surface complexation model that assumed an ion-exchange process below pH 6.5 and the formation of inner-sphere surface complexes at higher pH. Inner-sphere complexation was more dominant for the Cu(II), Pb(II) and Zn(II) systems
Energy Technology Data Exchange (ETDEWEB)
Xue Yongjie [School of Resource and Environment Science, Wuhan University, Hubei, Wuhan (China); Wuhan Kaidi Electric Power Environmental Protection Co. Ltd., Hubei, Wuhan (China)], E-mail: xueyj@mail.whut.edu.cn; Hou Haobo; Zhu Shujing [School of Resource and Environment Science, Wuhan University, Hubei, Wuhan (China)
2009-02-15
Polluted and contaminated water can often contain more than one heavy metal species. It is possible that the behavior of a particular metal species in a solution system will be affected by the presence of other metals. In this study, we have investigated the adsorption of Cd(II), Cu(II), Pb(II), and Zn(II) onto basic oxygen furnace slag (BOF slag) in single- and multi-element solution systems as a function of pH and concentration, in a background solution of 0.01 M NaNO{sub 3}. In adsorption edge experiments, the pH was varied from 2.0 to 13.0 with total metal concentration 0.84 mM in the single element system and 0.21 mM each of Cd(II), Cu(II), Pb(II), and Zn(II) in the multi-element system. The value of pH{sub 50} (the pH at which 50% adsorption occurs) was found to follow the sequence Zn > Cu > Pb > Cd in single-element systems, but Pb > Cu > Zn > Cd in the multi-element system. Adsorption isotherms at pH 6.0 in the multi-element systems showed that there is competition among various metals for adsorption sites on BOF slag. The adsorption and potentiometric titrations data for various slag-metal systems were modeled using an extended constant-capacitance surface complexation model that assumed an ion-exchange process below pH 6.5 and the formation of inner-sphere surface complexes at higher pH. Inner-sphere complexation was more dominant for the Cu(II), Pb(II) and Zn(II) systems.
Xue, Yongjie; Hou, Haobo; Zhu, Shujing
2009-02-15
Polluted and contaminated water can often contain more than one heavy metal species. It is possible that the behavior of a particular metal species in a solution system will be affected by the presence of other metals. In this study, we have investigated the adsorption of Cd(II), Cu(II), Pb(II), and Zn(II) onto basic oxygen furnace slag (BOF slag) in single- and multi-element solution systems as a function of pH and concentration, in a background solution of 0.01M NaNO(3). In adsorption edge experiments, the pH was varied from 2.0 to 13.0 with total metal concentration 0.84mM in the single element system and 0.21mM each of Cd(II), Cu(II), Pb(II), and Zn(II) in the multi-element system. The value of pH(50) (the pH at which 50% adsorption occurs) was found to follow the sequence Zn>Cu>Pb>Cd in single-element systems, but Pb>Cu>Zn>Cd in the multi-element system. Adsorption isotherms at pH 6.0 in the multi-element systems showed that there is competition among various metals for adsorption sites on BOF slag. The adsorption and potentiometric titrations data for various slag-metal systems were modeled using an extended constant-capacitance surface complexation model that assumed an ion-exchange process below pH 6.5 and the formation of inner-sphere surface complexes at higher pH. Inner-sphere complexation was more dominant for the Cu(II), Pb(II) and Zn(II) systems.
Nowicki, Waldemar; Gąsowska, Anna; Kirszensztejn, Piotr
2016-05-01
UV-vis spectroscopy measurements confirmed the reaction in heterogeneous system between Pt(II) ions and ethylenediamine type ligand, n-(2-aminoethyl)-3-aminopropyl-trimethoxysilane, immobilized at the silica surface. The formation of complexes is a consequence of interaction between the amine groups from the ligand grafted onto SiO2 and ions of platinum. A potentiometric titration technique was to determine the stability constants of complexes of Pt(II) with immobilized insoluble ligand (SG-L), on the silica gel. The results show the formation of three surface complexes of the same type (PtHSG-L, Pt(HSG-L)2, PtSG-L) with SG-L ligand, in a wide range of pH for different Debye length. The concentration distribution of the complexes in a heterogeneous system is evaluated.
Sollberger, Daniel; Gremaud-Heitz, Daniela; Riemenschneider, Anke; Küchenhoff, Joachim; Dammann, Gerhard; Walter, Marc
2012-01-01
Patients with borderline personality disorder (BPD) suffer from instability in their relationships, their affectivity, and their identity. However, the associations between these dimensions are not clear. The purpose of the present study was to investigate the relation between identity diffusion and psychopathology in BPD. In the second week of inpatient treatment, 52 patients with BPD were assessed with the Inventory of Personality Organization (IPO) and questionnaires measuring general psychiatric symptoms, mood states, and negative affects (SCL-90-R, BDI, STAI, and STAXI). A median split was examined to differentiate BPD patients with high identity diffusion from those with low identity diffusion. BPD patients with high identity diffusion did not differ in their social data from BPD patients with low identity diffusion. However, BPD patients with high identity diffusion showed significantly higher levels of psychiatric symptoms, as well as higher anxiety, anger, and depression scores (p personality disorders (p identity diffusion with psychopathological symptoms and features of personality disorder and emphasize the clinical significance of identity diffusion for patients with BPD. Copyright © 2011 S. Karger AG, Basel.
Jones, A.; Kauffmann, G.; D'Souza, R.; Bizyaev, D.; Law, D.; Haffner, L.; Bahé, Y.; Andrews, B.; Bershady, M.; Brownstein, J.; Bundy, K.; Cherinka, B.; Diamond-Stanic, A.; Drory, N.; Riffel, R. A.; Sánchez, S. F.; Thomas, D.; Wake, D.; Yan, R.; Zhang, K.
2017-03-01
We have conducted a study of extra-planar diffuse ionized gas using the first year data from the MaNGA IFU survey. We have stacked spectra from 49 edge-on, late-type galaxies as a function of distance from the midplane of the galaxy. With this technique we can detect the bright emission lines Hα, Hβ, [O II]λλ3726, 3729, [O III]λ5007, [N II]λλ6549, 6584, and [S II]λλ6717, 6731 out to about 4 kpc above the midplane. With 16 galaxies we can extend this analysis out to about 9 kpc, I.e. a distance of 2Re, vertically from the midplane. In the halo, the surface brightnesses of the [O II] and Hα emission lines are comparable, unlike in the disk where Hα dominates. When we split the sample by specific star-formation rate, concentration index, and stellar mass, each subsample's emission line surface brightness profiles and ratios differ, indicating that extra-planar gas properties can vary. The emission line surface brightnesses of the gas around high specific star-formation rate galaxies are higher at all distances, and the line ratios are closer to ratios characteristic of H II regions compared with low specific star-formation rate galaxies. The less concentrated and lower stellar mass samples exhibit line ratios that are more like H II regions at larger distances than their more concentrated and higher stellar mass counterparts. The largest difference between different subsamples occurs when the galaxies are split by stellar mass. We additionally infer that gas far from the midplane in more massive galaxies has the highest temperatures and steepest radial temperature gradients based on their [N II]/Hα and [O II]/Hα ratios between the disk and the halo. SDSS IV.
Diffuse scattering and the fundamental properties of materials
EIce, Gene; Barabash, Rozaliya
2009-01-01
Diffuse Scattering-the use of off-specular X-Rays and neutrons from surfaces and interfaces-has grown rapidly as a tool for characterizing the surface properties of materials and related fundamental structural properties. It has proven to be especially useful in the understanding of local properties within materials. This book reflects the efforts of physicists and materials scientists around the world who have helped to refine the techniques and applications of diffuse scattering. Major topics specifically covered include: -- Scattering in Low Dimensions -- Elastic and Thermal Diffuse Scattering from Alloys -- Scattering from Complex and Disordered Materials -- Scattering from Distorted Crystals.
International Nuclear Information System (INIS)
Estrada, T.; Medina, F.; Lopez-Bruna, D.; AscasIbar, E.; BalbIn, R.; Cappa, A.; Castejon, F.; Eguilior, S.; Fernandez, A.; Guasp, J.; Hidalgo, C.; Petrov, S.
2007-01-01
Transitions to improved core electron heat confinement are triggered by low order rational magnetic surfaces in TJ-II electron cyclotron heated (ECH) plasmas. Experiments are performed changing the magnetic shear around the rational surface n = 3/m = 2 to study its influence on the transition; ECH power modulation is used to look at transport properties. The improvement in the electron heat confinement shows no obvious dependence on the magnetic shear. Transitions triggered by the rational surface n = 4/m = 2 show, in addition, an increase in the ion temperature synchronized with the increase in the electron temperature. Ion temperature changes had not been previously observed either in TJ-II or in any other helical device. SXR measurements demonstrate that, under certain circumstances, the rational surface positioned inside the plasma core region precedes and provides a trigger for the transition
Azadirachta indica (Neem) leaf powder as a biosorbent for removal of Cd(II) from aqueous medium
Energy Technology Data Exchange (ETDEWEB)
Sharma, Arunima [Department of chemistry, Gauhati University, Guwahati 781014, Assam (India); Bhattacharyya, Krishna G. [Department of chemistry, Gauhati University, Guwahati 781014, Assam (India)]. E-mail: krishna2604@sify.com
2005-10-17
A biosorbent, Neem leaf powder (NLP), was prepared from the mature leaves of the Azadirachta indica (Neem) tree by initial cleaning, drying, grinding, washing to remove pigments and redrying. The powder was characterized with respect to specific surface area (21.45 m{sup 2} g{sup -1}), surface topography and surface functional groups and the material was used as an adsorbent in a batch process to remove Cd(II) from aqueous medium under conditions of different concentrations, NLP loadings, pH, agitation time and temperature. Adsorption increased from 8.8% at pH 4.0 to 70.0% at pH 7.0 and 93.6% at pH 9.5, the higher values in alkaline medium being due to removal by precipitation. The adsorption was very fast initially and maximum adsorption was observed within 300 min of agitation. The kinetics of the interactions was tested with pseudo first order Lagergren equation (mean k {sub 1} = 1.2 x 10{sup -2} min{sup -1}), simple second order kinetics (mean k {sub 2} = 1.34 x 10{sup -3} g mg{sup -1} min{sup -1}), Elovich equation, liquid film diffusion model (mean k = 1.39 x 10{sup -2} min{sup -1}) and intra-particle diffusion mechanism. The adsorption data gave good fits with Langmuir and Freundlich isotherms and yielded Langmuir monolayer capacity of 158 mg g{sup -1} for the NLP and Freundlich adsorption capacity of 18.7 L g{sup -1}. A 2.0 g of NLP could remove 86% of Cd(II) at 293 K from a solution containing 158.8 mg Cd(II) per litre. The mean values of the thermodynamic parameters, {delta}H, {delta}S and {delta}G, at 293 K were -73.7 kJ mol{sup -1}, -0.24 J mol{sup -1} K{sup -1} and -3.63 kJ mol{sup -1}, respectively, showing the adsorption process to be thermodynamically favourable. The results have established good potentiality for the Neem leaf powder to be used as a biosorbent for Cd(II)
The 640 × 512 LWIR type-II superlattice detectors operating at 110 K
Tan, Bi-Song; Zhang, Chuan-Jie; Zhou, Wen-Hong; Yang, Xiao-Jie; Wang, Guo-Wei; Li, Yun-Tao; Ding, Yan-Yan; Zhang, Zhou; Lei, Hua-Wei; Liu, Wei-Hua; Du, Yu; Zhang, Li-Fang; Liu, Bin; Wang, Li-Bao; Huang, Li
2018-03-01
The type-II InAs/GaSb superlattices (T2SLs)-based 640 × 512 long wavelength infrared (LWIR) Focal Plane Array (FPA) detector with15 μm pitch and 50% cut-off wavelength of 10.5 μm demonstrates a peak quantum efficiency of 38.6% and peak detectivity of 1.65 × 1011 cm Hz1/2 W-1 at 8.1 μm, high pixel operability of 99.5% and low responsivity non-uniformity of 2.69% at 80 K. The FPA exhibits clear infrared imaging at 110 K and diffusion-limited dark current densities below Tennant's 'Rule07' at temperature above 100 K, which is attributed to the efficient suppression of diffusion dark current and surface leak current by introducing M-structure barrier and double hetero-structure passivation layers.
