High-level, but not low-level, motion perception is impaired in patients with schizophrenia.

Science.gov (United States)

Kandil, Farid I; Pedersen, Anya; Wehnes, Jana; Ohrmann, Patricia

2013-01-01

Smooth pursuit eye movements are compromised in patients with schizophrenia and their first-degree relatives. Although research has demonstrated that the motor components of smooth pursuit eye movements are intact, motion perception has been shown to be impaired. In particular, studies have consistently revealed deficits in performance on tasks specific to the high-order motion area V5 (middle temporal area, MT) in patients with schizophrenia. In contrast, data from low-level motion detectors in the primary visual cortex (V1) have been inconsistent. To differentiate between low-level and high-level visual motion processing, we applied a temporal-order judgment task for motion events and a motion-defined figure-ground segregation task using patients with schizophrenia and healthy controls. Successful judgments in both tasks rely on the same low-level motion detectors in the V1; however, the first task is further processed in the higher-order motion area MT in the magnocellular (dorsal) pathway, whereas the second task requires subsequent computations in the parvocellular (ventral) pathway in visual area V4 and the inferotemporal cortex (IT). These latter structures are supposed to be intact in schizophrenia. Patients with schizophrenia revealed a significantly impaired temporal resolution on the motion-based temporal-order judgment task but only mild impairment in the motion-based segregation task. These results imply that low-level motion detection in V1 is not, or is only slightly, compromised; furthermore, our data restrain the locus of the well-known deficit in motion detection to areas beyond the primary visual cortex.

Ion Motion Stability in Asymmetric Surface Electrode Ion Traps

Science.gov (United States)

Shaikh, Fayaz; Ozakin, Arkadas

2010-03-01

Many recently developed designs of the surface electrode ion traps for quantum information processing have asymmetry built into their geometries. The asymmetry helps rotate the trap axes to angles with respect to electrode surface that facilitate laser cooling of ions but introduces a relative angle between the RF and DC fields and invalidates the classical stability analysis of the symmetric case for which the equations of motion are decoupled. For asymmetric case the classical motion of a single ion is given by a coupled, multi-dimensional version of Mathieu's equation. In this poster we discuss the stability diagram of asymmetric surface traps by performing an approximate multiple scale perturbation analysis of the coupled Mathieu equations, and validate the results with numerical simulations. After obtaining the stability diagram for the linear fields, we simulate the motion of an ion in a given asymmetric surface trap, utilizing a method-of-moments calculation of the electrode fields. We obtain the stability diagram and compare it with the ideal case to find the region of validity. Finally, we compare the results of our stability analysis to experiments conducted on a microfabricated asymmetric surface trap.

Technical note: Correlation of respiratory motion between external patient surface and internal anatomical landmarks

Science.gov (United States)

Fayad, Hadi; Pan, Tinsu; Clément, Jean-François; Visvikis, Dimitris

2011-01-01

Purpose Current respiratory motion monitoring devices used for motion synchronization in medical imaging and radiotherapy provide either 1D respiratory signals over a specific region or 3D information based on few external or internal markers. On the other hand, newer technology may offer the potential to monitor the entire patient external surface in real time. The main objective of this study was to assess the motion correlation between such an external patient surface and internal anatomical landmarks motion. Methods Four dimensional Computed Tomography (4D CT) volumes for ten patients were used in this study. Anatomical landmarks were manually selected in the thoracic region across the 4D CT datasets by two experts. The landmarks included normal structures as well as the tumour location. In addition, a distance map representing the entire external patient surface, which corresponds to surfaces acquired by a Time of Flight (ToF) camera or similar devices, was created by segmenting the skin of all 4D CT volumes using a thresholding algorithm. Finally, the correlation between the internal landmarks and external surface motion was evaluated for different regions (placement and size) throughout a patient’s surface. Results Significant variability was observed in the motion of the different parts of the external patient surface. The larger motion magnitude was consistently measured in the central regions of the abdominal and the thoracic areas for the different patient datasets considered. The highest correlation coefficients were observed between the motion of these external surface areas and internal landmarks such as the diaphragm and mediastinum structures as well as the tumour location landmarks (0.8 ± 0.18 and 0.72 ± 0.12 for the abdominal and the thoracic regions respectively). Worse correlation was observed when one considered landmarks not significantly influenced by respiratory motion such as the apex and the sternum. Discussion and conclusions There

Pivotal role of hMT+ in long-range disambiguation of interhemispheric bistable surface motion.

Science.gov (United States)

Duarte, João Valente; Costa, Gabriel Nascimento; Martins, Ricardo; Castelo-Branco, Miguel

2017-10-01

It remains an open question whether long-range disambiguation of ambiguous surface motion can be achieved in early visual cortex or instead in higher level regions, which concerns object/surface segmentation/integration mechanisms. We used a bistable moving stimulus that can be perceived as a pattern comprehending both visual hemi-fields moving coherently downward or as two widely segregated nonoverlapping component objects (in each visual hemi-field) moving separately inward. This paradigm requires long-range integration across the vertical meridian leading to interhemispheric binding. Our fMRI study (n = 30) revealed a close relation between activity in hMT+ and perceptual switches involving interhemispheric segregation/integration of motion signals, crucially under nonlocal conditions where components do not overlap and belong to distinct hemispheres. Higher signal changes were found in hMT+ in response to spatially segregated component (incoherent) percepts than to pattern (coherent) percepts. This did not occur in early visual cortex, unlike apparent motion, which does not entail surface segmentation. We also identified a role for top-down mechanisms in state transitions. Deconvolution analysis of switch-related changes revealed prefrontal, insula, and cingulate areas, with the right superior parietal lobule (SPL) being particularly involved. We observed that directed influences could emerge either from left or right hMT+ during bistable motion integration/segregation. SPL also exhibited significant directed functional connectivity with hMT+, during perceptual state maintenance (Granger causality analysis). Our results suggest that long-range interhemispheric binding of ambiguous motion representations mainly reflect bottom-up processes from hMT+ during perceptual state maintenance. In contrast, state transitions maybe influenced by high-level regions such as the SPL. Hum Brain Mapp 38:4882-4897, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley

Temperature-Responsive Anisotropic Slippery Surface for Smart Control of the Droplet Motion.

Science.gov (United States)

Wang, By Lili; Heng, Liping; Jiang, Lei

2018-02-28

Development of stimulus-responsive anisotropic slippery surfaces is important because of the high demand for such materials in the field of liquid directional-driven systems. However, current studies in the field of slippery surfaces are mainly conducted to prepare isotropic slippery surfaces. Although we have developed electric-responsive anisotropic slippery surfaces that enable smart control of the droplet motion, there remain challenges for designing temperature-responsive anisotropic slippery surfaces to control the liquid droplet motion on the surface and in the tube. In this work, temperature-responsive anisotropic slippery surfaces have been prepared by using paraffin, a thermo-responsive phase-transition material, as a lubricating fluid and directional porous polystyrene (PS) films as the substrate. The smart regulation of the droplet motion of several liquids on this surface was accomplished by tuning the substrate temperature. The uniqueness of this surface lies in the use of an anisotropic structure and temperature-responsive lubricating fluids to achieve temperature-driven smart control of the anisotropic motion of the droplets. Furthermore, this surface was used to design temperature-driven anisotropic microreactors and to manipulate liquid transfer in tubes. This work advances the understanding of the principles underlying anisotropic slippery surfaces and provides a promising material for applications in the biochip and microreactor system.

Real-time Terrain Rendering using Smooth Hardware Optimized Level of Detail

DEFF Research Database (Denmark)

Larsen, Bent Dalgaard; Christensen, Niels Jørgen

2003-01-01

We present a method for real-time level of detail reduction that is able to display high-complexity polygonal surface data. A compact and efficient regular grid representation is used. The method is optimized for modern, low-end consumer 3D graphics cards. We avoid sudden changes of the geometry...

Operational tracking of lava lake surface motion at Kīlauea Volcano, Hawai‘i

Science.gov (United States)

Patrick, Matthew R.; Orr, Tim R.

2018-03-08

Surface motion is an important component of lava lake behavior, but previous studies of lake motion have been focused on short time intervals. In this study, we implement the first continuous, real-time operational routine for tracking lava lake surface motion, applying the technique to the persistent lava lake in Halema‘uma‘u Crater at the summit of Kīlauea Volcano, Hawai‘i. We measure lake motion by using images from a fixed thermal camera positioned on the crater rim, transmitting images to the Hawaiian Volcano Observatory (HVO) in real time. We use an existing optical flow toolbox in Matlab to calculate motion vectors, and we track the position of lava upwelling in the lake, as well as the intensity of spattering on the lake surface. Over the past 2 years, real-time tracking of lava lake surface motion at Halema‘uma‘u has been an important part of monitoring the lake’s activity, serving as another valuable tool in the volcano monitoring suite at HVO.

Surface EMG signals based motion intent recognition using multi-layer ELM

Science.gov (United States)

Wang, Jianhui; Qi, Lin; Wang, Xiao

2017-11-01

The upper-limb rehabilitation robot is regard as a useful tool to help patients with hemiplegic to do repetitive exercise. The surface electromyography (sEMG) contains motion information as the electric signals are generated and related to nerve-muscle motion. These sEMG signals, representing human's intentions of active motions, are introduced into the rehabilitation robot system to recognize upper-limb movements. Traditionally, the feature extraction is an indispensable part of drawing significant information from original signals, which is a tedious task requiring rich and related experience. This paper employs a deep learning scheme to extract the internal features of the sEMG signals using an advanced Extreme Learning Machine based auto-encoder (ELMAE). The mathematical information contained in the multi-layer structure of the ELM-AE is used as the high-level representation of the internal features of the sEMG signals, and thus a simple ELM can post-process the extracted features, formulating the entire multi-layer ELM (ML-ELM) algorithm. The method is employed for the sEMG based neural intentions recognition afterwards. The case studies show the adopted deep learning algorithm (ELM-AE) is capable of yielding higher classification accuracy compared to the Principle Component Analysis (PCA) scheme in 5 different types of upper-limb motions. This indicates the effectiveness and the learning capability of the ML-ELM in such motion intent recognition applications.

Motion of Drops on Surfaces with Wettability Gradients

Science.gov (United States)

Subramanian, R. Shankar; McLaughlin, John B.; Moumen, Nadjoua; Qian, Dongying

2002-11-01

A liquid drop present on a solid surface can move because of a gradient in wettability along the surface, as manifested by a gradient in the contact angle. The contact angle at a given point on the contact line between a solid and a liquid in a gaseous medium is the angle between the tangent planes to the liquid and the solid surfaces at that point and is measured within the liquid side, by convention. The motion of the drop occurs in the direction of increasing wettability. The cause of the motion is the net force exerted on the drop by the solid surface because of the variation of the contact angle around the periphery. This force causes acceleration of an initially stationary drop, and leads to its motion in the direction of decreasing contact angle. The nature of the motion is determined by the balance between the motivating force and the resisting hydrodynamic force from the solid surface and the surrounding gaseous medium. A wettability gradient can be chemically induced as shown by Chaudhury and Whitesides who provided unambiguous experimental evidence that drops can move in such gradients. The phenomenon can be important in heat transfer applications in low gravity, such as when condensation occurs on a surface. Daniel et al have demonstrated that the velocity of a drop on a surface due to a wettability gradient in the presence of condensation can be more than two orders of magnitude larger than that observed in the absence of condensation. In the present research program, we have begun to study the motion of a drop in a wettability gradient systematically using a model system. Our initial efforts will be restricted to a system in which no condensation occurs. The experiments are performed as follows. First, a rectangular strip of approximate dimensions 10 x 20 mm is cut out of a silicon wafer. The strip is cleaned thoroughly and its surface is exposed to the vapor from an alkylchlorosilane for a period lasting between one and two minutes inside a

Effective basis for modelling outlines of envelopes generated by motion of surfaces of revolution

International Nuclear Information System (INIS)

Turlapov, V.E.; Yakunin, V.I.

1994-01-01

This paper considers effective solutions of problems on parallel processing of envelopes generated by three-dimensional movement of surfaces of revolution. In general, determining the points outlining the envelope corresponding to concrete values for motion parameters reduces to numerical solution of nonlinear equations in generatrix parameters. For surfaces of revolution whose generatrix is a circular arc, this problem reduces to solution of a fourth-degree algebraic equation. It is shown that an envelope outline can be specified in the form of an explicit function of the motion parameters for any motion if the generatrix of the surface of revolution is a strait line, and, for motion with a fixed point or a fixed axis for the surface of revolution, if the generatrix is a conic section, spline, or a number of other curves

Examination of earthquake Ground Motion in the deep underground environment of Japan

International Nuclear Information System (INIS)

Goto, J.; Tsuchi, H.; Mashimo, M.

2009-01-01

Among the possible impacts of earthquakes on the geological disposal system, ground motion is not included in the criteria for selecting a candidate repository site because, in general, ground motion deep underground is considered to be smaller than at the surface. Also, after backfilling/closure, the repository moves together with the surrounding rock. We have carried out a detailed examination of earthquake ground motion deep underground using extensive data from recent observation networks to support the above assumption. As a result, it has been reconfirmed that earthquake ground motion deep underground is relatively smaller than at the surface. Through detailed analysis of data, we have identified the following important parameters for evaluating earthquake ground motion deep underground: depth and velocity distribution of the rock formations of interest, the intensity of the short period component of earthquakes and incident angle of seismic waves to the rock formations. (authors)

Stochastic motion of 7 x 7 kinks at monoatomic step edges on the Si(1 1 1) surface

International Nuclear Information System (INIS)

Fukuda, T.; Maeda, S.; Nakayama, H.

2003-01-01

An offset of a straight step, called a kink, is occasionally formed on semiconductor surfaces. The motion of the kink on the Si(1 1 1) 7x7 surface in the [1-bar 1-bar 2] step was studied in detail by high-temperature scanning tunneling microscopy (STM), and thermal fluctuations of the kink displacement along the step edges was observed. The kink displacement did not diverge with time, suggesting that a restoring force acts on the kink. The displacement, however, could be clearly represented by the gaussian distribution and it was therefore considered to be a Brownian particle. The temperature dependence of the mean square displacement of the kink position showed that the displacement is a thermal activation process with an apparent activation energy of 1.54±0.1 eV. From the equation of motion on the kink displacement including an incoming and outgoing flux as a fluctuation source, the phenomenological Langevin equation was derived. The activation energy of the kink displacement is related to the diffusion coefficient of the two-dimensional adatom gas and the latent heat of the atoms from the kink site to the surface adatom

Vertical ground motion and historical sea-level records in Dakar (Senegal)

International Nuclear Information System (INIS)

Le Cozannet, Gonéri; Raucoules, Daniel; Garcin, Manuel; Lavigne, Franck; Wöppelmann, Guy; Gravelle, Médéric; Da Sylva, Sylvestre; Meyssignac, Benoit

2015-01-01

With growing concerns regarding future impacts of sea-level in major coastal cities, the most accurate information is required regarding local sea-level changes with respect to the coast. Besides global and regional sea-level changes, local coastal vertical ground motions can substantially contribute to local changes in sea-level. In some cases, such ground motions can also limit the usefulness of tide-gauge records, which are a unique source of information to evaluate global sea-level changes before the altimetry era. Using satellite synthetic aperture radar interferometry, this study aims at characterizing vertical coastal ground motion in Dakar (Senegal), where a unique century-long record in Africa has been rediscovered. Given the limited number of available images, we use a stacking procedure to compute ground motion velocities in the line of sight over 1992–2010. Despite a complex geology and a rapid population growth and development, we show that the city as a whole is unaffected by differential ground motions larger than 1 mm year −1 . Only the northern part of the harbor displays subsidence patterns after 2000, probably as a consequence of land reclamation works. However, these ground motions do not affect the historical tide gauge. Our results highlight the value of the historical sea-level records of Dakar, which cover a 100 year time-span in a tropical oceanic region of Africa, where little data are available for past sea-level reconstructions. (letter)

Motion of the surface of the human tympanic membrane measured with stroboscopic holography

Science.gov (United States)

Cheng, Jeffrey Tao; Aarnisalo, Antti A.; Harrington, Ellery; Hernandez-Montes, Maria del Socorro; Furlong, Cosme; Merchant, Saumil N.; Rosowski, John J.

2010-01-01

Sound-induced motion of the surface of the human tympanic membrane (TM) was studied by stroboscopic holographic interferometery, which measures the amplitude and phase of the displacement at each of about 40000 points on the surface of the TM. Measurements were made with tonal stimuli of 0.5, 1, 4 and 8 kHz. The magnitude and phase of the sinusoidal displacement of the TM at each driven frequency were derived from the fundamental Fourier component of the raw displacement data computed from stroboscopic holograms of the TM recorded at eight stimulus phases. The correlation between the Fourier estimates and measured motion data was generally above 0.9 over the entire TM surface. We used three data presentations: (i) Plots of the phasic displacements along a single chord across the surface of the TM, (ii) Phasic surface maps of the displacement of the entire TM surface, and (iii) Plots of the Fourier derived amplitude and phase-angle of the surface displacement along four diameter lines that define and bisect each of the four quadrants of the TM. These displays led to some common conclusions: At 0.5 and 1 kHz, the entire TM moved roughly in-phase with some small phase delay apparent between local areas of maximal displacement in the posterior half of the TM. At 4 and 8 kHz, the motion of the TM became more complicated with multiple local displacement maxima arranged in rings around the manubrium. The displacements at most of these maxima were roughly in-phase, while some moved out-of-phase. Superposed on this in- and out-of-phase behavior were significant cyclic variations in phase with location of less than 0.2 cycles or occasionally rapid half-cycle step-like changes in phase. The high frequency displacement amplitude and phase maps discovered in this study can not be explained by any single wave motion, but are consistent with a combination of low and higher order modal motions plus some small traveling-wave-like components. The observations of the dynamics of TM

Current plans to characterize the design basis ground motion at the Yucca Mountain, Nevada Site

International Nuclear Information System (INIS)

Simecka, W.B.; Grant, T.A.; Voegele, M.D.; Cline, K.M.

1992-01-01

A site at Yucca Mountain Nevada is currently being studied to assess its suitability as a potential host site for the nation's first commercial high level waste repository. The DOE has proposed a new methodology for determining design-basis ground motions that uses both deterministic and probabilistic methods. The role of the deterministic approach is primary. It provides the level of detail needed by design engineers in the characterization of ground motions. The probabilistic approach provides a logical structured procedure for integrating the range of possible earthquakes that contribute to the ground motion hazard at the site. In addition, probabilistic methods will be used as needed to provide input for the assessment of long-term repository performance. This paper discusses the local tectonic environment, potential seismic sources and their associated displacements and ground motions. It also discusses the approach to assessing the design basis earthquake for the surface and underground facilities, as well as selected examples of the use of this type of information in design activities

Tuple image multi-scale optical flow for detailed cardiac motion extraction: Application to left ventricle rotation analysis

NARCIS (Netherlands)

Assen, van H.C.; Florack, L.M.J.; Westenberg, J.J.M.; Haar Romenij, ter B.M.; Hamarneh, G.; Abugharbieh, R.

2008-01-01

We present a new method for detailed tracking of cardiac motion based on MR-tagging imaging, multi-scale optical flow, and HARP-like image filtering.In earlier work, we showed that the results obtained with our method correlate very well with Phase Contrast MRI. In this paper we combine the

Detailed modelling of strong ground motion in Trieste

International Nuclear Information System (INIS)

Vaccari, F.; Romanelli, F.; Panza, G.

2005-05-01

Trieste has been included in category IV by the new Italian seismic code. This corresponds to a horizontal acceleration of 0.05g for the anchoring of the elastic response spectrum. A detailed modelling of the ground motion in Trieste has been done for some scenario earthquakes, compatible with the seismotectonic regime of the region. Three-component synthetic seismograms (displacements, velocities and accelerations) have been analyzed to obtain significant parameters of engineering interest. The definition of the seismic input, derived from a comprehensive set of seismograms analyzed in the time and frequency domains, represents a powerful and convenient tool for seismic microzoning. In the specific case of Palazzo Carciotti, depending on the azimuth of the incoming wavefield, an increase of one degree in intensity may be expected due to different amplification patterns, while a nice stability can be seen in the periods corresponding to the peak values, with amplifications around 1 and 2 Hz. For Palazzo Carciotti, the most dangerous scenario considered, for an event of M=6.5 at an epicentral distance of 21 km, modelled taking into account source finiteness and directivity, leads to a peak ground acceleration value of 0.2 g. The seismic code, being based on a probabilistic approach, can be considered representative of the average seismic shaking for the province of Trieste, and can slightly underestimate the seismic input due the seismogenic potential (obtained from the historical seismicity and seismotectonics). Furthermore, relevant local site effects are mostly neglected. Both modelling and observations show that site conditions in the centre of Trieste can amplify the ground motion at the bedrock by a factor of five, in the frequency range of engineering interest. We may therefore expect macroseismic intensities as high as IX (MCS) corresponding to VIII (MSK). Spectral amplifications obtained for the considered scenario earthquakes are strongly event

Utilization of Large Scale Surface Models for Detailed Visibility Analyses

Science.gov (United States)

Caha, J.; Kačmařík, M.

2017-11-01

This article demonstrates utilization of large scale surface models with small spatial resolution and high accuracy, acquired from Unmanned Aerial Vehicle scanning, for visibility analyses. The importance of large scale data for visibility analyses on the local scale, where the detail of the surface model is the most defining factor, is described. The focus is not only the classic Boolean visibility, that is usually determined within GIS, but also on so called extended viewsheds that aims to provide more information about visibility. The case study with examples of visibility analyses was performed on river Opava, near the Ostrava city (Czech Republic). The multiple Boolean viewshed analysis and global horizon viewshed were calculated to determine most prominent features and visibility barriers of the surface. Besides that, the extended viewshed showing angle difference above the local horizon, which describes angular height of the target area above the barrier, is shown. The case study proved that large scale models are appropriate data source for visibility analyses on local level. The discussion summarizes possible future applications and further development directions of visibility analyses.

Vortex cores and vortex motion in superconductors with anisotropic Fermi surfaces

Energy Technology Data Exchange (ETDEWEB)

Galvis, J.A. [Laboratorio de Bajas Temperaturas, Departamento de Física de la Materia Condensada, Instituto de Ciencia de Materiales Nicolás Cabrera, Condensed Matter Physics Center (IFIMAC), Facultad de Ciencias, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Departamento de Ciencias Naturales, Facultad de ingeniería y Ciencias Básicas, Universidad Central, Bogotá (Colombia); National High Magnetic Field Laboratory, Florida State University, Tallahassee, Florida 32310 (United States); Herrera, E.; Guillamón, I.; Vieira, S. [Laboratorio de Bajas Temperaturas, Departamento de Física de la Materia Condensada, Instituto de Ciencia de Materiales Nicolás Cabrera, Condensed Matter Physics Center (IFIMAC), Facultad de Ciencias, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Unidad Asociada de Altos Campos Magnéticos y Bajas Temperaturas, UAM, CSIC, Madrid (Spain); Suderow, H., E-mail: hermann.suderow@uam.es [Laboratorio de Bajas Temperaturas, Departamento de Física de la Materia Condensada, Instituto de Ciencia de Materiales Nicolás Cabrera, Condensed Matter Physics Center (IFIMAC), Facultad de Ciencias, Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Unidad Asociada de Altos Campos Magnéticos y Bajas Temperaturas, UAM, CSIC, Madrid (Spain)

2017-02-15

Highlights: • The observation of vortex cores is reviewed, with emphasis in new experiments. • Vortex cores are follow superconducting gap and Fermi surface shapes. • The vortex core shape influences vortex dynamics. - Abstract: Explaning static and dynamic properties of the vortex lattice in anisotropic superconductors requires a careful characterization of vortex cores. The vortex core contains Andreev bound states whose spatial extension depends on the anisotropy of the electronic band-structure and superconducting gap. This might have an impact on the anisotropy of the superconducting properties and on vortex dynamics. Here we briefly summarize basic concepts to understand anisotropic vortex cores and review vortex core imaging experiments. We further discuss moving vortex lattices and the influence of vortex core shape in vortex motion. We find vortex motion in highly tilted magnetic fields. We associate vortex motion to the vortex entry barrier and the screening currents at the surface. We find preferential vortex motion along the main axis of the vortex lattice. After travelling integers of the intervortex distance, we find that vortices move more slowly due to the washboard potential of the vortex lattice.

Vortex cores and vortex motion in superconductors with anisotropic Fermi surfaces

International Nuclear Information System (INIS)

Galvis, J.A.; Herrera, E.; Guillamón, I.; Vieira, S.; Suderow, H.

2017-01-01

Highlights: • The observation of vortex cores is reviewed, with emphasis in new experiments. • Vortex cores are follow superconducting gap and Fermi surface shapes. • The vortex core shape influences vortex dynamics. - Abstract: Explaning static and dynamic properties of the vortex lattice in anisotropic superconductors requires a careful characterization of vortex cores. The vortex core contains Andreev bound states whose spatial extension depends on the anisotropy of the electronic band-structure and superconducting gap. This might have an impact on the anisotropy of the superconducting properties and on vortex dynamics. Here we briefly summarize basic concepts to understand anisotropic vortex cores and review vortex core imaging experiments. We further discuss moving vortex lattices and the influence of vortex core shape in vortex motion. We find vortex motion in highly tilted magnetic fields. We associate vortex motion to the vortex entry barrier and the screening currents at the surface. We find preferential vortex motion along the main axis of the vortex lattice. After travelling integers of the intervortex distance, we find that vortices move more slowly due to the washboard potential of the vortex lattice.

Optical surface scanning for respiratory motion monitoring in radiotherapy: a feasibility study

DEFF Research Database (Denmark)

Bekke, Susanne Lise; Mahmood, Faisal; Helt-Hansen, Jakob

2014-01-01

Purpose. We evaluated the feasibility of a surface scanning system (Catalyst) for respiratory motion monitoring of breast cancer patients treated with radiotherapy in deep inspiration breath-hold (DIBH). DIBH is used to reduce the radiation dose to the heart and lung. In contrast to RPM, a compet......Purpose. We evaluated the feasibility of a surface scanning system (Catalyst) for respiratory motion monitoring of breast cancer patients treated with radiotherapy in deep inspiration breath-hold (DIBH). DIBH is used to reduce the radiation dose to the heart and lung. In contrast to RPM...... and 3: the Quasar phantom was used to study if the angle of the monitored surface affects the amplitude of the recorded signal. Results. Experiment 1: we observed comparable period estimates for both systems. The amplitudes were 8 ± 0.1 mm (Catalyst) and 4.9 ± 0.1 mm (RPM). Independent check with in...... 1. Experiment 3: an increased (fixed) surface angle during breathing motion resulted in an overestimated amplitude with RPM, while the amplitude estimated by Catalyst was unaffected. Conclusion. Our study showed that Catalyst can be used as a better alternative to the RPM. With Catalyst...

Description of surface quadrupole oscillations of heated spherical nuclei in the Brownian-motion approximation

International Nuclear Information System (INIS)

Svin'in, I.R.

1982-01-01

The Brownian motion of a quadrupole quantum oscillator is considered as a model of surface quadrupole oscillations of heated spherical nuclei. The integrals of the motion related to energy and angular momentum conservation are constructed and the wave functions are obtained for states with definite values of these integrals of the motion in the phonon representation

Nanoparticle motion on the surface of drying droplets

Science.gov (United States)

Zhao, Mingfei; Yong, Xin

2018-03-01

Advances in solution-based printing and surface patterning techniques for additive manufacturing demand a clear understanding of particle dynamics in drying colloidal droplets and its relationship with deposit structure. Although the evaporation-driven deposition has been studied thoroughly for the particles dispersed in the bulk of the droplet, few investigations have focused on the particles strongly adsorbed to the droplet surface. We modeled the assembly and deposition of the surface-active particles in a drying sessile droplet with a pinned contact line by the multiphase lattice Boltzmann-Brownian dynamics method. The particle trajectory and its area density profile characterize the assembly dynamics and deposition pattern development during evaporation. While the bulk-dispersed particles continuously move to the contact line, forming the typical "coffee-ring" deposit, the interface-bound particles migrate first toward the apex and then to the contact line as the droplet dries out. To understand this unexpected behavior, we resolve the droplet velocity field both in the bulk and within the interfacial region. The simulation results agree well with the analytical solution for the Stokes flow inside an evaporating droplet. At different stages of evaporation, our study reveals that the competition between the tangential surface flow and the downward motion of the evaporating liquid-vapor interface governs the dynamics of the interface-bound particles. In particular, the interface displacement contributes to the particle motion toward the droplet apex in a short phase, while the outward advective flow prevails at the late stage of drying and carries the particles to the contact line. The final deposit of the surface-adsorbed particles exhibits a density enhancement at the center, in addition to a coffee ring. Despite its small influence on the final deposit in the present study, the distinct dynamics of surface-active particles due to the interfacial confinement

Effects of surface motion and electron-hole pair excitations in CO2 dissociation and scattering on Ni(100)

Science.gov (United States)

Luo, Xuan; Zhou, Xueyao; Jiang, Bin

2018-05-01

The energy transfer between different channels is an important aspect in chemical reactions at surfaces. We investigate here in detail the energy transfer dynamics in a prototypical system, i.e., reactive and nonreactive scattering of CO2 on Ni(100), which is related to heterogeneous catalytic processes with Ni-based catalysts for CO2 reduction. On the basis of our earlier nine-dimensional potential energy surface for CO2/Ni(100), dynamical calculations have been done using the generalized Langevin oscillator (GLO) model combined with local density friction approximation (LDFA), in which the former accounts for the surface motion and the latter accounts for the low-energy electron-hole pair (EHP) excitation. In spite of its simplicity, it is found that the GLO model yields quite satisfactory results, including the significant energy loss and product energy disposal, trapping, and steering dynamics, all of which agree well with the ab initio molecular dynamics ones where many surface atoms are explicitly involved with high computational cost. However, the GLO model fails to describe the reactivity enhancement due to the lattice motion because it intrinsically does not incorporate the variance of barrier height on the surface atom displacement. On the other hand, in LDFA, the energy transferred to EHPs is found to play a minor role and barely alter the dynamics, except for slightly reducing the dissociation probabilities. In addition, vibrational state-selected dissociative sticking probabilities are calculated and previously observed strong mode specificity is confirmed. Our work suggests that further improvement of the GLO model is needed to consider the lattice-induced barrier lowering.

Estimation of strong motions on free rock surface. Identification of soil structures and strong motions on free rock surface in Kashiwazaki-Kariwa nuclear power plant during the 2007 Niigataken Chuetsu-oki earthquake

International Nuclear Information System (INIS)

Saguchi, Koichiro; Masaki, Kazuaki; Irikura, Kojiro

2009-01-01

Very strong ground motions (maximum acceleration 993 cm/s 2 in the borehole seismometer point of -255m in depth) were observed in the Kashiwazaki Kariwa Nuclear Power Plant during the Niigataken Chuetsu-oki Earthquake on July 16, 2007. In this study, we tried to develop new method, which can simulate waveforms on free rock surface by using the bore hole records. We identified the underground structure model at the Service Hall from aftershock records observed in vertical array, using the simulated annealing method (Ingber(1989)). Based on numerical experiments it is identified that S-wave velocity and Q values of individual layers are inverted very well. Strong motion records of main shock observed by the bore hole seismometers were simulated by using one-dimensional multiple reflection method. In this study, non-linear effect is considered by introducing non-linear coefficient c(f) for under coming wave from surface. The maximum acceleration and phase characteristics in simulated waveforms are similar to the observed one. It means that our method is useful for simulate strong motion in non-linear region. Finally, strong motions on the free rock surface at the Service Hall during the main shock are simulated. The maximum acceleration of EW component on free rock surface is estimated to be 1,207 cm/s 2 . (author)

Hand Motion Classification Using a Multi-Channel Surface Electromyography Sensor

Directory of Open Access Journals (Sweden)

Dong Sun

2012-01-01

Full Text Available The human hand has multiple degrees of freedom (DOF for achieving high-dexterity motions. Identifying and replicating human hand motions are necessary to perform precise and delicate operations in many applications, such as haptic applications. Surface electromyography (sEMG sensors are a low-cost method for identifying hand motions, in addition to the conventional methods that use data gloves and vision detection. The identification of multiple hand motions is challenging because the error rate typically increases significantly with the addition of more hand motions. Thus, the current study proposes two new methods for feature extraction to solve the problem above. The first method is the extraction of the energy ratio features in the time-domain, which are robust and invariant to motion forces and speeds for the same gesture. The second method is the extraction of the concordance correlation features that describe the relationship between every two channels of the multi-channel sEMG sensor system. The concordance correlation features of a multi-channel sEMG sensor system were shown to provide a vast amount of useful information for identification. Furthermore, a new cascaded-structure classifier is also proposed, in which 11 types of hand gestures can be identified accurately using the newly defined features. Experimental results show that the success rate for the identification of the 11 gestures is significantly high.

Hand motion classification using a multi-channel surface electromyography sensor.

Science.gov (United States)

Tang, Xueyan; Liu, Yunhui; Lv, Congyi; Sun, Dong

2012-01-01

The human hand has multiple degrees of freedom (DOF) for achieving high-dexterity motions. Identifying and replicating human hand motions are necessary to perform precise and delicate operations in many applications, such as haptic applications. Surface electromyography (sEMG) sensors are a low-cost method for identifying hand motions, in addition to the conventional methods that use data gloves and vision detection. The identification of multiple hand motions is challenging because the error rate typically increases significantly with the addition of more hand motions. Thus, the current study proposes two new methods for feature extraction to solve the problem above. The first method is the extraction of the energy ratio features in the time-domain, which are robust and invariant to motion forces and speeds for the same gesture. The second method is the extraction of the concordance correlation features that describe the relationship between every two channels of the multi-channel sEMG sensor system. The concordance correlation features of a multi-channel sEMG sensor system were shown to provide a vast amount of useful information for identification. Furthermore, a new cascaded-structure classifier is also proposed, in which 11 types of hand gestures can be identified accurately using the newly defined features. Experimental results show that the success rate for the identification of the 11 gestures is significantly high.

The motion of a vortex on a closed surface of constant negative curvature.

Science.gov (United States)

Ragazzo, C Grotta

2017-10-01

The purpose of this work is to present an algorithm to determine the motion of a single hydrodynamic vortex on a closed surface of constant curvature and of genus greater than one. The algorithm is based on a relation between the Laplace-Beltrami Green function and the heat kernel. The algorithm is used to compute the motion of a vortex on the Bolza surface. This is the first determination of the orbits of a vortex on a closed surface of genus greater than one. The numerical results show that all the 46 vortex equilibria can be explicitly computed using the symmetries of the Bolza surface. Some of these equilibria allow for the construction of the first two examples of infinite vortex crystals on the hyperbolic disc. The following theorem is proved: 'a Weierstrass point of a hyperellitic surface of constant curvature is always a vortex equilibrium'.

Effects of Cable Sway, Electrode Surface Area, and Electrode Mass on Electroencephalography Signal Quality during Motion.

Science.gov (United States)

Symeonidou, Evangelia-Regkina; Nordin, Andrew D; Hairston, W David; Ferris, Daniel P

2018-04-03

More neuroscience researchers are using scalp electroencephalography (EEG) to measure electrocortical dynamics during human locomotion and other types of movement. Motion artifacts corrupt the EEG and mask underlying neural signals of interest. The cause of motion artifacts in EEG is often attributed to electrode motion relative to the skin, but few studies have examined EEG signals under head motion. In the current study, we tested how motion artifacts are affected by the overall mass and surface area of commercially available electrodes, as well as how cable sway contributes to motion artifacts. To provide a ground-truth signal, we used a gelatin head phantom with embedded antennas broadcasting electrical signals, and recorded EEG with a commercially available electrode system. A robotic platform moved the phantom head through sinusoidal displacements at different frequencies (0-2 Hz). Results showed that a larger electrode surface area can have a small but significant effect on improving EEG signal quality during motion and that cable sway is a major contributor to motion artifacts. These results have implications in the development of future hardware for mobile brain imaging with EEG.

Measurement of six-degree-of-freedom planar motions by using a multiprobe surface encoder

Science.gov (United States)

Li, Xinghui; Shimizu, Yuki; Ito, Takeshi; Cai, Yindi; Ito, So; Gao, Wei

2014-12-01

A multiprobe surface encoder for optical metrology of six-degree-of-freedom (six-DOF) planar motions is presented. The surface encoder is composed of an XY planar scale grating with identical microstructures in X- and Y-axes and an optical sensor head. In the optical sensor head, three paralleled laser beams were used as laser probes. After being divided by a beam splitter, the three laser probes were projected onto the scale grating and a reference grating with identical microstructures, respectively. For each probe, the first-order positive and negative diffraction beams along the X- and Y-directions from the scale grating and from the reference grating superimposed with each other and four pieces of interference signals were generated. Three-DOF translational motions of the scale grating Δx, Δy, and Δz can be obtained simultaneously from the interference signals of each probe. Three-DOF angular error motions θX, θY, and θZ can also be calculated simultaneously from differences of displacement output variations and the geometric relationship among the three probes. A prototype optical sensor head was designed, constructed, and evaluated. Experimental results verified that this surface encoder could provide measurement resolutions of subnanometer and better than 0.1 arc sec for three-DOF translational motions and three-DOF angular error motions, respectively.

Motion control report

CERN Document Server

2013-01-01

Please note this is a short discount publication. In today's manufacturing environment, Motion Control plays a major role in virtually every project.The Motion Control Report provides a comprehensive overview of the technology of Motion Control:* Design Considerations* Technologies* Methods to Control Motion* Examples of Motion Control in Systems* A Detailed Vendors List

AC Own Motion Percentage of Randomly Sampled Cases

Data.gov (United States)

Social Security Administration — Longitudinal report detailing the numbers and percentages of Appeals Council (AC) own motion review actions taken on un-appealed favorable hearing level decisions...

Molecular Dynamics Study of Thermally Augmented Nanodroplet Motion on Chemical Energy Induced Wettability Gradient Surfaces.

Science.gov (United States)

Chakraborty, Monojit; Chowdhury, Anamika; Bhusan, Richa; DasGupta, Sunando

2015-10-20

Droplet motion on a surface with chemical energy induced wettability gradient has been simulated using molecular dynamics (MD) simulation to highlight the underlying physics of molecular movement near the solid-liquid interface including the contact line friction. The simulations mimic experiments in a comprehensive manner wherein microsized droplets are propelled by the surface wettability gradient against forces opposed to motion. The liquid-wall Lennard-Jones interaction parameter and the substrate temperature are varied to explore their effects on the three-phase contact line friction coefficient. The contact line friction is observed to be a strong function of temperature at atomistic scales, confirming their experimentally observed inverse functionality. Additionally, the MD simulation results are successfully compared with those from an analytical model for self-propelled droplet motion on gradient surfaces.

Infrasonic induced ground motions

Science.gov (United States)

Lin, Ting-Li

On January 28, 2004, the CERI seismic network recorded seismic signals generated by an unknown source. Our conclusion is that the acoustic waves were initiated by an explosive source near the ground surface. The meteorological temperature and effective sound speed profiles suggested existence of an efficient near-surface waveguide that allowed the acoustic disturbance to propagate to large distances. An explosion occurring in an area of forest and farms would have limited the number of eyewitnesses. Resolution of the source might be possible by experiment or by detailed analysis of the ground motion data. A seismo-acoustic array was built to investigate thunder-induced ground motions. Two thunder events with similar N-wave waveforms but different horizontal slownesses are chosen to evaluate the credibility of using thunder as a seismic source. These impulsive acoustic waves excited P and S reverberations in the near surface that depend on both the incident wave horizontal slowness and the velocity structure in the upper 30 meters. Nineteen thunder events were chosen to further investigate the seismo-acoustic coupling. The consistent incident slowness differences between acoustic pressure and ground motions suggest that ground reverberations were first initiated somewhat away from the array. Acoustic and seismic signals were used to generate the time-domain transfer function through the deconvolution technique. Possible non-linear interaction for acoustic propagation into the soil at the surface was observed. The reverse radial initial motions suggest a low Poisson's ratio for the near-surface layer. The acoustic-to-seismic transfer functions show a consistent reverberation series of the Rayleigh wave type, which has a systematic dispersion relation to incident slownesses inferred from the seismic ground velocity. Air-coupled Rayleigh wave dispersion was used to quantitatively constrain the near-surface site structure with constraints afforded by near-surface body

A Fully Nonlinear, Dynamically Consistent Numerical Model for Solid-Body Ship Motion. I. Ship Motion with Fixed Heading

Science.gov (United States)

Lin, Ray-Quing; Kuang, Weijia

2011-01-01

In this paper, we describe the details of our numerical model for simulating ship solidbody motion in a given environment. In this model, the fully nonlinear dynamical equations governing the time-varying solid-body ship motion under the forces arising from ship wave interactions are solved with given initial conditions. The net force and moment (torque) on the ship body are directly calculated via integration of the hydrodynamic pressure over the wetted surface and the buoyancy effect from the underwater volume of the actual ship hull with a hybrid finite-difference/finite-element method. Neither empirical nor free parametrization is introduced in this model, i.e. no a priori experimental data are needed for modelling. This model is benchmarked with many experiments of various ship hulls for heave, roll and pitch motion. In addition to the benchmark cases, numerical experiments are also carried out for strongly nonlinear ship motion with a fixed heading. These new cases demonstrate clearly the importance of nonlinearities in ship motion modelling.

Reproducibility of UAV-based earth surface topography based on structure-from-motion algorithms.

Science.gov (United States)

Clapuyt, François; Vanacker, Veerle; Van Oost, Kristof

2014-05-01

A representation of the earth surface at very high spatial resolution is crucial to accurately map small geomorphic landforms with high precision. Very high resolution digital surface models (DSM) can then be used to quantify changes in earth surface topography over time, based on differencing of DSMs taken at various moments in time. However, it is compulsory to have both high accuracy for each topographic representation and consistency between measurements over time, as DSM differencing automatically leads to error propagation. This study investigates the reproducibility of reconstructions of earth surface topography based on structure-from-motion (SFM) algorithms. To this end, we equipped an eight-propeller drone with a standard reflex camera. This equipment can easily be deployed in the field, as it is a lightweight, low-cost system in comparison with classic aerial photo surveys and terrestrial or airborne LiDAR scanning. Four sets of aerial photographs were created for one test field. The sets of airphotos differ in focal length, and viewing angles, i.e. nadir view and ground-level view. In addition, the importance of the accuracy of ground control points for the construction of a georeferenced point cloud was assessed using two different GPS devices with horizontal accuracy at resp. the sub-meter and sub-decimeter level. Airphoto datasets were processed with SFM algorithm and the resulting point clouds were georeferenced. Then, the surface representations were compared with each other to assess the reproducibility of the earth surface topography. Finally, consistency between independent datasets is discussed.

A Motion Planning Approach to Studying Molecular Motions

KAUST Repository

Amato, Nancy M.

2010-01-01

While structurally very different, protein and RNA molecules share an important attribute. The motions they undergo are strongly related to the function they perform. For example, many diseases such as Mad Cow disease or Alzheimer\\'s disease are associated with protein misfolding and aggregation. Similarly, RNA folding velocity may regulate the plasmid copy number, and RNA folding kinetics can regulate gene expression at the translational level. Knowledge of the stability, folding, kinetics and detailed mechanics of the folding process may help provide insight into how proteins and RNAs fold. In this paper, we present an overview of our work with a computational method we have adapted from robotic motion planning to study molecular motions. We have validated against experimental data and have demonstrated that our method can capture biological results such as stochastic folding pathways, population kinetics of various conformations, and relative folding rates. Thus, our method provides both a detailed view (e.g., individual pathways) and a global view (e.g., population kinetics, relative folding rates, and reaction coordinates) of energy landscapes of both proteins and RNAs. We have validated these techniques by showing that we observe the same relative folding rates as shown in experiments for structurally similar protein molecules that exhibit different folding behaviors. Our analysis has also been able to predict the same relative gene expression rate for wild-type MS2 phage RNA and three of its mutants.

Stick-Slip Motion of Moving Contact Line on Chemically Patterned Surfaces

KAUST Repository

Wu, Congmin; Lei, Siulong; Qian, Tiezheng; Wang, Xiaoping

2009-01-01

Based on our continuum hydrodynamic model for immiscible two-phase flows at solid surfaces, the stick-slip motion has been predicted for moving contact line at chemically patterned surfaces [Wang et al., J. Fluid Mech., 605 (2008), pp. 59-78]. In this paper we show that the continuum predictions can be quantitatively verified by molecular dynamics (MD) simulations. Our MD simulations are carried out for two immiscible Lennard-Jones fluids confined by two planar solid walls in Poiseuille flow geometry. In particular, one solid surface is chemically patterned with alternating stripes. For comparison, the continuum model is numerically solved using material parameters directly measured in MD simulations. From oscillatory fluid-fluid interface to intermittent stick-slip motion of moving contact line, we have quantitative agreement between the continuum and MD results. This agreement is attributed to the accurate description down to molecular scale by the generalized Navier boundary condition in our continuum model. Numerical results are also presented for the relaxational dynamics of fluid-fluid interface, in agreement with a theoretical analysis based on the Onsager principle of minimum energy dissipation. © 2010 Global-Science Press.

Demons versus level-set motion registration for coronary 18F-sodium fluoride PET

Science.gov (United States)

Rubeaux, Mathieu; Joshi, Nikhil; Dweck, Marc R.; Fletcher, Alison; Motwani, Manish; Thomson, Louise E.; Germano, Guido; Dey, Damini; Berman, Daniel S.; Newby, David E.; Slomka, Piotr J.

2016-03-01

Ruptured coronary atherosclerotic plaques commonly cause acute myocardial infarction. It has been recently shown that active microcalcification in the coronary arteries, one of the features that characterizes vulnerable plaques at risk of rupture, can be imaged using cardiac gated 18F-sodium fluoride (18F-NaF) PET. We have shown in previous work that a motion correction technique applied to cardiac-gated 18F-NaF PET images can enhance image quality and improve uptake estimates. In this study, we further investigated the applicability of different algorithms for registration of the coronary artery PET images. In particular, we aimed to compare demons vs. level-set nonlinear registration techniques applied for the correction of cardiac motion in coronary 18F-NaF PET. To this end, fifteen patients underwent 18F-NaF PET and prospective coronary CT angiography (CCTA). PET data were reconstructed in 10 ECG gated bins; subsequently these gated bins were registered using demons and level-set methods guided by the extracted coronary arteries from CCTA, to eliminate the effect of cardiac motion on PET images. Noise levels, target-to-background ratios (TBR) and global motion were compared to assess image quality. Compared to the reference standard of using only diastolic PET image (25% of the counts from PET acquisition), cardiac motion registration using either level-set or demons techniques almost halved image noise due to the use of counts from the full PET acquisition and increased TBR difference between 18F-NaF positive and negative lesions. The demons method produces smoother deformation fields, exhibiting no singularities (which reflects how physically plausible the registration deformation is), as compared to the level-set method, which presents between 4 and 8% of singularities, depending on the coronary artery considered. In conclusion, the demons method produces smoother motion fields as compared to the level-set method, with a motion that is physiologically

Low level cloud motion vectors from Kalpana-1 visible images

Indian Academy of Sciences (India)

. In this paper, an attempt has been made to retrieve low-level cloud motion vectors using Kalpana-1 visible (VIS) images at every half an hour. The VIS channel provides better detection of low level clouds, which remain obscure in thermal IR ...

Self-Management of Patient Body Position, Pose, and Motion Using Wide-Field, Real-Time Optical Measurement Feedback: Results of a Volunteer Study

International Nuclear Information System (INIS)

Parkhurst, James M.; Price, Gareth J.; Sharrock, Phil J.; Jackson, Andrew S.N.; Stratford, Julie; Moore, Christopher J.

2013-01-01

Purpose: We present the results of a clinical feasibility study, performed in 10 healthy volunteers undergoing a simulated treatment over 3 sessions, to investigate the use of a wide-field visual feedback technique intended to help patients control their pose while reducing motion during radiation therapy treatment. Methods and Materials: An optical surface sensor is used to capture wide-area measurements of a subject's body surface with visualizations of these data displayed back to them in real time. In this study we hypothesize that this active feedback mechanism will enable patients to control their motion and help them maintain their setup pose and position. A capability hierarchy of 3 different level-of-detail abstractions of the measured surface data is systematically compared. Results: Use of the device enabled volunteers to increase their conformance to a reference surface, as measured by decreased variability across their body surfaces. The use of visual feedback also enabled volunteers to reduce their respiratory motion amplitude to 1.7 ± 0.6 mm compared with 2.7 ± 1.4 mm without visual feedback. Conclusions: The use of live feedback of their optically measured body surfaces enabled a set of volunteers to better manage their pose and motion when compared with free breathing. The method is suitable to be taken forward to patient studies

Ballbot-type motion of N-heterocyclic carbenes on gold surfaces

Science.gov (United States)

Wang, Gaoqiang; Rühling, Andreas; Amirjalayer, Saeed; Knor, Marek; Ernst, Johannes Bruno; Richter, Christian; Gao, Hong-Jun; Timmer, Alexander; Gao, Hong-Ying; Doltsinis, Nikos L.; Glorius, Frank; Fuchs, Harald

2017-02-01

Recently, N-heterocyclic carbenes (NHCs) were introduced as alternative anchors for surface modifications and so offered many attractive features, which might render them superior to thiol-based systems. However, little effort has been made to investigate the self-organization process of NHCs on surfaces, an important aspect for the formation of self-assembled monolayers (SAMs), which requires molecular mobility. Based on investigations with scanning tunnelling microscopy and first-principles calculations, we provide an understanding of the microscopic mechanism behind the high mobility observed for NHCs. These NHCs extract a gold atom from the surface, which leads to the formation of an NHC-gold adatom complex that displays a high surface mobility by a ballbot-type motion. Together with their high desorption barrier this enables the formation of ordered and strongly bound SAMs. In addition, this mechanism allows a complementary surface-assisted synthesis of dimeric and hitherto unknown trimeric NHC gold complexes on the surface.

Directional Limits on Motion Transparency Assessed Through Colour-Motion Binding.

Science.gov (United States)

Maloney, Ryan T; Clifford, Colin W G; Mareschal, Isabelle

2018-03-01

Motion-defined transparency is the perception of two or more distinct moving surfaces at the same retinal location. We explored the limits of motion transparency using superimposed surfaces of randomly positioned dots defined by differences in motion direction and colour. In one experiment, dots were red or green and we varied the proportion of dots of a single colour that moved in a single direction ('colour-motion coherence') and measured the threshold direction difference for discriminating between two directions. When colour-motion coherences were high (e.g., 90% of red dots moving in one direction), a smaller direction difference was required to correctly bind colour with direction than at low coherences. In another experiment, we varied the direction difference between the surfaces and measured the threshold colour-motion coherence required to discriminate between them. Generally, colour-motion coherence thresholds decreased with increasing direction differences, stabilising at direction differences around 45°. Different stimulus durations were compared, and thresholds were higher at the shortest (150 ms) compared with the longest (1,000 ms) duration. These results highlight different yet interrelated aspects of the task and the fundamental limits of the mechanisms involved: the resolution of narrowly separated directions in motion processing and the local sampling of dot colours from each surface.

Three-dimensional quantification of cardiac surface motion: a newly developed three-dimensional digital motion-capture and reconstruction system for beating heart surgery.

Science.gov (United States)

Watanabe, Toshiki; Omata, Sadao; Odamura, Motoki; Okada, Masahumi; Nakamura, Yoshihiko; Yokoyama, Hitoshi

2006-11-01

This study aimed to evaluate our newly developed 3-dimensional digital motion-capture and reconstruction system in an animal experiment setting and to characterize quantitatively the three regional cardiac surface motions, in the left anterior descending artery, right coronary artery, and left circumflex artery, before and after stabilization using a stabilizer. Six pigs underwent a full sternotomy. Three tiny metallic markers (diameter 2 mm) coated with a reflective material were attached on three regional cardiac surfaces (left anterior descending, right coronary, and left circumflex coronary artery regions). These markers were captured by two high-speed digital video cameras (955 frames per second) as 2-dimensional coordinates and reconstructed to 3-dimensional data points (about 480 xyz-position data per second) by a newly developed computer program. The remaining motion after stabilization ranged from 0.4 to 1.01 mm at the left anterior descending, 0.91 to 1.52 mm at the right coronary artery, and 0.53 to 1.14 mm at the left circumflex regions. Significant differences before and after stabilization were evaluated in maximum moving velocity (left anterior descending 456.7 +/- 178.7 vs 306.5 +/- 207.4 mm/s; right coronary artery 574.9 +/- 161.7 vs 446.9 +/- 170.7 mm/s; left circumflex 578.7 +/- 226.7 vs 398.9 +/- 192.6 mm/s; P heart surface movement. This helps us better understand the complexity of the heart, its motion, and the need for developing a better stabilizer for beating heart surgery.

Valgus-varus motion of the knee in normal level walking and stair climbing.

Science.gov (United States)

Yu, B; Stuart, M J; Kienbacher, T; Growney, E S; An, K-N

1997-07-01

OBJECTIVE: The knee valgus-varus moment and the knee angles were compared between normal level walking and stair climbing. DESIGN: Ten healthy subjects were tested for ascent, descent, and level walking. BACKGROUND: An understanding of the normal valgus-varus motion of the knee during stair climbing is needed to apply biomechanical analysis of stair climbing as a evaluation tool for knee osteoarthritis patients. METHODS: A motion analysis system, three force plates, and a flight of stairs were used to collect kinematic and kinetic data. The knee angles and moments were calculated from the collected kinematic and kinetic data. RESULTS: The knee varus angle for the maximum knee valgus moments in stair climbing was significantly greater than that in level walking. The knee valgus moment was significantly correlated to ground reaction forces and knee valgus-varus angle during stair climbing and level walking. CONCLUSIONS: There is a coupling between the knee valgus-varus motion and flexion-extension motion. Ground reaction forces are the major contributors to the within-subject variation in the knee valgus-varus moment during stair climbing and level walking. The knee valgus-varus angle is a major contributor to the between-subject variation in the knee valgus moment during stair climbing and level walking.

Revisiting the concept level of detail in 3D city modelling

NARCIS (Netherlands)

Biljecki, F.; Zhao, J.; Stoter, J.E.; Ledoux, H.

2013-01-01

This review paper discusses the concept of level of detail in 3D city modelling, and is a first step towards a foundation for a standardised definition. As an introduction, a few level of detail specifications, outlooks and approaches are given from the industry. The paper analyses the general

Diffusion in one dimensional random medium and hyperbolic Brownian motion

International Nuclear Information System (INIS)

Comtet, A.; Monthus, C.; Paris-6 Univ., 75

1995-03-01

Classical diffusion in a random medium involves an exponential functional of Brownian motion. This functional also appears in the study of Brownian diffusion on a Riemann surface of constant negative curvature. This relationship is analyzed in detail and various distributions are studied using stochastic calculus and functional integration. (author) 17 refs

Reducing Motional Decoherence in Ion Traps with Surface Science Methods

Science.gov (United States)

Haeffner, Hartmut

2014-03-01

Many trapped ions experiments ask for low motional heating rates while trapping the ions close to trapping electrodes. However, in practice small ion-electrode distances lead to unexpected high heating rates. While the mechanisms for the heating is still unclear, it is now evident that surface contamination of the metallic electrodes is at least partially responsible for the elevated heating rates. I will discuss heating rate measurements in a microfabricated surface trap complemented with basic surface science studies. We monitor the elemental surface composition of the Cu-Al alloy trap with an Auger spectrometer. After bake-out, we find a strong Carbon and Oxygen contamination and heating rates of 200 quanta/s at 1 MHz trap frequency. After removing most of the Carbon and Oxygen with Ar-Ion sputtering, the heating rates drop to 4 quanta/s. Interestingly, we still measure the decreased heating rate even after the surface oxidized from the background gas throughout a 40-day waiting time in UHV.

Optimized surface-slab excited-state muffin-tin potential and surface core level shifts

International Nuclear Information System (INIS)

Rundgren, J.

2003-01-01

An optimized muffin-tin (MT) potential for surface slabs with preassigned surface core-level shifts (SCLS's) is presented. By using the MT radii as adjustable parameters the model is able to conserve the definition of the SCLS with respect to the bulk and concurrently to generate a potential that is continuous at the MT radii. The model is conceived for elastic electron scattering in a surface slab with exchange-correlation interaction described by the local density approximation. The model employs two data bases for the self-energy of the signal electron (after Hedin and Lundqvist or Sernelius). The potential model is discussed in detail with two surface structures Be(101-bar0), for which SCLS's are available, and Cu(111)p(2x2)Cs, in which the close-packed radii of the atoms are extremely different. It is considered plausible that tensor LEED based on an optimized MT potential can be used for determining SCLS's

Experimental investigation on the motion of cathode spots in removing oxide film on metal surface by vacuum arc

International Nuclear Information System (INIS)

Shi Zongqian; Jia Shenli; Wang Lijun; Yuan Qingjun; Song Xiaochuan

2008-01-01

The motion of vacuum arc cathode spots has a very important influence on the efficiency of removing the oxide film on the metal surface. In this paper, the characteristics of cathode spot motion are investigated experimentally. Experiments were conducted in a detachable vacuum chamber with ac (50 Hz) arc current of 1 kA (rms). A stainless steel plate covered by an oxide layer was used as the cathode. The motion of cathode spots during the descaling process was photographed by a high-speed digital camera with an exposure time of 2 μs. Experimental results indicate that the motion of cathode spots is influenced by the interaction among individual cathode jets and the position of the anode as well as the surface condition. The waveform of arc voltage is also influenced by the motion of cathode spots

Motion of a cylinder adjacent to a free-surface: flow patterns and loading

Energy Technology Data Exchange (ETDEWEB)

Zhu, Q.; Lin, J.C. [Lehigh Univ., Bethlehem, PA (United States). Dept. of Mechanical Engineering and Mechanics; Unal, M.F.; Rockwell, D.

2000-06-01

The flow structure and loading due to combined translatory and sinusoidal motion of a cylinder adjacent to a free-surface are characterized using a cinema technique of high-image-density particle image velocimetry and simultaneous force measurements. The instantaneous patterns of vorticity and streamline topology are interpreted as a function of degree of submergence beneath the free-surface. The relative magnitudes of the peak vorticity and the circulation of vortices formed from the upper and lower surfaces of the cylinder, as well as vortex formation from the free-surface, are remarkably affected by the nominal submergence. The corresponding streamline topology, interpreted in terms of foci, saddle points, and multiple separation and reattachment points also exhibit substantial changes with submergence. All of these features affect the instantaneous loading of the cylinder. Calculation of instantaneous moments of vorticity and the incremental changes in these moments during the cylinder motion allow identification of those vortices that contribute most substantially to the instantaneous lift and drag. Furthermore, the calculated moments are in general accord with the time integrals of the measured lift and drag acting on the cylinder for sufficiently large submergence. (orig.)

Motion-compensated optical coherence tomography using envelope-based surface detection and Kalman-based prediction

Science.gov (United States)

Irsch, Kristina; Lee, Soohyun; Bose, Sanjukta N.; Kang, Jin U.

2018-02-01

We present an optical coherence tomography (OCT) imaging system that effectively compensates unwanted axial motion with micron-scale accuracy. The OCT system is based on a swept-source (SS) engine (1060-nm center wavelength, 100-nm full-width sweeping bandwidth, and 100-kHz repetition rate), with axial and lateral resolutions of about 4.5 and 8.5 microns respectively. The SS-OCT system incorporates a distance sensing method utilizing an envelope-based surface detection algorithm. The algorithm locates the target surface from the B-scans, taking into account not just the first or highest peak but the entire signature of sequential A-scans. Subsequently, a Kalman filter is applied as predictor to make up for system latencies, before sending the calculated position information to control a linear motor, adjusting and maintaining a fixed system-target distance. To test system performance, the motioncorrection algorithm was compared to earlier, more basic peak-based surface detection methods and to performing no motion compensation. Results demonstrate increased robustness and reproducibility, particularly noticeable in multilayered tissues, while utilizing the novel technique. Implementing such motion compensation into clinical OCT systems may thus improve the reliability of objective and quantitative information that can be extracted from OCT measurements.

SU-F-BRB-03: Quantifying Patient Motion During Deep-Inspiration Breath-Hold Using the ABC System with Simultaneous Surface Photogrammetry

Energy Technology Data Exchange (ETDEWEB)

Cheung, Y; Rahimi, A; Sawant, A [UT Southwestern Medical Center, Dallas, TX (United States)

2015-06-15

Purpose: Active breathing control (ABC) has been used to reduce treatment margin due to respiratory organ motion by enforcing temporary breath-holds. However, in practice, even if the ABC device indicates constant lung volume during breath-hold, the patient may still exhibit minor chest motion. Consequently, therapists are given a false sense of security that the patient is immobilized. This study aims at quantifying such motion during ABC breath-holds by monitoring the patient chest motion using a surface photogrammetry system, VisionRT. Methods: A female patient with breast cancer was selected to evaluate chest motion during ABC breath-holds. During the entire course of treatment, the patient’s chest surface was monitored by a surface photogrammetry system, VisionRT. Specifically, a user-defined region-of-interest (ROI) on the chest surface was selected for the system to track at a rate of ∼3Hz. The surface motion was estimated by rigid image registration between the current ROI image captured and a reference image. The translational and rotational displacements computed were saved in a log file. Results: A total of 20 fractions of radiation treatment were monitored by VisionRT. After removing noisy data, we obtained chest motion of 79 breath-hold sessions. Mean chest motion in AP direction during breath-holds is 1.31mm with 0.62mm standard deviation. Of the 79 sessions, the patient exhibited motion ranging from 0–1 mm (30 sessions), 1–2 mm (37 sessions), 2–3 mm (11 sessions) and >3 mm (1 session). Conclusion: Contrary to popular assumptions, the patient is not completely still during ABC breath-hold sessions. In this particular case studied, the patient exhibited chest motion over 2mm in 14 out of 79 breath-holds. Underestimating treatment margin for radiation therapy with ABC could reduce treatment effectiveness due to geometric miss or overdose of critical organs. The senior author receives research funding from NIH, VisionRT, Varian Medical Systems

Experimental investigation of the sloshing motion of the water free surface in the draft tube of a Francis turbine operating in synchronous condenser mode

Science.gov (United States)

Vagnoni, Elena; Favrel, Arthur; Andolfatto, Loïc; Avellan, François

2018-06-01

Hydropower units may be required to operate in condenser mode to supply reactive power. In this operating mode, the water level in the turbine or pump-turbine is decreased below the runner by closing the guide vanes and injecting pressurized air. While operating in condenser mode the machine experiences power losses due to several air-water interaction phenomena which cause air losses. One of such phenomena is the sloshing motion of the water free surface below the runner in the draft tube cone of a Francis turbine. The objective of the present work is to experimentally investigate the sloshing motion of the water free surface in the draft tube cone of a reduced scale physical model of a Francis turbine operating in condenser mode. Images acquisition and simultaneous pressure fluctuation measurements are performed and an image processing method is developed to investigate amplitude and frequency of the sloshing motion of the free surface. It is found that this motion is excited at the natural frequency of the water volume and corresponds to the azimuthal wavenumber m = 1 of a rotating gravity wave. The amplitude of the motion is perturbed by wave breaking and it decreases by increasing the densimetric Froude number. The sloshing frequency slightly increases with respect to the natural frequency of the water volume by increasing the densimetric Froude number. Moreover, it results that this resonant phenomenon is not related to the torque perturbation.

Assessing breathing motion by shape matching of lung and diaphragm surfaces

Science.gov (United States)

Urschler, Martin; Bischof, Horst

2005-04-01

Studying complex thorax breating motion is an important research topic for accurate fusion of functional and anatomical data, radiotherapy planning or reduction of breathing motion artifacts. We investigate segmented CT lung, airway and diaphragm surfaces at several different breathing states between Functional Residual and Total Lung Capacity. In general, it is hard to robustly derive corresponding shape features like curvature maxima from lung and diaphragm surfaces since diaphragm and rib cage muscles tend to deform the elastic lung tissue such that e.g. ridges might disappear. A novel registration method based on the shape context approach for shape matching is presented where we extend shape context to 3D surfaces. The shape context approach was reported as a promising method for matching 2D shapes without relying on extracted shape features. We use the point correspondences for a non-rigid thin-plate-spline registration to get deformation fields that describe the movement of lung and diaphragm. Our validation consists of experiments on phantom and real sheep thorax data sets. Phantom experiments make use of shapes that are manipulated with known transformations that simulate breathing behaviour. Real thorax data experiments use a data set showing lungs and diaphragm at 5 distinct breathing states, where we compare subsets of the data sets and qualitatively and quantitatively asses the registration performance by using manually identified corresponding landmarks.

Water droplets' internal fluidity during horizontal motion on a superhydrophobic surface with an external electric field.

Science.gov (United States)

Sakai, Munetoshi; Kono, Hiroki; Nakajima, Akira; Sakai, Hideki; Abe, Masahiko; Fujishima, Akira

2010-02-02

On a superhydrophobic surface, the internal fluidity of water droplets with different volumes (15, 30 microL) and their horizontal motion in an external electric field were evaluated using particle image velocimetry (PIV). For driving of water droplets on a superhydrophobic coating between parallel electrodes, it was important to place them at appropriate positions. Droplets moved with slipping. Small droplets showed deformation that is more remarkable. Results show that the dielectrophoretic force induced the initial droplet motion and that the surface potential gradient drove the droplets after reaching the middle point between electrodes.

Hierarchical Motion Control for a Team of Humanoid Soccer Robots

Directory of Open Access Journals (Sweden)

Seung-Joon Yi

2016-02-01

Full Text Available Robot soccer has become an effective benchmarking problem for robotics research as it requires many aspects of robotics including perception, self localization, motion planning and distributed coordination to work in uncertain and adversarial environments. Especially with humanoid robots that lack inherent stability, a capable and robust motion controller is crucial for generating walking and kicking motions without losing balance. In this paper, we describe the details of a motion controller to control a team of humanoid soccer robots, which consists of a hierarchy of controllers with different time frames and abstraction levels. A low level controller governs the real time control of each joint angle, either using target joint angles or target endpoint transforms. A mid-level controller handles bipedal locomotion and balancing of the robot. A high level controller decides the long term behavior of the robot, and finally the team level controller coordinates the behavior of a group of robots by means of asynchronous communication between the robots. The suggested motion system has been successfully used by many humanoid robot teams at the RoboCup international robot soccer competitions, which has awarded us five successful championships in a row.

Seismic velocity site characterization of 10 Arizona strong-motion recording stations by spectral analysis of surface wave dispersion

Science.gov (United States)

Kayen, Robert E.; Carkin, Brad A.; Corbett, Skye C.

2017-10-19

Vertical one-dimensional shear wave velocity (VS) profiles are presented for strong-motion sites in Arizona for a suite of stations surrounding the Palo Verde Nuclear Generating Station. The purpose of the study is to determine the detailed site velocity profile, the average velocity in the upper 30 meters of the profile (VS30), the average velocity for the entire profile (VSZ), and the National Earthquake Hazards Reduction Program (NEHRP) site classification. The VS profiles are estimated using a non-invasive continuous-sine-wave method for gathering the dispersion characteristics of surface waves. Shear wave velocity profiles were inverted from the averaged dispersion curves using three independent methods for comparison, and the root-mean-square combined coefficient of variation (COV) of the dispersion and inversion calculations are estimated for each site.

Technical Note: Kinect V2 surface filtering during gantry motion for radiotherapy applications.

Science.gov (United States)

Nazir, Souha; Rihana, Sandy; Visvikis, Dimitris; Fayad, Hadi

2018-04-01

In radiotherapy, the Kinect V2 camera, has recently received a lot of attention concerning many clinical applications including patient positioning, respiratory motion tracking, and collision detection during the radiotherapy delivery phase. However, issues associated with such applications are related to some materials and surfaces reflections generating an offset in depth measurements especially during gantry motion. This phenomenon appears in particular when the collimator surface is observed by the camera; resulting in erroneous depth measurements, not only in Kinect surfaces itself, but also as a large peak when extracting a 1D respiratory signal from these data. In this paper, we proposed filtering techniques to reduce the noise effect in the Kinect-based 1D respiratory signal, using a trend removal filter, and in associated 2D surfaces, using a temporal median filter. Filtering process was validated using a phantom, in order to simulate a patient undergoing radiotherapy treatment while having the ground truth. Our results indicate a better correlation between the reference respiratory signal and its corresponding filtered signal (Correlation coefficient of 0.76) than that of the nonfiltered signal (Correlation coefficient of 0.13). Furthermore, surface filtering results show a decrease in the mean square distance error (85%) between the reference and the measured point clouds. This work shows a significant noise compensation and surface restitution after surface filtering and therefore a potential use of the Kinect V2 camera for different radiotherapy-based applications, such as respiratory tracking and collision detection. © 2018 American Association of Physicists in Medicine.

Friction characteristics of the curved sidewall surfaces of a rotary MEMS device in oscillating motion

International Nuclear Information System (INIS)

Wu, Jie; Wang, Shao; Miao, Jianmin

2009-01-01

A MEMS device with a configuration similar to that of a micro-bearing was developed to study the friction behavior of the curved sidewall surfaces. This friction-testing device consists of two sets of actuators for normal motion and rotation, respectively. Friction measurements were performed at the curved sidewall surfaces of single-crystal silicon. Two general models were developed to determine the equivalent tangential stiffness of the bush-flexure assembly at the contact point by reducing a matrix equation to a one-dimensional formulation. With this simplification, the motions of the contacting surfaces were analyzed by using a recently developed quasi-static stick-slip model. The measurement results show that the coefficient of static friction exhibits a nonlinear dependence on the normal load. The true coefficient of static friction was determined by fitting the experimental friction curve

Influence of Head Motion on the Accuracy of 3D Reconstruction with Cone-Beam CT: Landmark Identification Errors in Maxillofacial Surface Model.

Directory of Open Access Journals (Sweden)

Kyung-Min Lee

Full Text Available The purpose of this study was to investigate the influence of head motion on the accuracy of three-dimensional (3D reconstruction with cone-beam computed tomography (CBCT scan.Fifteen dry skulls were incorporated into a motion controller which simulated four types of head motion during CBCT scan: 2 horizontal rotations (to the right/to the left and 2 vertical rotations (upward/downward. Each movement was triggered to occur at the start of the scan for 1 second by remote control. Four maxillofacial surface models with head motion and one control surface model without motion were obtained for each skull. Nine landmarks were identified on the five maxillofacial surface models for each skull, and landmark identification errors were compared between the control model and each of the models with head motion.Rendered surface models with head motion were similar to the control model in appearance; however, the landmark identification errors showed larger values in models with head motion than in the control. In particular, the Porion in the horizontal rotation models presented statistically significant differences (P < .05. Statistically significant difference in the errors between the right and left side landmark was present in the left side rotation which was opposite direction to the scanner rotation (P < .05.Patient movement during CBCT scan might cause landmark identification errors on the 3D surface model in relation to the direction of the scanner rotation. Clinicians should take this into consideration to prevent patient movement during CBCT scan, particularly horizontal movement.

Level of detail in 3D city models

NARCIS (Netherlands)

Biljecki, F.

2017-01-01

The concept of level of detail (LOD) describes the content of 3D city models and it plays an essential role during their life cycle. On one hand it comes akin to the concepts of scale in cartography and LOD in computer graphics, on the other hand it is a standalone concept that requires attention.

Evaluation of site effects on ground motions based on equivalent linear site response analysis and liquefaction potential in Chennai, south India

Science.gov (United States)

Nampally, Subhadra; Padhy, Simanchal; Trupti, S.; Prabhakar Prasad, P.; Seshunarayana, T.

2018-05-01

We study local site effects with detailed geotechnical and geophysical site characterization to evaluate the site-specific seismic hazard for the seismic microzonation of the Chennai city in South India. A Maximum Credible Earthquake (MCE) of magnitude 6.0 is considered based on the available seismotectonic and geological information of the study area. We synthesized strong ground motion records for this target event using stochastic finite-fault technique, based on a dynamic corner frequency approach, at different sites in the city, with the model parameters for the source, site, and path (attenuation) most appropriately selected for this region. We tested the influence of several model parameters on the characteristics of ground motion through simulations and found that stress drop largely influences both the amplitude and frequency of ground motion. To minimize its influence, we estimated stress drop after finite bandwidth correction, as expected from an M6 earthquake in Indian peninsula shield for accurately predicting the level of ground motion. Estimates of shear wave velocity averaged over the top 30 m of soil (V S30) are obtained from multichannel analysis of surface wave (MASW) at 210 sites at depths of 30 to 60 m below the ground surface. Using these V S30 values, along with the available geotechnical information and synthetic ground motion database obtained, equivalent linear one-dimensional site response analysis that approximates the nonlinear soil behavior within the linear analysis framework was performed using the computer program SHAKE2000. Fundamental natural frequency, Peak Ground Acceleration (PGA) at surface and rock levels, response spectrum at surface level for different damping coefficients, and amplification factors are presented at different sites of the city. Liquefaction study was done based on the V S30 and PGA values obtained. The major findings suggest show that the northeast part of the city is characterized by (i) low V S30 values

TH-CD-207A-03: A Surface Deformation Driven Respiratory Model for Organ Motion Tracking in Lung Cancer Radiotherapy

International Nuclear Information System (INIS)

Chen, H; Zhen, X; Zhou, L; Gu, X

2016-01-01

Purpose: To propose and validate a novel real-time surface-mesh-based internal organ-external surface motion and deformation tracking method for lung cancer radiotherapy. Methods: Deformation vector fields (DVFs) which characterizes the internal and external motion are obtained by registering the internal organ and tumor contours and external surface meshes to a reference phase in the 4D CT images using a recent developed local topology preserved non-rigid point matching algorithm (TOP). A composite matrix is constructed by combing the estimated internal and external DVFs. Principle component analysis (PCA) is then applied on the composite matrix to extract principal motion characteristics and finally yield the respiratory motion model parameters which correlates the internal and external motion and deformation. The accuracy of the respiratory motion model is evaluated using a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and three lung cancer cases. The center of mass (COM) difference is used to measure the tumor motion tracking accuracy, and the Dice’s coefficient (DC), percent error (PE) and Housdourf’s distance (HD) are used to measure the agreement between the predicted and ground truth tumor shape. Results: The mean COM is 0.84±0.49mm and 0.50±0.47mm for the phantom and patient data respectively. The mean DC, PE and HD are 0.93±0.01, 0.13±0.03 and 1.24±0.34 voxels for the phantom, and 0.91±0.04, 0.17±0.07 and 3.93±2.12 voxels for the three lung cancer patients, respectively. Conclusions: We have proposed and validate a real-time surface-mesh-based organ motion and deformation tracking method with an internal-external motion modeling. The preliminary results conducted on a synthetic 4D NCAT phantom and 4D CT images from three lung cancer cases show that the proposed method is reliable and accurate in tracking both the tumor motion trajectory and deformation, which can serve as a potential tool for real-time organ motion and deformation

TH-CD-207A-03: A Surface Deformation Driven Respiratory Model for Organ Motion Tracking in Lung Cancer Radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Chen, H; Zhen, X; Zhou, L [Southern Medical University, Guangzhou, Guangdong (China); Gu, X [UT Southwestern Medical Center, Dallas, TX (United States)

2016-06-15

Purpose: To propose and validate a novel real-time surface-mesh-based internal organ-external surface motion and deformation tracking method for lung cancer radiotherapy. Methods: Deformation vector fields (DVFs) which characterizes the internal and external motion are obtained by registering the internal organ and tumor contours and external surface meshes to a reference phase in the 4D CT images using a recent developed local topology preserved non-rigid point matching algorithm (TOP). A composite matrix is constructed by combing the estimated internal and external DVFs. Principle component analysis (PCA) is then applied on the composite matrix to extract principal motion characteristics and finally yield the respiratory motion model parameters which correlates the internal and external motion and deformation. The accuracy of the respiratory motion model is evaluated using a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and three lung cancer cases. The center of mass (COM) difference is used to measure the tumor motion tracking accuracy, and the Dice’s coefficient (DC), percent error (PE) and Housdourf’s distance (HD) are used to measure the agreement between the predicted and ground truth tumor shape. Results: The mean COM is 0.84±0.49mm and 0.50±0.47mm for the phantom and patient data respectively. The mean DC, PE and HD are 0.93±0.01, 0.13±0.03 and 1.24±0.34 voxels for the phantom, and 0.91±0.04, 0.17±0.07 and 3.93±2.12 voxels for the three lung cancer patients, respectively. Conclusions: We have proposed and validate a real-time surface-mesh-based organ motion and deformation tracking method with an internal-external motion modeling. The preliminary results conducted on a synthetic 4D NCAT phantom and 4D CT images from three lung cancer cases show that the proposed method is reliable and accurate in tracking both the tumor motion trajectory and deformation, which can serve as a potential tool for real-time organ motion and deformation

Instanton calculus without equations of motion: semiclassics from monodromies of a Riemann surface

Science.gov (United States)

Gulden, Tobias; Janas, Michael; Kamenev, Alex

2015-02-01

Instanton calculations in semiclassical quantum mechanics rely on integration along trajectories which solve classical equations of motion. However in systems with higher dimensionality or complexified phase space these are rarely attainable. A prime example are spin-coherent states which are used e.g. to describe single molecule magnets (SMM). We use this example to develop instanton calculus which does not rely on explicit solutions of the classical equations of motion. Energy conservation restricts the complex phase space to a Riemann surface of complex dimension one, allowing to deform integration paths according to Cauchy’s integral theorem. As a result, the semiclassical actions can be evaluated without knowing actual classical paths. Furthermore we show that in many cases such actions may be solely derived from monodromy properties of the corresponding Riemann surface and residue values at its singular points. As an example, we consider quenching of tunneling processes in SMM by an applied magnetic field.

Stream/Bounce Event Perception Reveals a Temporal Limit of Motion Correspondence Based on Surface Feature over Space and Time

Directory of Open Access Journals (Sweden)

Yousuke Kawachi

2011-06-01

Full Text Available We examined how stream/bounce event perception is affected by motion correspondence based on the surface features of moving objects passing behind an occlusion. In the stream/bounce display two identical objects moving across each other in a two-dimensional display can be perceived as either streaming through or bouncing off each other at coincidence. Here, surface features such as colour (Experiments 1 and 2 or luminance (Experiment 3 were switched between the two objects at coincidence. The moment of coincidence was invisible to observers due to an occluder. Additionally, the presentation of the moving objects was manipulated in duration after the feature switch at coincidence. The results revealed that a postcoincidence duration of approximately 200 ms was required for the visual system to stabilize judgments of stream/bounce events by determining motion correspondence between the objects across the occlusion on the basis of the surface feature. The critical duration was similar across motion speeds of objects and types of surface features. Moreover, controls (Experiments 4a–4c showed that cognitive bias based on feature (colour/luminance congruency across the occlusion could not fully account for the effects of surface features on the stream/bounce judgments. We discuss the roles of motion correspondence, visual feature processing, and attentive tracking in the stream/bounce judgments.

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Template Assembly for Detailed Urban Reconstruction

KAUST Repository

Nan, Liangliang; Wonka, Peter; Ghanem, Bernard; Jiang, Caigui

2015-01-01

Structure from Motion and Multi View Stereo, and we model a set of 3D templates of facade details. Next, we optimize the initial coarse model to enforce consistency between geometry and appearance (texture images). Then, building details are reconstructed

Disparity, motion, and color information improve gloss constancy performance.

Science.gov (United States)

Wendt, Gunnar; Faul, Franz; Ekroll, Vebjørn; Mausfeld, Rainer

2010-09-01

S. Nishida and M. Shinya (1998) found that observers have only a limited ability to recover surface-reflectance properties under changes in surface shape. Our aim in the present study was to investigate how the degree of surface-reflectance constancy depends on the availability of information that may help to infer the reflectance and shape properties of surfaces. To this end, we manipulated the availability of (i) motion-induced information (static vs. dynamic presentation), (ii) disparity information (with the levels "monocular," "surface disparity," and "surface + highlight disparity"), and (iii) color information (grayscale stimuli vs. hue differences between diffuse and specular reflections). The task of the subjects was to match the perceived lightness and glossiness between two surfaces with different spatial frequency and amplitude by manipulating the diffuse component and the exponent of the Phong lighting model in one of the surfaces. Our results indicate that all three types of information improve the constancy of glossiness matches--both in isolation and in combination. The lightness matching data only revealed an influence of motion and color information. Our results indicate, somewhat counterintuitively, that motion information has a detrimental effect on lightness constancy.

Simulation-Based Analysis of Ship Motions in Short-Crested Irregular Seas

Directory of Open Access Journals (Sweden)

Kıvanç Ali ANIL

2017-03-01

Full Text Available Demonstration of the seakeeping calculation results other than polar diagrams and Cartesian plots is important during the initial and detail design stages of naval platforms due to the necessity of numerical simulations (time series data for the design and validation of the systems on board. These time series simulations are called as “real time computer experiments”. Similar simulation algorithms for ship motions and wave elevation are also used by ship-handling simulators for realistic visualization. The goal of this paper is to create a basis for the simulation-based analysis of ship motions and wave elevation for future design and validation studies for both the naval platform itself and the systems on board. The focus of this paper is the clarification of the theoretical background of this process, i.e. all formulations required to create and validate a ship motion and wave surface simulation are given in detail. The results of this study may also be used in ship-handling simulators or helicopter landing on ship simulations.

Origins of ion irradiation-induced Ga nanoparticle motion on GaAs surfaces

International Nuclear Information System (INIS)

Kang, M.; Wu, J. H.; Chen, H. Y.; Thornton, K.; Goldman, R. S.; Sofferman, D. L.; Beskin, I.

2013-01-01

We have examined the origins of ion irradiation-induced nanoparticle (NP) motion. Focused-ion-beam irradiation of GaAs surfaces induces random walks of Ga NPs, which are biased in the direction opposite to that of ion beam scanning. Although the instantaneous NP velocities are constant, the NP drift velocities are dependent on the off-normal irradiation angle, likely due to a difference in surface non-stoichiometry induced by the irradiation angle dependence of the sputtering yield. It is hypothesized that the random walks are initiated by ion irradiation-induced thermal fluctuations, with biasing driven by anisotropic mass transport

Evaluation of interpolation methods for surface-based motion compensated tomographic reconstruction for cardiac angiographic C-arm data

International Nuclear Information System (INIS)

Müller, Kerstin; Schwemmer, Chris; Hornegger, Joachim; Zheng Yefeng; Wang Yang; Lauritsch, Günter; Rohkohl, Christopher; Maier, Andreas K.; Schultz, Carl; Fahrig, Rebecca

2013-01-01

Purpose: For interventional cardiac procedures, anatomical and functional information about the cardiac chambers is of major interest. With the technology of angiographic C-arm systems it is possible to reconstruct intraprocedural three-dimensional (3D) images from 2D rotational angiographic projection data (C-arm CT). However, 3D reconstruction of a dynamic object is a fundamental problem in C-arm CT reconstruction. The 2D projections are acquired over a scan time of several seconds, thus the projection data show different states of the heart. A standard FDK reconstruction algorithm would use all acquired data for a filtered backprojection and result in a motion-blurred image. In this approach, a motion compensated reconstruction algorithm requiring knowledge of the 3D heart motion is used. The motion is estimated from a previously presented 3D dynamic surface model. This dynamic surface model results in a sparse motion vector field (MVF) defined at control points. In order to perform a motion compensated reconstruction, a dense motion vector field is required. The dense MVF is generated by interpolation of the sparse MVF. Therefore, the influence of different motion interpolation methods on the reconstructed image quality is evaluated. Methods: Four different interpolation methods, thin-plate splines (TPS), Shepard's method, a smoothed weighting function, and a simple averaging, were evaluated. The reconstruction quality was measured on phantom data, a porcine model as well as on in vivo clinical data sets. As a quality index, the 2D overlap of the forward projected motion compensated reconstructed ventricle and the segmented 2D ventricle blood pool was quantitatively measured with the Dice similarity coefficient and the mean deviation between extracted ventricle contours. For the phantom data set, the normalized root mean square error (nRMSE) and the universal quality index (UQI) were also evaluated in 3D image space. Results: The quantitative evaluation of all

Nonlinear dynamics in the perceptual grouping of connected surfaces.

Science.gov (United States)

Hock, Howard S; Schöner, Gregor

2016-09-01

Evidence obtained using the dynamic grouping method has shown that the grouping of an object's connected surfaces has properties characteristic of a nonlinear dynamical system. When a surface's luminance changes, one of its boundaries is perceived moving across the surface. The direction of this dynamic grouping (DG) motion indicates which of two flanking surfaces has been grouped with the changing surface. A quantitative measure of overall grouping strength (affinity) for adjacent surfaces is provided by the frequency of DG motion perception in directions promoted by the grouping variables. It was found that: (1) variables affecting surface grouping for three-surface objects evolve over time, settling at stable levels within a single fixation, (2) how often DG motion is perceived when a surface's luminance is perturbed (changed) depends on the pre-perturbation affinity state of the surface grouping, (3) grouping variables promoting the same surface grouping combine cooperatively and nonlinearly (super-additively) in determining the surface grouping's affinity, (4) different DG motion directions during different trials indicate that surface grouping can be bistable, which implies that inhibitory interactions have stabilized one of two alternative surface groupings, and (5) when alternative surface groupings have identical affinity, stochastic fluctuations can break the symmetry and inhibitory interactions can then stabilize one of the surface groupings, providing affinity levels are not too high (which results in bidirectional DG motion). A surface-grouping network is proposed within which boundaries vary in salience. Low salience or suppressed boundaries instantiate surface grouping, and DG motion results from changes in boundary salience. Copyright © 2015 Elsevier Ltd. All rights reserved.

SM-ROM-GL (Strong Motion Romania Ground Level Database

Directory of Open Access Journals (Sweden)

Ioan Sorin BORCIA

2015-07-01

Full Text Available The SM-ROM-GL database includes data obtained by the processing of records performed at ground level by the Romanian seismic networks, namely INCERC, NIEP, NCSRR and ISPH-GEOTEC, during recent seismic events with moment magnitude Mw ≥ 5 and epicenters located in Romania. All the available seismic records were re-processed using the same basic software and the same procedures and options (filtering and baseline correction, in order to obtain a consistent dataset. The database stores computed parameters of seismic motions, i.e. peak values: PGA, PGV, PGD, effective peak values: EPA, EPV, EPD, control periods, spectral values of absolute acceleration, relative velocity and relative displacement, as well as of instrumental intensity (as defined bz Sandi and Borcia in 2011. The fields in the database include: coding of seismic events, stations and records, a number of associated fields (seismic event source parameters, geographical coordinates of seismic stations, links to the corresponding ground motion records, charts of the response spectra of absolute acceleration, relative velocity, relative displacement and instrumental intensity, as well as some other representative parameters of seismic motions. The conception of the SM-ROM-GL database allows for an easy maintenance; such that elementary knowledge of Microsoft Access 2000 is sufficient for its operation.

Range of motion of diabetic frozen shoulder recovers to the contralateral level

Science.gov (United States)

Vastamäki, Heidi; Ristolainen, Leena

2016-01-01

Objective To determine whether frozen shoulder heals equally well in patients with and without diabetes and whether dependency on insulin affects the outcome. Methods We retrospectively examined 178 patients with idiopathic frozen shoulder; 27 patients had diabetes. We evaluated range of motion, pain, and functional results. The mean follow-up was 9.7 years (SD, 7.1 years). Results In the presence of frozen shoulder, range of motion did not differ between patients with and without diabetes. At follow-up, range of motion in all directions of both the affected and unaffected shoulders of patients with diabetes was inferior to that of patients without diabetes. Among patients with diabetes, range of motion of the once-frozen shoulder reached the level of the unaffected shoulder. Patients with and without diabetes experienced similar pain except during exertion. The Constant–Murley score was not significantly different between the two groups, and insulin dependency did not lead to worse outcomes. Conclusion Frozen shoulder heals well in patients with diabetes. PMID:27856934

GOCI Level-2 Processing Improvements and Cloud Motion Analysis

Science.gov (United States)

Robinson, Wayne D.

2015-01-01

The Ocean Biology Processing Group has been working with the Korean Institute of Ocean Science and Technology (KIOST) to process geosynchronous ocean color data from the GOCI (Geostationary Ocean Color Instrument) aboard the COMS (Communications, Ocean and Meteorological Satellite). The level-2 processing program, l2gen has GOCI processing as an option. Improvements made to that processing are discussed here as well as a discussion about cloud motion effects.

Using motion capture to assess colonoscopy experience level

DEFF Research Database (Denmark)

Svendsen, Morten Bo Søndergaard; Preisler, Louise; Hillingsø, Jens Georg

2014-01-01

AIM: To study technical skills of colonoscopists using a Microsoft Kinect™ for motion analysis to develop a tool to guide colonoscopy education. RESULTS: Ten experienced endoscopists (gastroenterologists, n = 2; colorectal surgeons, n = 8) and 11 novices participated in the study. A Microsoft......) vs 12% for novice endoscopists (SD 9)], the level of the right hand below the sighting line (z-axis) (25 cm for experienced endoscopists vs 36 cm for novice endoscopists, P level of the left hand below the z-axis (6 cm for experienced endoscopists vs 15 cm for novice endoscopists, P...... experienced and novice endoscopists and to provide non-biased feedback. Whether it is possible to use this tool to train novices in a clinical setting requires further study....

Surface viscosity effects on the motion of self-propelling boat in a channel

Science.gov (United States)

Aliperio, M. G.; Nolan Confesor, Mark

2015-06-01

Self-propelled droplets have been conceived as simple chemical toy models to mimic motile biological samples such as bacteria. The motion of these droplets is believe to be due to the surface tension gradient in the boundary of the droplet. We performed experiments to look at the effect of varying the medium viscosity to the speed of a circular boat that was soaked in Pentanol. We found that the boats undergo oscillatory type of motion inside a channel. Moreover we found the maximum speed of the boat is independent on the viscosity of the medium. On the other a time scale describing the width of the velocity profile of the boat was found to increase with increasing viscosity.

Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

Energy Technology Data Exchange (ETDEWEB)

Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

2016-06-07

Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

Evaluation of interpolation methods for surface-based motion compensated tomographic reconstruction for cardiac angiographic C-arm data

Energy Technology Data Exchange (ETDEWEB)

Mueller, Kerstin; Schwemmer, Chris; Hornegger, Joachim [Pattern Recognition Lab, Department of Computer Science, Erlangen Graduate School in Advanced Optical Technologies (SAOT), Friedrich-Alexander-Universitaet Erlangen-Nuernberg, Erlangen 91058 (Germany); Zheng Yefeng; Wang Yang [Imaging and Computer Vision, Siemens Corporate Research, Princeton, New Jersey 08540 (United States); Lauritsch, Guenter; Rohkohl, Christopher; Maier, Andreas K. [Siemens AG, Healthcare Sector, Forchheim 91301 (Germany); Schultz, Carl [Thoraxcenter, Erasmus MC, Rotterdam 3000 (Netherlands); Fahrig, Rebecca [Department of Radiology, Stanford University, Stanford, California 94305 (United States)

2013-03-15

Purpose: For interventional cardiac procedures, anatomical and functional information about the cardiac chambers is of major interest. With the technology of angiographic C-arm systems it is possible to reconstruct intraprocedural three-dimensional (3D) images from 2D rotational angiographic projection data (C-arm CT). However, 3D reconstruction of a dynamic object is a fundamental problem in C-arm CT reconstruction. The 2D projections are acquired over a scan time of several seconds, thus the projection data show different states of the heart. A standard FDK reconstruction algorithm would use all acquired data for a filtered backprojection and result in a motion-blurred image. In this approach, a motion compensated reconstruction algorithm requiring knowledge of the 3D heart motion is used. The motion is estimated from a previously presented 3D dynamic surface model. This dynamic surface model results in a sparse motion vector field (MVF) defined at control points. In order to perform a motion compensated reconstruction, a dense motion vector field is required. The dense MVF is generated by interpolation of the sparse MVF. Therefore, the influence of different motion interpolation methods on the reconstructed image quality is evaluated. Methods: Four different interpolation methods, thin-plate splines (TPS), Shepard's method, a smoothed weighting function, and a simple averaging, were evaluated. The reconstruction quality was measured on phantom data, a porcine model as well as on in vivo clinical data sets. As a quality index, the 2D overlap of the forward projected motion compensated reconstructed ventricle and the segmented 2D ventricle blood pool was quantitatively measured with the Dice similarity coefficient and the mean deviation between extracted ventricle contours. For the phantom data set, the normalized root mean square error (nRMSE) and the universal quality index (UQI) were also evaluated in 3D image space. Results: The quantitative evaluation of

DETERMINING OPTIMAL CUBE FOR 3D-DCT BASED VIDEO COMPRESSION FOR DIFFERENT MOTION LEVELS

Directory of Open Access Journals (Sweden)

J. Augustin Jacob

2012-11-01

Full Text Available This paper proposes new three dimensional discrete cosine transform (3D-DCT based video compression algorithm that will select the optimal cube size based on the motion content of the video sequence. It is determined by finding normalized pixel difference (NPD values, and by categorizing the cubes as “low” or “high” motion cube suitable cube size of dimension either [16×16×8] or[8×8×8] is chosen instead of fixed cube algorithm. To evaluate the performance of the proposed algorithm test sequence with different motion levels are chosen. By doing rate vs. distortion analysis the level of compression that can be achieved and the quality of reconstructed video sequence are determined and compared against fixed cube size algorithm. Peak signal to noise ratio (PSNR is taken to measure the video quality. Experimental result shows that varying the cube size with reference to the motion content of video frames gives better performance in terms of compression ratio and video quality.

Irreversible particle motion in surfactant-laden interfaces due to pressure-dependent surface viscosity

Science.gov (United States)

Manikantan, Harishankar; Squires, Todd M.

2017-09-01

The surface shear viscosity of an insoluble surfactant monolayer often depends strongly on its surface pressure. Here, we show that a particle moving within a bounded monolayer breaks the kinematic reversibility of low-Reynolds-number flows. The Lorentz reciprocal theorem allows such irreversibilities to be computed without solving the full nonlinear equations, giving the leading-order contribution of surface pressure-dependent surface viscosity. In particular, we show that a disc translating or rotating near an interfacial boundary experiences a force in the direction perpendicular to that boundary. In unbounded monolayers, coupled modes of motion can also lead to non-intuitive trajectories, which we illustrate using an interfacial analogue of the Magnus effect. This perturbative approach can be extended to more complex geometries, and to two-dimensional suspensions more generally.

Estimating geocenter motion and barystatic sea-level variability from GRACE observations with explicit consideration of self-attraction and loading effects

Science.gov (United States)

Bergmann-Wolf, Inga; Dobslaw, Henryk

2016-04-01

Estimating global barystatic sea-level variations from monthly mean gravity fields delivered by the Gravity Recovery and Climate Experiment (GRACE) satellite mission requires additional information about geocenter motion. These variations are not available directly due to the mission implementation in the CM-frame and are represented by the degree-1 terms of the spherical harmonics expansion. Global degree-1 estimates can be determined with the method of Swenson et al. (2008) from ocean mass variability, the geometry of the global land-sea distribution, and GRACE data of higher degrees and orders. Consequently, a recursive relation between the derivation of ocean mass variations from GRACE data and the introduction of geocenter motion into GRACE data exists. In this contribution, we will present a recent improvement to the processing strategy described in Bergmann-Wolf et al. (2014) by introducing a non-homogeneous distribution of global ocean mass variations in the geocenter motion determination strategy, which is due to the effects of loading and self-attraction induced by mass redistributions at the surface. A comparison of different GRACE-based oceanographic products (barystatic signal for both the global oceans and individual basins; barotropic transport variations of major ocean currents) with degree-1 terms estimated with a homogeneous and non-homogeneous ocean mass representation will be discussed, and differences in noise levels in most recent GRACE solutions from GFZ (RL05a), CSR, and JPL (both RL05) and their consequences for the application of this method will be discussed. Swenson, S., D. Chambers and J. Wahr (2008), Estimating geocenter variations from a combination of GRACE and ocean model output, J. Geophys. Res., 113, B08410 Bergmann-Wolf, I., L. Zhang and H. Dobslaw (2014), Global Eustatic Sea-Level Variations for the Approximation of Geocenter Motion from GRACE, J. Geod. Sci., 4, 37-48

Three-dimensional motion tracking correlates with skill level in upper gastrointestinal endoscopy

DEFF Research Database (Denmark)

Arnold, Sif H.; Svendsen, Morten Bo Søndergaard; Konge, Lars

2015-01-01

untrained medical students) were tested using a virtual reality simulator. A motion sensor was used to collect data regarding the distance between the hands, and height and movement of the scope hand. Test characteristics between groups were explored using Kruskal-Wallis H and Man-Whitney U exact tests......Background and study aim: Feedback is an essential part of training in upper gastrointestinal endoscopy. Virtual reality simulators provide limited feedback, focusing only on visual recognition with no feedback on the procedural part of training. Motion tracking identifies patterns of movement......, and this study aimed to explore the correlation between skill level and operator movement using an objective automated tool. Methods: In this medical education study, 37 operators (12 senior doctors who performed endoscopic retrograde cholangiopancreatography, 13 doctors with varying levels of experience, and 12...

Deficient Biological Motion Perception in Schizophrenia: Results from a Motion Noise Paradigm

Directory of Open Access Journals (Sweden)

Jejoong eKim

2013-07-01

Full Text Available Background: Schizophrenia patients exhibit deficient processing of perceptual and cognitive information. However, it is not well understood how basic perceptual deficits contribute to higher level cognitive problems in this mental disorder. Perception of biological motion, a motion-based cognitive recognition task, relies on both basic visual motion processing and social cognitive processing, thus providing a useful paradigm to evaluate the potentially hierarchical relationship between these two levels of information processing. Methods: In this study, we designed a biological motion paradigm in which basic visual motion signals were manipulated systematically by incorporating different levels of motion noise. We measured the performances of schizophrenia patients (n=21 and healthy controls (n=22 in this biological motion perception task, as well as in coherent motion detection, theory of mind, and a widely used biological motion recognition task. Results: Schizophrenia patients performed the biological motion perception task with significantly lower accuracy than healthy controls when perceptual signals were moderately degraded by noise. A more substantial degradation of perceptual signals, through using additional noise, impaired biological motion perception in both groups. Performance levels on biological motion recognition, coherent motion detection and theory of mind tasks were also reduced in patients. Conclusion: The results from the motion-noise biological motion paradigm indicate that in the presence of visual motion noise, the processing of biological motion information in schizophrenia is deficient. Combined with the results of poor basic visual motion perception (coherent motion task and biological motion recognition, the association between basic motion signals and biological motion perception suggests a need to incorporate the improvement of visual motion perception in social cognitive remediation.

Wind speed and direction shears with associated vertical motion during strong surface winds

Science.gov (United States)

Alexander, M. B.; Camp, D. W.

1984-01-01

Strong surface winds recorded at the NASA 150-Meter Ground Winds Tower facility at Kennedy Space Center, Florida, are analyzed to present occurrences representative of wind shear and vertical motion known to be hazardous to the ascent and descent of conventional aircraft and the Space Shuttle. Graphical (percentage frequency distributions) and mathematical (maximum, mean, standard deviation) descriptions of wind speed and direction shears and associated updrafts and downdrafts are included as functions of six vertical layers and one horizontal distance for twenty 5-second intervals of parameters sampled simultaneously at the rate of ten per second during a period of high surface winds.

A Study of the correlation of the components of instructure motions during earthquakes

International Nuclear Information System (INIS)

Hudjian, A.H.

1984-01-01

The San Fernando earthquake of February 9, 1971 generated a large number of records in buildings throughout the Los Angeles basin. The correlation of the components of these instructure motions is studied with the expectation that an understanding of these in-situ motions could be helpful in the seismic analysis of equipment located in structures. Thirty-two buildings are selected that have all three components of motion recorded in the basement, midheight and top of the structure. The correlation coefficients of these motions, as a function of the orientation of recorder, is generated and evaluated. The effects of the structural characteristics on these motions are studied by comparing the top and midheight correlation functions with those of the basement records. Additionally, nine structures, whose design details are available in the technical literature, are selected for more detailed studies. Considering the fact that as-built structures tend to have a multitude of details that lead to non-symmetry, most of the structures studied tended towards increased correlation at the roof level. In a few cases the torsional response was accentuated due to a softening in one principal axis more than in the other as a direct result of structural damage. At midheight the correlation was reduced due to the fact that for highrise buildings the second and higher modes are significant contributors to the total structural response and tend to have a node at about this level for either of the principal axes. This midheight anomaly should not exist for the more rigid structures of nuclear power plant structures since these structures are dominated by the fundamental mode response

Swimming droplets driven by a surface wave

Science.gov (United States)

Ebata, Hiroyuki; Sano, Masaki

2015-02-01

Self-propelling motion is ubiquitous for soft active objects such as crawling cells, active filaments, and liquid droplets moving on surfaces. Deformation and energy dissipation are required for self-propulsion of both living and non-living matter. From the perspective of physics, searching for universal laws of self-propelled motions in a dissipative environment is worthwhile, regardless of the objects' details. In this article, we propose a simple experimental system that demonstrates spontaneous migration of a droplet under uniform mechanical agitation. As we vary control parameters, spontaneous symmetry breaking occurs sequentially, and cascades of bifurcations of the motion arise. Equations describing deformable particles and hydrodynamic simulations successfully describe all of the observed motions. This system should enable us to improve our understanding of spontaneous motions of self-propelled objects.

Spatial filtering precedes motion detection.

Science.gov (United States)

Morgan, M J

1992-01-23

When we perceive motion on a television or cinema screen, there must be some process that allows us to track moving objects over time: if not, the result would be a conflicting mass of motion signals in all directions. A possible mechanism, suggested by studies of motion displacement in spatially random patterns, is that low-level motion detectors have a limited spatial range, which ensures that they tend to be stimulated over time by the same object. This model predicts that the direction of displacement of random patterns cannot be detected reliably above a critical absolute displacement value (Dmax) that is independent of the size or density of elements in the display. It has been inferred that Dmax is a measure of the size of motion detectors in the visual pathway. Other studies, however, have shown that Dmax increases with element size, in which case the most likely interpretation is that Dmax depends on the probability of false matches between pattern elements following a displacement. These conflicting accounts are reconciled here by showing that Dmax is indeed determined by the spacing between the elements in the pattern, but only after fine detail has been removed by a physiological prefiltering stage: the filter required to explain the data has a similar size to the receptive field of neurons in the primate magnocellular pathway. The model explains why Dmax can be increased by removing high spatial frequencies from random patterns, and simplifies our view of early motion detection.

One-level modeling for diagnosing surface winds over complex terrain. II - Applicability to short-range forecasting

Science.gov (United States)

Alpert, P.; Getenio, B.; Zak-Rosenthal, R.

1988-01-01

The Alpert and Getenio (1988) modification of the Mass and Dempsey (1985) one-level sigma-surface model was used to study four synoptic events that included two winter cases (a Cyprus low and a Siberian high) and two summer cases. Results of statistical verification showed that the model is not only capable of diagnosing many details of surface mesoscale flow, but might also be useful for various applications which require operative short-range prediction of the diurnal changes of high-resolution surface flow over complex terrain, for example, in locating wildland fires, determining the dispersion of air pollutants, and predicting changes in wind energy or of surface wind for low-level air flights.

On quantum motion of particle in linear potential bounded by perfectly reflecting plane and parabolic surfaces

International Nuclear Information System (INIS)

Pokotilovskij, Yu.N.

1999-01-01

The motion of a particle in the linear potential bounded by an inclined plane or parabolic surfaces is considered. The quantization of energy and wave functions is obtained numerically by the separation of the variables method

Sloshing motion dynamics of a free surface in the draft tube cone of a Francis turbine operating in synchronous condenser mode

Science.gov (United States)

Vagnoni, Elena; Andolfatto, Loïc; Favrel, Arthur; Avellan, François

2016-11-01

The penetration of the electrical grid by intermittent renewable energy sources induces grid fluctuations which must be compensated in order to guarantee the stability of the grid. Hydropower plants can supply reactive power to ensure the grid stabilization by operating in condenser mode. In this operating mode, the turbine operates with the tail water depressed to let the runner spin in air to reduce the power consumption. Pressurized air is injected in the draft tube cone to maintain the water level below the runner and this induces air-water interaction phenomena which cause important power losses. Flow visualization and pressure fluctuation measurements are performed in a reduced scale physical model of a Francis turbine operating in condenser mode to investigate the dynamics of the air-water interaction in the draft tube cone which causes the sloshing motion of the free surface. An image post-processing method is developed, enabling a quantitative description of the sloshing motion. The latter depends on the Froude number. By increasing the value of the Froude number, the amplitude of the sloshing motion decreases, as well as the amplitude of the pressure fluctuations. The frequency of the sloshing motion corresponds to the first natural frequency of the water volume.

Motion-dependent levels of order in a relativistic universe.