Copper(II) complex of 3-cinnamalideneacetylacetone: Synthesis and ...
Indian Academy of Sciences (India)
Unknown
measurements, ESR and electronic spectral data indicate the presence of six coordinated Cu(II) ion. The ligand ... the test solution was diffused into the plate and affected the growth of the inoculated. Pseudomonas aeroginosa. .... bacteria Pseudomonas aerogenosa using the diffusion method 4. The antibacterial activity.
Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin
2015-10-01
Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.
Hydrogen diffusion along grain boundaries in erbium oxide coatings
International Nuclear Information System (INIS)
Mao, Wei; Chikada, Takumi; Suzuki, Akihiro; Terai, Takayuki
2014-01-01
Diffusion of interstitial atomic hydrogen in erbium oxide (Er 2 O 3 ) was investigated using density functional theory (DFT) and molecular dynamics (MD) methods. Hydrogen diffusivity in bulk, on (0 0 1) surface, and along Σ13 (4–3–1)/[1 1 1] symmetric tilt grain boundaries (GBs) were evaluated in a temperature range of 673–1073 K, as well as hydrogen diffusion barriers. It was found that H diffusion shows the faster on (0 0 1) surface than along GBs and in bulk. Also, energy barrier of H diffusion in bulk estimated by DFT and MD methods is somewhat higher than that along GBs evaluated in the experiments. This suggests that H diffusion in Er 2 O 3 coatings depends on GBs rather than bulk. In addition, with a correction of GB density, the simulated diffusivity along GBs in MD simulations is in good agreement with the experimental data within one order of magnitude. The discrepancy of H diffusivity between the experiments and the simulations should be reduced by considering H concentration, H diffusion direction, deviations of the initial configuration, vacancy defects, etc
Mohamed, Gehad G.; El-Gamel, Nadia E. A.
2004-11-01
The ternary piroxicam (Pir; 4-hydroxy-2-methyl- N-(2-pyridyl)-2H-1,2-benzothiazine-3-carboxamide 1,1-dioxide) complexes of Fe(II), Fe(III), Co(II), Ni(II), Cu(II) and Zn(II) with various amino acids (AA) such as glycine (Gly) or DL-phenylalanine (PhA) were prepared and characterized by elemental analyses, molar conductance, IR, UV-Vis, magnetic moment, diffuse reflectance and X-ray powder diffraction. The UV-Vis spectra of Pir and the effect of metal chelation on the different interligand transitions are discussed in detailed manner. IR and UV-Vis spectra confirm that Pir behaves as a neutral bidentate ligand coordinated to the metal ions via the pyridine- N and carbonyl group of the amide moiety. Gly molecule acted as a uninegatively monodentate ligand and coordinate to the metal ions through its carboxylic group, in addition PhA acted as a uninegatively bidentate ligand and coordinate to the metal ions through its carboxylic and amino groups. All the chelates have octahedral geometrical structures while Cu(II)- and Zn(II)-ternary chelates with PhA have square planar geometrical structures. The molar conductance data reveal that most of these chelates are non electrolytes, while Fe(III)-Pir-Gly, Co(II)-, Ni(II)-, Cu(II)- and Zn(II)-Pir-PhA cheletes were 1:1 electrolytes. X-ray powder diffraction is used as a new tool to estimate the crystallinity of chelates as well as to elucidate their geometrical structures.
Polyphase diffusion of fission products in graphite
International Nuclear Information System (INIS)
Dannert, V.
1989-05-01
The report attempts to give an introduction into the subject of fission product transport in nuclear graphite and results in an extended proposal of a transport-model. Beginning with a rough description of the graphite in question, an idea about the physical transport-phenomena in graphite is developed. Some of the basic experimental methods, especially techniques of porosimetry, determination of sorption-isotherms and of course several transport-experiments, are briefly described and their results are discussed. Some of the most frequent transport models are introduced and assessed with the criteria emphasized in this report. An extended model is proposed including the following main ideas: The transport of the fission-products is regarded as a two-phase-diffusion process through the open pores of the graphite. The two phases are: surface-diffusion and gas-diffusion. A time-dependent coupling of the two diffusion-phases by sorption-isotherms and a concentration-dependence of the surface diffusion coefficient, also related to the physical behaviour of the sorption-isotherms, are the basic properties of the proposed model. (orig./HP) [de
Directory of Open Access Journals (Sweden)
Lalhmunsiama
2017-07-01
Full Text Available Areca nut waste was utilized to obtain high surface area activated carbon (AC, and it was further functionalized with succinic anhydride under microwave irradiation. The surface morphology and surface functional groups of the materials were discussed with the help of scanning electron microscope(SEM images and fourier transform infra-red (FT-IR analysis. The specific surface area of the AC and functionalized-AC was obtained by the Brunauer-Emmett-Teller (BET method, and found to be 367.303 and 308.032 m2/g, respectively. Batch experiments showed that higher pH favoured the removal of Hg(II, whereas the phenol removal was slightly affected by the changes in the solution pH. The kinetic data followed pseudo-first order kinetic model, and intra-particle diffusion played a significant role in the removal of both pollutants. The maximum sorption capacity of Hg(II and phenol were evaluated using Langmuir adsorption isotherms, and found to be 11.23 and 5.37 mg/g, respectively. The removal of Hg(II was significantly suppressed in the presence of chloride ions due to the formation of a HgCl2 species. The phenol was specifically adsorbed, forming the donor–acceptor complexes or π–π electron interactions at the surface of the solid. Further, a fixed-bed column study was conducted for both Hg(II and phenol. The loading capacity of the column was estimated using the nonlinear Thomas equation, and found to be 2.49 and 2.70 mg/g, respectively. Therefore, the study showed that functionalized AC obtained from areca nut waste could be employed as a sustainable adsorbent for the simultaneous removal of Hg(II and phenol from polluted water.
Energy Technology Data Exchange (ETDEWEB)
Robinet, J.O. [Euro-Geomat-Consulting (France)]|[Institut National des Sciences Appliquees (INSA), 35 - Rennes (France); Plas, F. [Agence Nationale pour la Gestion des Dechets Radioactifs (ANDRA), 92 - Chatenay Malabry (France)
2005-07-01
The modelling of heat, mass transfer and the behaviour coupled thermo-hydro-mechanical in swelling clay require the development of appropriate constitutive laws as well as experimental data. This former approach, allows the quantitative validation of the theoretical models. In general modelling approaches consider dominant mechanisms, (i) Fourier law for diffusion of heat, (ii) generalized Darcy law for convection of liquid water, (iii) Flick law for diffusion of water vapour, and elastic-plastic models wit h hydric hardening and thermal damage/expansion for strain-stress behaviour. Transfer of dry air and water under thermal gradient and capillary (e.g. suction) gradient in unsaturated compacted swelling clays consider evaporation, migration and condensation. These transfers take into account the capillary effect. This effect is an evaporation of liquid water in the hot part for temperature higher than 100 C associated with a, diffusion of water vapor towards cold part then condensation, and convection of liquid water with gradient of suction in the opposite direction of the water vapour diffusion. High values of the diffusion coefficient of the vapour water are considered about 10{sup -7}m{sup 2}/s. Some thermal experiments related (i) low values of the water vapour diffusion coefficient in compacted swelling clays, 2004) and (ii) a significant drying associated with a water transfer even for temperature lower than 100 C. Other enhancement phenomena are used to explain these data and observations: the vaporization is a continuous process. At short term the mechanism of drying at short term is the thermal effect on the capillary pressure (e.g. surface tension depending of temperature); the thermal gradient is a driving force. When a temperature gradient is applied, diffusion occurs in order to reach equilibrium, e.g. to make the chemical potential (m) of each component uniform throughout. This mechanism is called thermal diffusion. This paper proposes a discussion
Hydrogen isotope in erbium oxide: Adsorption, penetration, diffusion, and vacancy trapping
International Nuclear Information System (INIS)
Mao, Wei; Chikada, Takumi; Suzuki, Akihiro; Terai, Takayuki; Matsuzaki, Hiroyuki
2015-01-01
Highlights: • H adsorption on cubic Er 2 O 3 surface results in electron transfer from H to the surface. • The H penetration energy of at least 1.6 eV is required for cubic Er 2 O 3 surface. • The dominated mechanisms of H diffusion in bulk Er 2 O 3 are elucidated. • H diffusion near or at vacancies in Er 2 O 3 is an exothermic reaction. - Abstract: In this study, we report results using first-principles density functional theory calculations for four critical aspects of the interaction: H adsorption on Er 2 O 3 surface, surface-to-subsurface penetration of H into Er 2 O 3 , bulk diffusion of H in Er 2 O 3 , and trapping of H at vacancies. We identify surface stable adsorption positions and find that H prefers to transfer electrons to the surfaces and form covalent bonds with the nearest neighboring four oxygen atoms. For low surface coverage of H as in our case (0.89 × 10 14 H/cm 2 ), a penetration energy of at least 1.60 eV is required for cubic Er 2 O 3 surfaces. Further, the H diffusion barrier between the planes defined by Er 2 O 3 units along the favorable <1 1 1> direction is found to be very small – 0.16 eV – whereas higher barriers of 0.41 eV and 1.64 eV are required for diffusion across the planes, somewhat higher than the diffusion energy barrier of 0.20 eV observed experimentally at 873 K. In addition, we predict that interstitial H is exothermically trapped when it approaches a vacancy with the vacancy defect behaving as an electron trap since the H-vacancy defect is found to be more stable than the intrinsic defect
Study of the factors affecting radon diffusion through building materials
International Nuclear Information System (INIS)
Chauhan, R.P.
2011-01-01
Radon appears mainly by diffusion processes from the point of origin following - decay of 226 Ra in underground soil and building materials used, in the construction of floors, walls, and ceilings. The diffusion of radon in dwellings is a process determined by the radon concentration gradient across the building material structure and can be a significant contributor to indoor radon inflow. Radon can originate from the deeply buried deposit beneath homes and can migrate to the surface of earth. Radon diffusion and transport through different media is a complex process and is affected by several factors. It is well known that for building construction materials the porosity, permeability and the diffusion coefficient are the parameters, which can quantify the materials capability to hinder the flow of radon soil gas. An increase in porosity will provide more air space within the material for radon to travel, thus reducing its resistance to radon transport. The permeability of material describes its ability to act as a barrier to gas movement when a pressure gradient exists across it and is closely related to the porosity of material. The radon diffusion coefficient of a material quantifies the ability of radon gas to move through it when a concentration gradient is the driving force. This parameter depends upon the porosity and permeability of the medium. As diffusion process is the major contributor to indoor levels, therefore, the factors affecting the diffusion process need to be kept in consideration. Keeping this in mind the experimental arrangements have been made for control study of radon diffusion through some building materials to observe the effects of different factors viz.; compaction, grain size, temperature, humidity and the mixing of these materials etc. For the present study alpha sensitive LR-115 type II solid-state nuclear track detectors (SSNTDs) have been used for the recording of alpha tracks caused by radon gas after its diffusion through the
Directory of Open Access Journals (Sweden)
Nobumichi Fujisawa
2017-01-01
Full Text Available The transition process from a diffuser rotating stall to a stage stall in a centrifugal compressor with a vaned diffuser was investigated by experimental and numerical analyses. From the velocity measurements, it was found that the rotating stall existed on the shroud side of the diffuser passage in the off-design flow condition. The numerical results revealed the typical vortical structure of the diffuser stall. The diffuser stall cell was caused by the systematic vortical structure which consisted of the tornado-type vortex, the longitudinal vortex at the shroud/suction surface corner (i.e., leading edge vortex (LEV, and the vortex in the throat area of the diffuser passages. Furthermore, the stage stall, which rotated within both the impeller and diffuser passages, occurred instead of the diffuser stall as the mass flow rate was decreased. According to the velocity measurements at the diffuser inlet, the diffuser stall which rotated on the shroud side was shifted to the hub side. Then, the diffuser stall moved into the impeller passages and formed the stage stall. Therefore, the stage stall was caused by the development of the diffuser stall, which transferred from the shroud side to the hub side in the vaneless space and expanded to the impeller passages.
Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin
2012-09-01
The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)
2009-07-01
Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.
Multicomponent diffusivities from the free volume theory
Wesselingh, J.A; Bollen, A.M
In this paper the free volume theory of diffusion is extended to multicomponent mixtures. The free volume is taken to be accessible for any component according to its surface. fraction. The resulting equations predict multicomponent (Maxwell-Stefan) diffusivities in simple liquid mixtures from pure
International Nuclear Information System (INIS)
Sun Jianzhong; Wang Zhikang; Gong Xiangyang
2006-01-01
Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)
Thermal diffusivity effect in opto-thermal skin measurements
International Nuclear Information System (INIS)
Xiao, P; Imhof, R E; Cui, Y; Ciortea, L I; Berg, E P
2010-01-01
We present our latest study on the thermal diffusivity effect in opto-thermal skin measurements. We discuss how thermal diffusivity affects the shape of opto-thermal signal, and how to measure thermal diffusivity in opto-thermal measurements of arbitrary sample surfaces. We also present a mathematical model for a thermally gradient material, and its corresponding opto-thermal signal. Finally, we show some of our latest experimental results of this thermal diffusivity effect study.
International Nuclear Information System (INIS)
Ku'rpick, Ulrike
2001-01-01
We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values
Ethanol Diffusion on Rutile TiO2(110) Mediated by H Adatoms
DEFF Research Database (Denmark)
Huo, Peipei; Hansen, Jonas Ørbæk; Martinez, Umberto
2012-01-01
and perpendicular to the rows of surface Ti atoms. The diffusion of ethanol molecules perpendicular to the rows of surface Ti atoms was found to be mediated by H adatoms in the rows of bridge-bonded O (Obr) atoms similarly to previous results obtained for water monomers. In contrast, the diffusion of H adatoms...... across the Ti rows, mediated by ethanol molecules, was observed only very rarely and exclusively on fully hydrogenated TiO2(110) surfaces. Possible reasons why the diffusion of H adatoms across the Ti rows mediated by ethanol molecules occurs less frequently than the cross-row diffusion of ethanol...... molecules mediated by H adatoms are discussed....
A diffusive ink transport model for lipid dip-pen nanolithography
Urtizberea, A.; Hirtz, M.
2015-09-01
Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus
Hong, Yoochan; Jo, Seongjae; Park, Joohyung; Park, Jinsung; Yang, Jaemoon
2018-05-01
In this paper, we describe the development of a nanoplasmonic biosensor based on the localized surface plasmon resonance (LSPR) effect that enables a sensitive and selective recognition of copper II ions. First, we fabricated the nanoplasmonics as LSPR substrates using gold nanorods (GNR) and the nano-adsorption method. The LSPR sensitivity of the nanoplasmonics was evaluated using various solvents with different refractive indexes. Subsequently, D-penicillamine (DPA)—a chelating agent of copper II ions—was conjugated to the surface of the GNR. The limit of detection (LOD) for the DPA-conjugated nanoplasmonics was 100 pM. Furthermore, selectivity tests were conducted using various divalent cations, and sensitivity tests were conducted on the nanoplasmonics under blood-like environments. Finally, the developed nanoplasmonic biosensor based on GNR shows great potential for the effective recognition of copper II ions, even in human blood conditions.
Energy Technology Data Exchange (ETDEWEB)
Verger, A. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Lorraine University, Department of Nuclear Medicine and Nancyclotep Imaging Platform, CHRU Nancy, Nancy (France); Lorraine University, IADI, INSERM, UMR 947, Nancy (France); Metellus, P. [Centre Hospitalier Prive Clairval, Department of Neurosurgery, Marseille (France); Aix-Marseille University, INSERM, UMR 911, Marseille (France); Sala, Q. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Colin, C. [Aix-Marseille University, INSERM, UMR 911, Marseille (France); Bialecki, E. [Centre Hospitalier Prive Clairval, Department of Neurosurgery, Marseille (France); Taieb, D. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Aix-Marseille University, CERIMED, Marseille (France); Chinot, O. [Aix-Marseille University, INSERM, UMR 911, Marseille (France); APHM, La Timone Hospital, Department of Neuro-Oncology, Marseille (France); Figarella-Branger, D. [Aix-Marseille University, INSERM, UMR 911, Marseille (France); APHM, La Timone Hospital, Department of Anatomopathology, Marseille (France); Guedj, E. [APHM, La Timone Hospital, Department of Nuclear Medicine, Marseille (France); Aix-Marseille University, CERIMED, Marseille (France); Aix-Marseille University, Institut de Neurosciences de la Timone, CNRS, UMR 7289, Marseille (France); Hopital de la Timone, Service Central de Biophysique et Medecine Nucleaire, Marseille (France)
2017-08-15
The World Health Organization Classification of Tumors of the Central Nervous System has recently been updated by the integration of diagnostic and prognostic molecular parameters, giving pivotal attention to IDH mutation as a favourable factor. Amino acid PET is increasingly used in the management of gliomas, but its prognostic value is a matter of debate. The aim of this study was to assess the relationship between IDH mutation and {sup 18}F-FDOPA uptake on PET in newly diagnosed gliomas. A total of 43 patients, presenting with diffuse astrocytic and oligodendroglial grade II and III gliomas, reclassified according to the 2016 WHO classification of tumours of the CNS, were retrospectively included. They had all undergone {sup 18}F-FDOPA PET at an initial stage before surgery and histological diagnosis. {sup 18}F-FDOPA uptake values were compared between patients with and without IDH mutation in terms of maximum standardized uptake value (SUVmax) ratios between tumour and normal contralateral brain (T/N), and between tumour and striatum (T/S). Patients with IDH mutation showed higher {sup 18}F-FDOPA T/N SUVmax ratios (1.6 vs. 1.2) and T/S SUVmax ratios (0.9 vs. 0.6) than patients without IDH mutation (p < 0.05). This study showed paradoxically higher {sup 18}F-FDOPA uptake in diffuse grade II and III gliomas with IDH mutation. Despite evident interest in the management of gliomas, and especially in relation to posttherapy evaluation, our findings raise the question of the prognostic value of {sup 18}F-FDOPA uptake on PET uptake in this group of patients. This may be related to differences in amino acid integration, metabolism, or cell differentiation. (orig.)
Carbon diffusion behavior in molybdenum at relatively low temperatures
Energy Technology Data Exchange (ETDEWEB)
Hiraoka, Yutaka, E-mail: hiraoka@dap.ous.ac.j [Department of Applied Physics, Okayama University of Science, 1-1 Ridai-cho, Okayama 700-0005 (Japan); Imamura, Kyosuke [Graduate School of Science, Okayama University of Science, 1-1 Ridai-cho, Okayama 700-0005 (Japan); Kadokura, Takanori; Yamamoto, Yoshiharu [Materials Research Department, A.L.M.T. Corp., 2 Iwasekoshi-machi, Toyama 931-8543 (Japan)
2010-01-07
Purpose of this study is to investigate the carbon diffusion behavior in pure molybdenum at relatively low temperatures by means of fracture surface observation. Carbon addition was performed at a temperature of 1273-1373 K with the heating time being changed. Fracture surface of the specimen after carbon addition was examined using SEM and the carbon diffusion distance was estimated from the change of fracture mode as a function of the distance from the surface. Results are summarized as follows. First, the carbon diffusion distance increased approximately linearly with the increase of heating time from 1.2 to 10.8 ks. This relationship does not agree with that obtained at much higher temperatures. From Arrhenius plots of the slope of the straight line and the temperature, activation energy was calculated (155 kJ/mol). Secondly, the carbon diffusion distance estimated in this study was generally larger than that simulated using the data of Rudman, particularly at a longer heating time.
Process for forming a chromium diffusion portion and articles made therefrom
Helmick, David Andrew; Cavanaugh, Dennis William; Feng, Ganjiang; Bucci, David Vincent
2012-09-11
In one embodiment, a method for forming an article with a diffusion portion comprises: forming a slurry comprising chromium and silicon, applying the slurry to the article, and heating the article to a sufficient temperature and for a sufficient period of time to diffuse chromium and silicon into the article and form a diffusion portion comprising silicon and a microstructure comprising .alpha.-chromium. In one embodiment, a gas turbine component comprises: a superalloy and a diffusion portion having a depth of less than or equal to 60 .mu.m measured from the superalloy surface into the gas turbine component. The diffusion portion has a diffusion surface having a microstructure comprising greater than or equal to 40% by volume .alpha.-chromium.
Electrochemical Impedance Imaging via the Distribution of Diffusion Times
Song, Juhyun; Bazant, Martin Z.
2018-03-01
We develop a mathematical framework to analyze electrochemical impedance spectra in terms of a distribution of diffusion times (DDT) for a parallel array of random finite-length Warburg (diffusion) or Gerischer (reaction-diffusion) circuit elements. A robust DDT inversion method is presented based on complex nonlinear least squares regression with Tikhonov regularization and illustrated for three cases of nanostructured electrodes for energy conversion: (i) a carbon nanotube supercapacitor, (ii) a silicon nanowire Li-ion battery, and (iii) a porous-carbon vanadium flow battery. The results demonstrate the feasibility of nondestructive "impedance imaging" to infer microstructural statistics of random, heterogeneous materials.
Diffuse neutron scattering signatures of rough films
International Nuclear Information System (INIS)
Pynn, R.; Lujan, M. Jr.
1992-01-01
Patterns of diffuse neutron scattering from thin films are calculated from a perturbation expansion based on the distorted-wave Born approximation. Diffuse fringes can be categorised into three types: those that occur at constant values of the incident or scattered neutron wavevectors, and those for which the neutron wavevector transfer perpendicular to the film is constant. The variation of intensity along these fringes can be used to deduce the spectrum of surface roughness for the film and the degree of correlation between the film's rough surfaces
Mechanisms of Stochastic Diffusion of Energetic Ions in Spherical Tori
Energy Technology Data Exchange (ETDEWEB)
Ya.I. Kolesnichenko; R.B. White; Yu.V. Yakovenko
2001-01-18
Stochastic diffusion of the energetic ions in spherical tori is considered. The following issues are addressed: (I) Goldston-White-Boozer diffusion in a rippled field; (ii) cyclotron-resonance-induced diffusion caused by the ripple; (iii) effects of non-conservation of the magnetic moment in an axisymmetric field. It is found that the stochastic diffusion in spherical tori with a weak magnetic field has a number of peculiarities in comparison with conventional tokamaks; in particular, it is characterized by an increased role of mechanisms associated with non-conservation of the particle magnetic moment. It is concluded that in current experiments on National Spherical Torus eXperiment (NSTX) the stochastic diffusion does not have a considerable influence on the confinement of energetic ions.