Science.gov (United States)

Frieden, B Roy; Petri, Michael

2012-09-01

Consider a generally closed system of continuous three-space coordinates x with a differentiable amplitude function ψ(x). What is its level of order R? Define R by the property that it decreases (or stays constant) after the system is coarse grained. Then R turns out to obey R=8(-1)L(2)I,where quantity I=4∫dx[nabla]ψ(*)·[nabla]ψ is the classical Fisher information in the system and L is the longest chord that can connect two points on the system surface. In general, order R is (i) unitless, and (ii) invariant to uniform stretch or compression of the system. On this basis, the order R in the Universe was previously found to be invariant in time despite its Hubble expansion, and with value R=26.0×10(60) for flat space. By comparison, here we model the Universe as a string-based "holostar," with amplitude function ψ(x)[proportionality]1/r over radial interval r=(r(0),r(H)). Here r(0) is of order the Planck length and r(H) is the radial extension of the holostar, estimated as the known value of the Hubble radius. Curvature of space and relative motion of the observer must now be taken into account. It results that a stationary observer observes a level of order R=(8/9)(r(H)/r(0))(3/2)=0.42×10(90); while for a free-falling observer R=2(-1)(r(H)/r(0))(2)=0.85×10(120). Both order values greatly exceed the above flat-space value. Interestingly, they are purely geometric measures, depending solely upon ratio r(H)/r(0). Remarkably, the free-fall value ~10(120) of R approximates the negentropy of a universe modeled as discrete. This might mean that the Universe contains about equal amounts of continuous and discrete structure.

Level-set simulations of buoyancy-driven motion of single and multiple bubbles

International Nuclear Information System (INIS)

Balcázar, Néstor; Lehmkuhl, Oriol; Jofre, Lluís; Oliva, Assensi

2015-01-01

Highlights: • A conservative level-set method is validated and verified. • An extensive study of buoyancy-driven motion of single bubbles is performed. • The interactions of two spherical and ellipsoidal bubbles is studied. • The interaction of multiple bubbles is simulated in a vertical channel. - Abstract: This paper presents a numerical study of buoyancy-driven motion of single and multiple bubbles by means of the conservative level-set method. First, an extensive study of the hydrodynamics of single bubbles rising in a quiescent liquid is performed, including its shape, terminal velocity, drag coefficients and wake patterns. These results are validated against experimental and numerical data well established in the scientific literature. Then, a further study on the interaction of two spherical and ellipsoidal bubbles is performed for different orientation angles. Finally, the interaction of multiple bubbles is explored in a periodic vertical channel. The results show that the conservative level-set approach can be used for accurate modelling of bubble dynamics. Moreover, it is demonstrated that the present method is numerically stable for a wide range of Morton and Reynolds numbers.

Atypical biological motion kinematics are represented by complementary lower-level and top-down processes during imitation learning.

Science.gov (United States)

Hayes, Spencer J; Dutoy, Chris A; Elliott, Digby; Gowen, Emma; Bennett, Simon J

2016-01-01

Learning a novel movement requires a new set of kinematics to be represented by the sensorimotor system. This is often accomplished through imitation learning where lower-level sensorimotor processes are suggested to represent the biological motion kinematics associated with an observed movement. Top-down factors have the potential to influence this process based on the social context, attention and salience, and the goal of the movement. In order to further examine the potential interaction between lower-level and top-down processes in imitation learning, the aim of this study was to systematically control the mediating effects during an imitation of biological motion protocol. In this protocol, we used non-human agent models that displayed different novel atypical biological motion kinematics, as well as a control model that displayed constant velocity. Importantly the three models had the same movement amplitude and movement time. Also, the motion kinematics were displayed in the presence, or absence, of end-state-targets. Kinematic analyses showed atypical biological motion kinematics were imitated, and that this performance was different from the constant velocity control condition. Although the imitation of atypical biological motion kinematics was not modulated by the end-state-targets, movement time was more accurate in the absence, compared to the presence, of an end-state-target. The fact that end-state targets modulated movement time accuracy, but not biological motion kinematics, indicates imitation learning involves top-down attentional, and lower-level sensorimotor systems, which operate as complementary processes mediated by the environmental context. Copyright © 2015 Elsevier B.V. All rights reserved.

Author Details

African Journals Online (AJOL)

Author Details. Journal Home > Advanced Search > Author Details. Log in or Register to get access to full text downloads. ... An algorithm to retrieve Land Surface Temperature using Landsat-8 Dataset Abstract PDF. ISSN: 2225-8531.

Surface deposition of radon decay products with and without enhanced air motion

International Nuclear Information System (INIS)

Rudnick, S.N.; Maher, E.F.; Hinds, W.C.; First, M.W.

1983-01-01

The effectiveness of fan-induced air motion in reducing airborne activity of short-lived radon decay products was evaluated in a 78-m 3 chamber. Observed reductions were as high as 50% for RaA ( 218 Po), 79% for RaB ( 214 Pb), and 86% for RaC ( 214 Bi). Activity Measurements of these nuclides on chamber and fan surfaces, along with airborne activity, were used to calculate material balances. Greater than about 90% of deposited activity was found on chamber surfaces, although areal activity density was higher on fan surfaces. Deposition velocity and diffusional boundary thickness were also determined. When no fans were used, boundary layer thickness was estimated to be 25 times the recoil distance of a RaB atom and, with fans, about 4 times the recoil distance, suggesting that recoiling of RaB atoms probably do not play a significant role in the relationship between surface and airborne activity. The results of this study have relevance for all habitable spaces having excessive radon concentration

14 CFR 406.141 - Motions.

Science.gov (United States)

2010-01-01

... cause shown, a party must file any prehearing motion with the Federal Docket Management System and serve... for more definite statement. A respondent may file a motion requesting a more definite statement of... pleading and must submit the details that the party believes would make the allegation or response definite...

Surface motion induced by nuclear explosions beneath Pahute Mesa. Part I. Halfbreak, Greeley, Scotch, Boxcar events

International Nuclear Information System (INIS)

Perret, W.R.

1976-10-01

Results of surface motion studies conducted by Sandia Laboratories during seven underground nuclear explosions detonated beneath Pahute Mesa, Areas 19 and 20 of the Nevada Test Site, between 1966 and 1973 are reported. The report is divided into two parts of which this, Part I, includes (1) descriptions of the Pahute Mesa geological environment and of the purposes and instrumentation used in these programs (Chapter 1), and (2) description of four events, the data derived from each, and analysis of these data. These Part I events are HALFBEAK (Chapter 2), GREELEY (Chapter 3), SCOTCH (Chapter 4), and BOXCAR (Chapter 5) for all of which a nominally radial array of gage stations yielded data as a function of distance primarily, although in a few cases data were derived from stations at widely separated azimuths from the explosion. Results of the analysis indicate that average propagation velocity through the geologic column between the explosions and mesa surface was about 8800 ft/sec and that for horizontal distances greater than shot depth, refraction occurred within rhyolite flows with characteristic velocity of about 12,300 ft/sec. There is evidence which suggests possible deeper refraction at a velocity between 18,000 and 21,000 ft/sec. Only the verticle motion peaks follow a pattern amenable to regression analysis because geometrical effects influence horizontal motion amplitudes differently as horizontal distances increase. Particle velocities vary roughly as the inverse square of slant or radial range with exponent values ranging from -3.9 to -1.3. Displacements follow a similar pattern with exponents ranging from about -6 to -2. Displacement profiles at various times during the motion and displacement hodographs in the vertical-radial plane aid in understanding several local phenomena implied by individual motion records

Radiation Level Changes at RAM Package Surfaces

Energy Technology Data Exchange (ETDEWEB)

Opperman, Erich [Washington Savannah River Company; Hawk, Mark B [ORNL; Kapoor, Ashok [U.S. Department of Energy, Office of Packaging and Transportation; Natali, Ronald [R. B. Natali Consulting, Inc.

2010-01-01

This paper will explore design considerations required to meet the regulations that limit radiation level variations at external surfaces of radioactive material (RAM) packages. The radiation level requirements at package surfaces (e.g. TS-R-1 paragraphs 531 and 646) invoke not only maximum radiation levels, but also strict limits on the allowable increase in the radiation level during transport. This paper will explore the regulatory requirements by quantifying the amount of near surface movement and/or payload shifting that results in a 20% increase in the radiation level at the package surface. Typical IP-2, IP-3, Type A and Type B packaging and source geometries will be illustrated. Variations in surface radiation levels are typically the result of changes in the geometry of the surface due to an impact, puncture or crush event, or shifting and settling of radioactive contents.

Motion correction options in PET/MRI.

Science.gov (United States)

Catana, Ciprian

2015-05-01

Subject motion is unavoidable in clinical and research imaging studies. Breathing is the most important source of motion in whole-body PET and MRI studies, affecting not only thoracic organs but also those in the upper and even lower abdomen. The motion related to the pumping action of the heart is obviously relevant in high-resolution cardiac studies. These two sources of motion are periodic and predictable, at least to a first approximation, which means certain techniques can be used to control the motion (eg, by acquiring the data when the organ of interest is relatively at rest). Additionally, nonperiodic and unpredictable motion can also occur during the scan. One obvious limitation of methods relying on external devices (eg, respiratory bellows or the electrocardiogram signal to monitor the respiratory or cardiac cycle, respectively) to trigger or gate the data acquisition is that the complex motion of internal organs cannot be fully characterized. However, detailed information can be obtained using either the PET or MRI data (or both) allowing the more complete characterization of the motion field so that a motion model can be built. Such a model and the information derived from simple external devices can be used to minimize the effects of motion on the collected data. In the ideal case, all the events recorded during the PET scan would be used to generate a motion-free or corrected PET image. The detailed motion field can be used for this purpose by applying it to the PET data before, during, or after the image reconstruction. Integrating all these methods for motion control, characterization, and correction into a workflow that can be used for routine clinical studies is challenging but could potentially be extremely valuable given the improvement in image quality and reduction of motion-related image artifacts. Copyright © 2015 Elsevier Inc. All rights reserved.

Surface renewal as a significant mechanism for dust emission

Directory of Open Access Journals (Sweden)

J. Zhang

2016-12-01

Full Text Available Wind tunnel experiments of dust emissions from different soil surfaces are carried out to better understand dust emission mechanisms. The effects of surface renewal on aerodynamic entrainment and saltation bombardment are analyzed in detail. It is found that flow conditions, surface particle motions (saltation and creep, soil dust content and ground obstacles all strongly affect dust emission, causing its rate to vary over orders of magnitude. Aerodynamic entrainment is highly effective, if dust supply is unlimited, as in the first 2–3 min of our wind tunnel runs. While aerodynamic entrainment is suppressed by dust supply limits, surface renewal through the motion of surface particles appears to be an effective pathway to remove the supply limit. Surface renewal is also found to be important to the efficiency of saltation bombardment. We demonstrate that surface renewal is a significant mechanism affecting dust emission and recommend that this mechanism be included in future dust models.

Imaging by Electrochemical Scanning Tunneling Microscopy and Deconvolution Resolving More Details of Surfaces Nanomorphology

DEFF Research Database (Denmark)

Andersen, Jens Enevold Thaulov

observed in high-resolution images of metallic nanocrystallites may be effectively deconvoluted, as to resolve more details of the crystalline morphology (see figure). Images of surface-crystalline metals indicate that more than a single atomic layer is involved in mediating the tunneling current......Upon imaging, electrochemical scanning tunneling microscopy (ESTM), scanning electrochemical micro-scopy (SECM) and in situ STM resolve information on electronic structures and on surface topography. At very high resolution, imaging processing is required, as to obtain information that relates...... to crystallographic-surface structures. Within the wide range of new technologies, those images surface features, the electrochemical scanning tunneling microscope (ESTM) provides means of atomic resolution where the tip participates actively in the process of imaging. Two metallic surfaces influence ions trapped...

The ShakeOut earthquake source and ground motion simulations

Science.gov (United States)

Graves, R.W.; Houston, Douglas B.; Hudnut, K.W.

2011-01-01

The ShakeOut Scenario is premised upon the detailed description of a hypothetical Mw 7.8 earthquake on the southern San Andreas Fault and the associated simulated ground motions. The main features of the scenario, such as its endpoints, magnitude, and gross slip distribution, were defined through expert opinion and incorporated information from many previous studies. Slip at smaller length scales, rupture speed, and rise time were constrained using empirical relationships and experience gained from previous strong-motion modeling. Using this rupture description and a 3-D model of the crust, broadband ground motions were computed over a large region of Southern California. The largest simulated peak ground acceleration (PGA) and peak ground velocity (PGV) generally range from 0.5 to 1.0 g and 100 to 250 cm/s, respectively, with the waveforms exhibiting strong directivity and basin effects. Use of a slip-predictable model results in a high static stress drop event and produces ground motions somewhat higher than median level predictions from NGA ground motion prediction equations (GMPEs).

Drag reduction and thrust generation by tangential surface motion in flow past a cylinder

Science.gov (United States)

Mao, Xuerui; Pearson, Emily

2018-03-01

Sensitivity of drag to tangential surface motion is calculated in flow past a circular cylinder in both two- and three-dimensional conditions at Reynolds number Re ≤ 1000 . The magnitude of the sensitivity maximises in the region slightly upstream of the separation points where the contour lines of spanwise vorticity are normal to the cylinder surface. A control to reduce drag can be obtained by (negatively) scaling the sensitivity. The high correlation of sensitivities of controlled and uncontrolled flow indicates that the scaled sensitivity is a good approximation of the nonlinear optimal control. It is validated through direct numerical simulations that the linear range of the steady control is much higher than the unsteady control, which synchronises the vortex shedding and induces lock-in effects. The steady control injects angular momentum into the separating boundary layer, stabilises the flow and increases the base pressure significantly. At Re=100 , when the maximum tangential motion reaches 50% of the free-stream velocity, the vortex shedding, boundary-layer separation and recirculation bubbles are eliminated and 32% of the drag is reduced. When the maximum tangential motion reaches 2.5 times of the free-stream velocity, thrust is generated and the power savings ratio, defined as the ratio of the reduced drag power to the control input power, reaches 19.6. The mechanism of drag reduction is attributed to the change of the radial gradient of spanwise vorticity (partial r \\hat{ζ } ) and the subsequent accelerated pressure recovery from the uncontrolled separation points to the rear stagnation point.

Visualization of Kepler's Laws of Planetary Motion

Science.gov (United States)

Lu, Meishu; Su, Jun; Wang, Weiguo; Lu, Jianlong

2017-01-01

For this article, we use a 3D printer to print a surface similar to universal gravitation for demonstrating and investigating Kepler's laws of planetary motion describing the motion of a small ball on the surface. This novel experimental method allows Kepler's laws of planetary motion to be visualized and will contribute to improving the…

Multivariate Autoregressive Model Based Heart Motion Prediction Approach for Beating Heart Surgery

Directory of Open Access Journals (Sweden)

Fan Liang

2013-02-01

Full Text Available A robotic tool can enable a surgeon to conduct off-pump coronary artery graft bypass surgery on a beating heart. The robotic tool actively alleviates the relative motion between the point of interest (POI on the heart surface and the surgical tool and allows the surgeon to operate as if the heart were stationary. Since the beating heart's motion is relatively high-band, with nonlinear and nonstationary characteristics, it is difficult to follow. Thus, precise beating heart motion prediction is necessary for the tracking control procedure during the surgery. In the research presented here, we first observe that Electrocardiography (ECG signal contains the causal phase information on heart motion and non-stationary heart rate dynamic variations. Then, we investigate the relationship between ECG signal and beating heart motion using Granger Causality Analysis, which describes the feasibility of the improved prediction of heart motion. Next, we propose a nonlinear time-varying multivariate vector autoregressive (MVAR model based adaptive prediction method. In this model, the significant correlation between ECG and heart motion enables the improvement of the prediction of sharp changes in heart motion and the approximation of the motion with sufficient detail. Dual Kalman Filters (DKF estimate the states and parameters of the model, respectively. Last, we evaluate the proposed algorithm through comparative experiments using the two sets of collected vivo data.

MO-FG-BRA-02: A Feasibility Study of Integrating Breathing Audio Signal with Surface Surrogates for Respiratory Motion Management

Energy Technology Data Exchange (ETDEWEB)

Lei, Y; Zhu, X; Zheng, D; Li, S; Ma, R; Zhang, M; Fan, Q; Wang, X; Verma, V; Zhou, S [University of Nebraska Medical Center, Omaha, NE (United States); Tang, X [Memorial Sloan Kettering Cancer Center, West Harrison, NY (United States)

2016-06-15

Purpose: Tracking the surrogate placed on patient skin surface sometimes leads to problematic signals for certain patients, such as shallow breathers. This in turn impairs the 4D CT image quality and dosimetric accuracy. In this pilot study, we explored the feasibility of monitoring human breathing motion by integrating breathing sound signal with surface surrogates. Methods: The breathing sound signals were acquired though a microphone attached adjacently to volunteer’s nostrils, and breathing curve were analyzed using a low pass filter. Simultaneously, the Real-time Position Management™ (RPM) system from Varian were employed on a volunteer to monitor respiratory motion including both shallow and deep breath modes. The similar experiment was performed by using Calypso system, and three beacons taped on volunteer abdominal region to capture breath motion. The period of each breathing curves were calculated with autocorrelation functions. The coherence and consistency between breathing signals using different acquisition methods were examined. Results: Clear breathing patterns were revealed by the sound signal which was coherent with the signal obtained from both the RPM system and Calypso system. For shallow breathing, the periods of breathing cycle were 3.00±0.19 sec (sound) and 3.00±0.21 sec (RPM); For deep breathing, the periods were 3.49± 0.11 sec (sound) and 3.49±0.12 sec (RPM). Compared with 4.54±0.66 sec period recorded by the calypso system, the sound measured 4.64±0.54 sec. The additional signal from sound could be supplement to the surface monitoring, and provide new parameters to model the hysteresis lung motion. Conclusion: Our preliminary study shows that the breathing sound signal can provide a comparable way as the RPM system to evaluate the respiratory motion. It’s instantaneous and robust characteristics facilitate it possibly to be a either independently or as auxiliary methods to manage respiratory motion in radiotherapy.

MO-FG-BRA-02: A Feasibility Study of Integrating Breathing Audio Signal with Surface Surrogates for Respiratory Motion Management

International Nuclear Information System (INIS)

Lei, Y; Zhu, X; Zheng, D; Li, S; Ma, R; Zhang, M; Fan, Q; Wang, X; Verma, V; Zhou, S; Tang, X

2016-01-01

Purpose: Tracking the surrogate placed on patient skin surface sometimes leads to problematic signals for certain patients, such as shallow breathers. This in turn impairs the 4D CT image quality and dosimetric accuracy. In this pilot study, we explored the feasibility of monitoring human breathing motion by integrating breathing sound signal with surface surrogates. Methods: The breathing sound signals were acquired though a microphone attached adjacently to volunteer’s nostrils, and breathing curve were analyzed using a low pass filter. Simultaneously, the Real-time Position Management™ (RPM) system from Varian were employed on a volunteer to monitor respiratory motion including both shallow and deep breath modes. The similar experiment was performed by using Calypso system, and three beacons taped on volunteer abdominal region to capture breath motion. The period of each breathing curves were calculated with autocorrelation functions. The coherence and consistency between breathing signals using different acquisition methods were examined. Results: Clear breathing patterns were revealed by the sound signal which was coherent with the signal obtained from both the RPM system and Calypso system. For shallow breathing, the periods of breathing cycle were 3.00±0.19 sec (sound) and 3.00±0.21 sec (RPM); For deep breathing, the periods were 3.49± 0.11 sec (sound) and 3.49±0.12 sec (RPM). Compared with 4.54±0.66 sec period recorded by the calypso system, the sound measured 4.64±0.54 sec. The additional signal from sound could be supplement to the surface monitoring, and provide new parameters to model the hysteresis lung motion. Conclusion: Our preliminary study shows that the breathing sound signal can provide a comparable way as the RPM system to evaluate the respiratory motion. It’s instantaneous and robust characteristics facilitate it possibly to be a either independently or as auxiliary methods to manage respiratory motion in radiotherapy.

Adaptive Motion Compensation in Radiotherapy

CERN Document Server

Murphy, Martin J

2011-01-01

External-beam radiotherapy has long been challenged by the simple fact that patients can (and do) move during the delivery of radiation. Recent advances in imaging and beam delivery technologies have made the solution--adapting delivery to natural movement--a practical reality. Adaptive Motion Compensation in Radiotherapy provides the first detailed treatment of online interventional techniques for motion compensation radiotherapy. This authoritative book discusses: Each of the contributing elements of a motion-adaptive system, including target detection and tracking, beam adaptation, and pati

Mapping Hydrophobicity on the Protein Molecular Surface at Atom-Level Resolution

Science.gov (United States)

Nicolau Jr., Dan V.; Paszek, Ewa; Fulga, Florin; Nicolau, Dan V.

2014-01-01

A precise representation of the spatial distribution of hydrophobicity, hydrophilicity and charges on the molecular surface of proteins is critical for the understanding of the interaction with small molecules and larger systems. The representation of hydrophobicity is rarely done at atom-level, as this property is generally assigned to residues. A new methodology for the derivation of atomic hydrophobicity from any amino acid-based hydrophobicity scale was used to derive 8 sets of atomic hydrophobicities, one of which was used to generate the molecular surfaces for 35 proteins with convex structures, 5 of which, i.e., lysozyme, ribonuclease, hemoglobin, albumin and IgG, have been analyzed in more detail. Sets of the molecular surfaces of the model proteins have been constructed using spherical probes with increasingly large radii, from 1.4 to 20 Å, followed by the quantification of (i) the surface hydrophobicity; (ii) their respective molecular surface areas, i.e., total, hydrophilic and hydrophobic area; and (iii) their relative densities, i.e., divided by the total molecular area; or specific densities, i.e., divided by property-specific area. Compared with the amino acid-based formalism, the atom-level description reveals molecular surfaces which (i) present an approximately two times more hydrophilic areas; with (ii) less extended, but between 2 to 5 times more intense hydrophilic patches; and (iii) 3 to 20 times more extended hydrophobic areas. The hydrophobic areas are also approximately 2 times more hydrophobicity-intense. This, more pronounced “leopard skin”-like, design of the protein molecular surface has been confirmed by comparing the results for a restricted set of homologous proteins, i.e., hemoglobins diverging by only one residue (Trp37). These results suggest that the representation of hydrophobicity on the protein molecular surfaces at atom-level resolution, coupled with the probing of the molecular surface at different geometric resolutions

Airborne ultrasound surface motion camera: Application to seismocardiography

Science.gov (United States)

Shirkovskiy, P.; Laurin, A.; Jeger-Madiot, N.; Chapelle, D.; Fink, M.; Ing, R. K.

2018-05-01

The recent achievements in the accelerometer-based seismocardiography field indicate a strong potential for this technique to address a wide variety of clinical needs. Recordings from different locations on the chest can give a more comprehensive observation and interpretation of wave propagation phenomena than a single-point recording, can validate existing modeling assumptions (such as the representation of the sternum as a single solid body), and provide better identifiability for models using richer recordings. Ultimately, the goal is to advance our physiological understanding of the processes to provide useful data to promote cardiovascular health. Accelerometer-based multichannel system is a contact method and laborious for use in practice, and also even ultralight accelerometers can cause non-negligible loading effects. We propose a contactless ultrasound imaging method to measure thoracic and abdominal surface motions, demonstrating that it is adequate for typical seismocardiogram (SCG) use. The developed method extends non-contact surface-vibrometry to fast 2D mapping by originally combining multi-element airborne ultrasound arrays, a synthetic aperture implementation, and pulsed-waves. Experimental results show the ability of the developed method to obtain 2D seismocardiographic maps of the body surface 30 × 40 cm2 in dimension, with a temporal sampling rate of several hundred Hz, using ultrasound waves with the central frequency of 40 kHz. Our implementation was validated in-vivo on eight healthy human participants. The shape and position of the zone of maximal absolute acceleration and velocity during the cardiac cycle were also observed. This technology could potentially be used to obtain more complete cardio-vascular information than single-source SCG in and out of clinical environments, due to enhanced identifiability provided by the distributed measurements, and observation of propagation phenomena.

The Importance of Lower Mantle Structure to Plate Stresses and Plate Motions

Science.gov (United States)

Holt, W. E.; Wang, X.; Ghosh, A.

2016-12-01

Plate motions and plate stresses are widely assumed as the surface expression of mantle convection. The generation of plate tectonics from mantle convection has been studied for many years. Lithospheric thickening (or ridge push) and slab pull forces are commonly accepted as the major driving forces for the plate motions. However, the importance of the lower mantle to plate stresses and plate motions remains less clear. Here, we use the joint modeling of lithosphere and mantle dynamics approach of Wang et al. (2015) to compute the tractions originating from deeper mantle convection and follow the method of Ghosh et al. (2013) to calculate gravitational potential energy per unit area (GPE) based on Crust 1.0 (Laske et al., 2013). Absolute values of deviatoric stresses are determined by the body force distributions (GPE gradients and traction magnitudes applied at the base of the lithosphere). We use the same relative viscosity model that Ghosh et al. (2013) used, and we solve for one single adjustable scaling factor that multiplies the entire relative viscosity field to provide absolute values of viscosity throughout the lithosphere. This distribution of absolute values of lithosphere viscosities defines the magnitudes of surface motions. In this procedure, the dynamic model first satisfies the internal constraint of no-net-rotation of motions. The model viscosity field is then scaled by the single factor until we achieve a root mean square (RMS) minimum between computed surface motions and the kinematic no-net-rotation (NNR) model of Kreemer et al. (2006). We compute plate stresses and plate motions from recently published global tomography models (over 70 based on Wang et al., 2015). We find that RMS misfits are significantly reduced when details of lower mantle structure from the latest tomography models are added to models that contain only upper and mid-mantle density distributions. One of the key reasons is that active upwelling from the Large Low Shear

The perception of object versus objectless motion.

Science.gov (United States)

Hock, Howard S; Nichols, David F

2013-05-01

Wertheimer, M. (Zeitschrift für Psychologie und Physiologie der Sinnesorgane, 61:161-265, 1912) classical distinction between beta (object) and phi (objectless) motion is elaborated here in a series of experiments concerning competition between two qualitatively different motion percepts, induced by sequential changes in luminance for two-dimensional geometric objects composed of rectangular surfaces. One of these percepts is of spreading-luminance motion that continuously sweeps across the entire object; it exhibits shape invariance and is perceived most strongly for fast speeds. Significantly for the characterization of phi as objectless motion, the spreading luminance does not involve surface boundaries or any other feature; the percept is driven solely by spatiotemporal changes in luminance. Alternatively, and for relatively slow speeds, a discrete series of edge motions can be perceived in the direction opposite to spreading-luminance motion. Akin to beta motion, the edges appear to move through intermediate positions within the object's changing surfaces. Significantly for the characterization of beta as object motion, edge motion exhibits shape dependence and is based on the detection of oppositely signed changes in contrast (i.e., counterchange) for features essential to the determination of an object's shape, the boundaries separating its surfaces. These results are consistent with area MT neurons that differ with respect to speed preference Newsome et al (Journal of Neurophysiology, 55:1340-1351, 1986) and shape dependence Zeki (Journal of Physiology, 236:549-573, 1974).

Estimating network effect in geocenter motion: Theory

Science.gov (United States)

Zannat, Umma Jamila; Tregoning, Paul

2017-10-01

Geophysical models and their interpretations of several processes of interest, such as sea level rise, postseismic relaxation, and glacial isostatic adjustment, are intertwined with the need to realize the International Terrestrial Reference Frame. However, this realization needs to take into account the geocenter motion, that is, the motion of the center of figure of the Earth surface, due to, for example, deformation of the surface by earthquakes or hydrological loading effects. Usually, there is also a discrepancy, known as the network effect, between the theoretically convenient center of figure and the physically accessible center of network frames, because of unavoidable factors such as uneven station distribution, lack of stations in the oceans, disparity in the coverage between the two hemispheres, and the existence of tectonically deforming zones. Here we develop a method to estimate the magnitude of the network effect, that is, the error introduced by the incomplete sampling of the Earth surface, in measuring the geocenter motion, for a network of space geodetic stations of a fixed size N. For this purpose, we use, as our proposed estimate, the standard deviations of the changes in Helmert parameters measured by a random network of the same size N. We show that our estimate scales as 1/√N and give an explicit formula for it in terms of the vector spherical harmonics expansion of the displacement field. In a complementary paper we apply this formalism to coseismic displacements and elastic deformations due to surface water movements.

Student Teachers' Levels of Understanding and Model of Understanding about Newton's Laws of Motion

Science.gov (United States)

Saglam-Arslan, Aysegul; Devecioglu, Yasemin

2010-01-01

This study was conducted to determine the level of student teachers' understandings of Newton's laws of motion and relating these levels to identify student teachers' models of understanding. An achievement test composed of two parts comprising 12 open ended questions was constructed and given to 45 pre-service classroom teachers. The first part…

Brownian motion using video capture

International Nuclear Information System (INIS)

Salmon, Reese; Robbins, Candace; Forinash, Kyle

2002-01-01

Although other researchers had previously observed the random motion of pollen grains suspended in water through a microscope, Robert Brown's name is associated with this behaviour based on observations he made in 1828. It was not until Einstein's work in the early 1900s however, that the origin of this irregular motion was established to be the result of collisions with molecules which were so small as to be invisible in a light microscope (Einstein A 1965 Investigations on the Theory of the Brownian Movement ed R Furth (New York: Dover) (transl. Cowper A D) (5 papers)). Jean Perrin in 1908 (Perrin J 1923 Atoms (New York: Van Nostrand-Reinhold) (transl. Hammick D)) was able, through a series of painstaking experiments, to establish the validity of Einstein's equation. We describe here the details of a junior level undergraduate physics laboratory experiment where students used a microscope, a video camera and video capture software to verify Einstein's famous calculation of 1905. (author)

Use of the discriminant Fourier-derived cepstrum with feature-level post-processing for surface electromyographic signal classification

International Nuclear Information System (INIS)

Chen, Xinpu; Zhu, Xiangyang; Zhang, Dingguo

2009-01-01

Myoelectrical pattern classification is a crucial part in multi-functional prosthesis control. This paper investigates a discriminant Fourier-derived cepstrum (DFC) and feature-level post-processing (FLPP) to discriminate hand and wrist motions using the surface electromyographic signal. The Fourier-derived cepstrum takes advantage of the Fourier magnitude or sub-band power energy of signals directly and provides flexible use of spectral information changing with different motions. Appropriate cepstral coefficients are selected by a proposed separability criterion to construct DFC features. For the post-processing, FLPP which combines features from several analysis windows is used to improve the feature performance further. In this work, two classifiers (a linear discriminant classifier and quadratic discriminant classifier) without hyper-parameter optimization are employed to simplify the training procedure and avoid the possible bias of feature evaluation. Experimental results of the 11-motion problem show that the proposed DFC feature outperforms traditional features such as time-domain statistics and autoregressive-derived cepstrum in terms of the classification accuracy, and it is a promising method for the multi-functionality and high-accuracy control of myoelectric prostheses

MotionExplorer: exploratory search in human motion capture data based on hierarchical aggregation.

Science.gov (United States)

Bernard, Jürgen; Wilhelm, Nils; Krüger, Björn; May, Thorsten; Schreck, Tobias; Kohlhammer, Jörn

2013-12-01

We present MotionExplorer, an exploratory search and analysis system for sequences of human motion in large motion capture data collections. This special type of multivariate time series data is relevant in many research fields including medicine, sports and animation. Key tasks in working with motion data include analysis of motion states and transitions, and synthesis of motion vectors by interpolation and combination. In the practice of research and application of human motion data, challenges exist in providing visual summaries and drill-down functionality for handling large motion data collections. We find that this domain can benefit from appropriate visual retrieval and analysis support to handle these tasks in presence of large motion data. To address this need, we developed MotionExplorer together with domain experts as an exploratory search system based on interactive aggregation and visualization of motion states as a basis for data navigation, exploration, and search. Based on an overview-first type visualization, users are able to search for interesting sub-sequences of motion based on a query-by-example metaphor, and explore search results by details on demand. We developed MotionExplorer in close collaboration with the targeted users who are researchers working on human motion synthesis and analysis, including a summative field study. Additionally, we conducted a laboratory design study to substantially improve MotionExplorer towards an intuitive, usable and robust design. MotionExplorer enables the search in human motion capture data with only a few mouse clicks. The researchers unanimously confirm that the system can efficiently support their work.

Tip Induced Motion of Adatoms on Metal Surfaces

International Nuclear Information System (INIS)

Kuerpick, U.; Rahman, T.S.

1999-01-01

From total energy calculations we show that for certain tip-adatom separations the activation barrier for the adatom to move towards the tip disappears and the adatom experiences an attractive force in the direction of the tip. For a Cu adatom at a (100) microfaceted step on Cu(111) this happens at a lateral separation of about one lattice constant, in agreement with recent experimental findings. Simultaneously, the activation barrier in the direction away from the tip increases significantly. The details of the changes in the potential energy surface induced by the tip are found to depend on the characteristics of the tip apex and its height above the adatom. copyright 1999 The American Physical Society

Surface-to-surface registration using level sets

DEFF Research Database (Denmark)

Hansen, Mads Fogtmann; Erbou, Søren G.; Vester-Christensen, Martin

2007-01-01

This paper presents a general approach for surface-to-surface registration (S2SR) with the Euclidean metric using signed distance maps. In addition, the method is symmetric such that the registration of a shape A to a shape B is identical to the registration of the shape B to the shape A. The S2SR...... problem can be approximated by the image registration (IR) problem of the signed distance maps (SDMs) of the surfaces confined to some narrow band. By shrinking the narrow bands around the zero level sets the solution to the IR problem converges towards the S2SR problem. It is our hypothesis...... that this approach is more robust and less prone to fall into local minima than ordinary surface-to-surface registration. The IR problem is solved using the inverse compositional algorithm. In this paper, a set of 40 pelvic bones of Duroc pigs are registered to each other w.r.t. the Euclidean transformation...

MotionFlow: Visual Abstraction and Aggregation of Sequential Patterns in Human Motion Tracking Data.

Science.gov (United States)

Jang, Sujin; Elmqvist, Niklas; Ramani, Karthik

2016-01-01

Pattern analysis of human motions, which is useful in many research areas, requires understanding and comparison of different styles of motion patterns. However, working with human motion tracking data to support such analysis poses great challenges. In this paper, we propose MotionFlow, a visual analytics system that provides an effective overview of various motion patterns based on an interactive flow visualization. This visualization formulates a motion sequence as transitions between static poses, and aggregates these sequences into a tree diagram to construct a set of motion patterns. The system also allows the users to directly reflect the context of data and their perception of pose similarities in generating representative pose states. We provide local and global controls over the partition-based clustering process. To support the users in organizing unstructured motion data into pattern groups, we designed a set of interactions that enables searching for similar motion sequences from the data, detailed exploration of data subsets, and creating and modifying the group of motion patterns. To evaluate the usability of MotionFlow, we conducted a user study with six researchers with expertise in gesture-based interaction design. They used MotionFlow to explore and organize unstructured motion tracking data. Results show that the researchers were able to easily learn how to use MotionFlow, and the system effectively supported their pattern analysis activities, including leveraging their perception and domain knowledge.

Ground motions from the 2015 Mw 7.8 Gorkha, Nepal, earthquake constrained by a detailed assessment of macroseismic data

Science.gov (United States)

Martin, Stacey; Hough, Susan E.; Hung, Charleen

2015-01-01

To augment limited instrumental recordings of the Mw 7.8 Gorkha, Nepal, earthquake on 25 April 2015 (Nepali calendar: 12 Baisakh 2072, Bikram Samvat), we collected 3831 detailed media and first-person accounts of macroseismic effects that include sufficiently detailed information to assign intensities. The resulting intensity map reveals the distribution of shaking within and outside of Nepal, with the key result that shaking intensities throughout the near-field region only exceeded intensity 8 on the 1998 European Macroseismic Scale (EMS-98) in rare instances. Within the Kathmandu Valley, intensities were generally 6–7 EMS. This surprising (and fortunate) result can be explained by the nature of the mainshock ground motions, which were dominated by energy at periods significantly longer than the resonant periods of vernacular structures throughout the Kathmandu Valley. Outside of the Kathmandu Valley, intensities were also generally lower than 8 EMS, but the earthquake took a heavy toll on a number of remote villages, where many especially vulnerable masonry houses collapsed catastrophically in 7–8 EMS shaking. We further reconsider intensities from the 1833 earthquake sequence and conclude that it occurred on the same fault segment as the Gorkha earthquake.

Surface deposition of 222Rn decay products with and without enhanced air motion

International Nuclear Information System (INIS)

Rudnick, S.N.; Maher, E.F.

1986-01-01

The effectiveness of fan-induced air motion in reducing airborne activities of short-lived 222 Rn decay products was evaluated in a 78.5-m3 chamber. Observed reductions were as high as 50% for 218Po (RaA), 79% for 214 Pb (RaB), and 86% for 214 Bi (RaC). Activity measurements of these nuclides on chamber and fan surfaces, along with airborne activities, were used to calculate material balances. Greater than about 90% of deposited activity was found on chamber surfaces, although areal activity densities were higher on fan surfaces. Deposition velocities for decay products not attached to particles were 2.3 mm s-1 when no fans were in operation and 9.2 to 13 mm s-1 when fans were used. Mean boundary layer thicknesses for unattached decay products were estimated to be about four times the recoil distance of a 214 Pb atom when no fans were used and about equal to the recoil distance when fans were used

Visualization of a Lifeboat Motion During Lowering Along Ship’s Side

Directory of Open Access Journals (Sweden)

Kniat Aleksander

2017-12-01

Full Text Available This paper presents description of a computer program for motion visualization of a lifeboat lowered along ship’s side. The program is a post-processor which reads results of numerical calculations of simulated objects’ motions. The data is used to create scene composed of 3D surfaces to visualize mutual spatial positions of a lifeboat, ship’s side and water waving surface. Since the numerical data contain description of a simulation as a function of time it is possible to screen a static scene showing the simulated objects in an arbitrary instance of time. The program can also reproduce a sequence of scenes in the form of animation and control its speed. The static mode allows to view an arbitrary crosssection of the scene, rotate and enlarge specific details and make the image more realistic by hiding invisible lines or shading. The application of the program is aimed at making it possible to assess and analyze numerical calculation results in advance of their experimental verification.

The estimation of geometry and motion of a surface from image sequences by means of linearisation of a paramatric model

NARCIS (Netherlands)

Korsten, Maarten J.; Houkes, Z.

1990-01-01

A method is given to estimate the geometry and motion of a moving body surface from image sequences. To this aim a parametric model of the surface is used, in order to reformulate the problem to one of parameter estimation. After linearization of the model standard linear estimation methods can be

Dynamics of entanglement of a three-level atom in motion interacting with two coupled modes including parametric down conversion

Science.gov (United States)

Faghihi, M. J.; Tavassoly, M. K.; Hatami, M.

In this paper, a model by which we study the interaction between a motional three-level atom and two-mode field injected simultaneously in a bichromatic cavity is considered; the three-level atom is assumed to be in a Λ-type configuration. As a result, the atom-field and the field-field interaction (parametric down conversion) will be appeared. It is shown that, by applying a canonical transformation, the introduced model can be reduced to a well-known form of the generalized Jaynes-Cummings model. Under particular initial conditions, which may be prepared for the atom and the field, the time evolution of state vector of the entire system is analytically evaluated. Then, the dynamics of atom by considering ‘atomic population inversion’ and two different measures of entanglement, i.e., ‘von Neumann entropy’ and ‘idempotency defect’ is discussed, in detail. It is deduced from the numerical results that, the duration and the maximum amount of the considered physical quantities can be suitably tuned by selecting the proper field-mode structure parameter p and the detuning parameters.

Exceptionally crystalline and conducting acid doped polyaniline films by level surface assisted solution casting approach

Energy Technology Data Exchange (ETDEWEB)

Puthirath, Anand B.; Varma, Sreekanth J.; Jayalekshmi, S., E-mail: jayalekshmi@cusat.ac.in [Division for Research in Advanced Materials, Department of Physics, Cochin University of Science and Technology, Cochin, Kerala 682022 (India); Methattel Raman, Shijeesh [Nanophotonic and Optoelectronic Devices Laboratory, Department of Physics, Cochin University of Science and Technology, Cochin, Kerala 682022 (India)

2016-04-18

Emeraldine salt form of polyaniline (PANI) was synthesized by chemical oxidative polymerisation method using ammonium persulfate as oxidant. Resultant emeraldine salt form of PANI was dedoped using ammonia solution and then re-doped with camphor sulphonic acid (CSA), naphthaline sulphonic acid (NSA), hydrochloric acid (HCl), and m-cresol. Thin films of these doped PANI samples were deposited on glass substrates using solution casting method with m-cresol as solvent. A level surface was employed to get homogeneous thin films of uniform thickness. Detailed X-ray diffraction studies have shown that the films are exceptionally crystalline. The crystalline peaks observed in the XRD spectra can be indexed to simple monoclinic structure. FTIR and Raman spectroscopy studies provide convincing explanation for the exceptional crystallinity observed in these polymer films. FESEM and AFM images give better details of surface morphology of doped PANI films. The DC electrical conductivity of the samples was measured using four point probe technique. It is seen that the samples also exhibit quite high DC electrical conductivity, about 287 S/cm for CSA doped PANI, 67 S/cm for NSA doped PANI 65 S/cm for HCl doped PANI, and just below 1 S/cm for m-cresol doped PANI. Effect of using the level surface for solution casting is studied and correlated with the observed crystallinity.

Impaired global, and compensatory local, biological motion processing in people with high levels of autistic traits.

Science.gov (United States)

van Boxtel, Jeroen J A; Lu, Hongjing

2013-01-01

People with Autism Spectrum Disorder (ASD) are hypothesized to have poor high-level processing but superior low-level processing, causing impaired social recognition, and a focus on non-social stimulus contingencies. Biological motion perception provides an ideal domain to investigate exactly how ASD modulates the interaction between low and high-level processing, because it involves multiple processing stages, and carries many important social cues. We investigated individual differences among typically developing observers in biological motion processing, and whether such individual differences associate with the number of autistic traits. In Experiment 1, we found that individuals with fewer autistic traits were automatically and involuntarily attracted to global biological motion information, whereas individuals with more autistic traits did not show this pre-attentional distraction. We employed an action adaptation paradigm in the second study to show that individuals with more autistic traits were able to compensate for deficits in global processing with an increased involvement in local processing. Our findings can be interpreted within a predictive coding framework, which characterizes the functional relationship between local and global processing stages, and explains how these stages contribute to the perceptual difficulties associated with ASD.

Impaired global, and compensatory local, biological motion processing in people with high levels of autistic traits

Directory of Open Access Journals (Sweden)

Jeroen J A Van Boxtel

2013-04-01

Full Text Available People with Autism Spectrum Disorder (ASD are hypothesized to have poor high-level processing but superior low-level processing, causing impaired social recognition, and a focus on non-social stimulus contingencies. Biological motion perception provides an ideal domain to investigate exactly how ASD modulates the interaction between low and high-level processing, because it involves multiple processing stages, and carries many important social cues. We investigated individual differences among typically developing observers in biological motion processing, and whether such individual differences associate with the number of autistic traits. In Experiment 1, we found that individuals with fewer autistic traits were automatically and involuntarily attracted to global biological motion information, whereas individuals with more autistic traits did not show this pre-attentional distraction. We employed an action adaptation paradigm in the second study to show that individuals with more autistic traits were able to compensate for deficits in global processing with an increased involvement in local processing. Our findings can be interpreted within a predictive coding framework, which characterizes the functional relationship between local and global processing stages, and explains how these stages contribute to the perceptual difficulties associated with ASD.

Contribution of vertical land motions to coastal sea level variations: a global synthesis of multisatellite altimetry, tide gauge and GPS measurements

Science.gov (United States)

Pfeffer, Julia; Allemand, Pascal

2016-04-01

Coastal sea level variations result from a complex mix of climatic, oceanic and geodynamical processes driven by natural and anthropogenic constraints. Combining data from multiple sources is one solution to identify particular processes and progress towards a better understanding of the sea level variations and the assessment of their impacts at coast. Here, we present a global database merging multisatellite altimetry with tide gauges and Global Positioning System (GPS) measurements. Vertical land motions and sea level variations are estimated simultaneously for a network of 886 ground stations with median errors lower than 1 mm/yr. The contribution of vertical land motions to relative sea level variations is explored to better understand the natural hazards associated with sea level rise in coastal areas. Worldwide, vertical land motions dominate 30 % of observed coastal trends. The role of the crust is highly heterogeneous: it can amplify, restrict or counter the effects of climate-induced sea level change. A set of 182 potential vulnerable localities are identified by large coastal subsidence which increases by several times the effects of sea level rise. Though regional behaviours exist, principally caused by GIA (Glacial Isostatic Adjustment), the local variability in vertical land motion prevails. An accurate determination of the vertical motions observed at the coast is fundamental to understand the local processes which contribute to sea level rise, to appraise its impacts on coastal populations and make future predictions.

Nonlinearity, Viscosity and Air-Compressibility Effects on the Helmholtz Resonant Wave Motion Generated by an Oscillating Twin Body in a Free Surface

Science.gov (United States)

Ananthakrishnan, Palaniswamy

2012-11-01

The problem is of practical relevance in determining the motion response of multi-hull and air-cushion vehicles in high seas and in littoral waters. The linear inviscid problem without surface pressure has been well studied in the past. In the present work, the nonlinear wave-body interaction problem is solved using finite-difference methods based on boundary-fitted coordinates. The inviscid nonlinear problem is tackled using the mixed Eulerian-Lagrangian formulation and the solution of the incompressible Navier-Stokes equations governing the viscous problem using a fractional-step method. The pressure variation in the air cushion is modeled using the isentropic gas equation pVγ = Constant. Results show that viscosity and free-surface nonlinearity significantly affect the hydrodynamic force and the wave motion at the resonant Helmholtz frequency (at which the primary wave motion is the vertical oscillation of the mean surface in between the bodies). Air compressibility suppresses the Helmholtz oscillation and enhances the wave radiation. Work supported by the ONR under the grant N00014-98-1-0151.

Three scales of motions associated with tornadoes

International Nuclear Information System (INIS)

Forbes, G.S.

1978-03-01

This dissertation explores three scales of motion commonly associated with tornadoes, and the interaction of these scales: the tornado cyclone, the tornado, and the suction vortex. The goal of the research is to specify in detail the character and interaction of these scales of motion to explain tornadic phenomena

Experiments on bubble dynamics between a free surface and a rigid wall

Science.gov (United States)

Zhang, A. M.; Cui, P.; Wang, Y.

2013-10-01

Experiments were conducted where the underwater bubble oscillates between two boundaries, a free surface and a horizontal rigid wall. The motion features of both the bubble and the free surface were investigated, via the consideration of two key factors, i.e., the non-dimensional distances from the bubble to the two boundaries. To support the investigation, experiments were conducted in the first place where the bubble oscillates near only one of the two boundaries. Then the other boundary was inserted at different positions to observe the changes in the motion features, including the types, maximum speed and height of the water spike and skirt, the form and speed of the jets, and bubble shapes. Correspondence is found between the motion features of the free surface and different stages of bubble oscillation. Intriguing details such as gas torus around the jet, double jets, bubble entrapment, and microjet of the water spike, etc., are observed.

Motion behavior of water droplets driven by triboelectric nanogenerator

Science.gov (United States)

Nie, Jinhui; Jiang, Tao; Shao, Jiajia; Ren, Zewei; Bai, Yu; Iwamoto, Mitsumasa; Chen, Xiangyu; Wang, Zhong Lin

2018-04-01

By integrating a triboelectric nanogenerator (TENG) and a simple circuit board, the motion of water droplets can be controlled by the output of the TENG, which demonstrates a self-powered microfluidic system toward various practical applications in the fields of microfluidic system and soft robotics. This paper describes a method to construct a physical model for this self-powered system on the basis of electrostatic induction theory. The model can precisely simulate the detailed motion behavior of the droplet under driving of TENG, and it can also reveal the influences of surface hydrophobicity on the motion of the droplet, which can help us to better understand the key parameters that decide the performance of the system. The experimental observation of the dynamic performance of the droplet has also been done with a high speed camera system. A comparison between simulation results and real measurements confirms that the proposed model can predict the velocity and position of the water droplet driven by high voltage source as well as TENG. Hence, the proposed model in this work could serve as a guidance for optimizing the self-powered systems in future studies.

Ground Motion Relations While TBM Drilling in Unconsolidated Sediments

Science.gov (United States)

Grund, Michael; Ritter, Joachim R. R.; Gehrig, Manuel

2016-05-01

The induced ground motions due to the tunnel boring machine (TBM), which has been used for the drilling of the urban metro tunnel in Karlsruhe (SW Germany), has been studied using the continuous recordings of seven seismological monitoring stations. The drilling has been undertaken in unconsolidated sediments of the Rhine River system, relatively close to the surface at 6-20 m depth and in the vicinity of many historic buildings. Compared to the reference values of DIN 4150-3 (1-80 Hz), no exceedance of the recommended peak ground velocity (PGV) limits (3-5 mm/s) was observed at the single recording site locations on building basements during the observation period between October 2014 and February 2015. Detailed analyses in the time and frequency domains helped with the detection of the sources of several specific shaking signals in the recorded time series and with the comparison of the aforementioned TBM-induced signals. The amplitude analysis allowed for the determination of a PGV attenuation relation (quality factor Q ~ 30-50) and the comparison of the TBM-induced ground motion with other artificially induced and natural ground motions of similar amplitudes.

Motion camera based on a custom vision sensor and an FPGA architecture

Science.gov (United States)

Arias-Estrada, Miguel

1998-09-01

A digital camera for custom focal plane arrays was developed. The camera allows the test and development of analog or mixed-mode arrays for focal plane processing. The camera is used with a custom sensor for motion detection to implement a motion computation system. The custom focal plane sensor detects moving edges at the pixel level using analog VLSI techniques. The sensor communicates motion events using the event-address protocol associated to a temporal reference. In a second stage, a coprocessing architecture based on a field programmable gate array (FPGA) computes the time-of-travel between adjacent pixels. The FPGA allows rapid prototyping and flexible architecture development. Furthermore, the FPGA interfaces the sensor to a compact PC computer which is used for high level control and data communication to the local network. The camera could be used in applications such as self-guided vehicles, mobile robotics and smart surveillance systems. The programmability of the FPGA allows the exploration of further signal processing like spatial edge detection or image segmentation tasks. The article details the motion algorithm, the sensor architecture, the use of the event- address protocol for velocity vector computation and the FPGA architecture used in the motion camera system.

Measurement of shoulder motion fraction and motion ratio

International Nuclear Information System (INIS)

Kang, Yeong Han

2006-01-01

This study was to understand about the measurement of shoulder motion fraction and motion ratio. We proposed the radiological criterior of glenohumeral and scapulothoracic movement ratio. We measured the motion fraction of the glenohumeral and scapulothoracic movement using CR (computed radiological system) of arm elevation at neutral, 90 degree, full elevation. Central ray was 15 .deg., 19 .deg., 22 .deg. to the cephald for the parallel scapular spine, and the tilting of torso was external oblique 40 .deg., 36 .deg., 22 .deg. for perpendicular to glenohumeral surface. Healthful donor of 100 was divided 5 groups by age (20, 30, 40, 50, 60). The angle of glenohumeral motion and scapulothoracic motion could be taken from gross arm angle and radiological arm angle. We acquired 3 images at neutral, 90 .deg. and full elevation position and measured radiographic angle of glenoheumeral, scapulothoracic movement respectively. While the arm elevation was 90 .deg., the shoulder motion fraction was 1.22 (M), 1.70 (W) in right arm and 1.31, 1.54 in left. In full elevation, Right arm fraction was 1.63, 1.84 and left was 1.57, 1.32. In right dominant arm (78%), 90 .deg. and Full motion fraction was 1.58, 1.43, in left (22%) 1.82, 1.94. In generation 20, 90 .deg. and Full motion fraction was 1.56, 1.52, 30' was 1.82, 1.43, 40' was 1.23, 1.16, 50' was 1.80, 1.28,60' was 1.24, 1.75. There was not significantly by gender, dominant arm and age. The criteria of motion fraction was useful reference for clinical diagnosis the shoulder instability

Level 2 and level 2.5 large deviation functionals for systems with and without detailed balance

International Nuclear Information System (INIS)

Hoppenau, J; Nickelsen, D; Engel, A

2016-01-01

Large deviation functions are an essential tool in the statistics of rare events. Often they can be obtained by contraction from a so-called level 2 or level 2.5 large deviation functional characterizing the empirical density and current of the underlying stochastic process. For Langevin systems obeying detailed balance, the explicit form of the level 2 functional has been known ever since the mathematical work of Donsker and Varadhan. We rederive the Donsker–Varadhan result using stochastic path-integrals. We than generalize the derivation to level 2.5 large deviation functionals for non-equilibrium steady states and elucidate the relation between the large deviation functionals and different notions of entropy production in stochastic thermodynamics. Finally, we discuss some aspects of the contractions to level 1 large deviation functions and illustrate our findings with examples. (paper)

A wearable 3D motion sensing system integrated with a Bluetooth smart phone application: A system level overview

KAUST Repository

Karimi, Muhammad Akram

2018-01-02

An era of ubiquitous motion sensing has just begun. All electronic gadgets ranging from game consoles to mobile phones have some sort of motion sensors in them. In contrast to rigid motion sensing systems, this paper presents a system level description of a wearable 3D motion sensor. The sensing mechanism is based upon well-established magnetic and inertial measurement unit (MIMU), which integrates accelerometer, gyroscope and magnetometer data. Two sensor boards have been integrated within a wearable arm sleeve to capture 3D orientation of the human arm. The sensors have been interfaced with a Bluetooth transceiver chip, which transmits data to a mobile phone app using standard Bluetooth protocol. An android mobile phone app has been developed to display the human arm motion in real time.