Modelling of diffuse solar fraction with multiple predictors
Energy Technology Data Exchange (ETDEWEB)
Ridley, Barbara; Boland, John [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Lauret, Philippe [Laboratoire de Physique du Batiment et des Systemes, University of La Reunion, Reunion (France)
2010-02-15
For some locations both global and diffuse solar radiation are measured. However, for many locations, only global radiation is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from direct on some other plane using trigonometry, we need to have diffuse radiation on the horizontal plane available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia. Boland et al. developed a validated model for Australian conditions. Boland et al. detailed our recent advances in developing the theoretical framework for the use of the logistic function instead of piecewise linear or simple nonlinear functions and was the first step in identifying the means for developing a generic model for estimating diffuse from global and other predictors. We have developed a multiple predictor model, which is much simpler than previous models, and uses hourly clearness index, daily clearness index, solar altitude, apparent solar time and a measure of persistence of global radiation level as predictors. This model performs marginally better than currently used models for locations in the Northern Hemisphere and substantially better for Southern Hemisphere locations. We suggest it can be used as a universal model. (author)
Comparison of adsorption of Cd(II and Pb(II ions on pure and chemically modified fly ashes
Directory of Open Access Journals (Sweden)
Sočo Eleonora
2016-06-01
Full Text Available The study investigates chemical modifications of coal fly ash (FA treated with HCl or NH4HCO3 or NaOH or Na2edta, based on the research conducted to examine the behaviour of Cd(II and Pb(II ions adsorbed from water solution on treated fly ash. In laboratory tests, the equilibrium and kinetics were examined applying various temperatures (293 - 333 K and pH (2 - 11 values. The maximum Cd(II and Pb(II ions adsorption capacity obtained at 293 K, pH 9 and mixing time 2 h from the Langmuir model can be grouped in the following order: FA-NaOH > FA-NH4HCO3 > FA > FA-Na2edta > FA-HCl. The morphology of fly ash grains was examined via small-angle X-ray scattering (SAXS and images of scanning electron microscope (SEM. The adsorption kinetics data were well fitted by a pseudo-second-order rate model but showed a very poor fit for the pseudofirst order model. The intra-particle model also revealed that there are two separate stages in the sorption process, i.e. the external diffusion and the inter-particle diffusion. Thermodynamics parameters such as free energy, enthalpy and entropy were also determined. A laboratory test demonstrated that the modified coal fly ash worked well for the Cd(II and Pb(II ion uptake from polluted waters.
Radon progeny distribution in cylindrical diffusion chambers
International Nuclear Information System (INIS)
Pressyanov, Dobromir S.
2008-01-01
An algorithm to model the diffusion of radioactive decay chain atoms is presented. Exact mathematical solutions in cylindrical geometry are given. They are used to obtain expressions for the concentrations of 222 Rn progeny atoms in the volume and deposited on the wall surface in cylindrical diffusion chambers. The dependence of volume fractions of 222 Rn progeny and chamber sensitivity on the coefficient of diffusion of 222 Rn progeny atoms in air is modeled.
Design Method for Channel Diffusers of Centrifugal Compressors
Directory of Open Access Journals (Sweden)
Mykola Kalinkevych
2013-01-01
Full Text Available The design method for channel diffusers of centrifugal compressors, which is based on the solving of the inverse problem of gas dynamics, is presented in the paper. The concept of the design is to provide high pressure recovery of the diffuser by assuming the preseparation condition of the boundary layer along one of the channel surfaces. The channel diffuser was designed with the use of developed method to replace the vaned diffuser of the centrifugal compressor model stage. The numerical simulation of the diffusers was implemented by means of CFD software. Obtained gas dynamic characteristics of the designed diffuser were compared to the base vaned diffuser of the compressor stage.
Diffusion in crushed rock and in bentonite clay
International Nuclear Information System (INIS)
Olin, M.
1994-04-01
Diffusion theories for porous media with sorption are reviewed to serve as a basis for considering diffusion in simple systems like sand of crushed rock. A Fickian diffusion and linear sorption model is solved both by analytical Laplance transform and Green's function methods and by numerical methods, and then applied to small-scale experiments for Finnish low- and medium-level operating waste repositories. The main properties of bentonite are reviewed. The hydraulic conductivity of compacted bentonite is so low that the major transport mechanism is diffusion. A Fickian diffusion and linear sorption model is applied to bentonite. The main component of bentonite, montmorillonite, has a high ion-exchange capacity and thus, transport in bentonite consists of interactive chemical and diffusion phenomena. A chemical equilibrium model, CHEQ, is developed for ion-exchange reactions in bentonite water systems. CHEQ is applied to some bentonite experiments with success, especially for monovalent ions. The fitted log-binding constants for sodium exchange with potassium, magnesium, and calcium were 0.27, 1.50, and 2.10, respectively. A coupled chemical and diffusion model, CHEQDIFF, is developed to take account of diffusion in pore water, surface diffusion and ion-exchange reactions. The model is applied to the same experiments as CHEQ, and validation is partly successful. In the diffusion case, the above-mentioned values for binding constants are used. The apparent diffusion (both anions and cations) and surface diffusion (only for cations) constants used are 3.0*10 -11 m 2 /s and 6.0*10 -12 m 2 /s, respectively, but these values are questionable, as experimental results good enough for fitting are not available. (orig.). (74 refs., 27 figs., 12 tabs.)
Zhou, Yong; Zha, Jie; Lin, Zhijuan; Fang, Zhihong; Zeng, Hanyan; Zhao, Jintao; Luo, Yiming; Li, Zhifeng; Xu, Bing
2018-01-15
Diffuse large B cell lymphoma (DLBCL) is a common B cell malignancy with approximately 30% of patients present relapsed or refractory disease after first-line therapy. Research of further treatment options is needed. Cytotoxic CD4 + T cells express cytolytic molecules and have potential antitumor function. Here, we showed that the CD19 + cells from DLBCL patients presented significantly reduced expression of MHC II molecules than those from healthy controls. Three years after the first-line treatment, patients that presented relapsed disease had significantly lower MHC II expression on their CD19 + cells than patients who did not show recurrence. Examining cytotoxic CD4 + T cells show that DLBCL patients presented significantly elevated frequencies of granzyme A-, granzyme B-, and/or perforin-expressing cytotoxic CD4 + T cells. Also, frequency of cytotoxic CD4 + T cells in DLBCL patients was positively correlated with the MHC II expression level. Subsequently, the cytotoxic potential of CD4 + T cells against autologous CD19 + cells was investigated. We found that the cytotoxic potential of CD4 + T cells was highest in MHC II-high, intermediate in MHC II-mid, and lowest in MHC II-low patients. The percentage of MHC II-expressing viable CD19 + cells presented a significant reduction after longer incubation with cytotoxic CD4 + T cells, suggesting that cytotoxic CD4 + T cells preferentially eliminated MHC II-expressing CD19 + cells. Blocking MHC II on CD19 + cells significantly reduced the cytolytic capacity of CD4 + T cells. Despite these discoveries, the frequency of cytotoxic CD4 + T cells did not predict the clinical outcome of DLBCL patients. Together, these results demonstrated that cytotoxic CD4 + T cells presented an MHC II-dependent cytotoxic potential against autologous CD19 + cells and could potentially represent a future treatment option for DLBCL. Copyright © 2017 Elsevier Inc. All rights reserved.
Moisture diffusivity in structure of random fractal fiber bed
Energy Technology Data Exchange (ETDEWEB)
Zhu, Fanglong, E-mail: zhufanglong_168@163.com [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); The Chinese People' s Armed Police Forces Academy, Langfan City (China); Zhou, Yu; Feng, Qianqian [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); Xia, Dehong [School of Mechanical Engineering, University of Science and Technology, Beijing (China)
2013-11-08
A theoretical expression related to effective moisture diffusivity to random fiber bed is derived by using fractal theory and considering both parallel and perpendicular channels to diffusion flow direction. In this Letter, macroporous structure of hydrophobic nonwoven material is investigated, and Knudsen diffusion and surface diffusion are neglected. The effective moisture diffusivity predicted by the present fractal model are compared with water vapor transfer rate (WVTR) experiment data and calculated values obtained from other theoretical models. This verifies the validity of the present fractal diffusivity of fibrous structural beds.
Investigation on a TEA-CO II laser with surface corona pre-ionization
Behjat, A.; Aram, M.; Soltanmoradi, F.; Shabanzadeh, M.
2006-05-01
The construction of a surface corona UV pre-ionized TEA CO II laser is described and dependence of its average output energy of the laser to gas mixture, discharge voltage and repetition rate is investigated. The electric circuit diagram and geometry of the pre-ionization system are presented. Configuration of circuit has been designed to produce only impulsive voltage difference between the laser electrodes. Also, the triggering configuration of trigatron is prepared for fast operation to minimize the arc occurrence as much as possible. Some data of current, voltage, laser pulses and average output energy versus gas mixture and applied voltages are given. IR spectrometer is used for measurements of central output wavelength of the laser. Operation of the laser on two adjacent vibrational-rotational transitions of CO II molecule has been observed that shows the ability of this laser for working on multi-line in a same time for special applications.
Diffusion behavior in the films of Nb-Ti systems
International Nuclear Information System (INIS)
Yoshitake, Michiko; Yoshihara, Kazuhiro
1990-01-01
The diffusion behavior of substrate element into a deposited film was investigated. The observed systems were a Nb film/Ti substrate and a Ti film/Nb substrate. When the Nb film/Ti substrate was heated in a vacuum, Ti diffused very rapidly in the Nb film. The pre-exponential factor of the diffusion constant of Ti in the Nb film was 5.6x10 -2 m 2 s -1 , and the activation energy was 220 kJmol -1 . The observed activation energy is about 60% of that of Ti in the bulk Nb. On the other hand, when the Ti film/Nb substrate was heated in a vacuum, Nb did not diffuse so rapidly. Titanium diffused through the Nb film rapidly and was concentrated on the surface of the Nb film. The chemical state of the concentrated Ti was metallic, and neither titanium oxides nor titanium carbide was observed. Therefore, the driving force of the rapid diffusion of Ti in the Nb film is considered as the reduction of the surface energy of Nb film. The difference in the diffusion behavior between Ti through the Nb film and Nb through the Ti film is explained supposing that the segregation of Ti reduces the surface energy of the Nb film but the segregation of Nb does not reduce the surface energy of the Ti film. After heating of the Nb film/Ti substrate for a long time, a new phase was formed at the interface between the Nb film and the Ti substrate. The chemical composition of the new phase is about 50% of Ti and 50% of Nb. This phase has not been reported in the phase diagram of the bulk Ti-Nb system. The surface area of the Nb film is considered to be quite large, so the contribution of surface energy to the thermodynamic state of the Nb film cannot be neglected. Therefore, the chemical potential of the film is different from that of the bulk. Then, the new phase, which does not exist in the phase diagram of the bulk system, is formed by an interaction of the films. (author)
Tritium permeation losses in HYLIFE-II heat exchanger tubes
International Nuclear Information System (INIS)
Longhurst, G.R.; Dolan, T.J.
1990-01-01
Tritium permeation through the intermediate heat exchanger of the HYLIFE-II inertial fusion design concept is evaluated for routine operating conditions. The permeation process is modelled using the Lewis analogy combined with surface recombination. It is demonstrated that at very low driving potentials, permeation becomes proportional to the first power of the driving potential. The model predicts that under anticipated conditions the primary cooling loop will pass about 6% of the tritium entering it to the intermediate coolant. Possible approached to reducing tritium permeation are explored. Permeation is limited by turbulent diffusion transport through the molten salt. Hence, surface barriers with impendance factors typical of present technology can do very little to reduce permeation. Low Flibe viscosity is desirable. An efficient tritium removal system operating on the Flibe before it gets to the intermediate heat exchanger is required. Needs for further research are highlighted. 9 refs., 2 figs., 1 tab
Search for Quasi-isodynamic Effects in TJ-II; Busqueda de efectos quasi-isodinamicos en el TJ-II
Energy Technology Data Exchange (ETDEWEB)
Guasp, J.; Liniers, M. [Ciemat. Madrid (Spain)
2000-07-01
The possibility of quasi-isodynamics effects (QID) in the TJ-II helical axis Stellarator has been explored maintaining the present setting for the toroidal field coils (TFC). In order to do this it has been necessary to implement a new method of calculation, using real space coordinates to follow the particle trajectories, instated the Boozer coordinates as was usual formerly. The result for the exploration of the flexibility diagram of TJ-II, including magnetic axis a shift effects, has been negative. It seems that there are not useful QID regions in TJ-II with the present setting of TFC carrying equal currents in all coils. Nevertheless, in spite of this negative result, the calculation in real space and, mainly, the grater number of configurations analysed, have produced a series of new important results, some of them unexpected. The influence of rational surfaces is very important. Optima and minima of confinement alternate at both sides of the rational values (mainly for the 1/2 by period) in a way very similar to the radial electric field resonance cases. This effect originates in the peculiar orbit topology in the presence of diffusion. Some lines of study are proposed to deal with this problem. Finally, the negative result of the QID search suggests the convenience to start a similar search without the restriction of equal currents on all the TEC. (Author) 18 refs.
Kinoshita, Koji; Parra, Elisa; Needham, David
2017-02-15
Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
A new model of anomalous phosphorus diffusion in silicon
International Nuclear Information System (INIS)
Budil, M.; Poetzl, H.; Stingeder, G.; Grasserbauer, M.
1989-01-01
A model is presented to describe the 'kink and tail' diffusion of phosphorus. The diffusion behaviour of phosphorus is expplained by the motion of phosphorus-interstitial and phosphorus-vacancy pairs in different charge states. The model yields the enhancement of diffusion in the tail region depending on surface concentration. Furthermore it yields the same selfdiffusion coefficient for interstitials as the gold diffusion experiments. A transformation of the diffusion equation was found to reduce the number of simulation equations. (author) 7 refs., 5 figs
Li, F. H.; Bi, H.; Huang, D. X.; Zhang, M.; Song, Y. B.
2018-01-01
Co(II), Mn(II), Cu(II) and Cr(III) salen type complexes were synthesized in situ in Y zeolite by the reaction of ion-exchanged metal ions with the flexible ligand molecules that had diffused into the cavities. Data of characterization indicates the formation of metal salen complexes in the pores without affecting the zeolite framework structure, the absence of any extraneous species and the geometry of encapsulated complexes. The catalytic activity results show that Cosalcyen Y exhibited higher catalytic activity in the water phase selective oxidation of benzyl alcohol, which could be attributed to their geometry and the steric environment of the metal actives sites.
A volume-based method for denoising on curved surfaces
Biddle, Harry
2013-09-01
We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.
A volume-based method for denoising on curved surfaces
Biddle, Harry; von Glehn, Ingrid; Macdonald, Colin B.; Marz, Thomas
2013-01-01
We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.
Hydrogen Diffusion and H{sub 2}S Corrosion in Steel
Energy Technology Data Exchange (ETDEWEB)
Haugstveit, Bjarte Erlend
2001-01-01
The electrochemical permeation technique introduced by Devanathan and Stachurski has been used to measure the effective diffusivity of hydrogen in steel in a H{sub 2}S-saturated aqueous environment. The linear polarization resistance (LPR) method has been used to measure the corrosion rate. The effective diffusion coefficient of hydrogen has been found to be in the range of 1*10-12 to 7*10-11, depending on the environmental conditions. The corrosion film was identified as mackinawite, and it affected the permeation process of hydrogen. The results supported the assumption that the diffusion process can be described by a three layer model and indicated that the model could be reduced to a two layer model in the cases of iron and steel. A model aimed to describe the reaction pathway of hydrogen through the surface film and into the steel is proposed. The corrosion film influenced the corrosion rate, and it was least protective against corrosion at pH 6.5. Corrosion rates were in the range of 0.2-1 mm/year. The corrosion rate was increased significantly at pH 3.5, but the effect of the surface film was stronger and overshadowed the pH effect at the higher pH values. Increased flow velocity also lead to increased corrosion rate, but this effect was less significant compared to the effect of pH and the surface film. DEG decreased the corrosion rate. The uncertainty in the diffusion measurements was mainly due to the assumption of a constant sub-surface concentration of atomic hydrogen, which was not fulfilled. A method less dependent on constant surface conditions would probably yield better estimates of the effective diffusivity. The uncertainty in the corrosion measurements was mainly due to the uncertainty in the value of the Stern-Geary constant. The qualitative assumptions based on the results in this thesis are assumed to be valid. A test section designed for this thesis was tested and was found successful in corrosion rate measurements, but proved to be
International Nuclear Information System (INIS)
Ganbold, Erdene Ochir; Park, Jin Ho; Ock, Kwang Su; Joo, Sang Woo
2011-01-01
We studied the detection of the Hg(II) concentration in an aqueous solution using rhodamine dyes on citrate-reduced Au nanoparticles (NPs). The quenching effect from Au NPs was found to decrease as the Hg(II) concentration increased under our experimental conditions. As the fluorescence signals intensified, the surface-enhanced Raman scattering (SERS) intensities reduced on the contrary due to less rhodamine dyes on Au NPs as the Hg(II) concentration increased. The rhodamine 6G (Rh6G) and rhodamine 123 (Rh123) dyes were examined via fluorescence and SERS measurements depending on Hg(II) concentrations. Fast and easy fluorescence detection of an Hg (II) concentration as low as a few ppm could be achieved by naked eye using citrate-reduced Au NPs
Li, Zhenhua; Li, Jingwen; Wang, Yanbin; Wei, Yajun
2014-01-01
A new Cu(II)-imprinted amino-functionalized activated carbon sorbent was prepared by a surface imprinting technique for selective solid-phase extraction (SPE) of Cu(II) prior to its determination by inductively coupled plasma atomic emission spectrometry (ICP-AES). Experimental conditions for effective adsorption of Cu(II) were optimized with respect to different experimental parameters using static and dynamic procedures in detail. Compared with non-imprinted sorbent, the ion-imprinted sorbent had higher selectivity and adsorption capacity for Cu(II). The maximum static adsorption capacity of the ion-imprinted and non-imprinted sorbent for Cu(II) was 26.71 and 6.86 mg g-1, respectively. The relatively selectivity factor values (αr) of Cu(II)/Zn(II), Cu(II)/Ni(II), Cu(II)/Co(II) and Cu(II)/Pb(II) were 166.16, 50.77, 72.26 and 175.77, respectively, which were greater than 1. Complete elution of the adsorbed Cu(II) from Cu(II)-imprinted sorbent was carried out using 2 mL of 0.1 mol L-1 EDTA solution. The relative standard deviation of the method was 2.4% for eleven replicate determinations. The method was validated for the analysis by two certified reference materials (GBW 08301, GBW 08303), the results obtained is in good agreement with standard values. The developed method was also successfully applied to the determination of trace copper in natural water samples with satisfactory results.
Hydrogen isotope in erbium oxide: Adsorption, penetration, diffusion, and vacancy trapping
Energy Technology Data Exchange (ETDEWEB)
Mao, Wei, E-mail: mao@nuclear.jp [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan); The University Museum, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Chikada, Takumi [Department of Chemistry, Graduate School of Science, Shizuoka University, 836 Ohya, Suruga-ku, Shizuoka 422-8529 (Japan); Suzuki, Akihiro [Nuclear Professional School, School of Engineering, The University of Tokyo, 2-22, Shirakata-shirane, Tokai, Naka 319-1188, Ibaraki (Japan); Terai, Takayuki [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-8656 (Japan); Matsuzaki, Hiroyuki [The University Museum, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan)
2015-03-15
Highlights: • H adsorption on cubic Er{sub 2}O{sub 3} surface results in electron transfer from H to the surface. • The H penetration energy of at least 1.6 eV is required for cubic Er{sub 2}O{sub 3} surface. • The dominated mechanisms of H diffusion in bulk Er{sub 2}O{sub 3} are elucidated. • H diffusion near or at vacancies in Er{sub 2}O{sub 3} is an exothermic reaction. - Abstract: In this study, we report results using first-principles density functional theory calculations for four critical aspects of the interaction: H adsorption on Er{sub 2}O{sub 3} surface, surface-to-subsurface penetration of H into Er{sub 2}O{sub 3}, bulk diffusion of H in Er{sub 2}O{sub 3}, and trapping of H at vacancies. We identify surface stable adsorption positions and find that H prefers to transfer electrons to the surfaces and form covalent bonds with the nearest neighboring four oxygen atoms. For low surface coverage of H as in our case (0.89 × 10{sup 14} H/cm{sup 2}), a penetration energy of at least 1.60 eV is required for cubic Er{sub 2}O{sub 3} surfaces. Further, the H diffusion barrier between the planes defined by Er{sub 2}O{sub 3} units along the favorable <1 1 1> direction is found to be very small – 0.16 eV – whereas higher barriers of 0.41 eV and 1.64 eV are required for diffusion across the planes, somewhat higher than the diffusion energy barrier of 0.20 eV observed experimentally at 873 K. In addition, we predict that interstitial H is exothermically trapped when it approaches a vacancy with the vacancy defect behaving as an electron trap since the H-vacancy defect is found to be more stable than the intrinsic defect.
Simulation Studies of Diffusion-Release and Effusive-Flow of Short-Lived Radioactive Isotopes
Zhang, Yan; Kawai, Yoko
2005-01-01
Delay times associated with diffusion release from targets and effusive-flow transport of radioactive isotopes to ion sources are principal intensity limiters at ISOL-based radioactive ion beam facilities, and simulation studies with computer models are cost effective methods for designing targets and vapor transport systems with minimum delay times to avoid excessive decay losses of short lived ion species. A finite difference code, Diffuse II, was recently developed at the Oak Ridge National Laboratory to study diffusion-release of short-lived species from three principal target geometries. Simulation results are in close agreement with analytical solutions to Ficks second equation. Complementary to the development of Diffuse II, the Monte-Carlo code, Effusion, was developed to address issues related to the design of fast vapor transport systems. Results, derived by using Effusion, are also found to closely agree with experimental measurements. In this presentation, the codes will be used in conc...
Diffusive limits for linear transport equations
International Nuclear Information System (INIS)
Pomraning, G.C.
1992-01-01
The authors show that the Hibert and Chapman-Enskog asymptotic treatments that reduce the nonlinear Boltzmann equation to the Euler and Navier-Stokes fluid equations have analogs in linear transport theory. In this linear setting, these fluid limits are described by diffusion equations, involving familiar and less familiar diffusion coefficients. Because of the linearity extant, one can carry out explicitly the initial and boundary layer analyses required to obtain asymptotically consistent initial and boundary conditions for the diffusion equations. In particular, the effects of boundary curvature and boundary condition variation along the surface can be included in the boundary layer analysis. A brief review of heuristic (nonasymptotic) diffusion description derivations is also included in our discussion
Kubo, Takayuki
2014-01-01
The field limit of superconducting radio-frequency cavity made of type II superconductor with a large Ginzburg-Landau parameter is studied with taking effects of nano-scale surface topography into account. If the surface is ideally flat, the field limit is imposed by the superheating field. On the surface of cavity, however, nano-defects almost continuously distribute and suppress the superheating field everywhere. The field limit is imposed by an effective superheating field given by the pro...
Radiative heat exchange between surfaces
International Nuclear Information System (INIS)
Yener, Y.; Yuncu, H.
1987-01-01
The geometrical features of radiative heat exchange between surfaces are discussed first by developing various radiation shape factor relations. The governing equations for enclosures with diffusely emitting and diffusely reflecting surfaces, as well as the equations for enclosures with gray surfaces having specular component of reflectivity are introduced next. Finally, a simplified model for enclosures with isothermal surfaces under the assumption of uniform radiosity over the surfaces is discussed, and various working relations for different conditions are presented
Thin-source concentration dependent diffusion
International Nuclear Information System (INIS)
Eng, G.