TU-EF-304-04: A Heart Motion Model for Proton Scanned Beam Chest Radiotherapy

International Nuclear Information System (INIS)

White, B; Kiely, J Blanco; Lin, L; Freedman, G; Both, S; Vennarini, S; Santhanam, A; Low, D

2015-01-01

Purpose: To model fast-moving heart surface motion as a function of cardiac-phase in order to compensate for the lack of cardiac-gating in evaluating accurate dose to coronary structures. Methods: Ten subjects were prospectively imaged with a breath-hold, cardiac-gated MRI protocol to determine heart surface motion. Radial and planar views of the heart were resampled into a 3-dimensional volume representing one heartbeat. A multi-resolution optical flow deformable image registration algorithm determined tissue displacement during the cardiac-cycle. The surface of the heart was modeled as a thin membrane comprised of voxels perpendicular to a pencil beam scanning (PBS) beam. The membrane’s out-of-plane spatial displacement was modeled as a harmonic function with Lame’s equations. Model accuracy was assessed with the root mean squared error (RMSE). The model was applied to a cohort of six chest wall irradiation patients with PBS plans generated on phase-sorted 4DCT. Respiratory motion was separated from the cardiac motion with a previously published technique. Volumetric dose painting was simulated and dose accumulated to validate plan robustness (target coverage variation accepted within 2%). Maximum and mean heart surface dose assessed the dosimetric impact of heart and coronary artery motion. Results: Average and maximum heart surface displacements were 2.54±0.35mm and 3.6mm from the end-diastole phase to the end-systole cardiac-phase respectively. An average RMSE of 0.11±0.04 showed the model to be accurate. Observed errors were greatest between the circumflex artery and mitral valve level of the heart anatomy. Heart surface displacements correspond to a 3.6±1.0% and 5.1±2.3% dosimetric impact on the maximum and mean heart surface DVH indicators respectively. Conclusion: Although heart surface motion parallel to beam’s direction was substantial, its maximum dosimetric impact was 5.1±2.3%. Since PBS delivers low doses to coronary structures relative to

Rolling motion in moving droplets

Indian Academy of Sciences (India)

motions. The two limits of a thin sheet-like drop in sliding motion on a surface, and a spherical drop in roll, have been extensively .... rigid body rotation. The solid body rotation makes sense in the context of small Reynolds. (Re) number flows ...

Surface-Level Diversity and Decision-Making in Groups: When Does Deep-Level Similarity Help?

OpenAIRE

2006-01-01

Abstract We examined how surface-level diversity (based on race) and deep-level similarities influenced three-person decision-making groups on a hidden-profile task. Surface-level homogeneous groups perceived their information to be less unique and spent less time on the task than surface-level diverse groups. When the groups were given the opportunity to learn about their deep-level similarities prior to t...

Preferential superior surface motion in wear simulations of the Charité total disc replacement.

Science.gov (United States)

Goreham-Voss, Curtis M; Vicars, Rachel; Hall, Richard M; Brown, Thomas D

2012-06-01

Laboratory wear simulations of the dual-bearing surface Charité total disc replacement (TDR) are complicated by the non-specificity of the device's center of rotation (CoR). Previous studies have suggested that articulation of the Charité preferentially occurs at the superior-bearing surface, although it is not clear how sensitive this phenomenon is to lubrication conditions or CoR location. In this study, a computational wear model is used to study the articulation kinematics and wear of the Charité TDR. Implant wear was found to be insensitive to the CoR location, although seemingly non-physiologic endplate motion can result. Articulation and wear were biased significantly to the superior-bearing surface, even in the presence of significant perturbations of loading and friction. The computational wear model provides novel insight into the mechanics and wear of the Charité TDR, allowing for better interpretation of in vivo results, and giving useful insight for designing future laboratory physical tests.

Ab initio study of the atomic motion in liquid metal surfaces: comparison with Lennard-Jones systems

International Nuclear Information System (INIS)

Gonzalez, Luis E; Gonzalez, David J

2006-01-01

It is established that liquid metals exhibit surface layering at the liquid-vapour interface, while dielectric simple systems, like those interacting through Lennard-Jones potentials, show a monotonic decay from the liquid density to that of the vapour. First principles molecular dynamics simulations of the free liquid surface of several liquid metals (Li, Na, K, Rb, Cs, Mg, Ba, Al, Tl and Si), and the Na 3 K 7 alloy near their triple points have been performed in order to study the atomic motion at the interface, mainly at the outer layer. Comparison with the results of classical molecular dynamics simulations of a Lennard-Jones system shows interesting differences and similarities. The probability distribution function of the time of residence in a layer shows a peak at very short times and a long-lasting tail. The mean residence time in a layer increases when approaching the interfacial region, slightly in the Lennard-Jones system but strongly in the metallic systems. The motion within the layers, parallel to the interface, can be described as diffusion enhanced (strongly in the case of the outermost layer) with respect to the bulk, for both types of systems, despite its reduced dimensionality in metals

Site characterization field manual for near surface geologic disposal of low-level radioactive waste

International Nuclear Information System (INIS)

McCray, J.G.; Nowatzki, E.A.

1985-01-01

This field manual has been developed to aid states and regions to do a detailed characterization of a proposed near-surface low-level waste disposal site. The field manual is directed at planners, staff personnel and experts in one discipline to acquaint them with the requirements of other disciplines involved in site characterization. While it can provide a good review, it is not designed to tell experts how to do their job within their own discipline

Template Assembly for Detailed Urban Reconstruction

KAUST Repository

Nan, Liangliang

2015-05-04

We propose a new framework to reconstruct building details by automatically assembling 3D templates on coarse textured building models. In a preprocessing step, we generate an initial coarse model to approximate a point cloud computed using Structure from Motion and Multi View Stereo, and we model a set of 3D templates of facade details. Next, we optimize the initial coarse model to enforce consistency between geometry and appearance (texture images). Then, building details are reconstructed by assembling templates on the textured faces of the coarse model. The 3D templates are automatically chosen and located by our optimization-based template assembly algorithm that balances image matching and structural regularity. In the results, we demonstrate how our framework can enrich the details of coarse models using various data sets.

Predictive local receptive fields based respiratory motion tracking for motion-adaptive radiotherapy.

Science.gov (United States)

Yubo Wang; Tatinati, Sivanagaraja; Liyu Huang; Kim Jeong Hong; Shafiq, Ghufran; Veluvolu, Kalyana C; Khong, Andy W H

2017-07-01

Extracranial robotic radiotherapy employs external markers and a correlation model to trace the tumor motion caused by the respiration. The real-time tracking of tumor motion however requires a prediction model to compensate the latencies induced by the software (image data acquisition and processing) and hardware (mechanical and kinematic) limitations of the treatment system. A new prediction algorithm based on local receptive fields extreme learning machines (pLRF-ELM) is proposed for respiratory motion prediction. All the existing respiratory motion prediction methods model the non-stationary respiratory motion traces directly to predict the future values. Unlike these existing methods, the pLRF-ELM performs prediction by modeling the higher-level features obtained by mapping the raw respiratory motion into the random feature space of ELM instead of directly modeling the raw respiratory motion. The developed method is evaluated using the dataset acquired from 31 patients for two horizons in-line with the latencies of treatment systems like CyberKnife. Results showed that pLRF-ELM is superior to that of existing prediction methods. Results further highlight that the abstracted higher-level features are suitable to approximate the nonlinear and non-stationary characteristics of respiratory motion for accurate prediction.

Synchronous and asynchronous perceptual bindings of colour and motion following identical stimulations.

Science.gov (United States)

McIntyre, Morgan E; Arnold, Derek H

2018-05-01

When a moving surface alternates in colour and direction, perceptual couplings of colour and motion can differ from their physical correspondence. Periods of motion tend to be perceptually bound with physically delayed colours - a colour/motion perceptual asynchrony. This can be eliminated by motion transparency. Here we show that the colour/motion perceptual asynchrony is not invariably eliminated by motion transparency. Nor is it an inevitable consequence given a particular physical input. Instead, it can emerge when moving surfaces are perceived as alternating in direction, even if those surfaces seem transparent, and it is eliminated when surfaces are perceived as moving invariably. For a given observer either situation can result from exposure to a common input. Our findings suggest that neural events that promote the perception of motion reversals are causal of the colour/motion perceptual asynchrony. Moreover, they suggest that motion transparency and coherence can be signalled simultaneously by subpopulations of direction-selective neurons, with this conflict instantaneously resolved by a competitive winner-takes-all interaction, which can instantiate or eliminate colour/motion perceptual asynchrony. Copyright © 2017. Published by Elsevier Ltd.

Global detailed gravimetric geoid. [based on gravity model derived from satellite tracking and surface gravity data

Science.gov (United States)

Vincent, S.; Marsh, J. G.

1973-01-01

A global detailed gravimetric geoid has been computed by combining the Goddard Space Flight Center GEM-4 gravity model derived from satellite and surface gravity data and surface 1 deg-by-1 deg mean free air gravity anomaly data. The accuracy of the geoid is + or - 2 meters on continents, 5 to 7 meters in areas where surface gravity data are sparse, and 10 to 15 meters in areas where no surface gravity data are available. Comparisons have been made with the astrogeodetic data provided by Rice (United States), Bomford (Europe), and Mather (Australia). Comparisons have also been carried out with geoid heights derived from satellite solutions for geocentric station coordinates in North America, the Caribbean, Europe, and Australia.

Tribology of thin wetting films between bubble and moving solid surface.

Science.gov (United States)

Karakashev, Stoyan I; Stöckelhuber, Klaus W; Tsekov, Roumen; Phan, Chi M; Heinrich, Gert

2014-08-01

This work shows a successful example of coupling of theory and experiment to study the tribology of bubble rubbing on solid surface. Such kind of investigation is reported for the first time in the literature. A theory about wetting film intercalated between bubble and moving solid surface was developed, thus deriving the non-linear evolution differential equation which accounted for the friction slip coefficient at the solid surface. The stationary 3D film thickness profile, which appears to be a solution of the differential equation, for each particular speed of motion of the solid surface was derived by means of special procedure and unique interferometric experimental setup. This allowed us to determine the 3D map of the lift pressure within the wetting film, the friction force per unit area and the friction coefficient of rubbing at different speeds of motion of the solid surface. Thus, we observed interesting tribological details about the rubbing of the bubble on the solid surface like for example: 1. A regime of mixed friction between dry and lubricated friction exists in the range of 6-170 μm/s, beyond which the rubbing between the bubble and solid becomes completely lubricated and passes through the maximum; 2. The friction coefficient of rubbing has high values at very small speeds of solid's motion and reduces substantially with the increase of the speed of the solid motion until reaching small values, which change insignificantly with the further increase of the speed of the solid. Despite the numerous studies on the motion of bubble/droplet in close proximity to solid wall in the literature, the present investigation appears to be a step ahead in this area as far as we were able to derive 3D maps of the bubble close to the solid surface, which makes the investigation more profound. © 2013.

A geophone wireless sensor network for investigating glacier stick-slip motion

Science.gov (United States)

Martinez, Kirk; Hart, Jane K.; Basford, Philip J.; Bragg, Graeme M.; Ward, Tyler; Young, David S.

2017-08-01

We have developed an innovative passive borehole geophone system, as part of a wireless environmental sensor network to investigate glacier stick-slip motion. The new geophone nodes use an ARM Cortex-M3 processor with a low power design capable of running on battery power while embedded in the ice. Only data from seismic events was stored, held temporarily on a micro-SD card until they were retrieved by systems on the glacier surface which are connected to the internet. The sampling rates, detection and filtering levels were determined from a field trial using a standard commercial passive seismic system. The new system was installed on the Skalafellsjökull glacier in Iceland and provided encouraging results. The results showed that there was a relationship between surface melt water production and seismic event (ice quakes), and these occurred on a pattern related to the glacier surface melt-water controlled velocity changes (stick-slip motion). Three types of seismic events were identified, which were interpreted to reflect a pattern of till deformation (Type A), basal sliding (Type B) and hydraulic transience (Type C) associated with stick-slip motion.

Explosion-produced ground motion: technical summary with respect to seismic hazards

Energy Technology Data Exchange (ETDEWEB)

Rodean, Howard C [Lawrence Radiation Laboratory, University of California, Livermore, CA (United States)

1970-05-15

perfectly elastic but anelastic. If an underground explosion is spherical and the surrounding medium is homogeneous and isotropic, only compressional or P waves are generated. This is an idealization; both P and shear or S waves are produced, with P waves being predominant. The interaction of these waves with the inhomogeneities within the earth and the free surface of the earth produce additional reflected and refracted P and S waves, plus Rayleigh (or R) and Love (or L) waves that travel along the surface. As a consequence, the surface ground motion at a location where seismic damage is of concern is a complex mixture of several types of waves: some are generated in the vicinity of the explosion, and others at various points along different propagation paths. They arrive at different times because of different propagation velocities and transmission paths. In addition, the surface or receiver response to these waves is a function of local geology; e. g., the least severe motion occurs on hard rock. The problem of seismic motion pertinent to property damage is therefore very complicated because the damage-producing part of the wave train does not appear to be the first arrival but some subsequent portion. There may be some valid correlations between damage (i.e., architectural like cracked plaster as well as structural) and measured values of frequency-dependent displacement, velocity, and acceleration; but it is not known which waves are associated with these measurements. Therefore, the prediction of ground motion for seismic damage assessment is, at present, based on extrapolation of past experience and not upon calculations from the first principles of mechanics. This does not mean that these calculations are not of value in damage prediction. However, correlation between theoretical calculations and experimental measurements of ground motion will probably be on a statistical basis because it generally will be impractical to determine all pertinent details of the

Explosion-produced ground motion: technical summary with respect to seismic hazards

International Nuclear Information System (INIS)

Rodean, Howard C.

1970-01-01

perfectly elastic but anelastic. If an underground explosion is spherical and the surrounding medium is homogeneous and isotropic, only compressional or P waves are generated. This is an idealization; both P and shear or S waves are produced, with P waves being predominant. The interaction of these waves with the inhomogeneities within the earth and the free surface of the earth produce additional reflected and refracted P and S waves, plus Rayleigh (or R) and Love (or L) waves that travel along the surface. As a consequence, the surface ground motion at a location where seismic damage is of concern is a complex mixture of several types of waves: some are generated in the vicinity of the explosion, and others at various points along different propagation paths. They arrive at different times because of different propagation velocities and transmission paths. In addition, the surface or receiver response to these waves is a function of local geology; e. g., the least severe motion occurs on hard rock. The problem of seismic motion pertinent to property damage is therefore very complicated because the damage-producing part of the wave train does not appear to be the first arrival but some subsequent portion. There may be some valid correlations between damage (i.e., architectural like cracked plaster as well as structural) and measured values of frequency-dependent displacement, velocity, and acceleration; but it is not known which waves are associated with these measurements. Therefore, the prediction of ground motion for seismic damage assessment is, at present, based on extrapolation of past experience and not upon calculations from the first principles of mechanics. This does not mean that these calculations are not of value in damage prediction. However, correlation between theoretical calculations and experimental measurements of ground motion will probably be on a statistical basis because it generally will be impractical to determine all pertinent details of the

Accuracy of implant transfer with open-tray and closed-tray impression techniques and surface detail reproduction of the tooth during impression

Directory of Open Access Journals (Sweden)

Hakimeh Siadat

2012-01-01

Full Text Available Background and Aims: Accurate recording of implant location is required to achieve passive fit and have the implants without stress concentration. The aim of this in-vitro study was to evaluate the dimensional and angular accuracy of open-tray and closed-tray impression techniques using polyether impression material and also to assess the surface detail reproduction of the tooth while impression making.Materials and Methods: One reference metal model with 2 implants (Implantium on the position of the maxillary second premolar and first molar and one molar tooth for evaluation of surface details was prepared. 27 polyether impressions of these models were made (9 using open-tray, 9 using closed-tray techniques and 9 were made just of the surface of the teeth without any implants. Impressions were poured with ADA type IV stone. Coordinate Measuring Machine was used for measuring the dimensional accuracy and video measuring machine for surface detail reproduction. All of these measurements were compared with the measurements on the reference model. Data were analyzed by and compared by T-test and One-way ANOVA.Results: There was a significant statistical difference between open-tray and closed-tray techniques (P0.05.Conclusion: The accuracy of open-tray impression technique was more than closed-tray technique. The surface detail reproduction of the tooth was not affected by impression technique.

Walking on a moving surface: energy-optimal walking motions on a shaky bridge and a shaking treadmill can reduce energy costs below normal.

Science.gov (United States)

Joshi, Varun; Srinivasan, Manoj

2015-02-08

Understanding how humans walk on a surface that can move might provide insights into, for instance, whether walking humans prioritize energy use or stability. Here, motivated by the famous human-driven oscillations observed in the London Millennium Bridge, we introduce a minimal mathematical model of a biped, walking on a platform (bridge or treadmill) capable of lateral movement. This biped model consists of a point-mass upper body with legs that can exert force and perform mechanical work on the upper body. Using numerical optimization, we obtain energy-optimal walking motions for this biped, deriving the periodic body and platform motions that minimize a simple metabolic energy cost. When the platform has an externally imposed sinusoidal displacement of appropriate frequency and amplitude, we predict that body motion entrained to platform motion consumes less energy than walking on a fixed surface. When the platform has finite inertia, a mass- spring-damper with similar parameters to the Millennium Bridge, we show that the optimal biped walking motion sustains a large lateral platform oscillation when sufficiently many people walk on the bridge. Here, the biped model reduces walking metabolic cost by storing and recovering energy from the platform, demonstrating energy benefits for two features observed for walking on the Millennium Bridge: crowd synchrony and large lateral oscillations.

A method of surface marker location optimization for tumor motion estimation in lung stereotactic body radiation therapy

International Nuclear Information System (INIS)

Lu, Bo; Park, Justin C.; Fan, Qiyong; Kahler, Darren; Liu, Chihray; Chen, Yunmei

2015-01-01

Purpose: Accurately localizing lung tumor localization is essential for high-precision radiation therapy techniques such as stereotactic body radiation therapy (SBRT). Since direct monitoring of tumor motion is not always achievable due to the limitation of imaging modalities for treatment guidance, placement of fiducial markers on the patient’s body surface to act as a surrogate for tumor position prediction is a practical alternative for tracking lung tumor motion during SBRT treatments. In this work, the authors propose an innovative and robust model to solve the multimarker position optimization problem. The model is able to overcome the major drawbacks of the sparse optimization approach (SOA) model. Methods: The principle-component-analysis (PCA) method was employed as the framework to build the authors’ statistical prediction model. The method can be divided into two stages. The first stage is to build the surrogate tumor matrix and calculate its eigenvalues and associated eigenvectors. The second stage is to determine the “best represented” columns of the eigenvector matrix obtained from stage one and subsequently acquire the optimal marker positions as well as numbers. Using 4-dimensional CT (4DCT) and breath hold CT imaging data, the PCA method was compared to the SOA method with respect to calculation time, average prediction accuracy, prediction stability, noise resistance, marker position consistency, and marker distribution. Results: The PCA and SOA methods which were both tested were on all 11 patients for a total of 130 cases including 4DCT and breath-hold CT scenarios. The maximum calculation time for the PCA method was less than 1 s with 64 752 surface points, whereas the average calculation time for the SOA method was over 12 min with 400 surface points. Overall, the tumor center position prediction errors were comparable between the two methods, and all were less than 1.5 mm. However, for the extreme scenarios (breath hold), the

Vertical land motion controls regional sea level rise patterns on the United States east coast since 1900

Science.gov (United States)

Piecuch, C. G.; Huybers, P. J.; Hay, C.; Mitrovica, J. X.; Little, C. M.; Ponte, R. M.; Tingley, M.

2017-12-01

Understanding observed spatial variations in centennial relative sea level trends on the United States east coast has important scientific and societal applications. Past studies based on models and proxies variously suggest roles for crustal displacement, ocean dynamics, and melting of the Greenland ice sheet. Here we perform joint Bayesian inference on regional relative sea level, vertical land motion, and absolute sea level fields based on tide gauge records and GPS data. Posterior solutions show that regional vertical land motion explains most (80% median estimate) of the spatial variance in the large-scale relative sea level trend field on the east coast over 1900-2016. The posterior estimate for coastal absolute sea level rise is remarkably spatially uniform compared to previous studies, with a spatial average of 1.4-2.3 mm/yr (95% credible interval). Results corroborate glacial isostatic adjustment models and reveal that meaningful long-period, large-scale vertical velocity signals can be extracted from short GPS records.

Towards a theory of chaos explained as travel on Riemann surfaces

International Nuclear Information System (INIS)

Calogero, F; Santini, P M; Gomez-Ullate, D; Sommacal, M

2009-01-01

We investigate the dynamics defined by a set of three coupled first-order ODEs. It is shown that the system can be reduced to quadratures which can be expressed in terms of elementary functions. Despite the integrable character of the model, the general solution is a multiple-valued function of time (considered as a complex variable), and we investigate the position and nature of its branch points. In the semi-symmetric case (g 1 = g 2 ≠ g 3 ), for rational values of the coupling constants the system is isochronous and explicit formulae for the period of the solutions can be given. For irrational values, the motions are confined but feature aperiodic motion with sensitive dependence on initial conditions. The system shows a rich dynamical behaviour that can be understood in quantitative detail since a global description of the Riemann surface associated with the solutions can be achieved. The details of the description of the Riemann surface are postponed to a forthcoming publication. This toy model is meant to provide a paradigmatic first step towards understanding a certain novel kind of chaotic behaviour

Empirical recurrence rates for ground motion signals on planetary surfaces

Science.gov (United States)

Lorenz, Ralph D.; Panning, Mark

2018-03-01

We determine the recurrence rates of ground motion events as a function of sensed velocity amplitude at several terrestrial locations, and make a first interplanetary comparison with measurements on the Moon, Mars, Venus and Titan. This empirical approach gives an intuitive order-of-magnitude guide to the observed ground motion (including both tectonic and ocean- and atmosphere-forced signals) of these locations as a guide to instrument expectations on future missions, without invoking interior models and specific sources: for example a Venera-14 observation of possible ground motion indicates a microseismic environment mid-way between noisy and quiet terrestrial locations. Quiet terrestrial regions see a peak velocity amplitude in mm/s roughly equal to 0.3*N(-0.7), where N is the number of "events" (half-hour intervals in which a given peak ground motion is exceeded) observed per year. The Apollo data show endogenous seismic signals for a given recurrence rate that are typically about 10,000 times smaller in amplitude than a quiet site on Earth, although local thermally-induced moonquakes are much more common. Viking data masked for low-wind periods appear comparable with a quiet terrestrial site, whereas a Venera observation of microseisms suggests ground motion more similar to a more active terrestrial location. Recurrence rate plots from in-situ measurements provide a context for seismic instrumentation on future planetary missions, e.g. to guide formulation of data compression schemes. While even small geophones can discriminate terrestrial activity rates, observations with guidance accelerometers are typically too insensitive to provide meaningful constraints (i.e. a non-zero number of "events") on actual ground motion observations unless operated for very long periods.

SU-G-JeP4-07: Evaluation of Intrafraction Motion Using 3D Surface Guided Radiation Therapy in Lung SBRT

International Nuclear Information System (INIS)

Jermoumi, M; Cao, D; Mehta, V; Shepard, D

2016-01-01

Purpose: Surface guided radiation therapy (SGRT) uses stereoscopic video images in combination with patterns projected onto the patient’s surface to dynamically capture and reconstruct a 3D surface map. In this work, we used a C-RAD Catalyst HD system (C-RAD) to evaluate intrafraction motion in the delivery of lung SBRT. Methods: The surface acquired from the 4DCT images from our preliminary cohort of eight lung cancer patients treated with SBRT were matched to the surface images acquired prior to each treatment. Additionally, a CBCT image set was acquired. A linear regression model was established between the external and internal motion of tumor during pretreatment and used to predict the CBCT deviation during treatment. The shifts determined from CBCT and the shifts from surface map imaging were compared and assessed using Bland-Altman method. For intrafraction motion, we assessed the percentage of mean errors that fell outside of the threshold of 2 mm, 3 mm, and 5 mm along the translational directions. The required PTV margin was quantified over the course of treatment. The correlation between intrafraction treatment time and mean error of 3D displacement was evaluated using the Pearson coefficient, r Results: A total of 7971 data points were analyzed. Deviations of 2mm, 3mm, and 5mm were observed less than 7%, 2 %, and 0 % of the time along the translational direction. CBCT and Catalyst showed close agreement during patient positioning. Furthermore, the calculated PTV margins were less than our clinical tolerance of 5 mm. Using the Pearson coefficient r,the mean error of 3D displacement showed significant correlation with treatment time (r=0.69, p= 0.000002). Conclusion: SGRT can be used to ensure accurate patient positioning during treatment without an additional delivery of dose to the patient. This study shows that importance of treatment time as a consideration during the treatment planning process.

SU-G-JeP4-07: Evaluation of Intrafraction Motion Using 3D Surface Guided Radiation Therapy in Lung SBRT

Energy Technology Data Exchange (ETDEWEB)

Jermoumi, M; Cao, D; Mehta, V; Shepard, D [Department of Radiation Oncology, Swedish Cancer Institute, Seattle, WA (United States)

2016-06-15

Purpose: Surface guided radiation therapy (SGRT) uses stereoscopic video images in combination with patterns projected onto the patient’s surface to dynamically capture and reconstruct a 3D surface map. In this work, we used a C-RAD Catalyst HD system (C-RAD) to evaluate intrafraction motion in the delivery of lung SBRT. Methods: The surface acquired from the 4DCT images from our preliminary cohort of eight lung cancer patients treated with SBRT were matched to the surface images acquired prior to each treatment. Additionally, a CBCT image set was acquired. A linear regression model was established between the external and internal motion of tumor during pretreatment and used to predict the CBCT deviation during treatment. The shifts determined from CBCT and the shifts from surface map imaging were compared and assessed using Bland-Altman method. For intrafraction motion, we assessed the percentage of mean errors that fell outside of the threshold of 2 mm, 3 mm, and 5 mm along the translational directions. The required PTV margin was quantified over the course of treatment. The correlation between intrafraction treatment time and mean error of 3D displacement was evaluated using the Pearson coefficient, r Results: A total of 7971 data points were analyzed. Deviations of 2mm, 3mm, and 5mm were observed less than 7%, 2 %, and 0 % of the time along the translational direction. CBCT and Catalyst showed close agreement during patient positioning. Furthermore, the calculated PTV margins were less than our clinical tolerance of 5 mm. Using the Pearson coefficient r,the mean error of 3D displacement showed significant correlation with treatment time (r=0.69, p= 0.000002). Conclusion: SGRT can be used to ensure accurate patient positioning during treatment without an additional delivery of dose to the patient. This study shows that importance of treatment time as a consideration during the treatment planning process.

Seismic behavior of NPP structures subjected to realistic 3D, inclined seismic motions, in variable layered soil/rock, on surface or embedded foundations

International Nuclear Information System (INIS)

Jeremić, B.; Tafazzoli, N.; Ancheta, T.; Orbović, N.; Blahoianu, A.

2013-01-01

Highlights: • Full 3D, inclined, incoherent seismic motions used for modeling SSI of an NPP. • Analyzed effects of variable and uniform soil/rock layering profiles on SSI. • Surface and embedded foundations were modeled and differences analyzed. - Abstract: Presented here is an investigation of the seismic response of a massive NPP structures due to full 3D, inclined, un-correlated input motions for different soil and rock profiles. Of particular interest are the effects of soil and rock layering on the response and the changes of input motions (frequency characteristics) due to such layering. In addition to rock/soil layering effects, investigated are also effects of foundation embedment on dynamic response. Significant differences were observed in dynamic response of containment and internal structure founded on surface and on embedded foundations. These differences were observed for both rock and soil profiles. Select results are used to present most interesting findings

Motion sickness: a negative reinforcement model.

Science.gov (United States)

Bowins, Brad

2010-01-15

Theories pertaining to the "why" of motion sickness are in short supply relative to those detailing the "how." Considering the profoundly disturbing and dysfunctional symptoms of motion sickness, it is difficult to conceive of why this condition is so strongly biologically based in humans and most other mammalian and primate species. It is posited that motion sickness evolved as a potent negative reinforcement system designed to terminate motion involving sensory conflict or postural instability. During our evolution and that of many other species, motion of this type would have impaired evolutionary fitness via injury and/or signaling weakness and vulnerability to predators. The symptoms of motion sickness strongly motivate the individual to terminate the offending motion by early avoidance, cessation of movement, or removal of oneself from the source. The motion sickness negative reinforcement mechanism functions much like pain to strongly motivate evolutionary fitness preserving behavior. Alternative why theories focusing on the elimination of neurotoxins and the discouragement of motion programs yielding vestibular conflict suffer from several problems, foremost that neither can account for the rarity of motion sickness in infants and toddlers. The negative reinforcement model proposed here readily accounts for the absence of motion sickness in infants and toddlers, in that providing strong motivation to terminate aberrant motion does not make sense until a child is old enough to act on this motivation.

Theory of motion for monopole-dipole singularities of classical Yang-Mills-Higgs fields. I. Laws of motion

International Nuclear Information System (INIS)

Drechsler, W.; Havas, P.; Rosenblum, A.

1984-01-01

In two recent papers, the general form of the laws of motion for point particles which are multipole sources of the classical coupled Yang-Mills-Higgs fields was determined by Havas, and for the special case of monopole singularities of a Yang-Mills field an iteration procedure was developed by Drechsler and Rosenblum to obtain the equations of motion of mass points, i.e., the laws of motion including the explicit form of the fields of all interacting particles. In this paper we give a detailed derivation of the laws of motion of monopole-dipole singularities of the coupled Yang-Mills-Higgs fields for point particles with mass and spin, following a procedure first applied by Mathisson and developed by Havas. To obtain the equations of motion, a systematic approximation method is developed in the following paper for the solution of the nonlinear field equations and determination of the fields entering the laws of motion found here to any given order in the coupling constant g

A motion algorithm to extract physical and motion parameters of mobile targets from cone-beam computed tomographic images.

Science.gov (United States)

Alsbou, Nesreen; Ahmad, Salahuddin; Ali, Imad

2016-05-17

A motion algorithm has been developed to extract length, CT number level and motion amplitude of a mobile target from cone-beam CT (CBCT) images. The algorithm uses three measurable parameters: Apparent length and blurred CT number distribution of a mobile target obtained from CBCT images to determine length, CT-number value of the stationary target, and motion amplitude. The predictions of this algorithm are tested with mobile targets having different well-known sizes that are made from tissue-equivalent gel which is inserted into a thorax phantom. The phantom moves sinusoidally in one-direction to simulate respiratory motion using eight amplitudes ranging 0-20 mm. Using this motion algorithm, three unknown parameters are extracted that include: Length of the target, CT number level, speed or motion amplitude for the mobile targets from CBCT images. The motion algorithm solves for the three unknown parameters using measured length, CT number level and gradient for a well-defined mobile target obtained from CBCT images. The motion model agrees with the measured lengths which are dependent on the target length and motion amplitude. The gradient of the CT number distribution of the mobile target is dependent on the stationary CT number level, the target length and motion amplitude. Motion frequency and phase do not affect the elongation and CT number distribution of the mobile target and could not be determined. A motion algorithm has been developed to extract three parameters that include length, CT number level and motion amplitude or speed of mobile targets directly from reconstructed CBCT images without prior knowledge of the stationary target parameters. This algorithm provides alternative to 4D-CBCT without requirement of motion tracking and sorting of the images into different breathing phases. The motion model developed here works well for tumors that have simple shapes, high contrast relative to surrounding tissues and move nearly in regular motion pattern

The Influence of Sediment Isostatic Adjustment on Sea Level Change and Land Motion Along the U.S. Gulf Coast

Science.gov (United States)

Kuchar, Joseph; Milne, Glenn; Wolstencroft, Martin; Love, Ryan; Tarasov, Lev; Hijma, Marc

2018-01-01

Sea level rise presents a hazard for coastal populations, and the Mississippi Delta (MD) is a region particularly at risk due to the high rates of land subsidence. We apply a gravitationally self-consistent model of glacial and sediment isostatic adjustment (SIA) along with a realistic sediment load reconstruction in this region for the first time to determine isostatic contributions to relative sea level (RSL) and land motion. We determine optimal model parameters (Earth rheology and ice history) using a new high-quality compaction-free sea level indicator database. Using the optimal model parameters, we show that SIA can lower predicted RSL in the MD area by several meters over the Holocene and so should be taken into account when modeling these data. We compare modeled contemporary rates of vertical land motion with those inferred using GPS. This comparison indicates that isostatic processes can explain the majority of the observed vertical land motion north of latitude 30.7°N, where subsidence rates average about 1 mm/yr; however, subsidence south of this latitude shows large data-model discrepancies of greater than 3 mm/yr, indicating the importance of nonisostatic processes. This discrepancy extends to contemporary RSL change, where we find that the SIA contribution in the Delta is on the order of 10-1 mm/yr. We provide estimates of the isostatic contributions to 20th and 21st century sea level rates at Gulf Coast Permanent Service for Mean Sea Level tide gauge locations as well as vertical and horizontal land motion at GPS station locations near the MD.

Collective motion in behaviorally heterogeneous systems

OpenAIRE

Copenhagen, Katherine

2017-01-01

Collective motion is a widespread phenomenon in nature where individuals actively propel themselves, gather together and move as a group. Some examples of collective motion are bird flocks, fish schools, bacteria swarms, cell clusters, and crowds of people. Many models seek to understand the effects of activity in collective systems including things such as environmental disorder, density, and interaction details primarily at infinite size limits and with uniform populations. In this disserta...

Seismic switch for strong motion measurement

Science.gov (United States)

Harben, P.E.; Rodgers, P.W.; Ewert, D.W.

1995-05-30

A seismic switching device is described that has an input signal from an existing microseismic station seismometer and a signal from a strong motion measuring instrument. The seismic switch monitors the signal level of the strong motion instrument and passes the seismometer signal to the station data telemetry and recording systems. When the strong motion instrument signal level exceeds a user set threshold level, the seismometer signal is switched out and the strong motion signal is passed to the telemetry system. The amount of time the strong motion signal is passed before switching back to the seismometer signal is user controlled between 1 and 15 seconds. If the threshold level is exceeded during a switch time period, the length of time is extended from that instant by one user set time period. 11 figs.

Seismic Input Motion Determined from a Surface-Downhole Pair of Sensors: A Constrained Deconvolution Approach

OpenAIRE

Dino Bindi; Stefano Parolai; M. Picozzi; A. Ansal

2010-01-01

We apply a deconvolution approach to the problem of determining the input motion at the base of an instrumented borehole using only a pair of recordings, one at the borehole surface and the other at its bottom. To stabilize the bottom-tosurface spectral ratio, we apply an iterative regularization algorithm that allows us to constrain the solution to be positively defined and to have a finite time duration. Through the analysis of synthetic data, we show that the method is capab...

Numerical study of acoustophoretic motion of particles in a PDMS microchannel driven by surface acoustic waves.

Science.gov (United States)

Nama, Nitesh; Barnkob, Rune; Mao, Zhangming; Kähler, Christian J; Costanzo, Francesco; Huang, Tony Jun

2015-06-21

We present a numerical study of the acoustophoretic motion of particles suspended in a liquid-filled PDMS microchannel on a lithium niobate substrate acoustically driven by surface acoustic waves. We employ a perturbation approach where the flow variables are divided into first- and second-order fields. We use impedance boundary conditions to model the PDMS microchannel walls and we model the acoustic actuation by a displacement function from the literature based on a numerical study of piezoelectric actuation. Consistent with the type of actuation, the obtained first-order field is a horizontal standing wave that travels vertically from the actuated wall towards the upper PDMS wall. This is in contrast to what is observed in bulk acoustic wave devices. The first-order fields drive the acoustic streaming, as well as the time-averaged acoustic radiation force acting on suspended particles. We analyze the motion of suspended particles driven by the acoustic streaming drag and the radiation force. We examine a range of particle diameters to demonstrate the transition from streaming-drag-dominated acoustophoresis to radiation-force-dominated acoustophoresis. Finally, as an application of our numerical model, we demonstrate the capability to tune the position of the vertical pressure node along the channel width by tuning the phase difference between two incoming surface acoustic waves.

Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

KAUST Repository

Habuchi, Satoshi

2016-09-26

We demonstrate a method for the synthesis of cyclic polymers and a protocol for characterizing their diffusive motion in a melt state at the single molecule level. An electrostatic self-assembly and covalent fixation (ESA-CF) process is used for the synthesis of the cyclic poly(tetrahydrofuran) (poly(THF)). The diffusive motion of individual cyclic polymer chains in a melt state is visualized using single molecule fluorescence imaging by incorporating a fluorophore unit in the cyclic chains. The diffusive motion of the chains is quantitatively characterized by means of a combination of mean-squared displacement (MSD) analysis and a cumulative distribution function (CDF) analysis. The cyclic polymer exhibits multiple-mode diffusion which is distinct from its linear counterpart. The results demonstrate that the diffusional heterogeneity of polymers that is often hidden behind ensemble averaging can be revealed by the efficient synthesis of the cyclic polymers using the ESA-CF process and the quantitative analysis of the diffusive motion at the single molecule level using the MSD and CDF analyses.

Figure-ground segregation modulates apparent motion.

Science.gov (United States)

Ramachandran, V S; Anstis, S

1986-01-01

We explored the relationship between figure-ground segmentation and apparent motion. Results suggest that: static elements in the surround can eliminate apparent motion of a cluster of dots in the centre, but only if the cluster and surround have similar "grain" or texture; outlines that define occluding surfaces are taken into account by the motion mechanism; the brain uses a hierarchy of precedence rules in attributing motion to different segments of the visual scene. Being designated as "figure" confers a high rank in this scheme of priorities.

Surface detail reproduction and dimensional accuracy of stone models: influence of disinfectant solutions and alginate impression materials.

Science.gov (United States)

Guiraldo, Ricardo Danil; Borsato, Thaís Teixeira; Berger, Sandrine Bittencourt; Lopes, Murilo Baena; Gonini, Alcides; Sinhoreti, Mário Alexandre Coelho

2012-01-01

This study compared the surface detail reproduction and dimensional accuracy of stone models obtained from molds disinfected with 2% sodium hypochlorite, 2% chlorhexidine digluconate or 0.2% peracetic acid to models produced using molds which were not disinfected, with 3 alginate materials (Cavex ColorChange, Hydrogum 5 and Jeltrate Plus). The molds were prepared over matrix containing 20-, 50-, and 75-µm lines, performed under pressure with perforated metal tray. The molds were removed following gelation and either disinfected (using one of the solutions by spraying followed by storage in closed jars for 15 min) or not disinfected. The samples were divided into 12 groups (n=5). Molds were filled with dental gypsum Durone IV and 1 h after the start of the stone mixing the models were separated from the tray. Surface detail reproduction and dimensional accuracy were evaluated using optical microscopy on the 50-µm line with 25 mm in length, in accordance with the ISO 1563 standard. The dimensional accuracy results (%) were subjected to ANOVA. The 50 µm-line was completely reproduced by all alginate impression materials regardless of the disinfection procedure. There was no statistically significant difference in the mean values of dimensional accuracy in combinations between disinfectant procedure and alginate impression material (p=0.2130) or for independent factors. The disinfectant solutions and alginate materials used in this study are no factors of choice regarding the surface detail reproduction and dimensional accuracy of stone models.

Motion of two spheres translating and rotating through a viscous fluid with slip surfaces

International Nuclear Information System (INIS)

Saad, E I

2012-01-01

The axisymmetrical motion of two spherical particles translating along and rotating about a common line that joins their centers in viscous fluid with slip flow boundary conditions on their surfaces has been studied numerically. The particles may differ in radius and in translational and angular velocities. Under the Stokesian approximation, a general solution is constructed from the superposition of the basic functions in the two spherical coordinate systems based on the centers of the particles. The boundary conditions at their surfaces are satisfied by the collocation technique. Numerical results for the normalized drag force and couple acting on each sphere are obtained for various values of the slip coefficients, size ratio, separation parameter, and velocity ratio of the particles. The normalized force and couple on each particle reach the single particle limit as the distance between the centers grows large enough and each particle may then be translated and rotated independently of each other. The accuracy of the numerical technique has been tested against the known analytical solution for two spheres with no-slip surfaces. (paper)

Stochastic motion of particles in tandem mirror devices

International Nuclear Information System (INIS)

Ichikawa, Y.H.; Kamimura, T.

1982-01-01

Stochastic motion of particles in tandem mirror devices is examined on basis of a nonlinear mapping of particle positions on the equatorial plane. Local stability analysis provides detailed informations on particle trajectories. The rate of stochastic plasma diffusion is estimated from numerical observations of motions of particles over a large number of time steps. (author)

Pharmacological and neurophysiological aspects of space/motion sickness

Science.gov (United States)

Lucot, James B.; Crampton, George H.

1991-01-01

A motorized motion testing device modeled after a Ferris wheel was constructed to perform motion sickness tests on cats. Details of the testing are presented, and some of the topics covered include the following: xylazine-induced emesis; analysis of the constituents of the cerebrospinal fluid (CSF) during motion sickness; evaluation of serotonin-1A (5-HT sub 1A) agonists; other 5HT receptors; antimuscarinic mechanisms; and antihistaminergic mechanisms. The ability of the following drugs to reduce motion sickness in the cats was examined: amphetamines, adenosinergic drugs, opioid antagonists, peptides, cannabinoids, cognitive enhancers (nootropics), dextromethorphan/sigma ligands, scopolamine, and diphenhydramine.

Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

Science.gov (United States)

Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

2016-12-01

The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

GEOMETRIC PROPERTIES OF A MECHANICAL FORWARD MOTION COMPENSATION SYSTEM CONTROLLED BY A PIEZOELECTRIC DRIVE

Directory of Open Access Journals (Sweden)

F. Collette

2012-07-01

Full Text Available Forward Motion Compensation (FMC systems have been designed to ensure the radiometric quality of motion acquisition in airborne cameras. If the radiometric benefits of FMC have been acknowledged, what are its effects on the geometrical properties of the camera? This paper demonstrates that FMC significantly improves geometrical properties of a camera. Aspects of FMC theory are discussed, with a focus on the near-lossless implementation of this technology into digital aerial camera systems. Among mechanical FMC technologies, the piezoelectric drive is proving to excel in dynamic positioning in both accuracy and repeatability. The patented piezoelectric drive integrated into Optech aerial camera systems allows for continuous and precise sensor motion to ensure exact compensation of the aircraft's forward motion. This paper presents findings that demonstrate the validity of this assertion. The paper also discusses the physical principles involved in motion acquisition. Equations are included that define the motion effect at image level and illustrate how FMC acts to prevent motion effects. The residual motion effect or compensation error is formulated and a practical computation applied to the more restrictive camera case. The assessment concludes that, in the range of airborne camera utilization, the mechanical FMC technique is free of "visible" error at both human eye and computer assessment level. Lastly, the paper proceeds to a detailed technical discussion of piezoelectric drives and why they have proven to be so effective as nanopositioning devices for optical applications. The effectiveness of the patented piezoelectric drives used to achieve FMC in Optech cameras is conclusively demonstrated.

Dry deposition of submicron atmospheric aerosol over water surfaces in motion

International Nuclear Information System (INIS)

Nevenick, Calec

2013-01-01

Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland...). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

Dry deposition of submicron atmospheric aerosol over water surfaces in motion

International Nuclear Information System (INIS)

Calec, Nevenick

2013-01-01

Whether by chronic or accidental releases, the impact of a nuclear installation on the environment mainly depends on atmospheric transfers; and as the accidents at Chernobyl and Fukushima show, affect the contamination of surfaces and impacts in the medium and long-term on the environment and the population. In this context, this work focuses on the characterization and modeling of dry deposition of submicron aerosols on liquid surfaces in motion such as rivers. Unlike wet deposition which is conditioned by washout and rainout (rain and clouds), dry deposition is a phenomenon that depends entirely on the characteristics of aerosols, receiving surfaces, and air flow. In practice, the evaluation of dry deposition is based on the estimation of flux modeling as the product of particle concentration and deposition velocity which can vary over several orders of magnitude depending on the receiving surfaces (forest, snow, urban, grassland..). This topic is motivated by the virtual non-existence of studies on the mechanisms of dry deposition on continental water systems such as rivers; and respect for submicron aerosols. They have the lowest deposition efficiencies and filtration and the longer residence time in the atmosphere. In addition, they are potentially the most dangerous to living beings because they can penetrate deeper into the airway. Due to the lack of data on the dry deposition of submicron aerosols on a liquid surface in motion, the approach was based on two axes: 1) the acquisition of experimental deposition velocities and 2) the analysis and interpretation of results through modeling. The experiments were performed with uranine aerosols released into the IOA wind tunnel (Interface Ocean Atmosphere) of the Institute for Research on Non Equilibrium Phenomena which is configured to study the coupling between the air flow and water. These experiments have given many dry deposition velocities for different configurations characterized according to wind

Modeling Nonlinear Site Response Uncertainty in Broadband Ground Motion Simulations for the Los Angeles Basin

Science.gov (United States)

Assimaki, D.; Li, W.; Steidl, J. M.; Schmedes, J.

2007-12-01

The assessment of strong motion site response is of great significance, both for mitigating seismic hazard and for performing detailed analyses of earthquake source characteristics. There currently exists, however, large degree of uncertainty concerning the mathematical model to be employed for the computationally efficient evaluation of local site effects, and the site investigation program necessary to evaluate the nonlinear input model parameters and ensure cost-effective predictions; and while site response observations may provide critical constraints on interpretation methods, the lack of a statistically significant number of in-situ strong motion records prohibits statistical analyses to be conducted and uncertainties to be quantified based entirely on field data. In this paper, we combine downhole observations and broadband ground motion synthetics for characteristic site conditions the Los Angeles Basin, and investigate the variability in ground motion estimation introduced by the site response assessment methodology. In particular, site-specific regional velocity and attenuation structures are initially compiled using near-surface geotechnical data collected at downhole geotechnical arrays, inverse low-strain velocity and attenuation profiles at these sites obtained by inversion of weak motion records and the crustal velocity structure at the corresponding locations obtained from the Southern California Earthquake Centre Community Velocity Model. Successively, broadband ground motions are simulated by means of a hybrid low/high-frequency finite source model with correlated random parameters for rupture scenaria of weak, medium and large magnitude events (M =3.5-7.5). Observed estimates of site response at the stations of interest are first compared to the ensemble of approximate and incremental nonlinear site response models. Parametric studies are next conducted for each fixed magnitude (fault geometry) scenario by varying the source-to-site distance and

Characterization of Friction Joints Subjected to High Levels of Random Vibration

Science.gov (United States)

deSantos, Omar; MacNeal, Paul

2012-01-01

This paper describes the test program in detail including test sample description, test procedures, and vibration test results of multiple test samples. The material pairs used in the experiment were Aluminum-Aluminum, Aluminum- Dicronite coated Aluminum, and Aluminum-Plasmadize coated Aluminum. Levels of vibration for each set of twelve samples of each material pairing were gradually increased until all samples experienced substantial displacement. Data was collected on 1) acceleration in all three axes, 2) relative static displacement between vibration runs utilizing photogrammetry techniques, and 3) surface galling and contaminant generation. This data was used to estimate the values of static friction during random vibratory motion when "stick-slip" occurs and compare these to static friction coefficients measured before and after vibration testing.

Prediction of strong earthquake motions on rock surface using evolutionary process models

International Nuclear Information System (INIS)

Kameda, H.; Sugito, M.

1984-01-01

Stochastic process models are developed for prediction of strong earthquake motions for engineering design purposes. Earthquake motions with nonstationary frequency content are modeled by using the concept of evolutionary processes. Discussion is focused on the earthquake motions on bed rocks which are important for construction of nuclear power plants in seismic regions. On this basis, two earthquake motion prediction models are developed, one (EMP-IB Model) for prediction with given magnitude and epicentral distance, and the other (EMP-IIB Model) to account for the successive fault ruptures and the site location relative to the fault of great earthquakes. (Author) [pt

Land motion due to 20th century mass balance of the Greenland Ice Sheet

Science.gov (United States)

Kjeldsen, K. K.; Khan, S. A.

2017-12-01

Quantifying the contribution from ice sheets and glaciers to past sea level change is of great value for understanding sea level projections into the 21st century. However, quantifying and understanding past changes are equally important, in particular understanding the impact in the near-field where the signal is highest. We assess the impact of 20th century mass balance of the Greenland Ice Sheet on land motion using results from Kjeldsen et al, 2015. These results suggest that the ice sheet on average lost a minimum of 75 Gt/yr, but also show that the mass balance was highly spatial- and temporal variable, and moreover that on a centennial time scale changes were driven by a decreasing surface mass balance. Based on preliminary results we discuss land motion during the 20th century due to mass balance changes and the driving components surface mass balance and ice dynamics.

Attention and apparent motion.

Science.gov (United States)

Horowitz, T; Treisman, A

1994-01-01

Two dissociations between short- and long-range motion in visual search are reported. Previous research has shown parallel processing for short-range motion and apparently serial processing for long-range motion. This finding has been replicated and it has also been found that search for short-range targets can be impaired both by using bicontrast stimuli, and by prior adaptation to the target direction of motion. Neither factor impaired search in long-range motion displays. Adaptation actually facilitated search with long-range displays, which is attributed to response-level effects. A feature-integration account of apparent motion is proposed. In this theory, short-range motion depends on specialized motion feature detectors operating in parallel across the display, but subject to selective adaptation, whereas attention is needed to link successive elements when they appear at greater separations, or across opposite contrasts.

Procedure to describe clavicular motion.

Science.gov (United States)

Gutierrez Delgado, Guivey; De Beule, Matthieu; Ortega Cardentey, Dolgis R; Segers, Patrick; Iznaga Benítez, Arsenio M; Rodríguez Moliner, Tania; Verhegghe, Benedict; Palmans, Tanneke; Van Hoof, Tom; Van Tongel, Alexander

2017-03-01

For many years, researchers have attempted to describe shoulder motions by using different mathematical methods. The aim of this study was to describe a procedure to quantify clavicular motion. The procedure proposed for the kinematic analysis consists of 4 main processes: 3 transcortical pins in the clavicle, motion capture, obtaining 3-dimensional bone models, and data processing. Clavicular motion by abduction (30° to 150°) and flexion (55° to 165°) were characterized by an increment of retraction of 27° to 33°, elevation of 25° to 28°, and posterior rotation of 14° to 15°, respectively. In circumduction, clavicular movement described an ellipse, which was reflected by retraction and elevation. Kinematic analysis shows that the articular surfaces move by simultaneously rolling and sliding on the convex surface of the sternum for the 3 movements of abduction, flexion, and circumduction. The use of 3 body landmarks in the clavicle and the direct measurement of bone allowed description of the osteokinematic and arthrokinematic movement of the clavicle. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Chaotic behavior appearing in dynamic motions of nanoscale particles

Energy Technology Data Exchange (ETDEWEB)

Ishikawa, M [Innovation Plaza Tokai, Japan Science and Technology Agency, 23-1 Ahara-cho, Minami-ku, Nagoya 457-0063 (Japan); Harada, R [Department of Physics, Aichi University of Education, Hirosawa 1, Igaya-cho, Kariya 448-8542 (Japan); Kato, M [Innovation Plaza Tokai, Japan Science and Technology Agency, 23-1 Ahara-cho, Minami-ku, Nagoya 457-0063 (Japan); Sasaki, N [Department of Applied Physics, Faculty of Science and Engineering, Seikei University, 3-3-1 Kichijoji Kitamachi, Musashino-shi, Tokyo 180-8633 (Japan); Miura, K [Innovation Plaza Tokai, Japan Science and Technology Agency, 23-1 Ahara-cho, Minami-ku, Nagoya 457-0063 (Japan)

2007-11-15

The case of one-directional motion, under which graphite and mica flakes are driven on an octamethylcyclotetrasiloxane (OMCTS) liquid surface, is presented. The dynamical forces needed to move these bodies increase linearly with the logarithm of scanning velocity, which are typical energy dissipation process. A transition from quasi-periodic to chaotic motions occurs in the dynamics of a graphite flake when its velocity is increased. The dynamics of graphite flakes pulled by the nanotip on an OMCTS liquid surface can be treated as that of a nanobody on a liquid. On the other hand, there do not appear chaotic motions in the dynamics of a mica flake because the contact area between a mica flake and an OMCTS liquid surface is larger than that between a graphite flake and an OMCTS liquid surface.

Chaotic behavior appearing in dynamic motions of nanoscale particles

International Nuclear Information System (INIS)

Ishikawa, M; Harada, R; Kato, M; Sasaki, N; Miura, K

2007-01-01

The case of one-directional motion, under which graphite and mica flakes are driven on an octamethylcyclotetrasiloxane (OMCTS) liquid surface, is presented. The dynamical forces needed to move these bodies increase linearly with the logarithm of scanning velocity, which are typical energy dissipation process. A transition from quasi-periodic to chaotic motions occurs in the dynamics of a graphite flake when its velocity is increased. The dynamics of graphite flakes pulled by the nanotip on an OMCTS liquid surface can be treated as that of a nanobody on a liquid. On the other hand, there do not appear chaotic motions in the dynamics of a mica flake because the contact area between a mica flake and an OMCTS liquid surface is larger than that between a graphite flake and an OMCTS liquid surface

Chaotic behavior appearing in dynamic motions of nanoscale particles

Science.gov (United States)

Ishikawa, M.; Harada, R.; Kato, M.; Sasaki, N.; Miura, K.

2007-11-01

The case of one-directional motion, under which graphite and mica flakes are driven on an octamethylcyclotetrasiloxane (OMCTS) liquid surface, is presented. The dynamical forces needed to move these bodies increase linearly with the logarithm of scanning velocity, which are typical energy dissipation process. A transition from quasi-periodic to chaotic motions occurs in the dynamics of a graphite flake when its velocity is increased. The dynamics of graphite flakes pulled by the nanotip on an OMCTS liquid surface can be treated as that of a nanobody on a liquid. On the other hand, there do not appear chaotic motions in the dynamics of a mica flake because the contact area between a mica flake and an OMCTS liquid surface is larger than that between a graphite flake and an OMCTS liquid surface.

A variational approach to multi-phase motion of gas, liquid and solid based on the level set method

Science.gov (United States)

Yokoi, Kensuke

2009-07-01

We propose a simple and robust numerical algorithm to deal with multi-phase motion of gas, liquid and solid based on the level set method [S. Osher, J.A. Sethian, Front propagating with curvature-dependent speed: Algorithms based on Hamilton-Jacobi formulation, J. Comput. Phys. 79 (1988) 12; M. Sussman, P. Smereka, S. Osher, A level set approach for capturing solution to incompressible two-phase flow, J. Comput. Phys. 114 (1994) 146; J.A. Sethian, Level Set Methods and Fast Marching Methods, Cambridge University Press, 1999; S. Osher, R. Fedkiw, Level Set Methods and Dynamics Implicit Surface, Applied Mathematical Sciences, vol. 153, Springer, 2003]. In Eulerian framework, to simulate interaction between a moving solid object and an interfacial flow, we need to define at least two functions (level set functions) to distinguish three materials. In such simulations, in general two functions overlap and/or disagree due to numerical errors such as numerical diffusion. In this paper, we resolved the problem using the idea of the active contour model [M. Kass, A. Witkin, D. Terzopoulos, Snakes: active contour models, International Journal of Computer Vision 1 (1988) 321; V. Caselles, R. Kimmel, G. Sapiro, Geodesic active contours, International Journal of Computer Vision 22 (1997) 61; G. Sapiro, Geometric Partial Differential Equations and Image Analysis, Cambridge University Press, 2001; R. Kimmel, Numerical Geometry of Images: Theory, Algorithms, and Applications, Springer-Verlag, 2003] introduced in the field of image processing.

Influence of alginate impression materials and storage time on surface detail reproduction and dimensional accuracy of stone models.

Science.gov (United States)

Guiraldo, Ricardo D; Moreti, Ana F F; Martinelli, Julia; Berger, Sandrine B; Meneghel, Luciana L; Caixeta, Rodrigo V; Sinhoreti, Mário A C

2015-01-01

This study compared the surface detail reproduction and dimensional accuracy of stone models obtained from molds prepared using different alginate impression materials (Cavex ColorChange, Hydrogum 5, or Jeltrate Plus) and with different storage times (1, 3, and 5 days) to models from molds that were filled immediately with no storage time. The molds were prepared over a matrix containing 50-μm line, (ISO 1563 standard) under pressure with a perforated metal tray. The molds were removed 2 minutes after loss of sticky consistency and either filled immediately or stored in closed jars at 100% relative humidity and 37°C for 1, 3, or 5 days. The molds were filled with dental plaster (Durone IV). Surface detail reproduction and dimensional accuracy were evaluated using optical microscopy on the 50-μm wide line, which was 25 mm in length, according to ISO 1563 standard. The dimensional accuracy results (%) were subjected to analysis of variance. The 50-μm wide line (ISO 1563 standard) was completely reproduced by all alginate impression materials regardless of the storage time. There was no statistically significant difference in the mean dimensional accuracy values of stone models made from molds composed of different alginate impression materials and with different storage times (p = 0.989). In conclusion, storing the mold for five days prior to filling did not change the surface detail reproduction or dimensional accuracy of the alginates examined in this study.

Spatial design and control of graphene flake motion

Science.gov (United States)

Ghorbanfekr-Kalashami, H.; Peeters, F. M.; Novoselov, K. S.; Neek-Amal, M.

2017-08-01

The force between a sharp scanning probe tip and a surface can drive a graphene flake over crystalline substrates. The recent design of particular patterns of structural defects on a graphene surface allows us to propose an alternative approach for controlling the motion of a graphene flake over a graphene substrate. The thermally induced motion of a graphene flake is controlled by engineering topological defects in the substrate. Such defect regions lead to an inhomogeneous energy landscape and are energetically unfavorable for the motion of the flake, and will invert and scatter graphene flakes when they are moving toward the defect line. Engineering the distribution of these energy barriers results in a controllable trajectory for the thermal motion of the flake without using any external force. We predict superlubricity of the graphene flake for motion along and between particular defect lines. This Rapid Communication provides insights into the frictional forces of interfaces and opens a route to the engineering of the stochastic motion of a graphene flake over any crystalline substrate.

Motion video analysis using planar parallax

Science.gov (United States)

Sawhney, Harpreet S.

1994-04-01

Motion and structure analysis in video sequences can lead to efficient descriptions of objects and their motions. Interesting events in videos can be detected using such an analysis--for instance independent object motion when the camera itself is moving, figure-ground segregation based on the saliency of a structure compared to its surroundings. In this paper we present a method for 3D motion and structure analysis that uses a planar surface in the environment as a reference coordinate system to describe a video sequence. The motion in the video sequence is described as the motion of the reference plane, and the parallax motion of all the non-planar components of the scene. It is shown how this method simplifies the otherwise hard general 3D motion analysis problem. In addition, a natural coordinate system in the environment is used to describe the scene which can simplify motion based segmentation. This work is a part of an ongoing effort in our group towards video annotation and analysis for indexing and retrieval. Results from a demonstration system being developed are presented.

Visibility-based optimal path and motion planning

CERN Document Server

Wang, Paul Keng-Chieh

2015-01-01

This monograph deals with various visibility-based path and motion planning problems motivated by real-world applications such as exploration and mapping planetary surfaces, environmental surveillance using stationary or mobile robots, and imaging of global air/pollutant circulation. The formulation and solution of these problems call for concepts and methods from many areas of applied mathematics including computational geometry, set-covering, non-smooth optimization, combinatorial optimization and optimal control. Emphasis is placed on the formulation of new problems and methods of approach to these problems. Since geometry and visualization play important roles in the understanding of these problems, intuitive interpretations of the basic concepts are presented before detailed mathematical development. The development of a particular topic begins with simple cases illustrated by specific examples, and then progresses forward to more complex cases. The intended readers of this monograph are primarily studen...

A 30-year record of surface mass balance (1966-95) and motion and surface altitude (1975-95) at Wolverine Glacier, Alaska

Science.gov (United States)

Mayo, Lawrence R.; Trabant, Dennis C.; March, Rod S.

2004-01-01

Scientific measurements at Wolverine Glacier, on the Kenai Peninsula in south-central Alaska, began in April 1966. At three long-term sites in the research basin, the measurements included snow depth, snow density, heights of the glacier surface and stratigraphic summer surfaces on stakes, and identification of the surface materials. Calculations of the mass balance of the surface strata-snow, new firn, superimposed ice, and old firn and ice mass at each site were based on these measurements. Calculations of fixed-date annual mass balances for each hydrologic year (October 1 to September 30), as well as net balances and the dates of minimum net balance measured between time-transgressive summer surfaces on the glacier, were made on the basis of the strata balances augmented by air temperature and precipitation recorded in the basin. From 1966 through 1995, the average annual balance at site A (590 meters altitude) was -4.06 meters water equivalent; at site B (1,070 meters altitude), was -0.90 meters water equivalent; and at site C (1,290 meters altitude), was +1.45 meters water equivalent. Geodetic determination of displacements of the mass balance stake, and glacier surface altitudes was added to the data set in 1975 to detect the glacier motion responses to variable climate and mass balance conditions. The average surface speed from 1975 to 1996 was 50.0 meters per year at site A, 83.7 meters per year at site B, and 37.2 meters per year at site C. The average surface altitudes were 594 meters at site A, 1,069 meters at site B, and 1,293 meters at site C; the glacier surface altitudes rose and fell over a range of 19.4 meters at site A, 14.1 meters at site B, and 13.2 meters at site C.

Determination of the Static Friction Coefficient from Circular Motion

Science.gov (United States)

Molina-Bolívar, J. A.; Cabrerizo-Vílchez, M. A.

2014-01-01

This paper describes a physics laboratory exercise for determining the coefficient of static friction between two surfaces. The circular motion of a coin placed on the surface of a rotating turntable has been studied. For this purpose, the motion is recorded with a high-speed digital video camera recording at 240 frames s[superscript-1], and the…

CA-LOD: Collision Avoidance Level of Detail for Scalable, Controllable Crowds

Science.gov (United States)

Paris, Sébastien; Gerdelan, Anton; O'Sullivan, Carol

The new wave of computer-driven entertainment technology throws audiences and game players into massive virtual worlds where entire cities are rendered in real time. Computer animated characters run through inner-city streets teeming with pedestrians, all fully rendered with 3D graphics, animations, particle effects and linked to 3D sound effects to produce more realistic and immersive computer-hosted entertainment experiences than ever before. Computing all of this detail at once is enormously computationally expensive, and game designers as a rule, have sacrificed the behavioural realism in favour of better graphics. In this paper we propose a new Collision Avoidance Level of Detail (CA-LOD) algorithm that allows games to support huge crowds in real time with the appearance of more intelligent behaviour. We propose two collision avoidance models used for two different CA-LODs: a fuzzy steering focusing on the performances, and a geometric steering to obtain the best realism. Mixing these approaches allows to obtain thousands of autonomous characters in real time, resulting in a scalable but still controllable crowd.

Sliding motion modulates stiffness and friction coefficient at the surface of tissue engineered cartilage.

Science.gov (United States)

Grad, S; Loparic, M; Peter, R; Stolz, M; Aebi, U; Alini, M

2012-04-01

Functional cartilage tissue engineering aims to generate grafts with a functional surface, similar to that of authentic cartilage. Bioreactors that stimulate cell-scaffold constructs by simulating natural joint movements hold great potential to generate cartilage with adequate surface properties. In this study two methods based on atomic force microscopy (AFM) were applied to obtain information about the quality of engineered graft surfaces. For better understanding of the molecule-function relationships, AFM was complemented with immunohistochemistry. Bovine chondrocytes were seeded into polyurethane scaffolds and subjected to dynamic compression, applied by a ceramic ball, for 1h daily [loading group 1 (LG1)]. In loading group 2 (LG2), the ball additionally oscillated over the scaffold, generating sliding surface motion. After 3 weeks, the surfaces of the engineered constructs were analyzed by friction force and indentation-type AFM (IT-AFM). Results were complemented and compared to immunohistochemical analyses. The loading type significantly influenced the mechanical and histological outcomes. Constructs of LG2 exhibited lowest friction coefficient and highest micro- and nanostiffness. Collagen type II and aggrecan staining were readily observed in all constructs and appeared to reach deeper areas in loaded (LG1, LG2) compared to unloaded scaffolds. Lubricin was specifically detected at the top surface of LG2. This study proposes a quantitative AFM-based functional analysis at the micrometer- and nanometer scale to evaluate the quality of cartilage surfaces. Mechanical testing (load-bearing) combined with friction analysis (gliding) can provide important information. Notably, sliding-type biomechanical stimuli may favor (re-)generation and maintenance of functional articular surfaces and support the development of mechanically competent engineered cartilage. Copyright © 2012 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights

A path planning method for robot end effector motion using the curvature theory of the ruled surfaces

Science.gov (United States)

Güler, Fatma; Kasap, Emin

Using the curvature theory for the ruled surfaces a technique for robot trajectory planning is presented. This technique ensures the calculation of robot’s next path. The positional variation of the Tool Center Point (TCP), linear velocity, angular velocity are required in the work area of the robot. In some circumstances, it may not be physically achievable and a re-computation of the robot trajectory might be necessary. This technique is suitable for re-computation of the robot trajectory. We obtain different robot trajectories which change depending on the darboux angle function and define trajectory ruled surface family with a common trajectory curve with the rotation trihedron. Also, the motion of robot end effector is illustrated with examples.

Computer-assisted time-averaged holograms of the motion of the surface of the mammalian tympanic membrane with sound stimuli of 0.4-25 kHz.

Science.gov (United States)

Rosowski, John J; Cheng, Jeffrey Tao; Ravicz, Michael E; Hulli, Nesim; Hernandez-Montes, Maria; Harrington, Ellery; Furlong, Cosme

2009-07-01

Time-averaged holograms describing the sound-induced motion of the tympanic membrane (TM) in cadaveric preparations from three mammalian species and one live ear were measured using opto-electronic holography. This technique allows rapid measurements of the magnitude of motion of the tympanic membrane surface at frequencies as high as 25 kHz. The holograms measured in response to low and middle-frequency sound stimuli are similar to previously reported time-averaged holograms. However, at higher frequencies (f>4 kHz), our holograms reveal unique TM surface displacement patterns that consist of highly-ordered arrangements of multiple local displacement magnitude maxima, each of which is surrounded by nodal areas of low displacement magnitude. These patterns are similar to modal patterns (two-dimensional standing waves) produced by either the interaction of surface waves traveling in multiple directions or the uniform stimulation of modes of motion that are determined by the structural properties and boundary conditions of the TM. From the ratio of the displacement magnitude peaks to nodal valleys in these apparent surface waves, we estimate a Standing Wave Ratio of at least 4 that is consistent with energy reflection coefficients at the TM boundaries of at least 0.35. It is also consistent with small losses within the uniformly stimulated modal surface waves. We also estimate possible TM surface wave speeds that vary with frequency and species from 20 to 65 m/s, consistent with other estimates in the literature. The presence of standing wave or modal phenomena has previously been intuited from measurements of TM function, but is ignored in some models of tympanic membrane function. Whether these standing waves result either from the interactions of multiple surface waves that travel along the membrane, or by uniformly excited modal displacement patterns of the entire TM surface is still to be determined.

Motion-guided attention promotes adaptive communications during social navigation.

Science.gov (United States)

Lemasson, B H; Anderson, J J; Goodwin, R A

2013-03-07

Animals are capable of enhanced decision making through cooperation, whereby accurate decisions can occur quickly through decentralized consensus. These interactions often depend upon reliable social cues, which can result in highly coordinated activities in uncertain environments. Yet information within a crowd may be lost in translation, generating confusion and enhancing individual risk. As quantitative data detailing animal social interactions accumulate, the mechanisms enabling individuals to rapidly and accurately process competing social cues remain unresolved. Here, we model how motion-guided attention influences the exchange of visual information during social navigation. We also compare the performance of this mechanism to the hypothesis that robust social coordination requires individuals to numerically limit their attention to a set of n-nearest neighbours. While we find that such numerically limited attention does not generate robust social navigation across ecological contexts, several notable qualities arise from selective attention to motion cues. First, individuals can instantly become a local information hub when startled into action, without requiring changes in neighbour attention level. Second, individuals can circumvent speed-accuracy trade-offs by tuning their motion thresholds. In turn, these properties enable groups to collectively dampen or amplify social information. Lastly, the minority required to sway a group's short-term directional decisions can change substantially with social context. Our findings suggest that motion-guided attention is a fundamental and efficient mechanism underlying collaborative decision making during social navigation.

Sea level differences between Topex/Poseidon altimetry and tide gauges: observed trends and vertical land motions

Science.gov (United States)

Lombard, A.; Dominh, K.; Cazenave, A.; Calmant, S.; Cretaux, J.

2002-12-01

Nine year-long (1993-2001) sea level difference time series have been constructed by comparing sea level recorded by tide gauges and Topex/Poseidon altimetry. Although the primary goal of such an analysis is to define a sub network of good quality tide gauges for calibration of satellite altimetry systems, in particular Jason-1. The difference time series displaying large positive or negative trends may give evidence of vertical land motion at the tide gauge site. We have analyzed 98 tide gauge records from the UHSLC. Among them, 42 sites mainly located on open ocean islands, give very good agreement (better than 2 mm/year) with Topex/Poseidon-derived sea level trends. 22 other sites, mainly located along the continental coastlines of the Pacific Ocean, present sea level trends differing by more than 5 mm/year with Topex/Poseidon. Many of these sites are located in active tectonic areas (either in the vicinity of subduction zones or in active volcanic areas), where vertical land motions (either transient or long-term) are expected. For example, this is the case at Kushimoto, Ofunato, Kushiro (Japan), Kodiak Island and Yakutat (Alaska), La Libertad, Callao, Caldera (western south America), and Rabaul (western Pacific). When possible, we compare these observed trends in sea level differences with GPS and/or DORIS observations.

Multi-level human motion analysis for surveillance applications

NARCIS (Netherlands)

Lao, W.; Han, Jungong; With, de P.H.N.; Rabbani, M.; Stevenson, R.L.

2009-01-01

In this paper, we study a flexible framework for semantic analysis of human motion from a monocular surveillance video. Successful trajectory estimation and human-body modeling facilitate the semantic analysis of human activities in video sequences. As a first contribution, we propose a flexible

On a free-surface problem with moving contact line: From variational principles to stable numerical approximations

Science.gov (United States)

Fumagalli, Ivan; Parolini, Nicola; Verani, Marco

2018-02-01

We analyze a free-surface problem described by time-dependent Navier-Stokes equations. Surface tension, capillary effects and wall friction are taken into account in the evolution of the system, influencing the motion of the contact line - where the free surface hits the wall - and of the dynamics of the contact angle. The differential equations governing the phenomenon are first derived from the variational principle of minimum reduced dissipation, and then discretized by means of the ALE approach. The numerical properties of the resulting scheme are investigated, drawing a parallel with the physical properties holding at the continuous level. Some instability issues are addressed in detail, in the case of an explicit treatment of the geometry, and novel additional terms are introduced in the discrete formulation in order to damp the instabilities. Numerical tests assess the suitability of the approach, the influence of the parameters, and the effectiveness of the new stabilizing terms.

Motion analysis and trials of the deep sea hybrid underwater glider Petrel-II

Science.gov (United States)

Liu, Fang; Wang, Yan-hui; Wu, Zhi-liang; Wang, Shu-xin

2017-03-01

A hybrid underwater glider Petrel-II has been developed and field tested. It is equipped with an active buoyancy unit and a compact propeller unit. Its working modes have been expanded to buoyancy driven gliding and propeller driven level-flight, which can make the glider work in strong currents, as well as many other complicated ocean environments. Its maximal gliding speed reaches 1 knot and the propelling speed is up to 3 knots. In this paper, a 3D dynamic model of Petrel-II is derived using linear momentum and angular momentum equations. According to the dynamic model, the spiral motion in the underwater space is simulated for the gliding mode. Similarly the cycle motion on water surface and the depth-keeping motion underwater are simulated for the level-flight mode. These simulations are important to the performance analysis and parameter optimization for the Petrel-II underwater glider. The simulation results show a good agreement with field trials.

Aerodynamic forces and flows of the full and partial clap-fling motions in insects

Directory of Open Access Journals (Sweden)

Xin Cheng

2017-03-01

Full Text Available Most of the previous studies on Weis-Fogh clap-fling mechanism have focused on the vortex structures and velocity fields. Detailed pressure distribution results are provided for the first time in this study to reveal the differences between the full and the partial clap-fling motions. The two motions are studied by numerically solving the Navier–Stokes equations in moving overset grids. The Reynolds number is set to 20, relevant to the tiny flying insects. The following has been shown: (1 During the clap phase, the wings clap together and create a high pressure region in the closing gap between wings, greatly increasing the positive pressure on the lower surface of wing, while pressure on the upper surface is almost unchanged by the interaction; during the fling phase, the wings fling apart and create a low pressure region in the opening gap between wings, greatly increasing the suction pressure on the upper surface of wing, while pressure on the lower surface is almost unchanged by the interaction; (2 The interference effect between wings is most severe at the end of clap phase and the start of the fling phase: two sharp force peaks (8–9 times larger than that of the one-winged case are generated. But the total force peaks are manifested mostly as drag and barely as lift of the wing, owing to the vertical orientation of the wing section; (3 The wing–wing interaction effect in the partial clap-fling case is much weaker than that in the full clap-fling case, avoiding the generation of huge drag. Compared with a single wing flapping with the same motion, mean lift in the partial case is enhanced by 12% without suffering any efficiency degradation, indicating that partial clap-fling is a more practical choice for tiny insects to employ.

A model for determining the scope and level of detail that is appropriate for a programmatic EIS

International Nuclear Information System (INIS)

Eccleston, C.H.

1995-03-01

Since the inception of the National Environmental Policy Act (NEPA), no definitive guidance has been established for determining the scope of topics and issues, or the level of detail suitable for presentation within a Programmatic Environmental Impact Statement (P-EIS). Lacking such guidance, an inordinate amount of time and resources can be expended in determining the scope that is most appropriately addressed within a P-EIS versus the more detailed scope that is best reserved for lower-tier documents. Faced with this predicament, agencies often err on the side of including too much detail, resulting in P-EISs that are over bloated and unnecessarily complex. Moreover, lack of definitive guidance leads to a great deal of inconsistency in the preparation of P-EISs among federal agency programs. A paradigm for assisting decisionmakers in making such determinations is presented below. This model expedites the preparation of P-EISs by providing a consistent and systematic approach for determining the scope and level of detail that is most appropriately addressed at the programmatic level. In many cases, the model provides agencies with an effective tool for managing and streamlining the NEPA process by de-scoping needless and unnecessary issues from the scope of a P-EIS

3D Surface Realignment Tracking for Medical Imaging: A Phantom Study with PET Motion Correction

DEFF Research Database (Denmark)

Olesen, Oline Vinter; Paulsen, Rasmus Reinhold; Jensen, Rasmus Ramsbøl

2011-01-01

We present a complete system for motion correction in high resolution brain positron emission tomography (PET) imaging. It is based on a compact structured light scanner mounted above the patient tunnel of the Siemens High Resolution Research Tomograph PET brain scanner. The structured light system...... is equipped with a near infrared diode and uses phase-shift interferometry to compute 3D representations of the forehead of the patient. These 3D point clouds are progressively aligned to a reference surface and thereby giving the head pose changes. The estimated pose changes are used to reposition a sequence...... of recon- structed PET frames. To align the structured light system with the PET coordinate system a novel registration algorithm based on the PET trans- mission scan and an initial surface has been developed. The performance of the complete setup has been evaluated using a custom made phantom based...

Internal Mass Motion for Spacecraft Dynamics and Control

National Research Council Canada - National Science Library

Hall, Christopher D

2008-01-01

We present a detailed description of the application of a noncanonical Hamiltonian formulation to the modeling, analysis, and simulation of the dynamics of gyrostat spacecraft with internal mass motion...

Correlated motions are a fundamental property of β-sheets

Science.gov (United States)

Fenwick, R. Bryn; Orellana, Laura; Esteban-Martín, Santi; Orozco, Modesto; Salvatella, Xavier

2014-06-01

Correlated motions in proteins can mediate fundamental biochemical processes such as signal transduction and allostery. The mechanisms that underlie these processes remain largely unknown due mainly to limitations in their direct detection. Here, based on a detailed analysis of protein structures deposited in the protein data bank, as well as on state-of-the art molecular simulations, we provide general evidence for the transfer of structural information by correlated backbone motions, mediated by hydrogen bonds, across β-sheets. We also show that the observed local and long-range correlated motions are mediated by the collective motions of β-sheets and investigate their role in large-scale conformational changes. Correlated motions represent a fundamental property of β-sheets that contributes to protein function.

Bubble Driven Quasioscillatory Translational Motion of Catalytic Micromotors

Science.gov (United States)

Manjare, Manoj; Yang, Bo; Zhao, Y.-P.

2012-09-01

A new quasioscillatory translational motion has been observed for big Janus catalytic micromotors with a fast CCD camera. Such motional behavior is found to coincide with both the bubble growth and burst processes resulting from the catalytic reaction, and the competition of the two processes generates a net forward motion. Detailed physical models have been proposed to describe the above processes. It is suggested that the bubble growth process imposes a growth force moving the micromotor forward, while the burst process induces an instantaneous local pressure depression pulling the micromotor backward. The theoretic predictions are consistent with the experimental data.

Accuracy of implant transfer and surface detail reproduction with polyether and polyvinyl siloxane using closed-tray impression technique

Directory of Open Access Journals (Sweden)

Marzieh Alikhasi

2013-10-01

Full Text Available   Background and Aims: Making accurate impressions of prepared teeth when they are adjacent to dental implants is of great importance. In these situations, disregarding the selection of appropriate impression material and technique, not only can affect accuracy of transferring of the 3-dimentional spatial status of implant, but also can jeopardize the accurate recording of tooth. In the present study, the accuracy of two impression materials with taper impression copings for recording implant position and surface details was evaluated.   Materials and Methods: One metal reference model with 2 implants (Implantium and a preparation of three grooves on a tooth according to ADA no. 19 standard was fabricated. 10 medium- consistency polyEther (PE impressions using custom trays and 10 polyVinyl Siloxane (PVS putty wash impressions using prefabricated trays with conical impression coping were made. Impressions were poured with ADA type IV stone. A Coordinate Measuring Machine (CMM evaluated x, y and angular displacement of the implant analog heads and also accuracy of groove reproduction were measured using a Video Measuring Machine (VMM. These measurements were compared to the ones from reference model. Data were analyzed using one-way ANOVA and T-test.   Results: Putty wash PVS had less linear discrepancy compared with reference model (P > 0.001. There was no significant difference in the surface detail reproduction (P = 0.15.   Conclusion: Putty wash PVS had better results for linear displacement compared with medium consistency PE. There was no significant difference in surface detail reproduction between the two impression materials.

Similar effects of feature-based attention on motion perception and pursuit eye movements at different levels of awareness.

Science.gov (United States)

Spering, Miriam; Carrasco, Marisa

2012-05-30

Feature-based attention enhances visual processing and improves perception, even for visual features that we are not aware of. Does feature-based attention also modulate motor behavior in response to visual information that does or does not reach awareness? Here we compare the effect of feature-based attention on motion perception and smooth-pursuit eye movements in response to moving dichoptic plaids--stimuli composed of two orthogonally drifting gratings, presented separately to each eye--in human observers. Monocular adaptation to one grating before the presentation of both gratings renders the adapted grating perceptually weaker than the unadapted grating and decreases the level of awareness. Feature-based attention was directed to either the adapted or the unadapted grating's motion direction or to both (neutral condition). We show that observers were better at detecting a speed change in the attended than the unattended motion direction, indicating that they had successfully attended to one grating. Speed change detection was also better when the change occurred in the unadapted than the adapted grating, indicating that the adapted grating was perceptually weaker. In neutral conditions, perception and pursuit in response to plaid motion were dissociated: While perception followed one grating's motion direction almost exclusively (component motion), the eyes tracked the average of both gratings (pattern motion). In attention conditions, perception and pursuit were shifted toward the attended component. These results suggest that attention affects perception and pursuit similarly even though only the former reflects awareness. The eyes can track an attended feature even if observers do not perceive it.

Motion correction of PET brain images through deconvolution: I. Theoretical development and analysis in software simulations

Science.gov (United States)

Faber, T. L.; Raghunath, N.; Tudorascu, D.; Votaw, J. R.

2009-02-01

Image quality is significantly degraded even by small amounts of patient motion in very high-resolution PET scanners. Existing correction methods that use known patient motion obtained from tracking devices either require multi-frame acquisitions, detailed knowledge of the scanner, or specialized reconstruction algorithms. A deconvolution algorithm has been developed that alleviates these drawbacks by using the reconstructed image to estimate the original non-blurred image using maximum likelihood estimation maximization (MLEM) techniques. A high-resolution digital phantom was created by shape-based interpolation of the digital Hoffman brain phantom. Three different sets of 20 movements were applied to the phantom. For each frame of the motion, sinograms with attenuation and three levels of noise were simulated and then reconstructed using filtered backprojection. The average of the 20 frames was considered the motion blurred image, which was restored with the deconvolution algorithm. After correction, contrast increased from a mean of 2.0, 1.8 and 1.4 in the motion blurred images, for the three increasing amounts of movement, to a mean of 2.5, 2.4 and 2.2. Mean error was reduced by an average of 55% with motion correction. In conclusion, deconvolution can be used for correction of motion blur when subject motion is known.

Motion correction of PET brain images through deconvolution: I. Theoretical development and analysis in software simulations

Energy Technology Data Exchange (ETDEWEB)

Faber, T L; Raghunath, N; Tudorascu, D; Votaw, J R [Department of Radiology, Emory University Hospital, 1364 Clifton Road, N.E. Atlanta, GA 30322 (United States)], E-mail: tfaber@emory.edu

2009-02-07

Image quality is significantly degraded even by small amounts of patient motion in very high-resolution PET scanners. Existing correction methods that use known patient motion obtained from tracking devices either require multi-frame acquisitions, detailed knowledge of the scanner, or specialized reconstruction algorithms. A deconvolution algorithm has been developed that alleviates these drawbacks by using the reconstructed image to estimate the original non-blurred image using maximum likelihood estimation maximization (MLEM) techniques. A high-resolution digital phantom was created by shape-based interpolation of the digital Hoffman brain phantom. Three different sets of 20 movements were applied to the phantom. For each frame of the motion, sinograms with attenuation and three levels of noise were simulated and then reconstructed using filtered backprojection. The average of the 20 frames was considered the motion blurred image, which was restored with the deconvolution algorithm. After correction, contrast increased from a mean of 2.0, 1.8 and 1.4 in the motion blurred images, for the three increasing amounts of movement, to a mean of 2.5, 2.4 and 2.2. Mean error was reduced by an average of 55% with motion correction. In conclusion, deconvolution can be used for correction of motion blur when subject motion is known.

A Common Framework for the Analysis of Complex Motion? Standstill and Capture Illusions

Directory of Open Access Journals (Sweden)

Max Reinhard Dürsteler

2014-12-01

Full Text Available A series of illusions was created by presenting stimuli, which consisted of two overlapping surfaces each defined by textures of independent visual features (i.e. modulation of luminance, color, depth, etc.. When presented concurrently with a stationary 2-D luminance texture, observers often fail to perceive the motion of an overlapping stereoscopically defined depth-texture. This illusory motion standstill arises due to a failure to represent two independent surfaces (one for luminance and one for depth textures and motion transparency (the ability to perceive motion of both surfaces simultaneously. Instead the stimulus is represented as a single non-transparent surface taking on the stationary nature of the luminance-defined texture. By contrast, if it is the 2D-luminance defined texture that is in motion, observers often perceive the stationary depth texture as also moving. In this latter case, the failure to represent the motion transparency of the two textures gives rise to illusionary motion capture. Our past work demonstrated that the illusions of motion standstill and motion capture can occur for depth-textures that are rotating, or expanding / contracting, or else spiraling. Here I extend these findings to include stereo-shearing. More importantly, it is the motion (or lack thereof of the luminance texture that determines how the motion of the depth will be perceived. This observation is strongly in favor of a single pathway for complex motion that operates on luminance-defines texture motion signals only. In addition, these complex motion illusions arise with chromatically-defined textures with smooth, transitions between their colors. This suggests that in respect to color motion perception the complex motions’ pathway is only able to accurately process signals from isoluminant colored textures with sharp transitions between colors, and/or moving at high speeds, which is conceivable if it relies on inputs from a hypothetical dual

Homothetic motions in general relativity

International Nuclear Information System (INIS)

McIntosh, C.B.G.

1976-01-01

Properties of homothetic or self-similar motions in general relativity are examined with particular reference to vacuum and perfect-fluid space-times. The role of the homothetic bivector with components Hsub((a;b)) formed from the homothetic vector H is discussed in some detail. It is proved that a vacuum space-time only admits a nontrivial homothetic motion if the homothetic vector field is non-null and is not hypersurface orthogonal. As a subcase of a more general result it is shown that a perfect-fluid space-time cannot admit a non-trivial homothetic vector which is orthogonal to the fluid velocity 4-vector. (author)

Surface motion near underground nuclear explosions in desert alluvium Operation Nougat I, Area 3, Nevada Test Site

International Nuclear Information System (INIS)

Perret, W.R.

1978-05-01

During Operation Nougat I, which was conducted in late 1961 and the first half of 1962, Sandia Laboratories measured surface motion in the vicinity of all contained underground nuclear explosions conducted by the Los Alamos Scientific Laboratory in Area 3 of the Nevada Test Site. This report presents and analyses most of the data derived from that study. Propagation velocities in the desert alluvium, 4440 ft/sec, and underlying tuff, 6020 ft/sec, are typical of those derived from later measurements. Motion attenuation data exhibit considerable scatter, in part because of early measurement and data reduction techniques but primarily because of differences in the characteristics of the geologic media which had not then been recognized. However, regression fits to the scaled data show attenuation of scaled acceleration at a rate 35% greater than that observed for Merlin event data (Merlin was conducted later in Area 3). The attenuation rate for particle velocity data from Nougat I events was 47% less than that for Merlin data, and the Nougat I scaled displacement data attenuation rate was 87% less than that for Merlin data. Analysis of data from a vertical string of gages extending to the surface above the Mink explosion has established a significant difference between normal spallation above contained explosions in competent rock and the reaction of uncemented alluvium to similar explosive loading

Multi-instantons in R4 and Minimal Surfaces in R2,1

International Nuclear Information System (INIS)

Tekin, Bayram

2000-01-01

It is known that self-duality equations for multi-instantons on a line in four dimensions are equivalent to minimal surface equations in three dimensional Minkowski space. We extend this equivalence beyond the equations of motion and show that topological number, instanton moduli space and anti-self-dual solutions have representations in terms of minimal surfaces. The issue of topological charge is quite subtle because the surfaces that appear are non-compact. This minimal surface/instanton correspondence allows us to define a metric on the configuration space of the gauge fields. We obtain the minimal surface representation of an instanton with arbitrary charge. The trivial vacuum and the BPST instanton as minimal surfaces are worked out in detail. BPS monopoles and the geodesics are also discussed. (author)

DNS of droplet motion in a turbulent flow

Science.gov (United States)

Rosso, Michele; Elghobashi, S.

2013-11-01

The objective of our research is to study the multi-way interactions between turbulence and vaporizing liquid droplets by performing direct numerical simulations (DNS). The freely-moving droplets are fully resolved in 3D space and time and all the relevant scales of the turbulent motion are simultaneously resolved down to the smallest length- and time-scales. Our DNS solve the unsteady three-dimensional Navier-Stokes and continuity equations throughout the whole computational domain, including the interior of the liquid droplets. The droplet surface motion and deformation are captured accurately by using the Level Set method. The pressure jump condition, density and viscosity discontinuities across the interface as well as surface tension are accounted for. Here, we present only the results of the first stage of our research which considers the effects of turbulence on the shape change of an initially spherical liquid droplet, at density ratio (of liquid to carrier fluid) of 1000, moving in isotropic turbulent flow. We validate our results via comparison with available expe. This research has been supported by NSF-CBET Award 0933085 and NSF PRAC (Petascale Computing Resource Allocation) Award.

Use of item response curves of the Force and Motion Conceptual Evaluation to compare Japanese and American students' views on force and motion

Science.gov (United States)

Ishimoto, Michi; Davenport, Glen; Wittmann, Michael C.

2017-12-01

Student views of force and motion reflect the personal experiences and physics education of the student. With a different language, culture, and educational system, we expect that Japanese students' views on force and motion might be different from those of American students. The Force and Motion Conceptual Evaluation (FMCE) is an instrument used to probe student views on force and motion. It was designed using research on American students, and, as such, the items might function differently for Japanese students. Preliminary results from a translated version indicated that Japanese students had similar misconceptions as those of American students. In this study, we used item response curves (IRCs) to make more detailed item-by-item comparisons. IRCs show the functioning of individual items across all levels of performance by plotting the proportion of each response as a function of the total score. Most of the IRCs showed very similar patterns on both correct and incorrect responses; however, a few of the plots indicate differences between the populations. The similar patterns indicate that students tend to interact with FMCE items similarly, despite differences in culture, language, and education. We speculate about the possible causes for the differences in some of the IRCs. This report is intended to show how IRCs can be used as a part of the validation process when making comparisons across languages and nationalities. Differences in IRCs can help to pinpoint artifacts of translation, contextual effects because of differences in culture, and perhaps intrinsic differences in student understanding of Newtonian motion.

Use of item response curves of the Force and Motion Conceptual Evaluation to compare Japanese and American students’ views on force and motion

Directory of Open Access Journals (Sweden)

Michi Ishimoto

2017-11-01

Full Text Available Student views of force and motion reflect the personal experiences and physics education of the student. With a different language, culture, and educational system, we expect that Japanese students’ views on force and motion might be different from those of American students. The Force and Motion Conceptual Evaluation (FMCE is an instrument used to probe student views on force and motion. It was designed using research on American students, and, as such, the items might function differently for Japanese students. Preliminary results from a translated version indicated that Japanese students had similar misconceptions as those of American students. In this study, we used item response curves (IRCs to make more detailed item-by-item comparisons. IRCs show the functioning of individual items across all levels of performance by plotting the proportion of each response as a function of the total score. Most of the IRCs showed very similar patterns on both correct and incorrect responses; however, a few of the plots indicate differences between the populations. The similar patterns indicate that students tend to interact with FMCE items similarly, despite differences in culture, language, and education. We speculate about the possible causes for the differences in some of the IRCs. This report is intended to show how IRCs can be used as a part of the validation process when making comparisons across languages and nationalities. Differences in IRCs can help to pinpoint artifacts of translation, contextual effects because of differences in culture, and perhaps intrinsic differences in student understanding of Newtonian motion.

Improved motion description for action classification

Directory of Open Access Journals (Sweden)

Mihir eJain

2016-01-01

Full Text Available Even though the importance of explicitly integrating motion characteristics in video descriptions has been demonstrated by several recent papers on action classification, our current work concludes that adequately decomposing visual motion into dominant and residual motions, i.e.: camera and scene motion, significantly improves action recognition algorithms. This holds true both for the extraction of the space-time trajectories and for computation of descriptors.We designed a new motion descriptor – the DCS descriptor – that captures additional information on local motion patterns enhancing results based on differential motion scalar quantities, divergence, curl and shear features. Finally, applying the recent VLAD coding technique proposed in image retrieval provides a substantial improvement for action recognition. These findings are complementary to each other and they outperformed all previously reported results by a significant margin on three challenging datasets: Hollywood 2, HMDB51 and Olympic Sports as reported in (Jain et al. (2013. These results were further improved by (Oneata et al. (2013; Wang and Schmid (2013; Zhu et al. (2013 through the use of the Fisher vector encoding. We therefore also employ Fisher vector in this paper and we further enhance our approach by combining trajectories from both optical flow and compensated flow. We as well provide additional details of DCS descriptors, including visualization. For extending the evaluation, a novel dataset with 101 action classes, UCF101, was added.

Computer-assisted time-averaged holograms of the motion of the surface of the mammalian tympanic membrane with sound stimuli of 0.4 to 25 kHz

Science.gov (United States)

Rosowski, John J.; Cheng, Jeffrey Tao; Ravicz, Michael E.; Hulli, Nesim; Hernandez-Montes, Maria; Harrington, Ellery; Furlong, Cosme

2009-01-01

Time-averaged holograms describing the sound-induced motion of the tympanic membrane (TM) in cadaveric preparations from three mammalian species and one live ear were measured using opto-electronic holography. This technique allows rapid measurements of the magnitude of motion of the tympanic membrane surface at frequencies as high as 25 kHz. The holograms measured in response to low and middle-frequency sound stimuli are similar to previously reported time-averaged holograms. However, at higher frequencies (f > 4 kHz), our holograms reveal unique TM surface displacement patterns that consist of highly-ordered arrangements of multiple local displacement magnitude maxima, each of which is surrounded by nodal areas of low displacement magnitude. These patterns are similar to modal patterns (two-dimensional standing waves) produced by either the interaction of surface waves traveling in multiple directions or the uniform stimulation of modes of motion that are determined by the structural properties and boundary conditions of the TM. From the ratio of the displacement magnitude peaks to nodal valleys in these apparent surface waves, we estimate a Standing Wave Ratio of at least 4 that is consistent with energy reflection coefficients at the TM boundaries of at least 0.35. It is also consistent with small losses within the uniformly stimulated modal surface waves. We also estimate possible TM surface wave speeds that vary with frequency and species from 20 to 65 m/s, consistent with other estimates in the literature. The presence of standing wave or modal phenomena has previously been intuited from measurements of TM function, but is ignored in some models of tympanic membrane function. Whether these standing waves result either from the interactions of multiple surface waves that travel along the membrane, or by uniformly excited modal displacement patterns of the entire TM surface is still to be determined. PMID:19328841

Mathematical modelling of powder material motion and transportation in high-temperature flow core during plasma coatings application

Science.gov (United States)

Bogdanovich, V. I.; Giorbelidze, M. G.

2018-03-01

A problem of mathematical modelling of powder material motion and transportation in gas thermal flow core has been addressed. Undertaken studies indicate significant impact on dynamics of motion of sprayed particles of phenomenological law for drag coefficient and accounting momentum loss of a plasma jet upon acceleration of these particles and their diameter. It is determined that at great dispersion of spraying particles, they reach detail surface at different velocity and significant particles separation takes place at spraying spot. According to the results of mathematical modelling, requirements for admissible dispersion of diameters of particles used for spraying have been formulated. Research has also allowed reducing separation of particles at the spraying spot due to the selection of the method of powder feed to the anode channel of the plasma torch.

Estimating tropical vertical motion profile shapes from satellite observations

Science.gov (United States)

Back, L. E.; Handlos, Z.

2013-12-01

The vertical structure of tropical deep convection strongly influences interactions with larger scale circulations and climate. This research focuses on investigating this vertical structure and its relationship with mesoscale tropical weather states. We test the hypothesis that vertical motion shape varies in association with weather state type. We estimate mean state vertical motion profile shapes for six tropical weather states defined using cloud top pressure and optical depth properties from the International Satellite Cloud Climatology Project. The relationship between vertical motion and the dry static energy budget are utilized to set up a regression analysis that empirically determines two modes of variability in vertical motion from reanalysis data. We use these empirically determined modes, this relationship and surface convergence to estimate vertical motion profile shape from observations of satellite retrievals of rainfall and surface convergence. We find that vertical motion profile shapes vary systematically between different tropical weather states. The "isolated systems" regime exhibits a more ''bottom-heavy'' profile shape compared to the convective/thick cirrus and vigorous deep convective regimes, with maximum upward vertical motion occurring in the lower troposphere rather than the middle to upper troposphere. The variability we observe with our method does not coincide with that expected based on conventional ideas about how stratiform rain fraction and vertical motion are related.

Dynamic Portrait of the Retrograde 1:1 Mean Motion Resonance

Science.gov (United States)

Huang, Yukun; Li, Miao; Li, Junfeng; Gong, Shengping

2018-06-01

Asteroids in mean motion resonances with giant planets are common in the solar system, but it was not until recently that several asteroids in retrograde mean motion resonances with Jupiter and Saturn were discovered. A retrograde co-orbital asteroid of Jupiter, 2015 BZ509 is confirmed to be in a long-term stable retrograde 1:1 mean motion resonance with Jupiter, which gives rise to our interests in its unique resonant dynamics. In this paper, we investigate the phase-space structure of the retrograde 1:1 resonance in detail within the framework of the circular restricted three-body problem. We construct a simple integrable approximation for the planar retrograde resonance using canonical contact transformation and numerically employ the averaging procedure in closed form. The phase portrait of the retrograde 1:1 resonance is depicted with the level curves of the averaged Hamiltonian. We thoroughly analyze all possible librations in the co-orbital region and uncover a new apocentric libration for the retrograde 1:1 resonance inside the planet’s orbit. We also observe the significant jumps in orbital elements for outer and inner apocentric librations, which are caused by close encounters with the perturber.

The unusual properties of beryllium surfaces

International Nuclear Information System (INIS)

Stumpf, R.; Hannon, J.B.

1994-01-01

Be is a ''marginal metal.'' The stable phase, hcp-Be, has a low Fermi-level density of states and very anisotropic structural and elastic properties, similar to a semiconductor's. At the Be(0001) surface, surface states drastically increase the Fermi-level density of states. The different nature of bonding in bulk-Be and at the Be(0001) surface explains the large outward relaxation. The presence of surface states causes large surface core-level shifts by inducing a higher electrostatic potential in the surface layers and by improving the screening at the surface. The authors experimental and theoretical investigations of atomic vibrations at the Be(0001) surface demonstrate clearly that Be screening of atomic motion by the surface states makes the surface phonon dispersion fundamentally different from that of the bulk. Properties of Be(0001) are so different from those of the bulk that the surface can be considered a new ''phase'' of beryllium with unique electronic and structural characteristics. For comparison they also study Be(11 bar 20), a very open surface without important surface states. Be(11 bar 20) is the only clean s-p metal surface known to reconstruct (1 x 3 missing row reconstruction)

Realization of a Service Robot for Cleaning Spherical Surfaces

Directory of Open Access Journals (Sweden)

Houxiang Zhang

2005-03-01

Full Text Available There are more and more buildings with complicated shape emerging all over the world. Their walls require constant cleaning which is difficult to realize. In this paper, based on analyzing the characteristics of the working target, a new kind of auto-climbing robot is proposed, which is used for cleaning the spherical surface of the National GrandTheatre in China. The robots' mechanism and unique aspects are presented in detail. A distributed controller based onCAN bus is designed to meet the requirements of controlling the robot. The control system is divided into 6 parts, fiveCAN bus control nodes and a remote controller, which are designed and established based mainly on the P80C592. Finally, the motion function is described in detail. The experimental results confirm the principle described above andthe robot's ability to work on the spherical surface.

Summary of ground motion prediction results for Nevada Test Site underground nuclear explosions related to the Yucca Mountain project

International Nuclear Information System (INIS)

Walck, M.C.

1996-10-01

This report summarizes available data on ground motions from underground nuclear explosions recorded on and near the Nevada Test Site, with emphasis on the ground motions recorded at stations on Yucca Mountain, the site of a potential high-level radioactive waste repository. Sandia National Laboratories, through the Weapons Test Seismic Investigations project, collected and analyzed ground motion data from NTS explosions over a 14-year period, from 1977 through 1990. By combining these data with available data from earlier, larger explosions, prediction equations for several ground motion parameters have been developed for the Test Site area for underground nuclear explosion sources. Also presented are available analyses of the relationship between surface and downhole motions and spectra and relevant crustal velocity structure information for Yucca Mountain derived from the explosion data. The data and associated analyses demonstrate that ground motions at Yucca Mountain from nuclear tests have been at levels lower than would be expected from moderate to large earthquakes in the region; thus nuclear explosions, while located relatively close, would not control seismic design criteria for the potential repository

Summary of ground motion prediction results for Nevada Test Site underground nuclear explosions related to the Yucca Mountain project

Energy Technology Data Exchange (ETDEWEB)

Walck, M.C.

1996-10-01

This report summarizes available data on ground motions from underground nuclear explosions recorded on and near the Nevada Test Site, with emphasis on the ground motions recorded at stations on Yucca Mountain, the site of a potential high-level radioactive waste repository. Sandia National Laboratories, through the Weapons Test Seismic Investigations project, collected and analyzed ground motion data from NTS explosions over a 14-year period, from 1977 through 1990. By combining these data with available data from earlier, larger explosions, prediction equations for several ground motion parameters have been developed for the Test Site area for underground nuclear explosion sources. Also presented are available analyses of the relationship between surface and downhole motions and spectra and relevant crustal velocity structure information for Yucca Mountain derived from the explosion data. The data and associated analyses demonstrate that ground motions at Yucca Mountain from nuclear tests have been at levels lower than would be expected from moderate to large earthquakes in the region; thus nuclear explosions, while located relatively close, would not control seismic design criteria for the potential repository.

Mathematical aspects of surface water waves

International Nuclear Information System (INIS)

Craig, Walter; Wayne, Clarence E

2007-01-01

The theory of the motion of a free surface over a body of water is a fascinating subject, with a long history in both applied and pure mathematical research, and with a continuing relevance to the enterprises of mankind having to do with the sea. Despite the recent advances in the field (some of which we will hear about during this Workshop on Mathematical Hydrodynamics at the Steklov Institute), and the current focus of the mathematical community on the topic, many fundamental mathematical questions remain. These have to do with the evolution of surface water waves, their approximation by model equations and by computer simulations, the detailed dynamics of wave interactions, such as would produce rogue waves in an open ocean, and the theory (partially probabilistic) of approximating wave fields over large regions by averaged 'macroscopic' quantities which satisfy essentially kinetic equations of motion. In this note we would like to point out open problems and some of the directions of current research in the field. We believe that the introduction of new analytical techniques and novel points of view will play an important role in the future development of the area.

Near-surface energy transfers from internal tide beams to smaller vertical scale motions

Science.gov (United States)

Chou, S.; Staquet, C.; Carter, G. S.; Luther, D. S.

2016-02-01

Mechanical energy capable of causing diapycnal mixing in the ocean is transferred to the internal wave field when barotropic tides pass over underwater topography and generate internal tides. The resulting internal tide energy is confined in vertically limited structures, or beams. As internal tide beams (ITBs) propagate through regions of non-uniform stratification in the upper ocean, wave energy can be scattered through multiple reflections and refractions, be vertically trapped, or transferred to non-tidal frequencies through different nonlinear processes. Various observations have shown that ITBs are no longer detectable in horizontal kinetic energy beyond the first surface reflection. Importantly, this implies that some of the internal tide energy no longer propagates in to the abyssal ocean and consequently will not be available to maintain the density stratification. Using the NHM, a nonlinear and nonhydrostatic model based on the MITgcm, simulations of an ITB propagating up to the sea surface are examined in order to quantify the transformation of ITB energy to other motions. We compare and contrast the transformations enabled by idealized, smoothly-varying stratification with transformations enabled by realistic stratification containing a broad-band vertical wavenumber spectrum of variations. Preliminary two-dimensional results show that scattering due to small-scale structure in realistic stratification profiles from Hawaii can lead to energy being vertically trapped near the surface. Idealized simulations of "locally" generated internal solitary waves are analyzed in terms of energy flux transfers from the ITB to solitary waves, higher harmonics, and mean flow. The amount of internal tide energy which propagates back down after near-surface reflection of the ITB in different environments is quantified.

Ground motion input in seismic evaluation studies

International Nuclear Information System (INIS)

Sewell, R.T.; Wu, S.C.

1996-07-01

This report documents research pertaining to conservatism and variability in seismic risk estimates. Specifically, it examines whether or not artificial motions produce unrealistic evaluation demands, i.e., demands significantly inconsistent with those expected from real earthquake motions. To study these issues, two types of artificial motions are considered: (a) motions with smooth response spectra, and (b) motions with realistic variations in spectral amplitude across vibration frequency. For both types of artificial motion, time histories are generated to match target spectral shapes. For comparison, empirical motions representative of those that might result from strong earthquakes in the Eastern U.S. are also considered. The study findings suggest that artificial motions resulting from typical simulation approaches (aimed at matching a given target spectrum) are generally adequate and appropriate in representing the peak-response demands that may be induced in linear structures and equipment responding to real earthquake motions. Also, given similar input Fourier energies at high-frequencies, levels of input Fourier energy at low frequencies observed for artificial motions are substantially similar to those levels noted in real earthquake motions. In addition, the study reveals specific problems resulting from the application of Western U.S. type motions for seismic evaluation of Eastern U.S. nuclear power plants

SOLAR MIXTURE OPACITY CALCULATIONS USING DETAILED CONFIGURATION AND LEVEL ACCOUNTING TREATMENTS

International Nuclear Information System (INIS)

Blancard, Christophe; Cossé, Philippe; Faussurier, Gérald

2012-01-01

An opacity model (OPAS) combining detailed configuration and level accounting treatments has been developed to calculate radiative opacity of plasmas in local thermodynamic equilibrium. The model is presented and used to compute spectral opacities of a solar mixture. Various density-temperature couples have been considered from the solar center up to the vicinity of the radiative/convective zone interface. For a given solar thermodynamic path, OPAS calculations are compared to Opacity Project (OP) and OPAL data. Rosseland mean opacity values are in very good agreement over all the considered solar thermodynamic path, while OPAS and OP spectral opacities of each element may vary considerably. Main sources of discrepancy are discussed.