1978-01-01
The diffusion of (Ca ++ ) in NaCl has been measured for various diffusion times and for the temperature range (575 0 to 775 0 C), using a thin-source of 45 Ca tracer, rectangular geometry, and serial sectioning. The pre-diffusion surface concentration was approximately 3 x 10 16 (Ca)-atoms/cm 2 , which, for an average penetration depth of 100 to 300 μm, produces a maximum (post-diffusion) impurity concentration comparable to or greater than the intrinsic cation vacancy concentration. The high-temperature function closely matches the D 0 (T) function obtained from low impurity concentration experiments. The lower-temperature function, combined with the sudden failure of the D(C) = D 0 (1 + [C] + 0.5[C] 2 ) function at these lower temperatures, indicates the onset of a second diffusion process, one which would operate only at extremely high impurity concentrations. This low-temperature behavior is shown to be consistent with a breakdown of the conditions assumed for vacancy equilibrium
Iron oxidation kinetics and phosphorus immobilization at the groundwater-surface water interface
van der Grift, Bas; Rozemeijer, Joachim; Griffioen, Jasper; van der Velde, Ype
2014-05-01
Eutrophication of freshwater environments following diffuse nutrient loads is a widely recognized water quality problem in catchments. Fluxes of non-point P sources to surface waters originate from surface runoff and flow from soil water and groundwater into surface water. The availability of P in surface waters is controlled strongly by biogeochemical nutrient cycling processes at the soil-water interface. The mechanisms and rates of the iron oxidation process with associated binding of phosphate during exfiltration of anaerobic Fe(II) bearing groundwater are among the key unknowns in P retention processes in surface waters in delta areas where the shallow groundwater is typically pH-neutral to slightly acid, anoxic, iron-rich. We developed an experimental field set-up to study the dynamics in Fe(II) oxidation and mechanisms of P immobilization at the groundwater-surface water interface in an agricultural experimental catchment of a small lowland river. We physically separated tube drain effluent from groundwater discharge before it entered a ditch in an agricultural field. The exfiltrating groundwater was captured in in-stream reservoirs constructed in the ditch. Through continuous discharge measurements and weekly water quality sampling of groundwater, tube drain water, exfiltrated groundwater, and ditch water, we quantified Fe(II) oxidation kinetics and P immobilization processes across the seasons. This study showed that seasonal changes in climatic conditions affect the Fe(II) oxidation process. In winter time the dissolved iron concentrations in the in-stream reservoirs reached the levels of the anaerobic groundwater. In summer time, the dissolved iron concentrations of the water in the reservoirs are low, indicating that dissolved Fe(II) is completely oxidized prior to inflow into the reservoirs. Higher discharges, lower temperatures and lower pH of the exfiltrated groundwater in winter compared to summer shifts the location of the redox transition zone
Cheng, Xiaoxiang; Liang, Heng; Ding, An; Zhu, Xuewu; Tang, Xiaobin; Gan, Zhendong; Xing, Jiajian; Wu, Daoji; Li, Guibai
2017-11-01
Coagulation and ozonation have been widely used as pretreatments for ultrafiltration (UF) membrane in drinking water treatment. While beneficial, coagulation or ozonation alone is unable to both efficiently control membrane fouling and product water quality in many cases. Thus, in this study an emerging alternative of ferrous iron/peroxymonosulfate (Fe(II)/PMS), which can act as both an oxidant and a coagulant was employed prior to UF for treatment of natural surface water, and compared with conventional coagulation and ozonation. The results showed that the Fe(II)/PMS-UF system exhibited the best performance for dissolved organic carbon removal, likely due to the dual functions of coagulation and oxidation in the single process. The fluorescent and UV-absorbing organic components were more susceptible to ozonation than Fe(II)/PMS treatment. Fe(II)/PMS and ozonation pretreatments significantly increased the removal efficiency of atrazine, p-chloronitrobenzene and sulfamethazine by 12-76% and 50-94%, respectively, whereas coagulation exerted a minor influence. The Fe(II)/PMS pretreatment also showed the best performance for the reduction of both reversible and irreversible membrane fouling, and the performance was hardly affected by membrane pore size and surface hydrophobicity. In addition, the characterization of hydraulic irreversible organic foulants confirmed its effectiveness. These results demonstrate the potential advantages of applying Fe(II)/PMS as a pretreatment for UF to simultaneously control membrane fouling and improve the permeate quality. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rotational and translational diffusions of fluorescent probes during gelation process
Hattori, Yusuke; Panizza, Pascal; Letamendia, Louis; Ushiki, Hideharu
2006-04-01
Gelation process has been investigated by using light scattering techniques in recent years. We measured both of rotational and translational motions of fluorescent probes during gelation process. The measurements were performed after the temperature quenched at 30 °C. As the results, rotational diffusion coefficient of fluorescein was decreased after 6.0 × 10 4 s and energy transfer rate was reduced after 2.0 × 10 4 s. We sorted the gelation process into the following three parts, (I) pre-gelation, (II) reduction of translational diffusion (aging), and (III) reduction of rotational diffusion with saturating translational diffusion (post-gelation). The time scale of the process was completely different from the results of other methods.
International Nuclear Information System (INIS)
Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang
2014-01-01
We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)
Interaction between diffusion and chemical stresses
International Nuclear Information System (INIS)
Yang Fuqian
2005-01-01
The present work studies the interaction between chemical stresses and diffusion. A new relation between hydrostatic stress and concentration of solute atoms is established. For a solid free of action of body force, the Laplacian of the hydrostatic stress is proportional to the Laplacian of the concentration of solute atoms, that is, deviation of the hydrostatic stress from its local average is proportional to deviation of the local concentration of solute atoms. A general relationship among surface concentration of solute atoms, normal stress and surface deformation of a solid is then derived, in which the normal stress is dependent on the mean curvature of the undeformed surface and tangential components of the surface displacement. A closed-form solution of the steady state concentration of solute atoms in a thin plate is obtained. It turns out that linear distribution of solute atoms in the plate is non-existent due to the interaction between chemical stresses and diffusion
Energy Technology Data Exchange (ETDEWEB)
Garcia-Gutierrez, M.; Alonso de los Rios, U.; Missana, T.; Cormenzana, J.L.; Mingarro, M.; Morejon, J.; Gil, P.
2008-08-06
The Opalinus Clay (OPA) formation in the Zurcher Weiland (Switzerland) is a potential host rock for a repository for high-level radioactive waste. Samples collected in the Mont Terri Underground Rock Laboratory (URL), where the OPA formation is located at a depth between -200 and -300 m below the surface, were used to study the radionuclide diffusion in clay materials. Classical laboratory essays and a novel experimental set-up for large-scale diffusion experiments were performed together to a novel application of the nuclear ion beam technique Rutherford Backscattering Spectrometry (RBS), to understand the transport properties of the OPA and to enhance the methodologies used for in situ diffusion experiments. Through-Diffusion and In-Diffusion conventional laboratory diffusion experiments were carried out with HTO, 36{sup C}l-, I-, 22{sup N}a, 75{sup S}e, 85{sup S}r, 233{sup U}, 137{sup C}s, 60{sup C}o and 152{sup E}u. Large-scale diffusion experiments were performed with HTO, 36{sup C}l, and 85{sup S}r, and new experiments with 60{sup C}o, 137{sup C}s and 152{sup E}u are ongoing. Diffusion experiments with RBS technique were done with Sr, Re, U and Eu. (Author) 38 refs.
International Nuclear Information System (INIS)
Ivanov, Konstantin L.; Lukzen, Nikita N.; Sadovsky, Vladimir M.
2015-01-01
In this work, we treat spin-selective recombination of a geminate radical pair (RP) in a spherical “microreactor,” i.e., of a RP confined in a micelle, vesicle, or liposome. We consider the microreactor model proposed earlier, in which one of the radicals is located at the center of the micelle and the other one undergoes three-dimensional diffusion inside the micelle. In addition, we suggest a two-dimensional model, in which one of the radicals is located at the “pole” of the sphere, while the other one diffuses on the spherical surface. For this model, we have obtained a general analytical expression for the RP recombination yield in terms of the free Green function of two-dimensional diffusion motion. In turn, this Green function is expressed via the Legendre functions and thus takes account of diffusion over a restricted spherical surface and its curvature. The obtained expression allows one to calculate the RP recombination efficiency at an arbitrary magnetic field strength. We performed a comparison of the two models taking the same geometric parameters (i.e., the microreactor radius and the closest approach distance of the radicals), chemical reactivity, magnetic interactions in the RP and diffusion coefficient. Significant difference between the predictions of the two models is found, which is thus originating solely from the dimensionality effect: for different dimensionality of space, the statistics of diffusional contacts of radicals becomes different altering the reaction yield. We have calculated the magnetic field dependence of the RP reaction yield and chemically induced dynamic nuclear polarization of the reaction products at different sizes of the microreactor, exchange interaction, and spin relaxation rates. Interestingly, due to the intricate interplay of diffusional contacts of reactants and spin dynamics, the dependence of the reaction yield on the microreactor radius is non-monotonous. Our results are of importance for (i) interpreting
Energy Technology Data Exchange (ETDEWEB)
Avila, R.E., E-mail: ravila@cchen.c [Departamento de Materiales Nucleares, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile); Pena, L.A.; Jimenez, J.C. [Departamento de Produccion y Servicios, Comision Chilena de Energia Nuclear, Cas. 188-D, Santiago (Chile)
2010-10-30
The release of tritium from Li{sub 2}TiO{sub 3} and Li{sub 2}ZrO{sub 3} pebbles, in batch experiments, is studied by means of temperature programmed desorption. Data reduction focuses on the analysis of the non-oxidized and oxidized tritium components in terms of release limited by diffusion from the bulk of ceramic grains, or by first or second order surface desorption. By analytical and numerical methods the in-furnace tritium release is deconvoluted from the ionization chamber transfer functions, for which a semi-empirical form is established. The release from Li{sub 2}TiO{sub 3} follows second order desorption kinetics, requiring a temperature for a residence time of 1 day (T{sub 1dRes}) of 620 K, and 603 K, of the non-oxidized, and the oxidized components, respectively. The release from Li{sub 2}ZrO{sub 3} appears as limited by either diffusion from the bulk of the ceramic grains, or by first order surface desorption, the first possibility being the more probable. The respective values of T{sub 1dRes} for the non-oxidized component are 661 K, according to the first order surface desorption model, and 735 K within the bulk diffusion limited model.
Carroll, M. S.; Chang, C.-L.; Sturm, J. C.; Büyüklimanli, T.
1998-12-01
In this letter, we show the ability, through introduction of a thin Si1-x-yGexCy layer, to eliminate the enhancement of enhanced boron diffusion in silicon due to an oxidizing surface or ion implant damage. This reduction of diffusion is accomplished through a low-temperature-grown thin epitaxial Si1-x-yGexCy layer which completely filters out excess interstitials introduced by oxidation or ion implant damage. We also quantify the oxidation-enhanced diffusion (OED) and transient-enhanced diffusion (TED) dependence on substitutional carbon level, and further report both the observation of carbon TED and OED, and its dependence on carbon levels.