On the absolute meaning of motion

Directory of Open Access Journals (Sweden)

H. Edwards

Full Text Available The present manuscript aims to clarify why motion causes matter to age slower in a comparable sense, and how this relates to relativistic effects caused by motion. A fresh analysis of motion, build on first axiom, delivers proof with its result, from which significant new understanding and computational power is gained.A review of experimental results demonstrates, that unaccelerated motion causes matter to age slower in a comparable, observer independent sense. Whilst focusing on this absolute effect, the present manuscript clarifies its context to relativistic effects, detailing their relationship and incorporating both into one consistent picture. The presented theoretical results make new predictions and are testable through suggested experiment of a novel nature. The manuscript finally arrives at an experimental tool and methodology, which as far as motion in ungravitated space is concerned or gravity appreciated, enables us to find the absolute observer independent picture of reality, which is reflected in the comparable display of atomic clocks.The discussion of the theoretical results, derives a physical causal understanding of gravity, a mathematical formulation of which, will be presented. Keywords: Kinematics, Gravity, Atomic clocks, Cosmic microwave background

Sea level rise at Honolulu and Hilo, Hawaii: GPS estimates of differential land motion

Science.gov (United States)

Caccamise, Dana J.; Merrifield, Mark A.; Bevis, Michael; Foster, James; Firing, Yvonne L.; Schenewerk, Mark S.; Taylor, Frederick W.; Thomas, Donald A.

2005-02-01

Since 1946, sea level at Hilo on the Big Island of Hawaii has risen an average of 1.8 +/- 0.4 mm/yr faster than at Honolulu on the island of Oahu. This difference has been attributed to subsidence of the Big Island. However, GPS measurements indicate that Hilo is sinking relative to Honolulu at a rate of -0.4 +/- 0.5 mm/yr, which is too small to account for the difference in sea level trends. In the past 30 years, there has been a statistically significant reduction in the relative sea level trend. While it is possible that the rates of land motion have changed over this time period, the available hydrographic data suggest that interdecadal variations in upper ocean temperature account for much of the differential sea level signal between the two stations, including the recent trend change. These results highlight the challenges involved in estimating secular sea level trends in the presence of significant low frequency variability.

The finite-difference and finite-element modeling of seismic wave propagation and earthquake motion

International Nuclear Information System (INIS)

Moczo, P.; Kristek, J.; Pazak, P.; Balazovjech, M.; Moczo, P.; Kristek, J.; Galis, M.

2007-01-01

Numerical modeling of seismic wave propagation and earthquake motion is an irreplaceable tool in investigation of the Earth's structure, processes in the Earth, and particularly earthquake phenomena. Among various numerical methods, the finite-difference method is the dominant method in the modeling of earthquake motion. Moreover, it is becoming more important in the seismic exploration and structural modeling. At the same time we are convinced that the best time of the finite-difference method in seismology is in the future. This monograph provides tutorial and detailed introduction to the application of the finite difference (FD), finite-element (FE), and hybrid FD-FE methods to the modeling of seismic wave propagation and earthquake motion. The text does not cover all topics and aspects of the methods. We focus on those to which we have contributed. We present alternative formulations of equation of motion for a smooth elastic continuum. We then develop alternative formulations for a canonical problem with a welded material interface and free surface. We continue with a model of an earthquake source. We complete the general theoretical introduction by a chapter on the constitutive laws for elastic and viscoelastic media, and brief review of strong formulations of the equation of motion. What follows is a block of chapters on the finite-difference and finite-element methods. We develop FD targets for the free surface and welded material interface. We then present various FD schemes for a smooth continuum, free surface, and welded interface. We focus on the staggered-grid and mainly optimally-accurate FD schemes. We also present alternative formulations of the FE method. We include the FD and FE implementations of the traction-at-split-nodes method for simulation of dynamic rupture propagation. The FD modeling is applied to the model of the deep sedimentary Grenoble basin, France. The FD and FE methods are combined in the hybrid FD-FE method. The hybrid

Validation of the Leap Motion Controller using markered motion capture technology.

Science.gov (United States)

Smeragliuolo, Anna H; Hill, N Jeremy; Disla, Luis; Putrino, David

2016-06-14

The Leap Motion Controller (LMC) is a low-cost, markerless motion capture device that tracks hand, wrist and forearm position. Integration of this technology into healthcare applications has begun to occur rapidly, making validation of the LMC׳s data output an important research goal. Here, we perform a detailed evaluation of the kinematic data output from the LMC, and validate this output against gold-standard, markered motion capture technology. We instructed subjects to perform three clinically-relevant wrist (flexion/extension, radial/ulnar deviation) and forearm (pronation/supination) movements. The movements were simultaneously tracked using both the LMC and a marker-based motion capture system from Motion Analysis Corporation (MAC). Adjusting for known inconsistencies in the LMC sampling frequency, we compared simultaneously acquired LMC and MAC data by performing Pearson׳s correlation (r) and root mean square error (RMSE). Wrist flexion/extension and radial/ulnar deviation showed good overall agreement (r=0.95; RMSE=11.6°, and r=0.92; RMSE=12.4°, respectively) with the MAC system. However, when tracking forearm pronation/supination, there were serious inconsistencies in reported joint angles (r=0.79; RMSE=38.4°). Hand posture significantly influenced the quality of wrist deviation (P<0.005) and forearm supination/pronation (P<0.001), but not wrist flexion/extension (P=0.29). We conclude that the LMC is capable of providing data that are clinically meaningful for wrist flexion/extension, and perhaps wrist deviation. It cannot yet return clinically meaningful data for measuring forearm pronation/supination. Future studies should continue to validate the LMC as updated versions of their software are developed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Five-dimensional motion compensation for respiratory and cardiac motion with cone-beam CT of the thorax region

Science.gov (United States)

Sauppe, Sebastian; Hahn, Andreas; Brehm, Marcus; Paysan, Pascal; Seghers, Dieter; Kachelrieß, Marc

2016-03-01

We propose an adapted method of our previously published five-dimensional (5D) motion compensation (MoCo) algorithm1, developed for micro-CT imaging of small animals, to provide for the first time motion artifact-free 5D cone-beam CT (CBCT) images from a conventional flat detector-based CBCT scan of clinical patients. Image quality of retrospectively respiratory- and cardiac-gated volumes from flat detector CBCT scans is deteriorated by severe sparse projection artifacts. These artifacts further complicate motion estimation, as it is required for MoCo image reconstruction. For high quality 5D CBCT images at the same x-ray dose and the same number of projections as todays 3D CBCT we developed a double MoCo approach based on motion vector fields (MVFs) for respiratory and cardiac motion. In a first step our already published four-dimensional (4D) artifact-specific cyclic motion-compensation (acMoCo) approach is applied to compensate for the respiratory patient motion. With this information a cyclic phase-gated deformable heart registration algorithm is applied to the respiratory motion-compensated 4D CBCT data, thus resulting in cardiac MVFs. We apply these MVFs on double-gated images and thereby respiratory and cardiac motion-compensated 5D CBCT images are obtained. Our 5D MoCo approach processing patient data acquired with the TrueBeam 4D CBCT system (Varian Medical Systems). Our double MoCo approach turned out to be very efficient and removed nearly all streak artifacts due to making use of 100% of the projection data for each reconstructed frame. The 5D MoCo patient data show fine details and no motion blurring, even in regions close to the heart where motion is fastest.

Direct reconstruction of parametric images for brain PET with event-by-event motion correction: evaluation in two tracers across count levels

Science.gov (United States)

Germino, Mary; Gallezot, Jean-Dominque; Yan, Jianhua; Carson, Richard E.

2017-07-01

Parametric images for dynamic positron emission tomography (PET) are typically generated by an indirect method, i.e. reconstructing a time series of emission images, then fitting a kinetic model to each voxel time activity curve. Alternatively, ‘direct reconstruction’, incorporates the kinetic model into the reconstruction algorithm itself, directly producing parametric images from projection data. Direct reconstruction has been shown to achieve parametric images with lower standard error than the indirect method. Here, we present direct reconstruction for brain PET using event-by-event motion correction of list-mode data, applied to two tracers. Event-by-event motion correction was implemented for direct reconstruction in the Parametric Motion-compensation OSEM List-mode Algorithm for Resolution-recovery reconstruction. The direct implementation was tested on simulated and human datasets with tracers [11C]AFM (serotonin transporter) and [11C]UCB-J (synaptic density), which follow the 1-tissue compartment model. Rigid head motion was tracked with the Vicra system. Parametric images of K 1 and distribution volume (V T  =  K 1/k 2) were compared to those generated by the indirect method by regional coefficient of variation (CoV). Performance across count levels was assessed using sub-sampled datasets. For simulated and real datasets at high counts, the two methods estimated K 1 and V T with comparable accuracy. At lower count levels, the direct method was substantially more robust to outliers than the indirect method. Compared to the indirect method, direct reconstruction reduced regional K 1 CoV by 35-48% (simulated dataset), 39-43% ([11C]AFM dataset) and 30-36% ([11C]UCB-J dataset) across count levels (averaged over regions at matched iteration); V T CoV was reduced by 51-58%, 54-60% and 30-46%, respectively. Motion correction played an important role in the dataset with larger motion: correction increased regional V T by 51% on average in the [11C

Free-field ground motions for the nonproliferation experiment: Preliminary comparisons with nearby nuclear events

International Nuclear Information System (INIS)

Olsen, K.H.; Peratt, A.L.

1994-01-01

Since 1987, we have installed fixed arrays of tri-axial accelerometers in the fire-field near the shot horizons for low-yield (≤ 20 kt) nuclear events in the N-tunnel complex beneath Rainier Mesa. For the Nonproliferation Experiment (NPE) we augmented the array to achieve 23 free-field stations. Goals are: (a) to examine robustness and stability of various free-field source function estimates -- e.g., reduced displacement potentials (RDP) and spectra; (b) to compare close-in with regional estimates to test whether detailed close-in free-field and/or surface ground motion data can improve predictability of regional-teleseismic source functions; (c) to provide experimental data for checking two-dimensional numerical simulations. We report preliminary comparisons between experimental free-field data for NPE (1993) and three nearby nuclear events (MISTY ECHO, 1988; MINERAL QUARRY, 1990; HUNTERS TROPHY, 1992). All four working points are within 1 km of each other in the same wet tuff bed, thus reducing concerns about possible large differences in material properties between widely separated shots. Initial comparison of acceleration and velocity seismograms for the four events reveals: (1) There is a large departure from the spherical symmetry commonly assumed in analytic treatments of source theory; both vertical and tangential components are surprisingly large. (2) All shots show similar first-peak particle-velocity amplitude decay rates suggesting significant attenuation even in the supposedly purely elastic region. (3) Sharp (>20 Hz) arrivals are not observed at tunnel level from near-surface pP reflections or spall-closure sources -- but broadened peaks are seen that suggest more diffuse reflected energy from the surface and from the Paleozoic limestone basement below tunnel level

Sea level and turbidity controls on mangrove soil surface elevation change

Science.gov (United States)

Lovelock, Catherine E.; Fernanda Adame, Maria; Bennion, Vicki; Hayes, Matthew; Reef, Ruth; Santini, Nadia; Cahoon, Donald R.

2015-01-01

Increases in sea level are a threat to seaward fringing mangrove forests if levels of inundation exceed the physiological tolerance of the trees; however, tidal wetlands can keep pace with sea level rise if soil surface elevations can increase at the same pace as sea level rise. Sediment accretion on the soil surface and belowground production of roots are proposed to increase with increasing sea level, enabling intertidal habitats to maintain their position relative to mean sea level, but there are few tests of these predictions in mangrove forests. Here we used variation in sea level and the availability of sediments caused by seasonal and inter-annual variation in the intensity of La Nina-El Nino to assess the effects of increasing sea level on surface elevation gains and contributing processes (accretion on the surface, subsidence and root growth) in mangrove forests. We found that soil surface elevation increased with mean sea level (which varied over 250 mm during the study) and with turbidity at sites where fine sediment in the water column is abundant. In contrast, where sediments were sandy, rates of surface elevation gain were high, but not significantly related to variation in turbidity, and were likely to be influenced by other factors that deliver sand to the mangrove forest. Root growth was not linked to soil surface elevation gains, although it was associated with reduced shallow subsidence, and therefore may contribute to the capacity of mangroves to keep pace with sea level rise. Our results indicate both surface (sedimentation) and subsurface (root growth) processes can influence mangrove capacity to keep pace with sea level rise within the same geographic location, and that current models of tidal marsh responses to sea level rise capture the major feature of the response of mangroves where fine, but not coarse, sediments are abundant.

Ultrafast MR imaging with EPI of organs undergoing nonperiodic motion

International Nuclear Information System (INIS)

Stehling, M.K.; Ordidge, R.J.; Howseman, A.M.; Coxon, R.; Chapman, B.; Mansfield, P.

1988-01-01

Conventional MR imaging employing repetitive data acquisition is susceptible to motion artifacts. Gating overcomes periodic motion effects. Nonperiodic motion, as encountered in the gastronintestinal tract, cardiac arrhythmias, unsedated children, and fetal imaging, thwarts conventional MR imaging. The EPI derivatives BEST and MBEST create a complex 128 x 128-pixel image in 64 msec and 128 msec, respectively, freezing motion almost completely. Sequentially recorded gastrointestinal-tract images allow quantitative evaluation of gastric and gut motility. Cardiac morphology, movement, and blood flow patterns in valvular heart disease have been depicted during atrial fibrillation. Selected clinical results with accompanying technical details illustrate the scope of EPI as a distinctive imaging modality

Detailed site effect estimation in the presence of strong velocity reversals within a small-aperture strong-motion array in Iceland

KAUST Repository

Rahpeyma, Sahar

2016-08-11

The rock site characterization for earthquake engineering applications in Iceland is common due to the easily exposed older bedrock and more recent volcanic lava rock. The corresponding site amplification is generally assumed to be low but has not been comprehensively quantified, especially for volcanic rock. The earthquake strong-motion of the Mw6.3 Ölfus earthquake on 29 May 2008 and 1705 of its aftershocks recorded on the first small-aperture strong-motion array (ICEARRAY I) in Iceland showed consistent and significant variations in ground motion amplitudes over short distances (<2 km) in an urban area located mostly on lava rock. This study analyses the aftershock recordings to quantify the local site effects using the Horizontal to Vertical Spectral Ratio (HVSR) and Standard Spectral Ratio (SSR) methods. Additionally, microseismic data has been collected at array stations and analyzed using the HVSR method. The results between the methods are consistent and show that while the amplification levels remain relatively low, the predominant frequency varies systematically between stations and is found to correlate with the geological units. In particular, for stations on lava rock the underlying geologic structure is characterized by repeated lava-soil stratigraphy characterized by reversals in the shear wave velocity with depth. As a result, standard modeling of HVSR using vertically incident body waves does not apply. Instead, modeling the soil structure as a two-degree-of-freedom dynamic system is found to capture the observed predominant frequencies of site amplification. The results have important implications for earthquake resistant design of structures on rock sites characterized by velocity reversals. © 2016 Elsevier Ltd

The Motion Of A Deformable Body In - Bounded Fluid

International Nuclear Information System (INIS)

Galpert, A.R.; Miloh, T.

1998-01-01

The Hamiltonian formalism for the motion of a deformable body in an inviscid irrotational fluid is generalized for the case of the motion in a bounded fluid. We found that the presence of the boundaries in a liquid leads to the chaotization of the body's motion. The ('memory' effect connected with a free surface boundary condition is also accounted for

Motion sickness, stress and the endocannabinoid system.

Directory of Open Access Journals (Sweden)

Alexander Choukèr

Full Text Available BACKGROUND: A substantial number of individuals are at risk for the development of motion sickness induced nausea and vomiting (N&V during road, air or sea travel. Motion sickness can be extremely stressful but the neurobiologic mechanisms leading to motion sickness are not clear. The endocannabinoid system (ECS represents an important neuromodulator of stress and N&V. Inhibitory effects of the ECS on N&V are mediated by endocannabinoid-receptor activation. METHODOLOGY/PRINCIPAL FINDINGS: We studied the activity of the ECS in human volunteers (n = 21 during parabolic flight maneuvers (PFs. During PFs, microgravity conditions (<10(-2 g are generated for approximately 22 s which results in a profound kinetic stimulus. Blood endocannabinoids (anandamide and 2-arachidonoylglycerol, 2-AG were measured from blood samples taken in-flight before start of the parabolic maneuvers, after 10, 20, and 30 parabolas, in-flight after termination of PFs and 24 h later. Volunteers who developed acute motion sickness (n = 7 showed significantly higher stress scores but lower endocannabinoid levels during PFs. After 20 parabolas, blood anandamide levels had dropped significantly in volunteers with motion sickness (from 0.39+/-0.40 to 0.22+/-0.25 ng/ml but increased in participants without the condition (from 0.43+/-0.23 to 0.60+/-0.38 ng/ml resulting in significantly higher anandamide levels in participants without motion sickness (p = 0.02. 2-AG levels in individuals with motion sickness were low and almost unchanged throughout the experiment but showed a robust increase in participants without motion sickness. Cannabinoid-receptor 1 (CB1 but not cannabinoid-receptor 2 (CB2 mRNA expression in leucocytes 4 h after the experiment was significantly lower in volunteers with motion sickness than in participants without N&V. CONCLUSIONS/SIGNIFICANCE: These findings demonstrate that stress and motion sickness in humans are associated with impaired endocannabinoid

Numerical Simulation of Droplet Motion and Two-Phase Flow Field in an Oscillating Container

Directory of Open Access Journals (Sweden)

T Watanabe

2016-09-01

Full Text Available The dynamic motion of the droplet in the oscillating flow field is simulated numerically using the arbitrary Lagrangian-Eulerian and level set coupled method. It is shown that radiating flows are generated from the droplet surface in the oscillating direction and the droplet moves toward the pressure node. The translational motion of the droplet is caused by the density variation, while the radiating flows are by the pressure variation. The flow field around the droplet in the oscillating container is found to be similar to that around the oscillating droplet in the stationary container.

Motion sensing energy controller

International Nuclear Information System (INIS)

Saphir, M.E.; Reed, M.A.

1984-01-01

A moving object sensing processor responsive to slowly varying motions of a human being or other moving object in a zone of interest employs high frequency pulse modulated non-visible radiation generated by a radiation generating source, such as an LED, and detected by a detector sensitive to radiation of a preselected wavelength which generates electrical signals representative of the reflected radiation received from the zone of interest. The detectorsignals are processed to normalize the base level and remove variations due to background level changes, and slowly varying changes in the signals are detected by a bi-polar threshold detector. The control signals generated by the threshold detector in response to slowly varying motion are used to control the application of power to a utilization device, such as a set of fluoroescent lights in a room, the power being applied in response to detection of such motion and being automatically terminated in the absence of such motion after a predetermined time period established by a settable incrementable counter

Adaptive motion of animals and machines

National Research Council Canada - National Science Library

Kimura, Hiroshi

2006-01-01

... single function in a control system and mechanism. That is, adaptation in motion is induced at every level from the central nervous system to the musculoskeletal system. Thus, we organized the International Symposium on Adaptive Motion in Animals and Machines (AMAM) for scientists and engineers concerned with adaptation on various levels to be broug...

Detailed Tropical Sea Level Record Spanning the Younger Dryas Chronozone

Science.gov (United States)

Abdul, N. A.; Mortlock, R. A.; Wright, J. D.; Fairbanks, R. G.

2010-12-01

Variability in sea level is a fundamental measure of past changes in continental ice volume and provides an important benchmark to test climate change hypotheses. Records of the most recent deglaciation show two pulses of accelerated sea-level rise (Meltwater Pulses 1A and 1B) separated by an interval of slower sea level rise. The Younger Dryas chronozone falls within the interval between MWP 1A and 1B. It was first described over 100 years ago and remains one of the most studied periods in Earth’s history. The Younger Dryas was originally constrained with 14C dating to the interval between 11,000 and 10,000 14C years BP, which converts to 13,000 to 11,640 calendar years BP. The climatic expression of the Younger Dryas was most pronounced in the circum North Atlantic where climate proxies returned in some regions to near glacial values. Interpretations of the Younger Dryas’ significance range from a catastrophic global cooling event accompanied by Northern hemisphere ice sheet growth to simply regional changes in ocean and air mass mixing zones confined mainly to the North Atlantic. A detailed sea level record containing the interval from the end of MWP 1A to the beginning of MWP 1B (~14,000 to 11,300 years BP) was generated using 26 new U/Th dates from our 2007 Barbados offshore drilling expedition combined with our 1988 expedition measurements. 16 of these dates fall within the Younger Dryas Chronozone. Younger Dryas sea level positions were based on Acropora palmata samples from 3 overlapping and contemporaneous offshore drill cores (RGF 12 and BBDS 9 & 10) and corrected for minor tectonic uplift. From 14,000 to 11,300 years BP, sea level rose from ~81 to 56.5 m below present sea level with an initial rate of 10 m/kyr that decreased smoothly to <5 m/kyr at the base of MWP 1B. At the beginning of the Younger Dryas, sea level was at 69 m below present and rose 8 m by the end of this interval. In the context of the Barbados sea level record, the Younger Dryas

Motion-encoded dose calculation through fluence/sinogram modification

International Nuclear Information System (INIS)

Lu, Weiguo; Olivera, Gustavo H.; Mackie, Thomas R.

2005-01-01

Conventional radiotherapy treatment planning systems rely on a static computed tomography (CT) image for planning and evaluation. Intra/inter-fraction patient motions may result in significant differences between the planned and the delivered dose. In this paper, we develop a method to incorporate the knowledge of intra/inter-fraction patient motion directly into the dose calculation. By decomposing the motion into a parallel (to beam direction) component and perpendicular (to beam direction) component, we show that the motion effects can be accounted for by simply modifying the fluence distribution (sinogram). After such modification, dose calculation is the same as those based on a static planning image. This method is superior to the 'dose-convolution' method because it is not based on 'shift invariant' assumption. Therefore, it deals with material heterogeneity and surface curvature very well. We test our method using extensive simulations, which include four phantoms, four motion patterns, and three plan beams. We compare our method with the 'dose-convolution' and the 'stochastic simulation' methods (gold standard). As for the homogeneous flat surface phantom, our method has similar accuracy as the 'dose-convolution' method. As for all other phantoms, our method outperforms the 'dose-convolution'. The maximum motion encoded dose calculation error using our method is within 4% of the gold standard. It is shown that a treatment planning system that is based on 'motion-encoded dose calculation' can incorporate random and systematic motion errors in a very simple fashion. Under this approximation, in principle, a planning target volume definition is not required, since it already accounts for the intra/inter-fraction motion variations and it automatically optimizes the cumulative dose rather than the single fraction dose

DIFFERENCES ON THE MOTION KNOWLEDGE LEVEL AT THE MALE STUDENTS IN SOME HIGH SCHOOLS IN THE REPUBLIC OF MACEDONIA

Directory of Open Access Journals (Sweden)

Viktor Mitrevski

2011-03-01

Full Text Available With the research in this labour we want to realize the difference among the high school students` motion knowledge in different cities in Macedonia. This research consists of 135, 15 years old examinees, all students in high school, Ist class, divided into 3 sub samples The classification was made according the number of the classes and the number of the students who regularly attend the tuition. The analysis on the motorics level was conducted on the polygon for checking the psychophysical alertness of the students. For the differences` determination among the students` groups were used uni variant analyses of variable (ANOVA and post hock analyses (LSD test. From the gained results we can notice that there are many differences among the students` groups on the motion level.

PHOTOMETRIC STEREO SHAPE-AND-ALBEDO-FROM-SHADING FOR PIXEL-LEVEL RESOLUTION LUNAR SURFACE RECONSTRUCTION

Directory of Open Access Journals (Sweden)

W. C. Liu

2017-07-01

Full Text Available Shape and Albedo from Shading (SAfS techniques recover pixel-wise surface details based on the relationship between terrain slopes, illumination and imaging geometry, and the energy response (i.e., image intensity captured by the sensing system. Multiple images with different illumination geometries (i.e., photometric stereo can provide better SAfS surface reconstruction due to the increase in observations. Photometric stereo SAfS is suitable for detailed surface reconstruction of the Moon and other extra-terrestrial bodies due to the availability of photometric stereo and the less complex surface reflecting properties (i.e., albedo of the target bodies as compared to the Earth. Considering only one photometric stereo pair (i.e., two images, pixel-variant albedo is still a major obstacle to satisfactory reconstruction and it needs to be regulated by the SAfS algorithm. The illumination directional difference between the two images also becomes an important factor affecting the reconstruction quality. This paper presents a photometric stereo SAfS algorithm for pixel-level resolution lunar surface reconstruction. The algorithm includes a hierarchical optimization architecture for handling pixel-variant albedo and improving performance. With the use of Lunar Reconnaissance Orbiter Camera - Narrow Angle Camera (LROC NAC photometric stereo images, the reconstructed topography (i.e., the DEM is compared with the DEM produced independently by photogrammetric methods. This paper also addresses the effect of illumination directional difference in between one photometric stereo pair on the reconstruction quality of the proposed algorithm by both mathematical and experimental analysis. In this case, LROC NAC images under multiple illumination directions are utilized by the proposed algorithm for experimental comparison. The mathematical derivation suggests an illumination azimuthal difference of 90 degrees between two images is recommended to achieve

Automatic Generation of Building Models with Levels of Detail 1-3

Science.gov (United States)

Nguatem, W.; Drauschke, M.; Mayer, H.

2016-06-01

We present a workflow for the automatic generation of building models with levels of detail (LOD) 1 to 3 according to the CityGML standard (Gröger et al., 2012). We start with orienting unsorted image sets employing (Mayer et al., 2012), we compute depth maps using semi-global matching (SGM) (Hirschmüller, 2008), and fuse these depth maps to reconstruct dense 3D point clouds (Kuhn et al., 2014). Based on planes segmented from these point clouds, we have developed a stochastic method for roof model selection (Nguatem et al., 2013) and window model selection (Nguatem et al., 2014). We demonstrate our workflow up to the export into CityGML.

On the physical and chemical details of alumina atomic layer deposition: A combined experimental and numerical approach

International Nuclear Information System (INIS)

Pan, Dongqing; Ma, Lulu; Xie, Yuanyuan; Yuan, Chris; Jen, Tien Chien

2015-01-01

Alumina thin film is typically studied as a model atomic layer deposition (ALD) process due to its high dielectric constant, high thermal stability, and good adhesion on various wafer surfaces. Despite extensive applications of alumina ALD in microelectronics industries, details on the physical and chemical processes are not yet well understood. ALD experiments are not able to shed adequate light on the detailed information regarding the transient ALD process. Most of current numerical approaches lack detailed surface reaction mechanisms, and their results are not well correlated with experimental observations. In this paper, the authors present a combined experimental and numerical study on the details of flow and surface reactions in alumina ALD using trimethylaluminum and water as precursors. Results obtained from experiments and simulations are compared and correlated. By experiments, growth rate on five samples under different deposition conditions is characterized. The deposition rate from numerical simulation agrees well with the experimental results. Details of precursor distributions in a full cycle of ALD are studied numerically to bridge between experimental observations and simulations. The 3D transient numerical model adopts surface reaction kinetics and mechanisms based on atomic-level studies to investigate the surface deposition process. Surface deposition is shown as a strictly self-limited process in our numerical studies. ALD is a complex strong-coupled fluid, thermal and chemical process, which is not only heavily dependent on the chemical kinetics and surface conditions but also on the flow and material distributions

Analysis of motion in speed skating

Science.gov (United States)

Koga, Yuzo; Nishimura, Tetsu; Watanabe, Naoki; Okamoto, Kousuke; Wada, Yuhei

1997-03-01

A motion on sports has been studied by many researchers from the view of the medical, psychological and mechanical fields. Here, we try to analyze a speed skating motion dynamically for an aim of performing the best record. As an official competition of speed skating is performed on the round rink, the skating motion must be studied on the three phases, that is, starting phase, straight and curved course skating phase. It is indispensable to have a visual data of a skating motion in order to analyze kinematically. So we took a several subject's skating motion by 8 mm video cameras in order to obtain three dimensional data. As the first step, the movement of the center of gravity of skater (abbreviate to C. G.) is discussed in this paper, because a skating motion is very complicated. The movement of C. G. will give an information of the reaction force to a skate blade from the surface of ice. We discuss the discrepancy of several skating motion by studied subjects. Our final goal is to suggest the best skating form for getting the finest record.

Quantum Theory of Conducting Matter Newtonian Equations of Motion for a Bloch Electron

CERN Document Server

Fujita, Shigeji

2007-01-01

Quantum Theory of Conducting Matter: Newtonian Equations of Motion for a Bloch Electron targets scientists, researchers and graduate-level students focused on experimentation in the fields of physics, chemistry, electrical engineering, and material sciences. It is important that the reader have an understanding of dynamics, quantum mechanics, thermodynamics, statistical mechanics, electromagnetism and solid-state physics. Many worked-out problems are included in the book to aid the reader's comprehension of the subject. The Bloch electron (wave packet) moves by following the Newtonian equation of motion. Under an applied magnetic field B the electron circulates around the field B counterclockwise or clockwise depending on the curvature of the Fermi surface. The signs of the Hall coefficient and the Seebeck coefficient are known to give the sign of the major carrier charge. For alkali metals, both are negative, indicating that the carriers are "electrons." These features arise from the Fermi surface difference...

Inter-fraction variations in respiratory motion models

Energy Technology Data Exchange (ETDEWEB)

McClelland, J R; Modat, M; Ourselin, S; Hawkes, D J [Centre for Medical Image Computing, University College London (United Kingdom); Hughes, S; Qureshi, A; Ahmad, S; Landau, D B, E-mail: j.mcclelland@cs.ucl.ac.uk [Department of Oncology, Guy' s and St Thomas' s Hospitals NHS Trust, London (United Kingdom)

2011-01-07

Respiratory motion can vary dramatically between the planning stage and the different fractions of radiotherapy treatment. Motion predictions used when constructing the radiotherapy plan may be unsuitable for later fractions of treatment. This paper presents a methodology for constructing patient-specific respiratory motion models and uses these models to evaluate and analyse the inter-fraction variations in the respiratory motion. The internal respiratory motion is determined from the deformable registration of Cine CT data and related to a respiratory surrogate signal derived from 3D skin surface data. Three different models for relating the internal motion to the surrogate signal have been investigated in this work. Data were acquired from six lung cancer patients. Two full datasets were acquired for each patient, one before the course of radiotherapy treatment and one at the end (approximately 6 weeks later). Separate models were built for each dataset. All models could accurately predict the respiratory motion in the same dataset, but had large errors when predicting the motion in the other dataset. Analysis of the inter-fraction variations revealed that most variations were spatially varying base-line shifts, but changes to the anatomy and the motion trajectories were also observed.

Optimizing monoscopic kV fluoro acquisition for prostate intrafraction motion evaluation

International Nuclear Information System (INIS)

Adamson, Justus; Wu Qiuwen

2009-01-01

Monoscopic kV imaging during radiotherapy has been recently implemented for prostate intrafraction motion evaluation. However, the accuracy of 3D localization techniques from monoscopic imaging of prostate and the effect of acquisition parameters on the 3D accuracy have not been studied in detail, with imaging dose remaining a concern. In this paper, we investigate methods to optimize the kV acquisition parameters and imaging protocol to achieve improved 3D localization and 2D image registration accuracy for minimal imaging dose. Prostate motion during radiotherapy was simulated using existing cine-MRI measurements, and was used to investigate the accuracy of various 3D localization techniques and the effect of the kV acquisition protocol. We also investigated the relationship between mAs and the accuracy of the 2D image registration for localization of fiducial markers and we measured imaging dose for a 30 cm diameter phantom to evaluate the necessary dose to achieve acceptable image registration accuracy. Simulations showed that the error in assuming the shortest path to localize the prostate in 3D using monoscopic imaging during a typical IMRT fraction will be less than ∼1.5 mm for 95% of localizations, and will also depend on prostate motion distribution, treatment duration and image acquisition and treatment protocol. Most uncertainty cannot be reduced from higher imaging frequency or acquiring during gantry rotation between beams. Measured maximum surface dose to the cylindrical phantom from monoscopic kV intrafraction acquisitions varied between 0.4 and 5.5 mGy, depending on the acquisition protocol, and was lower than the required dose for CBCT (21.1 mGy). Imaging dose can be lowered by ∼15-40% when mAs is optimized with acquisition angle. Images acquired during MV beam delivery require increased mAs to obtain the same level of registration accuracy, with mAs/registration increasing roughly linearly with field size and dose rate.

Enhancing physics demos using iPhone slow motion

Science.gov (United States)

Lincoln, James

2017-12-01

Slow motion video enhances our ability to perceive and experience the physical world. This can help students and teachers especially in cases of fast moving objects or detailed events that happen too quickly for the eye to follow. As often as possible, demonstrations should be performed by the students themselves and luckily many of them will already have this technology in their pockets. The "S" series of iPhone has the slow motion video feature standard, which also includes simultaneous sound recording (somewhat unusual among slow motion cameras). In this article I share some of my experiences using this feature and provide advice on how to successfully use this technology in the classroom.

Surface core-level shifts for simple metals

DEFF Research Database (Denmark)

Aldén, Magnus; Skriver, Hans Lomholt; Johansson, Börje

1994-01-01

screening, whereby a SCLS becomes equivalent to the surface segregation energy of a core-ionized atom, a quantity we obtain by separate bulk and surface impurity calculations. The results are in good agreement with experiment in most of those cases where the data originates from single-crystal measurements....... We discuss the surface shifts of the electrostatic potentials and the band centers in order to trace the microscopic origin of the SCLS in the simple metals and find that the anomalous subsurface core-level shifts in beryllium are caused by charge dipoles, which persist several layers into the bulk...

Numerical Algorithms for Acoustic Integrals - The Devil is in the Details

Science.gov (United States)

Brentner, Kenneth S.

1996-01-01

The accurate prediction of the aeroacoustic field generated by aerospace vehicles or nonaerospace machinery is necessary for designers to control and reduce source noise. Powerful computational aeroacoustic methods, based on various acoustic analogies (primarily the Lighthill acoustic analogy) and Kirchhoff methods, have been developed for prediction of noise from complicated sources, such as rotating blades. Both methods ultimately predict the noise through a numerical evaluation of an integral formulation. In this paper, we consider three generic acoustic formulations and several numerical algorithms that have been used to compute the solutions to these formulations. Algorithms for retarded-time formulations are the most efficient and robust, but they are difficult to implement for supersonic-source motion. Collapsing-sphere and emission-surface formulations are good alternatives when supersonic-source motion is present, but the numerical implementations of these formulations are more computationally demanding. New algorithms - which utilize solution adaptation to provide a specified error level - are needed.

Ultrasensitive, passive and wearable sensors for monitoring human muscle motion and physiological signals.

Science.gov (United States)

Cai, Feng; Yi, Changrui; Liu, Shichang; Wang, Yan; Liu, Lacheng; Liu, Xiaoqing; Xu, Xuming; Wang, Li

2016-03-15

Flexible sensors have attracted more and more attention as a fundamental part of anthropomorphic robot research, medical diagnosis and physical health monitoring. Here, we constructed an ultrasensitive and passive flexible sensor with the advantages of low cost, lightness and wearability, electric safety and reliability. The fundamental mechanism of the sensor is based on triboelectric effect inducing electrostatic charges on the surfaces between two different materials. Just like a plate capacitor, current will be generated while the distance or size of the parallel capacitors changes caused by the small mechanical disturbance upon it and therefore the output current/voltage will be produced. Typically, the passive sensor unambiguously monitors muscle motions including hand motion from stretch-clench-stretch, mouth motion from open-bite-open, blink and respiration. Moreover, this sensor records the details of the consecutive phases in a cardiac cycle of the apex cardiogram, and identify the peaks including percussion wave, tidal wave and diastolic wave of the radial pulse wave. To record subtle human physiological signals including radial pulsilogram and apex cardiogram with excellent signal/noise ratio, stability and reproducibility, the sensor shows great potential in the applications of medical diagnosis and daily health monitoring. Copyright © 2015 Elsevier B.V. All rights reserved.

Improving the effectiveness of detailed processing by dynamic control of processing with high sports range

Directory of Open Access Journals (Sweden)

Yu.V. Shapoval

2017-12-01

Full Text Available In this article the possibility of increasing the efficiency of the processing of parts with a diameter of up to 20 mm is analyzed, namely: vibration resistance of the cutting process at pinching due to cutting speed control in the processing, forecasting and selection of rotational frequencies, which ensure the stability of the processing system, controlling the dynamics of the process of displacement of the additional mass. The method of investigation of vibration processes during the sharpening is developed. As a result of the processing of experimental data, it was found that when an oscillatory motion is applied to the spindle rotation, the overall level of oscillation decreases, which is reflected on the quality of the treated surface. The choice of a previously known spindle rotation frequency range at which the lowest value of the oscillation amplitude of the instrument is observed in the radial direction to the detail part, allows you to increase the processing efficiency while maintaining the drawing requirements for roughness by increasing the spindle rotational speed. The combination of the node of the own forms of oscillation and the cutting zone, by dynamically controlling the fluctuations of the lathe armature due to the increase of the inertia characteristics of the machine and the reduction of the oscillation amplitude of the tool, can improve the accuracy of machining and roughness of the processed surface of the component at higher spindle speeds.

FJ-2207 measuring instrument detection pipe surface a level of pollution method

International Nuclear Information System (INIS)

Wang Jiangong

2010-01-01

On the pipe surface contamination were detected α level of pollution is a frequently encountered dose-detection work. Because the pipeline surface arc, while the measuring probe for the plane, which for accurate measurement difficult. In this paper, on the FJ-2207-type pipe surface contamination measuring instrument measuring pollution levels in the α method was studied. Introduced the FJ-2207 measuring instrument detection pipe surface α pollution levels. Studied this measuring instrument on the same sources of surface, plane α level of radioactivity measured differences in the results obtained control of the apparatus when the direct measurement of the surface correction factor, and gives 32-216 specifications commonly used pipe direct measurement of the amendment factor. Convenient method, test results are reliable for the accurate measurement of pipe pollution levels in the surface of α as a reference and learning. (authors)

Analyses of surface motions caused by the magnitude 9.0 2004 Sumatra earthquake

DEFF Research Database (Denmark)

Khan, Shfaqat Abbas; Gudmundsson, Ó.

The Sumatra, Indonesia, earthquake on December 26th was one of the most devastating earthquakes in history. With a magnitude of Mw = 9.0 it is the forth largest earthquake recorded since 1900. It occurred about one hundred kilometers off the west coast of northern Sumatra, where the relatively thin...... of years. The result was a devastating tsunami hitting coastlines across the Indian Ocean killing more than 225,000 people in Sri Lanka, India, Indonesia, Thailand and Malaysia. An earthquake of this magnitude is expected to involve a displacement on the fault on the order of 10 meters. But, what...... was the actual amplitude of the surface motions that triggered the tsunami? This can be constrained using the amplitudes of elastic waves radiated from the earthquake, or by direct measurements of deformation. Here we present estimates of the deformation based on continuous Global Positioning System (GPS...

On the Calculation of Quantum Mechanical Ground States from Classical Geodesic Motion on Certain Spaces of Constant Negative Curvature

CERN Document Server

Tomaschitz, R

1989-01-01

We consider geodesic motion on three-dimensional Riemannian manifolds of constant negative curvature, topologically equivalent to S x ]0,1[, S a compact surface of genus two. To those trajectories which are bounded and recurrent in both directions of the time evolution a fractal limit set is associated whose Hausdorff dimension is intimately connected with the quantum mechanical energy ground state, determined by the Schrodinger operator on the manifold. We give a rather detailed and pictorial description of the hyperbolic spaces we have in mind, discuss various aspects of classical and quantum mechanical motion on them as far as they are needed to establish the connection between energy ground state and Hausdorff dimension and give finally some examples of ground state calculations in terms of Hausdorff dimensions of limit sets of classical trajectories.

Level crossing analysis of growing surfaces

International Nuclear Information System (INIS)

Shahbazi, F; Sobhanian, S; Tabar, M Reza Rahimi; Khorram, S; Frootan, G R; Zahed, H

2003-01-01

We investigate the average frequency of positive slope ν + α , crossing the height α = h - h-bar in the surface growing processes. The exact level crossing analysis of the random deposition model and the Kardar-Parisi-Zhang equation in the strong coupling limit before creation of singularities is given

Structural origin of Si-2p core-level shifts from Si(100)-c[4x2] surface: A spectral x-ray photoelectron diffraction study

Energy Technology Data Exchange (ETDEWEB)

Chen, X.; Tonner, B.P. [Univ. of Wisconsin, Milwaukee, WI (United States); Denlinger, J. [Univ. of Wisconsin, Milwaukee, WI (United States)][Ernest Orlando Lawrence Berkeley National Lab., CA (United States)] [and others

1997-04-01

The authors have performed angle-resolved x-ray photoelectron diffraction (XPD) from a Si(100)-c(4x2) surface to study the structural origin of Si-2p core-level shifts. In the experiment, the highly resolved surface Si-2p core-level spectra were measured as a fine grid of hemisphere and photon energies, using the SpectroMicroscopy Facility {open_quotes}ultraESCA{close_quotes} instrument. By carefully decomposing the spectra into several surface peaks, the authors are able to obtain surface-atom resolved XPD patterns. Using a multiple scattering analysis, they derived a detailed atomic model for the Si(100)-c(4x2) surface. In this model, the asymmetric dimers were found tilted by 11.5 plus/minus 2.0 degrees with bond length of 2.32 plus/minus 0.05{angstrom}. By matching model XPD patterns to experiment, the authors can identify which atoms in the reconstructed surface are responsible for specific photoemission lines in the 2p spectrum.

Measurement and Quantification of Gross Human Shoulder Motion

Directory of Open Access Journals (Sweden)

Jeremy T. Newkirk

2013-01-01

Full Text Available The shoulder girdle plays an important role in the large pointing workspace that humans enjoy. The goal of this work was to characterize the human shoulder girdle motion in relation to the arm. The overall motion of the human shoulder girdle was characterized based on motion studies completed on test subjects during voluntary (natural/unforced motion. The collected data from the experiments were used to develop surface fit equations that represent the position and orientation of the glenohumeral joint for a given humeral pointing direction. These equations completely quantify gross human shoulder girdle motion relative to the humerus. The equations are presented along with goodness-of-fit results that indicate the equations well approximate the motion of the human glenohumeral joint. This is the first time the motion has been quantified for the entire workspace, and the equations provide a reference against which to compare future work.

Motion database of disguised and non-disguised team handball penalty throws by novice and expert performers

Directory of Open Access Journals (Sweden)

Fabian Helm

2017-12-01

Full Text Available This article describes the motion database for a large sample (n = 2400 of 7-m penalty throws in team handball that includes 1600 disguised throws. Throws were performed by both novice (n = 5 and expert (n = 5 penalty takers. The article reports the methods and materials used to capture the motion data. The database itself is accessible for download via JLU Web Server and provides all raw files in a three-dimensional motion data format (.c3d. Additional information is given on the marker placement of the penalty taker, goalkeeper, and ball together with details on the skill level and/or playing history of the expert group. The database was first used by Helm et al. (2017 [1] to investigate the kinematic patterns of disguised movements. Results of this analysis are reported and discussed in their article “Kinematic patterns underlying disguised movements: Spatial and temporal dissimilarity compared to genuine movement patterns” (doi:10.1016/j.humov.2017.05.010 [1]. Keywords: Motion capture data, Disguise, Expertise

Ab initio surface core-level shifts and surface segregation energies

DEFF Research Database (Denmark)

Aldén, Magnus; Skriver, Hans Lomholt; Johansson, Börje

1993-01-01

We have calculated the surface core-level energy shifts of the 4d and 5d transition metals by means of local-density theory and a Green’s-function technique based on the linear muffin-tin orbitals method. Final-state effects are included by treating the core-ionized atom as an impurity located in...

Synthesis of Cyclic Polymers and Characterization of Their Diffusive Motion in the Melt State at the Single Molecule Level

KAUST Repository

Habuchi, Satoshi; Yamamoto, Takuya; Tezuka, Yasuyuki

2016-01-01

We demonstrate a method for the synthesis of cyclic polymers and a protocol for characterizing their diffusive motion in a melt state at the single molecule level. An electrostatic self-assembly and covalent fixation (ESA-CF) process is used

Detailed Geological Modelling in Urban Areas focused on Structures relevant to the Near Surface Groundwater Flow in the context of Climatic Changes

Science.gov (United States)

Bach, T.; Pallesen, T. M.; Jensen, N. P.; Mielby, S.; Sandersen, P.; Kristensen, M.

2015-12-01

This case demonstrates a practical example from the city of Odense (DK) where new geological modeling techniques has been developed and used in the software GeoScene3D, to create a detailed voxel model of the anthropogenic layer. The voxel model has been combined with a regional hydrostratigraphic layer model. The case is part of a pilot project partly financed by VTU (Foundation for Development of Technology in the Danish Water Sector) and involves many different datatypes such as borehole information, geophysical data, human related elements (landfill, pipelines, basements, roadbeds etc). In the last few years, there has been increased focus on detailed geological modeling in urban areas. The models serve as important input to hydrological models. This focus is partly due to climate changes as high intensity rainfalls are seen more often than in the past, and water recharge is a topic too. In urban areas, this arises new challenges. There is a need of a high level of detailed geological knowledge for the uppermost zone of the soil, which typically are problematic due to practically limitations, especially when using geological layer models. Furthermore, to accommodate the need of a high detail, all relevant available data has to be used in the modeling process. Human activity has deeply changed the soil layers, e.g. by constructions as roadbeds, buildings with basements, pipelines, landfill etc. These elements can act as barriers or pathways regarding surface near groundwater flow and can attribute to local flooding or mobilization and transport of contaminants etc. A geological voxel model is built by small boxes (a voxel). Each box can contain several parameters, ex. lithology, transmissivity or contaminant concentration. Human related elements can be implemented using tools, which gives the modeler advanced options for making detailed small-scale models. This case demonstrates the workflow and the resulting geological model for the pilot area.

The cortical basis of true memory and false memory for motion.

Science.gov (United States)

Karanian, Jessica M; Slotnick, Scott D

2014-02-01

Behavioral evidence indicates that false memory, like true memory, can be rich in sensory detail. By contrast, there is fMRI evidence that true memory for visual information produces greater activity in earlier visual regions than false memory, which suggests true memory is associated with greater sensory detail. However, false memory in previous fMRI paradigms may have lacked sufficient sensory detail to recruit earlier visual processing regions. To investigate this possibility in the present fMRI study, we employed a paradigm that produced feature-specific false memory with a high degree of visual detail. During the encoding phase, moving or stationary abstract shapes were presented to the left or right of fixation. During the retrieval phase, shapes from encoding were presented at fixation and participants classified each item as previously "moving" or "stationary" within each visual field. Consistent with previous fMRI findings, true memory but not false memory for motion activated motion processing region MT+, while both true memory and false memory activated later cortical processing regions. In addition, false memory but not true memory for motion activated language processing regions. The present findings indicate that true memory activates earlier visual regions to a greater degree than false memory, even under conditions of detailed retrieval. Thus, the dissociation between previous behavioral findings and fMRI findings do not appear to be task dependent. Future work will be needed to assess whether the same pattern of true memory and false memory activity is observed for different sensory modalities. Copyright © 2013 Elsevier Ltd. All rights reserved.

Symmetry Motion Classes; Cambridge Conference on School Mathematics Feasibility Study No. 40.

Science.gov (United States)

McLane, Lyn

These materials were written with the aim of reflecting the thinking of The Cambridge Conference on School Mathematics (CCSM) regarding the goals and objectives for school mathematics. This document details the planning and response for each of ten lessons involving symmetry motions. The problems focused on (1) combining motions in a given order,…

Status of Ground Motion Mitigation Techniques for CLIC

CERN Document Server

Snuverink, J; Collette, C; Duarte Ramos, F; Gaddi, A; Gerwig, H; Janssens, S; Pfingstner, J; Schulte, D; Balik, G; Brunetti, L; Jeremie, A; Burrows, P; Caron, B; Resta-Lopez, J

2011-01-01

The Compact Linear Collider (CLIC) accelerator has strong stability requirements on the position of the beam. In particular, the beam position will be sensitive to ground motion. A number of mitigation techniques are proposed - quadrupole stabilisation and positioning, final doublet stabilisation as well as beam based orbit and interaction point (IP) feedback. Integrated studies of the impact of the ground motion on the CLIC Main Linac (ML) and Beam Delivery System (BDS) have been performed, which model the hardware and beam performance in detail. Based on the results future improvements of the mitigation techniques are suggested and simulated. It is shown that with the current design the tight luminosity budget for ground motion effects is fulfilled and accordingly, an essential feasibility issue of CLIC has been addressed.

Level tracking in detailed reactor simulations

Energy Technology Data Exchange (ETDEWEB)

Aktas, B.; Mahaffy, J.H. [Pennsylvania State Univ., University Park, PA (United States)

1995-09-01

We introduce a useful test problem for judging the performance of reactor safety codes in situations where moving two-phase mixture levels are present. The test problem tracks a two-phase liquid level as it rises and then falls back to its original position. Pure air exists above the level, and a low void air-water mixture is below the level. Conditions are subcooled and isothermal to remove complications resulting from failures of interfacial heat transfer packages to properly account for the level. Comparisons are made between the performance of current versions of CATHARE, RELAP5, TRAC-BF1, and TRAC-PF1. These system codes are based on finite-difference methods with a fixed, Eulerian staggered grid in space. When a partially filled cell with a mixture level discontinuity becomes the donor cell, the sharp changes in fluid properties across the interface results in numerical oscillations of various terms. Furthermore, the cell-to-cell convection of mass, momentum and energy are inaccurately predicted nearby a mixture level. To adequately model moving mixture levels, an efficient discontinuity tracking method for the finite-difference Eulerian approximations is described. This model had been implemented in the TRAC-BWR code for the two-phase mixture level tracking since the TRAC-BD1 Version (released April 1984). The result of the test problem run by the current version of TRAC-BF1/MOD1 with the mixture level tracking model shows some peculiar behavior of the variables such as velocities, pressures and interfacial terms. A systematic approach to improving performance of the tracking method is described. Implementing this approach in TRAC-BF1/MOD1 has shown a major improvement in the results.

Chaotic Motion of Nonlinearly Coupled Quintic Oscillators | Adeloye ...

African Journals Online (AJOL)

With a fixed energy, we investigate the motion of two nonlinearly coupled quintic oscillators for various values of the coupling strength with the aid of the Poincare surface of section. It is observed that chaotic motion sets in for coupling strength as low as 0.001. The degree of chaoticity generally increases as the coupling ...

[Restricted motion after total knee arthroplasty].

Science.gov (United States)

Kucera, T; Urban, K; Karpas, K; Sponer, P

2007-10-01

patients. In these, the average value of knee flexion increased by 17 degrees only and, in the patients suffering from excessive adhesion production, this value remained almost unchanged. Revision TKA was carried out in four patients, in whom knee joint flexion increased on average by 35 degrees to achieve an average flexion of 83 degrees. Restricted motion after TKA has been reported to range from 1.3 % to 12.0 %, but consistent criteria have not been set up. In our study it was 4.14 %. In agreement with the literature data, one of the reasons was pre-operative restricted motion, which was recorded in 16 of 32 patients. Similarly, also in our patients, biological predisposition to excessive production of fibrocartilage associated with adhesions in all knee joint compartments was the major therapeutic problem. Intra-operative fractures, ligament tears requiring post-operative fixation and unremoved dorsal osteophytes lead to the restriction of knee joint motion. By inadequate resection of articular surface, the original joint line may be at a higher level; this results in an increased tension of the posterior cruciate ligament and patella infera development, both influencing knee flexion. In our study, three patients were affected. Knee joint stiffness can also develop in patients declining physical therapy or in whom this is not correctly performed, often for insufficient analgesia. In contrast to the data reported in the literature, 17 of 32 patients in this study had no need for surgical treatment of restricted knee joint motion. Redress under general anesthesia was not effective. For markedly restricted motion of the knee joint, reimplantation can be recommended or, in less severe cases, an intervention on adjacent soft tissues. Restricted motion of the knee joint after TKA is difficult to treat and, therefore, prevention is recommended. This should include thorough conservative treatment of gonarthrosis, early indication for surgery, prevention of elevation in the

Measures and Relative Motions of Some Mostly F. G. W. Struve Doubles

Science.gov (United States)

Wiley, E. O.