Eight joint BER II and BESSY II users meeting. Abstracts
International Nuclear Information System (INIS)
2016-01-01
The following topics were dealt with: Accelerator operation and projecs, photon science and instrumentation at BESSY II, status of energy materials in-situ Lab at BESSY II, high resolution spectrometer PEAXIS at BESSY II, sample environment at BESSY II, molecular control mechanisms in the Brr2 RNA helicase for efficient and regulated splicing, the Li conversion reaction of 4CoFe_2O_4 nanoparticles, buried interfaces in lithium ion batteries probed with HAXPES, ARPES studies of the STO(001) 2DEG, all-in/all-out magnetic order in rare earth iridates, oxygen reduction reaction on graphene in Li-air batteries, electronic order in high-T_c superconductors, in-siu observation of novel switching phenomena in highly porous metal-organic frameworks, photoinduced demagnetization and insulator-to-metal transition in ferromagnetic insulating BaFeO_3 thin films, ARPES measurement of the ferroelectric bulk Rashba system GeTe, bisphenol A on Cu(111) and Ag(111), reverse water-gas shift or Sabathier methanation on N(110), structural studies of molecular machines, multi-MHz time-of-flight electronic band-structure imaging of graphene on Ir(111), diffusion pathways in ion conductors, ground-state potential energy surfaces around selected atoms from resonant inelastic X-ray scattering, solar energy in an emerging country, in-situ neutron analysis of electrode materials for electrochemical energy storage, structure and transport properties in thermoelectric skutterudites, investigation of the interphase formation on solid lithium-ion conductors by neutron reflectometry, load partitin and damage characterization of cast AlSi_1_2CuMgNi alloy with ceramic reinforcement, methane adsorption in highly porous metal-organics, structure and magnetic interactions in dimer system Ba_(_3_-_x_)Sr_xCr_2O_8, distribution of S in C-S nanocomposites, current status of HFM-EXED FACITIY; SPIN NEAMTICITY IN s=1/2 frustrated zigzag chaIN β-TeVO_4, electronic properties of U(Ru_0_._9_2Rh_0_._0_8)_2Si_2 in
Directory of Open Access Journals (Sweden)
Katja Magdić
2016-04-01
Full Text Available Different types of charge storage mechanisms at unmodified graphite vs. glassy carbon electrodes in acid sulphate supporting solution containing potassium hexacyanoferrate (II redox active electrolyte, have been revealed by electrochemical impedance spectroscopy and supported by cyclic voltammetry experiments. Reversible charge transfer of Fe(CN63-/4- redox reaction detected by assessment of CVs of glassy carbon electrode, is in impedance spectra indicated by presence of bulk diffusion impedance and constant double-layer/pseudocapacitive electrode impedance compared to that measured in the pure supporting electrolyte. Some surface retention of redox species detected by assessment of CVs of graphite electrode is in impedance spectra indicated by diffusion impedance coupled in this case by diminishing of double-layer/pseudocapacitive impedance compared to that measured in the pure supporting electrolyte. This phenomenon is ascribed to contribution of additional pseudocapacitive impedance generated by redox reaction of species confined at the electrode surface.
Tucker, O. J.; Farrell, W. M.; Killen, R. M.; Hurley, D. M.
2018-01-01
Recently, the near-infrared observations of the OH veneer on the lunar surface by the Moon Mineralogy Mapper (M3) have been refined to constrain the OH content to 500-750 parts per million (ppm). The observations indicate diurnal variations in OH up to 200 ppm possibly linked to warmer surface temperatures at low latitude. We examine the M3 observations using a statistical mechanics approach to model the diffusion of implanted H in the lunar regolith. We present results from Monte Carlo simulations of the diffusion of implanted solar wind H atoms and the subsequently derived H and H2 exospheres.
Directory of Open Access Journals (Sweden)
Xuefeng Zhang
2015-01-01
Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.
Magnetoresistance of films and strips with the diffuse surface scattering
International Nuclear Information System (INIS)
Aronov, A.G.
1993-08-01
Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs
International Nuclear Information System (INIS)
Whelan, David G.; Johnson, Kelsey E.; Indebetouw, Rémy; Lebouteiller, Vianney; Galliano, Frédéric; Peeters, Els; Bernard-Salas, Jeronimo; Brandl, Bernhard R.
2013-01-01
The focus of this work is to study mid-infrared point sources and the diffuse interstellar medium (ISM) in the low-metallicity (∼0.2 Z ☉ ) giant H II region N66 in order to determine properties that may shed light on star formation in these conditions. Using the Spitzer Space Telescope's Infrared Spectrograph, we study polycyclic aromatic hydrocarbon (PAH), dust continuum, silicate, and ionic line emission from 14 targeted infrared point sources as well as spectra of the diffuse ISM that is representative of both the photodissociation regions (PDRs) and the H II regions. Among the point source spectra, we spectroscopically confirm that the brightest mid-infrared point source is a massive embedded young stellar object, we detect silicates in emission associated with two young stellar clusters, and we see spectral features of a known B[e] star that are commonly associated with Herbig Be stars. In the diffuse ISM, we provide additional evidence that the very small grain population is being photodestroyed in the hard radiation field. The 11.3 μm PAH complex emission exhibits an unexplained centroid shift in both the point source and ISM spectra that should be investigated at higher signal-to-noise and resolution. Unlike studies of other regions, the 6.2 μm and 7.7 μm band fluxes are decoupled; the data points cover a large range of I 7.7 /I 11.3 PAH ratio values within a narrow band of I 6.2 /I 11.3 ratio values. Furthermore, there is a spread in PAH ionization, being more neutral in the dense PDR where the radiation field is relatively soft, but ionized in the diffuse ISM/PDR. By contrast, the PAH size distribution appears to be independent of local ionization state. Important to unresolved studies of extragalactic low-metallicity star-forming regions, we find that emission from the infrared-bright point sources accounts for only 20%-35% of the PAH emission from the entire region. These results make a comparative data set to other star-forming regions with
EXTENDED [C II] EMISSION IN LOCAL LUMINOUS INFRARED GALAXIES
International Nuclear Information System (INIS)
Díaz-Santos, T.; Armus, L.; Surace, J. A.; Charmandaris, V.; Stacey, G.; Murphy, E. J.; Haan, S.; Stierwalt, S.; Evans, A. S.; Malhotra, S.; Appleton, P.; Inami, H.; Magdis, G. E.; Elbaz, D.; Mazzarella, J. M.; Xu, C. K.; Lu, N.; Howell, J. H.; Van der Werf, P. P.; Meijerink, R.
2014-01-01
We present Herschel/PACS observations of extended [C II] 157.7 μm line emission detected on ∼1-10 kpc scales in 60 local luminous infrared galaxies (LIRGs) from the Great Observatories All-sky LIRG Survey. We find that most of the extra-nuclear emission show [C II]/FIR ratios ≥4 × 10 –3 , larger than the mean ratio seen in the nuclei, and similar to those found in the extended disks of normal star-forming galaxies and the diffuse interstellar medium of our Galaxy. The [C II] ''deficits'' found in the most luminous local LIRGs are therefore restricted to their nuclei. There is a trend for LIRGs with warmer nuclei to show larger differences between their nuclear and extra-nuclear [C II]/FIR ratios. We find an anti-correlation between [C II]/FIR and the luminosity surface density, Σ IR , for the extended emission in the spatially resolved galaxies. However, there is an offset between this trend and that found for the LIRG nuclei. We use this offset to derive a beam filling-factor for the star-forming regions within the LIRG disks of ∼6% relative to their nuclei. We confront the observed trend to photo-dissociation region models and find that the slope of the correlation is much shallower than the model predictions. Finally, we compare the correlation found between [C II]/FIR and Σ IR with measurements of high-redshift starbursting IR-luminous galaxies
Transient diffusion from a waste solid into fractured porous rock
International Nuclear Information System (INIS)
Ahn, J.; Chambre, P.L.; Pigford, T.H.
1988-01-01
Previous analytical studies of the advective transport of dissolved contaminants through fractured rock have emphasized the effect of molecular diffusion in the rock matrix in affecting the space-time-dependent concentration of the contaminant as it moves along the fracture. Matrix diffusion only in the direction normal to the fracture surface was assumed. Contaminant sources were constant-concentration surfaces of width equal to the fracture aperture and of finite or infinite extent in the transverse direction. Such studies illustrate the far-field transport features of fractured media. To predict the time-dependent mass transfer from a long waste cylinder surrounded by porous rock and intersected by a fracture, the present study includes diffusion from the waste surface directly into porous rock, as well as the more realistic geometry. Here the authors present numerical results from Chambre's analytical solution for the time-dependent mass transfer from the cylinder for the low-flow conditions wherein near-field mass transfer is expected to be controlled by molecular diffusion
Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus
2017-12-01
This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power
Energy Technology Data Exchange (ETDEWEB)
Brogaard Kristensen, S
2000-06-01
This report describes the work done on modelling and simulation of the complex diffusion of gas through the wall of a flexible pipe. The diffusion and thus the pressure in annulus depends strongly on the diffusion and solubility parameters of the gas-polymer system and on the degree of blocking of the outer surface of the inner liner due to pressure reinforcements. The report evaluates the basis modelling required to describe the complex geometries and flow patterns. Qualitatively results of temperature and concentration profiles are shown in the report. For the program to serve any modelling purpose in 'real life' the results need to be validated and possibly the model needs corrections. Hopefully, a full-scale test of a flexible pipe will provide the required temperatures and pressures in annulus to validate the models. (EHS)
Magnetic Shear and Transport in ECRH Discharges of the TJ-II under Ohmic Induction
Energy Technology Data Exchange (ETDEWEB)
Lopez-Bruna, D.; Castejon, F.; Romero, J. A.; Estrada, T.; Medina, F.; Ochando, M.; Lopez-Fraguas, A.; Ascasibar, E.; Herranz, J.; Sanchez, E.; Luna, E. de la; Pastor, I.
2006-07-01
TJ-II is ha heliac type stellarator characterised by high, but almost constant, vacuum rotational transform throughout the confining volume. In ECRH plasmas, moderate induced ohmic currents (negligible heating and modification of the magnetic field nodules) are enough to disregard the bootstrap contribution, which allows us performing a fair calculation of the evolution of the rotational transform. We use the loop voltage diagnostic to estimate the plasma electrical conductivity. Then the evolution of the rotational transform and shear is related to changes in the profiles of electron and thermal diffusivities: negative shear correlates with decreasing diffusivities in the region of steepest density gradient; transport increases toward zero shear but the achieved positive values are too small to draw conclusions. The radial sweeping of lowest order rational magnetic surfaces does not determine the observed trends in transport. (Author)43 refs.
Magnetic Shear and Transport in ECRH Discharges of the TJ-II under Ohmic Induction
International Nuclear Information System (INIS)
Lopez-Bruna, D.; Castejon, F.; Romero, J. A.; Estrada, T.; Medina, F.; Ochando, M.; Lopez-Fraguas, A.; Ascasibar, E.; Herranz, J.; Sanchez, E.; Luna, E. de la; Pastor, I.
2006-01-01
TJ-II is ha heliac type stellarator characterised by high, but almost constant, vacuum rotational transform throughout the confining volume. In ECRH plasmas, moderate induced ohmic currents (negligible heating and modification of the magnetic field nodules) are enough to disregard the bootstrap contribution, which allows us performing a fair calculation of the evolution of the rotational transform. We use the loop voltage diagnostic to estimate the plasma electrical conductivity. Then the evolution of the rotational transform and shear is related to changes in the profiles of electron and thermal diffusivities: negative shear correlates with decreasing diffusivities in the region of steepest density gradient; transport increases toward zero shear but the achieved positive values are too small to draw conclusions. The radial sweeping of lowest order rational magnetic surfaces does not determine the observed trends in transport. (Author)43 refs
Literature survey of matrix diffusion theory and of experiments and data including natural analogues
International Nuclear Information System (INIS)
Ohlsson, Yvonne; Neretnieks, I.
1995-08-01
Diffusion theory in general and matrix diffusion in particular has been outlined, and experimental work has been reviewed. Literature diffusion data has been systematized in the form of tables and data has been compared and discussed. Strong indications of surface diffusion and anion exclusion have been found, and natural analogue studies and in-situ experiments suggest pore connectivity in the scale of meters. Matrix diffusion, however, mostly seem to be confined to zones of higher porosity extending only a few centimeters into the rock. Surface coating material do not seem to hinder sorption or diffusion into the rock. 54 refs, 18 tabs
Directory of Open Access Journals (Sweden)
Murat Kuscu
Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.
Kuscu, Murat; Akan, Ozgur B
2018-01-01
We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.
Synthesis and studies on Cu(II), Co(II), Ni(II) complexes of Knoevenagel β-diketone ligands
Sumathi, S.; Tharmaraj, P.; Sheela, C. D.; Anitha, C.
2012-11-01
Transition metal complexes of various acetylacetone based ligands of the type ML [where M = Cu(II), Ni(II), Co(II); L = 3-(aryl)-pentane-2,4-dione] have been synthesized. The structural features have been derived from their elemental analysis, magnetic susceptibility, molar conductance, IR, UV-Vis, 1H NMR, Mass and ESR spectral studies. Conductivity measurements reveal that all the complexes are non-electrolytic in nature. Spectroscopic and other analytical data of the complexes suggest octahedral geometry for other metal(II) complexes. The redox behavior of the copper(II) complexes have been studied by cyclic voltammetry. The free ligands and their metal complexes have been screened for their in vitro biological activities against the bacteria Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus as well as the fungus Candida albicans by well diffusion method. The zone of inhibition value indicates that the most of the metal(II) complexes are found to possess increased activities compared to those of the free ligands. All synthesized compounds may serve as potential photoactive materials as indicated from their characteristic fluorescence properties. The second harmonic generation (SHG) efficiency of the ligands (L1-L3) was found to be considerable effect than that of urea and KDP (potassium dihydrogen phosphate).
International Nuclear Information System (INIS)
Park, Dong Ho; Park, Sung Soo; Choe, Sang Joon
1999-01-01
The immobilization of APTMS(3-(2-aminoethylamino)propyltrimethoxysilane) and AAPTMS(3-(2-(2-aminoethyl) aminoethylamino)propyltrimethoxysilane) on the surface of high quality mesoporous molecular sieves MCM-41 and MCM-48 have been confirmed by F.T.-IR spectroscopy, Raman spectroscopy, 29 Si solid state NMR, and a surface polarity measurement using Reichardt's dye. The formation of metal (Co(II), Ni(II), and Cu(II)) complexes by immobilized aminosilanes have been investigated by photoacoustic spectroscopy(PAS). The assignment of UV-Vis. PAS bands makes it possible to identify the structure of metal complexes within mesoporous molecular sieves. Co(II) ion may be coordinated mainly in a tetrahedral symmetry by two APTMS onto MCM-41, and in an octahedral one by two AAPTMS. Both Ni(II) and Cu(II) coordinated by aminosilanes within MCM-41 form possibly the octahedral complexes such as [Ni(APTMS) 2 (H 2 O) 2 ] 2+ , [Ni(AAPTMS) 2 ] 2+ , [Cu(APTMS) 2 (H 2 O) 2 ] 2+ , and [Cu(AAPTMS)(H 2 O) 3 ] 2+ , respectively. The PAS band shapes of complexes onto MCM-48 are similar to those of corresponding MCM-41 with the variation of PAS intensity. Most of metal ion(II) within MCM-41 and MCM-48 are coordinated by aminosilanes without the impregnation on the surface
International Nuclear Information System (INIS)
Ball, D.G.; Drake, J.B.; Cheverton, R.D.; Iskander, S.K.
1984-02-01
The OCA-II computer code, like its predecessor OCA-I, performs the thermal, stress, and linear elastic fracture-mechanics analysis for long flaws on the surface of a cylinder that is subjected to thermal and pressure transients. OCA-II represents a revised and expanded version of OCA-I and includes as new features (1) cladding as a discrete region, (2) a finite-element subroutine for calculating the stresses, and (3) the ability to calculate stress intensity factors for certain three-dimensional flaws, for two-dimensional circumferential flaws on the inner surface, and for both axial and circumferential flaws on the outer surface. OCA-I considered only inner-surface flaws. An option is included in OCA-II that permits a search for critical values of fluence or nil-ductility reference temperature corresponding to a specified failure criterion. These and other features of OCA-II are described in the report, which also includes user instructions for the code
Role of rational surfaces on fluctuations and transport in the plasma edge of the TJ-II stellarator
International Nuclear Information System (INIS)
Pedrosa, M.A.; Hidalgo, C.; Lopez-Fraguas, A.
2000-01-01
It has been shown that transport barriers in toroidal magnetically confined plasmas tend to be linked to regions of unique magnetic topology such as the location of a minimum in the safety factor, rational surfaces or the boundary between closed and open flux surfaces. In the absence of E x B sheared flows, fluctuations are expected to show maximum amplitude near rational surfaces, and plasma confinement might tend to deteriorate. On the other hand, if the generation of E x B sheared flows were linked to low order rational surfaces, these would be beneficial to confinement. Experimental evidence of E x B sheared flows linked to rational surfaces has been obtained in the plasma edge region of the TJ-II stellarator. (author)
Diffusion of water into SU-8 microcantilevers
DEFF Research Database (Denmark)
Liu, C.J.; Liu, Y.; Sokuler, M.
2010-01-01
We present a method to monitor the diffusion of liquid molecules in polymers. A microdrop of water is deposited by a piezoelectric drop generator onto the upper surface of a cantilever made of SU-8 based photoresist. In response, the cantilever bends in the opposite direction. We find...... sophisticated finite element model the diffusion coefficient of water in the SU-8 polymer can be determined quantitatively from the dynamics of cantilever bending....... that this bending is mainly caused by the diffusion of water into the cantilever and the consequent swelling of SU-8. Using a one-dimensional diffusion model and assuming a simple swelling law, we qualitatively model the bending of the cantilever during in and out diffusion of water in SU-8. With a more...
A diffusive ink transport model for lipid dip-pen nanolithography.
Urtizberea, A; Hirtz, M
2015-10-14
Despite diverse applications, phospholipid membrane stacks generated by dip-pen nanolithography (DPN) still lack a thorough and systematic characterization that elucidates the whole ink transport process from writing to surface spreading, with the aim of better controlling the resulting feature size and resolution. We report a quantitative analysis and modeling of the dependence of lipid DPN features (area, height and volume) on dwell time and relative humidity. The ink flow rate increases with humidity in agreement with meniscus size growth, determining the overall feature size. The observed time dependence indicates the existence of a balance between surface spreading and the ink flow rate that promotes differences in concentration at the meniscus/substrate interface. Feature shape is controlled by the substrate surface energy. The results are analyzed within a modified model for the ink transport of diffusive inks. At any humidity the dependence of the area spread on the dwell time shows two diffusion regimes: at short dwell times growth is controlled by meniscus diffusion while at long dwell times surface diffusion governs the process. The critical point for the switch of regime depends on the humidity.
Binzet, Gun; Gumus, Ilkay; Dogen, Aylin; Flörke, Ulrich; Kulcu, Nevzat; Arslan, Hakan
2018-06-01
We synthesized four new N,N-dialkyl-N‧-3-chlorobenzoylthiourea ligands (Alkyl: Dimethyl, diethyl, di-n-propyl and di-n-butyl) and their metal complexes with copper and nickel atoms. The structure of all synthesized compounds was fully characterized by physicochemical, spectroscopic and single crystal X-ray diffraction analysis techniques. The physical, spectral and analytical data of the newly synthesized metal complexes have shown the formation of 1:2 (metal:ligand) ratio. The benzoylthiourea ligands coordinate with metal atoms through oxygen and sulphur atoms. The metal atoms are in slightly distorted square-planar coordination geometry in Ni(II) or Cu(II) complex. Two oxygen and two sulphur atoms are mutually cis to each other in Ni(II) or Cu(II) complex. The intermolecular contacts in the compounds, which are HL1 and HL3, were examined by Hirshfeld surfaces and fingerprint plots using the data obtained from X-ray single crystal diffraction measurement. Besides these, their antimicrobial activities against Gram-positive bacteria (Bacillus subtilis, Staphylococcus aureus, Streptococcus pyogenes and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) and anti-yeast activity (Candida glabrata, Candida parapsilosis and Candida albicans) were investigated. This exhibited some promising results towards testing organism. Among all the compounds, Ni(L1)2 complex showed high activity against Bacillus subtilis with MIC values at 7.81 μg/mL.
Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven
2015-01-01
The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.
International Nuclear Information System (INIS)
Tahira, F.; Imran, M.; Iqbal, J.
2009-01-01
Some novel complexes of Co (II), Ni (II), Cu (II), and Zn (II) have been synthesized with a Schiff base ligand derived from sulphadimidine and benzaldehyde. The structural features of the complexes have been determined by elemental analysis, magnetic susceptibility, conductance measurement, UV/ Vis. and infrared spectroscopy. IR studies revealed that the Schiff base ligand Sulphadimidine-benzylidene has monoanionic bidendate nature and coordinate with metal ions through nitrogen atom of azomethine (>C = N) and deprotonated -NH group. All the complexes were assigned octahedral geometry on the basis of magnetic moment and electronic spectroscopic data. Low value of conductance supports their non-electrolytic nature. The ligand, as well as its complexes were checked for their in vitro antimicrobial activities against two gram positive bacterial strains, Bacillus subtillus. Staphylococcus aureus and one gram negative Salmonella typhae and five fungal strains, Nigrospora oryzae, Curvularia lunata, Drechslera rostrata, Aspergillus niger and Candida olbicans by disc diffusion method and agar plate technique, respectively. Both the antibacterial and antitungal activities of the synthesized metal complexes were found to be more as compared to parent drug and uncomplexed ligand. All the complexes contain coordinated water, which is lost at 141-160 degree C. (author)
Simulating watercolor by modeling diffusion, pigment, and paper fibers
Small, David
1991-08-01
This paper explores a parallel approach to the problem of predicting the actions of pigment and water when applied to paper fibers. This work was done on the Connection Machine II, whose parallel architecture allows one to cast the problem as that of a complex cellular automata. One defines simple rules for the behavior of each cell based on the state of that cell and its immediate neighbors. By repeating the computation for each cell in the paper over many time steps, elaborate and realistic behaviors can be achieved. The simulation takes into account diffusion, surface tension, gravity, humidity, paper absorbency and the molecular weight of each pigment. At each time step a processor associated with each fiber in the paper computes water and pigment gradients, surface tension and gravitational forces, and decides if there should be any movement of material. Pigment and water can be applied and removed (blotting) with masks created from type or scanned images. Use of a parallel processor simplifies the creation and testing of software, and variables can be stored and manipulated at highprecision. The resulting simulation runs at approximately one-tenth real time.
International Nuclear Information System (INIS)
Owens, A.J.
1977-01-01
The effects of non-field-aligned diffusion (i.e., terms in the diffusion tensor proportional to the antisymmetric coefficient kappa/sub A/) on the observed day-to-day deviation of the diffusive diurnal anisotropy from the daily average magnetic field direction are considered. Using reasonable parameters for the diffusion of cosmic rays in interplanetary space, I show that these terms give a natural explanation for the angular difference between the anisotropy and field directions during normal quiet interplanetary epochs
Tin( ii ) ketoacidoximates: synthesis, X-ray structures and processing to tin( ii ) oxide
Khanderi, Jayaprakash
2015-10-21
Tin(ii) ketoacidoximates of the type [HONCRCOO]Sn (R = Me 1, CHPh 2) and (MeONCMeCOO)Sn] NH·2HO 3 were synthesized by reacting pyruvate- and hydroxyl- or methoxylamine RONH (R = H, Me) with tin(ii) chloride dihydrate SnCl·2HO. The single crystal X-ray structure reveals that the geometry at the Sn atom is trigonal bipyramidal in 1, 2 and trigonal pyramidal in 3. Inter- or intramolecular hydrogen bonding is observed in 1-3. Thermogravimetric (TG) analysis shows that the decomposition of 1-3 to SnO occurs at ca. 160 °C. The evolved gas analysis during TG indicates complete loss of the oximato ligand in one step for 1 whereas a small organic residue is additionally removed at temperatures >400 °C for 2. Above 140 °C, [HONC(Me)COO]Sn (1) decomposes in air to spherical SnO particles of size 10-500 nm. Spin coating of 1 on Si or a glass substrate followed by heating at 200 °C results in a uniform film of SnO. The band gap of the produced SnO film and nanomaterial was determined by diffuse reflectance spectroscopy to be in the range of 3.0-3.3 eV. X-ray photoelectron spectroscopy indicates surface oxidation of the SnO film to SnO in ambient atmosphere.
Directory of Open Access Journals (Sweden)
H. Hammami
2017-08-01
Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other