2012-04-01

Measures of 59 pairs of double stars with long observational histories using "lucky imaging" techniques are reported. Relative motions of 59 pairs are investigated using histories of observation, scatter plots of relative motion, ordinary least-squares (OLS) and total proper motion analyses performed in "R," an open source programming language. A scatter plot of the coefficient of determinations derived from the OLS y|epoch and OLS x|epoch clearly separates common proper motion pairs from optical pairs and what are termed "long-period binary candidates." Differences in proper motion separate optical pairs from long-term binary candidates. An Appendix is provided that details how to use known rectilinear pairs as calibration pairs for the program REDUC.

High-precision drop shape analysis (HPDSA) of quasistatic contact angles on silanized silicon wafers with different surface topographies during inclining-plate measurements: Influence of the surface roughness on the contact line dynamics

International Nuclear Information System (INIS)

Heib, F.; Hempelmann, R.; Munief, W.M.; Ingebrandt, S.; Fug, F.; Possart, W.; Groß, K.; Schmitt, M.

2015-01-01

relative to the first boundary points X B,10 . Therefore, sessile drops during the inclination of the sample surface are video recorded and different specific contact angle events in dependence on the acceleration/deceleration of the triple line motion are analyzed. This procedure results in characteristically density distributions in dependence on the surface properties. The used procedures lead to the possibility to investigate influences on contact angles more in detail

High-precision drop shape analysis (HPDSA) of quasistatic contact angles on silanized silicon wafers with different surface topographies during inclining-plate measurements: Influence of the surface roughness on the contact line dynamics

Energy Technology Data Exchange (ETDEWEB)

Heib, F., E-mail: f.heib@mx.uni-saarland.de [Department of Physical Chemistry, Saarland University, 66123 Saarbrücken (Germany); Hempelmann, R. [Department of Physical Chemistry, Saarland University, 66123 Saarbrücken (Germany); Munief, W.M.; Ingebrandt, S. [Department of Informatics and Microsystem Technology, University of Applied Sciences, Kaiserslautern, 66482 Zweibrücken (Germany); Fug, F.; Possart, W. [Department of Adhesion and Interphases in Polymers, Saarland University, 66123 Saarbrücken (Germany); Groß, K.; Schmitt, M. [Department of Physical Chemistry, Saarland University, 66123 Saarbrücken (Germany)

2015-07-01

line dis relative to the first boundary points X{sub B,10}. Therefore, sessile drops during the inclination of the sample surface are video recorded and different specific contact angle events in dependence on the acceleration/deceleration of the triple line motion are analyzed. This procedure results in characteristically density distributions in dependence on the surface properties. The used procedures lead to the possibility to investigate influences on contact angles more in detail.

Teaching Motion with the Global Positioning System

Science.gov (United States)

Budisa, Marko; Planinsic, Gorazd

2003-01-01

We have used the GPS receiver and a PC interface to track different types of motion. Various hands-on experiments that enlighten the physics of motion at the secondary school level are suggested (visualization of 2D and 3D motion, measuring car drag coefficient and fuel consumption). (Contains 8 figures.)

Drop detachment and motion on fuel cell electrode materials.

Science.gov (United States)

Gauthier, Eric; Hellstern, Thomas; Kevrekidis, Ioannis G; Benziger, Jay

2012-02-01

Liquid water is pushed through flow channels of fuel cells, where one surface is a porous carbon electrode made up of carbon fibers. Water drops grow on the fibrous carbon surface in the gas flow channel. The drops adhere to the superficial fiber surfaces but exhibit little penetration into the voids between the fibers. The fibrous surfaces are hydrophobic, but there is a substantial threshold force necessary to initiate water drop motion. Once the water drops begin to move, however, the adhesive force decreases and drops move with minimal friction, similar to motion on superhydrophobic materials. We report here studies of water wetting and water drop motion on typical porous carbon materials (carbon paper and carbon cloth) employed in fuel cells. The static coefficient of friction on these textured surfaces is comparable to that for smooth Teflon. But the dynamic coefficient of friction is several orders of magnitude smaller on the textured surfaces than on smooth Teflon. Carbon cloth displays a much smaller static contact angle hysteresis than carbon paper due to its two-scale roughness. The dynamic contact angle hysteresis for carbon paper is greatly reduced compared to the static contact angle hysteresis. Enhanced dynamic hydrophobicity is suggested to result from the extent to which a dynamic contact line can track topological heterogeneities of the liquid/solid interface.

CHAOTIC MOTION OF CHARGED PARTICLES IN AN ELECTROMAGNETIC FIELD SURROUNDING A ROTATING BLACK HOLE

International Nuclear Information System (INIS)

Takahashi, Masaaki; Koyama, Hiroko

2009-01-01

The observational data from some black hole candidates suggest the importance of electromagnetic fields in the vicinity of a black hole. Highly magnetized disk accretion may play an importance rule, and large-scale magnetic field may be formed above the disk surface. Then, we expect that the nature of the black hole spacetime would be revealed by magnetic phenomena near the black hole. We will start investigating the motion of a charged test particle which depends on the initial parameter setting in the black hole dipole magnetic field, which is a test field on the Kerr spacetime. Particularly, we study the spin effects of a rotating black hole on the motion of the charged test particle trapped in magnetic field lines. We make detailed analysis for the particle's trajectories by using the Poincare map method, and show the chaotic properties that depend on the black hole spin. We find that the dragging effects of the spacetime by a rotating black hole weaken the chaotic properties and generate regular trajectories for some sets of initial parameters, while the chaotic properties dominate on the trajectories for slowly rotating black hole cases. The dragging effects can generate the fourth adiabatic invariant on the particle motion approximately.

An externally and internally deformable, programmable lung motion phantom

Energy Technology Data Exchange (ETDEWEB)

Cheung, Yam; Sawant, Amit, E-mail: amit.sawant@utsouthwestern.edu [UT Southwestern Medical Center, University of Texas, Dallas, Texas 75390 (United States)

2015-05-15

Purpose: Most clinically deployed strategies for respiratory motion management in lung radiotherapy (e.g., gating and tracking) use external markers that serve as surrogates for tumor motion. However, typical lung phantoms used to validate these strategies are based on a rigid exterior and a rigid or a deformable-interior. Such designs do not adequately represent respiration because the thoracic anatomy deforms internally as well as externally. In order to create a closer approximation of respiratory motion, the authors describe the construction and experimental testing of an externally as well as internally deformable, programmable lung phantom. Methods: The outer shell of a commercially available lung phantom (RS-1500, RSD, Inc.) was used. The shell consists of a chest cavity with a flexible anterior surface, and embedded vertebrae, rib-cage and sternum. A custom-made insert was designed using a piece of natural latex foam block. A motion platform was programmed with sinusoidal and ten patient-recorded lung tumor trajectories. The platform was used to drive a rigid foam “diaphragm” that compressed/decompressed the phantom interior. Experimental characterization comprised of determining the reproducibility and the external–internal correlation of external and internal marker trajectories extracted from kV x-ray fluoroscopy. Experiments were conducted to illustrate three example applications of the phantom—(i) validating the geometric accuracy of the VisionRT surface photogrammetry system; (ii) validating an image registration tool, NiftyReg; and (iii) quantifying the geometric error due to irregular motion in four-dimensional computed tomography (4DCT). Results: The phantom correctly reproduced sinusoidal and patient-derived motion, as well as realistic respiratory motion-related effects such as hysteresis. The reproducibility of marker trajectories over multiple runs for sinusoidal as well as patient traces, as characterized by fluoroscopy, was within 0

Target Trailing With Safe Navigation for Maritime Autonomous Surface Vehicles

Science.gov (United States)

Wolf, Michael; Kuwata, Yoshiaki; Zarzhitsky, Dimitri V.

2013-01-01

This software implements a motion-planning module for a maritime autonomous surface vehicle (ASV). The module trails a given target while also avoiding static and dynamic surface hazards. When surface hazards are other moving boats, the motion planner must apply International Regulations for Avoiding Collisions at Sea (COLREGS). A key subset of these rules has been implemented in the software. In case contact with the target is lost, the software can receive and follow a "reacquisition route," provided by a complementary system, until the target is reacquired. The programmatic intention is that the trailed target is a submarine, although any mobile naval platform could serve as the target. The algorithmic approach to combining motion with a (possibly moving) goal location, while avoiding local hazards, may be applicable to robotic rovers, automated landing systems, and autonomous airships. The software operates in JPL s CARACaS (Control Architecture for Robotic Agent Command and Sensing) software architecture and relies on other modules for environmental perception data and information on the predicted detectability of the target, as well as the low-level interface to the boat controls.

Drops on hydrophobic surfaces & vibrated fluid surfaces

DEFF Research Database (Denmark)

Wind-Willassen, Øistein

in the literature. Furthermore, we quantify the energy associated with center of mass translation and internal fluid motion. The model predicts trajectories for tracer particles deposited inside the drop, and satisfactorily describes the sliding motion of steadily accelerating droplets. The model can be used...... numerically, and the results are compared to experiments. We provide, again, the most detailed regime diagram of the possible orbits depending on the forcing and the rotation rate of the fluid bath. We highlight each class of orbit, and analyze in depth the wobbling state, precessing orbits, wobble...

Auditory motion capturing ambiguous visual motion

Directory of Open Access Journals (Sweden)

Arjen eAlink

2012-01-01

Full Text Available In this study, it is demonstrated that moving sounds have an effect on the direction in which one sees visual stimuli move. During the main experiment sounds were presented consecutively at four speaker locations inducing left- or rightwards auditory apparent motion. On the path of auditory apparent motion, visual apparent motion stimuli were presented with a high degree of directional ambiguity. The main outcome of this experiment is that our participants perceived visual apparent motion stimuli that were ambiguous (equally likely to be perceived as moving left- or rightwards more often as moving in the same direction than in the opposite direction of auditory apparent motion. During the control experiment we replicated this finding and found no effect of sound motion direction on eye movements. This indicates that auditory motion can capture our visual motion percept when visual motion direction is insufficiently determinate without affecting eye movements.

Capillary waves in slow motion

International Nuclear Information System (INIS)

Seydel, Tilo; Tolan, Metin; Press, Werner; Madsen, Anders; Gruebel, Gerhard

2001-01-01

Capillary wave dynamics on glycerol surfaces has been investigated by means of x-ray photon correlation spectroscopy performed at grazing angles. The measurements show that thermally activated capillary wave motion is slowed down exponentially when the sample is cooled below 273 K. This finding directly reflects the freezing of the surface waves. The wave-number dependence of the measured time constants is in quantitative agreement with theoretical predictions for overdamped capillary waves

Research on near-surface disposal of very low level radioactive waste

International Nuclear Information System (INIS)

Wang Shaowei; Yue Huiguo; Hou Jie; Chen Haiying; Zuo Rui; Wang Jinsheng

2012-01-01

Radioactive waste disposal is one of the most sensitive environmental problems to control and solve. As the arriving of decommissioning of early period nuclear facilities in China, large amounts of very low level radioactive waste will be produced inevitably. The domestic and abroad definitions about very low level radioactive waste and its disposal were introduced, and then siting principles of near-surface disposal of very low level radioactive waste were discussed. The near- surface disposal siting methods of very low level radioactive waste were analyzed from natural and geographical conditions assessment, geological conditions analysis, hydrogeological conditions analysis, geological hazard assessment and radioactive background investigation; the near-surface disposal sites'natural barriers of very low level radioactive waste were analyzed from the crustal structure and physico-chemical characteristics, the dynamics characteristics of groundwater, the radionuclide adsorption characteristics of natural barriers and so on; the near-surface disposal sites' engineered barriers of very low level radioactive waste were analyzed from the repository design, the repository barrier materials selection and so on. Finally, the improving direction of very low level radioactive waste disposal was proposed. (authors)

Method for including detailed evaluation of daylight levels in Be06

DEFF Research Database (Denmark)

Petersen, Steffen

2008-01-01

Good daylight conditions in office buildings have become an important issue due to new European regulatory demands which include energy consumption for electrical lighting in the building energy frame. Good daylight conditions in offices are thus in increased focus as an energy conserving measure....... In order to evaluate whether a certain design is good daylight design or not building designers must perform detailed evaluation of daylight levels, including the daylight performance of dynamic solar shadings, and include these in the energy performance evaluation. However, the mandatory national...... calculation tool in Denmark (Be06) for evaluating the energy performance of buildings is currently using a simple representation of available daylight in a room and simple assumptions regarding the control of shading devices. In a case example, this is leading to an overestimation of the energy consumption...

A neural model of the temporal dynamics of figure-ground segregation in motion perception.

Science.gov (United States)

Raudies, Florian; Neumann, Heiko

2010-03-01

How does the visual system manage to segment a visual scene into surfaces and objects and manage to attend to a target object? Based on psychological and physiological investigations, it has been proposed that the perceptual organization and segmentation of a scene is achieved by the processing at different levels of the visual cortical hierarchy. According to this, motion onset detection, motion-defined shape segregation, and target selection are accomplished by processes which bind together simple features into fragments of increasingly complex configurations at different levels in the processing hierarchy. As an alternative to this hierarchical processing hypothesis, it has been proposed that the processing stages for feature detection and segregation are reflected in different temporal episodes in the response patterns of individual neurons. Such temporal epochs have been observed in the activation pattern of neurons as low as in area V1. Here, we present a neural network model of motion detection, figure-ground segregation and attentive selection which explains these response patterns in an unifying framework. Based on known principles of functional architecture of the visual cortex, we propose that initial motion and motion boundaries are detected at different and hierarchically organized stages in the dorsal pathway. Visual shapes that are defined by boundaries, which were generated from juxtaposed opponent motions, are represented at different stages in the ventral pathway. Model areas in the different pathways interact through feedforward and modulating feedback, while mutual interactions enable the communication between motion and form representations. Selective attention is devoted to shape representations by sending modulating feedback signals from higher levels (working memory) to intermediate levels to enhance their responses. Areas in the motion and form pathway are coupled through top-down feedback with V1 cells at the bottom end of the hierarchy

Detailed balance of the Feynman micromotor

Science.gov (United States)

Abbott, Derek; Davis, Bruce R.; Parrondo, Juan M. R.

1999-09-01

One existing implication of micromotors is that they can be powered by rectifying non-equilibrium thermal fluctuations or mechanical vibrations via the so-called Feynman- micromotor. An example of mechanical rectification is found in the batteryless wristwatch. The original concept was described in as early as 1912 by Smoluchowski and was later revisited in 1963 by Feynman, in the context of rectifying thermal fluctuations to obtain useful motion. It has been shown that, although rectification is impossible at equilibrium, it is possible for the Feynman-micromotor to perform work under non-equilibrium conditions. These concepts can now be realized by MEMS technology and may have exciting implications in biomedicine - where the Feynman- micromotor can be used to power a smart pill, for example. Previously, Feynman's analysis of the motor's efficiency has been shown to be flawed by Parrondo and Espanol. We now show there are further problems in Feynman's treatment of detailed balance. In order to design and understand this device correctly, the equations of detailed balance must be found. Feynman's approach was to use probabilities based on energies and we show that this is problematic. In this paper, we demonstrate corrected equations using level crossing probabilities instead. A potential application of the Feynman-micromotor is a batteryless nanopump that consists of a small MEMS chip that adheres to the skin of a patient and dispense nanoliter quantities of medication. Either mechanical or thermal rectification via a Feynman- micromotor, as the power source, is open for possible investigation.

Surface Chloride Levels in Colorado Structural Concrete

Science.gov (United States)

2018-01-01

This project focused on the chloride-induced corrosion of reinforcing steel in structural concrete. The primary goal of this project is to analyze the surface chloride concentration level of the concrete bridge decks throughout Colorado. The study in...

Motion of Adsorbed Nano-Particles on Azobenzene Containing Polymer Films

Directory of Open Access Journals (Sweden)

Sarah Loebner

2016-12-01

Full Text Available We demonstrate in situ recorded motion of nano-objects adsorbed on a photosensitive polymer film. The motion is induced by a mass transport of the underlying photoresponsive polymer material occurring during irradiation with interference pattern. The polymer film contains azobenzene molecules that undergo reversible photoisomerization reaction from trans- to cis-conformation. Through a multi-scale chain of physico-chemical processes, this finally results in the macro-deformations of the film due to the changing elastic properties of polymer. The topographical deformation of the polymer surface is sensitive to a local distribution of the electrical field vector that allows for the generation of dynamic changes in the surface topography during irradiation with different light interference patterns. Polymer film deformation together with the motion of the adsorbed nano-particles are recorded using a homemade set-up combining an optical part for the generation of interference patterns and an atomic force microscope for acquiring the surface deformation. The particles undergo either translational or rotational motion. The direction of particle motion is towards the topography minima and opposite to the mass transport within the polymer film. The ability to relocate particles by photo-induced dynamic topography fluctuation offers a way for a non-contact simultaneous manipulation of a large number of adsorbed particles just in air at ambient conditions.

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Automatic Measurement of Low Level Contamination on Concrete Surfaces

International Nuclear Information System (INIS)

Tachibana, M.; Itoh, H.; Shimada, T.; Yanagihara, S.

2002-01-01

Automatic measurement of radioactivity is necessary for considering cost effectiveness in final radiological survey of building structures in decommissioning nuclear facilities. The RAPID (radiation measuring pilot device for surface contamination) was developed to be applied to automatic measurement of low level contamination on concrete surfaces. The RAPID has a capability to measure contamination with detection limit of 0.14 Bq/cm2 for 60Co in 30 seconds of measurement time and its efficiency is evaluated to be 5 m2/h in a normal measurement option. It was confirmed that low level contamination on concrete surfaces could be surveyed by the RAPID efficiently compared with direct measurement by workers through its actual application

On the calculation of quantum mechanical ground states from classical geodesic motion on certain spaces of constant negative curvature

International Nuclear Information System (INIS)

Tomaschitz, R.

1989-01-01

We consider geodesic motion on three-dimensional Riemannian manifolds of constant negative curvature, topologically equivalent to S x ]0,1[, S a compact surface of genus two. To those trajectories which are recurrent in both directions of the time evolution t → +∞, t → -∞ a fractal limit set is associated whose Hausdorff dimension is intimately connected with the quantum mechanical energy ground state, determined by the Schroedinger operator on the manifold. We give a rather detailed and pictorial description of the hyperbolic spaces we have in mind, discuss various aspects of classical and quantum mechanical motion on them as far as they are needed to establish the connection between energy ground state and Hausdorff dimension and give finally some examples of ground state calculations in terms of Hausdorff dimensions of limit sets of classical trajectories. (orig.)

SU-E-J-252: A Motion Algorithm to Extract Physical and Motion Parameters of a Mobile Target in Cone-Beam Computed Tomographic Imaging Retrospective to Image Reconstruction

Energy Technology Data Exchange (ETDEWEB)

Ali, I; Ahmad, S [University of Oklahoma Health Sciences, Oklahoma City, OK (United States); Alsbou, N [Department of Electrical and Computer Engineering, Ada, OH (United States)

2014-06-01

Purpose: A motion algorithm was developed to extract actual length, CT-numbers and motion amplitude of a mobile target imaged with cone-beam-CT (CBCT) retrospective to image-reconstruction. Methods: The motion model considered a mobile target moving with a sinusoidal motion and employed three measurable parameters: apparent length, CT number level and gradient of a mobile target obtained from CBCT images to extract information about the actual length and CT number value of the stationary target and motion amplitude. The algorithm was verified experimentally with a mobile phantom setup that has three targets with different sizes manufactured from homogenous tissue-equivalent gel material embedded into a thorax phantom. The phantom moved sinusoidal in one-direction using eight amplitudes (0–20mm) and a frequency of 15-cycles-per-minute. The model required imaging parameters such as slice thickness, imaging time. Results: This motion algorithm extracted three unknown parameters: length of the target, CT-number-level, motion amplitude for a mobile target retrospective to CBCT image reconstruction. The algorithm relates three unknown parameters to measurable apparent length, CT-number-level and gradient for well-defined mobile targets obtained from CBCT images. The motion model agreed with measured apparent lengths which were dependent on actual length of the target and motion amplitude. The cumulative CT-number for a mobile target was dependent on CT-number-level of the stationary target and motion amplitude. The gradient of the CT-distribution of mobile target is dependent on the stationary CT-number-level, actual target length along the direction of motion, and motion amplitude. Motion frequency and phase did not affect the elongation and CT-number distributions of mobile targets when imaging time included several motion cycles. Conclusion: The motion algorithm developed in this study has potential applications in diagnostic CT imaging and radiotherapy to extract

Nanostructured surfaces for microfluidics and sensing applications.

Energy Technology Data Exchange (ETDEWEB)

Picraux, Samuel Thomas (Arizona State University); Piech, Marcin (United Technologies Corp.); Schneider, John F.; Vail, Sean (Arizona State University); Hayes, Mark A. (Arizona State University); Garcia, Anthony A.; Bell, Nelson Simmons; Gust, D (Arizona State University); Yang, Dongqing (Arizona State University)

2007-01-01

The present work demonstrates the use of light to move liquids on a photoresponsive monolayer, providing a new method for delivering analyses in lab-on-chip environments for microfluidic systems. The light-driven motion of liquids was achieved on photoresponsive azobenzene modified surfaces. The surface energy components of azobenzene modified surfaces were calculated by Van Oss theory. The motion of the liquid was achieved by generation of a surface tension gradient by isomerization of azobenzene monolayers using UV and Visible light, thereby establishing a surface energy heterogeneity on the edge of the droplet. Contact angle measurements of various solvents were used to demonstrate the requirement for fluid motion.

Resonant coherent ionization in grazing ion/atom-surface collisions at high velocities

Energy Technology Data Exchange (ETDEWEB)

Garcia de Abajo, F J [Dept. de Ciencias de la Computacion e Inteligencia Artificial, Facultad de Informatica, Univ. del Pais Vasco, San Sebastian (Spain); Pitarke, J M [Materia Kondentsatuaren Fisika Saila, Zientzi Fakultatea, Euskal Herriko Univ., Bilbo (Spain)

1994-05-01

The resonant coherent interaction of a fast ion/atom with an oriented crystal surface under grazing incidence conditions is shown to contribute significantly to ionize the probe for high enough velocities and motion along a random direction. The dependence of this process on both the distance to the surface and the velocity of the projectile is studied in detail. We focus on the case of hydrogen moving with a velocity above 2 a.u. Comparison with other mechanisms of charge transfer, such as capture from inner shells of the target atoms, permits us to draw some conclusions about the charge state of the outgoing projectiles. (orig.)

Resonant coherent ionization in grazing ion/atom-surface collisions at high velocities

International Nuclear Information System (INIS)

Garcia de Abajo, F.J.; Pitarke, J.M.

1994-01-01

The resonant coherent interaction of a fast ion/atom with an oriented crystal surface under grazing incidence conditions is shown to contribute significantly to ionize the probe for high enough velocities and motion along a random direction. The dependence of this process on both the distance to the surface and the velocity of the projectile is studied in detail. We focus on the case of hydrogen moving with a velocity above 2 a.u. Comparison with other mechanisms of charge transfer, such as capture from inner shells of the target atoms, permits us to draw some conclusions about the charge state of the outgoing projectiles. (orig.)

Motion of air bubbles in stagnant water condition

International Nuclear Information System (INIS)

Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

2004-01-01

Full text: In this study, air bubble motion in stagnant water condition in a vertical pipe is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature

Motion of air bubbles in stagnant water condition

International Nuclear Information System (INIS)

Bezdegumeli, U.; Ozdemir, S.; Yesin, O.

2004-01-01

In this study, air bubble motion in stagnant water condition in a vertical pipe of 4.6 cm diameter is investigated experimentally. For this purpose, a test set-up was designed and constructed. Motions of single bubbles, having different diameters in the range of 3.0-4.8 mm, were recorded by using a monochrome camera, an image capture card and a PC. Recorded video images were processed to analyse bubble motion and to obtain the necessary data. The purpose of the study is to determine the variation of bubble axial velocity and bubble drag coefficient as a function of equivalent bubble diameter and bubble Reynolds number, Re b . Therefore, detailed information for this range of bubble diameters was obtained. The results have shown good consistency with the previous studies found in the literature. (author)

The INGV Real Time Strong Motion Database

Science.gov (United States)

Massa, Marco; D'Alema, Ezio; Mascandola, Claudia; Lovati, Sara; Scafidi, Davide; Gomez, Antonio; Carannante, Simona; Franceschina, Gianlorenzo; Mirenna, Santi; Augliera, Paolo

2017-04-01

The INGV real time strong motion data sharing is assured by the INGV Strong Motion Database. ISMD (http://ismd.mi.ingv.it) was designed in the last months of 2011 in cooperation among different INGV departments, with the aim to organize the distribution of the INGV strong-motion data using standard procedures for data acquisition and processing. The first version of the web portal was published soon after the occurrence of the 2012 Emilia (Northern Italy), Mw 6.1, seismic sequence. At that time ISMD was the first European real time web portal devoted to the engineering seismology community. After four years of successfully operation, the thousands of accelerometric waveforms collected in the archive need necessary a technological improvement of the system in order to better organize the new data archiving and to make more efficient the answer to the user requests. ISMD 2.0 was based on PostgreSQL (www.postgresql.org), an open source object- relational database. The main purpose of the web portal is to distribute few minutes after the origin time the accelerometric waveforms and related metadata of the Italian earthquakes with ML≥3.0. Data are provided both in raw SAC (counts) and automatically corrected ASCII (gal) formats. The web portal also provide, for each event, a detailed description of the ground motion parameters (i.e. Peak Ground Acceleration, Velocity and Displacement, Arias and Housner Intensities) data converted in velocity and displacement, response spectra up to 10.0 s and general maps concerning the recent and the historical seismicity of the area together with information about its seismic hazard. The focal parameters of the events are provided by the INGV National Earthquake Center (CNT, http://cnt.rm.ingv.it). Moreover, the database provides a detailed site characterization section for each strong motion station, based on geological, geomorphological and geophysical information. At present (i.e. January 2017), ISMD includes 987 (121

GAIA: A WINDOW TO LARGE-SCALE MOTIONS

Energy Technology Data Exchange (ETDEWEB)

Nusser, Adi [Physics Department and the Asher Space Science Institute-Technion, Haifa 32000 (Israel); Branchini, Enzo [Department of Physics, Universita Roma Tre, Via della Vasca Navale 84, 00146 Rome (Italy); Davis, Marc, E-mail: adi@physics.technion.ac.il, E-mail: branchin@fis.uniroma3.it, E-mail: mdavis@berkeley.edu [Departments of Astronomy and Physics, University of California, Berkeley, CA 94720 (United States)

2012-08-10

Using redshifts as a proxy for galaxy distances, estimates of the two-dimensional (2D) transverse peculiar velocities of distant galaxies could be obtained from future measurements of proper motions. We provide the mathematical framework for analyzing 2D transverse motions and show that they offer several advantages over traditional probes of large-scale motions. They are completely independent of any intrinsic relations between galaxy properties; hence, they are essentially free of selection biases. They are free from homogeneous and inhomogeneous Malmquist biases that typically plague distance indicator catalogs. They provide additional information to traditional probes that yield line-of-sight peculiar velocities only. Further, because of their 2D nature, fundamental questions regarding vorticity of large-scale flows can be addressed. Gaia, for example, is expected to provide proper motions of at least bright galaxies with high central surface brightness, making proper motions a likely contender for traditional probes based on current and future distance indicator measurements.

Synthesis of High-Frequency Ground Motion Using Information Extracted from Low-Frequency Ground Motion

Science.gov (United States)

Iwaki, A.; Fujiwara, H.

2012-12-01

Broadband ground motion computations of scenario earthquakes are often based on hybrid methods that are the combinations of deterministic approach in lower frequency band and stochastic approach in higher frequency band. Typical computation methods for low-frequency and high-frequency (LF and HF, respectively) ground motions are the numerical simulations, such as finite-difference and finite-element methods based on three-dimensional velocity structure model, and the stochastic Green's function method, respectively. In such hybrid methods, LF and HF wave fields are generated through two different methods that are completely independent of each other, and are combined at the matching frequency. However, LF and HF wave fields are essentially not independent as long as they are from the same event. In this study, we focus on the relation among acceleration envelopes at different frequency bands, and attempt to synthesize HF ground motion using the information extracted from LF ground motion, aiming to propose a new method for broad-band strong motion prediction. Our study area is Kanto area, Japan. We use the K-NET and KiK-net surface acceleration data and compute RMS envelope at four frequency bands: 0.5-1.0 Hz, 1.0-2.0 Hz, 2.0-4.0 Hz, .0-8.0 Hz, and 8.0-16.0 Hz. Taking the ratio of the envelopes of adjacent bands, we find that the envelope ratios have stable shapes at each site. The empirical envelope-ratio characteristics are combined with low-frequency envelope of the target earthquake to synthesize HF ground motion. We have applied the method to M5-class earthquakes and a M7 target earthquake that occurred in the vicinity of Kanto area, and successfully reproduced the observed HF ground motion of the target earthquake. The method can be applied to a broad band ground motion simulation for a scenario earthquake by combining numerically-computed low-frequency (~1 Hz) ground motion with the empirical envelope ratio characteristics to generate broadband ground motion

Estimating Vertical Land Motion in the Chesapeake Bay

Science.gov (United States)

Houttuijn Bloemendaal, L.; Hensel, P.

2017-12-01

This study aimed to provide a modern measurement of subsidence in the Chesapeake Bay region and establish a methodology for measuring vertical land motion using static GPS, a cheaper alternative to InSAR or classical leveling. Vertical land motion in this area is of particular concern because tide gages are showing up to 5 mm/yr of local, relative sea level rise. While a component of this rate is the actual eustatic sea level rise itself, part of the trend may also be vertical land motion, in which subsidence exacerbates the effects of actual changes in sea level. Parts of this region are already experiencing an increase in the frequency and magnitude of near-shore coastal flooding, but the last comprehensive study of vertical land motion in this area was conducted by NOAA in 1974 (Holdahl & Morrison) using repeat leveled lines. More recent measures of vertical land motion can help inform efforts on resilience to sea level rise, such as in the Hampton Roads area. This study used measured GPS-derived vertical heights in conjunction with legacy GPS data to calculate rates of vertical motion at several points in time for a selection of benchmarks scattered throughout the region. Seventeen marks in the stable Piedmont area and in the areas suspected of subsidence in the Coastal Plain were selected for the analysis. Results indicate a significant difference between the rates of vertical motion in the Piedmont and Coastal Plain, with a mean rate of -4.10 mm/yr in the Coastal Plain and 0.15 mm/yr in the Piedmont. The rates indicate particularly severe subsidence at the southern Delmarva Peninsula coast and the Hampton-Roads area, with a mean rate of -6.57 mm/yr in that region. By knowing local rates of subsidence as opposed to sea level change itself, coastal managers may make better informed decisions regarding natural resource use, such as deciding whether or not to reduce subsurface fluid withdrawals or to consider injecting treated water back into the aquifer to slow

Hierarchical Motion Planning for Autonomous Aerial and Terrestrial Vehicles

Science.gov (United States)

Cowlagi, Raghvendra V.

Autonomous mobile robots---both aerial and terrestrial vehicles---have gained immense importance due to the broad spectrum of their potential military and civilian applications. One of the indispensable requirements for the autonomy of a mobile vehicle is the vehicle's capability of planning and executing its motion, that is, finding appropriate control inputs for the vehicle such that the resulting vehicle motion satisfies the requirements of the vehicular task. The motion planning and control problem is inherently complex because it involves two disparate sub-problems: (1) satisfaction of the vehicular task requirements, which requires tools from combinatorics and/or formal methods, and (2) design of the vehicle control laws, which requires tools from dynamical systems and control theory. Accordingly, this problem is usually decomposed and solved over two levels of hierarchy. The higher level, called the geometric path planning level, finds a geometric path that satisfies the vehicular task requirements, e.g., obstacle avoidance. The lower level, called the trajectory planning level, involves sufficient smoothening of this geometric path followed by a suitable time parametrization to obtain a reference trajectory for the vehicle. Although simple and efficient, such hierarchical decomposition suffers a serious drawback: the geometric path planner has no information of the kinematical and dynamical constraints of the vehicle. Consequently, the geometric planner may produce paths that the trajectory planner cannot transform into a feasible reference trajectory. Two main ideas appear in the literature to remedy this problem: (a) randomized sampling-based planning, which eliminates the geometric planner altogether by planning in the vehicle state space, and (b) geometric planning supported by feedback control laws. The former class of methods suffer from a lack of optimality of the resultant trajectory, while the latter class of methods makes a restrictive assumption

Dynamics of gas-surface interactions atomic-level understanding of scattering processes at surfaces

CERN Document Server

Díez Muniño, Ricardo

2013-01-01

This book gives a representative survey of the state of the art of research on gas-surface interactions. It provides an overview of the current understanding of gas surface dynamics and, in particular, of the reactive and non-reactive processes of atoms and small molecules at surfaces. Leading scientists in the field, both from the theoretical and the experimental sides, write in this book about their most recent advances. Surface science grew as an interdisciplinary research area over the last decades, mostly because of new experimental technologies (ultra-high vacuum, for instance), as well as because of a novel paradigm, the ‘surface science’ approach. The book describes the second transformation which is now taking place pushed by the availability of powerful quantum-mechanical theoretical methods implemented numerically. In the book, experiment and theory progress hand in hand with an unprecedented degree of accuracy and control. The book presents how modern surface science targets the atomic-level u...

Motion of the tympanic membrane after cartilage tympanoplasty determined by stroboscopic holography.

Science.gov (United States)

Aarnisalo, Antti A; Cheng, Jeffrey T; Ravicz, Michael E; Furlong, Cosme; Merchant, Saumil N; Rosowski, John J

2010-05-01

Stroboscopic holography was used to quantify dynamic deformations of the tympanic membrane (TM) of the entire surface of the TM before and after cartilage tympanoplasty of the posterior or posterior-superior part of the TM. Cartilage is widely used in tympanoplasties to provide mechanical stability for the TM. Three human cadaveric temporal bones were used. A 6 mm x 3 mm oval cartilage graft was placed through the widely opened facial recess onto the medial surface of the posterior or posterior-superior part of the TM. The graft was either in contact with the bony tympanic rim and manubrium or not. Graft thickness was either 0.5 or 1.0mm. Stroboscopic holography produced displacement amplitude and phase maps of the TM surface in response to stimulus sound. Sound stimuli were 0.5, 1, 4 and 7 (or 8)kHz tones. Middle-ear impedance was measured from the motion of the entire TM. Cartilage placement generally produced reductions in the motion of the TM apposed to the cartilage, especially at 4 kHz and 7 or 8 kHz. Some parts of the TM showed altered motion compared to the control in all three cases. In general, middle-ear impedance was either unchanged or increased somewhat after cartilage reconstruction both at low (0.5 and 1 kHz) and high (4 and 7 kHz) frequencies. At 4 kHz, with the 1.0mm thick graft that was in contact with the bony tympanic rim, the impedance slightly decreased. While our earlier work with time-averaged holography allowed us to observe differences in the pattern of TM motion caused by application of cartilage to the TM, stroboscopic holography is more sensitive to TM motions and allowed us to quantify the magnitude and phase of motion of each point on the TM surface. Nonetheless, our results are similar to those of our earlier work: The placement of cartilage on the medial surface of TM reduces the motion of the TM that apposes the cartilage. These obvious local changes occur even though the cartilage had little effect on the sound-induced motion of

Surface drainage in leveled land: Implication of slope

Directory of Open Access Journals (Sweden)

Antoniony S. Winkler

Full Text Available ABSTRACT In the lowlands of Rio Grande do Sul, land leveling is mostly carried out with no slope for the purpose of rice production. In this environment, soils with a low hydraulic conductivity are predominant owing to the presence of a practically impermeable B-horizon near the surface. Land leveling leads to soil accommodation resulting in the formation of depressions where water accumulates after heavy rainfalls, subsequently leading to problems with crops implanted in succession to rice, such as soybeans. The objective of this research was to quantify the areas and volumes of water accumulation in soil as a function of the slope of land leveling. Five typical leveled lowland areas were studied as a part of this research. The original areas presented slopes of 0, 0.20, 0.25, 0.28 and 0.40%, which were used to generate new digital elevation models with slopes between 0 and 0.5%. These newly generated digital models were used to map the depressions with surface water storage. In conclusion, land leveling with slopes higher than 0.1% is recommended to minimize problems with superficial water storage in rice fields.

Motion of ionizing electric-field solitons in a bounded plasma

International Nuclear Information System (INIS)

Lagar'kov, A.; Rutkevich, I.

1981-01-01

A theory is derived for the motion of fast ionization waves along a plane slab of a weakly ionized plasma. The properties of the ionization wave are shown to be closely related to the motion of a two-dimensional surface-charge wave along the slab boundaries. As a result, the ionization wave is quite different from a one-dimensional wave. A quasi-one-dimensional description is used for the wave motion, in which the initial equations are averaged over the transverse coordinate. The relationship between the normal component of the current density at the plasma boundary and the amplitude of the electric potential from the linear theory for a surface wave is used to close the system of averaged equations. Self-similar solutions are derived for these equations; the solutions describe space-charge solitons and electric-field solitons which ionize the plasma. The theory is used to explain the motion of fast ionization waves in long discharge tubes

Internal Motion Estimation by Internal-external Motion Modeling for Lung Cancer Radiotherapy.

Science.gov (United States)

Chen, Haibin; Zhong, Zichun; Yang, Yiwei; Chen, Jiawei; Zhou, Linghong; Zhen, Xin; Gu, Xuejun

2018-02-27

The aim of this study is to develop an internal-external correlation model for internal motion estimation for lung cancer radiotherapy. Deformation vector fields that characterize the internal-external motion are obtained by respectively registering the internal organ meshes and external surface meshes from the 4DCT images via a recently developed local topology preserved non-rigid point matching algorithm. A composite matrix is constructed by combing the estimated internal phasic DVFs with external phasic and directional DVFs. Principle component analysis is then applied to the composite matrix to extract principal motion characteristics, and generate model parameters to correlate the internal-external motion. The proposed model is evaluated on a 4D NURBS-based cardiac-torso (NCAT) synthetic phantom and 4DCT images from five lung cancer patients. For tumor tracking, the center of mass errors of the tracked tumor are 0.8(±0.5)mm/0.8(±0.4)mm for synthetic data, and 1.3(±1.0)mm/1.2(±1.2)mm for patient data in the intra-fraction/inter-fraction tracking, respectively. For lung tracking, the percent errors of the tracked contours are 0.06(±0.02)/0.07(±0.03) for synthetic data, and 0.06(±0.02)/0.06(±0.02) for patient data in the intra-fraction/inter-fraction tracking, respectively. The extensive validations have demonstrated the effectiveness and reliability of the proposed model in motion tracking for both the tumor and the lung in lung cancer radiotherapy.

Decommissioning high-level waste surface facilities

International Nuclear Information System (INIS)

1978-04-01

The protective storage, entombment and dismantlement options of decommissioning a High-Level Waste Surface Facility (HLWSF) was investigated. A reference conceptual design for the facility was developed based on the designs of similar facilities. State-of-the-art decommissioning technologies were identified. Program plans and cost estimates for decommissioning the reference conceptual designs were developed. Good engineering design concepts were on the basis of this work identified

The effect of giving detailed information about intravenous radiopharmaceutical administration on the anxiety level of patients who request more information

International Nuclear Information System (INIS)

Kaya, E.; Ciftci, I.; Demirel, R.; Gecici, O.; Cigerci, Y.

2010-01-01

Nuclear medicine procedures use radiopharmaceuticals, which produce radiation and potential adverse reactions, albeit at a low rate. It is the patient's ethical, legal, and medical right to be informed of the potential side effects of procedures applied to them. Our purpose was to determine the effect of providing information about intravenous radiopharmaceutical administration on the anxiety level of patients who request more information. This study was completed in two separate Nuclear Medicine Departments. The study included 620 (247 M, 373 F) patients who had been referred for myocardial perfusion, bone, dynamic renal, and thyroid scintigraphic examinations. The patients were divided into two groups according to whether they requested more information or not. Group 1 consisted of 388 patients who wanted to receive more information about the procedure, while Group 2 consisted of 232 patients who did not request additional information. The State-Trait Anxiety Inventory (STAI-S and STAI-T) was used to determine a patient's anxiety level. After simple information was given, state and trait anxiety levels were measured in both groups. We gave detailed information to the patients in Group 1 and then measured state anxiety again. Detailed information included an explanation of the radiopharmaceutical risk and probable side effects due to the scan procedure. There was no statistical difference between Groups 1 and 2 in STAI-T or STAI-S scores after simple information was given (p=0.741 and p=0.945, respectively). The mean value of STAI-S score was increased after the provision of detailed information and there was a statistically significant difference between after simple information STAI-S and after detailed information STAI-S (p<0.001). The STAI-S score was increased in 246 patients and decreased in 110 patients after detailed information, while there was no change in 32 patients. After detailed information, the greatest increase in STAI-S score was seen in the

Broadband Ground Motion Reconstruction for the Kanto Basin during the 1923 Kanto Earthquake

Science.gov (United States)

Sekiguchi, Haruko; Yoshimi, Masayuki

2011-03-01

Ground motions of the 1923 Kanto Earthquake inside the Kanto Basin are numerically simulated in a wide frequency range (0-10 Hz) based on new knowledge of the earthquake's source processes, the sedimentary structure of the basin, and techniques for generating broadband source models of great earthquakes. The Kanto Earthquake remains one of the most important exemplars for ground motion prediction in Japan due to its size, faulting geometry, and location beneath the densely populated Kanto sedimentary basin. We reconstruct a broadband source model of the 1923 Kanto Earthquake from inversion results by introducing small-scale heterogeneities. The corresponding ground motions are simulated using a hybrid technique comprising the following four calculations: (1) low-frequency ground motion of the engineering basement, modeled using a finite difference method; (2) high-frequency ground motion of the engineering basement, modeled using a stochastic Green's function method; (3) total ground motion of the engineering basement (i.e. 1 + 2); and (4) ground motion at the surface in response to the total basement ground motion. We employ a recently developed three-dimensional (3D) velocity structure model of the Kanto Basin that incorporates prospecting data, microtremor observations and measurements derived from strong ground motion records. Our calculations reveal peak ground velocities (PGV) exceeding 50 cm/s in the area above the fault plane: to the south, where the fault plane is shallowest, PGV reaches 150-200 cm/s at the engineering basement and 200-250 cm/s at the surface. Intensity 7, the maximum value in the Japan Meteorological Agency's intensity scale, is calculated to have occurred widely in Sagami Bay, which corresponds well with observed house-collapse rates due to the 1923 event. The modeling reveals a pronounced forward directivity effect for the area lying above the southern, shallow part of the fault plane. The high PGV and intensity seen above the

New method for imaging epicardial motion with scattered radiation

International Nuclear Information System (INIS)

Tilley, D.G.

1976-01-01

A new method for monitoring cardiac motion is described which employs the secondary radiation emerging from the thorax during fluoroscopic x-ray examination of the heart. The motion of selected points on the heart's epicardial surface can be investigated by detecting the intensity variations of radiation scattered in the local vicinity of the heart-lung border. Also discussed are the radiation detectors and signal processing electronics used to produce a voltage analog depicting the periodic displacements of the heart surface. Digital data processing methods are described which are used to accomplish a transformation from a time scale for representing surface motion, to a frequency scale that is better suited for the quantitative analysis of the heart's myocardial dynamics. The dynamic radiographic technique is compared to other methods such as electrocardiography, phonocardiography, radarkymography, and echocardiography; which are also used to sense the dynamic state of the heart. A three-dimensional Monte Carlo computer code is used to investigate the transport of x-radiation in the canine thorax. The Monte Carlo computer studies are used to explore the capabilities and limitations of the dynamic radiograph as it is used to sense motions of the canine heart. Animal studies were conducted with the dynamic radiograph to determine the reproducibility of the examination procedure. Canine case studies are reported showing the effects of increased myocardial contractility resulting from intervention with these inotropic agents

Cooling mechanical motion via vacuum effect of an ensemble of quantum emitters.

Science.gov (United States)

Nie, Wenjie; Chen, Aixi; Lan, Yueheng

2015-11-30

We design a hybrid optomechanical setup, in which an ensemble of quantum emitters is coupled with a movable mirror through vacuum interaction. The optical cavity is driven along with the quantum emitters and therefore the coupling between the cavity field and the ensemble determines the dynamics of the coupled system. In particular, we investigated the influence of the vacuum coupling strength on the effective frequency and the effective damping rate of the movable mirror, which shows that the vacuum interaction enhances greatly the effective damping rate. Further, the cooling characteristics of the mechanical resonator is analyzed in detail by counting the effective phonon number in the mirror's motion. It is found that the ground-state cooling of the mechanical motion can be approached in the bad cavity limit when the vacuum coupling is included. The dependence of the cooling of the mechanical motion on the parameters of the cavity and the quantum emitter is investigated in detail numerically.

Apparatus and method for motion tracking in brain imaging

DEFF Research Database (Denmark)

2013-01-01

Disclosed is apparatus and method for motion tracking of a subject in medical brain imaging. The method comprises providing a light projector and a first camera; projecting a first pattern sequence (S1) onto a surface region of the subject with the light projector, wherein the subject is positioned......2,1) based on the detected first pattern sequence (S1'); projecting the second pattern sequence (S2) onto a surface region of the subject with the light projector; detecting the projected second pattern sequence (S2') with the first camera; and determining motion tracking parameters based...

Surface core level shifts of clean and oxygen covered Ir(111)

Energy Technology Data Exchange (ETDEWEB)

Bianchi, M; Cassese, D; Cavallin, A; Comin, R; Orlando, F; Postregna, L [Universita degli Studi di Trieste, Via A Valerio 2, 34127, Trieste (Italy); Golfetto, E; Baraldi, A [Dipartimento di Fisica e CENMAT, Universita degli Studi di Trieste, Via A Valerio 2, 34127, Trieste (Italy); Lizzit, S [Sincrotrone Trieste S.C.p.A., S.S. 14 Km 163.5, 34012 Trieste (Italy)], E-mail: alessandro.baraldi@elettra.trieste.it

2009-06-15

We present the results of high resolution core level photoelectron spectroscopy employed to investigate the electronic structure of clean and oxygen covered Ir(111) surface. Ir 4f{sub 7/2} core level spectra are shown to be very sensitive to the local atomic environment. For the clean surface we detected two distinct components shifted by 550 meV, originated by surface and bulk atoms. The larger Gaussian width of the bulk component is explained as due to experimentally unresolved subsurface components. In order to determine the relevance of the phonon contribution we examined the thermal behaviour of the core level lineshape using the Hedin-Rosengren theory. From the phonon-induced spectral broadening we found the Debye temperature of bulk and surface atoms to be 298 and 181 K, respectively, which confirms the softening of the vibrational modes at the surface. Oxygen adsorption leads to the appearance of new surface core level components at -200 meV and +230 meV, which are interpreted as due to first-layer Ir atoms differently coordinated with oxygen. The coverage dependence of these components demonstrates that the oxygen saturation corresponds to 0.38 ML, in good agreement with recent density functional theory calculations.

Kinetic energy budget details

Indian Academy of Sciences (India)

Abstract. This paper presents the detailed turbulent kinetic energy budget and higher order statistics of flow behind a surface-mounted rib with and without superimposed acoustic excitation. Pattern recognition technique is used to determine the large-scale structure magnitude. It is observed that most of the turbulence ...

Auditory Motion Elicits a Visual Motion Aftereffect.

Science.gov (United States)

Berger, Christopher C; Ehrsson, H Henrik

2016-01-01

The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect-an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

Auditory Motion Elicits a Visual Motion Aftereffect

Directory of Open Access Journals (Sweden)

Christopher C. Berger

2016-12-01

Full Text Available The visual motion aftereffect is a visual illusion in which exposure to continuous motion in one direction leads to a subsequent illusion of visual motion in the opposite direction. Previous findings have been mixed with regard to whether this visual illusion can be induced cross-modally by auditory stimuli. Based on research on multisensory perception demonstrating the profound influence auditory perception can have on the interpretation and perceived motion of visual stimuli, we hypothesized that exposure to auditory stimuli with strong directional motion cues should induce a visual motion aftereffect. Here, we demonstrate that horizontally moving auditory stimuli induced a significant visual motion aftereffect—an effect that was driven primarily by a change in visual motion perception following exposure to leftward moving auditory stimuli. This finding is consistent with the notion that visual and auditory motion perception rely on at least partially overlapping neural substrates.

SU-E-J-150: Four-Dimensional Cone-Beam CT Algorithm by Extraction of Physical and Motion Parameter of Mobile Targets Retrospective to Image Reconstruction with Motion Modeling

International Nuclear Information System (INIS)

Ali, I; Ahmad, S; Alsbou, N

2015-01-01

Purpose: To develop 4D-cone-beam CT (CBCT) algorithm by motion modeling that extracts actual length, CT numbers level and motion amplitude of a mobile target retrospective to image reconstruction by motion modeling. Methods: The algorithm used three measurable parameters: apparent length and blurred CT number distribution of a mobile target obtained from CBCT images to determine actual length, CT-number value of the stationary target, and motion amplitude. The predictions of this algorithm were tested with mobile targets that with different well-known sizes made from tissue-equivalent gel which was inserted into a thorax phantom. The phantom moved sinusoidally in one-direction to simulate respiratory motion using eight amplitudes ranging 0–20mm. Results: Using this 4D-CBCT algorithm, three unknown parameters were extracted that include: length of the target, CT number level, speed or motion amplitude for the mobile targets retrospective to image reconstruction. The motion algorithms solved for the three unknown parameters using measurable apparent length, CT number level and gradient for a well-defined mobile target obtained from CBCT images. The motion model agreed with measured apparent lengths which were dependent on the actual target length and motion amplitude. The gradient of the CT number distribution of the mobile target is dependent on the stationary CT number level, actual target length and motion amplitude. Motion frequency and phase did not affect the elongation and CT number distribution of the mobile target and could not be determined. Conclusion: A 4D-CBCT motion algorithm was developed to extract three parameters that include actual length, CT number level and motion amplitude or speed of mobile targets directly from reconstructed CBCT images without prior knowledge of the stationary target parameters. This algorithm provides alternative to 4D-CBCT without requirement to motion tracking and sorting of the images into different breathing phases

SU-E-J-150: Four-Dimensional Cone-Beam CT Algorithm by Extraction of Physical and Motion Parameter of Mobile Targets Retrospective to Image Reconstruction with Motion Modeling

Energy Technology Data Exchange (ETDEWEB)

Ali, I; Ahmad, S [University of Oklahoma Health Sciences, Oklahoma City, OK (United States); Alsbou, N [Ohio Northern University, Ada, OH (United States)

2015-06-15

Purpose: To develop 4D-cone-beam CT (CBCT) algorithm by motion modeling that extracts actual length, CT numbers level and motion amplitude of a mobile target retrospective to image reconstruction by motion modeling. Methods: The algorithm used three measurable parameters: apparent length and blurred CT number distribution of a mobile target obtained from CBCT images to determine actual length, CT-number value of the stationary target, and motion amplitude. The predictions of this algorithm were tested with mobile targets that with different well-known sizes made from tissue-equivalent gel which was inserted into a thorax phantom. The phantom moved sinusoidally in one-direction to simulate respiratory motion using eight amplitudes ranging 0–20mm. Results: Using this 4D-CBCT algorithm, three unknown parameters were extracted that include: length of the target, CT number level, speed or motion amplitude for the mobile targets retrospective to image reconstruction. The motion algorithms solved for the three unknown parameters using measurable apparent length, CT number level and gradient for a well-defined mobile target obtained from CBCT images. The motion model agreed with measured apparent lengths which were dependent on the actual target length and motion amplitude. The gradient of the CT number distribution of the mobile target is dependent on the stationary CT number level, actual target length and motion amplitude. Motion frequency and phase did not affect the elongation and CT number distribution of the mobile target and could not be determined. Conclusion: A 4D-CBCT motion algorithm was developed to extract three parameters that include actual length, CT number level and motion amplitude or speed of mobile targets directly from reconstructed CBCT images without prior knowledge of the stationary target parameters. This algorithm provides alternative to 4D-CBCT without requirement to motion tracking and sorting of the images into different breathing phases

Surface roughness effects on heat transfer in Couette flow

International Nuclear Information System (INIS)

Elia, G.G.

1981-01-01

A cell theory for viscous flow with rough surfaces is applied to two basic illustrative heat transfer problems which occur in Couette flow. Couette flow between one adiabatic surface and one isothermal surface exhibits roughness effects on the adiabatic wall temperature. Two types of rough cell adiabatic surfaces are studied: (1) perfectly insulating (the temperature gradient vanishes at the boundary of each cell); (2) average insulating (each cell may gain or lose heat but the total heat flow at the wall is zero). The results for the roughness on a surface in motion are postulated to occur because of fluid entrainment in the asperities on the moving surface. The symmetry of the roughness effects on thermal-viscous dissipation is discussed in detail. Explicit effects of the roughness on each surface, including combinations of roughness values, are presented to enable the case where the two surfaces may be from different materials to be studied. The fluid bulk temperature rise is also calculated for Couette flow with two ideal adiabatic surfaces. The effect of roughness on thermal-viscous dissipation concurs with the viscous hydrodynamic effect. The results are illustrated by an application to lubrication. (Auth.)

Sea level: measuring the bounding surfaces of the ocean

Science.gov (United States)

Tamisiea, Mark E.; Hughes, Chris W.; Williams, Simon D. P.; Bingley, Richard M.

2014-01-01

The practical need to understand sea level along the coasts, such as for safe navigation given the spatially variable tides, has resulted in tide gauge observations having the distinction of being some of the longest instrumental ocean records. Archives of these records, along with geological constraints, have allowed us to identify the century-scale rise in global sea level. Additional data sources, particularly satellite altimetry missions, have helped us to better identify the rates and causes of sea-level rise and the mechanisms leading to spatial variability in the observed rates. Analysis of all of the data reveals the need for long-term and stable observation systems to assess accurately the regional changes as well as to improve our ability to estimate future changes in sea level. While information from many scientific disciplines is needed to understand sea-level change, this review focuses on contributions from geodesy and the role of the ocean's bounding surfaces: the sea surface and the Earth's crust. PMID:25157196

Motional spin relaxation in photoexcited triplet states

International Nuclear Information System (INIS)

Harryvan, D.; Faassen, E. van

1997-01-01

Transient EPR experiments were performed on photoexcited spin triplet states of the luminescent dye EOSIN-Y in diluted (order of 1 nMol) frozen propane-1-ol solutions at various temperatures. Photoexcitation was achieved by irradiation with intense, short laser pulses. The details of the spin relaxation, in particular the dependence on time, magnetic field and microwave field strength are all reproduced by a model which computes the total magnetization in a population of photoexcited triplet states undergoing random reorientational motion. Using this model, we estimated the motional correlation times to be around a microsecond. This timescale is two orders of magnitude slower than the phase memory time of the triplets. (author)

Clinically acceptable agreement between the ViMove wireless motion sensor system and the Vicon motion capture system when measuring lumbar region inclination motion in the sagittal and coronal planes

DEFF Research Database (Denmark)

Mjøsund, Hanne Leirbekk; Boyle, Eleanor; Kjær, Per

2017-01-01

. CONCLUSIONS: We found a clinically acceptable level of agreement between these two methods for measuring standing lumbar inclination motion in these two cardinal movement planes. Further research should investigate the ViMove system's ability to measure lumbar motion in more complex 3D functional movements...

Origin of metallic surface core-level shifts

DEFF Research Database (Denmark)

Aldén, Magnus; Skriver, Hans Lomholt; Abrikosov, I. A.

1995-01-01

The unique property of the open 4f energy shell in the lanthanide metals is used to show that the initial-state energy shift gives an insufficient description of surface core-level shifts. Instead a treatment, which fully includes the final-state screening, account for the experimentally observed...

Knee Motion Generation Method for Transfemoral Prosthesis Based on Kinematic Synergy and Inertial Motion.

Science.gov (United States)

Sano, Hiroshi; Wada, Takahiro

2017-12-01

Previous research has shown that the effective use of inertial motion (i.e., less or no torque input at the knee joint) plays an important role in achieving a smooth gait of transfemoral prostheses in the swing phase. In our previous research, a method for generating a timed knee trajectory close to able-bodied individuals, which leads to sufficient clearance between the foot and the floor and the knee extension, was proposed using the inertial motion. Limb motions are known to correlate with each other during walking. This phenomenon is called kinematic synergy. In this paper, we measure gaits in level walking of able-bodied individuals with a wide range of walking velocities. We show that this kinematic synergy also exists between the motions of the intact limbs and those of the knee as determined by the inertial motion technique. We then propose a new method for generating the motion of the knee joint using its inertial motion close to the able-bodied individuals in mid-swing based on its kinematic synergy, such that the method can adapt to the changes in the motion velocity. The numerical simulation results show that the proposed method achieves prosthetic walking similar to that of able-bodied individuals with a wide range of constant walking velocities and termination of walking from steady-state walking. Further investigations have found that a kinematic synergy also exists at the start of walking. Overall, our method successfully achieves knee motion generation from the initiation of walking through steady-state walking with different velocities until termination of walking.

Leap Motion development essentials

CERN Document Server

Spiegelmock, Mischa

2013-01-01

This book is a fast-paced guide with practical examples that aims to help you understand and master the Leap Motion SDK.This book is for developers who are either involved in game development or who are looking to utilize Leap Motion technology in order to create brand new user interaction experiences to distinguish their products from the mass market. You should be comfortable with high-level languages and object-oriented development concepts in order to get the most out of this book.

A linear motion machine for soft x-ray interferometry

International Nuclear Information System (INIS)

Duarte, R.; Howells, M.R.; Hussain, Z.; Lauritzen, T.; McGill, R.

1997-07-01

A Fourier Transform X-ray Spectrometer has been designed and built for use at the Advanced light source at Lawrence Berkeley National Laboratory. The design requires a total rectilinear motion of 15 mm with a maximum pitch error of the stage below ±0.4 μradians, to achieve this the authors chose to build the entire machine as a single monolithic flexure. A hydraulic driver with sliding O-ring seals was developed with the intention to provide motion with a stick-slip position error of less than 0.8 nm at a uniform velocity of 20 μm/sec. The machine is comprised of two pairs of nested linear motion flexures, all explained by means of a theory published earlier by Hathaway. Certain manufacturing errors were successfully corrected by an extra weak-link feature in the monolith frame. The engineering details of all the subsystems of the linear motion machine are described and measured performance reported

Equations of motion in phase space

International Nuclear Information System (INIS)

Broucke, R.

1979-01-01

The article gives a general review of methods of constructing equations of motion of a classical dynamical system. The emphasis is however on the linear Lagrangian in phase space and the corresponding form of Pfaff's equations of motion. A detailed examination of the problem of changes of variables in phase space is first given. It is shown that the Linear Lagrangian theory falls very naturally out of the classical quadratic Lagrangian theory; we do this with the use of the well-known Lagrange multiplier method. Another important result is obtained very naturally as a by-product of this analysis. If the most general set of 2n variables (coordinates in phase space) is used, the coefficients of the equations of motion are the Poisson Brackets of these variables. This is therefore the natural way of introducing not only Poisson Brackets in Dynamics formulations but also the associated Lie Algebras and their important properties and consequences. We give then several examples to illustrate the first-order equations of motion and their simplicity in relation to general changes of variables. The first few examples are elementary (the harmonic Oscillator) while the last one concerns the motion of a rigid body about a fixed point. In the next three sections we treat the first-order equations of motion as derived from a Linear differential form, sometimes called Birkhoff's equations. We insist on the generality of the equations and especially on the unity of the space-time concept: the time t and the coordinates are here completely identical variables, without any privilege to t. We give a brief review of Cartan's 2-form and the corresponding equations of motion. As an illustration the standard equations of aircraft flight in a vertical plane are derived from Cartan's exterior differential 2-form. Finally we mention in the last section the differential forms that were proposed by Gallissot for the derivation of equations of motion

Smartphone-based accelerometry is a valid tool for measuring dynamic changes in knee extension range of motion

DEFF Research Database (Denmark)

Støve, Morten Pallisgaard; Palsson, Thorvaldur Skuli; Hirata, Rogerio Pessoto

2018-01-01

Introduction: Measurement of static joint range of motion is used extensively in orthopaedic and rehabilitative communities to benchmark treatment efficacy. Static measures are, however, insufficient in providing detailed information about patient impairments. Dynamic range of motion measures cou...

Circular random motion in diatom gliding under isotropic conditions

International Nuclear Information System (INIS)

Gutiérrez-Medina, Braulio; Maldonado, Ana Iris Peña; Guerra, Andrés Jiménez; Rubio, Yadiralia Covarrubias; Meza, Jessica Viridiana García

2014-01-01

How cells migrate has been investigated primarily for the case of trajectories composed by joined straight segments. In contrast, little is known when cellular motion follows intrinsically curved paths. Here, we use time-lapse optical microscopy and automated trajectory tracking to investigate how individual cells of the diatom Nitzschia communis glide across surfaces under isotropic environmental conditions. We find a distinct kind of random motion, where trajectories are formed by circular arcs traveled at constant speed, alternated with random stoppages, direction reversals and changes in the orientation of the arcs. Analysis of experimental and computer-simulated trajectories show that the circular random motion of diatom gliding is not optimized for long-distance travel but rather for recurrent coverage of limited surface area. These results suggest that one main biological role for this type of diatom motility is to efficiently build the foundation of algal biofilms. (paper)

Motion tracking in narrow spaces: a structured light approach

DEFF Research Database (Denmark)

Olesen, Oline Vinter; Paulsen, Rasmus; Højgaard, Liselotte

2010-01-01

We present a novel tracking system for patient head motion inside 3D medical scanners. Currently, the system is targeted at the Siemens High Resolution Research Tomograph (HRRT) PET scanner. Partial face surfaces are reconstructed using a miniaturized structured light system. The reconstructed 3D...... the system to a standard optical motion tracker based on a rigid tracking tool. Our system achieves an angular RMSE of 0.11 degrees demonstrating its relevance for motion compensated 3D scan image reconstructions as well as its competitiveness against the standard optical system with an RMSE of 0.08 degrees...... point clouds are matched to a reference surface using a robust iterative closest point algorithm. A main challenge is the narrow geometry requiring a compact structured light system and an oblique angle of observation. The system is validated using a mannequin head mounted on a rotary stage. We compare...

An operational-oriented approach to the assessment of low probability seismic ground motions for critical infrastructures

Science.gov (United States)

Garcia-Fernandez, Mariano; Assatourians, Karen; Jimenez, Maria-Jose

2018-01-01

Extreme natural hazard events have the potential to cause significant disruption to critical infrastructure (CI) networks. Among them, earthquakes represent a major threat as sudden-onset events with limited, if any, capability of forecast, and high damage potential. In recent years, the increased exposure of interdependent systems has heightened concern, motivating the need for a framework for the management of these increased hazards. The seismic performance level and resilience of existing non-nuclear CIs can be analyzed by identifying the ground motion input values leading to failure of selected key elements. Main interest focuses on the ground motions exceeding the original design values, which should correspond to low probability occurrence. A seismic hazard methodology has been specifically developed to consider low-probability ground motions affecting elongated CI networks. The approach is based on Monte Carlo simulation, which allows for building long-duration synthetic earthquake catalogs to derive low-probability amplitudes. This approach does not affect the mean hazard values and allows obtaining a representation of maximum amplitudes that follow a general extreme-value distribution. This facilitates the analysis of the occurrence of extremes, i.e., very low probability of exceedance from unlikely combinations, for the development of, e.g., stress tests, among other applications. Following this methodology, extreme ground-motion scenarios have been developed for selected combinations of modeling inputs including seismic activity models (source model and magnitude-recurrence relationship), ground motion prediction equations (GMPE), hazard levels, and fractiles of extreme ground motion. The different results provide an overview of the effects of different hazard modeling inputs on the generated extreme motion hazard scenarios. This approach to seismic hazard is at the core of the risk analysis procedure developed and applied to European CI transport

Visualizing Tensor Normal Distributions at Multiple Levels of Detail.

Science.gov (United States)

Abbasloo, Amin; Wiens, Vitalis; Hermann, Max; Schultz, Thomas

2016-01-01

Despite the widely recognized importance of symmetric second order tensor fields in medicine and engineering, the visualization of data uncertainty in tensor fields is still in its infancy. A recently proposed tensorial normal distribution, involving a fourth order covariance tensor, provides a mathematical description of how different aspects of the tensor field, such as trace, anisotropy, or orientation, vary and covary at each point. However, this wealth of information is far too rich for a human analyst to take in at a single glance, and no suitable visualization tools are available. We propose a novel approach that facilitates visual analysis of tensor covariance at multiple levels of detail. We start with a visual abstraction that uses slice views and direct volume rendering to indicate large-scale changes in the covariance structure, and locations with high overall variance. We then provide tools for interactive exploration, making it possible to drill down into different types of variability, such as in shape or orientation. Finally, we allow the analyst to focus on specific locations of the field, and provide tensor glyph animations and overlays that intuitively depict confidence intervals at those points. Our system is demonstrated by investigating the effects of measurement noise on diffusion tensor MRI, and by analyzing two ensembles of stress tensor fields from solid mechanics.

Data analysis for seismic motion characteristics

International Nuclear Information System (INIS)

Ishimaru, Tsuneari; Kohriya, Yorihide

2002-10-01

This data analysis is aimed at studying the characteristics of amplification of acceleration amplitude from deep underground to the surface, and is one of several continuous studies on the effects of earthquake motion. Seismic wave records were observed via a center array located in Shibata-cho, Miyagi Prefecture, which is part of the Kumagai-Gumi Array System for Strong Earthquake Motion (KASSEM) located on the Pacific coast in Miyagi and Fukushima Prefectures. Using acceleration waves obtained from earthquake observations, the amplification ratios of maximum acceleration amplitude and of root mean square acceleration amplitude which were based on the deepest observation point were estimated. Comparison between the seismic motion amplification characteristics of this study were made with the analyzed data at the Kamaishi-Mine (Kamaishi Miyagi Prefecture). The obtained results are as follows. The amplification ratios estimated from maximum acceleration amplitude and root mean square acceleration amplitude are almost constant in soft rock formations. However, amplification ratios at the surface in diluvium and alluvium are about three to four times larger than the ratios in soft rock formations. The amplification ratios estimated from root mean square acceleration amplitude are less dispersed than the ratios estimated from maximum acceleration amplitude. Comparing the results of this analysis with the results obtained at the Kamaishi-Mine, despite the difference in the rock types and the geologic formations at the observation points, there is a tendency for the amplification ratios at both points to be relatively small in the rock foundation and gradually increase toward the ground surface. (author)

Numerical simulation of high Reynolds number bubble motion

Energy Technology Data Exchange (ETDEWEB)

McLaughlin, J.B. [Clarkson Univ., Potsdam, NY (United States)

1995-12-31

This paper presents the results of numerical simulations of bubble motion. All the results are for single bubbles in unbounded fluids. The liquid phase is quiescent except for the motion created by the bubble, which is axisymmetric. The main focus of the paper is on bubbles that are of order 1 mm in diameter in water. Of particular interest is the effect of surfactant molecules on bubble motion. Results for the {open_quotes}insoluble surfactant{close_quotes} model will be presented. These results extend research by other investigators to finite Reynolds numbers. The results indicate that, by assuming complete coverage of the bubble surface, one obtains good agreement with experimental observations of bubble motion in tap water. The effect of surfactant concentration on the separation angle is discussed.

Role of Alpha-band Oscillations in Spatial Updating across Whole Body Motion

Directory of Open Access Journals (Sweden)

Tjerk Peter Gutteling

2016-05-01

Full Text Available When moving around in the world, we have to keep track of important locations in our surroundings. In this process, called spatial updating, we must estimate our body motion and correct representations of memorized spatial locations in accordance with this motion. While the behavioral characteristics of spatial updating across whole body motion have been studied in detail, its neural implementation lacks detailed study. Here we use electro-encephalography (EEG to distinguish various spectral components of this process. Subjects gazed at a central body-fixed point in otherwise complete darkness, while a target was briefly flashed, either left or right from this point. Subjects had to remember the location of this target as either moving along with the body or remaining fixed in the world while being translated sideways on a passive motion platform. After the motion, subjects had to indicate the remembered target location in the instructed reference frame using a mouse response. While the body motion, as detected by the vestibular system, should not affect the representation of body-fixed targets, it should interact with the representation of a world-centered target to update its location relative to the body. We show that the initial presentation of the visual target induced a reduction of alpha band power in contralateral parieto-occipital areas, which evolved to a sustained increase during the subsequent memory period. Motion of the body led to a reduction of alpha band power in central parietal areas extending to lateral parieto-temporal areas, irrespective of whether the targets had to be memorized relative to world or body. When updating a world-fixed target, its internal representation shifts hemispheres, only when subjects’ behavioral responses suggested an update across the body midline. Our results suggest that parietal cortex is involved in both self-motion estimation and the selective application of this motion information to

Dimers at Ge/Si(001) surfaces: Ge coverage dependent quenching, reactivation of flip-flop motion, and interaction with dimer vacancy lines

International Nuclear Information System (INIS)

Hirayama, H.; Mizuno, H.; Yoshida, R.

2002-01-01

We studied Ge coverage (θ Ge ) dependent quenching, reactivation of the flip-flop motion, and interaction with dimer vacancy lines (DVLs) of dimers on Ge/Si(001) surfaces using a scanning tunneling microscope (STM) combined with a molecular beam epitaxy apparatus. Deposition of ∼0.3 ML (monolayer) Ge quenched the flip-flop motion, making all dimers asymmetric. Further deposition introduced DVLs at θ Ge ≥∼0.5 ML, and symmetric dimer domains appeared again locally at θ≥1.5 ML. High-resolution STM images indicated that asymmetric dimer rows always invert their phase in alternation with buckled dimer's up-end at the DVLs. Low-temperature STM images indicated that the symmetric dimer domains were due to flip-flopping of asymmetric dimers activated by large θ Ge at room temperature. The symmetric dimer domains extended along the dimer rows over the DVLs due to the phase correlation

Delay/Disruption Tolerant Networks (DTN): Testing and Demonstration for Lunar Surface Applications

Science.gov (United States)

2009-01-01

This slide presentation reviews the testing of the Delay/Disruption Tolerant Network (DTN) designed for use with Lunar Surface applications. This is being done through the DTN experimental Network (DEN), that permit access and testing by other NASA centers, DTN team members and protocol developers. The objective of this work is to demonstrate DTN for high return applications in lunar scenarios, provide DEN connectivity with analogs of Constellation elements, emulators, and other resources from DTN Team Members, serve as a wireless communications staging ground for remote analog excursions and enable testing of detailed communication scenarios and evaluation of network performance. Three scenarios for DTN on the Lunar surface are reviewed: Motion imagery, Voice and sensor telemetry, and Navigation telemetry.

A mass conserving level set method for detailed numerical simulation of liquid atomization

Energy Technology Data Exchange (ETDEWEB)

Luo, Kun; Shao, Changxiao [State Key Laboratory of Clean Energy Utilization, Zhejiang University, Hangzhou 310027 (China); Yang, Yue [State Key Laboratory of Turbulence and Complex Systems, Peking University, Beijing 100871 (China); Fan, Jianren, E-mail: fanjr@zju.edu.cn [State Key Laboratory of Clean Energy Utilization, Zhejiang University, Hangzhou 310027 (China)

2015-10-01

An improved mass conserving level set method for detailed numerical simulations of liquid atomization is developed to address the issue of mass loss in the existing level set method. This method introduces a mass remedy procedure based on the local curvature at the interface, and in principle, can ensure the absolute mass conservation of the liquid phase in the computational domain. Three benchmark cases, including Zalesak's disk, a drop deforming in a vortex field, and the binary drop head-on collision, are simulated to validate the present method, and the excellent agreement with exact solutions or experimental results is achieved. It is shown that the present method is able to capture the complex interface with second-order accuracy and negligible additional computational cost. The present method is then applied to study more complex flows, such as a drop impacting on a liquid film and the swirling liquid sheet atomization, which again, demonstrates the advantages of mass conservation and the capability to represent the interface accurately.

Zero-point motion in the bag description of the nucleon

International Nuclear Information System (INIS)

Brown, G.E.; Durso, J.W.; Johnson, M.B.

1983-01-01

In the bag model, confinement of quarks is accomplished by introduction of a boundary condition at some definite radius R, where the energy of the total system is a minimum. This minimum is, however, relatively shallow and energies for substantially different bag radii are not much larger than this minimum value. This indicates that the zero-point motion of the bag surface may be important. In this paper, quantization of the bag surface motion is carried out in a somewhat ad hoc fashion, modelled after the generator coordinate theory in nuclear physics. This procedure unifies a number of ideas previously in the literature; it stresses the anharmonicity of the collective motion. As in earlier treatments, the Roper resonance emerges as a breathing-mode type of excitation of the nucleon. The one- and two-pion decays of the Roper resonance are calculated and the widths are found to fall short of the empirical ones. It is pointed out, however, that decays involving intermediate states containing virtual rho-mesons will enhance the widths. Pion-nucleon scattering in the P 11 channel is constructed in our model and found to agree roughly with experiment. A crucial term in the driving force involves the pion coupling to the nucleon through a virtual rho-meson. With introduction of zero-point motion of the bag surface, the motion of 'bag radius' becomes dependent on precisely which moment of the radius is measured. Our development gives a model for cutting off smoothly the pion-exchange term in the nucleon-nucleon interaction. (orig.)

The global signature of post-1900 land ice wastage on vertical land motion

Science.gov (United States)

Riva, Riccardo; Frederikse, Thomas; King, Matt; Marzeion, Ben; van den Broeke, Michiel

2017-04-01

The amount of ice stored on land has strongly declined during the 20th century, and melt rates showed a significant acceleration over the last two decades. Land ice wastage is well known to be one of the main drivers of global mean sea-level rise, as widely discussed in the literature and reflected in the last assessment report of the IPCC. A less obvious effect of melting land ice is the response of the solid earth to mass redistribution on its surface, which, in the first approximation, results in land uplift where the load reduces (e.g., close to the meltwater sources) and land subsidence where the load increases (e.g., under the rising oceans). This effect is nowadays well known within the cryospheric and sea level communities. However, what is often not realized is that the solid earth response is a truly global effect: a localized mass change does cause a large deformation signal in its proximity, but also causes a change of the position of every other point on the Earth's surface. The theory of the Earth's elastic response to changing surface loads forms the basis of the 'sea-level equation', which allows sea-level fingerprints of continental mass change to be computed. In this paper, we provide the first dedicated analysis of global vertical land motion driven by land ice wastage. By means of established techniques to compute the solid earth elastic response to surface load changes and the most recent datasets of glacier and ice sheet mass change, we show that land ice loss currently leads to vertical deformation rates of several tenths of mm per year at mid-latitudes, especially over the Northern Hemisphere where most sources are located. In combination with the improved accuracy of space geodetic techniques (e.g., Global Navigation Satellite Systems), this means that the effect of ice melt is non-negligible over a large part of the continents. In particular, we show how deformation rates have been strongly varying through the last century, which implies

Stock price prediction using geometric Brownian motion

Science.gov (United States)

Farida Agustini, W.; Restu Affianti, Ika; Putri, Endah RM

2018-03-01

Geometric Brownian motion is a mathematical model for predicting the future price of stock. The phase that done before stock price prediction is determine stock expected price formulation and determine the confidence level of 95%. On stock price prediction using geometric Brownian Motion model, the algorithm starts from calculating the value of return, followed by estimating value of volatility and drift, obtain the stock price forecast, calculating the forecast MAPE, calculating the stock expected price and calculating the confidence level of 95%. Based on the research, the output analysis shows that geometric Brownian motion model is the prediction technique with high rate of accuracy. It is proven with forecast MAPE value ≤ 20%.

COMPARISON OF BACKGROUND SUBTRACTION, SOBEL, ADAPTIVE MOTION DETECTION, FRAME DIFFERENCES, AND ACCUMULATIVE DIFFERENCES IMAGES ON MOTION DETECTION

Directory of Open Access Journals (Sweden)

Dara Incam Ramadhan

2018-02-01

Full Text Available Nowadays, digital image processing is not only used to recognize motionless objects, but also used to recognize motions objects on video. One use of moving object recognition on video is to detect motion, which implementation can be used on security cameras. Various methods used to detect motion have been developed so that in this research compared some motion detection methods, namely Background Substraction, Adaptive Motion Detection, Sobel, Frame Differences and Accumulative Differences Images (ADI. Each method has a different level of accuracy. In the background substraction method, the result obtained 86.1% accuracy in the room and 88.3% outdoors. In the sobel method the result of motion detection depends on the lighting conditions of the room being supervised. When the room is in bright condition, the accuracy of the system decreases and when the room is dark, the accuracy of the system increases with an accuracy of 80%. In the adaptive motion detection method, motion can be detected with a condition in camera visibility there is no object that is easy to move. In the frame difference method, testing on RBG image using average computation with threshold of 35 gives the best value. In the ADI method, the result of accuracy in motion detection reached 95.12%.

Analysis of nematode motion using an improved light-scatter based system.

Directory of Open Access Journals (Sweden)

Chuck S Nutting

2015-02-01

Full Text Available The detailed assessment of nematode activity and viability still remains a relatively undeveloped area of biological and medical research. Computer-based approaches to assessing the motility of larger nematode stages have been developed, yet these lack the capability to detect and analyze the more subtle and important characteristics of the motion of nematodes. There is currently a need to improved methods of assessing the viability and health of parasitic worms.We describe here a system that converts the motion of nematodes through a light-scattering system into an electrical waveform, and allows for reproducible, and wholly non-subjective, assessment of alterations in motion, as well as estimation of the number of nematode worms of different forms and sizes. Here we have used Brugia sp. microfilariae (L1, infective larvae (L3 and adults, together with the free-living nematode Caenorhabditis elegans.The motion of worms in a small (200 ul volume can be detected, with the presence of immotile worms not interfering with the readings at practical levels (up to at least 500 L1 /200 ul. Alterations in the frequency of parasite movement following the application of the anti-parasitic drugs, (chloroquine and imatinib; the anti-filarial effect of the latter agent is the first demonstrated here for the first time. This system can also be used to estimate the number of parasites, and shortens the time required to estimate parasites numbers, and eliminates the need for microscopes and trained technicians to provide an estimate of microfilarial sample sizes up to 1000 parasites/ml. Alterations in the form of motion of the worms can also be depicted.This new instrument, named a "WiggleTron", offers exciting opportunities to further study nematode biology and to aid drug discovery, as well as contributing to a rapid estimate of parasite numbers in various biological samples.

Sea level: measuring the bounding surfaces of the ocean.

Science.gov (United States)

Tamisiea, Mark E; Hughes, Chris W; Williams, Simon D P; Bingley, Richard M

2014-09-28

The practical need to understand sea level along the coasts, such as for safe navigation given the spatially variable tides, has resulted in tide gauge observations having the distinction of being some of the longest instrumental ocean records. Archives of these records, along with geological constraints, have allowed us to identify the century-scale rise in global sea level. Additional data sources, particularly satellite altimetry missions, have helped us to better identify the rates and causes of sea-level rise and the mechanisms leading to spatial variability in the observed rates. Analysis of all of the data reveals the need for long-term and stable observation systems to assess accurately the regional changes as well as to improve our ability to estimate future changes in sea level. While information from many scientific disciplines is needed to understand sea-level change, this review focuses on contributions from geodesy and the role of the ocean's bounding surfaces: the sea surface and the Earth's crust. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

The 3D Human Motion Control Through Refined Video Gesture Annotation

Science.gov (United States)

Jin, Yohan; Suk, Myunghoon; Prabhakaran, B.

In the beginning of computer and video game industry, simple game controllers consisting of buttons and joysticks were employed, but recently game consoles are replacing joystick buttons with novel interfaces such as the remote controllers with motion sensing technology on the Nintendo Wii [1] Especially video-based human computer interaction (HCI) technique has been applied to games, and the representative game is 'Eyetoy' on the Sony PlayStation 2. Video-based HCI technique has great benefit to release players from the intractable game controller. Moreover, in order to communicate between humans and computers, video-based HCI is very crucial since it is intuitive, easy to get, and inexpensive. On the one hand, extracting semantic low-level features from video human motion data is still a major challenge. The level of accuracy is really dependent on each subject's characteristic and environmental noises. Of late, people have been using 3D motion-capture data for visualizing real human motions in 3D space (e.g, 'Tiger Woods' in EA Sports, 'Angelina Jolie' in Bear-Wolf movie) and analyzing motions for specific performance (e.g, 'golf swing' and 'walking'). 3D motion-capture system ('VICON') generates a matrix for each motion clip. Here, a column is corresponding to a human's sub-body part and row represents time frames of data capture. Thus, we can extract sub-body part's motion only by selecting specific columns. Different from low-level feature values of video human motion, 3D human motion-capture data matrix are not pixel values, but is closer to human level of semantics.

Motion of charged test particles in Reissner-Nordstroem spacetime

International Nuclear Information System (INIS)

Pugliese, Daniela; Quevedo, Hernando; Ruffini, Remo

2011-01-01

We investigate the circular motion of charged test particles in the gravitational field of a charged mass described by the Reissner-Nordstroem spacetime. We study in detail all the spatial regions where circular motion is allowed around either black holes or naked singularities. The effects of repulsive gravity are discussed by finding all the circles at which a particle can have vanishing angular momentum. We show that the geometric structure of stable accretion disks, made of only test particles moving along circular orbits around the central body, allows us to clearly distinguish between black holes and naked singularities.

Ross sea ice motion, area flux, and deformation

Science.gov (United States)

kwok, Ron

2005-01-01

The sea ice motion, area export, and deformation of the Ross Sea ice cover are examined with satellite passive microwave and RADARSAT observations. The record of high-resolution synthetic aperture radar (SAR) data, from 1998 and 2000, allows the estimation of the variability of ice deformation at the small scale (10 km) and to assess the quality of the longer record of passive microwave ice motion. Daily and subdaily deformation fields and RADARSAT imagery highlight the variability of motion and deformation in the Ross Sea. With the passive microwave ice motion, the area export at a flux gate positioned between Cape Adare and Land Bay is estimated. Between 1992 and 2003, a positive trend can be seen in the winter (March-November) ice area flux that has a mean of 990 x 103 km2 and ranges from a low of 600 x 103 km2 in 1992 to a peak of 1600 x 103 km2 in 2001. In the mean, the southern Ross Sea produces almost twice its own area of sea ice during the winter. Cross-gate sea level pressure (SLP) gradients explain 60% of the variance in the ice area flux. A positive trend in this gradient, from reanalysis products, suggests a 'spinup' of the Ross Sea Gyre over the past 12 yr. In both the NCEP-NCAR and ERA-40 surface pressure fields, longer-term trends in this gradient and mean SLP between 1979 and 2002 are explored along with positive anomalies in the monthly cross-gate SLP gradient associated with the positive phase of the Southern Hemisphere annular mode and the extrapolar Southern Oscillation.

Understanding Motion Capture for Computer Animation

CERN Document Server

Menache, Alberto

2010-01-01

The power of today's motion capture technology has taken animated characters and special effects to amazing new levels of reality. And with the release of blockbusters like Avatar and Tin-Tin, audiences continually expect more from each new release. To live up to these expectations, film and game makers, particularly technical animators and directors, need to be at the forefront of motion capture technology. In this extensively updated edition of Understanding Motion Capture for Computer Animation and Video Games, an industry insider explains the latest research developments in digital design

A Field Study of Performance Among Embarked Infantry Personnel Exposed to Waterborne Motion

Science.gov (United States)

2012-09-01

motion sickness. However, the symptoms associated with these sicknesses may also arise in the absence of motion. Cinema sickness and simulator... identical courses were constructed to facilitate the timely completion of 35 the physical coordination course. Participants with an odd identification...nearly identical to the layout at Pelican Point. Figure 9 shows the detailed course layout superimposed over an aerial view of Red Beach

Nuisance Flooding and Relative Sea-Level Rise: the Importance of Present-Day Land Motion.

Science.gov (United States)

Karegar, Makan A; Dixon, Timothy H; Malservisi, Rocco; Kusche, Jürgen; Engelhart, Simon E

2017-09-11

Sea-level rise is beginning to cause increased inundation of many low-lying coastal areas. While most of Earth's coastal areas are at risk, areas that will be affected first are characterized by several additional factors. These include regional oceanographic and meteorological effects and/or land subsidence that cause relative sea level to rise faster than the global average. For catastrophic coastal flooding, when wind-driven storm surge inundates large areas, the relative contribution of sea-level rise to the frequency of these events is difficult to evaluate. For small scale "nuisance flooding," often associated with high tides, recent increases in frequency are more clearly linked to sea-level rise and global warming. While both types of flooding are likely to increase in the future, only nuisance flooding is an early indicator of areas that will eventually experience increased catastrophic flooding and land loss. Here we assess the frequency and location of nuisance flooding along the eastern seaboard of North America. We show that vertical land motion induced by recent anthropogenic activity and glacial isostatic adjustment are contributing factors for increased nuisance flooding. Our results have implications for flood susceptibility, forecasting and mitigation, including management of groundwater extraction from coastal aquifers.

Engineering characterization of ground motion. Task I. Effects of characteristics of free-field motion on structural response

Energy Technology Data Exchange (ETDEWEB)

Kennedy, R.P.; Short, S.A.; Merz, K.L.; Tokarz, F.J.; Idriss, I.M.; Power, M.S.; Sadigh, K.

1984-05-01

This report presents the results of the first task of a two-task study on the engineering characterization of earthquake ground motion for nuclear power plant design. The overall objective of this study is to develop recommendations for methods for selecting design response spectra or acceleration time histories to be used to characterize motion at the foundation level of nuclear power plants. Task I of the study develops a basis for selecting design response spectra, taking into account the characteristics of free-field ground motion found to be significant in causing structural damage.

Engineering characterization of ground motion. Task I. Effects of characteristics of free-field motion on structural response

International Nuclear Information System (INIS)

Kennedy, R.P.; Short, S.A.; Merz, K.L.; Tokarz, F.J.; Idriss, I.M.; Power, M.S.; Sadigh, K.

1984-05-01

This report presents the results of the first task of a two-task study on the engineering characterization of earthquake ground motion for nuclear power plant design. The overall objective of this study is to develop recommendations for methods for selecting design response spectra or acceleration time histories to be used to characterize motion at the foundation level of nuclear power plants. Task I of the study develops a basis for selecting design response spectra, taking into account the characteristics of free-field ground motion found to be significant in causing structural damage

A Potential Method for Body and Surface Wave Propagation in Transversely Isotropic Half- and Full-Spaces

Directory of Open Access Journals (Sweden)

Mehdi Raoofian Naeeni

2016-12-01

Full Text Available The problem of propagation of plane wave including body and surface waves propagating in a transversely isotropic half-space with a depth-wise axis of material symmetry is investigated in details. Using the advantage of representation of displacement fields in terms of two complete scalar potential functions, the coupled equations of motion are uncoupled and reduced to two independent equations for potential functions. In this paper, the secular equations for determination of body and surface wave velocities are derived in terms of both elasticity coefficients and the direction of propagation. In particular, the longitudinal, transverse and Rayleigh wave velocities are determined in explicit forms. It is also shown that in transversely isotropic materials, a Rayleigh wave may propagate in different manner from that of isotropic materials. Some numerical results for synthetic transversely isotropic materials are also illustrated to show the behavior of wave motion due to anisotropic nature of the problem.

Manufacturing microsystems-on-a-chip with 5-level surface micromachining technology

Energy Technology Data Exchange (ETDEWEB)

Sniegowski, J.; Rodgers, M.S.

1998-05-01

An agile microsystem manufacturing technology has been developed that provides unprecedented 5 levels of independent polysilicon surface-micromachine films for the designer. Typical surface-micromachining processes offer a maximum of 3 levels, making this the most complex surface-micromachining process technology developed to date. Leveraged from the extensive infrastructure present in the microelectronics industry, the manufacturing method of polysilicon surface-micromachining offers similar advantages of high-volume, high-reliability, and batch-fabrication to microelectromechanical systems (MEMS) as has been accomplished with integrated circuits (ICs). These systems, comprised of microscopic-sized mechanical elements, are laying the foundation for a rapidly expanding, multi-billion dollar industry 2 which impacts the automotive, consumer product, and medical industries to name only a few.

Intrinsic and extrinsic measurement for Brownian motion

International Nuclear Information System (INIS)

Castro-Villarreal, Pavel

2014-01-01

Based upon the Smoluchowski equation on curved manifolds, three physical observables are considered for Brownian displacement, namely geodesic displacement s, Euclidean displacement δR, and projected displacement δR ⊥ . The Weingarten–Gauss equations are used to calculate the mean-square Euclidean displacements in the short-time regime. Our findings show that from an extrinsic point of view the geometry of the space affects the Brownian motion in such a way that the particle’s diffusion is decelerated, contrasting with the intrinsic point of view where dynamics is controlled by the sign of the Gaussian curvature (Castro-Villarreal, 2010 J. Stat. Mech. P08006). Furthermore, it is possible to give exact formulas for 〈δR〉 and 〈δR 2 〉 on spheres and minimal surfaces, which are valid for all values of time. In the latter case, surprisingly, Brownian motion corresponds to the usual diffusion in flat geometries, albeit minimal surfaces have non-zero Gaussian curvature. Finally, the two-dimensional case is emphasized due to its close relation to surface self-diffusion in fluid membranes. (paper)

Motion of the esophagus due to cardiac motion.

Directory of Open Access Journals (Sweden)

Jacob Palmer

Full Text Available When imaging studies (e.g. CT are used to quantify morphological changes in an anatomical structure, it is necessary to understand the extent and source of motion which can give imaging artifacts (e.g. blurring or local distortion. The objective of this study was to assess the magnitude of esophageal motion due to cardiac motion. We used retrospective electrocardiogram-gated contrast-enhanced computed tomography angiography images for this study. The anatomic region from the carina to the bottom of the heart was taken at deep-inspiration breath hold with the patients' arms raised above their shoulders, in a position similar to that used for radiation therapy. The esophagus was delineated on the diastolic phase of cardiac motion, and deformable registration was used to sequentially deform the images in nearest-neighbor phases among the 10 cardiac phases, starting from the diastolic phase. Using the 10 deformation fields generated from the deformable registration, the magnitude of the extreme displacements was then calculated for each voxel, and the mean and maximum displacement was calculated for each computed tomography slice for each patient. The average maximum esophageal displacement due to cardiac motion for all patients was 5.8 mm (standard deviation: 1.6 mm, maximum: 10.0 mm in the transverse direction. For 21 of 26 patients, the largest esophageal motion was found in the inferior region of the heart; for the other patients, esophageal motion was approximately independent of superior-inferior position. The esophagus motion was larger at cardiac phases where the electrocardiogram R-wave occurs. In conclusion, the magnitude of esophageal motion near the heart due to cardiac motion is similar to that due to other sources of motion, including respiratory motion and intra-fraction motion. A larger cardiac motion will result into larger esophagus motion in a cardiac cycle.

Entropy, extremality, euclidean variations, and the equations of motion

Science.gov (United States)

Dong, Xi; Lewkowycz, Aitor

2018-01-01

We study the Euclidean gravitational path integral computing the Rényi entropy and analyze its behavior under small variations. We argue that, in Einstein gravity, the extremality condition can be understood from the variational principle at the level of the action, without having to solve explicitly the equations of motion. This set-up is then generalized to arbitrary theories of gravity, where we show that the respective entanglement entropy functional needs to be extremized. We also extend this result to all orders in Newton's constant G N , providing a derivation of quantum extremality. Understanding quantum extremality for mixtures of states provides a generalization of the dual of the boundary modular Hamiltonian which is given by the bulk modular Hamiltonian plus the area operator, evaluated on the so-called modular extremal surface. This gives a bulk prescription for computing the relative entropies to all orders in G N . We also comment on how these ideas can be used to derive an integrated version of the equations of motion, linearized around arbitrary states.

Cervical motion testing: methodology and clinical implications.

Science.gov (United States)

Prushansky, Tamara; Dvir, Zeevi

2008-09-01

Measurement of cervical motion (CM) is probably the most commonly applied functional outcome measure in assessing the status of patients with cervical pathology. In general terms, CM refers to motion of the head relative to the trunk as well as conjunct motions within the cervical spine. Multiple techniques and instruments have been used for assessing CM. These were associated with a wide variety of parameters relating to accuracy, reproducibility, and validity. Modern measurement systems enable recording, processing, and documentation of CM with a high degree of precision. Cervical motion measures provide substantial information regarding the severity of motion limitation and level of effort in cervically involved patients. They may also be used for following up performance during and after conservative or invasive interventions.

Modelling the motion of meteors in the Earth's atmosphere

International Nuclear Information System (INIS)

Rodrigues, Hilário

2013-01-01

This work discusses the motion of meteors in the Earth's atmosphere. The equations of motion of the projectile are presented and a simplified numerical approach to solve them is discussed. An algorithm for solving the equations of motion is constructed, and implemented in a very simple way using Excel software. The paper is intended as an example of the application of Newton's laws of motion at undergraduate level. (paper)

Parameters Studies on Surface Initiated Rolling Contact Fatigue of Turnout Rails by Three-Level Unreplicated Saturated Factorial Design

Directory of Open Access Journals (Sweden)

Xiaochuan Ma

2018-03-01

Full Text Available Surface initiated rolling contact fatigue (RCF, mainly characterized by cracks and material stripping, is a common type of damage to turnout rails, which can not only shorten service life of turnout but also lead to poor running safety of vehicle. The rail surface initiated RCF of turnouts is caused by a long-term accumulation, the size and distribution of which are related to the dynamic parameters of the complicated vehicle-turnout system. In order to simulate the accumulation of rail damage, some random samples of dynamic parameters significantly influencing it should be input. Based on the three-level unreplicated saturated factorial design, according to the evaluation methods of H, P and B statistic values, six dynamic parameters that influence the rail surface initiated RCF in turnouts, namely running speed of vehicle, axle load, wheel-rail profiles, integral vertical track stiffness and wheel-rail friction coefficient, are obtained by selecting 13 dynamic parameters significantly influencing the dynamic vehicle-turnout interaction as the analysis factors, considering four dynamic response results, i.e., the normal wheel-rail contact force, longitudinal creep force, lateral creep force and wheel-rail contact patch area as the observed parameters. In addition, the rail surface initiated RCF behavior in turnouts under different wheel-rail creep conditions is analyzed, considering the relative motion of stock/switch rails. The results show that the rail surface initiated RCF is mainly caused by the tangential stress being high under small creep conditions, the normal and tangential stresses being high under large creep conditions, and the normal stress being high under pure spin creep conditions.

Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

Science.gov (United States)

Rosenblatt, Steven David; Crane, Benjamin Thomas

2015-01-01

A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37) participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s) at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001) and rotation (pperception was shifted in the direction consistent with the visual stimulus. Arrows had a small effect on self-motion

Fluctuations in Echo Level Associated with Changes in Target Aspect and Target Frequency Response (abstract only)

NARCIS (Netherlands)

Zampolli, M.; Ainslie, M.A.; Zon, T. van

2011-01-01

Ping-to-ping variations in echo level can be caused by time variations in sonar parameters (source level, orientation), target aspect, relative and absolute motion of sonar and target, and time varying environment (e.g. surface waves). Quantifying and understanding such fluctuations are important,

Detailed Analysis of ECMWF Surface Pressure Data

Science.gov (United States)

Fagiolini, E.; Schmidt, T.; Schwarz, G.; Zenner, L.

2012-04-01

Investigations of temporal variations within the gravity field of the Earth led us to the analysis of common surface pressure data products delivered by ECMWF. We looked into the characteristics of global as well as spatially and temporally confined phenomena being visible in the data. In particular, we were interested in the overall data quality, the local and temporal signal-to-noise ratio of surface pressure data sets, and the identification of irregular data. To this end, we analyzed a time series of a full year of surface pressure operational analysis data and their nominal standard deviations. The use of pressure data on a Gaussian grid data allowed us to remain close to the internal computations at ECMWF during data assimilation. Thus, we circumvented potential interpolation effects that would otherwise occur in cylindrical projections of conventional map products. The results obtained by us demonstrate the identification of a few distinct outliers, data quality effects over land or water and along coastlines as well as neighborhood effects of samples within and outside of the tropics. Small scale neighborhood effects depend on their geographical direction, sampling distance, land or water, and local time. In addition, one notices large scale seasonal effects that are latitude and longitude dependent. As a consequence, we obtain a cause-and-effect survey of pressure data peculiarities. One can then use background corrected pressure data to analyze seasonal effects within given latitude belts. Here time series of pressure data allow the tracking of high and low pressure areas together with the identification of their actual extent, velocity and life time. This information is vital to overall mass transport calculations and the determination of temporally varying gravity fields. However, one has to note that the satellite and ground-based instruments and the assimilation software being used for the pressure calculations will not remain the same over the years

Effect of Task-Correlated Physiological Fluctuations and Motion in 2D and 3D Echo-Planar Imaging in a Higher Cognitive Level fMRI Paradigm.

Science.gov (United States)

Ladstein, Jarle; Evensmoen, Hallvard R; Håberg, Asta K; Kristoffersen, Anders; Goa, Pål E

2016-01-01

To compare 2D and 3D echo-planar imaging (EPI) in a higher cognitive level fMRI paradigm. In particular, to study the link between the presence of task-correlated physiological fluctuations and motion and the fMRI contrast estimates from either 2D EPI or 3D EPI datasets, with and without adding nuisance regressors to the model. A signal model in the presence of partly task-correlated fluctuations is derived, and predictions for contrast estimates with and without nuisance regressors are made. Thirty-one healthy volunteers were scanned using 2D EPI and 3D EPI during a virtual environmental learning paradigm. In a subgroup of 7 subjects, heart rate and respiration were logged, and the correlation with the paradigm was evaluated. FMRI analysis was performed using models with and without nuisance regressors. Differences in the mean contrast estimates were investigated by analysis-of-variance using Subject, Sequence, Day, and Run as factors. The distributions of group level contrast estimates were compared. Partially task-correlated fluctuations in respiration, heart rate and motion were observed. Statistically significant differences were found in the mean contrast estimates between the 2D EPI and 3D EPI when using a model without nuisance regressors. The inclusion of nuisance regressors for cardiorespiratory effects and motion reduced the difference to a statistically non-significant level. Furthermore, the contrast estimate values shifted more when including nuisance regressors for 3D EPI compared to 2D EPI. The results are consistent with 3D EPI having a higher sensitivity to fluctuations compared to 2D EPI. In the presence partially task-correlated physiological fluctuations or motion, proper correction is necessary to get expectation correct contrast estimates when using 3D EPI. As such task-correlated physiological fluctuations or motion is difficult to avoid in paradigms exploring higher cognitive functions, 2D EPI seems to be the preferred choice for higher

Detection of kinetic change points in piece-wise linear single molecule motion

Science.gov (United States)

Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.

2018-03-01

Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.

Optimization-based human motion prediction using an inverse-inverse dynamics technique implemented in the AnyBody Modeling System

DEFF Research Database (Denmark)

Farahani, Saeed Davoudabadi; Andersen, Michael Skipper; de Zee, Mark

2012-01-01

derived from the detailed musculoskeletal analysis. The technique is demonstrated on a human model pedaling a bicycle. We use a physiology-based cost function expressing the mean square of all muscle activities over the cycle to predict a realistic motion pattern. Posture and motion prediction...... on a physics model including dynamic effects and a high level of anatomical realism. First, a musculoskeletal model comprising several hundred muscles is built in AMS. The movement is then parameterized by means of time functions controlling selected degrees of freedom of the model. Subsequently......, the parameters of these functions are optimized to produce an optimum posture or movement according to a user-defined cost function and constraints. The cost function and the constraints are typically express performance, comfort, injury risk, fatigue, muscle load, joint forces and other physiological properties...

A Level Set Discontinuous Galerkin Method for Free Surface Flows

DEFF Research Database (Denmark)

Grooss, Jesper; Hesthaven, Jan

2006-01-01

We present a discontinuous Galerkin method on a fully unstructured grid for the modeling of unsteady incompressible fluid flows with free surfaces. The surface is modeled by embedding and represented by a levelset. We discuss the discretization of the flow equations and the level set equation...

Influence of Visual Motion, Suggestion, and Illusory Motion on Self-Motion Perception in the Horizontal Plane.

Directory of Open Access Journals (Sweden)

Steven David Rosenblatt

Full Text Available A moving visual field can induce the feeling of self-motion or vection. Illusory motion from static repeated asymmetric patterns creates a compelling visual motion stimulus, but it is unclear if such illusory motion can induce a feeling of self-motion or alter self-motion perception. In these experiments, human subjects reported the perceived direction of self-motion for sway translation and yaw rotation at the end of a period of viewing set visual stimuli coordinated with varying inertial stimuli. This tested the hypothesis that illusory visual motion would influence self-motion perception in the horizontal plane. Trials were arranged into 5 blocks based on stimulus type: moving star field with yaw rotation, moving star field with sway translation, illusory motion with yaw, illusory motion with sway, and static arrows with sway. Static arrows were used to evaluate the effect of cognitive suggestion on self-motion perception. Each trial had a control condition; the illusory motion controls were altered versions of the experimental image, which removed the illusory motion effect. For the moving visual stimulus, controls were carried out in a dark room. With the arrow visual stimulus, controls were a gray screen. In blocks containing a visual stimulus there was an 8s viewing interval with the inertial stimulus occurring over the final 1s. This allowed measurement of the visual illusion perception using objective methods. When no visual stimulus was present, only the 1s motion stimulus was presented. Eight women and five men (mean age 37 participated. To assess for a shift in self-motion perception, the effect of each visual stimulus on the self-motion stimulus (cm/s at which subjects were equally likely to report motion in either direction was measured. Significant effects were seen for moving star fields for both translation (p = 0.001 and rotation (p0.1 for both. Thus, although a true moving visual field can induce self-motion, results of this

Quasi-static motion of microparticles at the depinning contact line of an evaporating droplet on PDMS surface

Science.gov (United States)

Yu, Ying-Song; Xia, Xue-Lian; Zheng, Xu; Huang, Xianfu; Zhou, Jin-Zhi

2017-09-01

In this paper, evaporation of sessile water droplets containing fluorescent polystyrene (PS) microparticles on polydimethylsiloxane (PDMS) surfaces with different curing ratios was studied experimentally using laser confocal microscopy. At the beginning, there were some microparticles located at the contact line and some microparticles moved towards the line. Due to contact angle hysteresis, at first both the contact line and the microparticles were pinned. With the depinning contact line, the microparticles moved together spontaneously. Using the software ImageJ, the location of contact lines at different time were acquired and the circle centers and radii of the contact lines were obtained via the least square method. Then the average distance of two neighbor contact lines at a certain time interval was obtained to characterize the motion of the contact line. Fitting the distance-time curve at the depinning contact line stage with polynomials and differentiating the polynomials with time, we obtained the velocity and acceleration of both the contact line and the microparticles located at the line. The velocity and the maximum acceleration were, respectively, of the orders of 1 μm/s and 20-200 nm/s2, indicating that the motion of the microparticles located at the depinning contact line was quasi-static. Finally, we presented a theoretical model to describe the quasi-static process, which may help in understanding both self-pinning and depinning of microparticles.

Evaluation of surface detail reproduction, dimensional stability and gypsum compatibility of monophase polyvinyl-siloxane and polyether elastomeric impression materials under dry and moist conditions.

Science.gov (United States)

Vadapalli, Sriharsha Babu; Atluri, Kaleswararao; Putcha, Madhu Sudhan; Kondreddi, Sirisha; Kumar, N Suman; Tadi, Durga Prasad

2016-01-01

This in vitro study was designed to compare polyvinyl-siloxane (PVS) monophase and polyether (PE) monophase materials under dry and moist conditions for properties such as surface detail reproduction, dimensional stability, and gypsum compatibility. Surface detail reproduction was evaluated using two criteria. Dimensional stability was evaluated according to American Dental Association (ADA) specification no. 19. Gypsum compatibility was assessed by two criteria. All the samples were evaluated, and the data obtained were analyzed by a two-way analysis of variance (ANOVA) and Pearson's Chi-square tests. When surface detail reproduction was evaluated with modification of ADA specification no. 19, both the groups under the two conditions showed no significant difference statistically. When evaluated macroscopically both the groups showed statistically significant difference. Results for dimensional stability showed that the deviation from standard was significant among the two groups, where Aquasil group showed significantly more deviation compared to Impregum group (P < 0.001). Two conditions also showed significant difference, with moist conditions showing significantly more deviation compared to dry condition (P < 0.001). The results of gypsum compatibility when evaluated with modification of ADA specification no. 19 and by giving grades to the casts for both the groups and under two conditions showed no significant difference statistically. Regarding dimensional stability, both impregum and aquasil performed better in dry condition than in moist; impregum performed better than aquasil in both the conditions. When tested for surface detail reproduction according to ADA specification, under dry and moist conditions both of them performed almost equally. When tested according to macroscopic evaluation, impregum and aquasil performed significantly better in dry condition compared to moist condition. In dry condition, both the materials performed almost equally. In

Electromagnetic radiation of charged particles in stochastic motion

Energy Technology Data Exchange (ETDEWEB)

Harko, Tiberiu [Babes-Bolyai University, Department of Physics, Cluj-Napoca (Romania); University College London, Department of Mathematics, London (United Kingdom); Mocanu, Gabriela [Astronomical Institute of the Romanian Academy, Cluj-Napoca (Romania)

2016-03-15